DOCSLIB.ORG

Fournier's Gangrene of the Penis Caused by Streptococcus Dysgalactiae Subspecies Equisimilis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Fournier's Gangrene of the Penis Caused by Streptococcus Dysgalactiae Subspecies Equisimilis Anantha et al. BMC Infectious Diseases 2013, 13:381 http://www.biomedcentral.com/1471-2334/13/381 CASE REPORT Open Access Fournier’s gangrene of the penis caused by Streptococcus dysgalactiae subspecies equisimilis: case report and incidence study in a tertiary-care hospital Ram V Anantha1,2*, Katherine J Kasper1, Kelcey G Patterson1, Joseph J Zeppa1, Johan Delport1 and John K McCormick1 Abstract Background: Fournier’s gangrene is a rare necrotizing soft tissue infection of the scrotum and penis. We report, to our knowledge, the first case of Fournier’s gangrene caused by Streptococcus dysgalactiae subsp. equisimilis (SDSE), a strain of pyogenic β-hemolytic streptococci that is increasingly being recognized as an important human pathogen. Case presentation: We describe a healthy 59 year-old Caucasian male who presented to the emergency department with Fournier’s gangrene of the penis and scrotum, with extension to the anterior abdominal wall. He underwent urgent surgical debridement of his scrotum, penis, and anterior abdomen. Swabs from the scrotum grew Gram-positive cocci, which were initially identified as Streptococcus anginosus group by matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS). However, polymerase chain reaction (PCR) amplification and sequencing of the 16S rRNA gene identified the isolate as Streptococcus dysgalatiae subspecies equisimilis (SDSE). The incidences of invasive S. anginosus group and SDSE infections at the London Health Sciences Centre, a tertiary-care institution in southwestern Ontario, were determined between August 1, 2011 and August 31, 2012, revealing a slightly lower rate of SDSE (3.2 cases per 100,000 population) than other studies. Conclusions: This case highlights a unique disease manifestation of the emerging human pathogen Streptococcus dysgalatiae subspecies equisimilis that has not been previously reported. This case also underscores the limitations of MALDI-TOF MS in differentiating between closely-related streptococcal species which may have different pathogenic profiles. Keywords: Streptococcus dysgalactiae subsp. equisimilis, Fournier’s gangrene, MALDI-TOF MS, Species identification Background Klebsiella, Bacteroides, Clostridium, streptococci and en- Fournier’s gangrene is a rare necrotizing infection of the terococci [1]. Early therapy is critical, including surgi- male genitalia [1,2]. It is classically characterized by in- cal debridement, broad-spectrum antibiotics, and skin tense pain and tenderness in the genitals, rapidly grafting [1-3]. We describe a case of Fournier’sgangrene progressing to gangrene and septic shock. Risk factors in a healthy male caused by Streptococcus dysgalactiae include diabetes [1], immune compromise, drug use, subsp. equisimilis (SDSE), initially misidentified as Strepto- obesity, and trauma to the perineum [2,3]. Most cases of coccus anginosus group. SDSE is a pyogenic β-hemolytic Fournier’s gangrene are polymicrobial [2], and com- Streptococcus that is emerging as a human pathogen with monly isolated microorganisms include Escherichia, a similar disease profile to S. pyogenes [4-6]. While it pri- marily presents as skin and soft-tissue infections, including * Correspondence: [email protected] cellulitis and necrotizing fasciitis [4], SDSE can also cause 1Western University, London, Ontario, Canada 2Department of Microbiology and Immunology, Siebens-Drake Research endocarditis, rheumatic fever, and streptococcal toxic Institute Room 133, Western University, 1400 Western Road, London N6G shock-like syndrome [5,6]. With an ever-increasing clinical 2V4, Canada © 2013 Anantha et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Anantha et al. BMC Infectious Diseases 2013, 13:381 Page 2 of 5 http://www.biomedcentral.com/1471-2334/13/381 burden, there is a need to accurately identify invasive Table 1 List of primers used to amplify streptococcal SDSE infections. superantigen genes, 16S ribosomal RNA (rRNA), and emm genes Case presentation Name Sequence 5′-3′ Source A 59 year-old, previously healthy Caucasian male presen- SpeA forward AAAGTTGCCATCTCTTGGTTC Sigma genosys ted with scrotal and penile pain for six days, and brownish- SpeA reverse CAAGAGGTATTTGCTCAACAAGAC Sigma genosys black discoloration of the scrotum. His past medical and SpeC forward TTTGAGCAGGCGTAATTCCT Sigma genosys surgical history was non-contributory and he did not take SpeC reverse TTCAACGACACACACATTAAACA Sigma genosys any medications. There was no history of trauma or sepsis in the genital area, and there were no symptoms of dysuria SpeG forward ACCCCATGCGATTATGAAAA Sigma genosys or hematuria. A review of systems was unremarkable. On SpeG reverse GGGAGACCAAAAACATCGAC Sigma genosys examination, the patient was alert and oriented, but SpeH forward ATTCCAATGTTGTTCAAGCAAA Sigma genosys appeared unwell. He was also febrile (38.3°C), tachycardic SpeH reverse TGAGCGGTTACTTTCGGTTT Sigma genosys (heart rate 116/min), and normotensive (blood pressure SpeI forward TCCGCCATTTTCAGGTAGTT Sigma genosys 136/79). His lower abdomen was erythematous with palp- SpeI reverse TTTCCTTCCTCAAAGCCAGA Sigma genosys able subcutaneous emphysema extending to the umbilicus. His penile shaft was swollen and tender, and his scrotum SpeJ forward GCTCTCGACCTCAGAATCAA Sigma genosys was necrotic. Bloodwork revealed a white cell count of SpeJ reverse CTTTCATGGGTACGGAAGTG Sigma genosys 17 × 109/L, hyponatremia (125 mmol/L), hypochloremia SpeK forward CAAACAAGGAACGCAATTGAT Sigma genosys (86 mmol/L), and elevated serum lactate (3.1 mmol/L). SpeK reverse GTGTCTAATGCCACCGTCT Sigma genosys ’ The patients international normalized ratio (INR) was 1.6, SpeL forward ATAAGTCAGCACCTTCCTCTTTC Sigma genosys and his serum alanine-aminotransferase (ALT), and serum SpeL reverse AAATCTCCCGTTACCTTCCA Sigma genosys aspartate-aminotransferase (AST) were elevated at 127 U/L, and 66 U/L respectively. Blood glucose and serum creatinine SpeM forward AACTTCTTCTTCCTTAAAGCGTCT Sigma genosys were within normal limits. SpeM reverse TGCTGTGTTGGTTAATAGCGA Sigma genosys Intravenous treatment with vancomycin (1 g every 12 h), SmeZ forward TTTCTCGTCCTGTGATTGGA Sigma genosys and piperacillin-tazobactam (4.5 g every 8 h) was initiated. SmeZ reverse AATGGGACGGAGAACATAGC Sigma genosys The patient was urgently taken to the operating room and SSA forward ACAGGTCAGCTTTTACAGCA Sigma genosys underwent extensive debridement of his scrotum, penile SSA reverse GGGCATCATATCGTACCAAA Sigma genosys shaft, and anterior abdomen, while preserving the testes and abdominal muscles. A small abscess cavity communi- 16S rRNA forward AGAGTTTGATCCTGGCTCAG Invitrogen life technologies cating with the necrotizing infection was identified in the 16S rRNA reverse AAGGAGGTGATCCAGCCGCA Invitrogen life right buttock and debrided. A suprapubic catheter was technologies placed for urinary diversion, and the patient was admitted to emm genotyping TATTCGCTTAGAAAATTAA Invitrogen life the intensive care unit. After 48 hours, he underwent a primer forward technologies transverse colostomy to divert stool from his perineum, and emm genotyping GCAAGTTCTTCAGCTTGTTT Invitrogen life skin grafting to close his anterior abdominal wounds primer reverse technologies and penile shaft. His testes were tunnelled into his thighs, and after sixteen days in hospital, he was discharged home. A swab from the scrotal tissue was taken during the initial dysgalatiae subspecies equisimilis.Thiswasfurthercon- operation, and was streaked on blood agar plates, resulting firmed by sequencing the emm amplicon and performing a in a monoculture of uniformly-sized beta-haemolytic col- BLAST search on the Centers for Disease Control (CDC) onies. From this, the bacteria was isolated and subjected to streptococcal emm sequence database [8]: the isolate was matrix-assisted laser desorption ionization–time of flight identified as group G Streptococcus emm type stG643.0.Fur- mass spectrometry (MALDI-TOF MS) to identify the organ- ther PCR amplification experiments (Additional file 1: ism as Streptococcus anginosus group (score = 2.3), although FigureS1)didnotdetectanyofthe11knownstreptococcal the software (Biotyper software version 3.0) was unable to superantigen genes [9], when compared to genomic DNA distinguish the species. Susceptibility testing was performed preparations of S. pyogenes serotypes MGAS5005 [9], SF370 by the Kirby-Bauer disc diffusion method [7], and the organ- [10], MGAS8232 [10], and MGAS315 [10], which served as ism was sensitive to ceftriaxone, clindamycin, erythromycin, positive controls. In addition, proliferation assays [11] con- penicillin, and vancomycin. Polymerase chain reaction firmed the absence of Group A streptococcal superantigen (PCR) amplification (Table 1) and sequencing of the 16S activity in the isolate (Addition file 1: Figure S2). Briefly, rRNA amplicon from DNA isolated from overnight cultures supernatants from overnight cultures of the isolate were of two isolated colonies identified the isolate as Streptococcus added to fresh, gradient-purified human peripheral blood Anantha et al. BMC Infectious Diseases 2013, 13:381 Page 3 of 5 http://www.biomedcentral.com/1471-2334/13/381 mononuclear cells (PBMCs; 2.0 × 105 cells/well) in 96-well shock, and death if untreated. Although Group A plates.
Load more

Recommended publications
  • Common Commensals
    Common Commensals Actinobacterium meyeri Aerococcus urinaeequi Arthrobacter nicotinovorans Actinomyces Aerococcus urinaehominis Arthrobacter nitroguajacolicus Actinomyces bernardiae Aerococcus viridans Arthrobacter oryzae Actinomyces bovis Alpha‐hemolytic Streptococcus, not S pneumoniae Arthrobacter oxydans Actinomyces cardiffensis Arachnia propionica Arthrobacter pascens Actinomyces dentalis Arcanobacterium Arthrobacter polychromogenes Actinomyces dentocariosus Arcanobacterium bernardiae Arthrobacter protophormiae Actinomyces DO8 Arcanobacterium haemolyticum Arthrobacter psychrolactophilus Actinomyces europaeus Arcanobacterium pluranimalium Arthrobacter psychrophenolicus Actinomyces funkei Arcanobacterium pyogenes Arthrobacter ramosus Actinomyces georgiae Arthrobacter Arthrobacter rhombi Actinomyces gerencseriae Arthrobacter agilis Arthrobacter roseus Actinomyces gerenseriae Arthrobacter albus Arthrobacter russicus Actinomyces graevenitzii Arthrobacter arilaitensis Arthrobacter scleromae Actinomyces hongkongensis Arthrobacter astrocyaneus Arthrobacter sulfonivorans Actinomyces israelii Arthrobacter atrocyaneus Arthrobacter sulfureus Actinomyces israelii serotype II Arthrobacter aurescens Arthrobacter uratoxydans Actinomyces meyeri Arthrobacter bergerei Arthrobacter ureafaciens Actinomyces naeslundii Arthrobacter chlorophenolicus Arthrobacter variabilis Actinomyces nasicola Arthrobacter citreus Arthrobacter viscosus Actinomyces neuii Arthrobacter creatinolyticus Arthrobacter woluwensis Actinomyces odontolyticus Arthrobacter crystallopoietes
    [Show full text]
  • Bacteriology
    SECTION 1 High Yield Microbiology 1 Bacteriology MORGAN A. PENCE Definitions Obligate/strict anaerobe: an organism that grows only in the absence of oxygen (e.g., Bacteroides fragilis). Spirochete Aerobe: an organism that lives and grows in the presence : spiral-shaped bacterium; neither gram-positive of oxygen. nor gram-negative. Aerotolerant anaerobe: an organism that shows signifi- cantly better growth in the absence of oxygen but may Gram Stain show limited growth in the presence of oxygen (e.g., • Principal stain used in bacteriology. Clostridium tertium, many Actinomyces spp.). • Distinguishes gram-positive bacteria from gram-negative Anaerobe : an organism that can live in the absence of oxy- bacteria. gen. Bacillus/bacilli: rod-shaped bacteria (e.g., gram-negative Method bacilli); not to be confused with the genus Bacillus. • A portion of a specimen or bacterial growth is applied to Coccus/cocci: spherical/round bacteria. a slide and dried. Coryneform: “club-shaped” or resembling Chinese letters; • Specimen is fixed to slide by methanol (preferred) or heat description of a Gram stain morphology consistent with (can distort morphology). Corynebacterium and related genera. • Crystal violet is added to the slide. Diphtheroid: clinical microbiology-speak for coryneform • Iodine is added and forms a complex with crystal violet gram-positive rods (Corynebacterium and related genera). that binds to the thick peptidoglycan layer of gram-posi- Gram-negative: bacteria that do not retain the purple color tive cell walls. of the crystal violet in the Gram stain due to the presence • Acetone-alcohol solution is added, which washes away of a thin peptidoglycan cell wall; gram-negative bacteria the crystal violet–iodine complexes in gram-negative appear pink due to the safranin counter stain.
    [Show full text]
  • Molecular Analysis of Streptococcus Anginosus -Derived Saga Peptides
    ANTICANCER RESEARCH 34: 4627-4632 (2014) Molecular Analysis of Streptococcus anginosus -derived SagA Peptides YUKI KAWAGUCHI1, ATSUSHI TABATA2, HIDEAKI NAGAMUNE2 and KAZUTO OHKURA1,3* 1Faculty of Pharmaceutical Sciences, Chiba Institute of Science, Choshi, Chiba, Japan; 2Department of Biological Science and Technology, Life System, Institute of Technology and Science, The University of Tokushima Graduate School, Tokushima, Tokushima, Japan; 3Graduate School of Pharmaceutical Sciences, Suzuka University of Medical Science Graduate School, Suzuka, Mie, Japan Abstract. Background: SagA1 and SagA2 molecules and gastrointestinal tract (4). It is generally considered that produced from beta-hemolytic Streptococcus anginosus they have relatively low pathogenic potential compared to subsp. anginosus are composed of a leader peptide and a other streptococci, in particular members of the Pyogenic propeptide, and their mature form has hemolytic activity as a group streptococci (PGS) such as S. pyogenes (SPy, also well-known Streptococcal peptide toxin, streptolysin. The designated as Group A streptococci, GAS). However, SAA function of these SagA molecules is thought to be dependent is being increasingly recognized as a pathogen that is able to on intra-molecular heterocycle formation. In this study, we cause a wide range of purulent infections that commonly examined the heterocycle-involved molecular features of manifest as abscess formation, and SAA presence has been SagA1, SagA2, and S. pyogenes SagA (SPySagA), focusing detected in esophageal cancer (5, 6). The awareness of the on their heterocycle formation. Materials and Methods: clinical importance of SAA has increased, but the molecular Molecular models of SagA1, SagA2, and SPySagA were basis of the pathogenicity of this species has not been clearly constructed using a molecular modeling technique.
    [Show full text]
  • Db20-0503.Full.Pdf
    Page 1 of 32 Diabetes Analysis of the Composition and Functions of the Microbiome in Diabetic Foot Osteomyelitis based on 16S rRNA and Metagenome Sequencing Technology Zou Mengchen1*; Cai Yulan2*; Hu Ping3*; Cao Yin1; Luo Xiangrong1; Fan Xinzhao1; Zhang Bao4; Wu Xianbo4; Jiang Nan5; Lin Qingrong5; Zhou Hao6; Xue Yaoming1; Gao Fang1# 1Department of Endocrinology and Metabolism, Nanfang Hospital, Southern Medical University, Guangzhou, China 2Department of Endocrinology, Affiliated Hospital of Zunyi Medical College, Zunyi, China 3Department of Geriatric Medicine, Xiaogan Central Hospital, Xiaogan, China 4School of Public Health and Tropic Medicine, Southern Medical University, Guangzhou, China 5Department of Orthopaedics & Traumatology, Nanfang Hospital, Southern Medical University, Guangzhou, China 6Department of Hospital Infection Management of Nanfang Hospital, Southern Medical University, Guangzhou, China *Zou mengchen, Cai yulan and Hu ping contributed equally to this work. Running title: Microbiome of Diabetic Foot Osteomyelitis Word count: 3915 Figures/Tables Count: 4Figures / 3 Tables References: 26 Diabetes Publish Ahead of Print, published online August 14, 2020 Diabetes Page 2 of 32 Keywords: diabetic foot osteomyelitis; microbiome; 16S rRNA sequencing; metagenome sequencing #Corresponding author: Gao Fang, E-mail: [email protected], Tel: 13006871226 Page 3 of 32 Diabetes ABSTRACT Metagenome sequencing has not been used in infected bone specimens. This study aimed to analyze the microbiome and its functions. This prospective observational study explored the microbiome and its functions of DFO (group DM) and posttraumatic foot osteomyelitis (PFO) (group NDM) based on 16S rRNA sequencing and metagenome sequencing technologies. Spearman analysis was used to explore the correlation between dominant species and clinical indicators of patients with DFO.
    [Show full text]
  • Type of the Paper (Article
    Supplementary Materials S1 Clinical details recorded, Sampling, DNA Extraction of Microbial DNA, 16S rRNA gene sequencing, Bioinformatic pipeline, Quantitative Polymerase Chain Reaction Clinical details recorded In addition to the microbial specimen, the following clinical features were also recorded for each patient: age, gender, infection type (primary or secondary, meaning initial or revision treatment), pain, tenderness to percussion, sinus tract and size of the periapical radiolucency, to determine the correlation between these features and microbial findings (Table 1). Prevalence of all clinical signs and symptoms (except periapical lesion size) were recorded on a binary scale [0 = absent, 1 = present], while the size of the radiolucency was measured in millimetres by two endodontic specialists on two- dimensional periapical radiographs (Planmeca Romexis, Coventry, UK). Sampling After anaesthesia, the tooth to be treated was isolated with a rubber dam (UnoDent, Essex, UK), and field decontamination was carried out before and after access opening, according to an established protocol, and shown to eliminate contaminating DNA (Data not shown). An access cavity was cut with a sterile bur under sterile saline irrigation (0.9% NaCl, Mölnlycke Health Care, Göteborg, Sweden), with contamination control samples taken. Root canal patency was assessed with a sterile K-file (Dentsply-Sirona, Ballaigues, Switzerland). For non-culture-based analysis, clinical samples were collected by inserting two paper points size 15 (Dentsply Sirona, USA) into the root canal. Each paper point was retained in the canal for 1 min with careful agitation, then was transferred to −80ºC storage immediately before further analysis. Cases of secondary endodontic treatment were sampled using the same protocol, with the exception that specimens were collected after removal of the coronal gutta-percha with Gates Glidden drills (Dentsply-Sirona, Switzerland).
    [Show full text]
  • CGM-18-001 Perseus Report Update Bacterial Taxonomy Final Errata
    report Update of the bacterial taxonomy in the classification lists of COGEM July 2018 COGEM Report CGM 2018-04 Patrick L.J. RÜDELSHEIM & Pascale VAN ROOIJ PERSEUS BVBA Ordering information COGEM report No CGM 2018-04 E-mail: [email protected] Phone: +31-30-274 2777 Postal address: Netherlands Commission on Genetic Modification (COGEM), P.O. Box 578, 3720 AN Bilthoven, The Netherlands Internet Download as pdf-file: http://www.cogem.net → publications → research reports When ordering this report (free of charge), please mention title and number. Advisory Committee The authors gratefully acknowledge the members of the Advisory Committee for the valuable discussions and patience. Chair: Prof. dr. J.P.M. van Putten (Chair of the Medical Veterinary subcommittee of COGEM, Utrecht University) Members: Prof. dr. J.E. Degener (Member of the Medical Veterinary subcommittee of COGEM, University Medical Centre Groningen) Prof. dr. ir. J.D. van Elsas (Member of the Agriculture subcommittee of COGEM, University of Groningen) Dr. Lisette van der Knaap (COGEM-secretariat) Astrid Schulting (COGEM-secretariat) Disclaimer This report was commissioned by COGEM. The contents of this publication are the sole responsibility of the authors and may in no way be taken to represent the views of COGEM. Dit rapport is samengesteld in opdracht van de COGEM. De meningen die in het rapport worden weergegeven, zijn die van de auteurs en weerspiegelen niet noodzakelijkerwijs de mening van de COGEM. 2 | 24 Foreword COGEM advises the Dutch government on classifications of bacteria, and publishes listings of pathogenic and non-pathogenic bacteria that are updated regularly. These lists of bacteria originate from 2011, when COGEM petitioned a research project to evaluate the classifications of bacteria in the former GMO regulation and to supplement this list with bacteria that have been classified by other governmental organizations.
    [Show full text]
  • Complicated Pneumonia with Empyema Caused by Streptococcus Anginosus in a Child
    CASE REPORT http://dx.doi.org/10.1590/1984-0462/2020/38/2018258 COMPLICATED PNEUMONIA WITH EMPYEMA CAUSED BY STREPTOCOCCUS ANGINOSUS IN A CHILD Pneumonia complicada com derrame pleural causada por Streptococcus anginosus em uma criança Ana Reis-Meloa,* , Diana Soaresb , Manuel Ferreira Magalhãesa , Catarina Ferraza , Luísa Vaza ABSTRACT RESUMO Objective: To highlight the pathogenicity of Streptococcus Objetivo: Alertar para a patogenicidade do Streptococcus anginosus anginosus, which is rare in pediatric patients, but can cause que, apesar de raro em pediatria, pode causar infeções graves severe infections that are known to have a better outcome when que necessitam de tratamento invasivo e antibioterapia de longo treated early with interventional procedures and prolonged curso para obter um melhor prognóstico. antibiotic therapy. Descrição do caso: Criança de seis anos, com atraso do Case description: The patient is a 6-year-old boy with global desenvolvimento psicomotor, avaliado no serviço de urgência developmental delay, examined in the emergency room due por febre e dificuldade respiratória. O exame físico, juntamente to fever and respiratory distress. The physical examination com os exames complementares, revelou uma pneumonia and diagnostic workout revealed complicated pneumonia complicada com empiema no hemitórax esquerdo, tendo with empyema of the left hemithorax; he started antibiotic iniciado antibioterapia e sido submetido à drenagem do líquido therapy and underwent thoracic drainage. Pleural fluid cultures pleural. Foi identificado Streptococcus anginosus nesse líquido. grew Streptococcus anginosus. On day 11, the child had a No 11º dia de doença, a criança agravou o seu estado clínico, clinical deterioration with recurrence of fever, hypoxia, and com recidiva da febre, hipoxemia e dificuldade respiratória.
    [Show full text]
  • Streptococcus Laboratory General Methods
    The reference used for compiling the methods in Section I is: Murray, P.R., Baron, E. J., Jorgensen, J.J., Pfaller, M.A., and Yolken, R.H. Manual of Clinical Microbiology, 8th ed. ASM Press: Washington, DC, 2003. The Streptococcus species identification methods in Section II were compiled by Dr. Lynn Shewmaker. Also thanks to input from several individuals, including Richard Facklam and Lucia Teixeira. Section I. 1. Accuprobe-Enterococcus Test………….………..4 2. Accuprobe-Pneumococcus Test …………..….….4 3. Acid formation in carbohydrate broth..................5 4. Arginine Hydrolysis……………………….……….6 5. Bacitracin Test……………………………………..7 6. Bile-esculin Test…………………………………...8 7. Bile solubility Test …………………………………9 8. CAMP Test…......................................................10 9. Catalase Test......................................................11 10. Clindamycin test………………………………….12 11. Esculin hydrolysis……………………………….. 13 12. Gas from MRS broth……………………………...14 13. Gram Stain………………………………………...15 14. Growth at 10 & 45C……………………………. 17 15. Hemolysis………………………………………….18 16. Hippurate hydrolysis…………………………… 19 17. Lancefield Group Antigen………………………..20 18. Leucine amino peptidase (LAP)…………………21 19. Litmus Milk Test…………………………………..22 20. Motility………………………………………………23 21. 6.5% NaCl Tolerace Test...................................24 22. Optochin…………………………………………….25 23. Pigmentation....................................................... 26 24. Pyridoxal Requirement Test (Vitamin B6)……….27 25. Pyrrolidonlarylamindase (PYR)............................28 26.
    [Show full text]
  • Curated Annotation and Whole-Genome Comparat
    Olson et al. BMC Genomics 2013, 14:895 http://www.biomedcentral.com/1471-2164/14/895 RESEARCH ARTICLE Open Access Phylogenetic relationship and virulence inference of Streptococcus Anginosus Group: curated annotation and whole-genome comparative analysis support distinct species designation Adam B Olson1, Heather Kent1, Christopher D Sibley3, Margot E Grinwis3, Philip Mabon1, Claude Ouellette1, Shari Tyson1, Morag Graham1,2, Shaun D Tyler1, Gary Van Domselaar1,2, Michael G Surette3,4* and Cindi R Corbett1,2* Abstract Background: The Streptococcus Anginosus Group (SAG) represents three closely related species of the viridans group streptococci recognized as commensal bacteria of the oral, gastrointestinal and urogenital tracts. The SAG also cause severe invasive infections, and are pathogens during cystic fibrosis (CF) pulmonary exacerbation. Little genomic information or description of virulence mechanisms is currently available for SAG. We conducted intra and inter species whole-genome comparative analyses with 59 publically available Streptococcus genomes and seven in-house closed high quality finished SAG genomes; S. constellatus (3), S. intermedius (2), and S. anginosus (2). For each SAG species, we sequenced at least one numerically dominant strain from CF airways recovered during acute exacerbation and an invasive, non-lung isolate. We also evaluated microevolution that occurred within two isolates that were cultured from one individual one year apart. Results: The SAG genomes were most closely related to S. gordonii and S. sanguinis, based on shared orthologs and harbor a similar number of proteins within each COG category as other Streptococcus species. Numerous characterized streptococcus virulence factor homologs were identified within the SAG genomes including; adherence, invasion, spreading factors, LPxTG cell wall proteins, and two component histidine kinases known to be involved in virulence gene regulation.
    [Show full text]
  • WO 2014/176068 A2 30 October 2014 (30.10.2014) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2014/176068 A2 30 October 2014 (30.10.2014) P O P C T (51) International Patent Classification: (81) Designated States (unless otherwise indicated, for every A61K 38/14 (2006.01) kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, (21) International Application Number: BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, PCT/US20 14/034083 DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, (22) International Filing Date: HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, 15 April 2014 (15.04.2014) KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, (25) Filing Language: English OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (26) Publication Language: English SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, (30) Priority Data: ZW. 61/814,577 22 April 2013 (22.04.2013) US 61/841,368 30 June 2013 (30.06.2013) US (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (71) Applicant: THE MEDICINES COMPANY [US/US]; 8 GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ, TZ, Sylvan Way, Parsippany, New Jersey 07054 (US).
    [Show full text]
  • 4 the Genus Streptococcus J .M
    4 The genus Streptococcus J .M. HARDIE and R.A. WHILEY 4.1 Introduction The genus Streptococcus consists of Gram-positive, spherical or ovoid cells that are typically arranged in chains or pairs. These cocci are facultatively anaerobic, non-sporing, catalase-negative, homofermentative, and have complex nutritional requirements. Many of the known species are parasitic in man or other animals and some are important pathogens (Jones, 1978; Hardie, 1986; Colman, 1990). Chain-forming cocci were observed in wounds by Billroth (1874) and he applied the term 'streptococcos' to such organisms to designate their morphological arrangement (Jones, 1978). A few years later, Rosenbach (1884) first used the word Streptococcus in the generic sense and described the species Streptococcus pyogenes which is now the type species of the genus. This species was originally isolated from suppurative lesions in humans. Subsequently, in early studies by Nocard and Mollereau (1887), Schutz (1887, 1888) and Talamon (1883) - cited by Colman (1990) - several other varieties of streptococci were isolated from different sources, including S. agalactiae from cows with mastitis and streptococci from both equine and human cases of pneumonia. During the period around the turn of the last century, the association between streptococci and a variety of human and animal diseases was established. Around this time the importance of morphologically similar bacteria, then classified as streptococci, in the dairy industry was also recognized. Thus, by the 1930s a large number of Streptococcus-like bacteria had been described and a multiplicity of names existed in the published literature. Despite numerous attempts over the years, as outlined below, it is only comparatively recently that the classification of these clinically and industrially important bacteria has been brought to a more generally acceptable level, although uncertainties remain in a few areas.
    [Show full text]
  • ID 4 | Issue Number: 4 | Issue Date: 22 September 21 | Page: 1 of 31
    UK Standards for Microbiology Investigations Identification of Streptococcus species, Enterococcus species and morphologically similar organisms This publication was created by Public Health England (PHE) in partnership with the NHS. Issued by the Standards Unit, National Infection Service, PHE Identification | ID 4 | Issue number: 4 | Issue date: 22 September 21 | Page: 1 of 31 © Crown copyright 2021 Identification of Streptococcus species, Enterococcus species and morphologically similar organisms Acknowledgments UK Standards for Microbiology Investigations (UK SMIs) are developed under the auspices of PHE working in partnership with the National Health Service (NHS), Public Health Wales and with the professional organisations whose logos are displayed below and listed on the UK SMI website. UK SMIs are developed, reviewed and revised by various working groups which are overseen by a steering committee (see the steering committee page on GOV.UK). The contributions of many individuals in clinical, specialist and reference laboratories who have provided information and comments during the development of this document are acknowledged. We are grateful to the medical editors for editing the medical content. PHE publications gateway number: GOV-8348 UK Standards for Microbiology Investigations are produced in association with: Identification | ID 4 | Issue number: 4 | Issue date: 22 September 21 | Page: 2 of 31 UK Standards for Microbiology Investigations | Issued by the Standards Unit, Public Health England Identification of Streptococcus
    [Show full text]