Role of 2-Adrenoceptor Subtypes in Suppression of L-Type Ca2+

International Journal of Molecular Sciences

Article Role of α2-Adrenoceptor Subtypes in Suppression of L-Type Ca2+ Current in Mouse Cardiac Myocytes

Edward V. Evdokimovskii 1, Ryounghoon Jeon 2 , Sungjo Park 2 , Oleg Y. Pimenov 1 and Alexey E. Alekseev 1,2,*

1 Institute of Theoretical and Experimental Biophysics, Russian Academy of Science, Institutskaya 3, 142290 Pushchino, Russia; [email protected] (E.V.E.); [email protected] (O.Y.P.) 2 Department of Cardiovascular Medicine, Center for Regenerative Medicine, Mayo Clinic, Stabile 5, Mayo Clinic, 200 1st Street SW, Rochester, MN 55905, USA; [email protected] (R.J.); [email protected] (S.P.) * Correspondence: [email protected]; Tel.: +1-507-284-9501

Abstract: Sarcolemmal α2 adrenoceptors (α2-AR), represented by α2A, α2B and α2C isoforms, can safeguard cardiac muscle under sympathoadrenergic surge by governing Ca2+ handling and contractility of cardiomyocytes. Cardiomyocyte-specific targeting of α2-AR would provide cardiac muscle-delimited stress control and enhance the efficacy of cardiac malfunction treatments. However, little is known about the specific contribution of the α2-AR subtypes in modulating cardiomyocyte functions. Herein, we analyzed the expression profile of α2A, α2B and α2C subtypes in mouse ventricle and conducted electrophysiological antagonist assay evaluating the contribution of these 2+ isoforms to the suppression of L-type Ca current (ICaL). Patch-clamp electro-pharmacological studies revealed that the α2-agonist-induced suppression of ICaL involves mainly the α2C, to a lesser extent the α2B, and not the α2A isoforms. RT-qPCR evaluation revealed the presence of adra2b and

Citation: Evdokimovskii, E.V.; Jeon, adra2c (α2B and α2C isoform genes, respectively), but was unable to identify the expression of adra2a R.; Park, S.; Pimenov, O.Y.; Alekseev, (α2A isoform gene) in the mouse left ventricle. Immunoblotting conﬁrmed the presence only of the A.E. Role of α2-Adrenoceptor α2B and the α2C proteins in this tissue. The identiﬁed α2-AR isoform-linked regulation of ICaL in Subtypes in Suppression of L-Type the mouse ventricle provides an important molecular substrate for the cardioprotective targeting. Ca2+ Current in Mouse Cardiac Myocytes. Int. J. Mol. Sci. 2021, 22, Keywords: G-protein coupled receptors; left ventricle; cell signaling; guanabenz; BRL 44408; ARC 4135. https://doi.org/10.3390/ 239; JP 1302 ijms22084135

Academic Editor: Claudiu T. Supuran 1. Introduction Received: 8 February 2021 Previously, the catalog of myocellular membrane receptors has been expanded to Accepted: 14 April 2021 α α α Published: 16 April 2021 include 2-adrenoceptors ( 2-ARs) that in line with other adrenergic receptors ( 1- and β-) control the stress-reactive response of cardiomyocytes [1,2]. We have identified that, α Publisher’s Note: MDPI stays neutral in addition to the established 2-AR-mediated feedback suppression of sympathetic and α 2+ with regard to jurisdictional claims in adrenal catecholamine release, 2-ARs in cardiac myocytes improve intracellular Ca published maps and institutional affil- handling and support myocardial contractility [2,3]. The evidence indicates that protective iations. potential of α2-AR in cardiomyocytes can be mobilized not only against the deleterious effects of chronic stimulation by excessive catecholamine but also against angiotensinergic loads to mitigate the development of cardiac dysfunctions [1,4]. In this regard, future therapeutic directions aimed at cardiac specific restoration or enhancement of α2-AR signaling require identifying α2-AR isoforms in ventricular myocytes, which mediate Copyright: © 2021 by the authors. Licensee MDPI, Basel, Switzerland. cardioprotective cellular response. α This article is an open access article To date, four different 2-AR subtypes have been identified. Mammalian species distributed under the terms and express α2A, α2B and α2C receptor isoforms encoded by the adra2A, adra2B and adra2C conditions of the Creative Commons genes, respectively [5–7]. Other vertebrates, except crocodiles, also express α2D isoforms Attribution (CC BY) license (https:// encoded by the genes adra2Da and adra2Db [8–10]. In mammals, primarily the α2A- and creativecommons.org/licenses/by/ α2C-receptor subtypes are present in the central neural system, whereas all three receptor 4.0/). isoforms are broadly distributed in peripheral organs. The presynaptic receptor isoforms

Int. J. Mol. Sci. 2021, 22, 4135. https://doi.org/10.3390/ijms22084135 https://www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2021, 22, 4135 2 of 11

exhibit different potency to norepinephrine, which is higher for the α2C-AR compared to the α2A-AR, as well as distinct responsiveness to neuronal stimulation frequencies [11–13]. Genetic ablations of either α2A or α2C subtypes have allowed discriminating between the α2A-AR-dependent control of plasma norepinephrine and the predominant α2C-AR- driven inhibition of the catecholamine secretion from chromaffin cells. Activation of α2B- AR mediates initial phase of peripheral hypertensive response followed by hypotension that is mediated by α2A-AR. In addition, α2B-ARs in line with other receptor isoforms also mediate the antinociceptive response to α2-AR agonists [14]. Mechanistically, activation of the presynaptic α2-ARs results in suppression of cAMP levels, opening of K+ channels and inhibition of voltage-gated Ca2+ channels directly af- fecting the exocytotic machinery [15,16]. Thus, α2-ARs have been recognized as short-loop feedback suppressors of sympathetic and adrenal catecholamine release and, thereby, gen- erally have an inhibitory influence on sympathoadrenergic drive [11,17–19]. The range of pharmacology effects of these receptor isoforms in neurons also relies on regulation of other than norepinephrine neurotransmitter release in the central and peripheral nervous, which contributes to anti-depressive potentials of the α2-AR antagonists [20]. Concomitantly, α2-AR agonists are clinically used as an adjuvant for premedication, especially in patients susceptible to preoperative and perioperative stress because of its sedative, anxiolytic, analgesic and sympatholytic profiles [21,22]. The expression of α2A, α2B and α2C in rat hearts was found negligible compared to levels of these receptors in neuronal, kidney, liver or aortic tissues [23], which led to the conventional belief that direct α2-AR-mediated regulation of cardiac excitation or contractile functions must be limited. More recent studies that also identified the expression of all α2-AR isoforms in rat ventricular myocytes [24,25] demonstrated that NO and cGMP were central intracellular messengers mediating α2-AR-signaling [2,25]. Key cardiomyocyte responses to activation of α2-AR include stimulation of endothelial NO synthase (eNOS), reduction of intracellular Ca2+ levels and suppression of spontaneous intracellular Ca2+ oscillations (presumably through the regulation of SERCA/RyR activi- ties) and inhibition of membrane inward Ca2+ currents via L-type Ca2+ channels [2,25,26]. Furthermore, by promoting phosphorylation of Erk1/2, Akt and eNOS in left ventricular myocytes, the α2-AR agonist dexmedetomidine improved cardiac recovery after ischemia/reperfusion [24,27]. At the same time, the maladaptive cardiac remodeling asso- ciated with development of cardiac hypertrophy and heart failure is accompanied by the functional desensitization/internalization of α2-AR [2,28]. Comparison of the amino acid sequences in the third intracellular loop of α2-AR isoforms, the region responsible for phosphorylation of multiple serine or threonine residues, revealed little sequence homology suggesting the subtype selective desensitization mechanisms [29,30]. Thus, cardiomyocyte- specific targeting of α2-ARs aimed at improving cardiac muscle-delimited stress control demands information about a link between α2-AR subtypes and specific cell-signaling pathways encompassing cardioprotective mechanisms. While current evidence underlines a cardioprotective potential of α2-ARs in cardiomyocytes, little is known about the specific contribution of α2-AR isoforms in cardiac muscle responses. Herein we probe the expression profile of α2-AR isoforms in the mouse ventricle and analyzed the α2-AR agonist-induced suppression of L-type Ca2+ current in isolated cardiomyocytes, using selective antagonists of α2A, α2B and α2C receptor isoforms.

2. Results 2.1. Activation of α2-ARs Inhibits L-Type Ca2+ Current In isolated mouse cardiomyocytes guanabenz, a non-selective agonist of the α2- AR isoforms, signiﬁcantly, but reversibly, reduced inward transient currents measured throughout a range of depolarizing membrane potentials (Figure1a–c). At the applied holding potential (−40 mV) nifedipine (5 µM), a selective inhibitor of L-type Ca2+ channels, eliminated the measured inward currents (Figure1c). This indicates that the measured whole-cell currents represent only the low-threshold voltage-gated L-type Ca2+ current Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 3 of 11

Int. J. Mol. Sci. 2021, 22, 4135 holding potential (−40 mV) nifedipine (5 µM), a selective inhibitor of L-type Ca2+ channels,3 of 11 eliminated the measured inward currents (Figure 1c). This indicates that the measured whole-cell currents represent only the low-threshold voltage-gated L-type Ca2+ current (ICaL) amenable to regulation by guanabenz. Dose-response relationship constructed for (ICaL) amenable to regulation by guanabenz. Dose-response relationship constructed for the effect of guanabenz on peak values of ICaL, measured at +10 mV of membrane potential, the effect of guanabenz on peak values of ICaL, measured at +10 mV of membrane potential, and fitted with Hill’s equation revealed IC50 = 24.8 ± 9.7 µM and h = 1.22 ± 0.38 (n = 3–5; and fitted with Hill’s equation revealed IC50 = 24.8 ± 9.7 µM and h = 1.22 ± 0.38 (n = 3–5; Figure 1d,e). The time-course of guanabenz-induced inhibition of the peak ICaL values Figure1d,e). The time-course of guanabenz-induced inhibition of the peak ICaL values demonstrated that the steady steady-state-state blocking effect was effectively suppressed by 50 µM of yohimbine, a non non-specific-specific antagonist of α2α2-AR-AR isoforms (Figure 11f).f). OfOf note,note, 5050 µMµM of yohimbine alone induced 23.2 ± 3.1% inhibition of the peak ICaL values (n = 4; Figure 1f). yohimbine alone induced 23.2 ± 3.1% inhibition of the peak ICaL values (n = 4; Figure1f). CaL Suppression of ICaLbyby guanabenz guanabenz measured measured in in the the presence presence of of yohimbine (re (relativelative to the effect ofof thisthis antagonistantagonist alone) alone) and and fitted fitted by by Hill’s Hill’s equation equation demonstrated demonstrated a right-shift a right-shift of the of theguanabenz-dependent guanabenz-dependent dose-response dose-response curve curve to IC to50 IC=50 184.6 = 184.6± ±41.3 41.3µ MµM and andh h= = 1.22 1.22± ± 0.51 (n = 3 3–4;–4; Figure Figure 11e).e). Thus, in mouse cardiomyocytes,cardiomyocytes, thethe activationactivation ofof sarcolemmalsarcolemmal αα22-AR-AR isoforms by guanabenz results in the suppression of IICaL. .

a b c control guanabenz 40 mM -40 -30 -20 -10 10 20 30 40 -30 mV mV -30 mV

+30 mV -20 mV -2

-20 mV +20 mV -4 +30 mV +10 mV -10 mV 0 mV 2 pA/pF 2 -6 +20 mV 40 ms pA/pF 2 40 ms control -8 guanabenz 40 mM wash-out +10 mV -10 mV nifedipine 5 mM 0 mV -10 pA/pF d e f 1.0

5 0.8 0 guanabenz: -1 4 yohim 50 mM yohim 50 mM 5 - 100 mM 0.6 -2 guan 20 mM guan 20 mM guan 50 mM 4 - 40 mM density -3 3

Ca -4 3 - 20 mM 0.4 -5

2 pA/pF 2 2 - 5 mM 1 - control -6 Relative current guanabenz 40 ms 0.2 I Peak

guan + yohim 50 M pA/pF @ mV, +10 -7 2 m 0 200 400 600 800 1000 0.0 1 Time, s -6 -5 -4 Log[Guanabenz], M

2+ Figure 1. Guanabenz,Guanabenz, an an agonist agonist of of α2α-2-AR,AR, suppressed suppressed L- L-typetype Ca Ca2+ currentscurrents (ICaL (I) CaLin isolated) in isolated mouse mouse cardiac cardiac myocytes. myocytes. (a,b) (Wholea,b) Whole-cell-cell currents currents were weremeasured measured in response in response to depolarization to depolarization from − from40 mV− 40to membrane mV to membrane potentials potentials indicated indicated nearby nearbythe current the traces. current (c traces.) Voltage (c)–current Voltage–current relationships relationships demonstrated demonstrated reversible reversibleguanabenz guanabenz-induced-induced inhibition of inhibition membrane of membranecurrents that currents, under that,the experimental under the experimental conditions, conditions,entirely belong entirely to the belong dihydropyridine to the dihydropyridine (nifedipine) (nifedipine)-sensitive-sensitive ICaLFigure (n = 13– 5). (d) Representative dose-dependent suppression of ICaL by guanabenz. (e) Dose-dependent relationships of the guana- ICaL (n = 3–5). (d) Representative dose-dependent suppression of ICaL by guanabenz. (e) Dose-dependent relationships benz-induced suppression of ICaL constructed based on the peak ICaL values relative to the control peak ICaL. Yohimbine, a of the guanabenz-induced suppression of I constructed based on the peak I values relative to the control peak I . non-specific antagonist of α2-AR isoforms,CaL induced a rightward shift of the guanCaLabenz-dependent dose effect. This rela-CaL Yohimbine, a non-speciﬁc antagonist of α2-AR isoforms, induced a rightward shift of the guanabenz-dependent dose effect. tionship was constructed relative to the values measured in the presence of yohimbine alone. Curves represent the Hill’s This relationship was constructed relative to the values measured in the presence of yohimbine alone. Curves represent fits with parameters indicated in the text. (f) Representative time-course of the peak ICaL density values in the presence of theguanabenz Hill’s ﬁts (guan) with parametersand yohimbine indicated (yohim). in theHorizontal text. (f) bars Representative denote the time-courseprotocol of the of thedrug peak applications.ICaL density values in the presence of guanabenz (guan) and yohimbine (yohim). Horizontal bars denote the protocol of the drug applications. 2.2. α2A-AR in Guanabenz-Induced Suppression of ICaL

2.2. αTo2A-AR block in the Guanabenz-Induced α2A receptor isoforms Suppression we applied of ICaL BRL 44404, an established selective antagonistTo block of this the adrenoceptorα2A receptor subtype isoforms [31] we. appliedThe agonist BRL guan 44404,abenz an establishedin the presence selective of 40 antagonist of this adrenoceptor subtype [31]. The agonist guanabenz in the presence of 40 µM of BRL 44408 maintained the suppression of ICaL (Figure2a,b). BRL 44408 alone produced minor inhibition of ICaL, which was estimated at 9.4 ± 2.2% of control peak ICaL values measured at +10 mV (Figure2b). The antagonist BRL 44408 provided an Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 4 of 11 Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 4 of 11

Int. J. Mol. Sci. 2021, 22, 4135 4 of 11 µM of BRL 44408 maintained the suppression of ICaL (Figure 2a,b). BRL 44408 alone pro- µM of BRL 44408 maintained the suppression of ICaL (Figure 2a,b). BRL 44408 alone produced minor inhibition of ICaL, which was estimated at 9.4 ± 2.2% of control peak ICaL values measuredduced minor at +10 inhibition mV (Figure of ICaL 2b)., which The wasantagonist estimated BRL at 44408 9.4 ± 2.2% provided of control an unessential peak ICaL values right measured at +10 mV (Figure 2b). The antagonist BRL 44408 provided an unessential right shiftunessential of guanabenz right shift-dependent of guanabenz-dependent dose-response curve, dose-response which was curve, fitted whichby Hill’s was equation ﬁtted by shift of guanabenz-dependent dose-response curve, which was fitted by Hill’s equation withHill’s IC equation50 = 27.2 ± with 4.6 µM IC50 and= 27.2 h = ±1.344.6 ±µ 0.28M and (n =h 3;= Figure 1.34 ± 2c).0.28 Therefore, (n = 3; Figure the2 α2Ac). Therefore, receptor with IC50 = 27.2 ± 4.6 µM and h = 1.34 ± 0.28 (n = 3; Figure 2c). Therefore, the α2A receptor isoformthe α2A does receptor not contribute isoform does to the not suppression contribute to of the ICaL. suppression of ICaL. isoform does not contribute to the suppression of ICaL.

guanabenz + BRL 44408 40 mM guanabenzguanabenz + BRL 44408 40 mM a b c 1.0 guanabenz a b c 1.0 0 0.8 0 BRL 44408 40 mM 0.8 -2 BRL 44408guan 40 20 m MmM -2 guan 20 mM 0.6 -4 guan 20 mM 0.6

density 2 pA/pF 2 guan 20 mM

Ca -4

density 50 ms pA/pF 2 -6 0.4

50 ms Ca 3 -6 0.4

3 - BRL 44408 40 mM + Guan 40 mM -8 Relative current 3 0.2

Relative current 23 - BRL 44408 40 mM (α2A)+ Guan 40 mM PeakI -8 @ +10@ mV, pA/pF -10 0.2 2 - BRL 44408 40 mM (α2A) PeakI 1 - control +10@ mV, pA/pF 2 -10 0 200 400 600 800 0.0 2 1 - control 1 0 200 Time,400 s 600 800 0.0 -6 -5 -4 1 Time, s Log[Guanabenz],-6 -5 M -4 Log[Guanabenz], M

FigureFigure 2. 2. BRLBRL 44408, 44408, a a specific specific antagonist antagonist of of the the α2Aα2A isoform, isoform, did did not affect the guanabenz guanabenz-induced-induced suppression of ICaL. . Figure 2. BRL 44408, a specific antagonist of the α2A isoform, did not affect the guanabenz-induced suppression of ICaL. ((aa,,bb)) Representative Representative ICaLICaL recordingsrecordings and and time time-course-course of peak of peak ICaLI densityCaL density values values in the in presence the presence of guanabenz of guanabenz (guan) (guan) and (a,b) Representative ICaL recordings and time-course of peak ICaL density values in the presence of guanabenz (guan) and BRLand 44408. BRL 44408. Horizontal Horizontal bars denote bars denote the protocol the protocol of the ofdrug the applications. drug applications. (c) BRL (c 44408) BRL did 44408 not did induce not inducea significant a significant right- BRL 44408. Horizontal bars denote the protocol of the drug applications. (c) BRL 44408 did not induce a significant rightward shift of dose-dependent inhibition of ICaL by guanabenz. Curves represent the Hill’s fits with parameters indicated rightward shift of dose-dependent inhibition of ICaL by guanabenz. Curves represent the Hill’s fits with parameters inward the shifttext. of dose-dependent inhibition of ICaL by guanabenz. Curves represent the Hill’s fits with parameters indicated inindicated the text. in the text.

2.3. α2B-AR in Guanabenz-Induced Suppression of ICaL 2.3.2.3. α2α2B-ARB-AR in in Guanabenz Guanabenz-Induced-Induced Suppression Suppression of of I ICaLCaL To test the role of the α2B isoform in suppression of ICaL we used ARC 239, a selective To test the role of the α2B isoform in suppression of I we used ARC 239, a selective antagonistTo test of the this role adrenoceptor of the α2B isoform subtype in suppression[32]. ARC 239 of IatCaLCaL high we used concentration ARC 239, aof selective 40 µM antagonistantagonist of of this this adrenoceptor adrenoceptor subtype subtype [32] [32].. ARC ARC 239 239 at at high high concentration concentration of of 40 40 µMµM antagonized the inhibitory effect of guanabenz on ICaL only at low doses, and, in contrast antagonizedantagonized the inhibitory effecteffect ofof guanabenz guanabenz on onICaL ICaLonly only at at low low doses, doses, and, and, in in contrast contrast to to BRL 44404, did not induce detectable effects on ICaL when applied alone (Figure 3a,b). BRL 44404, did not induce detectable effects on ICaL when applied alone (Figure3a,b) . Consequently,to BRL 44404, didARC not 239 induce induced detectable a minor effectsright-shift on IofCaL the when guanabenz applied dosealone-response (Figure 3 rela-a,b). Consequently, ARC 239 induced a minor right-shift of the guanabenz dose-response tionshipConsequently, at the ARCagonist 239 levels induced below a minor 30–40 right µM.- shiftThe ofHill’s the guanabenzfitting of the dose guanabenz-response dose rela-- tionshiprelationship at the at agonist the agonist levels levels below below 30–40 30–40 µM. TµheM. Hill’s The Hill’sfitting ﬁtting of the ofguanabenz the guanabenz dose- responsedose-response revealed revealed IC50 = 33.2 IC ±= 7.2 33.2 µM± and7.2 hµ =M 1.51 and ± h0.34= 1.51(n = ±3; Figure0.34 (n 3=c), 3; indicating Figure3c), a response revealed IC50 = 33.250 ± 7.2 µM and h = 1.51 ± 0.34 (n = 3; Figure 3c), indicating a veryindicating modest a contribution very modest of contribution α2B-ARs in of theα2B-ARs suppression in the of suppression ICaL. of I . very modest contribution of α2B-ARs in the suppression of ICaL. CaL guanabenz a b c guanguanabenz + ARC 239 40 mM a b c 1.0 guan + ARC 239 40 mM 0 0 1.0 ARC 239 40 mM 0 guan 100 mM 0 ARC 239 40 mM guan 100 mM 0.8 guan 100 mM guan 100 mM 0.8 -2 guan 40 mM -2 guan 40 mM -2 guan 40 mM -2 guan 40 mM 0.6 0.6 guan 20 mM density

density -4 -4

guan 20 mM density

0.4

Ca density -4 -4 guan 20 mM

Ca 0.4

Ca guan 20 mM -6 guan 5 mM -6 guan 5 mM Relativecurrent 0.2

Relativecurrent Peak I Peak guan 5 mM Peak I Peak pA/pF mV, +10 @ -6 guan 5 mM pA/pF mV, +10 @ -6 0.2

Peak I Peak Peak I Peak pA/pF mV, +10 @ pA/pF mV, +10 @ 0.0 0 100 200 300 400 500 600 0 100 200 300 400 500 600 700 800 0.0 -6 -5 -4 0 100 200 300 400 500 600 0 100 200 300 400 500 600 700 800 Time, s Time, s -6 Log[Guanabenz],-5 -4 M Time, s Time, s Log[Guanabenz], M Figure 3. The effect of ARC 239, a specific antagonist of the α2B isoform, on the guanabenz-induced suppression of ICaL. CaL (FigureFigurea,b) Representative 3. TheThe effect of time ARC -courses 239, a of speciﬁcspecific peak I antagonistCaL density values of the α α2Bof2B guanabenz isoform, on (guan) the guanabenz-inducedguanabenz-induced suppression-induced suppression of ICaL in the of Iab-CaL. . (a,b) Representative time-courses of peak ICaL density values of guanabenz (guan)-induced suppression of ICaL in the absence(a,b) Representativeand presence of time-coursesthe antagonist of ARC peak 239.ICaL Horizontaldensity values bars denote of guanabenz the protocol (guan)-induced of the drug suppressionapplications.of (c)I CaLARCin 239 the sence and presence of the antagonist ARC 239. Horizontal bars denote the protocol of the drug applications. (c) ARC 239 inducedabsence a and minor presence rightward of the shift antagonist of dose ARC-dependent 239. Horizontal inhibition bars of I denoteCaL at the the lower protocol concentrations of the drug applications.of guanabenz. (c ) ARC 239 induced a minor rightward shift of dose-dependent inhibition of ICaL at the lower concentrations of guanabenz. induced a minor rightward shift of dose-dependent inhibition of ICaL at the lower concentrations of guanabenz.

2.4. α2C-AR Mediates Guanabenz-Induced Suppression of ICaL

To assess the input of the α2C isoform to suppression of ICaL, the selective antagonist JP 1302 was applied [33]. While the agonistic effects of JP 1302 were not found in competition binding assays or in multiple physiological studies [33], in isolated cardiomyocytes, JP 1302

Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 5 of 11

2.4. α2C-AR Mediates Guanabenz-Induced Suppression of ICaL Int. J. Mol. Sci. 2021, 22, 4135 5 of 11 To assess the input of the α2C isoform to suppression of ICaL, the selective antagonist JP 1302 was applied [33]. While the agonistic effects of JP 1302 were not found in competition binding assays or in multiple physiological studies [33], in isolated cardiomyocytes, JPalone 1302 induced alone induced signiﬁcant significant inhibition inhibition of ICaL (Figure of ICaL4 a,b).(Figure Our 4a,b measurements). Our measurements revealed there- vealeddose-response the dose relationship-response relationship for JP 1302–induced for JP 1302ICaL–inducedinhibition ICaL inhibition with IC50 =with 17.9 IC±502.7 = 17.9µM ±and 2.7 hµM= 1.63and h± =0.33 1.63 (±n 0.33= 3–5; (n = Figure 3–5; Figure4c). When 4c). When applied applied at 4 µatM, 4 µ JPM, 1302 JP 1302 reversed reversed the µ thesuppression suppression of I CaL of IinducedCaL induced by 20 by 20M of μM guanabenz of guanabenz (Figure (Figure4d,e). 4 Thed,e). guanabenz The guanabenz dose- doseresponse-response relationships relationships constructed constructed at 4 and at 20 4 µandM of 20 JP μM 1302 of indicated JP 1302 indicated signiﬁcant significant rightward ± µ h ± ± µ h ± rightwardshifts with shifts IC50 =with 34.0 IC502.3 = 34.0M, ± 2.3= 1.46 µМ, h 0.13= 1.46 and ± 0.13 IC50 and= 63.4 IC50 =4.8 63.4M, ± 4.8= µ 1.52М, h = 0.15,1.52 ±respectively 0.15, respectively (n = 3–4; (n Figure= 3–4; 4Figuref). Thus, 4f). αThus,2C is α2C the mainis the receptor main recepto isoformr isoform that in that mouse in cardiomyocytes mediates guanabenz-induced suppression of I . mouse cardiomyocytes mediates guanabenz-induced suppressionCaL of ICaL. a b c 1.0 0 JP 40mM 0.8 -2 JP 20mM

2 2 - JP 1302 40 mM density 0.6 JP 10mM -4

1 - control Ca 0.4 -6

Relativecurrent 0.2 Peak I Peak -8

@ +10 mV, pA/pF mV, +10 @

2 pA/pF 2 0 200 400 600 800 0.0 50 ms Time, s -6 -5 -4 1 Log[JP 1302], M

Guan e f JP-1302 4 mM + Guan d JP-1302 20 mM + Guan 0 1.0 -1 JP-1302 4 mM -2 guan 20 mM guan 20 mM 0.8

density density JP-1302 4 mM -3 0.6

Ca -4

2 pA/pF 2 0.4 50 ms -5 2

PeakI -6 current Relative @ +10 mV, pA/pF mV, +10 @ 0.2 3 3 guan 20 mM + JP 1302 4 mM 0 200 400 600 800 2 guan 20 mM 0.0 1 1 control Time, s -6 -5 -4 Log[Guanabenz], M

Figure 4. The effect of JP 1302, a speciﬁcspecific antagonist of the αα2C2C isoform,isoform, onon thethe guanabenz-inducedguanabenz-induced suppressionsuppression of IICaL. . (a,b) Representative ICaL recordings and time-course of peak ICaL density values measured in the presence of JP 1302 alone. (a,b) Representative ICaL recordings and time-course of peak ICaL density values measured in the presence of JP 1302 (c) dose-response relationship of JP 1302-induced suppression of ICaL (the Hill’s plot parameters in the text). (d,e) Repre- alone. (c) dose-response relationship of JP 1302-induced suppression of ICaL (the Hill’s plot parameters in the text). (d,e) sentative ICaL recordings and time-course of peak ICaL density values obtained at low concentration of JP 1302 thatFigure reversed 4 Representative ICaL recordings and time-course of peak ICaL density values obtained at low concentration of JP 1302 that guanabenz-induced suppression of ICaL. (f) JP 1302 induced rightward shifts of dose-dependent inhibition of ICaL by gua- reversed guanabenz-induced suppression of I .(f) JP 1302 induced rightward shifts of dose-dependent inhibition of I nabenz (the Hill’s plot parameters in the text).CaL The relationships in the presence of JP 1302 were constructed relative to theCaL currentby guanabenz values (themeasured Hill’s plotin the parameters presence of in the antagonist text). The relationships alone. in the presence of JP 1302 were constructed relative to the current values measured in the presence of the antagonist alone. 2.5. Expression of α2-AR Genes in Mouse Hearts 2.5. ExpressionIn the mouse of α 2-ARleft ventr Genesicle, in MouseRT-qPCR Hearts assay revealed low levels of α2 subtype gene expressionIn thes mousethat might left ventricle,explain the RT-qPCR necessity assay for relatively revealed high low levelsagonist of concentrationsα2 subtype gene to induceexpressions the considerable that might explainfunctional the output necessity in cardiomyocyte for relatively high[2,25,26] agonist. This concentrations assay did not identifyto induce in thethe considerable mouse left ventricle functional the output expression in cardiomyocyte of adra2A mRNA [2,25 ,26(α2A]. This gene) assay, and did it revnotea identifyled the inmean the mousecycle threshold left ventricle value thes of expression 36.8 ± 2.7 of(n adra2A= 3) formRNA adra2B ((α2Вα2A gene),gene) and 33.9it revealed ± 1.8 (n the= 3) meanfor adra2C cycle (α2С threshold gene). values The ΔCt of values 36.8 ± for2.7 these (n = 3)genes for adra2Bestimated(α2B relative gene) toand the 33.9 gapdh± mean1.8 (n Ct= 3)value for adra2Cof 15.7 ±(α 0.32C ( gene).n = 6) indicate The ∆Ct a weak values expression for these genesof both estimated mRNAs, andrelative that the to the expressiongapdh mean levels Ct of value adra2B of were 15.7 approximately± 0.3 (n = 6) indicate one order a weakof magnitude expression lower of comparedboth mRNAs, to adra2C and that (Figure the expression 5a). In contrast, levels of aadra2B more were prominent approximately expression one of order α2-AR of isoformsmagnitude was lower identified compared by this to adra2C assay in(Figure the brain5a). Inlysate contrast, with a the more mean prominent Ct values expression of 25.6 ± 0.2,of α 28.92-AR ± isoforms0.3 and 24.1 was identiﬁed± 0.02 for byadra2A, this assay adra2B in theand brain adra2C, lysate respectively, with the mean and Ctwith values the of 25.6 ± 0.2, 28.9 ± 0.3 and 24.1 ± 0.02 for adra2A, adra2B and adra2C, respectively, and with the gapdh Ct value of 15.9 ± 0.1 (n = 3 for all samples). Immunoblotting demonstrated the absence of α2A protein and the presence of α2B and α2C protein subtypes in mouse left ventricle (Figure5b). Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 6 of 11

gapdh Ct value of 15.9 ± 0.1 (n = 3 for all samples). Immunoblotting demonstrated the ab- Int. J. Mol. Sci. 2021, 22, 4135 6 of 11 sence of α2A protein and the presence of α2В and α2С protein subtypes in mouse left ventricle (Figure 5b).

a b adra2A adra2B adra2C kDa α2C α2B α2A 0 ND 100 -5 70 -10

Ct D -15 55

-20 40 -25

FigureFigure 5. 5.TheThe mRNA mRNA and and protein protein expression expression levels levels of of the the α2α2-AR-AR isoforms isoforms in in the the mouse mouse left left ventri- ventricle. cle.(a )(a mRNA) mRNA expression expression of theof theα2 α2 adrenoceptor adrenoceptor genes genes obtained obtained using using the the RT-qPCR RT-qPCR assay. assay. In contrast In con- to trastadra2B to adra2Band adrs2C and adrs2Cgenes thegenes expression the expression of adra2A of adra2Awas not was detected not detected (ND). (b (ND).) Western (b) Western blots conﬁrmed blots confirmed the expression of α2B and α2C but not α2А receptor proteins in the mouse left ventric- the expression of α2B and α2C but not α2A receptor proteins in the mouse left ventricular tissue. ular tissue.

3. Discussion Figure 5 3. DiscussionWe have established, herein, that in isolated mouse cardiomyocytes guanabenz, an agonistWe have of α2-AR, established, reversibly herein, suppressed that in isolated L-type Camouse2+ currents. cardiomyocytes Inhibitory guanabenz, analysis using an 2+ agonistthe specific of α2 receptor-AR, reversibly antagonists suppressed revealed L that-type the Caα2-agonist-induced currents. Inhibitory suppression analysis using of ICaL themainly specific involves receptor the antagonistsα2C, to a lesser revealed extent that the theα2B, α2- andagonist not- theinducedα2Areceptor suppression isoforms. of ICaL In mainlygeneral, involves suppression the α2С, of ItoCaL a inlesser mouse extent cardiomyocytes the α2В, and innot response the α2А to receptor activation isoforms. of α2-ARs In general,is consistent suppression with the of data ICaL in obtained mouse incardiomyocytes rat cardiomyocytes in response [2]. In bothto activation species, theof α2 intrinsic-ARs isexpression consistent levelswith the of αdata2-AR obtained genes were in rat low, cardiomyocytes which may explain [2]. In theboth relatively species, lowthe intrinsic efficiency expressionof the agonists levels inof cardiomyocytes.α2-AR genes were However, low, which the profilemay explain of α2-AR the subtyperelatively expressions low effi- ciencyin the of mouse the agonists left ventricle in cardiomyocytes was found. to However, be different the fromprofile expression of α2-AR ofsubtype corresponding expres- sionsmRNAs in the in mouse rat cardiomyocytes. left ventricle was In contrastfound to to be rat different cardiomyocytes, from expressio we didn of not correspond- identify the ingexpression mRNAs in of ratadra2a cardiomyocytes.gene in the mouse In contrast myocardium. to rat cardiomyocytes Thus, the input, we of didα2-AR not identify isoforms thein expression diverse cardiomyocyte of adra2a gene responses in the may mouse not myocardium be identical. among Thus, the mammals, input of including α2-AR isoformshumans, in necessitating diverse cardiomyocyte further investigations. responses may not be identical among mammals, in- cludingThe humans, analysis necessitating of protein further expression investigations. using Western blots confirmed the absence in theThe left analysis mouse ventricleof protein of expression the α2A isoformusing W andestern the blots presence confirmed of the theα2B absence and the in theα2C leftproteins. mouse Theventricle molecular of the weight α2А isoform of the Westernand the presence blot products of the precipitated α2В and the by α2С the antibodiesproteins. Theagainst molecularα2B proteinweight inof ourthe Western study (~72 blot kDa), product althoughs precipitated heavier by than the predicted antibodies (~50 against kDa), α2Вexactly protein correspond in our study to the (~72 manufacturer kDa), althoug datasheeth heavier [34 ].than In ourpredicted studies, (~ the50 AlomonekDa), exactly Labs correspondantibody againstto the manufacturerα2C did not datasheet precipitate [34] any. In protein our studies, of the the expected Alomone molecular Labs antibody weight. againstHowever, α2C correspondingdid not precipitate Abcam any antibodies, protein of inthe line expected with the molecular manufacturer weight. specifications, However, correspondingprecipitated aAbcam 60–70 kDaantibodies, product in in line the with mouse the tissue manufacturer [35]. Of note,specifications, both the Alomoneprecipi- tatedLabs a and60–70 Abcam kDa product specific in antibodies the mouse against tissue the [35]α.2A Of receptornote, both subtype the Alomone did not Labs detect and the Abcampresence specific of this antibodies isoform in against the lysate the α2A of mouse receptor myocardium subtype did tissue. not Althoughdetect the therepresence is no ofclear this isoform explanation in the for lysate the difference of mouse inmyocardium the receptor tissue. molecular Although weights there observed is no clear here, ex- as planationwell as in for the the manufacturer difference in assaysthe receptor between molecular mouse and,weights for instance,observed humanhere, as tissues, well as itin is thepossible manufacturer that phosphorylation, assays between glycosylation, mouse and, lipidation,for instance, etc., human may alternatively tissues, it is contributepossible α thatto thephosphorylation, post-translational glycosylation, modifications lipidation of 2-AR, etc. proteins, may alternatively in different tissues contribute [36–38 to]. the The specific antagonists used here are well-established tools for pharmacological dis- post-translational modifications of α2-AR proteins in different tissues [36–38]. crimination of α2-AR subtypes in numerous in vivo and in vitro studies [20]. Among other The specific antagonists used here are well-established tools for pharmacological dis- specific antagonists, JP 1302, an antagonist of α2C isoform, exhibited a more significant crimination of α2-AR subtypes in numerous in vivo and in vitro studies [20]. Among other inhibitory effect on I in mouse cardiomyocytes. To the best of our knowledge, the JP specific antagonists, JPCaL 1302, an antagonist of α2C isoform, exhibited a more significant 1302-induced suppression of L-type Ca2+ currents has not been previously reported. In inhibitory effect on ICaL in mouse cardiomyocytes. To the best of our knowledge, the JP particular, the antagonism assays employing JP 1302 in hippocampal neurons revealed no 1302-induced suppression of L-type Ca2+ currents has not been previously reported. In effect of this agent alone to synaptic vesicle exocytosis, which depends upon activation particular, the antagonism assays employing JP 1302 in hippocampal neurons revealed no of both N-type and P/Q-type voltage-gated Ca2+ currents [33,39]. JP 1302 (1–10 µM), effect of this agent alone to synaptic vesicle exocytosis, which depends upon activation of in the absence of α2-AR agonists, exhibited no significant effects on contractile force of ventricular strips, but induced a negative inotropic effect in atrial strip samples [40]. In line with the previous studies, our results indicate that the antagonist JP 1302 hardly can

be characterized as a partial α2-AR agonist, since, in this case, its effect on ICaL would be Int. J. Mol. Sci. 2021, 22, 4135 7 of 11

synergetic to the blocking effect of agonist. In contrast, we identified that JP 1302 at low doses could antagonize the suppression of ICaL by guanabenz. However, at present, we cannot specify the alternative α2-AR-independent mechanism by which JP 1302 affects ICaL. We believe that the obtained results further underline the significance of α2-AR signaling that by optimizing intracellular Ca2+ handling can increase the effectiveness of contractile systolic function and reduce a risk for detrimental Ca2+ cellular overload [41]. Furthermore, these data provide an important molecular and genomic basis for understand- ing the functional reactions of myocardial cells to activation of α2-AR. Such information would be critical for a future development of animal models with a tissue-specific suppression or potentiation of expression of the α2-AR isoforms, as well as for a prospective new gene- or cell-based therapies aimed at treating cardiomyopathy and heart failure [1].

4. Materials and Methods 4.1. Cell Isolation Cardiomyocytes were isolated from the left ventricle of isoflurane anesthetized mice (C57BL/6) by enzymatic dissociation [42]. Following open chest surgery, the hearts were exposed, and descending aorta and inferior vena cava were cut. Immediately, 7 mL of HEPES buffer containing (in mM): NaCl, 130; KCl 5; NaH2PO4, 0.5; Glucose 10; Taurine, 10; Diacetyl monoxime, 10; HEPES 10 (pH 7.8) with 5 mM EDTA was injected into the right ventricle. Next to succeeding ascending aorta clamping, the hearts were perfused via the left ventricle apex by consecutive injections of the following solutions: (i) 10 mL of HEPES buffer + 5 mM EDTA; (ii) 3 mL of HEPES buffer + 1 mM MgCl2; (iii) 30–40 mL of HEPES collagenase buffer (Collagenase II, 0.5 mg/mL; Collagenase IV, 0.5 mg/mL; Protease XIV, 0.05 mg/mL) + 1 mM MgCl2. The left ventricles were cut into small pieces and isolated cardiomyocytes were obtained by a gentle trituration followed by centrifugation. Proteolytic reactions were quenched by washing with fetal bovine serum. Cells filtered through a 100-µm nylon mesh cell strainer (Thermo Fisher Scientific Inc., Waltham, MA, USA) were resuspended in a low Ca2+ media containing (in mM): NaCl, 80; KCl, 10; KH2PO4, 1.2; MgCl2, 5; glucose, 20; taurine, 50; L-arginine, 1; HEPES, 10 (pH 7.35) and underwent gravity settled post-dissociation recovery achieved by stepwise Ca2+ increase from 0.2 to 1.8 mM.

4.2. Electrophysiology Membrane currents in isolated cardiac myocytes were measured using the perforated mode of the whole-cell patch clamp technique. Whole-cell membrane potential was controlled through the electrical access obtained by membrane patch perforation induced by amphotericin B (200–250 µg/mL) added to the pipette (4–5 MΩ) containing (in mM): CsCl, 130; MgSO4, 5; HEPES, 10 (pH 7.25). The bath solution contained (in mM): NaCl, 80; CaCl2, 2; MgSO4, 5; KH2PO4, 1.2; CsCl, 10; tetraethylammonium chloride (TEA-Cl), 20; glucose, 20; L-arginine, 1; HEPES, 10 (pH 7.25). L-type Ca2+ currents were elicited by depolarizing rectangular pulses from a holding potential of −40 mV, chosen to inactivate low threshold voltage-gated channels. Currents were measured by using an Axopatch 200B amplifier (Molecular Devices, San Jose, CA, USA). Progress of membrane perforation was monitored online by estimation of serious resistance and cellular capacitance values based on analysis of capacitive transient currents. Protocol of stimulation, determination of cell parameters and data acquisition were performed by using the custom BioQuest software and a L-154 AD/DA converter (L-card, Moscow, Russia) [43]. Following formation of the perforated whole-cell patch-clamp configuration, approximately 20 MΩ of series resistances was compensated by 80–100% (at the LAG control 80–100 µs) to final values less than 12 MΩ. Measurements were performed at 31 ± 0.5 ◦C, using a HCC-100A temperature controller (Dagan Corp., Minneapolis, MN, USA). Peak current values measured at +10 mV of membrane potentials were normalized to the cell capacitances and presented in graphs as “Peak ICaL density”. Int. J. Mol. Sci. 2021, 22, 4135 8 of 11

4.3. RNA Isolation and RT-qPCR Assay Total RNA was extracted from left ventricular walls (~100 mg) isolated from isoflu- orane (2%)-anesthetized mice. Tissue samples were stored and homogenized in 1 mL of ExtractRNA reagent (BC032 Evrogen, Moscow, Russia). RNA isolation was performed according to the manufacturer recommendations. At the final step, RNA was precipitated by 3 volumes of 96% ethanol. The pellet, following washing in cold 75% ethanol and air-drying, was resuspended in 100 µL of deionized water. RNA preps were treated with DNAse I (04716728001 Roche) for 1 h at 37 ◦C, followed by DNAse inactivation for 10 min at 70 ◦C, to reduce genomic DNA contamination. The quality of RNA isolation was controlled spectrophotometrically, using the NanoDrop 2000c (Thermo Fisher Scientific Inc., Waltham, MA, USA). Synthesis of cDNA was carried out with the commercially available reverse transcription MMLV RT kit (Evrogen, Moscow, Russia) using an oliogo(dT)18 primer. Then, qPCR for each α2-AR isoform was performed with the Applied BiosystemsTM 7500 Real- Time PCR System (Thermo Fisher Scientific Inc., Waltham, MA, USA), using HS Taq DNA polymerase (PK018, Evrogen, Moscow, Russia) according to the following protocol: 94 ◦C for 5 min, 40 cycles of 94 ◦C for 20 s and then 60 ◦C for 1 min. The expression levels of particular adra2 gene of interest (GOI) were expressed relative to the expression of house- keeping gene gapdh, as following: ∆Ct = Ct[gapdh]—Ct[GOI]. Primers (forward, ... _F; reversed, . . . _R and probe, . . . _P) used for the assay are listed in Table1.

Table 1. Primers for RT-qPCR assay.

Name Primer Sequence GenBank Index Localization Adra2a_F TTTCCCCTGTGCCTAACTGC 3072–3091 Adra2a_R TGGCTTTATACACGGGGCTGNM_007417.5 2250–2269 Adra2a_P FAM-ACAGCGATGGACCAAGGCAGAAGG-BHQ1 2222–2246 Adra2b_F TTCAACCTCGCAGAGAGCAG 2728–2747 Adra2b_R CTCTAGCGCATTTCCCCCATNM_009633.4 2834–2815 Adra2b_P GCCTGCCGCCT-R6G-ACTTGCAGCAGGG-BHQ1 2758–2781 Adra2c_F AGTTGCCAGAACCGCTCTTT 2546–2565 Adra2c_R GAGCGCCTGAAGTCCTGATTNM_007418.3 2648–2629 Adra2c_P Cy3-TGCAACAGTTCGCTCAACCCGGT-BHQ2 2590–2612 GAPDH_F GGGTCCCAGCTTAGGTTCAT 32–51 GAPDH_R CCCAATACGGCCAAATCCGTNM_001289726.1 131–112 GAPDH_P Cy5-CAGGAGAGTGTTTCCTCGTCCCGT-BHQ2 62–85

4.4. Western Blot Proteins were separated in 10% SDS-PAGE, transferred to nitrocellulose membranes (sc- 3724, 0.45 µm, Santa Cruz Biotechnology) and probed with antibodies against α2A (AAR-020, Alomone labs, lot AAR020AN0202), α2B (AAR-021, Alomone labs, lot AAR021AN0202) and α2C (ab46536, Abcam) diluted to 1:100. Counterstain was performed with horseradish peroxidase (HRP)-conjugated anti-rabbit (Santa Cruz, sc-2004, 1:200 dilution) secondary antibodies. HRP signals were detected by using 3,30-diaminobenzidine tetrahydrochloride (DAB) substrate (Amresco, E733). All expression assays were performed in triplicate in at least two independent experiments.

4.5. Drugs The stock solutions (10–20 mM) of the α2-AR agonist guanabenz acetate (Sigma, St. Louis, MO, USA), non-selective antagonist yohimbine dihydrochloride (Sigma) and selective antagonists BRL44408 maleate (α2A-AR), ARC239 dihydrochloride (α2B-AR) and JP1302 dihydrochloride (α2C-AR), all from Tocris, were prepared in deionized water. Int. J. Mol. Sci. 2021, 22, 4135 9 of 11

4.6. Data Analysis and Presentation The averaged data are presented as mean ±SEM. Inhibition proﬁles of measured membrane currents in dose-response experiments were presented relative to the control current values measured before drag application and ﬁtted with corresponding Hill’s equations: −h Relative inhibition = [1 + (c/IC50)] ,

where IC50 is the half-inhibition constant, c is the concentration and h is the Hill coefﬁcient.

Author Contributions: Conceptualization, A.E.A. and E.V.E.; methodology, A.E.A., E.V.E., R.J. and S.P.; software, A.E.A.; formal analysis, A.E.A. and E.V.E.; investigation, A.E.A., E.V.E. and R.J.; writing—original draft preparation, A.E.A.; writing—review and editing, A.E.A., E.V.E., S.P. and O.Y.P.; visualization, A.E.A. and E.V.E.; supervision, O.Y.P.; funding acquisition, O.Y.P. and A.E.A. All authors have read and agreed to the published version of the manuscript. Funding: This research was supported by the Russian Science Foundation, grant number 18-15-00198. Institutional Review Board Statement: Surgical experimental procedures were approved by the Biological Safety and Ethics Committee (Institute of Theoretical and Experimental Biophysics) in accord with Directive 2010/63/EU of the European Parliament and by the Institutional Animal Care and Use Committee (Mayo Clinic) in accord with United States National Institutes of Health guidelines. Informed Consent Statement: Not applicable. Data Availability Statement: The data presented in this study are available in the article. Acknowledgments: We thank Beletsky I.P., Sc.D., for his support of this publication. Conﬂicts of Interest: The authors declare no conﬂict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References 1. Alekseev, A.E.; Park, S.; Pimenov, O.Y.; Reyes, S.; Terzic, A. Sarcolemmal α2-Adrenoceptors in Feedback Control of Myocardial Response to Sympathetic Challenge. Pharmacol. Ther. 2019, 197, 179–190. [CrossRef][PubMed] 2. Kokoz, Y.M.; Evdokimovskii, E.V.; Maltsev, A.V.; Nenov, M.N.; Nakipova, O.V.; Averin, A.S.; Pimenov, O.Y.; Teplov, I.Y.; Berezhnov, A.V.; Reyes, S.; et al. Sarcolemmal α2-Adrenoceptors Control Protective Cardiomyocyte-Delimited Sympathoadrenal Response. J. Mol. Cell. Cardiol. 2016, 100, 9–20. [CrossRef][PubMed] 3. Averin, A.S.; Nakipova, O.V.; Kosarsky, L.S.; Pimenov, O.Y.; Galimova, M.H.; Nenov, M.N.; Berejnov, A.V.; Alekseev, A.E. Activa- tion of Sarcolemmal α2 Adrenoceptors Supports Ca2+ Homeostasis and Prevents Ventricular Arrhythmia under Sympathetic Stress. Biophysics 2019, 64, 793–798. [CrossRef] 4. Reyes, S.; Varagic, J.; VonCannon, J.; Cheng, C.P.; Ferrario, C.M. Novel Action of Cardiomyocyte α2-Adrenergic Receptors in Reversing Angiotensin II Mediated Cardiac Hypertrophy. Circulation 2018, 138 (Suppl. S1), A16308. 5. Lomasney, J.W.; Lorenz, W.; Allen, L.F.; King, K.; Regan, J.W.; Yang-Feng, T.L.; Caron, M.G.; Lefkowitz, R.J. Expansion of the Alpha 2-Adrenergic Receptor Family: Cloning and Characterization of a Human Alpha 2-Adrenergic Receptor Subtype, the Gene for Which Is Located on Chromosome 2. Proc. Natl. Acad. Sci. USA 1990, 87, 5094–5098. [CrossRef] 6. Bylund, D.B.; Blaxall, H.S.; Iversen, L.J.; Caron, M.G.; Lefkowitz, R.J.; Lomasney, J.W. Pharmacological Characteristics of Alpha 2-Adrenergic Receptors: Comparison of Pharmacologically Defined Subtypes with Subtypes Identified by Molecular Cloning. Mol. Pharmacol. 1992, 42, 1–5. 7. MacDonald, E.; Kobilka, B.K.; Scheinin, M. Gene Targeting—Homing in on α2-Adrenoceptor-Subtype Function. Trends Pharmacol. Sci. 1997, 18, 211–219. [CrossRef] 8. Ruuskanen, J.O.; Xhaard, H.; Marjamäki, A.; Salaneck, E.; Salminen, T.; Yan, Y.-L.; Postlethwait, J.H.; Johnson, M.S.; Larhammar, D.; Scheinin, M. Identification of Duplicated Fourth α2-Adrenergic Receptor Subtype by Cloning and Mapping of Five Receptor Genes in Zebrafish. Mol. Biol. Evol. 2004, 21, 14–28. [CrossRef][PubMed] 9. Ruuskanen, J.O.; Laurila, J.; Xhaard, H.; Rantanen, V.-V.; Vuoriluoto, K.; Wurster, S.; Marjamäki, A.; Vainio, M.; Johnson, M.S.; Scheinin, M. Conserved Structural, Pharmacological and Functional Properties among the Three Human and Five Zebrafish α2-Adrenoceptors: Human and Fish α2-Receptor Comparative Pharmacology. Br. J. Pharmacol. 2005, 144, 165–177. [CrossRef] 10. Céspedes, H.A.; Zavala, K.; Vandewege, M.W.; Opazo, J.C. Evolution of the α2 -Adrenoreceptors in Vertebrates: ADRA2D Is Absent in Mammals and Crocodiles. Gen. Comp. Endocrinol. 2017, 250, 85–94. [CrossRef] Int. J. Mol. Sci. 2021, 22, 4135 10 of 11

11. Hein, L.; Altman, J.D.; Kobilka, B.K. Two Functionally Distinct α2-Adrenergic Receptors Regulate Sympathetic Neurotransmission. Nature 1999, 402, 181–184. [CrossRef] 12. Philipp, M.; Brede, M.; Hein, L. Physiological Significance of α2-Adrenergic Receptor Subtype Diversity: One Receptor Is Not Enough. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2002, 283, R287–R295. [CrossRef] 13. Uys, M.M.; Shahid, M.; Harvey, B.H. Therapeutic Potential of Selectively Targeting the α2C-Adrenoceptor in Cognition, Depres- sion, and Schizophrenia—New Developments and Future Perspective. Front. Psychiatry 2017, 8.[CrossRef] 14. Guo, T.Z.; Davies, M.F.; Kingery, W.S.; Patterson, A.J.; Limbird, L.E.; Maze, M. Nitrous Oxide Produces Antinociceptive Response via Alpha2B and/or Alpha2C Adrenoceptor Subtypes in Mice. Anesthesiology 1999, 90, 470–476. [CrossRef][PubMed] 15. Fairbanks, C.A.; Stone, L.S.; Wilcox, G.L. Pharmacological Profiles of Alpha 2 Adrenergic Receptor Agonists Identified Using Genetically Altered Mice and Isobolographic Analysis. Pharmacol. Ther. 2009, 123, 224–238. [CrossRef][PubMed] 16. Schlicker, E.; Feuerstein, T. Human Presynaptic Receptors. Pharmacol. Ther. 2017, 172, 1–21. [CrossRef][PubMed] 17. Altman, J.D.; Trendelenburg, A.U.; MacMillan, L.; Bernstein, D.; Limbird, L.; Starke, K.; Kobilka, B.K.; Hein, L. Abnormal Regulation of the Sympathetic Nervous System in Alpha2A-Adrenergic Receptor Knockout Mice. Mol. Pharmacol. 1999, 56, 154–161. [CrossRef] 18. Trendelenburg, A.U.; Klebroff, W.; Hein, L.; Starke, K. A Study of Presynaptic Alpha2-Autoreceptors in Alpha2A/D-, Alpha2B- and Alpha2C-Adrenoceptor-Deficient Mice. Naunyn Schmiedebergs Arch. Pharmacol. 2001, 364, 117–130. [CrossRef] 19. Brede, M.; Nagy, G.; Philipp, M.; Sørensen, J.B.; Lohse, M.J.; Hein, L. Differential Control of Adrenal and Sympathetic Cate- cholamine Release by α2 -Adrenoceptor Subtypes. Mol. Endocrin. 2003, 17, 1640–1646. [CrossRef] 20. Quaglia, W.; Del Bello, F.; Giannella, M.; Piergentili, A.; Pigini, M. α2C-Adrenoceptor Modulators: A Patent Review. Expert. Opin. Ther. Pat. 2011, 21, 455–481. [CrossRef] 21. Kaur, M.; Singh, P.M. Current Role of Dexmedetomidine in Clinical Anesthesia and Intensive Care. Anesth. Essays. Res. 2011, 5, 128–133. [CrossRef] 22. Kaye, A.D.; Chernobylsky, D.J.; Thakur, P.; Siddaiah, H.; Kaye, R.J.; Eng, L.K.; Harbell, M.W.; Lajaunie, J.; Cornett, E.M. Dexmedetomidine in Enhanced Recovery After Surgery (ERAS) Protocols for Postoperative Pain. Curr. Pain Headache Rep. 2020, 24, 21. [CrossRef] 23. Lorenz, W.; Lomasney, J.W.; Collins, S.; Regan, J.W.; Caron, M.G.; Lefkowitz, R.J. Expression of Three Alpha 2-Adrenergic Receptor Subtypes in Rat Tissues: Implications for Alpha 2 Receptor Classification. Mol. Pharmacol. 1990, 38, 599–603. 24. Ibacache, M.; Sanchez, G.; Pedrozo, Z.; Galvez, F.; Humeres, C.; Echevarria, G.; Duaso, J.; Hassi, M.; Garcia, L.; Díaz-Araya, G.; et al. Dexmedetomidine Preconditioning Activates Pro-Survival Kinases and Attenuates Regional Ischemia/Reperfusion Injury in Rat Heart. Biochim. Biophys. Acta 2012, 1822, 537–545. [CrossRef] 25. Maltsev, A.V.; Kokoz, Y.M.; Evdokimovskii, E.V.; Pimenov, O.Y.; Reyes, S.; Alekseev, A.E. Alpha-2 Adrenoceptors and Imidazoline Receptors in Cardiomyocytes Mediate Counterbalancing Effect of Agmatine on NO Synthesis and Intracellular Calcium Handling. J. Mol. Cell. Cardiol. 2014, 68, 66–74. [CrossRef][PubMed] 26. Zhao, J.; Zhou, C.-L.; Xia, Z.-Y.; Wang, L. Effects of Dexmedetomidine on L-Type Calcium Current in Rat Ventricular Myocytes. Acta Cardiol. Sin. 2013, 29, 175–180. 27. Yoshikawa, Y.; Hirata, N.; Kawaguchi, R.; Tokinaga, Y.; Yamakage, M. Dexmedetomidine Maintains Its Direct Cardioprotective Effect Against Ischemia/Reperfusion Injury in Hypertensive Hypertrophied Myocardium. Anesth. Analg. 2018, 126, 443–452. [CrossRef][PubMed] 28. Lymperopoulos, A. Chapter Two—Arrestins in the Cardiovascular System: An Update. In Progress in Molecular Biology and Translational Science; Teplow, D.B., Ed.; Academic Press: Cambridge, MA, USA, 2018; Volume 159, pp. 27–57. [CrossRef] 29. Liggett, S.B.; Ostrowski, J.; Chesnut, L.C.; Kurose, H.; Raymond, J.R.; Caron, M.G.; Lefkowitz, R.J. Sites in the Third Intracellular Loop of the Alpha 2A-Adrenergic Receptor Confer Short Term Agonist-Promoted Desensitization. Evidence for a Receptor Kinase-Mediated Mechanism. J. Biol. Chem. 1992, 267, 4740–4746. [CrossRef] 30. Eason, M.G.; Liggett, S.B. Subtype-Selective Desensitization of Alpha 2-Adrenergic Receptors. Different Mechanisms Control Short and Long Term Agonist-Promoted Desensitization of Alpha 2C10, Alpha 2C4, and Alpha 2C2. J. Biol. Chem. 1992, 267, 25473–25479. [CrossRef] 31. Devedjian, J.-C.; Esclapez, F.; Denis-Pouxviel, C.; Paris, H. Further Characterization of Human α2-Adrenoceptor Subtypes: [3H]RX821002 Binding and Definition of Additional Selective Drugs. Eur. J. Pharmacol. 1994, 252, 43–49. [CrossRef] 32. Bylund, D.B.; Ray-Prenger, C.; Murphy, T.J. Alpha-2A and Alpha-2B Adrenergic Receptor Subtypes: Antagonist Binding in Tissues and Cell Lines Containing Only One Subtype. J. Pharmacol. Exp. Ther. 1988, 245, 600–607. [PubMed] 33. Sallinen, J.; Höglund, I.; Engström, M.; Lehtimäki, J.; Virtanen, R.; Sirviö, J.; Wurster, S.; Savola, J.-M.; Haapalinna, A. Pharmaco- logical Characterization and CNS Effects of a Novel Highly Selective α2C-Adrenoceptor Antagonist JP-1302. Br. J. Pharmacol. 2007, 150, 391–402. [CrossRef][PubMed] 34. Anti-α2B-Adrenergic Receptor (Extracellular) Antibody. Available online: https://www.alomone.com/p/anti-2b-adrenoceptor- extracellular/AAR-021 (accessed on 2 February 2021). 35. Anti-Alpha 2C Adrenergic Receptor/ADRA2C Antibody (Ab46536). Archived Datasheet (PDF). Available online: https://www. abcam.com/alpha-2c-adrenergic-receptoradra2c-antibody-ab46536.html (accessed on 2 February 2021). 36. Gurevich, E.V.; Gurevich, V.V. GRKs as Modulators of Neurotransmitter Receptors. Cells 2021, 10, 52. [CrossRef][PubMed] Int. J. Mol. Sci. 2021, 22, 4135 11 of 11

37. Hurt, C.M.; Sorensen, M.W.; Angelotti, T. Common α2A and α2C Adrenergic Receptor Polymorphisms Do Not Affect Plasma Membrane Trafficking. Naunyn Schmiedebergs Arch. Pharmacol. 2014, 387, 569–579. [CrossRef][PubMed] 38. Shenoy, S.K. Seven-Transmembrane Receptors and Ubiquitination. Circ. Res. 2007, 100, 1142–1154. [CrossRef] 39. Hara, M.; Zhou, Z.-Y.; Hemmings, H.C., Jr. α2-Adrenergic Receptor and Isoflurane Modulation of Presynaptic Ca2+ Influx and Exocytosis in Hippocampal Neurons. Anesthesiology 2016, 125, 535–546. [CrossRef][PubMed] 40. Zefirov, T.L.; Khisamieva, L.I.; Ziyatdinova, N.I.; Zefirov, A.L. Selective Blockade of α2-Adrenoceptor Subtypes Modulates Contractility of Rat Myocardium. Bull. Exp. Biol. Med. 2016, 162, 177–179. [CrossRef] 41. Baier, M.J.; Klatt, S.; Hammer, K.P.; Maier, L.S.; Rokita, A.G. Ca2+/Calmodulin-Dependent Protein Kinase II Is Essential in Hyperacute Pressure Overload. J. Mol. Cell. Cardiol. 2020, 138, 212–221. [CrossRef] 42. Ackers-Johnson, M.; Li, P.Y.; Holmes, A.P.; O’Brien, S.-M.; Pavlovic, D.; Foo, R.S. A Simplified, Langendorff-Free Method for Concomitant Isolation of Viable Cardiac Myocytes and Nonmyocytes From the Adult Mouse Heart. Circ. Res. 2016, 119, 909–920. [CrossRef] 43. Alekseev, A.E.; Markevich, N.I.; Korystova, A.F.; Terzic, A.; Kokoz, Y.M. Comparative Analysis of the Kinetic Characteristics of L-Type Calcium Channels in Cardiac Cells of Hibernators. Biophys J. 1996, 70, 786–797. [CrossRef]