sign in sign up
<<
Home , AP3B2, BLZF1, NSP4 (rotavirus), Rotavirus

STUDIES OF RETROVIRAL VECTORS FOR IN UTERO TRANSFER

AND INVESTIGATION OF -MEDIATED GENE REGULATION BY

HUMAN T-LYMPHOTROPIC TYPE-1

DISSERTATION

Presented in Partial Fulfillment of the Requirements for

the Degree Doctor of Philosophy in the Graduate

School of The Ohio State University

By

Amrithraj M. Nair B.V.Sc & A.H.

* * * * *

The Ohio State University

2004

Dissertation Committee:

Professor Michael D. Lairmore, Adviser Approved by

Professor Patrick Green

Professor Natarajan Muthusamy ______

Professor Stefan Niewiesk Adviser

Professor Bruce A. Bunnell Veterinary Biosciences Graduate program

ABSTRACT

Retrovirus-derived vectors provide efficient means of gene transfer and are potential excellent tools for therapeutic intervention against congenital or inherited disorders by in utero gene therapy and for gene transfer into dividing cells both in vitro and in vivo. To improve biodistribution of retroviral gene transfer vectors and to obtain efficient gene transfer towards hematopoietic stem cells via pre-natal administration, we performed in utero administration of retroviral vectors pseudotyped with different retroviral and non-retroviral envelope . RD114 envelope enhanced the gene transfer ability of retroviral vectors to peripheral blood, thymus, kidney and brain, while amphotropic envelope pseudotyped vectors had significantly higher gene transfer to thymus, spleen, kidney, brain and gonads. The ability of retroviral vectors to transduce myeloid progenitors was highest for ecotropic envelope pseudotype followed by amphotropic, RD114, VSV-G, GALV and . Gene transfer to erythroid progenitors was more efficient with ecotropic pseudotype followed by RD114, VSV-G,

GALV, amphotropic and rabies. Although there was a significant reduction in the percentage of colonies containing the transgene 3 months postnatally irrespective of the pseudotype, high level (40%-58%) of was observed in both erythroid

ii and myeloid colonies. We then used HIV-1 derived lentiviral vectors to investigate the role of T-lymphotropic virus type-1 (HTLV-1) accessory p12I in .

HTLV-1 is the etiologic agent of adult T-cell leukemia/lymphoma, an aggressive

CD4+ T-lymphocyte malignancy. Activation of T-lymphocytes is required for effective infectivity, but the molecular mechanisms involved in HTLV-1 mediated T-cell activation remain unclear. HTLV-1 encodes various accessory from the pX region of the such as p12I. We have earlier demonstrated that p12I localizes in the , increases intracellular calcium, activates nuclear factor of activated T cells-mediated transcription and is critical for HTLV-1 infectivity in vivo and in vitro. To further elucidate the role of p12I in regulation of cellular gene expression, we performed gene array analysis on stable p12I expressing Jurkat T-cells.

Our data indicates that p12I altered the expression of associated with a network of interrelated pathways including T-cell signaling, cell proliferation and apoptosis.

Expression of several calcium regulated genes was found to be altered by p12I, consistent with known properties of the . Gene array findings were confirmed by semi-quantitative RT-PCR in Jurkat T-cells and primary CD4+ T- lymphocytes. Furthermore, -dependent expression of p12I in Jurkat T cells resulted in significant increases of p300 and p300 dependent transcription.

iii To further characterize the mechanism by which p12I upregulates p300, we demonstrated that expression of p300 is modulated by p12I in a calcium-dependent, but calcineurin-independent manner in T-lymphocytes. We also provide data to show that sustained low magnitude calcium release results in increased RNA and protein levels of p300 in T-lymphocytes. Calcium-responsive p300-mediated transcription was completely inhibited by the p300-binding protein, adenovirus E1A and E1A∆CR2

(mutated for retinoblastoma binding, but retaining p300 binding). In contrast,

E1A∆CR1 (mutated for p300 binding) failed to inhibit p300-dependent transcription mediated by calcium. In addition, using an ER-localization deficient mutant of p12I, we demonstrate that ER localization of p12I is required for its ability to increase p300.

Collectively, data provided in this thesis indicates that retroviral vectors can be improved to provide effective tools for gene delivery. Using this approach HTLV-1 p12I was demonstrated to modulate cellular gene expression patterns to hasten the activation of T lymphocytes and also enhances the expression of a rate limiting co- adaptor p300 in a calcium-dependent manner. These findings provide important insights into the mechanisms whereby HTLV-1 promotes lymphocyte proliferation to enhance viral infectivity and clonal expansion of its genome during cell division.

iv

Dedicated to Bindhu, My wonderful wife, who is always there for me and helps me

progress through the harsh roads in life

and

Vavlo

v ACKNOWLEDGMENTS

First and foremost, I would like to express my gratitude to my thesis advisor, Dr.

Michael Lairmore for his valuable guidance and support. His offer to join his laboratory provided me the perfect opportunity and environment to fulfill my career goals. I highly appreciate his support and commitment to instruct me to reach my academic level. I am also very thankful that he helped me develop the ability of scientific independence that will unlimitedly benefit my future career in every aspect. Moreover, he was gracious enough to support me through my Pathology Training.

I would like to thank my committee members Dr. Patrick Green, Dr. Natarajan

Muthusamy, Dr. Stefan Niewiesk and Dr. Bruce Bunnell for their helpful ideas and suggestions. I would like to express my gratitude to other members of the center for research, Drs. Larry Mathes and Kathleen Boris-Lawrie, who have helped me on my projects. I would like to extend my sincere appreciation to Dr. Weisbrode, a member of my candidacy exam committee and a great teacher during my Pathology residency training. I would also like thank Dr. Louis Mansky, a member of my candidacy exam committee.

I would like to thank all my colleagues, Hajime Hiraragi, Wei Ding, Antara

Datta, Andrew Phipps, Lee Silverman, Seung-Jae Kim, Chris Premandandan, Rashade

vi Haynes, Andy Montgomery, John Nisbet and Laurie Millward for their helpful ideas, productive scientific discussions and great times shared together. I am privileged to have to friends outside the lab like David, Tanya, Stan, Jordan, Rachelmol, Thomas and

George, who made my life in Columbus worthwhile.

I could not have been where I am today, without the single most important person in my life, Bindhu, my wonderful wife, friend and colleague, who always finds time to direct me in the right direction. I am fortunate to have found Vavlo (thanks to

Cynthia Segal), who makes even the smallest things in life enjoyable.

vii VITA

November, 10th, 1974------Born – Kerala, India

1990 - 1992 ------Pre-Degree- , Chemistry, Physics University of Calicut, Trichur, Kerala, India

1992 -1998 ------BVSc and AH (DVM equivalent) Kerala Agricultural University, India

1998 - 1999 ------Teaching Associate Department of Veterinary Preventive medicine Kerala Agricultural University, India

1999 -1999 ------Research Associate, Royal Veterinary College, University of London, UK

1999 - 1999 ------Research Associate, Natural History Museum, London, UK

2000 – present ------Graduate Research Associate Department of Veterinary Biosciences The Ohio State University, Columbus, Ohio

PUBLICATIONS Research Publications

1. Ding, W., Kim, S., Nair, A., Michael, B., Boris-lawrie, K., Tripp, A., Feuer G and Lairmore, M. Human T-Lymphotropic Virus Type-1 p12I Enhances Interleukin-2 Production during T Cell Activation. Journal of Virology. 77: 11027-11039, 2003

2. Amrithraj, M., Bindhu Michael and Madhavan Pillai, K. Artyfechinostomum malayanum (Leiper, 1911) Mendheim, 1943 from a Small Indian Civet (Viverricula indica). Zoo's Print. 14: 6, 1999

viii 3. Bindhu Michael, M. Amrithraj and K. Madhavan Pillai. A Note on Isospora in a Southern Red Whiskered Bulbul (Pycnonotus jocosus fascicaudatus). Zoo’s Print. 12: 5, 1997.

4. Bindhu Michael, Amrithraj M, Sajan George and P. J. Rajkamal. Case Study of a Specialised Buffalo Farmer in the Foot-hills of Western Ghats. Dairy Guide. 18: 13-14, 1997.

5. Amrithraj M, Gigi. K. Joseph and Francis Xavier: Morphometry of Painted Bat. Zoo’s Print. 13: 4-5, 1996.

Review Publications

1. Bindhu Michael, Amrithraj M. Nair and Michael D. Lairmore. Role of Accessory Proteins of HTLV-1 in Viral Replication, T Cell Activation, and Cellular Gene Expression. Frontiers in Bioscience. 9: 2556-2576, 2004.

FIELDS OF STUDY

Major Field: Veterinary Biosciences

ix TABLE OF CONTENTS

Page Abstract------ii

Dedication ------v

Acknowledgments ------vi

Vita------viii

List of Tables ------xiii

List of Figures ------xiv

Chapters:

1. Literature Review: Studies of retroviral vectors for in utero gene transfer and investigation of calcium-mediated gene regulation by human T-lymphotropic virus type-1 ------1

1.1 Basic Components of Retroviral Vectors ------2 1.2 Modifications of Retroviral Vectors for Improved Gene Transfer and Expression------5 1.3 Retroviral Vectors and In-utero Gene Transfer ------6 1.4 Retroviral Vectors and Gene Transfer to Lymphocytes------8 1.5 Human T-Lymphotropic Virus Type-1------9 1.6 Geographical Distribution and of HTLV-1 ------10 1.7 Adult T cell Leukemia / Lymphoma------11 1.8 Tropical Spastic Paraparesis / HTLV-1-Associated Myelopathy (TSP/HAM) ------14

x 1.9 Other Diseases Associated with HTLV-1-Infection ------15 1.10 HTLV-1Genome Organization and Replication ------16 1.11 Structural and Regulatory Proteins of HTLV-1 ------19 1.12 HTLV-1 Accessory Proteins------22 1.12.1 pX ORF II p13II ------24 1.12.2 pX ORF II p30II ------25 1.12.3 pX ORF I p12I------27 1.13 Role of p12I in Viral Infectivity in vitro and in vivo------30 1.14 Role of p12I in Calcium-Mediated T Cell Signaling ------31 1.15 Role of p12I in the Development of HAM/TSP------35 1.16 Regulation of p300 Through Calcium ------36 1.17 References------40

2. Effect of pseudotyping on in utero Gene Transfer Efficiency, Biodistribution, and Hematopoietic Stem Cell Directed Transgene Expression of Recombinant -derived Vector System in Fetal Mice ------78

2.1 Introduction ------78 2.2 Materials and Methods ------82 2.3 Results and Discussion ------87 2.4 References------103

3. Human T Lymphotropic Virus Type 1 Accessory Protein p12I Modulates Cellular Gene Expression and Enhances p300 Expression in T-Lymphocytes------128

3.1 Introduction ------128 3.2 Materials and Methods ------131 3.3 Results ------137 3.4 Discussion------147 3.5 References------153

xi 4. Calcium-dependent Enhanced Transcription of p300 by Human T-Lymphotropic Virus Type-1 p12I ------190

4.1 Introduction ------190 4.2 Materials and Methods ------193 4.3 Results ------198 4.4 Discussion------204 4.5 References------209

5. Synopsis and Future Directions ------221

5.1 Improved retroviral vectors for lineage-specific gene expression in hematopoietic cells------223 5.2 Further characterization of p12I mediated enhancement of p300 expression ------224 5.3 Is p12I virion-associated or selectively expressed before viral integration?------225 5.4 Temporal expression pattern and interaction between HTLV-1 regulatory and accessory proteins during various stages of HTLV-1 infection --- 226 5.5 Does p12I affect cell cycle progression in T lymphocytes?------227 5.6 Does p12I affect apoptosis in T lymphocytes? ------228 5.7 Does p12I affect cell to cell adhesion between T lymphocytes? ------228 I I 5.8 Does p12 interact with IP3R and how does p12 affect the ER store calcium release? ------229 5.9 References------232

Bibliography ------237

xii LIST OF TABLES

Table Page

2.1 Viability of murine fetuses injected with recombinant retroviral vectors------111

3.1 Genes modulated by HTLV-1 p12I ------160

xiii LIST OF FIGURES

Figure Page

1.1 Schematic illustration of a simple retrovirus genome ------74

1.2 Schematic illustration of the retroviral vector system ------75

1.3 Schematic illustration of HTLV-1 genome ------76

1.4 Schematic illustration of HTLV-1 accessory proteins p12I, p30II and p13II ------77

2.1 Standard curve for semi-quantitative detection of gene transfer ------112

2.2 Efficiency of gene transfer towards peripheral blood on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins------113

2.3 Efficiency of gene transfer towards bone marrow on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins------114

2.4 Efficiency of gene transfer towards heart on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins------115

2.5 Efficiency of gene transfer towards lungs on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins------116

2.6 Efficiency of gene transfer towards thymus on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins------117

xiv

2.7 Efficiency of gene transfer towards spleen on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins------118

2.8 Efficiency of gene transfer towards liver on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins------119

2.9 Efficiency of gene transfer towards kidney on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins------120

2.10 Efficiency of gene transfer towards skeletal muscle on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins------121

2.11 Efficiency of gene transfer towards brain on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins------122

2.12 Efficiency of gene transfer towards gonads on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins------123

2.13 Efficiency of gene transfer towards hematopoietic progenitor cells at 1 month of age on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins ------124

2.14 Efficiency of gene transfer towards hematopoietic progenitor cells at 3 month of age on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins ------125

2.15 Temporal reduction in hematopoietic progenitor cell directed gene transfer------126

xv 2.16 Expression of β-galactosidase in hematopoietic progenitor cells 3 month post-natally------127

3.1 Stable expression of HTLV-1 p12I in Jurkat T-lymphocytes using lentiviral vectors------180

3.2 Modulation of the expression of genes associated with apoptosis by HTLV-1 p12I ------181

3.3 Modulation of the expression of genes associated with T-cell proliferation by HTLV-1 p12I ------182

3.4 Modulation of the expression of genes associated with T lymphocyte siganling by HTLV-1 p12I ------183

3.5 Modulation of the expression of genes associated with immune response by HTLV-1 p12I------184

3.6 Modulation of the expression of genes associated with cell adhesion by HTLV-1 p12I ------185

3.7 Semiquantitative RT-PCR and densitometric analysis of selected genes in controls and p12I expressing Jurkat T-lymphocytes------186

3.8 Semiquantitative RT-PCR and densitometric analysis of selected genes in controls and p12I expressing primary CD4+ T-lymphocytes------187

3.9 Schematic illustration of functional gene expression analysis ------188

3.10 HTLV-1 p12I enhances p300-dependent VP16 mediated transcription------189

4.1 HTLV-1 p12I enhances p300 protein levels in Jurkat T lymphocytes ------214

xvi 4.2 Sustained low magnitude increase in intra cellular calcium concentration enhances transcription of p300 ------215

4.3 Enhanced mRNA levels of p300 correlates with increased protein levels of p300------216

4.4 Ionomycin mediated increase in p300 levels is significant for its function as a transcriptional co-activator------217

4.5 Enhanced expression of p300 is calcium-dependent, but calcineurin-independent ------218

4.6 Binding of p12I to ER is required for enhanced expression of p300 ------219

4.7 HTLV-1 p12I partially inhibits the transcriptional repression of p30II on HTLV-1 LTR ------220

xvii

CHAPTER 1

LITERATURE REVIEW

STUDIES OF RETROVIRAL VECTORS FOR IN UTERO GENE TRANSFER

AND INVESTIGATION OF CALCIUM-MEDIATED GENE REGULATION BY

HUMAN T-LYMPHOTROPIC VIRUS TYPE-1

Novel methods have been developed for efficient gene transfer to cells both in vivo and in vitro. Employing viral vectors for gene transfer is a relatively recent concept and useful viral vectors have been generated from a number of different virus families, including adenoviruses, herpesviruses, adeno-associated and

65,36,105,294. Adenovirus-based vectors have the potential to transfer up to 30 kb of DNA and they generate very high-titer viruses that can infect nondividing cells. However, they do not integrate into the host cell genome and gene expression is transient.

Furthermore, these viral vectors elicit a very strong immune response36. Herpesvirus- based vectors have the potential to transfer slightly larger amounts of DNA105. Both adenoviral and herpesviral vectors require multiple experimental steps to generate infectious viral particles. Vectors derived from adeno-associated viruses (AAV) are

1 easier to manipulate 294. In addition, they transduce non-dividing cells and are capable of integrating into the host cell genome. The major limitation is that AAV based vectors can only transfer up to 4 kB of foreign DNA. Among these viral vectors, recombinant retroviral vector mediated gene transfer has been extensively studied. Oncoretrovirus- derived recombinant vectors provide efficient means of gene transfer and are comprehensively used in gene therapy trials as as in molecular and cellular biology research. These vectors are ideal tools for gene delivery into dividing cells both in vitro and in vivo 312. They are easy to manipulate and provide stable, long-term gene expression because of the unique ability to integrate into the genome of the host cell. In addition, retroviral vectors can carry relatively large transgenes up to 10 kilobase pairs

(kb) in size. The major advantages of retroviral vectors are that they are relatively less complicated, they integrate into the target cell genome and they do not induce a strong immune response 65. Although initially developed with gene therapy applications in mind, retroviral vectors have proven to be useful and efficient tools to study gene function in various cell cultures and organ systems.

1.1 Basic Components of Retroviral Vectors

Retroviral vectors can be broadly classified into two categories, replication- competent and replication-defective 312. The proviral genome of replication-competent vectors contains all the components required for viral replication, integration and production of new virions. The replication-defective viral vectors lack one or more nucleotide elements including genes necessary for replication and generation of new

2 virions. The replication-competent vectors spread out from the point of injection while the replication-incompetent vectors infect cells locally and are able to complete only a single round of the replication. Replication-defective, vectors are preferred for various reasons including safety of use 312. It is important to understand the genetic organization of retroviruses in order to develop a better replication-defective vector from the parental retrovirus. Retroviruses are enveloped positive-sense RNA viruses with a diploid genome that replicate through a DNA intermediate 65. The viral core contains a nucleoprotein complex composed of two copies of the RNA genome along with proteins such as and . The envelope is made of a lipid membrane obtained while budding, which contains oligomeric complexes made up of surface (SU) and trnasmembrane (TM) subunits. Initial steps of infection by retroviruses occur through a specific binding between envelope glycoproteins and its cellular (s). Once the retrovirus enters the cytoplasm, genomic RNA is reverse- transcribed into DNA. This double stranded DNA (provirus) traffics to the nucleus and randomly integrates into the host-cell genome. Once integrated, the provirus uses viral proteins as well as cellular transcription and translation machinery to express retroviral genes and generate new copies of the retroviral (RNA) genome. The newly synthesized retroviral proteins and genome assemble into new infectious viral particles that bud out through the plasma membrane of the infected cell.215.

The genome of simple retroviruses carry three structural genes, gag, and

(Fig. 1.1), which encode all the proteins required for reverse-transcription and integration of the retroviral genome (Pol), as well as the proteins that make up the

3 retroviral (Gag) and the envelope (Env). The retroviral genome also contains cis-acting elements necessary for viral replication (Fig.1.1) such as the long terminal repeats (LTRs), at 5’ and 3’ ends of the provirus. The promoters and enhancers for viral gene transcription are located in the U3 region of LTR. The R and U5 regions of LTR are required for reverse transcription and poly A modification of RNA transcripts. Other elements include the tRNA, primer-binding site (PBS), purine-rich region upstream of env known as the polypurine tract (PPT) and specific packaging signal, Ψ located between PBS and gag, which mediates the packaging of retroviral genomic RNA into the viral particle65. Generation of replication-incompetent retroviral vectors necessitates separation of the cis- and trans-acting sequences of the viral genome. In order to achieve this, gag, pol, and env genes are replaced with a foreign gene of interest, leaving cis-acting regions critical for reverse transcription, integration, transcription and encapsidation in the genome (Fig. 1.2) 215. Expression of gag, pol, and env genes in trans is provided from another plasmid or from packaging cell lines for the generation of recombinant viral particles containing the gene of interest. Extensive research for the development of better and more effective vector constructs has resulted in the generation of new vector systems. Viral vectors produced by trans- complementation can be used to infect and express a foreign gene in target cells.

Generally, marker genes such as green fluroscent protein (GFP) or β-galactosidase genes are used for screening and quantification of viral vectors. The foreign gene is expressed directly from the U3 located in the 5’ LTR of the vector construct or from an internal heterologus promoter. Two or more genes can be expressed from the same construct by use of an internal ribosome entry site (IRES) 1. Use of internal 4 heterologous promoters, often times results in enhanced foreign gene expression. These promoters typically include viral promoters such as immediate/ early promoter (CMV I/E), and cellular promoters such as elongation factor 1 α (EF1α).

1.2 Modifications of Retroviral Vectors for Improved Gene Transfer and

Expression.

Research has been centered around improving these vectors for more safe and effective gene transfer. The concept of modifying a virus, which is capable of causing terminal illness, for therapeutic gene transfer, is a topic of debate. Even though, the use of a heterologous promoter increases foreign gene expression, these alterations can decrease gene expression by an incompletely understood phenomenon called promoter interference 49. The interference in gene expression can be related to the precise or relative location of the promoters or even by the foreign gene itself 97,98. Efforts to overcome promoter interference using heterologous promoter or foreign gene cassette in an antisense orientation relative to LTRs has had limited success. Another improvement was the development of self-inactivating (SIN) vectors with an increased safety advantage and reduced promoter interference 388. SIN vectors are engineered to generate a defective provirus with an inactive promoter, following reverse transcription. The promoter activity of 5’LTR was abolished by constructing a defective U3 region at the

3’ end of the viral RNA. SIN vectors offer additional safety advantages by (a) reducing the chances of recombination and generation of a wild-type parental retrovirus and (b) by decreasing the chances of insertional mutagenesis after the integration of the

5 provirus 388. In order to obtain tissue specific expression of the foreign gene, tissue- specific internal promoter have been used in retroviral vectors359. A critical modification made in retroviral vectors is envelope substitution (pseudotyping), which is achieved by the use of envelope glycoproteins from other viruses, both within and outside the retrovirus family, along with a retroviral packaging plasmid devoid of env.

This modification relies on the interaction of with its cell surface receptor for efficient infectivity in the natural setting. In particular, pseudotyping of retroviral vectors with heterogeneous envelopes from viruses exhibiting increased tropism to certain tissues or organs offers a unique possibility for enhancing tissue specific gene transfer21,54,277. Envelope glycoproteins from different retroviruses such as gibbon ape leukemia virus (GALV), amphotropic MLV 300,301, ecotropic MLV 180, and feline endogenous retrovirus (RD114) 363 have been successfully used for envelope substitution of retroviral vectors. Envelopes from rhabdoviruses, such as vesicular stomatitis virus (VSV-G) and rabies have also been used for pseudotyping gene transfer vectors 231,256.

1.3 Retroviral Vectors and In-utero Gene Transfer

Retroviral vector mediated in utero gene therapy is considered to be an excellent tool for therapeutic intervention against congenital or inherited disorders. Moloney murine leukemia virus (MoMLV)-based retroviral vectors are attractive tools for in vivo gene transfer because of their ability to stably integrate into the host cell genome, resulting in sustained expression of the transgene 256,358. In addition, retroviral vectors

6 contain viral genes precluding de novo expression of potentially immunogenic viral proteins in transduced target cells 153. However, the cell division status of target cells is a critical determinant in the transduction with retroviral vectors, since nuclear import of pre-integration complex and subsequent integration of the provirus into the host genome is mitosis-dependent 48. However, due to the ability of fetal cells to proliferate at a high rate, mitosis-dependence does not limit the efficiency of retroviral vector mediated in utero gene transfer.

Novel methods that allow therapeutic intervention early in the development are necessary against genetic disorders, such as storage diseases, with an early onset and accelerated progression leading to irreparable tissue and organ damage. In utero gene transfer to the fetus is believed to allow correction of such genetic disorders, prior to the onset of disease and the development of tissue pathology. In utero administration of many viral vectors have been successful in obtaining relatively efficient gene transfer to fetal tissues in various animal models 194,290,291,321,337,339,347,348,382. In utero gene transfer to fetuses has several advantages over ex vivo gene therapy or in vivo gene delivery performed later in life. Unique features of fetal development, such as the higher proportion of stem cells, marked proliferation of stem cells and rapid organ system development with, support the amplification of genetically-modified cells and prolonged expression of the transgene product 44,92,322. In addition, gene transfer to fetuses, which are immunologically naïve, circumvents humoral and cell-mediated immune reactions to the vector and transgene product. Furthermore, exposure to vector or transgene products early in development results in sustained tolerance to foreign

7 allowing successful postnatal treatment 143. In addition, the small size of the fetus compared to that of the adult provides a stoichiometric advantage for optimizing the vector to target cell ratio, favoring increased compartmental and hematogenous distribution of the vector 219. The in utero transduction of fetal cells by direct injection of viral vectors has been previously described in several animal models60,91,193,194,214,235,290,336,337,348. Data presented in this thesis demonstrates that suitably pseudotyped MLV derived retroviral vectors can act as excellent gene delivery vehicles to various organ systems, via in utero gene transfer techniques. Our data also demonstrates successful gene transfer to both myeloid and erythroid colonies using these retroviral vectors. These studies have identified viral envelopes that provide relatively higher levels of gene transfer to specific organ systems and hematopoietic progenitors.

1.4 Retroviral Vectors and Gene Transfer to Lymphocytes

Although viral vectors were initially developed with gene therapy applications in mind, they are useful and efficient tools to study gene function in various cell types and organ systems. A number of retroviral vectors including human virus (HIV) - 1 derived lentiviral vectors have been developed for stable expression of foreign genes in primary murine, human and non-human primate B and T lymphocytes

40,187,256,356. Optimal infection of lymphocytes occurs when they are efficiently activated, which is usually achieved by mitogens such as phytohemagglutinin (PHA). These viral vectors have been extensively used to study the molecular pathogenesis of a variety of

8 viruses. Both retroviral 4,212,249,305 and lentiviral vectors 88,306,349have been previously used to investigate the molecular pathogenesis of human T-lymphotropic virus-1

(HTLV-1). In order to obtain a stable high-level expression for HTLV-1 accessory protein p12I, we developed a lentiviral vector system capable of efficient delivery of genes in T lymphocytes. Data presented in the following chapters demonstrate the successful use of recombinant lentiviral vectors in our efforts to elucidate the role of p12I in the pathogenesis of HTLV-1 infection.

1.5 Human T-Lymphotropic Virus Type-1

HTLV-1 was the first human retrovirus identified and was subsequently associated with disease141,385,386. Interestingly, HTLV-1 associated lymphoma was reported in 1977, prior to the isolation of the virus. A unique and aggressive CD4+ T cell malignancy was observed among patients diagnosed with lymphoid neoplasms in

Japan. The condition was termed adult T cell leukemia (ATLL) 246,333,353. In 1980,

Poisez, Gallo and their colleagues detected type C retrovirus particles, later named

HTLV-1, in T cell lymphoblastoid cell lines, HUT 102 and CTCL-3 and fresh peripheral blood lymphocytes from a patient with cutaneous T cell lymphoma (mycosis fungoides)287. This patient however had a clinical picture of widespread systemic involvement consistent with ATLL. Similar type C retroviral particles were demonstrated in cell lines, MT-1 and MT-2, established from patients diagnosed with

ATLL 142,386, 237-239,385. Additional sero-epidemiologic, genetic and molecular studies helped establish the association between ATLL and HTLV-1141,385,386.

9 1.6 Geographical Distribution and Transmission of HTLV-1

HTLV-1 sequences have been identified in a 1,500-year-old Andean mummy, demonstrating the ancient nature of HTLV-1 208. Infections with HTLV-1 have been reported from different parts of the world and it is estimated that 15 to 25 million people are infected worldwide 124. The virus is in southern Japan 141, the Caribbean 28, central Africa 313, Central and South America 232,299 and among some

Melanesian Islands in the Pacific basin 13. The seroprevalence of HTLV-1 varies between 0.1 % and 30 % of the population within endemic regions 124. The serious risk of HTLV-1 infection among susceptible groups has lead intervention policies such as blood donor screening to prevent HTLV-1 contaminated blood from entering the blood supply 70,95,103,250,252,253,317. HTLV-1 infection has also been reported from southern India, northern Iran and northern Australia further demonstrating its world-wide distribution 124.

HTLV-1 is a highly cell-associated virus and cell-cell contact between virus infected cells and target T cells is required for efficient transmission 380. The principal route of HTLV-1 transmission in endemic areas is from mother to child through breastfeeding by transfer of infected milk-borne lymphocytes 139,140. High HTLV-1 antibody titer, prolonged ruptured membranes during delivery, and low socioeconomic status are some of the maternal factors involved in increased risk of infection via this route369. Another route of HTLV-1 transmission is by exposure to infected blood or whole cell blood products 226. In fact, sharing of needles among intravenous drug users

10 is the most common cause of blood-to-blood transmission among susceptible populations in the United States 167,168. Transmission of the virus through infected blood products has been a major public health concern in endemic areas such as Japan

226,267. The sexual route of transmission is probably the least efficient mode of transmission, but has been reported 331. Male to female transmission of HTLV-1 is about four times as frequent as female to male transmission 331. Higher antibody levels against Tax proteins, penile sores/ulcers and diagnosis of syphilis are among risk factors involved in sexual transmission of the virus 251.

A variety of techniques have been developed for the detection of antibodies (Ab) reactive to HTLV-1 for diagnosis of the viral infection. Virtually all HTLV-1-antibody- positive individuals are also virus-positive. In the United States, linked immunosorbent assay (ELISA), which can either detect anti-HTLV-1 antibody in patient serum or viral (Ag) secreted by peripheral blood mononuclear cells

(PBMC) cultured ex vivo 9,192,343 for the diagnosis of HTLV-1, while in Japan, the particle agglutination assay is widely used for detection of HTLV-1 Ab. Subsequent confirmation techniques used include polymerase chain reaction (PCR) and Western blot assays 17.

1.7 Adult T cell Leukemia / Lymphoma

Adult T cell leukemia/lymphoma is an aggressive T cell malignancy characterized by monoclonal expansion of CD3+/CD4+/CD8-/CD25+/HLA-DR+ T cells 353. The etiological association between HTLV-1 and ATL is based on numerous

11 observations. Geographic areas with high incidence of ATLL were the same as those with high prevalence of HTLV-1 infection. HTLV-1 proviral DNA was consistently demonstrated in ATL neoplastic cells and all ATL patients have antibodies against

HTLV-1 376,378. In general, 1 to 5 % of the HTLV-1 infected individuals, who acquire the virus before the age of 20 develop ATL after a prolonged of around 20-30 years 62,378,379, 62,370 .

The clinical picture of ATLL is similar to non-Hodgkin’s lymphoma. Affected patients present with malaise, , lymphoadenopathy, hepatosplenomegaly, jaundice, drowsiness, weight loss, and opportunistic infections. These patients also exhibit a wide spectrum of cutaneous (from large nodules to plaques and ulcers on the limbs, trunk, or face) and lytic bone lesions. Opportunistic fungal infections such as

Pneumocystis carinii has been reported in some patients 368. ATLL patients are usually hypercalcemic, with high serum concentrations of lactate dehydrogenase and elevated serum levels of soluble interleukin-2 (IL-2) receptor α chain. Neoplastic T lymphocytes in ATLL patients have a characteristic convoluted multi-lobulated nuclei, which gives the appearance of “flower cells” 325. Diagnosis of ATLL includes specific parameters including sero-positive status for HTLV-1, marked leukocytosis, “flower cell” morphology of neoplastic T cells, T cell immunophenotyping, hypercalcemia, increased circulating levels of the IL-2 receptor α-chain (IL-2Rα/CD25) and elevated serum lactate dehydrogenase (LDL) levels325.

12 ATL is classified into four stages based on the clinical course of the disease namely , pre-leukemic, chronic or smoldering and acute 166,325,377. The chronic and acute stages of the disease are clinically apparent with characteristic clinical presentation. The chronic stage ATL is characterized by leukocytosis, while the acute stage is characterized by the presence of “flower cells”, skin lesions, lymphoadenopathy and hepatosplenomegaly 376,376,378.

Even though the development of ATL has been a topic of intense research, the molecular mechanisms involved in the process have not been completely elucidated.

Like other retroviruses, HTLV-1 infects target cells by interaction of viral envelope and cell surface receptor. Subsequent to uncoating and reverse transcription, the HTLV-1 provirus integrates into the host 244. Although HTLV-1 is capable of replication via reverse transcription, the principal mode of viral replication in vivo is by mitosis of infected cells. In ATL, the initial polyclonal expansion of infected cells is followed by a progression to oligoclonal and then to monoclonal proliferation in vivo, which is achieved while the cells become IL-2 independent 106,144,386. The long clinical latency and the small proportion of infected individuals developing ATL, strongly suggests the role of a series of cellular alterations or mutations in T cell transformation

121. HTLV-1 proteins Tax plays a critical role in transformation of infected lymphocytes by altering critical cellular activation and death pathways 121. However, the presence of defective proviruses in transformed cells, indicates the possibility of viral protein independent maintenance of the transformed phenotype 108,109,185.

13 1.8 Tropical Spastic Paraparesis / HTLV-1-Associated Myelopathy (TSP/HAM)

Gessain and colleagues first reported the association of Tropical Spastic

Paraparesis (TSP) with HTLV-1 infection in 1985 123. Another neurologic condition observed among HTLV-1-infected individuals, termed HTLV-1 Associated Myelopathy

(HAM), having similar clinical findings as TSP patients was reported by Osame et al

275. Subsequently, in 1988, the World Health Organization (WHO) declared HAM and

TSP as the same disease, now known collectively as HAM/TSP.

HAM/TSP is a progressive chronic myelopathy, predominantly of the thoracic spinal cord 2,118,162,178,253. In general, the natural history of the disease is described as a slowly progressive degenerative syndrome manifested as low back pain, urinary incontinence and leg paraparesis. A cerebellar syndrome with ataxia and intention tremor is also occasionally associated with syndrome 45. In certain cases, a predominance of sympathetic nervous system dysfunction has been reported 5.

Magnetic resonance imaging (MRI) reveals multiple white matter lesions in both the spinal cord and the brain involving perivascular demyelination and axonal degeneration

116,126,174,175. There is severe cellular destruction and inflammation associated with

HAM/TSP. Histopathological features are multiple foci of severe demyelination in the cerebrum and the lower cervical/thoracic spinal cord, as well as a widespread mononuclear cell infiltration (mainly T cells, , astrocytes, and glial cells) with perivascular cuffing, parenchymal invasion and gliosis within white matter 273, 151.

Interestingly, the number of CD8 positive T cells increases with the duration of the

14 disease 205,354. Presence of high levels of proinflammatory , such as IFN-γ,

TNF-α, IL-1 and IL-6, 14,165,188,230 and large numbers of activated lymphocytes, in the cerebrospinal fluid (CSF) of affected individuals suggests an important role of these cytokines and activated lymphocytes in the development of HAM/TSP151. High levels of anti-HTLV-1 antibodies 122 and HTLV-1 Tax specific cytotoxic T lymphocytes

(CTL) 186 observed in the cerebrospinal fluid (CSF) of HAM/TSP patients are implicated in the cellular destruction and inflammation on the central nervous system

(CNS) 186.

The development and progression to HAM/TSP is influenced by multiple risk factors including host genetic factors254, host immune response, high HTLV-1 proviral load 18,19,177,264,381, route of infection (exposure via blood transfusion) 274 and by specific viral characteristics such as variations in tax18,77,99,128,221,308. Although the pathogenesis of HAM/TSP is not completely resolved, immune mediated damage is a widely accepted hypothesis supported by increased cellular and humoral immune responses observed in HAM/TSP patients. Recent theories include molecular mimicry between

HTLV-1 and autoantigens in CNS which may play a role in the pathogenesis of

HAM/TSP 203,204.

1.9 Other Diseases Associated with HTLV-1-Infection

In addition to ATL and HAM/TSP, HTLV-1 infection has been associated with many other disorders believed to be caused by immune-system dysfunction. These include uveitis 240, HTLV-1-associated arthropathy 263, Sjögren’s syndrome 338,

15 infective dermatitis 190, polymyositis 202, lymphadenitis 266, chronic respiratory disease171, acute myeloid leukemia 374 and conditions such as systemic sarcoidosis as well as increased susceptibility to Strongyloides stercoralis infection 375. However, the etiological role of HTLV-1 in development of these conditions remains controversial.

1.10 HTLV-1Genome Organization and Replication

HTLV-1 is a complex retrovirus with type C retroviral morphology. The virus belongs to the deltaretrovirus group along with bovine leukemia virus (BLV) and

Simian T lymphotropic virus (STLV). Mature HTLV-1 particles are spherical in shape and have a diameter of about 110 to 140 nm. HTLV-1 is an enveloped virus and the outer envelope is composed of both viral and cellular proteins and lipids 63. The core of the virion is composed of a ribonucleoprotein complex containing two copies of an identical ~9 kb positive sense RNA genome, the primer tRNA-Pro of host cell origin, along with structural and enzymatic proteins, including nucleocapsid, capsid, matrix, reverse transcriptase, integrase and . The RNA genome has post-transcriptional modifications similar to host mRNA including 5’ m7Gppp cap and 3’ poly(A) sequences63.

The HTLV-1 genome is 9032 nucleotides long, 318 has 5’ and 3’ long terminal repeats (LTR) with sequences encoding structural, enzymatic, regulatory and accessory genes placed in between the two LTRs. The LTR contains cis-acting regulatory sequences essential for viral gene expression and replication, including sequences important in transcription start and termination, splicing, mRNA ,

16 strand transfer during reverse transcription and RNA transport 24,58,183. The LTR is further subdivided into U3, R and U5 regions 133. The U3 region contains three imperfect 21-base-pair repeats, known as Tax-responsive elements-1 (TRE-1) upstream of the transcription start site 324, necessary for viral gene transcription 35,129,176,342,366,367.

The TRE-1 elements functions as defective cyclic adenosine monophosphate (cAMP) response elements (CRE), and bind multiple transcription factors such as cyclic AMP response element binding protein (CREB)332,391, cAMP response element modulator

(CREM) 332, activating transcription factors (ATFs) 134 and other cellular proteins that facilitate transcription including TRE binding proteins [TREB-1 334, TREB-5 387,

TREB-7 387, c-Jun 154, c-Fos 114, activator protein-2 (AP-2) 245,265, HTLV enhancer binding protein (HEB)-1p67 and HEB-1p94] 216. In addition, the U3 region also contains a second enhancer element, Tax-responsive element 2 (TRE-2) critical in viral transcription 227,335. Cellular transcriptional factors such as Ets family proteins (Ets-1,

Ets-2, Elf-1 and TIF-1), c-Myb, NF-κB, AP-2 and PU.1 bind TRE-231,32,61,66,346,81.

Besides TRE-1 and 2, many cellular proteins such as Sp-1 265 and nuclear factor-1 (NF-

1)265 bind the LTR at regions outside TRE and enhance transcription. Moreover, LTR also contains a Rex-responsive element (RxRE), which directly interacts with Rex and is essential for Rex-mediated nuclear export of unspliced and singly spliced .

The HTLV-1 replication cycle starts when viral particles attach to the cell surface through an interaction between envelope and HTLV-1 receptors. Recent studies have identified transferrin receptor, an inducible iron receptor, which plays a crucial role in the regulation of iron uptake and cell growth, is overexpressed in ATL cells 283.

17 More importantly, Manel et al recently identified GLUT-1, a ubiquitous glucose transport protein, as a receptor for HTLV-1222. It is not clear how interactions of the

HTLV-1 envelope with GLUT-1 affect cell-to-cell spread of the virus, however if

GLUT-1 is essential for the spread of both cell-free and cell-associated HTLV-1, further characterization of this receptor may be valuable in understanding of the complexities of HTLV-1 pathogenesis and in designing strategies to prevent HTLV-1 transmission276.

When the viral envelope fuses with the cell membrane, components of the virion such as nucleocapsid and capsid enter the cytoplasm. In the cytoplasm, the viral genomic RNA is reverse transcribed into generate double-stranded DNA (dsDNA) using the virally encoded reverse transcriptase (RNA-dependent/ DNA-dependent polymerase). Viral dsDNA associates with cellular and viral proteins to form a pre- integration complex 39, which traffics to the nucleus and randomly integrates into the host genome using the viral encoded integrase. The integrated form of viral DNA is called provirus130. These processes are accomplished by the structural and enzymatic proteins packaged in the virions without de novo viral gene expression 132. Once integrated, the provirus behaves similar to cellular genes with host cellular machinery driving transcription from the proviral DNA using host cell RNA polymerase II. The unspliced full-length (~9 kb) viral genomic RNA is used to generate progeny virus particles (virions) and to generate Gag (internal group specific antigen) 271, Pol

(polymerase, reverse transcriptase and integrase needed for viral replication and maturation) 257 and Pro (protease enzyme required for maturation of structural and

18 enzymatic proteins) 258 proteins. The singly spliced subgenomic ~4.3 kb mRNA is used to generate Env proteins (surface and transmembrane envelope glycoprotein) and doubly-spliced (two introns removed) RNA (~ 2.1 kb) is used to translate the regulatory proteins Tax ( (ORF) IV) and Rex (ORF III). Additionally, by alternative splicing, several accessory proteins are also produced from pX ORF I and II, which are discussed in the following sections 24. Immature virus particles are assembled at the plasma membrane and nascent virions buds off from infected cells. Complete maturation of virions occur after budding 64.

1.11 Structural and Regulatory Proteins of HTLV-1

Viral proteins are produced from same of HTLV-1 by employing ribosomal frame shifting and alternative splicing mechanisms 63. The Gag protein is translated from an unspliced, full-length mRNA as a single precursor polyprotein p55(Gag) 271. p55 is then myristoylated at its N-terminus, targeted to inner plasma membrane 268 and cleaved by viral protease into matrix (19 kDa), capsid (24 kDa) and nucleocapsid (15 kDa) proteins 138,271. The matrix protein is localized to the inner surface of the viral envelope 258. The p19 matrix protein (MA) contains eleven basic amino acids, critical in the release of HTLV-1 virus particles and cell-to cell transmission 195. The same genomic mRNA, in a different reading frame, act as the template for the synthesis of Gag/Pol precursor through a ribosomal frame shift 257.

Reverse transcriptase (RT) and integrase (IN) is produced by cleavage of the precursor by the protease 258. Pol also has RNase H activity that is required during the process of

19 reverse transcription 64. Another ribosomal frameshift between 3' of gag and 5' of pol yields an immature form of Protease (PR) 258, which undergoes self-cleavage to become the active form 133. A singly-spliced sub-genomic mRNA is the template for the viral envelope glycoprotein (Env). Env is synthesized as a 61 to 68 kDa glycoprotein, which is glycosylated and cleaved into SU (gp46) and TM (gp21) proteins 285. SU and TM proteins form a heterodimer and is critical for the binding of the cell surface receptor and subsequent fusion involving the early events of viral infection 131.

Unlike simple retroviruses, complex retroviruses carry additional genes to encode for several regulatory and accessory proteins. As a complex retrovirus, HTLV-1 encodes regulatory proteins from the pX region (between env and 3’ LTR), by alternative splicing from four open reading frames (ORF). ORF IV and ORF III encode regulatory proteins Tax and Rex respectively 179,319. Tax, (Transcriptional Activator of pX region) a 40 KDa nuclear protein produced from a doubly spliced mRNA, is transactivator of HTLV-1 gene transcription from the viral LTR 41,101,115,327,328. Tax binds to GC-rich sequences flanking the TRE-1 for the transactivation of the LTR

172,173,201,218. Tax enhances the binding of CREB/ATF proteins to the TRE-1 and several basic (bZIP) proteins to the TRE-2 280. Tax binds p300/CBP at the KIX domain, recruits CBP/p300 to the DNA bound CREB, allows CBP/p300 to associate with DNA and facilitates transcription. Association of CBP/p300 associated factor

(P/CAF) at the C-terminal activation domain of Tax 136,156 is required along with the recruitment CBP/p300 for effective transactivation of viral LTR137. In addition, Tax regulates the expression of numerous cellular genes, predominantly by induction of the

20 transcription factors NF-kB and SRF, independent of CREB activation. These cellular genes include cytokines such as IL-2 229, IL-3 371, IL-4211, IL-6 248, IL-8 242, IL-2Rα 229,

IL-1 243, GM-CSF 236, TNFα 71 and TNFβ 213, transcription factors such as c- 94, c-

112 298 113 207 155 261,351 fos , c-sis , -1 , c-rel , lck, apoptosis related genes Bcl-xL and Bax

200 and DNA repair genes proliferating cell nuclear antigen (PCNA) and β-polymerase

302 37,209. Rex, a nucleolar localizing 27 KDa protein, is responsible for nuclear export of unspliced (gag/pol) and singly spliced (env) viral RNA to cytoplasm. Rex expression is also associated with inhibition of splicing and transport of doubly spliced RNAs from the pX region 148,149,179. Rex balances messages encoding for viral structural proteins and messages encoding regulatory or accessory proteins. Rex binds a highly stable

RNA stem-loop structure in the U3/R region of the HTLV-1 3’LTR (Rex response element or RxRE), 16,22,26,27,169,320 and is important in polyadenylation of viral RNAs 3,83.

Additionally, Rex may inhibit mRNA splicing by altering early splicosome assembly and stabilizing the mRNA of cellular gene, IL-2Rα chain by acting in trans on its coding sequence 160. The molecular mechanism of Rex-mediated RNA export is considered similar to HIV-1 Rev, involving the CRM1/exportin1 pathway 30,135 74,288.

Rex directly binds both the viral mRNA and hCRM1 in the presence of RanGTP bridging the target mRNA and the export receptor. Multimerization of Rex along the viral mRNA is necessary for RNA export78,220,365. Even though Rex is dispensible in vitro, it is critical for efficient infection of cells and persistence in vivo 384.

21 1.12 HTLV-1 Accessory Proteins

In addition to the regulatory proteins Tax and Rex, HTLV-1 pX genome region encodes four accessory proteins, p12I, p27I, p13II, and p30II from alternatively spliced forms of mRNA in ORF I and II (Fig. 1.3)24,56,181,183. Nucleotides 1-119 in the R region of viral 5’ LTR forms the first exon of all pX mRNA . The first exon is spliced to either nucleotide 4641 or 4658 in case of doubly spliced messages. The second exon ends at nucleotide 4831 and is spliced to various splice acceptor sites in the pX region.

A splice acceptor site at nucleotide 6383 is used for the generation of doubly spliced pX-rex-orf I and singly spliced pX-orf I mRNAs, which encode p27I and p12I, respectively. Splice acceptor site at nucleotide 6478 or 6875 is used to generate doubly spliced message pX-tax-orf II that encodes p30II or singly spliced message pX-orf II that encodes p13II. A splice acceptor site at 6950 is used to generate doubly spliced message pX-tax/rex that encodes Tax or Rex using ORF IV or ORF III 24,58,117,182, 46.

HTLV-1 accessory proteins were considered dispensable for viral replication 84, however, recent findings have demonstrated the role of the HTLV-1 accessory proteins in viral infectivity, maintenance of high viral loads, host cell activation, and regulation of gene transcription 6,7,23,59,68,76,82,85,157,170,191,350,389,390. Although accessory proteins encoded by ORF I and II have not been directly detected in HTLV-1 infected cells, increasing evidence from various studies provide strong evidence for their production during the natural viral infection. mRNA of these proteins are detected in HTLV-1 infected cell lines, cells transfected with HTLV-1 proviral clones and isolated primary

22 cells from ATLL patient and asymptomatic carriers 24,58,117,182; 46. Interestingly, chronically infected cell lines were found to have 1000-fold lower levels of pX-rex-

ORF I mRNA compared to pX-tax/rex mRNA. The pX tax-ORF II mRNA levels were

500-fold to 2500-fold lower levels than pX-tax/rex mRNA, suggesting differential regulation of various HTLV-1 proteins 293. The nucleotide sequence and genomic region encoding these accessory proteins, particularly p12I, are highly conserved in different

HTLV-1 strains, HTLV-2 and STLV 56,57,309,323. HTLV-1 infected patients and rabbits produce antibodies that recognize p12I 51,82. Antibody specific for p30II can be found in the sera of ATLL and HAM/TSP patients 51. In addition to humoral immune response,

CD8+ cytotoxic T-lymphocytes (CTL) derived from HTLV-1-infected asymptomatic carriers, HAM/TSP patients, and an ATLL donor recognize the ORF I and II peptide sequences 286. These findings strongly indicate the production of ORF I/II encoding proteins during HTLV-1 infection and leukemogenesis.

p12I is translated from both singly and doubly spliced messages. Since expression plasmids containing HA1 tagged full-length p27I cDNA or the cDNA for the singly spliced p12I produced only the p12I form of protein, p27I mRNA is thought to be preferentially used over the p12I message 183. However, p27I protein was produced using in vitro transcription-translation systems from the doubly spliced mRNA 58 and

CTL response was observed against p27I peptides286. The pX ORF II of HTLV-1 produce p30II and p13II from two alternatively spliced mRNAs. p30II is encoded by a doubly spliced message and p13II, the smaller protein containing the C-terminal 87 amino acids of p30II, is produced from a singly spliced message.24,183. Collectively

23 these studies illustrate that retroviruses have evolutionarily conserved gene regions and are equipped with different strategies for the synthesis of a multitude of protein products from these relatively short genomic regions.

1.12.1 pX ORF II p13II

Earlier studies demonstrated that p13II localizes to the nucleus 183, however more-recent reports demonstrated that the protein localizes to the mitochondria 59,75, specifically in the inner mitochondrial membrane 75 mediated by an atypical mitochondrial targeting sequence (MTS) in the N terminus of p13II 59(Fig 1.4).

Sequence analysis of p13II reveals no DNA-binding motifs and previous data show neither DNA binding nor transcriptional activity304.

Expression of p13II is correlated with disruption of the mitochondrial inner membrane potential and alterations in mitochondrial morphology, leading to mitochondrial swelling and fragmentation, suggesting a role for p13II in apoptosis59. In addition, p13II is thought to change mitochondrial permeability and/or alter processes like calcium signaling that relies on the mitochondrial network and the ER. Even though p13II causes these alterations in mitochondrial microenvironment, the protein does not change permeability transition pore (PTP) driven cation fluxes75 or release of cytochrome c59. In a recent report, p13II was demonstrated to induce selective permeability changes causing swelling, subsequent de-energization and irreversible swelling of mitochondria 76. However, thus far, the biological significance of this viral

24 accessory protein in the pathogenesis of HTLV-1 infection remains unclear. Since alteration of cellular death pathways is thought to play a crucial role in pathogenesis of

HTLV-1, this mitochondrial localizing protein might have an important role in the development of ATLL.

p13II physically associates with two novel cellular proteins named C44 and

C254 147. C254 is a rabbit actin binding protein 280 (ABP280) present in the cytoskeleton of many different cell types and functions in the modulation of cell shape and polarity. Interestingly, ABP-280 is critical in the insertion of adhesion molecules into the cell membrane 147. C44 shares homology with archeal adenylate kinases involved in energy . The human homologue of C44 is expressed in the

Jurkat T cell line and proliferating PBMC 147. Additionally, p13II binds to farnesyl pyrophosphate synthetase (FPPS), an enzyme involved in the mevalonate/squalene pathway, and in the synthesis of a substrate required for prenylation of Ras namely farnesyl pyrophosphate 197. Interestingly, mitochondrial localizing accessory protein of

BLV, G4, also binds to FPPS 198. Future studies on the interaction between p13II and these cellular proteins will clarify the role of p13II in altering mitochondrial physiology and its biological relevance in HTLV-1 replication and tumerigenesis.

1.12.2 pX ORF II p30II

The isolation of an HTLV-1 clone containing a stop codon in pX ORF II from leukemic cells led to the belief that pX ORF II was not necessary for the growth of leukemic clones in vivo 53. The functional role of pX ORF II in viral replication in vivo, 25 was demonstrated by our laboratory group, by inoculating rabbits with lethally irradiated cell lines expressing the wild-type molecular clone of HTLV-1 (ACH) and a clone containing selected mutations in pX ORF II (ACH.p30/13)23. While all ACH- inoculated rabbits became infected as early as 2 weeks post-inoculation, ACH.p30/13- inoculated animals failed to become infected or maintained low viral load (up to 100 fold less) in their blood leukocytes. These animals also had weak and transient ex vivo p19 antigen production and their antibody titers declined towards the end of the study.

Interestingly, a recent report from our laboratory looking at the significance of p30II in vivo, identified a reversion of the ACH molecular clone harboring a mutation in p30II

(ACH.p30) to wild-type, with evidence of early co-existence of mutant and wild-type sequence 326. Taken together, these data suggested that pX ORF II is in fact critical for maintenance of high proviral loads in vivo.

While the p13II MTS is also present in p30II, p30II localizes in the nucleus mediated through a highly conserved bipartite NLS 181,390,. Nuclear localization is a key evidence for the transcriptional function of p30II. In addition, p30II contains serine and threonine-rich regions with homology to cellular transcription factors, such as Oct-1/2,

Pit-1, and POU-1 58 (Fig. 1.4). Our laboratory group has demonstrated that, at limiting concentrations, p30II stimulates HTLV-1 LTR-driven reporter gene activity whereas higher concentrations represses LTR and CRE-driven reporter gene activity 390. Earlier studies identified co-localization and physical interaction of p30II with the cellular transcriptional co-adaptor p300 in the nucleus389. Taken together, these characteristics suggest that p30II has a role in transcription of viral and cellular gene expression. p30II

26 and Tax interacts with CBP/p300 through the same KIX domain and it is possible that the competition between p30II and Tax might be the mechanism by which HTLV-1 regulates viral gene transcription from LTR 389. Recently, p30II was identified to modulate LTR mediated transcription, by a post-transcriptional mechanism 260. p30II has been demonstrated to bind and retain the doubly spliced mRNA encoding the Tax and

Rex proteins in the nucleus, thereby acting as a negative regulator of viral gene transcription and virion production 260. Collectively, p30II has a major role the regulation of regulation of LTR driven viral gene transcription and thus act as a critical player in the development of ATLL

1.12.3 pX ORF I p12I

HTLV-1 p12I is a hydrophobic protein, with leucine and proline forming 32% and 17% of the amino acid residues respectively 183. The protein also contains two putative transmembrane domains (aa 12 to 30 and aa 48 to 67)86,350 and two predicted leucine zipper motifs, which might have a role in the ER localization and dimerization

(Fig. 1.4) 350. In addition, p12I contains four putative SH3-binding PxxP motifs (Fig.

1.4), 42 with first ( aa 8 – 11) and third (aa 70 - 74) PxxP motifs being highly conserved among viral strains. There is also a conserved PSLP(I/L)T sequence in p12I, with homology to the calcineurin-binding PxIxIT motif of nuclear factor of activated T cells

(NFAT). This motif was found to be critical for the interaction between p12I and calcineurin170. In addition, p12I contains a dileucine DxxxLL motif, commonly involved in directing protein trafficking through endosomal compartments, at amino

27 acid positions 26 to 31 (Fig. 1.4) 73. Sequence analysis of p12I has identified potential post-translational modification sites in the protein such as phosphorylation sites, glycosylation sites and a ubiquitynation motif surrounding the lysine at position 88 350.

However, p12I was determined to be not a glycoprotein or a phosphoprotein 86, but has recently been reported to be palmitoylated (CSH, 2004).

HTLV-1 p12I localizes in cellular endomembranes 181, predominantly in the ER and cis-Golgi apparatus as evidenced by immunofluorescent confocal microscopy, electron microscopy and subcellular fractionation studies. In addition, p12I directly binds calreticulin and calnexin, two proteins in the ER associated with calcium storage and calcium-mediated cell signaling, suggesting a role for HTLV-1 p12I in calcium homeostasis of infected T cells 86.

HTLV-1 p12I was reported to associate with immature peptides of the major histocompatibility complex class-I (MHC-I), interfere with the interactions of MHC-I, decrease the surface expression of MHC-I and direct its degradation in the

159,159, suggestive of a role in viral escape of immune surveillance. However, T- lymphocytes immortalized with the wild type and p12I-mutant HTLV-1 molecular clones (ACH and ACH.p12 respectively) had similar levels of MHC-I and II 67. In addition, virus infection is blocked very early post-inoculation with ACH.p12, before a possible active immune response. Therefore, down regulation of MHC-I is an unlikely explanation for the early loss of infectivity of ACH.p12 68. Previous reports have demonstrated that p12I binds the 16 kDa subunit of the vacuolar H+-ATPase (16K)

107,184 and also associates with immature forms of IL-2 receptor β and γ chain247 28 resulting in reduced cell-surface expression of these receptors 247. The p12I-binding site on the IL-2R chain overlaps with the binding site for Janus kinases, JAK 1 and 3 and the adapter protein Shc. The binding of p12I to IL-R correlates with a reduced cell- surface expression of the receptor and a decreased requirement of IL-2 to induce proliferation during suboptimal stimulation with anti-CD3 and anti-CD28 antibodies 262.

However, lymphocyte cell lines immortalized by the HTLV-1 proviral clone ablated for pX ORF I expression, ACH.p12I, have intact IL-2 receptor signaling pathways 67.

Nevertheless, p12I does not appear to significantly alter the activation of the IL-2R- associated JAK1 and JAK3, or their downstream effectors STAT3 and STAT5, after immortalization. Collectively, these studies indicate that p12I interacts with key cellular proteins involved in immune recognition and cellular proliferation to confer a growth advantage to infected cells during the early stages of infection, before immortalization.

Future studies are necessary to characterize the interaction between p12I and MHC-1 in vivo and to understand the JAK3-independent induction of STAT5 activation by p12I.

Viral proteins with similar binding properties and functional characteristics are described in many other viruses. HTLV-2 accessory proteins p10I and p11V 158 as well as HIV-1 was reported to associate with MHC-I. HIV-Nef, down regulates the cell surface expression of MHC-I and is believed to contribute to immune evasion by HIV-1

284. Bovine papilloma virus (BPV) E5 protein shares amino acid with HTLV-1 p12I, is very hydrophobic and has similar subcellular localization patterns

107. Analogous to p12I, E5 also binds to the vacuolar H+-ATPase (16K) 107,184 and IL-2R

β and γ chain. Interestingly, Nef also binds the catalytic subunit NBP-1 of ATPase 217.

29 1.13 Role of p12I in Viral Infectivity in vitro and in vivo

pX ORF I of HTLV-1 was identified to be dispensable for viral infectivity and primary lymphocyte transformation in vitro84,303. In contrast, studies from our laboratory, using ACH.p12I demonstrated that ablation of p12I dramatically reduced viral infectivity in vivo 68. Rabbits inoculated with ACH.p12 failed to establish persistent infection evidenced by reduced anti-HTLV-1 antibody responses, failure to demonstrate viral p19 antigen production in PBMC cultures, and only transient detection of provirus by PCR68. The major difference between in vitro and in vivo studies is the use of mitogenic stimuli such as IL-2 in in vitro co-culture techniques.

However, the majority of circulating and tissue-associated lymphocytes are quiescent/non-dividing in vivo.

In parallel with these findings, using co-culture assays for transmission of the virus to resting primary lymphocytes, our group demonstrated that pX ORF I mRNA is critical for viral infectivity in non-activated/quiescent PBMCs in vitro6. In addition, viral infectivity was restored upon addition of IL-2 and / or other mitogens to the co- cultured PBMCs6. These data suggested a role of p12I in T-lymphocyte activation and in the early stage of viral infection. Studies on a functionally similar viral protein,

HIV-1 Nef indicate that Nef is also dispensable for transmission of the virus to activated target cells in vitro but is required for viral infectivity in quiescent T lymphocytes225,281,373.

30 1.14 Role of p12I in Calcium-Mediated T Cell Signaling

p12I specifically activates NFAT in synergy with Ras/MAP kinase activation stimulated by the phorbol ester, PMA. Reports from our laboratory demonstrated that p12I expression in Jurkat T cells results in ~ 20-fold activation of NFAT dependent gene expression, while AP-1 or NF-κB-mediated transcription remained unchanged7.

Studies performed by inhibiting phospholipase C- γ (PLC-γ), linker for activation of T cells (LAT), calcineurin and NFAT, narrowed the functional platform of p12I to be between PLC-γ and calcineurin7. Activation of NFAT by p12I was dependent on increase in cytosolic calcium and p12I functionally substituted for thapsigargin, a specific inhibitor of ER calcium ATPase, which specifically depletes the ER calcium store. In fact, p12I increases the base-line cytoplasmic calcium concentration, by release of calcium from ER stores and subsequent higher capacitative calcium entry85.

Collectively, HTLV-1 p12I regulates the calcium homeostasis and activates NFAT- mediated transcription in lymphoid cells in a calcium-dependent manner.

Both the IP3R, and calcium release activated calcium channels (CRAC), contribute to the NFAT activation by p12I, strongly indicating the role of p12I on calcium homeostasis. Calcium release from the ER by p12I and subsequent activation of NFAT 85, would be advantageous to the virus during the early stages of HTLV-1 infection. In addition, p12I mediated increase in NFAT activity could cause complete activation of cellular stimuli that would normally induce only partial activation of T cells. These stimuli could be triggered by cytokines or chemokines released from

31 infected neighboring cells or by direct contact between viral envelope proteins and certain cell surface receptors on newly targeted lymphocytes prior to viral entry 15.

Although localization of p12I to the ER appears to be essential for NFAT activation, 87, direct binding between calreticulin and p12I does not correlate with the NFAT activation85. Interestingly, there is a functional similarity between p12I and a cellular protein CAML (Ca2+-modulating cyclophilin ligand), which also contain two putative transmembrane domains like p12I, colocalizes with calreticulin in the ER, induces calcium release from the ER and leads to NFAT activation 362. Further studies are necessary to identify the significance of p12I - calreticulin interaction in HTLV-1 infection and development of ATLL.

Expression of NFAT induces a highly permissive state to overcome the blockade at reverse transcription and permitted HIV replication in primary CD4+ T cells, therefore it is possible that p12I causes T cells to be hypersensitive to T cell receptor and CD28 stimulation and thus highly permissive for subsequent viral infection.

Interestingly, susceptibility of these cells to HIV infection could be restored by mitogen treatment, likely due to the phytohemagglutinin-induced upregulation of NFAT activity.

This is similar to earlier reports from our laboratory that addition of mitogens can rescue the infectivity of a p12I mutant viral clone in resting PBMC 6, likely by overriding the requirement for p12I-induced activation of NFAT.

Studies from our laboratory demonstrated that p12I competes with NFAT for calcineurin binding. Interestingly, alanine substitution mutations in PxIxIT motif resulted in increased nuclear translocation and transcriptional activity (~2-fold) of 32 NFAT 170. Many calcineurin-binding proteins such as the anti-apoptotic protein Bcl-2, calcineurin B homologous protein, a kinase anchoring protein AKAP79, and myocyte- enriched calcineurin-interacting protein 1 inhibit either calcineurin phosphatase activity or its substrate NFAT transcriptional activity72,206,361. However, p12I binding to calcineurin via a motif similar to PXIXIT did not inhibit calcineurin phosphatase activity but instead influenced NFAT and calcineurin interaction by competing for binding with

NFAT similar to artificial peptides representing this motif 12.

The presence of calcineurin-binding motif in p12I, could regulate NFAT by either positive modulation via increasing cytosolic calcium concentration from ER stores or negative modulation by calcineurin binding. The significance of this mutually opposed regulatory functions of p12I on NFAT transcriptional activity is unclear.

Similar to another protein with similar binding properties such as Bcl-2, p12I may act as an ion channel protein to increase ER calcium permeability and thereby affect apoptosis in HTLV-1-infected T cells. Another ER membrane protein, CAML that activates

NFAT by increasing calcium flux binds with calcineurin indirectly, through its association with cyclophilin362. Overall, p12I interacts with proteins involved in regulation of intracellular calcium levels such as calcineurin, mediated through a highly conserved PSLP(I/L)T motif, to further T cell activation, and subsequently enhance viral infectivity.

A number of viruses encode proteins which modulates the cellular Ca2+ homeostasis to regulate various aspects of viral pathogenesis 120. For instance, hepatitis

B virus X protein (HBx) activate Pyk2 or Ca2+ signaling mediated by mitochondrial 33 Ca2+ channels, which is necessary for HBV replication 33 while encodes NSP4, a nonstructural glycoprotein, which increases the cytosolic calcium in rotavirus-infected cells 341. In addition, kaposi's sarcoma-associated herpesvirus (KSHV) mitochondrial protein K7 targets CAML, a cellular Ca2+-modulating protein to increase the cytosolic

Ca2+ response, which consequently protects cells from mitochondrial damage and apoptosis, thereby allowing the completion of viral lytic replication, maximizes the production of viral progeny for maintenance of persistent infection in the infected host

102. Furthermore, calcium plays a critical role in the replication cycles and pathogenesis of other viral diseases such as , cytomegalovirus, and virus

307. protein 2B is known to induce the influx of extracellular Ca2+ and to release Ca2+ from ER stores, modifies plasma membrane permeability and facilitates virus release 355 while HIV-1 pathogenicity factor Nef is known to modulate calcium signaling in host cells, involving atypical IP3R-triggered activation of plasma membrane calcium influx channels in a manner that is uncoupled from depletion of intracellular calcium stores 225. Nef, activates NFAT in synergy with Ras/MAPK pathway in a calcium dependent fashion223-225. In the case of HTLV-1, p12I enhances the production of IL-2, a downstream gene of NFAT activation, in Jurkat T cells and primary lymphocytes, in a calcium-dependent fashion 87. This increase in IL-2 could account for the reduced requirement of the in proliferation of human primary lymphocytes in the presence of p12I 262. Overall, p12I expression hastens T cell activation and likely facilitates viral replication and productive infection, which correlates with the indispensable nature of p12I in viral infectivity in vivo 68.

34 The mechanism by which calcium induces gene expression has been the focus of many investigations. Based on DNA microarray analysis, Feske et al 104 demonstrated that Ca2+ signals modulate the expression of various genes involved in transcription, including c-Myc, c-Jun, c-rel, STAT5B, STAT4, STAT-1, CREM, NFAT4, FosB,

BRF2, , IRF-1, IRF-2, NF-IL3A, Fra-2, FLI1, MINOR, NOT and SMBP2.

Calcium-dependent activation of a wide variety of transcription factors, such as NFAT,

NFκB, Elk-1, Nur77, AP-1, ATF-2 and CREB, is through calmodulin-dependent protein kinases and phosphatases 11,296,344. While a small transient spike of Ca2+ increase by store depletion activates signaling pathways and transcription factors such as NFκB and JNK 89, capacitative calcium entry and a sustained Ca2+ increase is necessary to activate other transcription factors, such as NFAT 89,90,210.

1.15 Role of p12I in the Development of HAM/TSP

Degradation of viral proteins by proteosome pathway is thought to be a major intracellular defense mechanism against viral infection 80,314. Lysine is a target residue for covalent binding of ubiquitin 69,80,314 and ubiquitylation of a lysine residue at amino acid position 88 of p12I renders the protein metabolically unstable. Ubiquitylated p12I subsequently undergoes proteasomal degradation 350. Degradation of p12I would alleviate the reduction of MHC-I molecules at the cell surface20. Interestingly, the lysine carrying allele was present only in some TSP-HAM cases irrespective of geographical locations, suggesting that a selective pressure over p12I might occur in the host 106,350.

Based on these findings, reduced stability of p12I in HAM/TSP patients has been

35 hypothesized to facilitate generation of a viral-specific CTL response. However, the lysine residue at position 88 in p12I was not found in all HAM/TSP patients 228. Overall, it is possible that the lysine at position 88 of p12I might have a significant effect on the biological effects of the protein in the host, including giving a possible selective advantage in individuals with a certain MHC-I. Further studies looking at HTLV-1- infected individuals in populations from multiple geographic locations may better explain the significance of lysine residue in HTLV-1 infection and pathogenesis.

1.16 Regulation of p300 Through Calcium

Transcriptional co-activators p300 and CREB binding protein (CBP) mediate transcriptional control of various cellular and viral DNA binding transcription factors.

These co-activators, commonly referred to as p300/CBP, have divergent functions, but highly related in nucleotide sequence, evolutionarily conserved and share many functional properties 29,127,360. A large number of sequence-specific, DNA-binding factors form complexes with p300/CBP, including nuclear steroid receptors, c-Jun, Fos, , Sap1, Stat1 and Stat2, MyoD, Ets-1, NFκB, HIF1, GATA 1, cMyb and Smad proteins. In addition, CBP/p300 interacts with TBP, TFIIB, TFIID, RNA helicase A,

CREB, MAP kinase p90rsk and RNA poymerase II (see 127,152,360 for review). Several viral proteins also interact with p300/CBP, including HTLV-1 p30II and Tax, adenovirus E1A, HIV-1 and Tat, Kaposi’s sarcoma-associated herpes virus

(KSHV) viral regulatory factor protein (vIRF), virus 40 large T antigen, HPV E6 and E7, small delta antigen of hepatitis delta virus, Epstein-Barr virus

36 (EBV) nuclear antigen 3C (EBNA3C) and EBNA2, and virion protein-

146,389 16 (VP16) . Additionally, proteins such as papillomavirus E 2 protein employs a novel mechanism of transcriptional activation, by interacting with cellular protein,

AMF-1 to form complexes with p300 279.

p300 and CBP mediate the activities of various transcription factors, however, their availability in the cell is only at limiting concentrations and even small reductions in the concentrations of these co-activators are damaging in many instances 282. In addition, in circumstances where p300/ CBP levels are limiting, proteins are known to compete for binding p300/ CBP and there could be selective preference of one over the other, causing an exclusion of one of the proteins 66. Such an environment of co- activator competition between transcription factors provides an additional regulatory layer of gene expression. Competition between viral and cellular proteins for binding p300/CBP has been reported for HIV, adenovirus and SV40 145,145,383.

The mechanism of how the cell directs the activities of p300 and CBP in a specific and time-regulated fashion have been the focus of many investigations. These studies demonstrated two non-mutually exclusive mechanisms - competitive protein- protein interactions and post-translational modifications such as phosphorylation and acetylation 47,125. However, the transcriptional regulation of p300 remains to be elucidated. Studies presented in this thesis demonstrate, for the first time, that the level 37 of p300 is enhanced by human T lymphotropic virus type-1 (HTLV-1) accessory protein p12I in a calcium-dependent manner. Our data strongly indicate that transcription of p300 is calcium-dependent, but calcineurin-independent and sustained low magnitude increase in intracellular calcium concentration upregulates the transcription of p300.

Transcriptional co-adaptor proteins CBP and p300 are key players in HTLV-1 gene transcription and development of ATLL. CBP/p300 co-activators form complexes with other transcription factors at the HTLV-1 promoter, and are known to play a critical role in the regulation of HTLV-1 transcription in infected T-cells 199. HTLV-1

Tax, a transactivator of LTR mediated transcription, is critical in the activation of the

HTLV-1 viral genes through its interaction with the p300 and CBP co-activators 25.

CBP is known to stimulate Tax-mediated HTLV-1 LTR transcription initiation and reinitiation from a naked DNA template in vitro 163 while p300 acts as co-activator for

Tax-dependent HTLV-1 LTR transcription 156. HTLV-1 Tax directly interacts with p300/CBP in a multi-histone acetyltransferase/ activator-enhancer complex 136. Previous reports from our laboratory demonstrated that HTLV-1 accessory protein p30II binds

CBP/p300 at the highly conserved KIX region 389. Intriguingly, KIX domain is the binding site of CBP/p300 for HTLV-1 Tax protein as well. Recent findings from our laboratory indicate that HTLV-1 p30II and Tax appear to compete with each other in modulating the transcriptional activity from the LTR, possibly through competitive binding to CBP/p300. Our present study demonstrates that HTLV-1 p12I enhances the 38 expression of p300, thereby reverses the transcriptional repression of p30II on HTLV-1

LTR in a p300 dependent manner and establishes a new role of p12I in modulating

HTLV-1 gene expression.

Collectively, data presented in this thesis establishes the role of p12I in HTLV-1 pathogenesis as a key molecule involved in modulation of cellular gene expression in a calcium-dependent manner. In addition to the unique ability of p12I in hastening T cell activation, herein we demonstrate that p12I regulates the expression of cellular genes involved in various biological processes like cell proliferation, apoptosis, cell adhesion, immune response and signal transduction. More importantly, we have identified a novel mechanism of transcriptional regulation of a critical rate limiting transcriptional co- adaptor protein p300. Overall, the data presented in this thesis provides insight into how

HTLV-1 uses accessory proteins to modulate their cellular environment by targeting a rate limiting co-adaptor (p300) critical for long-term cell survival.

39 1.17 REFERENCES

1. Adam, M. A., N. Ramesh, A. D. Miller, and W. R. Osborne. 1991. Internal initiation of translation in retroviral vectors carrying 5' nontranslated regions. J Virol 65:4985-4990.

2. Adedayo, O., G. Grell, and P. Bellot. 2003. Hospital admissions for human T- cell lymphotropic virus type-1 (HTLV-1) associated diseases in Dominica. Postgrad. Med. J 79:341-344.

3. Ahmed, Y. F., G. M. Gilmartin, S. M. Hanly, J. R. Nevins, and W. C. Greene. 1991. The HTLV-1 Rex Response Element Mediates a Novel Form of mRNA Polyadenylation. Cell 64:727-737.

4. Akagi, T., H. Ono, and K. Shimotohno. 1995. Characterization of T cells immortalized by Tax1 of human T-cell leukemia virus type 1. Blood 86:4243- 4249.

5. Alamy, A. H., F. B. Menezes, A. C. Leite, O. M. Nascimento, and A. Q. Araujo. 2001. Dysautonomia in human T-cell lymphotrophic virus type I- associated myelopathy/tropical spastic paraparesis. Ann. Neurol. 50:681-685.

6. Albrecht, B., N. D. Collins, M. T. Burniston, J. W. Nisbet, L. Ratner, P. L. Green, and M. D. Lairmore. 2000. Human T-lymphotropic virus type 1 open reading frame I p12(I) is required for efficient viral infectivity in primary lymphocytes. J. Virol. 74:9828-9835.

7. Albrecht, B., C. D. D'Souza, W. Ding, S. Tridandapani, K. M. Coggeshall, and M. D. Lairmore. 2002. Activation of nuclear factor of activated T cells by human T- lymphotropic virus type 1 accessory protein p12(I). J. Virol. 76:3493- 3501.

8. Anderson, D. W., J. S. Epstein, T. H. Lee, M. D. Lairmore, C. Saxinger, V. S. Kalyanaraman, D. Slamon, W. Parks, B. J. Poiesz, L. T. Pierik, and . 1989. Serological confirmation of human T-lymphotropic virus type I infection in healthy blood and plasma donorsBlood 74:2585-2591.

9. Aramburu, J., A. Rao, and C. B. Klee. 2000. Calcineurin: from structure to function. Curr. Top. Cell Regul. 36:237-295.

10. Aramburu, J., M. B. Yaffe, C. Lopez-Rodriguez, L. C. Cantley, P. G. Hogan, and A. Rao. 1999. Affinity-driven peptide selection of an NFAT inhibitor more selective than cyclosporin A. Science 285:2129-2133.

40 11. Asher, D. M., J. Goudsmit, K. Pomeroy, R. M. Garruto, M. Bakker, S. Ono, N. Elliot, K. Harris, H. Askins, Z. Eldadah, A. L. Goldstein, and D. C. Gajdusek. 1988. Antibodies to HTLV-I in populations of the southwestern Pacific. J. Med. Virol. 26:339.

12. Azimi, N., J. Mariner, S. Jacobson, and T. A. Waldmann. 2000. How does interleukin 15 contribute to the pathogenesis of HTLV type 1- associated Myelopathy/Tropical spastic paraparesis? AIDS Res. Hum. Retroviruses 16:1717-1722.

13. Ballard, D. W. 2001. Molecular mechanisms in lymphocyte activation and growth. Immunol. Res. 23:157-166.

14. Ballaun, C., G. K. Farrington, M. Dobrovnik, J. Rusche, J. Hauber, and E. Bohnlein. 1991. Functional Analysis of Human T-Cell Leukemia Virus Type 1 rex-Response Element: Direct RNA Binding of Rex Protein Correlates with In Vivo Activity. J. Virol. 65:4408-4413.

15. Bangham, C. R. 2000. HTLV-1 infections. J. Clin. Pathol. 53:581-586.

16. Bangham, C. R. 2003. Human T-lymphotropic virus type 1 (HTLV-1): persistence and immune control. Int. J Hematol. 78:297-303.

17. Bangham, C. R. 2003. The immune control and cell-to-cell spread of human T- lymphotropic virus type 1. J Gen. Virol 84:3177-3189.

18. Barmak, K., E. Harhaj, C. Grant, T. Alefantis, and B. Wigdahl. 2003. Human T cell leukemia virus type I-induced disease: pathways to cancer and neurodegeneration. Virology 308:1-12.

19. Barrette, S. and D. Orlic. 2000. Alternative viral envelopes for oncoretroviruses to increase gene transfer into hematopoietic stem cells. Curr. Opin. Mol. Ther. 2:507-514.

20. Barshira, A., A. Panet, and A. Honigman. 1991. An RNA Secondary Structure Juxtaposes Two Remote Genetic Signals for Human T-Cell Leukemia Virus Type 1 RNA 3'-End Processing. J. Virol. 65:5165-5173.

21. Bartoe, J. T., B. Albrecht, N. D. Collins, M. D. Robek, L. Ratner, P. L. Green, and M. D. Lairmore. 2000. Functional role of pX open reading frame II of human T- lymphotropic virus type 1 in maintenance of viral loads in vivo. J. Virol. 74:1094-1100.

41

22. Berneman, Z. N., R. B. Gartenhaus, M. S. Reitz, W. A. Blattner, A. Manns, B. Hanchard, O. Ikehara, R. C. Gallo, and M. E. Klotman. 1992. Expression of alternatively spliced human T-lymphotropic virus type 1 pX mRNA in infected cell lines and in primary uncultured cells from patients with adult T-cell leukemia/lymphoma and healthy carriers. Proc. Natl. Acad. Sci. USA 89:3005- 3009.

23. Bex, F. and R. B. Gaynor. 1998. Regulation of gene expression by HTLV-I Tax protein. Methods 16:83-94.

24. Black, A. C., I. S. Y. Chen, S. Arrigo, C. T. Ruland, T. Allogiamento, E. Chin, and J. D. Rosenblatt. 1991. Regulation of HTLV-II gene expretion by rex involves positive and negative cis-Acting elements in the 5 long terminal repeat. Virology 181:433-444.

25. Black, A. C., C. Ruland, M. T. Yip, J. Luo, B. Tran, A. Kalssi, E. Quan, M. Aboud, I. S. Y. Chen, and J. D. Rosenblatt. 1991. Human T-Cell Leukemia Virus Type II Rex Binding and Activity Require an Intact splice Donor Site and a Specific RNA Secondary Structure. J. Virol. 65:6645-6653.

26. Blattner, W., V. Kalyanaraman, M. Robert-Guroff, T. Lister, D. Galton, P. S. Sarin, M. Crawford, D. Catovsky, M. Greaves, and R. C. Gallo. 1982. The human type-C retrovirus, HTLV, in blacks from the Caribbean region and relationchip to adult T-cell leukemia/lymphoma. Int. J. Cancer 30:257.

27. Blobel, G. A. 2000. CREB-binding protein and p300: molecular integrators of hematopoietic transcription. Blood 95:745-755.

28. Bogerd, H. P., A. Echarri, T. M. Ross, and B. R. Cullen. 1998. Inhibition of human immunodeficiency virus Rev and human T- cell leukemia virus Rex function, but not Mason-Pfizer monkey virus constitutive transport element activity, by a mutant human nucleoporin targeted to Crm1. J Virol 72:8627-8635.

29. Bosselut, R., J. F. Duvall, A. Gegonne, M. Bailly, A. Hemar, J. Brady, and J. Ghysdael. 1990. The product of the c-ets-1 proto- and the related Ets2 protein act as transcriptional activators of the long terminal repeat of human T cell leukemia virus HTLV-1. EMBO J. 9:3137-3144.

30. Bosselut, R., F. Lim, P. C. Romond, J. Frampton, J. Brady, and J. Ghysdael. 1992. Myb protein binds to multiple sites in the human T cell lymphotropic virus type 1 long terminal repeat and transactivates LTR-mediated expression. Virology 186:764-769.

42 31. Bouchard, M. J., L. H. Wang, and R. J. Schneider. 2001. Calcium signaling by HBx protein in virus DNA replication. Science 294:2376-2378.

32. Brady, J. N., K. T. Jeang, J. Duvall, and G. Khoury. 1987. Identification of p40x-Responsive Regulatory Sequences within the Human T-Cell Leukemia Virus Type 1 Long Terminal Repeat. J. Virol. 61:2175-2181.

33. Bramson, J. L., F. L. Graham, and J. Gauldie. 1995. The use of adenoviral vectors for gene therapy and gene transfer in vivo. Curr. Opin. Biotechnol. 6:590-595.

34. Brauweiler, A., J. E. Garrus, J. C. Reed, and J. K. Nyborg. 1997. Repression of Bax gene expression by the HTLV-I tax protein: Implications for suppression of apoptosis in virally infected cells. Virology 231:135-140.

35. Bukrinsky, M. I., N. Sharova, M. P. Dempsey, T. L. Stanwick, A. G. Bukrinskaya, S. Haggerty, and M. Stevenson. 1992. Active nuclear import of human immunodeficiency virus type 1 preintegration complexes. Proc. Natl. Acad. Sci U. S. A 89:6580-6584.

36. Bunnell, B. A., L. M. Muul, R. E. Donahue, R. M. Blaese, and R. A. Morgan. 1995. High-efficiency retroviral-mediated gene transfer into human and nonhuman primate peripheral blood lymphocytes. Proc. Natl. Acad. Sci U. S. A 92:7739-7743.

37. Cann, A. J., J. D. Rosenblatt, W. Wachsman, N. P. Shah, and I. S. Chen. 1985. Identification of the gene responsible for human T-cell leukaemia virus transcriptional regulation. Nature 318:571-574.

38. Cantrell, D. 1996. T cell antigen receptor signal transduction pathways. Annu. Rev. Immunol. 14:259-274.

39. Caplen, N. J., J. N. Higginbotham, J. R. Scheel, N. Vahanian, Y. Yoshida, H. Hamada, R. M. Blaese, and W. J. Ramsey. 1999. Adeno-retroviral chimeric viruses as in vivo transducing agents. Gene Ther. 6:454-459.

40. Castillo, L. C., F. Gracia, G. C. Roman, P. Levine, W. C. Reeves, and J. Kaplan. 2000. Spinocerebellar syndrome in patients infected with human T- lymphotropic virus types I and II (HTLV-I/HTLV-II): report of 3 cases from Panama. Acta Neurol. Scand. 101:405-412.

41. Cereseto, A., Z. Berneman, I. Koralnik, J. Vaughn, G. Franchini, and M. E. Klotman. 1997. Differential expression of alternatively spliced pX mRNAs in HTLV-I-infected cell lines. Leukemia 11:866-870.

43 42. Chan, H. M. and N. B. La Thangue. 2001. p300/CBP proteins: HATs for transcriptional bridges and scaffolds. J Cell Sci 114:2363-2373.

43. Chang, L. J. and J. He. 2001. Retroviral vectors for gene therapy of AIDS and cancer. Curr. Opin. Mol. Ther. 3:468-475.

44. Chen, B. F., L. H. Hwang, and D. S. Chen. 1993. Characterization of a bicistronic retroviral vector composed of the swine vesicular disease virus internal ribosome entry site. J Virol 67:2142-2148.

45. Chen, Y. M., S. H. Chen, C. Y. Fu, J. Y. Chen, and M. Osame. 1997. Antibody reactivities to tumor-suppressor protein p53 and HTLV-I Tof, Rex and Tax in HTLV-I-infected people with differing clinical status. International. Journal. of. Cancer 71:196-202.

46. Chou, K. S., A. Okayama, N. Tachibana, T. H. Lee, and M. Essex. 1995. Nucleotide sequence analysis of a full-length human T-cell leukemia virus type I from adult T-cell leukemia cells: A prematurely terminated pX open reading frame II. Int. J. Cancer 60:701-706.

47. Chuah, M. K., H. Brems, V. Vanslembrouck, D. Collen, and T. VandenDriessche. 1998. Bone marrow stromal cells as targets for gene therapy of hemophilia A. Hum. Gene Ther. 9:353-365.

48. Ciminale, V., D. D'Agostino, L. Zotti, G. Franchini, B. K. Felber, and L. Chieco-Bianchi. 1995. Expression and characterization of proteins produced by mRNAs spliced into the X region of the human T-cell leukemia/lymphotropic virus type II. Virology 209:445-456.

49. Ciminale, V., D. M. D'Agostino, L. Zotti, and L. Chieco-Bianchi. 1996. Coding potential of the X region of human T-cell leukemia/lymphotropic virus type II. J. Acquir. Immune. Defic. Syndr. Hum. Retrovirol. 13 Suppl 1:S220- S227.

50. Ciminale, V., G. N. Pavlakis, D. Derse, C. P. Cunningham, and B. K. Felber. 1992. Complex splicing in the human T-cell leukemia virus (HTLV) family of retroviruses: Novel mRNAs and proteins produced by HTLV type I. J. Virol. 66:1737-1745.

51. Ciminale, V., L. Zotti, D. M. Dagostino, T. Ferro, L. Casareto, G. Franchini, P. Bernardi, and L. Chiecobianchi. 1999. Mitochondrial targeting of the p13(II) protein coded by the x-II ORF of human T-cell leukemia/lymphotropic virus type I (HTLV-I). Oncogene 18:4505-4514.

44 52. Clapp, D. W., L. L. Dumenco, M. Hatzoglou, and S. L. Gerson. 1991. Fetal liver hematopoietic stem cells as a target for in utero retroviral gene transfer. Blood 78:1132-1139.

53. Clark, N. M., M. J. Smith, J. M. Hilfinger, and D. M. Markovitz. 1993. Activation of the human T-cell leukemia virus type I enhancer is mediated by binding sites for Elf-1 and the pets factor. J. Virol. 67:5522-5528.

54. Cleghorn, F. R., A. Manns, R. Falk, P. Hartge, B. Hanchard, N. Jack, E. Williams, E. Jaffe, F. White, C. Bartholomew, and W. Blattner. 1995. Effect of human T-lymphotropic virus type I infection on non- Hodgkin's lymphoma incidence. J. Nat. Cancer Inst. 87:1009-1014.

55. Coffin, J. M. 1992. Structure and Classification of Retroviruses. The Retroviridae. 1:19-49.

56. Coffin, J. M. Retroviridae: The Viruses and Their Replication. 1767-1835. 1996. Phildaelphia, PA, Lippinocott-Raven Publishers.

57. Coffin, J. M., S. H. Hughes, and H. Varmus. 2001. Retroviruses. CHSL Pr, Plainview, N.Y.

58. Colgin, M. A. and J. K. Nyborg. 1998. The human T-cell leukemia virus type 1 oncoprotein Tax inhibits the transcriptional activity of c-Myb through competition for the CREB binding protein. J. Virol. 72:9396-9399.

59. Collins, N. D., C. D'Souza, B. Albrecht, M. D. Robek, L. Ratner, W. Ding, P. L. Green, and M. D. Lairmore. 1999. Proliferation response to interleukin-2 and Jak/Stat activation of T cells immortalized by human T-cell lymphotropic virus type 1 is independent of open reading frame I expression. J. Virol. 73:9642-9649.

60. Collins, N. D., G. C. Newbound, B. Albrecht, J. L. Beard, L. Ratner, and M. D. Lairmore. 1998. Selective ablation of human T-cell lymphotropic virus type 1 p12I reduces viral infectivity in vivo. Blood 91:4701-4707.

61. Coscoy, L. and D. Ganem. 2003. PHD domains and E3 ubiquitin ligases: viruses make the connection. Trends Cell Biol. 13:7-12.

62. Courouce, A. M., J. Pillonel, J. M. Lemaire, and C. Saura. 1998. HTLV testing in blood transfusion. Vox Sang. 74 Suppl 2:165-169.

63. Cowan, E. P., R. K. Alexander, S. Daniel, F. Kashanchi, and J. N. Brady. 1997. Induction of tumor necrosis factor alpha in human neuronal cells by extracellular human T-cell lymphotropic virus type 1 Tax(1). J. Virol. 71:6982- 6989.

45 64. Crabtree, G. R. 2001. Calcium, calcineurin, and the control of transcription. J. Biol. Chem. 276:2313-2316.

65. Craig, H. M., T. R. Reddy, N. L. Riggs, P. P. Dao, and J. C. Guatelli. 2000. Interactions of HIV-1 nef with the mu subunits of adaptor protein complexes 1, 2, and 3: role of the dileucine-based sorting motif. Virology 271:9-17.

66. Cullen, B. R. 1998. Retroviruses as model systems for the study of nuclear RNA export pathways. Virology 249:203-210.

67. D'Agostino, D. M., L. Ranzato, G. Arrigoni, I. Cavallari, F. Belleudi, M. R. Torrisi, M. Silic-Benussi, T. Ferro, V. Petronilli, O. Marin, L. Chieco- Bianchi, P. Bernardi, and V. Ciminale. 2002. Mitochondrial alterations induced by the p13II protein of human T-cell leukemia virus type 1. Critical role of arginine residues. J Biol. Chem. 277:34424-34433.

68. D'Agostino, D. M., L. Zotti, T. Ferro, G. Franchini, L. Chieco-Bianchi, and V. Ciminale. 2000. The p13II protein of HTLV type 1: comparison with mitochondrial proteins coded by other human viruses. AIDS Res. Hum. Retroviruses 16:1765-1770.

69. Daenke, S., S. Nightingale, J. K. Cruickshank, and C. R. M. Bangham. 1990. Sequence variants of human T-cell lymphotropic virus type I from patients with tropical spastic paraparesis and adult T-cell leukemia do not distinguish neurological from leukemic isolates. J. Virol. 64:1278-1282.

70. Daly, T. J., R. C. Doten, P. Rennert, M. Auer, H. Jaksche, A. Donner, G. Fisk, and J. R. Rusche. 1993. Biochemical characterization of binding of multiple HIV-1 Rev monomeric proteins to the Rev responsive element. Biochemistry 32:10497-10505.

71. Dantuma, N. P. and M. G. Masucci. 2003. The ubiquitin/proteasome system in Epstein-Barr virus latency and associated malignancies. Semin. Cancer Biol. 13:69-76.

72. Datta, S., N. H. Kothari, and H. Fan. 2000. In vivo genomic footprinting of the human T-cell leukemia virus type 1 (HTLV-1) long terminal repeat enhancer sequences in HTLV-1-infected human T-cell lines with different levels of Tax I activity. J. Virol. 74:8277-8285.

73. Dekaban, G. A., A. A. Peters, J. C. Mulloy, J. M. Johnson, R. Trovato, E. Rivadeneira, and G. Franchini. 2000. The HTLV-I orfI protein is recognized by serum antibodies from naturally infected and experimentally infected rabbits. Virology 274:86-93.

46 74. Derse, D. 1987. Bovine leukemia virus transcription is controlled by a virus- encoded trans-acting factor and by cis-acting response elements. J Virol 61:2462-2471.

75. Derse, D., J. Mikovits, and F. Ruscetti. 1997. X-I and X-II open reading frames of HTLV-I are not required for virus replication or for immortalization of primary T-cells in vitro. Virology 237:123-128.

76. Ding, W., Albrecht B., R. E. Kelley, N. Muthusamy, S. Kim, R. A. Altschuld, and M. D. Lairmore. 2002. Human T lymphotropic virus type 1 p12(I) expression increases cytoplasmic calcium to enhance the activation of nuclear factor of activated T cells. J Virol 76:10374-10382.

77. Ding, W., B. Albrecht, R. Luo, W. Zhang, J. R. Stanley, G. C. Newbound, and M. D. Lairmore. 2001. Endoplasmic Reticulum and cis-Golgi Localization of Human T- Lymphotropic Virus Type 1 p12(I): Association with Calreticulin and Calnexin. J. Virol. 75:7672-7682.

78. Ding, W., S. J. Kim, A. M. Nair, B. Michael, K. Boris-Lawrie, A. Tripp, G. Feuer, and M. D. Lairmore. 2003. Human T-Cell Lymphotropic Virus Type 1 p12(I) Enhances Interleukin-2 Production during T-Cell Activation. J Virol 77:11027-11039.

79. Ding, W., S. J. Kim, A. M. Nair, B. Michael, K. Boris-Lawrie, A. Tripp, G. Feuer, and M. D. Lairmore. 2003. Human T-cell lymphotropic virus type 1 p12I enhances interleukin-2 production during T-cell activation. J Virol 77:11027-11039.

80. Dolmetsch, R. E., R. S. Lewis, C. C. Goodnow, and J. I. Healy. 1997. Differential activation of transcription factors induced by Ca2+ response amplitude and duration. Nature 386:855-858.

81. Dolmetsch, R. E., K. Xu, and R. S. Lewis. 1998. Calcium oscillations increase the efficiency and specificity of gene expression. Nature 392:933-936.

82. Douar, A. M., S. Adebakin, M. Themis, A. Pavirani, T. Cook, and C. Coutelle. 1997. Foetal gene delivery in mice by intra-amniotic administration of retroviral producer cells and adenovirus. Gene Ther. 4:883-890.

83. Douar, A. M., M. Themis, V. Sandig, T. Friedmann, and C. Coutelle. 1996. Effect of amniotic fluid on cationic lipid mediated transfection and retroviral infection. Gene Ther. 3:789-796.

47 84. Duyao, M. P., D. J. Kessler, D. B. Spicer, C. Bartholomew, J. L. Cleveland, M. Siekevitz, and G. E. Sonenshein. 1992. Transactivation of the c-myc Promoter by Human T Cell Leukemia virus Type 1 tax is Mediated by NFkB. J. Biol. Chem. 267:16288-16291.

85. Edlich, R. F., J. A. Arnette, and F. M. Williams. 2000. Global epidemic of human T-cell lymphotropic virus type-I (HTLV-I). J. Emerg. Med. 18:109-119.

86. Emerman, M. and H. M. Temin. 1984. Genes with promoters in retrovirus vectors can be independently suppressed by an epigenetic mechanism. Cell 39:449-467.

87. Emerman, M. and H. M. Temin. 1986. Comparison of promoter suppression in avian and murine retrovirus vectors. Nucleic Acids Res. 14:9381-9396.

88. Evangelista, A., S. Maroushek, H. Minnigan, A. Larson, E. Retzel, A. Haase, D. Gonzalez-Dunia, D. McFarlin, E. Mingioli, S. Jacobson, and . 1990. Nucleotide sequence analysis of a provirus derived from an individual with tropical spastic paraparesis. Microb. Pathog. 8:259-278.

89. Felber, B. K., H. Paskalis, and C. Kleinmanewing. 1985. The pX Protein of HTLV-1 is a Transcriptional Activator of its Long Terminal Repeats. Science 229:675-679.

90. Feng, P., J. Park, B. S. Lee, S. H. Lee, R. J. Bram, and J. U. Jung. 2002. Kaposi's sarcoma-associated herpesvirus mitochondrial K7 protein targets a cellular calcium-modulating cyclophilin ligand to modulate intracellular calcium concentration and inhibit apoptosis. J Virol 76:11491-11504.

91. Ferreira, O. C., V. Planelles, and J. D. Rosenblatt. 1997. Human T-cell leukemia viruses: Epidemiology, biology, and pathogenesis. Blood Rev. 11:91- 104.

92. Feske, S., J. Giltnane, R. Dolmetsch, L. M. Staudt, and A. Rao. 2001. Gene regulation mediated by calcium signals in T lymphocytes. Nat. Immunol. 2:316- 324.

93. Fink, D. J. and J. C. Glorioso. 1997. -based vectors: problems and some solutions. Adv. Neurol. 72:149-156.

94. Franchini, G. 1995. Molecular mechanisms of human T-cell leukemia/lymphotropic virus type I infection. Blood 86:3619-3639.

48 95. Franchini, G., J. C. Mulloy, I. J. Koralnik, M. A. Lo, J. J. Sparkowski, T. Andresson, D. J. Goldstein, and R. Schlegel. 1993. The human T-cell leukemia/lymphotropic virus type I p12I protein cooperates with the E5 oncoprotein of bovine papillomavirus in cell transformation and binds the 16- kilodalton subunit of the vacuolar H+ ATPase. J Virol 67:7701-7704.

96. Franchini, G., F. Wong-Staal, and R. C. Gallo. 1984. Human T-cell leukemia virus (HTLV-I) transcripts in fresh and cultured cells of patients with adult T- cell leukemia. Proc. Natl. Acad. Sci. U. S. A 81:6207-6211.

97. Franchini, G., F. Wong-Staal, and R. C. Gallo. 1984. Molecular studies of human T-cell leukemia virus and adult T-cell leukemia. J Invest Dermatol. 83:63s-66s.

98. Fujii, M., P. Sassone-Corsi, and I. Verma. 1988. c-fos promotor trans- activation of cAMP on IL-2 stimulated gene expression. Proc. Natl. Acad. Sci. U. S. A.8526-8530.

99. Fujii, M., H. Tsuchiya, T. Chuhjo, T. Akizawa, and M. Seiki. 1992. Interaction of HTLV-1 Tax1 with p67SRF causes the aberrant induction of cellular immediate early genes through CArG boxes. Genes Dev. 6:2066-2076.

100. Fujii, M., H. Tsuchiya, X. B. Meng, and M. Seiki. 1995. c-Jun, c-Fos and their family members activate the transcription mediated by three 21-bp repetitive sequences in the HTLV-I long terminal repeat. Intervirology 38:221-228.

101. Fujisawa, J., M. Seiki, T. Kiyokawa, and M. Yoshida. 1985. Functional activation of the long terminal repeat of human T-cell leukemia virus type 1 by a trans-acting factor. Proc. Natl. Acad. Sci. USA 82:2277-2281.

102. Fukushima, T., T. Ikeda, E. Uyama, M. Uchino, H. Okabe, and M. Ando. 1994. Cognitive event-related potentials and brain magnetic resonance imaging in HTLV-1 associated myelopathy (HAM). J. Neurol. Sci. 126:30-39.

103. Furukawa, K., K. Furukawa, and H. Shiku. 1991. Alternatively spliced mRNA of the pX region of human T lymphotropic virus type I proviral genome. FEBS Lett. 295:141-145.

104. Furukawa, Y., R. Kubota, N. Eiraku, M. Nakagawa, K. Usuku, S. Izumo, and M. Osame. 2003. Human T-cell lymphotropic virus type I (HTLV-I)- related clinical and laboratory findings for HTLV-I-infected blood donors. J Acquir. Immune. Defic. Syndr. 32:328-334.

105. Ganem, D. 2001. Virology. The X files--one step closer to closure. Science 294:2299-2300.

49 106. Gatza, M. L., J. C. Watt, and S. J. Marriott. 2003. Cellular transformation by the HTLV-I Tax protein, a jack-of-all-trades. Oncogene 22:5141-5149.

107. Gessain, A. 1996. Virological aspects of tropical spastic paraparesis/HTLV-I associated myelopathy and HTLV-I infection. J. Neurovirology. 2:299-306.

108. Gessain, A., F. Barin, J. Vernant, O. Gout, L. Maurs, A. Calender, and G. Dethe. 1985. Antibodies to human T lymphotropic virus type 1 in patients with tropical spastic paresis. Lancet 2:407-410.

109. Gessain, A. and R. Mahieux. 2000. [A virus called HTLV-1. Epidemiological aspects]. Presse Med. 29:2233-2239.

110. Giordano, A. and M. L. Avantaggiati. 1999. p300 and CBP: partners for life and death. J. Cell Physiol 181:218-230.

111. Godoy, A. J., J. Kira, K. Hasuo, and I. Goto. 1995. Characterization of cerebral white matter lesions of HTLV- I- associated myelopathy tropical spastic paraparesis in comparison with multiple sclerosis and collagen-vasculitis: A semiquantitative MRI study. J. Neurol. Sci. 133:102-111.

112. Goodman, R. H. and S. Smolik. 2000. CBP/p300 in cell growth, transformation, and development. Genes Dev. 14:1553-1577.

113. Gould, K. G. and C. R. Bangham. 1998. Virus variation, escape from cytotoxic T lymphocytes and human retroviral persistence. Semin Cell Dev Biol 9:321-328.

114. Grant, C., K. Barmak, T. Alefantis, J. Yao, S. Jacobson, and B. Wigdahl. 2002. Human T cell leukemia virus type I and neurologic disease: events in bone marrow, peripheral blood, and central nervous system during normal immune surveillance and neuroinflammation. J. Cell Physiol 190:133-159.

115. Green P.L. and Chen, B. K. Molecular features of the human T-cell leukemia virus: Mechanisms of transfromation and leukemogenicity. The Retroviridae. Vol. 3 (Levy J, ed.), 277-298. 1994. Plenum Publishing Corp. New York.

116. Green P.L. and I. S. Y. Chen. 2000. Human T-cell leukemia virus types 1 and 2, p. 1941-1969. Lippincott, Williams & Wilkins.

117. Green, P. L. and I. S. Y. Chen. 1990. Regulation of human T cell leukemia virus expression. FASEB J. 4:169-175.

118. Green, P. L. and I. S. Y. Chen. 1994. Molecular features of the human T-cell leukemia virus. Mechanisms of transformation and leukemogenicity., p. 277-311. In J. A. Levy (ed.), The Retroviridae. Plenum Press, New York.

50 119. Hai, T. W., F. Liu, W. J. Coukos, and M. R. Green. 1989. ATF cDNA clones: an extensive family of leucine zipper proteins able to selectively form DNA-binding heterodimers. Genes Dev. 3:2083-2090.

120. Hakata, Y., T. Umemoto, S. Matsushita, and H. Shida. 1998. Involvement of human CRM1 (exportin 1) in the export and multimerization of the Rex protein of human T-cell leukemia virus type 1. J Virol 72:6602-6607.

121. Harrod, R., Y. L. Kuo, Y. Tang, Y. Yao, A. Vassilev, Y. Nakatani, and C. Z. Giam. 2000. p300 and p300/cAMP-responsive element-binding protein associated factor interact with human T-cell lymphotropic virus type-1 Tax in a multi- histone acetyltransferase/activator-enhancer complex. J. Biol. Chem. 275:11852-11857.

122. Harrod, R., Y. Tang, C. Nicot, H. S. Lu, A. Vassilev, Y. Nakatani, and C. Z. Giam. 1998. An exposed KID-like domain in human T-cell lymphotropic virus type 1 Tax is responsible for the recruitment of coactivators CBP/p300. Mol. Cell Biol. 18:5052-5061.

123. Hattori, S., T. Kiyokawa, K. Imagawa, F. Shimizu, E. Hashimura, M. Seiki, and M. Yoshida. 1984. Identification of gag and env gene products of human T-cell leukemia virus (HTLV). Virology 136:338-347.

124. Hino, S. 1989. Milk-borne transmission of HTLV-I as a major route in the endemic cycle. Acta Paediatr. Jpn. 31:428-435.

125. Hino, S., K. Yamaguchi, S. Katamine, H. Sugiyama, T. Amagasaki, K. Kinoshita, Y. Yoshida, H. Doi, Y. Tsuji, and T. Miyamoto. 1985. Mother-to- child transmission of human T-cell leukemia virus type-I. Jpn. J. Cancer Res. 76:474-480.

126. Hinuma, Y., H. Komoda, T. Chosa, T. Kondo, M. Kohakura, T. Takenaka, M. Kikuchi, M. Ichimaru, K. Yunoki, I. Sato, R. Matsuo, Y. Takiuchi, H. Uchino, and M. Hanaoka. 1982. Antibodies to adult T-cell leukemia virus- associated antigen (ATLA) in sera from patients with ATL and controls in Japan: a nation-wide seroepidemiological study. Int. J. Cancer 29:631.

127. Hinuma, Y., K. Nagata, M. Hanaoka, M. Nakai, T. Matsumoto, K. Shirakawa, and I. Miyoshi. 1981. Adult T Cell Leukemia: Antigens in an ATL cell line and detection of antibodies to antigen in human sera. Proc. Natl. Acad. Sci. U. S. A. 78:6476-6480.

128. Holladay, S. D. and R. J. Smialowicz. 2000. Development of the murine and human immune system: differential effects of immunotoxicants depend on time of exposure. Environ. Health Perspect. 108 Suppl 3:463-473.

51 129. Hollsberg, P., K. W. Wucherpfennig, L. J. Ausubel, V. Calvo, B. E. Bierer, and D. A. Hafler. 1992. Characterization of HTLV-1 In Vivo Infected T Cell Clones IL-2-independent Growth of Nontransformed T Cells. J. Immunol. 148:3256-3263.

130. Hottiger, M. O., L. K. Felzien, and G. J. Nabel. 1998. Modulation of cytokine-induced HIV gene expression by competitive binding of transcription factors to the coactivator p300. EMBO J. 17:3124-3134.

131. Hottiger, M. O. and G. J. Nabel. 2000. Viral replication and the coactivators p300 and CBP. Trends Microbiol. 8:560-565.

132. Hou, X., S. Foley, M. Cueto, and M. A. Robinson. 2000. The Human T-Cell Leukemia Virus Type I (HTLV-I) X Region Encoded Protein p13(II) Interacts with Cellular Proteins. Virology 277:127-135.

133. Inoue, J., M. Seiki, and M. Yoshida. 1986. The second pX product p27 chi-III of HTLV-1 is required for gag gene expression. FEBS Lett. 209:187-190.

134. Inoue, J., M. Yoshida, and M. Seiki. 1987. Transcriptional (p40x) and post- transcriptional (p27x-III) regulators are required for the expression and replication of human t-cell leukemia virus type I genes. Proc. Natl. Acad. Sci. USA 84:3653-3657.

135. Jacobson, S. 2002. Immunopathogenesis of human T cell lymphotropic virus type I-associated neurologic disease. J Infect. Dis. 186 Suppl 2:S187-S192.

136. Janknecht, R. 2002. The versatile functions of the transcriptional coactivators p300 and CBP and their roles in disease. Histol. Histopathol. 17:657-668.

137. Janssens, W., M. K. Chuah, L. Naldini, A. Follenzi, D. Collen, J. M. Saint- Remy, and T. VandenDriessche. 2003. Efficiency of onco-retroviral and lentiviral gene transfer into primary mouse and human B-lymphocytes is pseudotype dependent. Hum. Gene Ther. 14:263-276.

138. Jeang, K. T., R. Chiu, E. Santos, and S. J. Kim. 1991. Induction of the HTLV-I LTR by Jun occurs through the Tax-responsive 21- bp elements. Virology 181:218-227.

139. Jeang, K. T., S. G. Widen, O. J. Semmes, and S. H. Wilson. 1990. HTLV-1 Trans-Activator Protein, Tax, Is a Trans-Repressor of the Human B-Ploymerase Gene. Science 247:1082-1083.

52 140. Jiang, H., H. Lu, R. L. Schiltz, C. A. Pise-Masison, V. V. Ogryzko, Y. Nakatani, and J. N. Brady. 1999. PCAF interacts with tax and stimulates tax transactivation in a histone acetyltransferase-independent manner [published erratum appears in Mol Cell Biol 2000 Mar;20(5):1897]. Mol. Cell Biol. 19:8136-8145.

141. Johnson, J. M. and G. Franchini. 2002. Retroviral proteins that target the major histocompatibility complex class I. Virus Res. 88:119-127.

142. Johnson, J. M., J. C. Mulloy, V. Ciminale, J. Fullen, C. Nicot, and G. Franchini. 2000. The MHC class I heavy chain is a common target of the small proteins encoded by the 3' end of HTLV type 1 and HTLV type 2. AIDS Res. Hum. Retroviruses 16:1777-1781.

143. Johnson, J. M., C. Nicot, J. Fullen, V. Ciminale, L. Casareto, J. C. Mulloy, S. Jacobson, and G. Franchini. 2001. Free Major Histocompatibility Complex Class I Heavy Chain Is Preferentially Targeted for Degradation by Human T- Cell Leukemia/Lymphotropic Virus Type 1 p12(I) Protein. J. Virol. 75:6086- 6094.

144. Kanamori, H., N. Suzuki, H. Siomi, T. Nosaka, A. Sato, H. Sabe, M. Hatanaka, and T. Honjo. 1990. HTLV-1 p27rex stabilizes human interleukin-2 receptor alpha chain mRNA. EMBO J. 9:4161-4166.

145. Kasahata, N., J. Shiota, Y. Miyazawa, I. Nakano, and S. Murayama. 2003. Acute human T-lymphotropic virus type 1-associated myelopathy: a clinicopathologic study. Arch. Neurol. 60:873-876.

146. Kashanchi, F., J. F. Duvall, R. P. Kwok, J. R. Lundblad, R. H. Goodman, and J. N. Brady. 1998. The coactivator CBP stimulates human T-cell lymphotrophic virus type I Tax transactivation in vitro. J. Biol. Chem. 273:34646-34652.

147. Kawakami, K., A. Miyazato, Y. Iwakura, and A. Saito. 1999. Induction of lymphocytic inflammatory changes in lung interstitium by human T lymphotropic virus type I. AMER J RESPIR CRIT CARE MED 160:995-1000.

148. Kawano, F., K. Yamaguchi, H. Nishimura, H. Tsuda, and K. Takatsuki. 1985. Variation in the clinical courses of adult T-cell leukemia. Cancer 55:851- 856.

149. Khabbaz, R. F., J. M. Douglas, F. N. Judson, R. A. Spiegel, M. E. St Louis, W. Whittington, T. M. Hartley, M. Lairmore, and J. E. Kaplan. 1990. Seroprevalence of human T-lymphotropic virus type I or II in sexually transmitted disease clinic patients in the USA. J. Infect. Dis. 162:241-244.

53 150. Khabbaz, R. F., I. M. Onorato, R. O. Cannon, T. M. Hartley, B. Roberts, B. Hosein, and J. E. Kaplan. 1992. Seroprevalence of HTLV-1 and HTLV-2 among intravenous drug users and persons in clinics for sexually transmitted diseases. N. Engl. J. Med. 326:375-380.

151. Kim, J. H., P. A. Kaufman, S. M. Hanly, L. T. Rimsky, and W. C. Greene. 1991. Rex transregulation of human T-cell leukemia virus type II gene expression. J. Virol. 65:405-414.

152. Kim, S. J., W. Ding, B. Albrecht, P. L. Green, and M. D. Lairmore. 2003. A conserved calcineurin-binding motif in human T lymphotropic virus type 1 p12I functions to modulate nuclear factor of activated T cell activation. J Biol. Chem. 278:15550-15557.

153. Kimura, I., T. Tsubota, S. Tada, and J. Sogawa. 1986. Presence of antibodies against adult T cell leukemia antigen in the patients with chronic respiratory diseases. Acta Med. Okayama 40:281-284.

154. Kimzey, A. L. and W. S. Dynan. 1998. Specific regions of contact between human T-cell leukemia virus type I Tax protein and DNA identified by photocross- linking. J Biol Chem 273:13768-13775.

155. Kimzey, A. L. and W. S. Dynan. 1999. Identification of a human T-cell leukemia virus type I tax peptide in contact with DNA. J Biol Chem 274:34226- 34232.

156. Kira, J., I. Goto, M. Otsuka, and Y. Ichiya. 1993. Chronic Progressive Spinocerebellar Syndrome Associated with Antibodies to Human T- Lymphotropic Virus Type-I - Clinico- Virological and Magnetic Resonance Imaging Studies. J. Neurol. Sci. 115:111-116.

157. Kira, J. I., K. Fujihara, Y. Itoyama, I. Goto, and K. Hasuo. 1991. Leukoencephalopathy in HTLV-I-associated mylopathy/ tropical spastic paraparesis: MRI analysis and a two year follow up study after corticosteroid therapy. J. Neurol. Sci. 106:41-49.

158. Kitado, H., I. S. Chen, N. P. Shah, A. J. Cann, K. Shimotohno, and H. Fan. 1987. U3 sequences from HTLV-I and -II LTRs confer pX protein response to a murine leukemia virus LTR. Science 235:901-904.

159. Kitze, B. and K. Usuku. 2002. HTLV-1-mediated immunopathological CNS disease. Curr. Top. Microbiol. Immunol. 265:197-211.

54 160. Kiwaki, T., F. Umehara, Y. Arimura, S. Izumo, K. Arimura, K. Itoh, and M. Osame. 2003. The clinical and pathological features of peripheral neuropathy accompanied with HTLV-I associated myelopathy. J Neurol. Sci. 206:17-21.

161. Kiyokawa, T., M. Seiki, S. Iwashita, K. Imagawa, F. Shimizu, and M. Yoshida. 1985. p27x-III and p21x-III, proteins encoded by the pX sequence of human T-cell leukemia virus type 1. Proc. Natl. Acad. Sci. USA 82:8359-8363.

162. Kootstra, N. A. and I. M. Verma. 2003. Gene therapy with viral vectors. Annu. Rev. Pharmacol. Toxicol. 43:413-439.

163. Koralnik, I. J., J. Fullen, and G. Franchini. 1993. The p12I, p13II, and p30II proteins encoded by human T-cell leukemia/lymphotropic virus type I open reading frames I and II are localized in three different cellular compartments. J Virol 67:2360-2366.

164. Koralnik, I. J., A. Gessain, M. E. Klotman, A. Lo Monico, Z. N. Berneman, and G. Franchini. 1992. Protein isoforms encoded by the pX region of human T-cell leukemia/lymphotropic virus type 1. Proc. Natl. Acad. Sci. USA 89:8813- 8817.

165. Koralnik, I. J., A. Gessain, M. E. Klotman, M. A. Lo, Z. N. Berneman, and G. Franchini. 1992. Protein isoforms encoded by the pX region of human T- cell leukemia/lymphotropic virus type I. Proc. Natl. Acad. Sci U. S. A 89:8813- 8817.

166. Koralnik, I. J., J. C. Mulloy, T. Andresson, J. Fullen, and G. Franchini. 1995. Mapping of the intermolecular association of human T cell leukaemia/lymphotropic virus type I p12I and the vacuolar H+-ATPase 16 kDa subunit protein. J Gen. Virol 76 ( Pt 8):1909-1916.

167. Korber, B., A. Okayama, R. Donnelly, N. Tachibana, and M. Essex. 1991. Polymerase chain reaction analysis of defective human T-cell leukemia virus type 1 proviral in leukemic cells of patients with adult T-cell leukemia. J. Virol. 65:5471-5476.

168. Kubota, R., S. S. Soldan, R. Martin, and S. Jacobson. 2002. Selected cytotoxic T lymphocytes with high specificity for HTLV-I in cerebrospinal fluid from a HAM/TSP patient. J. Neurovirol. 8:53-57.

169. Kurata, H., H. J. Lee, A. O'Garra, and N. Arai. 1999. Ectopic expression of activated Stat6 induces the expression of Th2-specific cytokines and transcription factors in developing Th1 cells. . 11:677-688.

170. Kuroda, Y. and M. Matsui. 1993. Cerebrospinal Fluid Interferon-Gamma Is Increased in HTLV- I- Associated Myelopathy. J. Neuroimmunol. 42:223-226.

55 171. Lagrenade, L., B. Hanchard, V. Fletcher, B. Cranston, and W. Blattner. 1990. Infective dermatitis of Jamaican children: a marker for HTLV-I infection. Lancet 336:1345-1347.

172. Lairmore, M. D., B. Albrecht, C. D'Souza, J. W. Nisbet, W. Ding, J. T. Bartoe, P. L. Green, and W. Zhang. 2000. In vitro and in vivo functional analysis of human T cell lymphotropic virus type 1 pX open reading frames I and II. AIDS Res. Hum. Retroviruses 16:1757-1764.

173. Lairmore, M. D. and R. Lal. 1995. Other Human Retrovirus Infections: HTLV-I and HTLV-II, p. 168-188. In G. Schocketman and J. R. George (eds.), AIDS Testing. Methodology and Management Issues. Springer-Verlag, New York.

174. Larson, J. E., S. L. Morrow, J. B. Delcarpio, R. P. Bohm, M. S. Ratterree, J. L. Blanchard, and J. C. Cohen. 2000. Gene transfer into the fetal primate: evidence for the of transgene product. Mol. Ther. 2:631-639.

175. Larson, J. E., S. L. Morrow, L. Happel, J. F. Sharp, and J. C. Cohen. 1997. Reversal of cystic fibrosis phenotype in mice by gene therapy in utero. Lancet 349:619-620.

176. Le, B., I, A. R. Rosenberg, and M. C. Dokhelar. 1999. Multiple functions for the basic amino acids of the human T-cell leukemia virus type 1 matrix protein in viral transmission. J Virol 73:1860-1867.

177. Lefebvre, L., V. Ciminale, A. Vanderplasschen, D. D'Agostino, A. Burny, L. Willems, and R. Kettmann. 2002. Subcellular localization of the bovine leukemia virus R3 and G4 accessory proteins. J Virol 76:7843-7854.

178. Lefebvre, L., A. Vanderplasschen, V. Ciminale, H. Heremans, O. Dangoisse, J. C. Jauniaux, J. F. Toussaint, V. Zelnik, A. Burny, R. Kettmann, and L. Willems. 2002. Oncoviral BLV G4 and Human T-Cell Leukemia Virus Type 1 p13(II) Accessory Proteins Interact with Farnesyl Pyrophosphate Synthetase. J. Virol. 76:1400-1414.

179. Lemasson, I., N. J. Polakowski, P. J. Laybourn, and J. K. Nyborg. 2002. Transcription factor binding and histone modifications on the integrated proviral promoter in human T-cell leukemia virus-I-infected T-cells. J Biol. Chem. 277:49459-49465.

180. Lemasson, I., V. Roberthebmann, S. Hamaia, M. D. Dodon, L. Gazzolo, and C. Devaux. 1997. Transrepression of lck gene expression by human T-cell leukemia virus type 1-encoded p40(tax). J. Virol. 71:1975-1983.

56 181. Lenzmeier, B. A., E. E. Baird, P. B. Dervan, and J. K. Nyborg. 1999. The Tax protein-DNA interaction is essential for HTLV-I transactivation in vitro. J Mol Biol 291:731-744.

182. Leonmonzon, M., I. Illa, and M. C. Dalakas. 1994. Polymyositis in patients infected with human T-cell leukemia virus type I: The role of the virus in the cause of the disease. Ann. Neurol. 36:643-649.

183. Levin, M. C., S. M. Lee, F. Kalume, Y. Morcos, F. C. Dohan, Jr., K. A. Hasty, J. C. Callaway, J. Zunt, D. Desiderio, and J. M. Stuart. 2002. Autoimmunity due to molecular mimicry as a cause of neurological disease. Nat. Med. 8:509-513.

184. Levin, M. C., S. M. Lee, Y. Morcos, J. Brady, and J. Stuart. 2002. Cross- reactivity between immunodominant human T lymphotropic virus type I tax and neurons: implications for molecular mimicry. J Infect. Dis. 186:1514-1517.

185. Levin, M. C., T. J. Lehky, A. N. Flerlage, D. Katz, D. W. Kingma, E. S. Jaffe, J. D. Heiss, N. Patronas, H. F. Mcfarland, and S. Jacobson. 1997. Immunologic analysis of a spinal cord-biopsy specimen from a patient with human T-cell lymphotropic virus type I-associated neurologic disease. N. Engl. J Med. 336:839-845.

186. Lewis, R. S. 2001. Calcium signaling mechanisms in T lymphocytes. Annu. Rev. Immunol. 19:497-521.:497-521.

187. Li, C. C., F. W. Ruscetti, N. R. Rice, E. Chen, N. S. Yang, J. Mikovits, and D. L. Longo. 1993. Differential expression of Rel family members in human T- cell leukemia virus type I-infected cells: transcriptional activation of c-rel by Tax protein. J. Virol. 67:4205-4213.

188. Li, H. C., T. Fujiyoshi, H. Lou, S. Yashiki, S. Sonoda, L. Cartier, L. Nunez, I. Munoz, S. Horai, and K. Tajima. 1999. The presence of ancient human T- cell lymphotropic virus type I provirus DNA in an Andean mummy. NATURE MED 5:1428-1432.

189. Li, M., B. Damania, X. Alvarez, V. Ogryzko, K. Ozato, and J. U. Jung. 2000. Inhibition of p300 histone acetyltransferase by viral interferon regulatory factor. Mol. Cell Biol. 20:8254-8263.

190. Li, W., J. Llopis, M. Whitney, G. Zlokarnik, and R. Y. Tsien. 1998. Cell- permeant caged InsP3 ester shows that Ca2+ spike frequency can optimize gene expression. Nature 392:936-941.

57 191. Li-Weber, M., M. Giaisi, K. Chlichlia, K. Khazaie, and P. H. Krammer. 2001. Human T cell leukemia virus type I Tax enhances IL-4 gene expression in T cells. Eur. J Immunol. 31:2623-2632.

192. Liang, M. H., T. Geisbert, Y. Yao, S. H. Hinrichs, and C. Z. Giam. 2002. Human T-lymphotropic virus type 1 oncoprotein tax promotes S-phase entry but blocks mitosis. J Virol 76:4022-4033.

193. Lindholm, P. F., R. L. Reid, and J. N. Brady. 1992. Extracellular Tax Protein Stimulates Tumor Necrosis Factor-B and Immunoglobulin Kappa Light Chain Expression in Lymphoid Cells. J. Virol. 66:1294-1302.

194. Lipshutz, G. S., L. Flebbe-Rehwaldt, and K. M. Gaensler. 1999. Adenovirus- mediated gene transfer to the peritoneum and hepatic parenchyma of fetal mice in utero. Surgery 126:171-177.

195. Lois, C., Y. Refaeli, X. F. Qin, and L. Van Parijs. 2001. Retroviruses as tools to study the immune system. Curr. Opin. Immunol. 13:496-504.

196. Lombard Platet, G. and P. Jalinot. 1993. Purification by DNA affinity precipitation of the cellular factors HEB1-p67 and HEB1-p94 which bind specifically to the human T-cell leukemia virus type-I 21 bp enhancer. Nucleic. Acids. Res. 21:3935-3942.

197. Lu, X., H. Yu, S. H. Liu, F. M. Brodsky, and B. M. Peterlin. 1998. Interactions between HIV1 Nef and vacuolar ATPase facilitate the internalization of CD4. Immunity. 8:647-656.

198. Lundblad, J. R., R. P. Kwok, M. E. Laurance, M. S. Huang, J. P. Richards, R. G. Brennan, and R. H. Goodman. 1998. The human T-cell leukemia virus- 1 transcriptional activator Tax enhances cAMP-responsive element-binding protein (CREB) binding activity through interactions with the DNA minor groove. J Biol Chem 273:19251-19259.

199. MacKenzie, T. C., G. P. Kobinger, N. A. Kootstra, A. Radu, M. Sena- Esteves, S. Bouchard, J. M. Wilson, I. M. Verma, and A. W. Flake. 2002. Efficient transduction of liver and muscle after in utero injection of lentiviral vectors with different pseudotypes. Mol. Ther. 6:349-358.

200. Madore, S. J., L. S. Tiley, M. H. Malim, and B. R. Cullen. 1994. Sequence requirements for Rev multimerization in vivo. Virology 202:186-194.

58 201. Mahieux, R., F. Ibrahim, P. Mauclere, V. Herve, P. Michel, F. Tekaia, C. Chappey, B. Garin, E. Vanderryst, B. Guillemain, E. Ledru, E. Delaporte, G. Dethe, and A. Gessain. 1997. Molecular epidemiology of 58 new African human T-cell leukemia virus type 1 (HTLV-1) strains: Identification of a new and distinct HTLV-1 molecular subtype in central Africa and in pygmies. J. Virol. 71:1317-1333.

202. Manel, N., F. J. Kim, S. Kinet, N. Taylor, M. Sitbon, and J. L. Battini. 2003. The ubiquitous glucose transporter GLUT-1 is a receptor for HTLV. Cell 115:449-459.

203. Manninen, A., P. Huotari, M. Hiipakka, G. H. Renkema, and K. Saksela. 2001. Activation of NFAT-dependent gene expression by Nef: conservation among divergent Nef alleles, dependence on SH3 binding and membrane association, and cooperation with protein kinase C-theta. J. Virol. 75:3034-3037.

204. Manninen, A. and K. Saksela. 2002. HIV-1 Nef Interacts with Inositol Trisphosphate Receptor to Activate Calcium Signaling in T Cells. J. Exp. Med. 195:1023-1032.

205. Manninen, A. and K. Saksela. 2002. HIV-1 Nef interacts with inositol trisphosphate receptor to activate calcium signaling in T cells. J Exp. Med. 195:1023-1032.

206. Manns, A., R. J. Wilks, E. L. Murphy, G. Haynes, J. P. Figueroa, M. Barnett, B. Hanchard, and W. A. Blattner. 1992. A prospective study of transmission by transfusion of HTLV-I and risk factors associated with seroconversion. Int. J. Cancer 51:886-891.

207. Marriott, S. J., P. F. Lindholm, K. M. Brown, S. D. Gitlin, J. F. Duvall, M. F. Radonovich, and J. N. Brady. 1990. A 36-kilodalton cellular transcription factor mediates an indirect interaction of human T-cell leukemia/lymphoma virus type 1 Tax1 with a responsive element in the viral long terminal repeat. Mol. Cell Biol. 10:4192-4201.

208. Martins, M. L., B. C. Soares, J. G. Ribas, G. W. Thorun, J. Johnson, E. G. Kroon, A. B. Carneiro-Prioetti, and C. A. Bonjardim. 2002. Frequency of p12K and p12R Alleles of HTLV Type 1 in HAM/TSP Patients and in Asymptomatic HTLV Type 1 Carriers. AIDS Res. Hum. Retroviruses 18:899- 902.

209. Maruyama, M., H. Shibuya, H. Harada, M. Hatakeyama, M. Seiki, T. Fujita, J. Inoue, M. Yoshida, and T. Taniguchi. 1987. Evidence for aberrant activation of the interleukin-2 autocrine loop by HTLV-1-encoded p40x and T3/Ti complex triggering. Cell 48:343-350.

59 210. Matsui, M., F. Nagumo, J. Tadano, and Y. Kuroda. 1995. Characterization of humoral and cellular immunity in the central nervous system of HAM/TSP. J. Neurol. Sci. 130:183-189.

211. Mazarakis, N. D., M. Azzouz, J. B. Rohll, F. M. Ellard, F. J. Wilkes, A. L. Olsen, E. E. Carter, R. D. Barber, D. F. Baban, S. M. Kingsman, A. J. Kingsman, K. O'Malley, and K. A. Mitrophanous. 2001. glycoprotein pseudotyping of lentiviral vectors enables retrograde axonal transport and access to the nervous system after peripheral delivery. Hum. Mol. Genet. 10:2109-2121.

212. Merino, F., M. Robert-Guroff, J. Clark, M. Biondo-Bracho, W. Blattner, and R. C. Gallo. 1984. Natural antibodies to human T-cell leukemia/lymphoma virus in healthy Venezuelan populations. Int. J. Cancer 34:501.

213. Mitchell, M., M. Jerebtsova, M. L. Batshaw, K. Newman, and X. Ye. 2000. Long-term gene transfer to mouse fetuses with recombinant adenovirus and adeno-associated virus (AAV) vectors. Gene Ther. 7:1986-1992.

214. Miyatake, S., M. Seiki, R. D. Malefijt, T. Heike, J. Fujisawa, Y. Takebe, J. Nishida, J. Shlomai, T. Yokota, M. Yoshida, and . 1988. Activation of T cell- derived lymphokine genes in T cells and fibroblasts: effects of human T cell leukemia virus type I p40x protein and bovine papilloma virus encoded E2 protein. Nucleic Acids Res. 16:6547-6566.

215. Miyoshi, I., I. Kubonishi, M. Sumida, S. Hiraki, T. Tsubota, I. Kimura, K. Miyamoto, and J. Sato. 1980. A novel T-cell line derived from adult T-cell leukemia. Gann 71:155-156.

216. Miyoshi, I., I. Kubonishi, S. Yoshimoto, and Y. Shiraishi. 1981. A T-cell line derived from normal human cord leukocytes by co-culturing with human leukemic T-cells. Gann 72:978-981.

217. Miyoshi, I., S. Yoshimoto, I. Kubonishi, H. Taguchi, Y. Shiraishi, Y. Ohtsuki, and T. Akagi. 1981. Transformation of normal human cord lymphocytes by co-cultivation with a lethally irradiated human T-cell line carrying type C virus particles. Gann 72:997-998.

218. Mochizuki, M., T. Watanabe, K. Yamaguchi, K. Takatsuki, K. Yoshimura, M. Shirao, S. Nakashima, S. Mori, S. Araki, and N. Miyata. 1992. HTLV-I Uveitis: A distinct clinical entity caused by HTLV-I. Jpn. J. Cancer Res. 83:236- 239.

60 219. Mori, N., N. Mukaida, D. W. Ballard, K. Matsushima, and N. Yamamoto. 1998. Human T-cell leukemia virus type I Tax transactivates human interleukin 8 gene through acting concurrently on AP- 1 and nuclear factor-kappa B-like sites. Cancer Res 58:3993-4000.

220. Mori, N. and D. Prager. 1996. Transactivation of the interleukin-1 alpha promoter by human T- cell leukemia virus type I and type II tax proteins. Blood 87:3410-3417.

221. Mortreux, F., A. S. Gabet, and E. Wattel. 2003. Molecular and cellular aspects of HTLV-1 associated leukemogenesis in vivo. Leukemia 17:26-38.

222. Muchardt, C., J. S. Seeler, A. Nirula, S. Gong, and R. Gaynor. 1992. Transcription factor AP-2 activates gene expression of HTLV-I. EMBO Journal. 11:2573-2581.

223. Mueller, N., A. Okayama, S. Stuver, and N. Tachibana. 1996. Findings from the Miyazaki Cohort Study. J Acquir. Immune. Defic. Syndr. Hum. Retrovirol. 13 Suppl 1:S2-S7.

224. Mulloy, J. C., R. W. Crownley, J. Fullen, W. J. Leonard, and G. Franchini. 1996. The human T-cell leukemia/lymphotropic virus type 1 p12I proteins bind the interleukin-2 receptor beta and gammac chains and affects their expression on the cell surface. J Virol 70:3599-3605.

225. Muraoka, O., T. Kaisho, M. Tanabe, and T. Hirano. 1993. Transcriptional activation of the interleukin-6 gene by HTLV-1. Immunology Letters. 37(2- 3):159-165.

226. Murata, K., M. Fujita, T. Honda, Y. Yamada, M. Tomonaga, and H. Shiku. 1996. Rat primary T cells expressing HTLV-I tax gene transduced by a retroviral vector: in vitro and in vivo characterization. Int. J Cancer 68:102-108.

227. Murphy, E. L., M. P. Busch, M. Tong, P. Cornett, and G. N. Vyas. 1998. A prospective study of the risk of transfusion-acquired viral infections. Transfus. Med. 8:173-178.

228. Murphy, E. L., J. P. Figueroa, W. N. Gibbs, A. Brathwaite, M. Holding- Cobham, D. Waters, B. Cranston, B. Hanchard, and W. A. Blattner. 1989. Sexual transmission of human Y-lymphotropic virus type I (HTLV-I). Ann. Intern. Med. 111:555-560.

229. Murphy, E. L., S. A. Glynn, J. Fridey, J. W. Smith, R. A. Sacher, C. C. Nass, H. E. Ownby, D. J. Wright, and G. J. Nemo. 1999. Increased incidence of infectious diseases during prospective follow-up of human T-lymphotropic virus type II- and I-infected blood donors. ARCH INTERN MED 159:1485-1491.

61 230. Nagai, M. and M. Osame. 2003. Human T-cell lymphotropic virus type I and neurological diseases. J Neurovirol. 9:228-235.

231. Nagai, M., K. Usuku, W. Matsumoto, D. Kodama, N. Takenouchi, T. Moritoyo, S. Hashiguchi, M. Ichinose, C. R. Bangham, S. Izumo, and M. Osame. 1998. Analysis of HTLV-I proviral load in 202 HAM/TSP patients and 243 asymptomatic HTLV-I carriers: high proviral load strongly predisposes to HAM/TSP. J Neurovirol. 4:586-593.

232. Naldini, L., U. Blomer, P. Gallay, D. Ory, R. Mulligan, F. H. Gage, I. M. Verma, and D. Trono. 1996. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272:263-267.

233. Nam, S. H., T. D. Copeland, M. Hatanaka, and S. Oroszlan. 1993. Characterization of ribosomal frameshifting for expression of pol gene products of human T-cell leukemia virus type I. J. Virol. 67:196-203.

234. Nam, S. H., M. Kidokoro, H. Shida, and M. Hatanaka. 1988. Processing of gag Precursor Polyprotein of Human T-Cell Leukemia Virus Type 1 by Virus- Encoded Protease. J. Virol. 62:3718-3728.

235. Nicot, C., M. Dundr, J. M. Johnson, J. R. Fullen, N. Alonzo, R. Fukumoto, G. L. Princler, D. Derse, T. Misteli, and G. Franchini. 2004. HTLV-1- encoded p30(II) is a post-transcriptional negative regulator of viral replication. Nat. Med.

236. Nicot, C., R. Mahieux, S. Takemoto, and G. Franchini. 2000. Bcl-X(L) is up- regulated by HTLV-I and HTLV-II in vitro and in ex vivo ATLL samples. Blood 96:275-281.

237. Nicot, C., J. C. Mulloy, M. G. Ferrari, J. M. Johnson, K. Fu, R. Fukumoto, R. Trovato, J. Fullen, W. J. Leonard, and G. Franchini. 2001. HTLV-1 p12(I) protein enhances STAT5 activation and decreases the interleukin-2 requirement for proliferation of primary human peripheral blood mononuclear cells. Blood 98:823-829.

238. Nishioka, K., I. Maruyama, K. Sato, I. Kitajima, Y. Nakajima, and M. Osame. 1989. Chronic inflammatory arthropathy associated with HTLV-I [letter]. Lancet i:441.

239. Nitta, T., M. Tanaka, B. Sun, S. Hanai, and M. Miwa. 2003. The genetic background as a determinant of human T-cell leukemia virus type 1 proviral load. Biochem. Biophys. Res. Commun. 309:161-165.

62 240. Nyborg, J. K. and W. S. Dynan. 1990. Interaction of cellular proteins with the human T-cell leukemia virus type I transcriptional control region. Purification of cellular proteins that bind the 21- repeat elements. J. Biol. Chem. 265:8230-8236.

241. Ohshima, K., M. Kikuchi, Y. Masuda, Y. Sumiyoshi, F. Eguchi, H. Mohtai, M. Takeshita, and N. Kimura. 1992. Human T-cell leukemia virus type I associated lymphadenitis. Cancer 69:239-248.

242. Okochi, K., H. Sato, and Y. Hinuma. 1984. A retrospective study on transmission of adult T cell leukemia virus by blood transfusion: seroconversion in recipients. Vox Sang. 46:245-253.

243. Ootsuyama, Y., K. Shimotohno, M. Miwa, S. Oroszlan, and T. Sugimura. 1985. Myristylation of gag protein in human T-cell leukemia virus type-I and type-II. Jpn. J Cancer Res. 76:1132-1135.

244. Oroszlan, S. 1984. Chemical Analysis of HTLV-1 Structural proteins, p. 101- 110. In R. C. Gallo, M. E. Essex, and L. Gross (eds.), Human T-cell Leukemia Lymphoma Viruses. Cold Spring Harbor Laboratory Press.

245. Osame, M. 2002. Pathological mechanisms of human T-cell lymphotropic virus type I-associated myelopathy (HAM/TSP). J Neurovirol. 8:359-364.

246. Osame, M., R. Janssen, H. Kubota, H. Nishitani, A. Igata, S. Nagataki, M. Mori, I. Goto, H. Shimabukuro, R. Khabbaz, and J. Kaplan. 1990. Nationwide survey of HTLV-I-associated Myelopathy in Japan: Association with blood transfusion. Ann. Neurol. 28:50-56.

247. Osame, M., K. Usuku, S. Izumo, N. Ijichi, H. Amitani, A. Igata, M. Matsumoto, and M. Tara. 1986. HTLV-I associated myelopathy, a new clinical entity. Lancet i:1031-1032.

248. Overbaugh, J. 2004. HTLV-1 sweet-talks its way into cells. Nat. Med. 10:20- 21.

249. Palu, G., C. Parolin, Y. Takeuchi, and M. Pizzato. 2000. Progress with retroviral gene vectors. Rev. Med Virol 10:185-202.

250. Peng, Y. C., D. E. Breiding, F. Sverdrup, J. Richard, and E. J. Androphy. 2000. AMF-1/Gps2 binds p300 and enhances its interaction with papillomavirus E2 proteins. J. Virol. 74:5872-5879.

251. Perini, G., S. Wagner, and M. R. Green. 1995. Recognition of bZIP proteins by the human T-cell leukaemia virus transactivator Tax. Nature 376:602-605.

63 252. Petit, C., F. Buseyne, C. Boccaccio, J. P. Abastado, J. M. Heard, and O. Schwartz. 2001. Nef is required for efficient -1 replication in cocultures of dendritic cells and lymphocytes. Virology 286:225-236.

253. Petrij, F., R. H. Giles, H. G. Dauwerse, J. J. Saris, R. C. Hennekam, M. Masuno, N. Tommerup, G. J. van Ommen, R. H. Goodman, and D. J. Peters. 1995. Rubinstein-Taybi syndrome caused by mutations in the transcriptional co- activator CBP [see comments]. Nature 376:348-351.

254. Petrini, M., E. Pelosi-Testa, N. M. Sposi, G. Mastroberardino, A. Camagna, L. Bottero, F. Mavilio, U. Testa, and C. Peschle. 1989. Constitutive expression and abnormal glycosylation of transferrin receptor in acute T-cell leukemia. Cancer Res. 49:6989-6996.

255. Piguet, V., O. Schwartz, S. Legall, and D. Trono. 1999. The downregulation of CD4 and MHC-I by primate lentiviruses: a paradigm for the modulation of cell surface receptors. Immunol Rev 168:51-63.

256. Pique, C., D. Pham, T. Tursz, and M. C. Dokhelar. 1992. Human T-Cell Leukemia Virus Type I Envelope Protein Maturation Process: Requirements for Syncytium Formation. J. Virol. 66:906-913.

257. Pique, C., A. Uretavidal, A. Gessain, B. Chancerel, O. Gout, R. Tamouza, F. Agis, and M. C. Dokhelar. 2000. Evidence for the chronic in vivo production of human T cell leukemia virus type I Rof and Tof proteins from cytotoxic T lymphocytes directed against viral peptides. J. Exp. Med. 191:567-572.

258. Poiesz, B. J., F. W. Ruscetti, A. F. Gazdar, P. A. Bunn, J. D. Minna, and R. C. Gallo. 1980. Detection and isolation of type C retrovirus particles from fresh and cultured lymphocytes of a patient with cutaneous T-cell lymphoma. Proc. Natl. Acad. Sci. USA 77:7415-7419.

259. Pollard, V. W. and M. H. Malim. 1998. The HIV-1 Rev protein. Annu. Rev. Microbiol. 52:491-532.

260. Porada, C. D., N. Tran, M. Eglitis, R. C. Moen, L. Troutman, A. W. Flake, Y. Zhao, W. F. Anderson, and E. D. Zanjani. 1998. In utero gene therapy: transfer and long-term expression of the bacterial neo(r) gene in sheep after direct injection of retroviral vectors into preimmune fetuses. Hum. Gene Ther. 9:1571-1585.

261. Porada, C. D., N. D. Tran, Y. Zhao, W. F. Anderson, and E. D. Zanjani. 2000. Neonatal gene therapy. transfer and expression of exogenous genes in neonatal sheep following direct injection of retroviral vectors into the bone marrow space. Exp. Hematol. 28:642-650.

64 262. Princler, G. L., J. G. Julias, S. H. Hughes, and D. Derse. 2003. Roles of viral and cellular proteins in the expression of alternatively spliced HTLV-1 pX mRNAs. Virology 317:136-145.

263. Rabinowitz, J. E. and J. Samulski. 1998. Adeno-associated virus expression systems for gene transfer. Curr. Opin. Biotechnol. 9:470-475.

264. Rao, A., C. Luo, and P. G. Hogan. 1997. Transcription factors of the NFAT family: regulation and function. Annu. Rev. Immunol. 15:707-747.

265. Ratner, L. 1989. Regulation of expression of the c-sis proto-oncogene. Nucleic Acids Res. 17:4101-4115.

266. Reeves, W., C. Saxinger, M. Brenes, E. Quinoz, M. Hoh, J. Clark, C. Holt, R. C. Gallo, and W. Blattner. 1988. Human T-cell lymphotropic virus type I (HTLV-I) and risk factors in metropolitan Panama. Am. J. Epidemiol. 127:539.

267. Relander, T., A. C. Brun, K. Olsson, L. Pedersen, and J. Richter. 2002. Overexpression of gibbon ape leukemia virus (GALV) receptor (GLVR1) on human CD34(+) cells increases gene transfer mediated by GALV pseudotyped vectors. Mol. Ther. 6:400-406.

268. Relander, T., S. Karlsson, and J. Richter. 2002. Oncoretroviral gene transfer to NOD/SCID repopulating cells using three different viral envelopes. J Gene Med 4:122-132.

269. Ressler, S., G. F. Morris, and S. J. Marriott. 1997. Human T-cell leukemia virus type 1 Tax transactivates the human proliferating cell nuclear antigen promoter. J. Virol. 71:1181-1190.

270. Robek, M. D., F. H. Wong, and L. Ratner. 1998. Human T-Cell leukemia virus type 1 pX-I and pX-II open reading frames are dispensable for the immortalization of primary lymphocytes. J. Virol. 72:4458-4462.

271. Roithmann, S., C. Pique, A. Le Cesne, L. Delamarre, D. Pham, T. Tursz, and M. C. Dokhelar. 1994. The open reading frame I (ORF I)/ORF II part of the human T-cell leukemia virus type 1 X region is dispensable for p40tax, p27rex, or envelope expression. J. Virol. 68:3448-3451.

272. Rosen, C. A., J. G. Sodroski, K. Campbell, and W. A. Haseltine. 1986. Construction of recombinant murine retroviruses that express the human T-cell leukemia virus type II and human T-cell lymphotropic virus type III trans activator genes. J Virol 57:379-384.

65 273. Royer-Leveau, C., E. Mordelet, F. Delebecque, A. Gessain, P. Charneau, and S. Ozden. 2002. Efficient transfer of HTLV-1 tax gene in various primary and immortalized cells using a flap lentiviral vector. J Virol Methods 105:133- 140.

274. Ruiz, M. C., J. Cohen, and F. Michelangeli. 2000. Role of Ca2+in the replication and pathogenesis of rotavirus and other viral infections. Cell Calcium 28:137-149.

275. Saito, M., Y. Furukawa, R. Kubota, K. Usuku, S. Sonoda, S. Izumo, M. Osame, and M. Yoshida. 1995. Frequent mutation in pX region of HTLV-1 is observed in HAM/TSP patients, but is not specifically associated with the central nervous system lesions. J. Neurovirol. 1:286-294.

276. Saksena, N. K., A. Srinivasan, Y. C. Ge, S. H. Xiang, A. Azad, W. Bolton, V. Herve, S. Reddy, O. Diop, M. Mirandasaksena, W. D. Rawlinson, A. M. Vandamme, and F. Barresinoussi. 1997. Simian T cell leukemia virus type I from naturally infected feral monkeys from Central and West Africa encodes a 91-amino acid p12 (ORF-I) protein as opposed to a 99-amino acid protein encoded by HTLV type I from humans. AIDS Res. Hum. Retroviruses 13:425- 432.

277. Satoh, T. and D. M. Fekete. 2003. Retroviral vectors to study cell differentiation. Front Biosci. 8:d183-d192.

278. Saxinger, W. C., W. Blattner, P. Levine, J. Clark, R. J. Biggar, M. Hoh, J. Moghissi, P. Jacobs, L. Wilson, R. Jacobson, R. Crookes, M. Strong, A. A. Ansari, A. Dean, F. Nkrumah, N. Mourali, and R. C. Gallo. 1984. Human T- cell leukemia virus (HTLV-I) antibodies in Africa. Science 225:1473.

279. Scheffner, M. and N. J. Whitaker. 2003. Human papillomavirus-induced carcinogenesis and the ubiquitin-proteasome system. Semin. Cancer Biol. 13:59- 67.

280. Schreiber, G. B., E. L. Murphy, J. A. Horton, D. J. Wright, R. Garfein, H. C. Chien, and C. C. Nass. 1997. Risk factors for HTLV types I and II in blood donors: the Retrovirus Epidemiology Donor Study. NHLBI Retrovirus Epidemiology Donor Study. J Acquir. Immune. Defic. Syndr. Hum. Retrovirol. 14:263-271.

281. Seiki, M., S. Hattori, Y. Hirayama, and M. Yoshida. 1983. Human adult T- cell leukemia virus: Complete nucleotide sequence of the provirus genome integrated in leukemia cell DNA. Proc. Natl. Acad. Sci. 80:3618-3622.

66 282. Seiki, M., A. Hikikoshi, T. Taniguchi, and M. Yoshida. 1985. Expression of the pX Gene of HTLV-1: General Splicing Mechanism in the HTLV Family. Science 228:1532-1534.

283. Seiki, M., J. Inoue, M. Hidaka, and M. Yoshida. 1988. Two cis-acting elements responsible for posttranscriptional trans-regulation of gene expression of human T-cell leukemia virus type I. Proc. Natl. Acad. Sci. U. S. A 85:7124- 7128.

284. Sekhon, H. S. and J. E. Larson. 1995. In utero gene transfer into the pulmonary . Nat. Med 1:1201-1203.

285. Senut, M. C. and F. H. Gage. 1999. Prenatal gene therapy: can the technical hurdles be overcome? Mol. Med Today 5:152-156.

286. Shaw, G. M., M. A. Gonda, G. H. Flickinger, B. H. Hahn, R. C. Gallo, and F. Wongstaal. 1984. Genomes of evolutionarily divergent members of the human T-cell leukemia virus family (HTLV-I and HTLV-II) are highly conserved, especially in pX. Proc. Natl. Acad. Sci. USA 81:4544-4548.

287. Shimotohno, K., M. Takano, T. Teruuchi, and M. Miwa. 1986. Requirement of multiple copies of a 21-nucleotide sequence in the U3 regions of human T- cell leukemia virus type I and type II long terminal repeats for trans-acting activation of transcription. Proc. Natl. Acad. Sci. U. S. A 83:8112-8116.

288. Shimoyama, M. 1991. Diagnostic criteria and classification of clinical subtypes of adult T- cell leukaemia-lymphoma. A report from the Lymphoma Study Group (1984- 87). Br. J. Haematol. 79:428-437.

289. Silverman, L. R., A. J. Phipps, A. Montgomery, L. Ratner, and M. D. Lairmore. 2004. Human T-cell lymphotropic virus type 1 open reading frame II-encoded p30II is required for in vivo replication: evidence of in vivo reversion. J Virol 78:3837-3845.

290. Sodroski, J., C. Rosen, W. C. Goh, and W. Haseltine. 1985. A transcriptional activator protein encoded by the x-lor region of the human T-cell leukemia virus. Science 228:1430-1434.

291. Sodroski, J. G., C. A. Rosen, and W. A. Haseltine. 1984. Trans-Acting Transcriptional Activation of the Long Terminal Repeat of Human T Lymphotropic Viruses in Infected Cells. Science 223:381-385.

292. Stuver, S. O., N. Tachibana, A. Okayama, S. Shioiri, Y. Tsunetoshi, K. Tsuda, and N. E. Mueller. 1993. Heterosexual transmission of human T cell leukemia/lymphoma virus type I among married couples in southwestern Japan: an initial report from the Miyazaki Cohort Study. J. Infect. Dis. 167:57-65. 67 293. Suzuki, T., J. Fujisawa, M. Toita, and M. Yoshida. 1993. The trans-activator Tax of human T-cell leukemia virus type 1 (HTLV-1) interacts with cAMP- responsive element (CRE) binding and CRE modulator proteins that bind to the 21-base-pair enhancer of HTLV-1. Proc. Natl. Acad. Sci. U. S. A. 90:610-614.

294. Takatsuki, K., T. Uchiyama, K. Sagawa, and J. Yodoi. 1977. Adult T-cell leukemia in Japan, p. 73-77. In S. Seno, F. Takaku, and S. Irino (eds.), Topics in Hematology. Excerpta Medica, Amsterdam.

295. Tan, T. H., R. Jia, and R. G. Roeder. 1989. Utilization of Signal Transduction Pathway by the Human T-Cell Leukemia Virus Type 1 Transcriptional Activator tax. J. Virol. 63:3761-3768.

296. Tanimura, A., H. Teshima, J. I. Fujisawa, and M. Yoshida. 1993. A New Regulatory Element that Augments the Tax-Dependent Enhancer of Human T- Cell Leukemia Virus Type 1 and Cloning of cDNAs Encoding Its Binding Proteins. J. Virol. 67:5375-5382.

297. Tarantal, A. F., C. I. Lee, J. E. Ekert, R. McDonald, D. B. Kohn, C. G. Plopper, S. S. Case, and B. A. Bunnell. 2001. Lentiviral vector gene transfer into fetal rhesus monkeys (Macaca mulatta): lung-targeting approaches. Mol. Ther. 4:614-621.

298. Tarantal, A. F., J. P. O'Rourke, S. S. Case, G. C. Newbound, J. Li, C. I. Lee, C. R. Baskin, D. B. Kohn, and B. A. Bunnell. 2001. Rhesus monkey model for fetal gene transfer: studies with retroviral- based vector systems. Mol. Ther. 3:128-138.

299. Terada, K., S. Katamine, K. Eguchi, R. Moriuchi, M. Kita, H. Shimada, I. Yamashita, K. Iwata, Y. Tsuji, S. Nagataki, and T. Miyamoto. 1994. Prevalence of serum and salivary antibodies to HTLV-1 in Sjogren's syndrome. Lancet 344:1116-1119.

300. Themis, M., H. Schneider, T. Kiserud, T. Cook, S. Adebakin, S. Jezzard, S. Forbes, M. Hanson, A. Pavirani, C. Rodeck, and C. Coutelle. 1999. Successful expression of beta-galactosidase and factor IX transgenes in fetal and neonatal sheep after ultrasound-guided percutaneous adenovirus vector administration into the umbilical vein. Gene Ther. 6:1239-1248.

301. Tian, P., M. K. Estes, Y. Hu, J. M. Ball, C. Q. Zeng, and W. P. Schilling. 1995. The rotavirus nonstructural glycoprotein NSP4 mobilizes Ca2+ from the endoplasmic reticulum. J. Virol. 69:5763-5772.

302. Tillmann, M., R. Wessner, and B. Wigdahl. 1994. Identification of human T- cell lymphotropic virus type I 21-base- pair repeat-specific and glial cell-specific DNA- protein complexes. J. Virol. 68:4597-4608.

68 303. Toedter, G. P., S. Pearlman, D. Hofheinz, J. Blakeslee, G. Cockerell, C. Dezzutti, J. Yee, R. B. Lal, and M. D. Lairmore. 1992. Development of a -based p24 capsid antigen detection assay for HTLV-I, HTLV-II, and STLV-I infection. AIDS Res. Hum. Retroviruses 8:527-532.

304. Tokumitsu, H., H. Enslen, and T. R. Soderling. 1995. Characterization of a Ca2+/calmodulin-dependent protein kinase cascade. Molecular cloning and expression of calcium/calmodulin-dependent protein kinase kinase. J Biol. Chem. 270:19320-19324.

305. Torgeman, A., N. Morvaknin, and M. Aboud. 1999. Sp1 is involved in a protein kinase C-independent activation of human T cell leukemia virus type I long terminal repeat by 12-O-tetradecanoylphorbol-13-acetate. Virology 254:279-287.

306. Tran, N. D., C. D. Porada, G. Almeida-Porada, H. A. Glimp, W. F. Anderson, and E. D. Zanjani. 2001. Induction of stable prenatal tolerance to beta-galactosidase by in utero gene transfer into preimmune sheep fetuses. Blood 97:3417-3423.

307. Tran, N. D., C. D. Porada, Y. Zhao, G. Almeida-Porada, W. F. Anderson, and E. D. Zanjani. 2000. In utero transfer and expression of exogenous genes in sheep. Exp. Hematol. 28:17-30.

308. Tripp, A., Y. Liu, M. Sieburg, J. Montalbano, S. Wrzesinski, and G. Feuer. 2003. Human T-cell leukemia virus type 1 tax oncoprotein suppression of multilineage hematopoiesis of CD34+ cells in vitro. J Virol 77:12152-12164.

309. Trovato, R., J. C. Mulloy, J. M. Johnson, S. Takemoto, M. P. de Oliveira, and G. Franchini. 1999. A lysine-to-arginine change found in natural alleles of the human T-cell lymphotropic/leukemia virus type 1 p12(I) protein greatly influences its stability. J Virol 73:6460-6467.

310. Tsukahara, T., M. Kannagi, T. Ohashi, H. Kato, M. Arai, G. Nunez, Y. Iwanaga, N. Yamamoto, K. Ohtani, M. Nakamura, and M. Fujii. 1999. Induction of Bcl-x(L) expression by human T-cell leukemia virus type 1 tax through NF-kappa B in apoptosis-resistant T-cell transfectants with tax. J Virol 73:7981-7987.

311. Uchiyama, T., J. Yodoi, K. Sagawa, K. Takatsuki, and H. Uchino. 1977. Adult T-cell leukemia: clinical and hematologic features of 16 cases. Blood 50:481-492.

69 312. Umehara, F., S. Izumo, M. Nakagawa, A. T. Ronquillo, K. Takahashi, K. Matsumoto, E. Sato, and M. Osame. 1993. Immunocytochemical analysis of the cellular infiltrate in the spinal cord lesions in HTLV-I-Associated myelopathy. J. Neuropathol. Exp. Neurol. 52:424-430.

313. van Kuppeveld, F. J., J. G. Hoenderop, R. L. Smeets, P. H. Willems, H. B. Dijkman, J. M. Galama, and W. J. Melchers. 1997. Coxsackievirus protein 2B modifies endoplasmic reticulum membrane and plasma membrane permeability and facilitates virus release. EMBO J. 16:3519-3532.

314. Van Parijs, L., Y. Refaeli, A. K. Abbas, and D. Baltimore. 1999. Autoimmunity as a consequence of retrovirus-mediated expression of C-FLIP in lymphocytes. Immunity. 11:763-770.

315. VandenDriessche, T., V. Vanslembrouck, I. Goovaerts, H. Zwinnen, M. L. Vanderhaeghen, D. Collen, and M. K. Chuah. 1999. Long-term expression of human coagulation factor VIII and correction of hemophilia A after in vivo retroviral gene transfer in factor VIII-deficient mice. Proc. Natl. Acad. Sci U. S. A 96:10379-10384.

316. Vile, R. G., R. M. Diaz, N. Miller, S. Mitchell, A. Tuszyanski, and S. J. Russell. 1995. Tissue-specific gene expression from Mo-MLV retroviral vectors with hybrid LTRs containing the murine tyrosinase enhancer/promoter. Virology 214:307-313.

317. Vo, N. and R. H. Goodman. 2001. CREB-binding protein and p300 in transcriptional regulation. J. Biol. Chem. 276:13505-13508.

318. Vogel, K. W., R. Briesewitz, T. J. Wandless, and G. R. Crabtree. 2001. Calcineurin inhibitors and the generalization of the presenting protein strategy. Adv. Protein Chem. 56:253-291.

319. von Bulow, G. U. and R. J. Bram. 1997. NF-AT activation induced by a CAML-interacting member of the tumor necrosis factor receptor superfamily. Science 278:138-141.

320. von Kalle, C., H. P. Kiem, S. Goehle, B. Darovsky, S. Heimfeld, B. Torok- Storb, R. Storb, and F. G. Schuening. 1994. Increased gene transfer into human hematopoietic progenitor cells by extended in vitro exposure to a pseudotyped retroviral vector. Blood 84:2890-2897.

321. Weichselbraun, I., J. Berger, M. Dobrovnik, H. Bogerd, R. Grassmann, W. C. Greene, J. Hauber, and E. Bohnlein. 1992. Dominant-negative mutants are clustered in a domain of the human T-cell leukemia virus type I Rex protein: implications for trans dominance. J Virol 66:4540-4545.

70 322. Wessner, R., M. Tillmann-Bogush, and B. Wigdahl. 1995. Characterization of a glial cell-specific DNA-protein complex formed with the human T cell lymphotropic virus type I (HTLV-I) enhancer. J Neurovirol. 1:62-77.

323. Wessner, R. and B. Wigdahl. 1997. AP-1 derived from mature monocytes and astrocytes preferentially interacts with the HTLV-I promoter central 21 bp repeat. Leukemia 11 Suppl 3:21-4.:21-24.

324. White, J. D., S. L. Zaknoen, C. Kastensportes, L. E. Top, L. Navarroroman, D. L. Nelson, and T. A. Waldmann. 1995. Infectious complications and immunodeficiency in patients with human T-cell lymphotropic virus I- associated adult T- cell leukemia/lymphoma. Cancer 75:1598-1607.

325. Wiktor, S. Z., E. J. Pate, E. L. Murphy, T. J. Palker, E. Champegnie, A. Ramlal, B. Cranston, B. Hanchard, and W. A. Blattner. 1993. Mother-to- child transmission of human T-cell lymphotropic virus type I (HTLV-I) in Jamaica: association with antibodies to envelope glycoprotein (gp46) epitopes. J. Acquir. Immune. Defic. Syndr. 6:1162-1167.

326. Wilks, R., B. Hanchard, O. Morgan, E. Williams, B. Cranston, M. L. Smith, P. Rodgersjohnson, and A. Manns. 1996. Patterns of HTLV-I infection among family members of patients with adult T-cell leukemia/lymphoma and HTLV-I associated myelopathy tropical spastic paraparesis. Int. J. Cancer 65:272-273.

327. Wolin, M., M. Kornuc, C. Hong, S. K. Shin, F. Lee, R. Lau, and S. Nimer. 1993. Differential effect of HTLV infection and HTLV Tax on interleukin 3 expression. Oncogene 8:1905-1911.

328. Wu, Y. and J. W. Marsh. 2001. Selective transcription and modulation of resting T cell activity by preintegrated HIV DNA. Science 293:1503-1506.

329. Xu, R. Z., Q. K. Gao, S. J. Wang, H. H. Kan, L. Y. Sheng, C. Q. Li, X. H. Zhang, G. B. Xu, and K. Q. Zhang. 1996. Human acute myeloid leukemias may be etiologically associated with new human retroviral infection. Leuk. Res. 20:449-455.

330. Yajima, A., A. Kawada, Y. Aragane, and T. Tezuka. 2001. Detection of HTLV-I proviral DNA in sarcoidosis. Dermatology 203:53-56.

331. Yamaguchi, K. 1994. Human T-lymphotropic virus type I in Japan. Lancet 343:213-216. 332. Yamaguchi, K., H. Nishimura, H. Kohrogi, M. Jono, Y. Miyamoto, and K. Takatsuki. 1983. A proposal for smoldering adult T-cell leukemia: a clinicopathologic study of five cases. Blood 62:758-766.

71 333. Yamaguchi, K. and K. Takatsuki. 1993. Adult T cell leukaemia-lymphoma. Clin. Haematol. 6:899-915.

334. Yamaguchi, K. and K. Takatsuki. 1993. Adult T cell leukaemia-lymphoma. Clin. Haematol. 6:899-915.

335. Yamamoto, N., M. Okada, Y. Koyanagi, M. Kannagi, and Y. Hinuma. 1982. Transformation of human Leukocytes by cocultivation with an adult T cell leukemia virus producer cell line. Science 217:737-739.

336. Yamano, Y., M. Nagai, M. Brennan, C. A. Mora, S. S. Soldan, U. Tomaru, N. Takenouchi, S. Izumo, M. Osame, and S. Jacobson. 2002. Correlation of human T-cell lymphotropic virus type 1 (HTLV-1) mRNA with proviral DNA load, virus-specific CD8(+) T cells, and disease severity in HTLV-1-associated myelopathy (HAM/TSP). Blood 99:88-94.

337. Yang, E. Y., H. B. Kim, A. F. Shaaban, R. Milner, N. S. Adzick, and A. W. Flake. 1999. Persistent postnatal transgene expression in both muscle and liver after fetal injection of recombinant adenovirus. J Pediatr. Surg. 34:766-772.

338. Yang, X. J., V. V. Ogryzko, J. Nishikawa, B. H. Howard, and Y. Nakatani. 1996. A p300/CBP-associated factor that competes with the adenoviral oncoprotein E1A. Nature 382:319-324.

339. Ye, J., L. Silverman, M. D. Lairmore, and P. L. Green. 2003. HTLV-1 Rex is required for viral spread and persistence in vivo but is dispensable for cellular immortalization in vitro. Blood.

340. Yoshida, M., I. Miyoshi, and Y. Hinuma. 1982. Isolation and characterization of retrovirus from cell lines of human T-cell leukemia and its implication in the disease. Proc. Natl. Acad. Sci. USA 79:2031-2035.

341. Yoshida, M., M. Seiki, K. Yamaguchi, and K. Takatsuki. 1984. Monoclonal integration of human T-cell leukemia provirus in all primary tumors of adult T- cell leukemia suggests causative role of human T-cell leukemia virus in the disease. Proc. Natl. Acad. Sci. U. S. A. 81:2534-2537.

342. Yoshimura, T., J. Fujisawa, and M. Yoshida. 1990. Multiple cDNA clones encoding nuclear proteins that bind to the tax-dependent enhancer of HTLV-I: all contain a leucine zipper structure and basic amino acid domain. EMBO J. 9:2537-2542.

343. Yu, S. F., T. von Ruden, P. W. Kantoff, C. Garber, M. Seiberg, U. Ruther, W. F. Anderson, E. F. Wagner, and E. Gilboa. 1986. Self-inactivating retroviral vectors designed for transfer of whole genes into mammalian cells. Proc. Natl. Acad. Sci U. S. A 83:3194-3198.

72 344. Zhang, W., J. W. Nisbet, B. Albrecht, W. Ding, F. Kashanchi, J. T. Bartoe, and M. D. Lairmore. 2001. Human T-lymphotropic virus type 1 p30(II) regulates gene transcription by binding CREB binding protein/p300. J. Virol. 75:9885-9895.

345. Zhang, W., J. W. Nisbet, J. T. Bartoe, W. Ding, and M. D. Lairmore. 2000. Human T-lymphotropic virus type 1 p30(II) functions as a transcription factor and differentially modulates CREB-responsive promoters. J. Virol. 74:11270- 11277.

346. Zhao, L. J. and C. Z. Giam. 1992. Human T-cell lymphotropic virus type I (HTLV-I) transcriptional activator, Tax, enhances CREB binding to HTLV-I 21- base-pair repeats by protein-protein interaction. Proceedings. of. the. National. Academy. of. Sciences. of. the. United. States. of. America. 89:7070-7074.

73

Figure 1.1 Schematic illustration of simple retrovirus genome.

The genome of simple retroviruses carry three structural genes, gag, pol and env, which encode all the proteins required for reverse-transcription and integration of the retroviral genome (Pol), as well as the proteins that make up the retroviral capsid (Gag) and the envelope glycoprotein (Env). The retroviral genome also contains cis-acting elements necessary for viral replication such as the long terminal repeats (LTRs), at 5’ and 3’ ends of the provirus. The promoters and enhancers for viral gene transcription are located in the U3 region of LTR. The R and U5 regions of LTR are required for reverse transcription and poly A modification of RNA transcripts. Other elements include the packaging signal, Ψ located between PBS and gag, which mediates the packaging of retroviral genomic RNA into the viral particle.

74

Figure 1.2 Schematic illustration of retroviral vector system

Generation of replication-incompetent retroviral vectors necessitates separation of the cis- and trans-acting sequences of the viral genome. In order to achieve this, gag, pol, and env genes are replaced with a foreign gene of interest, usually a marker gene such as GFP or β-galactosidase, leaving cis-acting regions critical for reverse transcription, integration, transcription and encapsidation in the genome. Expression of gag, pol, and env genes in trans is provided from another plasmid for the generation of recombinant viral particles containing the gene of interest.

75

Figure 1.3 Schematic illustration of HTLV-1 genome

Diagram of HTLV-1 genome and alternatively spliced mRNA and protein species from pX ORFs. Numbers correspond to nucleotide positions of exon splice acceptor and donor sites with respect to the full length HTLV-1 genome. Dotted lines indicate the mRNA while the boxes below the dotted lines indicate coding regions of each protein. Open reading frame from which each protein is produced, is indicated as superscript, on the right of each protein (Adapted from Michael et al, 2004)

76

Figure 1.4. Schematic Illustration of HTLV-1 accessory proteins p12I, p30II and p13II

Diagram of p12I, p30II, and p13II with putative and identified functional motifs. Abbreviations: TM, transmembrane region; LZip, leucine zipper motif; DxxxLL, dileucine motif; PxxP, SH3 binding motif; K/R, lysine-to-arginine variant at position 88 (arginine at this position increases stability of protein); MTS, mitochondrial targeting sequence. Boxes below p30II indicate regions sharing sequence homology with the DNA binding domain and homeodomain of Oct-1. Numbers below bars indicate amino acid position numbers.

77

CHAPTER 2

EFFECT OF PSEUDOTYPING ON IN UTERO GENE TRANSFER

EFFICIENCY, BIODISTRIBUTION, AND HEMATOPOIETIC STEM CELL

DIRECTED TRANSGENE EXPRESSION OF RECOMBINANT MURINE

LEUKEMIA VIRUS DERIVED VECTOR SYSTEM IN FETAL MICE

2.1 INTRODUCTION

Novel methods that allow therapeutic intervention early in the development are necessary against genetic disorders, such as storage diseases, with an early onset and accelerated progression leading to irreparable tissue and organ damage. In utero gene transfer to fetus is believed to allow correction of such genetic disorders, prior to the onset of disease and the development of tissue pathology. In utero administration of many viral vectors have been successful in obtaining relatively efficient gene transfer to fetal tissues in various animal models 32,50,51,61,66,67,70,71,78. In utero gene transfer has several advantages over ex vivo gene therapy or in vivo gene delivery performed later in life. Unique features of fetus and fetal development, such as the higher proportion of progenitor/stem cells, rapid organ system development with marked proliferation and 78 expansion of stem/progenitor cells, support the amplification of genetically-modified cells and prolonged expression of the transgene product 8,17,62. In addition, gene transfer to fetus, which is immunologically naïve, circumvents humoral and cell mediated immune reactions to the components of gene transfer system and transgene product.

Furthermore, exposure to vector/transgene products early in the development results in sustained tolerance to the foreign antigens allowing successful postnatal treatment 24. In addition, the small size of the fetus compared to that of the adult provides a stoichiometric advantage on the vector to target cell ratio, favoring increased compartmental and hematogenous distribution of the vector 35.

Retroviral vector mediated in utero gene therapy is considered to be an excellent tool for therapeutic intervention against congenital/inherited disorders. Moloney murine leukemia virus (MoMLV)-based onco-retroviral vectors are attractive tools for in vivo gene transfer because of their ability to stably integrate into the host cell genome, resulting in sustained expression of the transgene 42,74. In addition, onco-retroviral vectors contain residual viral genes precluding de novo expression of potentially immunogenic viral proteins in transduced target cells 26. However, the cell division status of the target cells is a critical determinant in the transduction with onco-retroviral vectors, since nuclear import of pre-integration complex and subsequent integration of the provirus into the host genome is mitosis-dependent 9. However, due to the ability of fetal cells to proliferate at a high rate, mitosis-dependence does not limit the efficiency of retroviral vector mediated in utero gene transfer.

79 Congenital/inherited disorders of hematopoietic cells are excellent candidates for therapeutic intervention using retroviral vector mediated in utero gene therapy. The unique feature of hematopoietic stem cells to self-renew and differentiate along all lineages, to completely reconstitute bone marrow hematopoiesis makes it an attractive target cell population for gene delivery. However, because of the relatively quiescent nature of HSCs in adult bone marrow, it is difficult to transduce them using retroviral vectors postnatally. Targeting these cells prenatally, when they are rapidly dividing, overcomes this major obstacle in the treatment of hematopoietic disorders. Another challenge in successful gene transfer to the fetus is the development of safe and effective gene transfer techniques that allow long-term, tissue-specific, and regulated expression of the desired protein. Various modifications have been made to the first generation of retroviral vectors to improve gene transfer efficiency and tissue/organ specific gene delivery 18,79.

A critical modification made in retroviral vectors is envelope substitution

(pesudotyping), which is achieved by the use of envelope glycoproteins from other viruses, both within and outside the retrovirus family, along with retroviral packaging plasmid devoid of env. This modification relies on the interaction of viral envelope with its cell surface receptor for efficient infectivity in natural setting. In particular, pseudotyping of retroviral vectors with heterogeneous envelopes from viruses exhibiting increased tropism to certain tissues/organs offers a unique possibility for enhancing tissue specific gene transfer3,12,47. Envelope glycoproteins from different retroviruses such as gibbon ape leukemia virus (GALV), amphotropic MLV 55,56,

80 ecotropic MLV 29, and feline endogenous retrovirus (RD114) 75 have been successfully used for envelope substitution of onco-retroviral vectors. Envelopes from rhabdoviruses, such as vesicular stomatitis virus (VSV-G) and rabies have also been used for pseudotyping gene transfer vectors 36,42.

To investigate whether the unique nature of interaction between viral envelope and cell surface receptor could be employed to efficiently transduce multiple organ systems and HSCs in developing fetuses, we developed an approach to directly inject retroviral vectors into the peritoneal cavity of fetal mouse. The in utero transduction of fetal cells by direct injection of viral vectors has been previously described in several animal models14,16,31,32,34,39,50,65,66,71. In the present study, we analyzed the efficacy and biosafety of pseudotyping in in utero gene transfer protocols. The envelopes used in the study include ecotropic MLV, amphoptropic MLV, GALV, RD114, VSV-G and rabies, which has previously been reported to effectively transduce murine cells 36,48,56. The specific goal of this study was to evaluate recombinant onco-retroviral vector mediated gene transfer efficiency, biodistribution and gene expression in developing fetal tissues as well as multiple lineages of the hematopoietic system. Herein, we demonstrate that pseudotyping oncoretroviral vectors can affect their gene transfer efficiencies to multiple organs and different lineages of hematopoietic system and that the vector tropism is influenced by the selection of the envelope protein, which may be of significance for in utero gene therapy protocols.

81 2.2 MATERIALS AND METHODS

Animals

FVB/N mice were obtained from Charles River (Wilmington, MA, USA), and were housed in the barrier facility of the Children’s Research Institute. All animals used in this study were maintained in accordance with the guidelines set by the Committee on the Care and Use of Laboratory Animals, DHHS Public. No. NIH85-23.

Plasmids, cells and media

MLV transfer vector, ∆U3-MLV-LacZ, contains β galactosidase marker downstream of cytomegalovirus immediate early promoter (CMV I/E). The packaging plasmid pHIT 60 expresses Gag and Pol proteins of MLV, required to package recombinant genomes 63. The envelope expression plasmids used in the study include pMD.G, which encodes VSV-G envelope 42, GALV, which encodes gibbon ape leukemia virus envelope 19, Ampho, which encodes amphotropic MLV envelope 30,

Rabies, which encodes rabies virues envelope 36, RD114, which encodes feline endogenous retrovirus envelope 58, and Eco, which encodes ecotropic MLV envelope.

Recombinant viral vectors.

Recombinant MLV derived retroviral vectors pseudotyped with different envelopes were produced by transient transfection of 293T cells as described 42,66.

Briefly 293T cells were transfected with transfer vector, packaging plasmid and

82 envelope expression vector using calcium phosphate method. Supernatant was collected at 24, 48 and 72 h post transfection, cleared of cellular debris by centrifugation at 1000 rpm for 10 min at room temp and then filtered through a 0.2 µm filter. Recombinant vectors were then concentrated by slow speed centrifugation of the supernatant at 6,500 g for 16 h at 4° C. The viral pellet was suspended in D10 overnight at 4° C and concentrated virus was aliquoted and stored at –80°C until use 4. Infectious titers were determined by limiting dilution analysis on TE671 cells (ATCC# HTB-139).

TE671 cells were seeded at 1 x 105 cells/well in a 6-well plate (Corning,

Miami, FL) coated with poly-L lysine (sigma) in D-10 and incubated at 37oC incubator for 15-18 h. These cells were transduced with 2-ml serial dilutions (i.e., 1x10-3 to 1x10-

5) of vector supernatants by centrifugation at 2700 rpm for 1 h at 28o C in the presence of 4µg/ml polybrene (sigma). The cells were analyzed for β galactosidase expression

48 hours days post-transduction by staining with 5-bromo-4-chloro-3-indolyl-beta-D- galactopyranoside (X-Gal) (Sigma).Typical titers for the concentrated recombinant

MLV vector supernatants were 4-9x108 IU/ml. None of the recombinant vector preparations used in these studies contained either replication competent retrovirus as analyzed by transduction of fresh 293T cells with the supernatant from cells once infected with recombinant vectors.

Fetal Intra-peritoneal Injections

Prior to injection, the concentration of the recombinant vectors were adjusted to

1x108 IU/ml by dilution with PBS (Dulbecco’s phosphate buffered saline, Gibco). PBS alone was used for injections instead of a vector preparation in a control group. At day 83 16 post-coitum (p.c.), as timed by detection of post-copulatory vaginal plugs, pregnant mice were anesthetized in a covered chamber and maintained under general anesthesia with isoflurane mixed with oxygen and delivered by a non-rebreathing circuit. The mice were then placed in dorsal recumbancy on a heating pad set at 38oC; hair was clipped over the abdominal area from vulva to mid-thorax, and the entire abdomen was scrubbed for surgery. A 1.5-cm midline incision was made approximately 1.5 cm caudal to the sternum through the skin, abdominal muscles, and peritoneum, and the gravid uterus was exteriorized for injection, one uterine horn at a time. Throughout the procedure, the uterus was kept moist and warm by lavage with Lactated Ringer’s kept in a 33oC water bath. Each fetus was then injected intra-peritoneally with 5 µl of vector preparation using a 100 µL Luer tip Hamilton syringe fitted with a 33-gauge 1-inch 30o- beveled needle and a repeating dispenser. After a final lavage, the uterus was replaced inside the abdominal cavity and the skin was closed. The mouse was recovered in a neonatal incubator kept at 38oC, and supplemented with oxygen until alert and responsive. The mice were given 0.04 mg of diazepam orally in a mixture of 10% apple juice and water for 2 days prior to surgery and at least 2 days following the surgery.

Necropsy/Tissue Harvest and Preparation

Complete tissue harvests were performed post-gene transfer. Mice injected in

utero were euthanized at 1 month and 3 months of age by CO2 inhalation. Peripheral blood mononuclear cells (PBMC), heart, thymus, lung, liver, spleen, muscle, brain,

84 bone marrow and gonads were harvested from each pup. Tissue samples were equally divided in cell buffer for DNA isolation for PCR and in RNAlater (Ambion,

Austin, TX) for RNA isolation for RT-PCR.

Colony forming cells (CFC) assay

Hematopoietic progenitor assays were established from bone marrow samples collected at necropsy. Progenitor cell assays were established using 6.0 x 105 nucleated bone marrow cells/plate in 2 ml Methocult GF M3434 (StemCell Technologies, Inc.,

Vancouver, Canada), and plated in triplicate. Evaluation after a standard incubation period (12 days) included total colony counts, and quantification of individual erythroid and myeloid progenitors (burst forming unit-erythroid [BFU-E], colony forming unit-

CFU-granulocyte [CFU-GM], and CFU-granulocyte erythroid macrophage megakaryocyte [CFU-GEMM]. Individual erythroid and myeloid colonies were collected and processed using routine techniques and stored at -80oC until analyzed for gene transfer by PCR using CMV promoter specific primers. Reverse transcriptase-PCR was performed on individual erythroid and myeloid colonies using β galactosidase specific primers to analyze expression in 3 month old animals.

PCR Analysis

PCR was performed on genomic DNA isolated from all tissues collected at necropsy and on colonies from CFC assay. Genomic DNA was isolated (1x106-1x107 nucleated cells) using the Gentra System DNA isolation kit (Gentra, Minneapolis, MN), as recommended by the manufacturer. DNA and RNA was isolated from hematopoietic

85 progenitor cell colonies by heating in 50 µl of a 100 µg/ml proteinase K solution at

55oC for one hr followed by 95oC for 10 min to inactivate the enzyme. Biodistribution of the virus vector genome was assessed by performing PCR (Amplitaq Gold, Perkin-

Elmer, Norwalk, CT) using CMV promoter specific primers on 100 ng of genomic

DNA isolated from the tissue specimens and 10 µl of progenitor DNA/RNA solution

(annealing temperature: 62oC, 32 cycles) with the following PCR primers:

CMV forward - 5'-ATC-ATA-TGC-CAA-GTA-CGC-CC-3'

CMV reverse - 5'-GGC-GGA-GTT-GTT-ACG-ACA-TT-3'

In order to determine transduction efficiency, a standard curve was generated from Sup

T1 cells (Sup T1-EGFP) (ATCC # CRL-1942) containing a single integrated copy of the MLV transfer vector pLEGFP-C1 containing the CMV promoter (Clontech, Palo

Alto, CA) diluted with non-transduced Sup T1 cells at the ratios 100%, 10%, 1%, 0.1%,

0.01%, 0.001%, and 0%. In order to ensure that results were standardized for the amount of genomic DNA isolated from each sample, PCR for the β-actin gene was performed on each sample (annealing temperature: 60oC, 25 cycles) with the following primers:

β-Actin forward - 5'-CAT-TGT-GAT-GGA-CTC-CGG-AGA-CGG-3'

β-Actin reverse - 5'-CAT-CTC-CTG-CTC-GAA-GTC-TAG-AGC-3'

Bands were visualized by SYBR Green staining of PCR gels (Molecular Probes,

Eugene, OR) and scanned by the Storm imaging system (Molecular Dynamics,

Sunnyvale, CA) and data was analyzed by ImageQuant software (Molecular Dynamics).

A linear regression equation was generated from the standards, which allowed

86 calculation of the percentage of cells transduced in each tissue. For all standard curves, the p value for regression was < 0.01. Statistical analysis was performed using Student’s t test, P < 0.05.

RT-PCR Analysis

Progenitor DNA/RNA solution was treated with DNase 1 using DNA-free kit

(Ambion, Austin, TX) to get rid of DNA. 20µl of DNase treated progenitor RNA solution was reverse transcribed to cDNA using Reverse Transcription System

(Promega, Madison, WI). PCR analysis using β galactosidase specific primers (FWD:

5’-CAG-TAT-GAA-GGC-GGC-GGA-G-3’ and REV: 5’-CCA-GCG-GCT-TAC-CAT-

CCA-G-3’) was performed on cDNA at an annealing temperature of 60oC for 40 cycles.

All samples were subjected to RT-PCR for the β-actin mRNA as control for integrity of the RNA. Possible DNA contamination was ruled out by performing a control with no reverse transcriptase.

2.3 RESULTS AND DISCUSSION

All of the recombinant vector injected animals were healthy during the study period. There was no significant mortality associated with the surgical procedure or injection of recombinant viral vectors (Table 2.1). In the current study, survival rate of fetuses undergoing intra-peritoneal (IP) administration of the vector was defined as the ratio of the fetuses surviving to term and through the first week of life to the total number of fetuses injected with recombinant onco-retroviral vectors. There was no

87 statistically significant difference in survival rates amongst the different pseudotypes of recombinant retroviral vectors used in the study. These viability results correlate with the previous reported studies on in utero gene transfer to fetal mice using recombinant viral vectors derived from retroviruses, lentiviruses and adeno-associated virus (AAV)

35,39,72. All newborn mice remained healthy during the postnatal observation period and displayed normal growth and physical development. The loss of animals observed postnatally in VSV-G and rabies pseudotyped group was not associated with any disease, but was a result of cage aggression. The animals were sacrificed at 1 and 3 months of age and samples from multiple tissues were analyzed for efficiency of gene transfer as well as gene expression of β-galactosidase reporter gene.

Biodistribution and efficiency of gene transfer using retroviral vectors pseudotyped with different envelope glycoproteins

In order to assess the biodistribution and gene transfer efficiency of retroviral vectors pseudotyped with various envelope glycoproteins, pups were sacrificed at 1 month of age and tissues from different organ systems were sampled. Semi-quantitative

PCR for the CMV promoter in the transfer vector was performed on the genomic DNA isolated from peripheral blood, heart, lungs, thymus, liver, spleen, kidney, skeletal muscle, brain, bone marrow and gonads. A standard curve was developed for quantitation purposes as described in materials and methods (Fig. 2.1). Overall, significant levels of gene transfer were obtained in all the major organ systems with all pseudotypes used in the study.

88 Targeting gene transfer to peripheral blood leukocytes, particularly lymphocytes is critical in the treatment of various disorders of immune system such as adenosine deaminase deficiency and AIDS6. We evaluated the effect of pseudotyping retroviral vectors with different envelope glycoproteins on gene transfer efficiency to cells in peripheral blood. The pseudotype with the highest degree of gene transfer was RD114 with 1.8145%± 0.2554, followed by VSV-G pseudotype with 1.3943%± 0.0891. This is consistent with previous reports using VSV-G and RD114 pseudotyped retroviral vectors, which demonstrated efficient gene transfer to PBMC and SCID repopulating cells in murine 57. Amphotropic, ecotropic, and GALV pseudotyped retroviral vectors had a mean gene transfer efficiency of 1.0368%± 0.0676, 0.6673%± 0.2989 and

0.3782%± 0.0525 respectively. Animals injected with rabies pseudotyped retroviral vectors had insignificant levels of transgene, 0.0018%± 0.0005 (Fig.2.2).

Successful homing of HSC to bone marrow is critical for the development of a sound hematopoietic system, and therefore the HSC directed gene transfer techniques must not hinder the homing ability of these stem cells to the bone marrow. Recent research has elucidated the mechanisms and microenvironment conducive for efficient gene transfer to cells in the bone marrow 15. We evaluated the effect of pseudotyping on enhanced gene transfer towards cells in murine bone marrow. Among the various envelopes used for pseudotyping, RD114 had the highest mean gene transfer efficiency with 1.2007%±0.2176, followed by VSV-G pseudotype with 0.8680%±0.0550. Other pseudotypes like GALV, ecotropic and amphotropic had 0.7590%±0.0722,

89 0.7521%±0.3617 and 0.6830%±0.0154 respectively. There was no statistically significant difference between different pseudotypes in their mean gene transfer efficiencies, however, rabies pseudotyped MLV vectors had significantly lower levels of gene transfer to cells in bone marrow (0.0018%±0.0008) (Fig.2.3).

Cardiovascular disease is the leading causes of mortality and morbidity in developed countries and inefficient conventional therapeutic strategies tend to treat the symptoms rather than the underlying causes of the disorder. Gene transfer into somatic cells interfering with the pathogenesis of , provides a novel approach for better prevention and treatment of cardiovascular disorders. Viral vector mediated gene transfer to the cardiovascular system has been extensively researched in recent years and a variety of viral vectors and different modes of administration have been proposed. Gene transfer methods employing retroviral vectors, adenoviral vectors or liposome-based vectors have already been used in clinical trials 69. All the pseudotypes used in the present study resulted in successful gene transfer to heart.

Ecotropic and amphotropic pseudotypes had relatively higher levels of gene transfer of

0.3691%±0.1494 and 0.2661%± 0.0383 respectively. Rabies envelope pseudotyped vector had the next higher level of gene transfer to heart with 0.1971%± 0.0425, followed by RD114, VSV-G and GALV with a mean gene transfer efficiency of

0.1553%± 0.0810, 0.1274%± 0.0064 and 0.1016%± 0.0255 respectively (Fig.2.4).

Findings of this in utero retroviral vector mediated gene transfer towards the cardiovascular are comparable with the previous reported gene transfer results 22,77.

90 Viral vector mediated gene transfer has been attempted for the prevention or therapy of pulmonary disorders such as cystic fibrosis7. In utero gene transfer has particular significance in these approaches since gene transfer has to occur before the irreversible destruction of the airway epithelium. In addition, in utero gene delivery to immature pulmonary epithelium circumvents the relatively resistant nature of the mature epithelium towards gene transfer and the barrier of immune response65. We evaluated the effect of pseudotyping retroviral vectors on gene transfer to murine lungs.

Among the various envelopes used in the study, rabies pseudotyped retroviral vectors had the highest level of gene transfer to lungs with 1.2959%± 0.1609, followed by ecotropic envelope with 0.6240%± 0.3038. Other envelopes such as VSV-G, RD114, amphotropic and GALV had a mean gene transfer efficiency of 0.6068%± 0.0806,

0.3160%± 0.1284, 0.2243%± 0.0379 and 0.0855%± 0.0167 respectively (Fig.2.5).

Thymus and spleen are central lymphoid organs involved in immune regulation.

Targeting therapeutic genes to peripheral lymphoid organs is critical in the correction of various lymphoid disorders and in the clinical therapeutics of infectious diseases6. In utero gene therapy offers the unique possibility of gene transfer to various organs of the immune system, by administering the genes to an immunologically naïve fetus. Our study looked at the possible effects of pseudotyping on enhanced gene transfer to spleen and thymus. RD114 (0.6500%± 0.1583), ecotropic (0.6282%± 0.3765) and amphotropic

(0.2491%± 0.0309) envelopes had significantly higher levels of gene transfer to thymus compared to rabies (0.0834%± 0.0310), VSV-G (0.0563%± 0.0102) and GALV

(0.0549%± 0.0178) pseudotypes (Fig.2.6). Gene transfer efficiency of recombinant

91 retroviral vectors had a different pattern in spleen compared to thymus. Amphotropic pseudotype had the highest gene transfer with 0.5587%±0.1327 followed by GALV with 0.1910%±0.0689 and RD114 with 0.1734%±0.0238. Ecotropic and rabies pseudotypes demonstrated the least efficient gene transfer towards spleen with

0.0729%±0.0067 and 0.0066%±0.0034 respectively (Fig. 2.7).

Liver has been a target organ for gene delivery, since it plays a key role in metabolism and serum protein production. Many metabolic disorders result from a deficiency of liver-derived protein products. Previously, there have been attempts to transfer therapeutic genes to liver using different viral vectors 11,49. We evaluated the liver of pups injected with retroviral vectors to identify the effects of pseudotyping on hepatic gene transfer efficiency. Among the envelopes used in the present study, ecotropic pseudotype had the highest level of gene transfer, 1.0694%± 0.3263, followed by rabies with 0.5746%± 0.1379. Other pseudotypes such as amphotropic, GALV,

RD114 and VSV-G had a mean gene transfer efficiency of 0.4257%± 0.0503,

0.3116%± 0.0239, 0.2986%± 0.0996 and 0.2076%± 0.0308 respectively (Fig.2.8).

Gene therapy is a potential therapeutic strategy for numerous renal diseases such as diabetic nephropathy, chronic rejection, Alport syndrome, polycystic kidney disease, and inherited tubular disorders 10. In previous studies using cationic liposomes, adenoviral or retroviral vectors to deliver genes into the kidney, transgene expression has been transient and often associated with adverse host immune responses 5,23,33,41.

Our study investigated the possible effects of pseudotyping on enhanced gene transfer

92 to the renal system. Kidneys from pups injected with amphotropic pseudotype had significantly higher levels of transgene, 1.6149%± 0.1114. RD114 and rabies pseudotypes followed amphotropic with 0.6771%± 0.2715 and 0.3489%± 0.0374 respectively. The mean gene transfer efficiencies of other envelopes were 0.3107%±

0.2082 for ecotropic, 0.2399%± 0.1101 for VSV-G and 0.0896%± 0.0318 for GALV

(Fig.2.9).

Against a wide array of musculoskeletal disorders and myopathies, such as

Duchenne muscular dystrophy, skeletal muscle is considered as an attractive target for gene therapy 20,25. Muscle-directed gene transfer may also be used to treat disorders which require continued secretion of proteins through the circulatory system 40.

Oncoretrovirus (MLVbased) vectors are believed to transduce regenerating skeletal muscle with low efficiency, but not the mature, postmitotic skeletal myocytes. In utero gene therapy transfers the transgene during an immature stage of development, when the skeletal muscles are actively proliferating. We analyzed the skeletal muscles isolated from thigh region of pups injected with retroviral gene transfer vectors, to identify the possible role of pseudotyping on muscular system directed gene therapy.

All the envelopes demonstrated efficient gene transfer to skeletal muscles. There was relatively higher level of gene transfer with RD114 pseudotype, 0.5921%± 0.2846, followed by amphotropic and VSV-G envelopes with 0.5284%± 0.0401 and 0.4081%±

0.0298 respectively. GALV, ecotropic and rabies pseudotypes demonstrated a mean gene transfer efficiency of 0.3747%± 0.0625, 0.3629%± 0.1176 and 0.2017%± 0.0537 respectively (Fig.2.10).

93 Neural stem cells present an ideal route for gene therapy and offer new possibilities to replace neurons lost to injury or disease. Highly efficient delivery and long-term expression of foreign genes in neural cells have been demonstrated using retroviral vectors both in vitro and in vivo 43. Compared to other vectors, moloney murine leukemia retroviral vectors are more suitable as tools for neural stem cell directed gene delivery in vivo, due to their stable expression and absence of cytotoxicity

43. Experiments in cell culture and in animal brain tumor models have demonstrated the feasibility of retroviral vector-mediated gene transduction and these vectors are extensively used for cancer gene therapy in humans. Quantitative PCR results of brain from pups injected with different pseudotypes of retroviral vectors, demonstrated that the amphotropic had the highest level of gene transfer followed by GALV, rabies,

RD114, ecotropic and VSV-G with a mean efficiency of 1.5310%±0.1816,

1.2483%±0.1862, 0.9594%±0.3160, 0.6863%±0.2284, 0.1358%±0.0475 and

0.0283%±0.0045 respectively (Fig. 2.11)

Although gene delivery to gonads is typically a result of non-specific gene transfer, there have been gene delivery attempts using retroviral vectors targeted to primordial germ cells, to develop rat strains with modified germline 46. Retroviral gene transfer to germs cells is also valuable in understanding and characterizing the spermatogonial stem cell activity 53. In the current study, gene transfer to the gonads was evaluated by quantitative PCR analysis of genomic DNA extracted from testes in males and ovaries in females. Tubular genitalia were not used for extraction of DNA.

94 Among the various envelopes used in the study, amphotropic and GALV demonstrated the highest level of gene transfer to gonadal tissue with a mean gene transfer efficiency of 2.7498%±0.1238 and 1.5977%±0.0712 respectively. These were followed by ecotropic (0.9428%±0.3363), RD114 (0.8478%±0.2421), Rabies (0.3815%±0.0446) and VSV-G (0.3563%±0.2047) pesudotypes (Fig. 2.12).

Significant levels of gene transfer were obtained in various organ systems at 1 month of age after in utero administration of MLV based retroviral vectors peudotyped with different envelope glycoproteins. The persistence of proviral DNA in the tissues for up to 1 month postnatal age indicates long-term persistence, which is suggestive of integration of the recombinant vector genomes. Overall, this study identified various viral envelope glycoproteins, which are capable of providing significant levels of gene transfer to specific organ systems by in utero gene therapy.

Gene transfer and transgene expression in erythroid and myeloid early progenitor cells

To analyze the gene transfer to late hematopoietic progenitors, we performed colony forming cells (CFC) assay using cells obtained from bone marrow of mouse at 1 and 3 months of age. The colonies were categorized as erythroid or myeloid based on their histomorphological parameters. Administration of retroviral vectors pseudotyped with different envelopes had no significant effect on the total number of colonies or on the number of colonies in myeloid or erythroid lineages. Individual colonies were

95 processed for PCR and number of colonies within each lineage, containing the transgene was expressed as a percentage of the total number of colonies. The RNA from colonies containing β galactosidase was used to perform RT-PCR.

In 1 month old animals, pseudotypes with the highest percentage of total colonies containing β galactosidase were ecotropic and VSV-G with 64.06% ± 16.44 and 64.06% ± 5.98 respectively. Amphotropic and RD114 pseudotyped vectors had

62.5% ± 6.25 and 62.5% ± 8.83 colonies containing β galactosidase gene, followed by

GALV pseudotype with 43.75% ± 8.83 and the lowest was rabies pseudotype with

12.5% ± 7.22 (Fig. 2.13). In general, myeloid colonies had higher level of gene transfer than erythroid colonies. Pseudotype with highest percentage of gene transfer to myeloid colonies was ecotropic followed by amphotropic, RD114, VSV-G, GALV and rabies.

The percentage of gene transfer were 81.25 ± 23.95, 73.64 ± 15.7, 71.18 ± 15.02, 69.88

± 9.81, 46.78 ± 8.36 and 11.9 ± 9.21 respectively (Fig.2.13). In erythroid colonies, ecotropic envelope pseudotyped vectors had the highest percentage of colonies containing β galactosidase, followed by RD114, VSV-G, GALV, amphotropic and rabies with 57.5 ± 15.32, 51.34 ± 15.39, 51.34 ± 16.52, 39.93 ± 10.6, 38.89 ± 11.9 and

11.9 ± 5.8 respectively (Fig. 2.13).

In 3 month old animals, the percentage of total colonies containing β galactosidase followed the similar pattern as 1 month old animals, with ecotropic pseudotype as the highest followed by VSV-G, amphotropic, RD114, GALV and rabies.

The percentage of colonies with the transgene were 52.1 ± 3.61, 50 ± 6.25, 47.92 ± 3.61,

96 39.58 ± 3.61, 29.17 ± 3.61 and 6.25 ± 3.8 respectively (Fig. 2.14). Similar to 1 month old animals, the myeloid colonies had higher level of gene transfer compared to erythroid colonies. Ecotropic envelope pseudotyped vector had the highest percentage of myeloid colonies containing β galactosidase (55.57 ± 2.39) followed by RD114

(51.50 ± 2.60), VSV-G (50.42 ± 10.53), amphotropic (41.29 ± 3.64), GALV (34.54 ±

6.56) and rabies (6.43 ± 4.3) (Fig. 2.14). Among erythroid colonies, the highest percentage of colonies containing the transgene was observed in animals injected with

RD114 pseudotyped retroviral vectors, followed by ecotropic, VSV-G, amphotropic,

GALV and rabies. The percentage of gene transfer was 38.30 ± 12.5, 32.77 ± 7.51,

32.77 ± 7.51, 28.87 ± 7.67, 18.89 ± 1.93 and 5.0 ± 3.2 respectively (Fig. 2.14).

The gene transfer efficiency to early hematopoietic progenitor cells by rabies pseudotyped retroviral vector was considered to be insignificant in comparison with other pseudotypes used in the study. By 3 months, there was ~18-37% reduction in the overall percentage of colonies containing the transgene compared to the percentage of colonies at 1 month. In parallel, myeloid colonies exhibited ~26-44% while the erythroid colonies showed ~25-43% reduction in the gene transfer (Fig. 2.15).

Total cellular RNA from erythroid and myeloid colonies containing β galactosidase gene were reverse transcribed to cDNA and used as template for PCR using primers specific for β galactosidase. The myeloid colonies had a higher percentage of colonies expressing β galactosidase than erythroid colonies, however the

97 difference was not statistically significant. The pseudotype with the highest percentage of transgene expression in myeloid colonies was amphotropic, with 58.76 ± 6.67, followed by GALV and VSV-G with 53.42±6.06 and 53.35±6.05 respectively. Myeloid colonies from animals injected with RD114 pseudotyped retroviral vector had

51.84%±5.88 colonies expressing β galactosidase, followed by ecotropic pseudotype with 49.27±5.59. Among erythroid colonies, ecotropic envelope pesudotyped vectors had the highest level of gene expression with 48.52%±4.45 β galactosidase positive colonies. Erythroid colonies from animals injected with RD114, amphotropic, GALV and VSV-G pseudotyped vectors had 45.89±4.21, 44.28±4.06, 42.61±3.91 and

41.16±3.77 colonies expressing the transgene (Fig. 2.16).

Using a murine model, we report the successful in utero gene transfer and persistence of transgene for at least 1 month in multiple organ systems. This is the first study to establish high levels of gene transfer and expression of transgene in hematopoietic stem cells, using different pseudotyped onco-retroviral vectors. While the

RD114 envelope enhanced the gene transfer ability of retroviral vectors to peripheral blood, thymus, kidney and brain, amphotropic envelope pseudotyped vectors had significantly higher gene transfer to thymus, spleen, kidney, brain and gonads.

Ecotropic envelope demonstrated high level of gene transfer to thymus and liver, while

GALV pseudotype enhanced the gene transfer of retroviral vectors to brain and gonads.

Although VSV-G and rabies pseudotypes exhibited significant gene transfer to peripheral blood and lungs respectively, rabies envelope had only insignificant levels of 98 gene transfer towards bone marrow, HSCs, peripheral blood and spleen. Overall, we show that pseudotyping retroviral vectors with heterogenous viral envelopes determined the efficiency of tissue specific gene transfer.

The ability of retroviral vectors to transduce myeloid progenitors was highest for ecotropic envelope pseudotype followed by amphotropic, RD114, VSV-G and GALV.

Gene transfer to erythroid progenitors was more efficient with ecotropic pseudotype followed by RD114, VSV-G, GALV and amphotropic . Although there was a significant reduction in the percentage of colonies containing the transgene 3 months postnatally irrespective of the pseudotype, high level gene expression was observed in both erythroid and myeloid colonies. Rabies envelope pseudotyped retroviral vectors were unsuccessful in gene delivery to early hematopoietic progenitors.

Inadvertent production of replication competent retrovirus (RCR) is the major concern for the use of retroviral vectors in human clinical trials. Much effort is made into the vector design itself to avoid the emergence of RCR in vivo. Separating various components of viral genomes such as gag, pol and env into different plasmids reduces the chances of RCR formation. The recently developed HIV-based vector (trans-vector) splits the gag-pol component of the packaging construct into two parts and thereby prevents the generation of env-minus recombinant lentivirus containing a functional gag-pol structure (LTR-gag-pol-LTR), which is absolutely required for retroviral DNA mobilization and the emergence of RCR 27. Splitting these cis elements provides an additional opportunity to make recombinant viral vectors with heterogenous envelope glycoproteins. Envelope substitution is one of the crucial modifications made in

99 recombinant retroviral and lentiviral vectors to improve safety and gene transfer efficiency. Although successful assembly of infectious viral particles has been observed in pseudotyped vectors, the functional association between heterogenous envelopes and viral cores and protein incorporation mechanism in retroviruses is not fully elucidated21.

Efficient transduction of recombinant retroviral vectors pesudotyped with heterogenous envelope glycoproteins relies on the specific interaction between the envelope and its cell surface receptor. The expression of cell surface receptors specific for various viral envelopes is dependent on the type of cell and the degree of differentiation and maturation2,64. Most onco-retroviral envelopes are known to bind transporter molecules, which are expressed on the cell surface13,37. In particular, the

MoMLV ecotropic envelope binds a cellular amino acid transporter 76. This binding is specific as illustrated by a two-amino acid variation between the sequence of murine ecotropic receptor and its human homologue restricting the binding of the ecotropic envelope. The amphotropic envelope protein, binds to a phosphate transporter protein,

Pit-2 (or GLVR-2) and its binding site is conserved among , allowing amphotropic pseudotyped virions to transduce both murine and human cells 38. The

GALV envelope binds a distinct but related sodium-phosphate symporters Pit-1 28. The receptor for the widely used vesicular stomatitis virus G glycoprotein (VSV-G) appears to involve a phosphatidylserine moiety on the lipid bilayer, and is believed to be highly expressed in different cell types from many distinct species 59. An earlier study on the receptor for feline endogenous type C retrovirus RD114 identified the gene to be

100 located on human chromosome 19 60. Although the rabies virus receptor, neural cell adhesion molecule (NCAM, CD56) has been demonstrated to play an integral part in rabies viral infectivity, other cell surface molecules are thought to bind rabies virus and act as co-receptors, thereby causing efficient infectivity 68.

The expression levels of GALV and amphotropic receptors have been well characterized 1,38,73 and were found to correlate with the infectivity of these retroviruses towards human, baboon and mouse CD34+ cells 44,45. Although human bone marrow and fetal liver exhibited the highest levels of mRNA for the RD114 receptor, a neutral amino acid transporter 54, retroviral vectors pseudotyped with RD114 did not show any significant difference in transduction efficiency towards human bone marrow cells, than amphotropic or GALV-pseudotyped vectors 52. Rabies envelope has been reported to provide increased gene transfer towards central nervous system 36 and there are no reports on rabies pseudotype being a suitable candidate for gene transfer to lymphocytes of HSCs.

In conclusion, we report that pseudotyping MLV derived onco-retroviral vectors with heterogenous viral envelopes, can act as excellent gene delivery vehicles to various organ systems, via in utero gene transfer techniques. Careful selection of envelope glycoproteins is necessary in obtaining efficient gene transfer. Based on the findings of the present study, we conclude that relatively higher levels of gene transfer can be obtained in certain organ systems by employing specific envelope pseudotypes.

101 However, absolute tissue/organ targeting could not be achieved. All the pseudotypes had high levels of gene transfer towards gonads, which calls for additional improvements in retroviral vector design and sheds light on the need to elucidate the mechanism of interaction between the viral envelope and cell surface receptor.

102 2.4 REFERENCES

1. Albritton, L. M., L. Tseng, D. Scadden, and J. M. Cunningham. 1989. A putative murine ecotropic retrovirus receptor gene encodes a multiple membrane- spanning protein and confers susceptibility to virus infection. Cell 57:659-666.

2. Arai, T., M. Takada, M. Ui, and H. Iba. 1999. Dose-dependent transduction of vesicular stomatitis virus G protein-pseudotyped retrovirus vector into human solid tumor cell lines and murine fibroblasts. Virology 260:109-115.

3. Barrette, S. and D. Orlic. 2000. Alternative viral envelopes for oncoretroviruses to increase gene transfer into hematopoietic stem cells. Curr. Opin. Mol. Ther. 2:507-514.

4. Bowles, N. E., R. C. Eisensmith, R. Mohuiddin, M. Pyron, and S. L. Woo. 1996. A simple and efficient method for the concentration and purification of recombinant retrovirus for increased hepatocyte transduction in vivo. Hum. Gene Ther. 7:1735-1742.

5. Breyer, B., W. Jiang, H. Cheng, L. Zhou, R. Paul, T. Feng, and T. C. He. 2001. Adenoviral vector-mediated gene transfer for human gene therapy. Curr. Gene Ther. 1:149-162.

6. Bunnell, B. A., L. M. Muul, R. E. Donahue, R. M. Blaese, and R. A. Morgan. 1995. High-efficiency retroviral-mediated gene transfer into human and nonhuman primate peripheral blood lymphocytes. Proc. Natl. Acad. Sci U. S. A 92:7739-7743.

7. Caplan, A. L. and J. M. Wilson. 2000. The ethical challenges of in utero gene therapy. Nat. Genet. 24:107.

8. Caplen, N. J., J. N. Higginbotham, J. R. Scheel, N. Vahanian, Y. Yoshida, H. Hamada, R. M. Blaese, and W. J. Ramsey. 1999. Adeno-retroviral chimeric viruses as in vivo transducing agents. Gene Ther. 6:454-459.

9. Chang, L. J. and J. He. 2001. Retroviral vectors for gene therapy of AIDS and cancer. Curr. Opin. Mol. Ther. 3:468-475.

10. Chen, S., A. Agarwal, O. Y. Glushakova, M. S. Jorgensen, S. K. Salgar, A. Poirier, T. R. Flotte, B. P. Croker, K. M. Madsen, M. A. Atkinson, W. W. Hauswirth, K. I. Berns, and C. C. Tisher. 2003. Gene delivery in renal tubular epithelial cells using recombinant adeno-associated viral vectors. J Am Soc Nephrol. 14:947-958.

103 11. Cheung, S. T., T. Y. Tsui, W. L. Wang, Z. F. Yang, S. Y. Wong, Y. C. Ip, J. Luk, and S. T. Fan. 2002. Liver as an ideal target for gene therapy: expression of CTLA4Ig by retroviral gene transfer. J Gastroenterol. Hepatol. 17:1008-1014.

12. Chuah, M. K., H. Brems, V. Vanslembrouck, D. Collen, and T. VandenDriessche. 1998. Bone marrow stromal cells as targets for gene therapy of hemophilia A. Hum. Gene Ther. 9:353-365.

13. Chuah, M. K., D. Collen, and T. VandenDriessche. 1998. Gene therapy for hemophilia: hopes and hurdles. Crit Rev. Oncol. Hematol. 28:153-171.

14. Clapp, D. W., L. L. Dumenco, M. Hatzoglou, and S. L. Gerson. 1991. Fetal liver hematopoietic stem cells as a target for in utero retroviral gene transfer. Blood 78:1132-1139.

15. Dando, J. S., F. Ficara, S. Deola, M. G. Roncarolo, C. Bordignon, and A. Aiuti. 2004. Efficient gene transfer into primitive hematopoietic progenitors using a bone marrow microenvironment cell line engineered to produce retroviral vectors. Haematologica 89:462-470.

16. Douar, A. M., S. Adebakin, M. Themis, A. Pavirani, T. Cook, and C. Coutelle. 1997. Foetal gene delivery in mice by intra-amniotic administration of retroviral producer cells and adenovirus. Gene Ther. 4:883-890.

17. Douar, A. M., M. Themis, V. Sandig, T. Friedmann, and C. Coutelle. 1996. Effect of amniotic fluid on cationic lipid mediated transfection and retroviral infection. Gene Ther. 3:789-796.

18. Dull, T., R. Zufferey, M. Kelly, R. J. Mandel, M. Nguyen, D. Trono, and L. Naldini. 1998. A third-generation lentivirus vector with a conditional packaging system. J Virol 72:8463-8471.

19. Eglitis, M. A., R. D. Schneiderman, P. M. Rice, and M. V. Eiden. 1995. Evaluation of retroviral vectors based on the gibbon ape leukemia virus. Gene Ther. 2:486-492.

20. Fassati, A. and N. Bresolin. 2000. Retroviral vectors for gene therapy of Duchenne muscular dystrophy. Neurol. Sci 21:S925-S927.

21. Freed, E. O. 1998. HIV-1 gag proteins: diverse functions in the virus life cycle. Virology 251:1-15.

22. Fu, S., D. Chen, X. Mao, N. Zhang, Y. Ding, and J. S. Bromberg. 2003. Feline immunodeficiency virus-mediated viral interleukin-10 gene transfer prolongs non- vascularized cardiac allograft survival. Am J Transplant. 3:552-561.

104 23. Galimi, F. and I. M. Verma. 2002. Opportunities for the use of lentiviral vectors in human gene therapy. Curr. Top. Microbiol Immunol. 261:245-254.

24. Holladay, S. D. and R. J. Smialowicz. 2000. Development of the murine and human immune system: differential effects of immunotoxicants depend on time of exposure. Environ. Health Perspect. 108 Suppl 3:463-473.

25. Inui, K., S. Okada, and G. Dickson. 1996. Gene therapy in Duchenne muscular dystrophy. Brain Dev. 18:357-361.

26. Janssens, W., M. K. Chuah, L. Naldini, A. Follenzi, D. Collen, J. M. Saint- Remy, and T. VandenDriessche. 2003. Efficiency of onco-retroviral and lentiviral gene transfer into primary mouse and human B-lymphocytes is pseudotype dependent. Hum. Gene Ther. 14:263-276.

27. Kappes, J. C. and X. Wu. 2001. Safety considerations in vector development. Somat. Cell Mol. Genet. 26:147-158.

28. Kavanaugh, M. P., D. G. Miller, W. Zhang, W. Law, S. L. Kozak, D. Kabat, and A. D. Miller. 1994. Cell-surface receptors for gibbon ape leukemia virus and amphotropic murine retrovirus are inducible sodium-dependent phosphate symporters. Proc. Natl. Acad. Sci U. S. A 91:7071-7075.

29. Kootstra, N. A. and I. M. Verma. 2003. Gene therapy with viral vectors. Annu. Rev. Pharmacol. Toxicol. 43:413-439.

30. Kurre, P., H. P. Kiem, J. Morris, S. Heyward, J. L. Battini, and A. D. Miller. 1999. Efficient transduction by an amphotropic retrovirus vector is dependent on high-level expression of the cell surface virus receptor. J Virol 73:495-500.

31. Larson, J. E., S. L. Morrow, J. B. Delcarpio, R. P. Bohm, M. S. Ratterree, J. L. Blanchard, and J. C. Cohen. 2000. Gene transfer into the fetal primate: evidence for the secretion of transgene product. Mol. Ther. 2:631-639.

32. Larson, J. E., S. L. Morrow, L. Happel, J. F. Sharp, and J. C. Cohen. 1997. Reversal of cystic fibrosis phenotype in mice by gene therapy in utero. Lancet 349:619-620.

33. Lechardeur, D. and G. L. Lukacs. 2002. Intracellular barriers to non-viral gene transfer. Curr. Gene Ther. 2:183-194.

34. Lipshutz, G. S., L. Flebbe-Rehwaldt, and K. M. Gaensler. 1999. Adenovirus- mediated gene transfer to the peritoneum and hepatic parenchyma of fetal mice in utero. Surgery 126:171-177.

105 35. MacKenzie, T. C., G. P. Kobinger, N. A. Kootstra, A. Radu, M. Sena-Esteves, S. Bouchard, J. M. Wilson, I. M. Verma, and A. W. Flake. 2002. Efficient transduction of liver and muscle after in utero injection of lentiviral vectors with different pseudotypes. Mol. Ther. 6:349-358.

36. Mazarakis, N. D., M. Azzouz, J. B. Rohll, F. M. Ellard, F. J. Wilkes, A. L. Olsen, E. E. Carter, R. D. Barber, D. F. Baban, S. M. Kingsman, A. J. Kingsman, K. O'Malley, and K. A. Mitrophanous. 2001. Rabies virus glycoprotein pseudotyping of lentiviral vectors enables retrograde axonal transport and access to the nervous system after peripheral delivery. Hum. Mol. Genet. 10:2109-2121.

37. Miller, A. D. and F. Chen. 1996. Retrovirus packaging cells based on 10A1 murine leukemia virus for production of vectors that use multiple receptors for cell entry. J Virol 70:5564-5571.

38. Miller, D. G. and A. D. Miller. 1994. A family of retroviruses that utilize related phosphate transporters for cell entry. J Virol 68:8270-8276.

39. Mitchell, M., M. Jerebtsova, M. L. Batshaw, K. Newman, and X. Ye. 2000. Long-term gene transfer to mouse fetuses with recombinant adenovirus and adeno-associated virus (AAV) vectors. Gene Ther. 7:1986-1992.

40. Moisset, P. A. and J. P. Tremblay. 2001. Gene therapy: a strategy for the treatment of inherited muscle diseases? Curr. Opin. Pharmacol. 1:294-299.

41. Nakanishi, K., A. Moran, T. Hays, Y. Kuang, E. Fox, D. Garneau, R. M. de Oca, M. Grompe, and A. D. D'Andrea. 2001. Functional analysis of patient- derived mutations in the Fanconi anemia gene, FANCG/XRCC9. Exp. Hematol. 29:842-849.

42. Naldini, L., U. Blomer, P. Gallay, D. Ory, R. Mulligan, F. H. Gage, I. M. Verma, and D. Trono. 1996. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272:263-267.

43. Nanmoku, K., M. Kawano, Y. Iwasaki, and K. Ikenaka. 2003. Highly efficient gene transduction into the brain using high-titer retroviral vectors. Dev. Neurosci. 25:152-161.

44. Orlic, D., L. J. Girard, S. M. Anderson, L. C. Pyle, M. C. Yoder, H. E. Broxmeyer, and D. M. Bodine. 1998. Identification of human and mouse hematopoietic stem cell populations expressing high levels of mRNA encoding retrovirus receptors. Blood 91:3247-3254.

106 45. Orlic, D., L. J. Girard, C. T. Jordan, S. M. Anderson, A. P. Cline, and D. M. Bodine. 1996. The level of mRNA encoding the amphotropic retrovirus receptor in mouse and human hematopoietic stem cells is low and correlates with the efficiency of retrovirus transduction. Proc. Natl. Acad. Sci U. S. A 93:11097- 11102.

46. Orwig, K. E., M. R. Avarbock, and R. L. Brinster. 2002. Retrovirus-mediated modification of male germline stem cells in rats. Biol. Reprod. 67:874-879.

47. Palu, G., C. Parolin, Y. Takeuchi, and M. Pizzato. 2000. Progress with retroviral gene vectors. Rev. Med Virol 10:185-202.

48. Pan, Y., P. Zhai, A. M. Dashti, S. Wu, X. Lin, and M. Wu. 2002. A combined gene delivery by co-transduction of adenoviral and retroviral vectors for cancer gene therapy. Cancer Lett. 184:179-188.

49. Ponder, K. P., J. R. Melniczek, L. Xu, M. A. Weil, T. M. O'Malley, P. A. O'Donnell, V. W. Knox, G. D. Aguirre, H. Mazrier, N. M. Ellinwood, M. Sleeper, A. M. Maguire, S. W. Volk, R. L. Mango, J. Zweigle, J. H. Wolfe, and M. E. Haskins. 2002. Therapeutic neonatal hepatic gene therapy in mucopolysaccharidosis VII dogs. Proc. Natl. Acad. Sci U. S. A 99:13102-13107.

50. Porada, C. D., N. Tran, M. Eglitis, R. C. Moen, L. Troutman, A. W. Flake, Y. Zhao, W. F. Anderson, and E. D. Zanjani. 1998. In utero gene therapy: transfer and long-term expression of the bacterial neo(r) gene in sheep after direct injection of retroviral vectors into preimmune fetuses. Hum. Gene Ther. 9:1571- 1585.

51. Porada, C. D., N. D. Tran, Y. Zhao, W. F. Anderson, and E. D. Zanjani. 2000. Neonatal gene therapy. transfer and expression of exogenous genes in neonatal sheep following direct injection of retroviral vectors into the bone marrow space. Exp. Hematol. 28:642-650.

52. Porter, C. D., M. K. Collins, C. S. Tailor, M. H. Parkar, F. L. Cosset, R. A. Weiss, and Y. Takeuchi. 1996. Comparison of efficiency of infection of human gene therapy target cells via four different retroviral receptors. Hum. Gene Ther. 7:913-919.

53. Rainov, N. G. and H. Ren. 2003. Clinical trials with retrovirus mediated gene therapy--what have we learned? J Neurooncol. 65:227-236.

54. Rasko, J. E., J. L. Battini, R. J. Gottschalk, I. Mazo, and A. D. Miller. 1999. The RD114/simian type D retrovirus receptor is a neutral amino acid transporter. Proc. Natl. Acad. Sci U. S. A 96:2129-2134.

107 55. Relander, T., A. C. Brun, K. Olsson, L. Pedersen, and J. Richter. 2002. Overexpression of gibbon ape leukemia virus (GALV) receptor (GLVR1) on human CD34(+) cells increases gene transfer mediated by GALV pseudotyped vectors. Mol. Ther. 6:400-406.

56. Relander, T., S. Karlsson, and J. Richter. 2002. Oncoretroviral gene transfer to NOD/SCID repopulating cells using three different viral envelopes. J Gene Med 4:122-132.

57. Sandrin, V., B. Boson, P. Salmon, W. Gay, D. Negre, R. Le Grand, D. Trono, and F. L. Cosset. 2002. Lentiviral vectors pseudotyped with a modified RD114 envelope glycoprotein show increased stability in sera and augmented transduction of primary lymphocytes and CD34+ cells derived from human and nonhuman primates. Blood 100:823-832.

58. Sandrin, V., S. J. Russell, and F. L. Cosset. 2003. Targeting retroviral and lentiviral vectors. Curr. Top. Microbiol Immunol. 281:137-178.

59. Schlegel, R., T. S. Tralka, M. C. Willingham, and I. Pastan. 1983. Inhibition of VSV binding and infectivity by phosphatidylserine: is phosphatidylserine a VSV- binding site? Cell 32:639-646.

60. Schnitzer, T. J., R. A. Weiss, D. K. Juricek, and F. H. Ruddle. 1980. Use of vesicular stomatitis virus pseudotypes to map viral receptor genes: Assignment of RD114 virus receptor gene to human chromosome 19. J Virol 35:575-580.

61. Sekhon, H. S. and J. E. Larson. 1995. In utero gene transfer into the pulmonary epithelium. Nat. Med 1:1201-1203.

62. Senut, M. C. and F. H. Gage. 1999. Prenatal gene therapy: can the technical hurdles be overcome? Mol. Med Today 5:152-156.

63. Soneoka, Y., P. M. Cannon, E. E. Ramsdale, J. C. Griffiths, G. Romano, S. M. Kingsman, and A. J. Kingsman. 1995. A transient three-plasmid expression system for the production of high titer retroviral vectors. Nucleic Acids Res. 23:628-633.

64. Stitz, J., S. Steidl, H. Merget-Millitzer, R. Konig, P. Muller, F. Nocken, M. Engelstadter, M. Bobkova, I. Schmitt, R. Kurth, C. J. Buchholz, and K. Cichutek. 2000. MLV-derived retroviral vectors selective for CD4-expressing cells and resistant to neutralization by sera from HIV-infected patients. Virology 267:229-236.

108 65. Tarantal, A. F., C. I. Lee, J. E. Ekert, R. McDonald, D. B. Kohn, C. G. Plopper, S. S. Case, and B. A. Bunnell. 2001. Lentiviral vector gene transfer into fetal rhesus monkeys (Macaca mulatta): lung-targeting approaches. Mol. Ther. 4:614-621.

66. Tarantal, A. F., J. P. O'Rourke, S. S. Case, G. C. Newbound, J. Li, C. I. Lee, C. R. Baskin, D. B. Kohn, and B. A. Bunnell. 2001. Rhesus monkey model for fetal gene transfer: studies with retroviral- based vector systems. Mol. Ther. 3:128-138.

67. Themis, M., H. Schneider, T. Kiserud, T. Cook, S. Adebakin, S. Jezzard, S. Forbes, M. Hanson, A. Pavirani, C. Rodeck, and C. Coutelle. 1999. Successful expression of beta-galactosidase and factor IX transgenes in fetal and neonatal sheep after ultrasound-guided percutaneous adenovirus vector administration into the umbilical vein. Gene Ther. 6:1239-1248.

68. Thoulouze, M. I., M. Lafage, M. Schachner, U. Hartmann, H. Cremer, and M. Lafon. 1998. The neural cell adhesion molecule is a receptor for rabies virus. J Virol 72:7181-7190.

69. Tomita, N., H. Azuma, Y. Kaneda, T. Ogihara, and R. Morishita. 2003. Gene therapy with transcription factor decoy oligonucleotides as a potential treatment for cardiovascular diseases. Curr. Drug Targets. 4:339-346.

70. Tran, N. D., C. D. Porada, G. Almeida-Porada, H. A. Glimp, W. F. Anderson, and E. D. Zanjani. 2001. Induction of stable prenatal tolerance to beta- galactosidase by in utero gene transfer into preimmune sheep fetuses. Blood 97:3417-3423.

71. Tran, N. D., C. D. Porada, Y. Zhao, G. Almeida-Porada, W. F. Anderson, and E. D. Zanjani. 2000. In utero transfer and expression of exogenous genes in sheep. Exp. Hematol. 28:17-30.

72. Turkay, A., T. Saunders, and K. Kurachi. 1999. Intrauterine gene transfer: gestational stage-specific gene delivery in mice. Gene Ther. 6:1685-1694.

73. van Zeijl, M., S. V. Johann, E. Closs, J. Cunningham, R. Eddy, T. B. Shows, and B. O'Hara. 1994. A human amphotropic retrovirus receptor is a second member of the gibbon ape leukemia virus receptor family. Proc. Natl. Acad. Sci U. S. A 91:1168-1172.

74. VandenDriessche, T., V. Vanslembrouck, I. Goovaerts, H. Zwinnen, M. L. Vanderhaeghen, D. Collen, and M. K. Chuah. 1999. Long-term expression of human coagulation factor VIII and correction of hemophilia A after in vivo retroviral gene transfer in factor VIII-deficient mice. Proc. Natl. Acad. Sci U. S. A 96:10379-10384.

109 75. von Kalle, C., H. P. Kiem, S. Goehle, B. Darovsky, S. Heimfeld, B. Torok- Storb, R. Storb, and F. G. Schuening. 1994. Increased gene transfer into human hematopoietic progenitor cells by extended in vitro exposure to a pseudotyped retroviral vector. Blood 84:2890-2897.

76. Wang, Z. H., Y. Ji, W. Shan, B. Zeng, N. Raksadawan, G. M. Pastores, T. Wisniewski, and E. H. Kolodny. 2002. Therapeutic effects of astrocytes expressing both tyrosine hydroxylase and brain-derived neurotrophic factor on a rat model of Parkinson's disease. Neuroscience 113:629-640.

77. Wong, W., J. S. Billing, S. A. Stranford, K. Hyde, J. Fry, P. J. Morris, and K. J. Wood. 2003. Retroviral transfer of donor MHC class I or MHC class II genes into recipient bone marrow cells can induce operational tolerance to alloantigens in vivo. Hum. Gene Ther. 14:577-590.

78. Yang, E. Y., H. B. Kim, A. F. Shaaban, R. Milner, N. S. Adzick, and A. W. Flake. 1999. Persistent postnatal transgene expression in both muscle and liver after fetal injection of recombinant adenovirus. J Pediatr. Surg. 34:766-772.

79. Zufferey, R., D. Nagy, R. J. Mandel, L. Naldini, and D. Trono. 1997. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat. Biotechnol. 15:871-875.

110 Pseudotype Pups Pups alive Pups alive injected at 1 week at 1 month GALV 12 10 10 Amphotropic 12 10 10 VSV-G 12 10 9 RD114 12 10 10 Ecotropic 12 10 10 Rabies 12 10 9

Table 2.1 - Viability of murine fetuses injected with recombinant retroviral vectors

At day 16 post-coitum pregnant mice were anesthetized with isoflurane mixed with oxygen and delivered by a non-rebreathing circuit. A 1.5-cm midline incision was made caudal to the sternum through the skin, abdominal muscles, and peritoneum, and the gravid uterus was exteriorized. Each fetus was then injected intra-peritoneally with 5 µl of vector preparation using a 100 µL Luer tip Hamilton syringe fitted with a 33-gauge 1- inch 30o-beveled needle and a repeating dispenser. The uterus was placed inside the abdominal cavity and the skin was closed. The number of pups alive at one week and one month are given in the table. Neither the surgical procedure not the viral vectors had any detrimental effect on fetal development and viability. The loss of animals observed postnatally in VSV-G and rabies pseudotyped group was not associated with any disease, but was a result of cage aggression.

111

Figure 2.1 Standard curve for semi-quantitative detection of gene transfer

To determine transduction efficiency, a standard curve was generated from Sup T1 cells containing a single integrated copy of the MLV transfer vector pLEGFP-C1 containing the CMV promoter diluted with non-transduced Sup T1 cells at the ratios 10%, 1%, 0.1%, 0.01%, 0.001%, and 0%. Genomic DNA was extracted and PCR was performed to using CMV specific primers for 32 cycles. In order to ensure that results were standardized for the amount of genomic DNA isolated from each sample, PCR for the β-actin gene was performed on each sample for 25 cycles. Densitometric analysis and linear regression analysis was performed on the PCR products. For all standard curves, the p value for regression was < 0.01.

112

Figure 2.2 Efficiency of gene transfer towards peripheral blood on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins.

Pups injected with recombinant retroviral vectors in utero were sacrified at 1 month of age and genomic DNA was extracted from peripheral blood cells. PCR was performed to using CMV specific primers for 32 cycles and β-actin specific primers for 25 cycles along with standard curve. Densitometric and linear regression analysis was performed on the PCR products and percentage gene transfer was calculated. The pseudotype with the highest degree of gene transfer was RD114 with 1.8145%± 0.2554, followed by VSV-G pseudotype with 1.3943%± 0.0891. Amphotropic, ecotropic, and GALV pseudotyped retroviral vectors had a mean gene transfer efficiency of 1.0368%± 0.0676, 0.6673%± 0.2989 and 0.3782%± 0.0525 respectively. Animals injected with rabies pseudotyped retroviral vectors had insignificant levels of transgene, 0.0018%± 0.0005. Statistical analysis was performed using Student’s t test. * indicates P value < 0.05. Results are expressed as mean of the percentage gene transfer with standard deviation.

113

Figure 2.3 Efficiency of gene transfer towards bone marrow on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins.

Pups injected with recombinant retroviral vectors in utero were sacrified at 1 month of age and genomic DNA was extracted from bone marrow. PCR was performed to using CMV specific primers for 32 cycles and β-actin specific primers for 25 cycles along with standard curve. Densitometric and linear regression analysis was performed on the PCR products and percentage gene transfer was calculated. RD114 envelope had the highest mean gene transfer efficiency with 1.2007%±0.2176, followed by VSV-G pseudotype with 0.8680%±0.0550. Other pseudotypes like GALV, ecotropic and amphotropic had 0.7590%±0.0722, 0.7521%±0.3617 and 0.6830%±0.0154 respectively. Even though no statistically significant differences between different pseudotypes were noticed, rabies pseudotyped MLV vectors had significantly lower levels of gene transfer to cells in bone marrow (0.0018%±0.0008). Statistical analysis was performed using Student’s t test. * indicates P value < 0.05. Results are expressed as mean of the percentage gene transfer with standard deviation.

114

Figure 2.4 Efficiency of gene transfer towards heart on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins.

Pups injected with recombinant retroviral vectors in utero were sacrified at 1 month of age and genomic DNA was extracted from heart. PCR was performed to using CMV specific primers for 32 cycles and β-actin specific primers for 25 cycles along with standard curve. Densitometric and linear regression analysis was performed on the PCR products and percentage gene transfer was calculated. Ecotropic and amphotropic pseudotypes had relatively higher levels of gene transfer of 0.3691%±0.1494 and 0.2661%± 0.0383 respectively. Rabies envelope pseudotyped vector had the next higher level of gene transfer to heart with 0.1971%± 0.0425, followed by RD114, VSV-G and GALV with a mean gene transfer efficiency of 0.1553%± 0.0810, 0.1274%± 0.0064 and 0.1016%± 0.0255 respectively. Statistical analysis was performed using Student’s t test. Results are expressed as mean of the percentage gene transfer with standard deviation.

115

Figure 2.5 Efficiency of gene transfer towards lungs on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins.

Pups injected with recombinant retroviral vectors in utero were sacrified at 1 month of age and genomic DNA was extracted from lungs. PCR was performed to using CMV specific primers for 32 cycles and β-actin specific primers for 25 cycles along with standard curve. Densitometric and linear regression analysis was performed on the PCR products and percentage gene transfer was calculated. Rabies pseudotyped retroviral vectors had the highest level of gene transfer to lungs with 1.2959%± 0.1609, followed by ecotropic envelope with 0.6240%± 0.3038. Other envelopes such as VSV-G, RD114, amphotropic and GALV had a mean gene transfer efficiency of 0.6068%± 0.0806, 0.3160%± 0.1284, 0.2243%± 0.0379 and 0.0855%± 0.0167 respectively. Statistical analysis was performed using Student’s t test. * indicates P value < 0.05. Results are expressed as mean of the percentage gene transfer with standard deviation.

116

Figure 2.6 Efficiency of gene transfer towards thymus on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins.

Pups injected with recombinant retroviral vectors in utero were sacrified at 1 month of age and genomic DNA was extracted from thymus. PCR was performed to using CMV specific primers for 32 cycles and β-actin specific primers for 25 cycles along with standard curve. Densitometric and linear regression analysis was performed on the PCR products and percentage gene transfer was calculated. RD114 (0.6500%± 0.1583), ecotropic (0.6282%± 0.3765) and amphotropic (0.2491%± 0.0309) envelopes had significantly higher levels of gene transfer to thymus compared to rabies (0.0834%± 0.0310), VSV-G (0.0563%± 0.0102) and GALV (0.0549%± 0.0178) pseudotypes. Statistical analysis was performed using Student’s t test. * indicates P value < 0.05. Results are expressed as mean of the percentage gene transfer with standard deviation.

117

Figure 2.7 Efficiency of gene transfer towards spleen on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins.

Pups injected with recombinant retroviral vectors in utero were sacrified at 1 month of age and genomic DNA was extracted from spleen. PCR was performed to using CMV specific primers for 32 cycles and β-actin specific primers for 25 cycles along with standard curve. Densitometric and linear regression analysis was performed on the PCR products and percentage gene transfer was calculated. Amphotropic pseudotype had the highest gene transfer with 0.5587%±0.1327 followed by GALV with 0.1910%±0.0689 and RD114 with 0.1734%±0.0238. Ecotropic and rabies pseudotypes demonstrated the least efficient gene transfer towards spleen with 0.0729%±0.0067 and 0.0066%±0.0034 respectively. Statistical analysis was performed using Student’s t test. * indicates P value < 0.05. Results are expressed as mean of the percentage gene transfer with standard deviation.

118

Figure 2.8 Efficiency of gene transfer towards liver on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins.

Pups injected with recombinant retroviral vectors in utero were sacrified at 1 month of age and genomic DNA was extracted from liver. PCR was performed to using CMV specific primers for 32 cycles and β-actin specific primers for 25 cycles along with standard curve. Densitometric and linear regression analysis was performed on the PCR products and percentage gene transfer was calculated. Among the envelopes used in the present study, ecotropic pseudotype had the highest level of gene transfer, 1.0694%± 0.3263, followed by rabies with 0.5746%± 0.1379. Other pseudotypes such as amphotropic, GALV, RD114 and VSV-G had a mean gene transfer efficiency of 0.4257%± 0.0503, 0.3116%± 0.0239, 0.2986%± 0.0996 and 0.2076%± 0.0308 respectively. Statistical analysis was performed using Student’s t test. * indicates P value < 0.05. Results are expressed as mean of the percentage gene transfer with standard deviation.

119

Figure 2.9 Efficiency of gene transfer towards kidneys on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins.

Pups injected with recombinant retroviral vectors in utero were sacrified at 1 month of age and genomic DNA was extracted from kidneys. PCR was performed to using CMV specific primers for 32 cycles and β-actin specific primers for 25 cycles along with standard curve. Densitometric and linear regression analysis was performed on the PCR products and percentage gene transfer was calculated. Kidneys from pups injected with amphotropic pseudotype had significantly higher levels of transgene, 1.6149%± 0.1114. RD114 and rabies pseudotypes followed amphotropic with 0.6771%± 0.2715 and 0.3489%± 0.0374 respectively. The mean gene transfer efficiencies of other envelopes were 0.3107%± 0.2082 for ecotropic, 0.2399%± 0.1101 for VSV-G and 0.0896%± 0.0318 for GALV. Statistical analysis was performed using Student’s t test. * indicates P value < 0.05. Results are expressed as mean of the percentage gene transfer with standard deviation.

120

Figure 2.10 Efficiency of gene transfer towards skeletal muscle on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins.

Pups injected with recombinant retroviral vectors in utero were sacrified at 1 month of age and genomic DNA was extracted from skeletal muscle. PCR was performed to using CMV specific primers for 32 cycles and β-actin specific primers for 25 cycles along with standard curve. Densitometric and linear regression analysis was performed on the PCR products and percentage gene transfer was calculated. There was relatively higher level of gene transfer with RD114 pseudotype, 0.5921%± 0.2846, followed by amphotropic and VSV-G envelopes with 0.5284%± 0.0401 and 0.4081%± 0.0298 respectively. GALV, ecotropic and rabies pseudotypes demonstrated a mean gene transfer efficiency of 0.3747%± 0.0625, 0.3629%± 0.1176 and 0.2017%± 0.0537 respectively. Statistical analysis was performed using Student’s t test. Results are expressed as mean of the percentage gene transfer with standard deviation.

121

Figure 2.11 Efficiency of gene transfer towards brain on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins.

Pups injected with recombinant retroviral vectors in utero were sacrified at 1 month of age and genomic DNA was extracted from brain. PCR was performed to using CMV specific primers for 32 cycles and β-actin specific primers for 25 cycles along with standard curve. Densitometric and linear regression analysis was performed on the PCR products and percentage gene transfer was calculated. amphotropic had the highest level of gene transfer followed by GALV, rabies, RD114, ecotropic and VSV-G with a mean efficiency of 1.5310%±0.1816, 1.2483%±0.1862, 0.9594%±0.3160, 0.6863%±0.2284, 0.1358%±0.0475 and 0.0283%±0.0045 respectively. Statistical analysis was performed using Student’s t test. * indicates P value < 0.05. Results are expressed as mean of the percentage gene transfer with standard deviation.

122

Figure 2.12 Efficiency of gene transfer towards gonads on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins.

Pups injected with recombinant retroviral vectors in utero were sacrified at 1 month of age and genomic DNA was extracted from gonads. PCR was performed to using CMV specific primers for 32 cycles and β-actin specific primers for 25 cycles along with standard curve. Densitometric and linear regression analysis was performed on the PCR products and percentage gene transfer was calculated. Amphotropic and GALV demonstrated the highest level of gene transfer to gonadal tissue with a mean gene transfer efficiency of 2.7498%±0.1238 and 1.5977%±0.0712 respectively. These were followed by ecotropic (0.9428%±0.3363), RD114 (0.8478%±0.2421), Rabies (0.3815%±0.0446) and VSV-G (0.3563%±0.2047) pesudotypes. Statistical analysis was performed using Student’s t test. * indicates P value < 0.05. Results are expressed as mean of the percentage gene transfer with standard deviation.

123

Figure 2.13 Efficiency of gene transfer towards hematopoietic progenitor cells at 1 month of age on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins.

Pups injected with recombinant retroviral vectors in utero were sacrified at 1 month of age and mononuclear cells were isolated from bone marrow. Progenitor cell assays were established using 6.0 x 105 nucleated bone marrow cells/plate in 2 ml Methocult GF M3434, and plated in triplicate. Evaluation after 12 days of incubation included total colony counts, and quantification of individual erythroid and myeloid progenitors. Individual erythroid and myeloid colonies were collected, processed and analyzed for gene transfer by PCR using CMV promoter specific primers. Highest overall percentage of gene transfer was obtained using ecotropic and VSV-G followed by amphotropic, RD114 and GALV pseudotyped vectors the lowest was rabies pseudotype. Pseudotype with highest percentage of gene transfer to myeloid colonies was ecotropic followed by amphotropic, RD114, VSV-G, GALV and rabies. In erythroid colonies, ecotropic envelope pseudotyped vectors had the highest percentage of colonies containing β galactosidase, followed by RD114, VSV-G, GALV, amphotropic and rabies. Statistical analysis was performed using Student’s t test. * indicates P value < 0.05. Results are expressed as mean of the percentage gene transfer with standard deviation.

124

Figure 2.14 Efficiency of gene transfer towards hematopoietic progenitor cells at 3 month of age on in utero administration of retroviral vectors pseudotyped with different envelope glycoproteins.

Pups injected with recombinant retroviral vectors in utero were sacrified at 3 months of age and mononuclear cells were isolated from bone marrow. Progenitor cell assays were established using 6.0 x 105 nucleated bone marrow cells/plate in 2 ml Methocult GF M3434, and plated in triplicate. Evaluation after 12 days of incubation included total colony counts, and quantification of individual erythroid and myeloid progenitors. Individual erythroid and myeloid colonies were collected, processed and analyzed for gene transfer by PCR using CMV promoter specific primers. Ecotropic pseudotype had the highest percentage gene transfer followed by VSV-G, amphotropic, RD114, GALV and rabies. Ecotropic envelope pseudotyped vector had the highest percentage of myeloid colonies containing β galactosidase followed by RD114, VSV-G, amphotropic, GALV and rabies. Among erythroid colonies, the highest percentage of colonies containing the transgene was observed in animals injected with RD114 pseudotyped retroviral vectors, followed by ecotropic, VSV-G, amphotropic, GALV and rabies. . Statistical analysis was performed using Student’s t test. * indicates P value < 0.05. Results are expressed as mean of the percentage gene transfer with standard deviation.

125

Figure 2.15 Temporal reduction in hematopoietic progenitor cell directed gene transfer

By 3 months, there was ~18-37% reduction in the overall percentage of colonies containing the transgene compared to the percentage of colonies at 1 month. In parallel, myeloid colonies exhibited ~26-44% while the erythroid colonies showed ~25-43% reduction in the gene transfer. Results are expressed as mean of the percentage gene transfer.

126

Figure 2.16 Expression of β-galactosidase in hematopietic progenitor cells 3 months postnatally.

Pups injected with recombinant retroviral vectors in utero were sacrified at 3 months of age and mononuclear cells were isolated from bone marrow. Progenitor cell assays were established using 6.0 x 105 nucleated bone marrow cells/plate in 2 ml Methocult GF M3434, and plated in triplicate. Evaluation after 12 days of incubation included total colony counts, and quantification of individual erythroid and myeloid progenitors. Individual erythroid and myeloid colonies were collected, processed and analyzed for gene transfer by RT-PCR using β-galactosidase promoter specific primers. The pseudotype with the highest percentage of transgene expression in myeloid colonies was amphotropic, followed by GALV, VSV-G, RD114 and ecotropic pseudotype. Among erythroid colonies, ecotropic envelope pesudotyped vectors had the highest level of gene expression followed by RD114, amphotropic, GALV and VSV-G pseudotyped vectors. Statistical analysis was performed using Student’s t test. Results are expressed as mean of the percentage gene expression with standard deviation.

127

CHAPTER 3

HUMAN T LYMPHOTROPIC VIRUS TYPE 1 ACCESSORY PROTEIN P12I

MODULATES CELLULAR GENE EXPRESSION AND ENHANCES P300

EXPRESSION IN T LYMPHOCYTES

3.1 INTRODUCTION

Human T-lymphotropic virus type 1 (HTLV-1), a deltaretrovirus, infects approximately 15 to 20 million people worldwide 24. The virus is the etiologic agent of adult T cell leukemia/lymphoma (ATLL), an aggressive malignancy of T lymphocytes characterized by prolonged latency, monoclonal proliferation of CD3+CD4+CD8-

CD25+ HLA-DR+ T lymphocytes and viral persistence in infected individuals 7,22,28,44

HTLV-1 induces transformation of T lymphocytes in vitro, and activation of T lymphocytes appears to be necessary for efficient viral infection, as well as establishment of productive infection 28. However, details of the molecular mechanism of T cell activation and transformation by HTLV-1 remain to be completely understood.

HTLV-1 encodes regulatory proteins Tax and Rex as well as accessory proteins p12I, p27I, p13II, and p30II in the pX gene region of the viral genome4. Recent studies have investigated the role of HTLV-1 accessory protein p12I in viral infection and T- 128 cell activation. Earlier studies reported that pX ORF I dispensable for HTLV-1 infection in vitro 16,52, however findings from our laboratory demonstrated that selective ablation of ORF I from HTLV-1 proviral clone, ACH, dramatically reduced viral infectivity in vivo 13. ORF I deletion reduced viral infectivity to quiescent peripheral blood mononuclear cells (PBMC) in the absence of mitogenic stimulation in vitro 1.

Additionally, the ability of the mutated virus to infect PBMC was restored by addition of mitogenic stimuli1. More importantly, recent studies have demonstrated that the expression of p12I in Jurkat T cells increases IL-2 production, a cytokine crucial in T cell activation19. Collectively, these findings established that p12I plays a critical role in

T cell activation and efficient viral infection of quiescent T lymphocytes.

HTLV-1 p12I contains two putative transmembrane regions, four putative proline-rich SH3-binding domains 21 and a calcineurin binding site 34, suggesting its possible involvement in T-cell signaling pathways. p12I binds IL-2 R ß and chains and enhances Stat5 DNA-binding activity 45,49. In addition, p12I localizes in the ER and cis-

Golgi compartment and associates with calreticulin involved in calcium homeostasis

18,39. Importantly, expression of p12I elevates cytosolic calcium levels 17 and selectively activates NFAT-mediated transcription in a calcium-dependent manner in Jurkat T cells

3. Taken together, these findings indicate a crucial role of HTLV-1 p12I in calcium mediated cellular gene expression and T-cell activation.

There is a growing interest in the use of gene array technology to identify candidate genes important in the pathogenesis of HTLV-I infection. cDNA array analysis of HTLV-1 immortalized T cells demonstrated that HTLV-1 induced 129 alterations in expression of a large number of transcription factors, cell cycle related genes and genes involved in apoptosis 15,27. Altered gene expression of several gene networks is thought to be associated with the initiation or progression of ATL and recently, an extensive oligonucleotide array analysis of HTLV-1 immortalized and transformed cell lines discovered multiple genes involved in oncogenesis 51. Tax was found to alter the expression of multiple genes, such as cytokines, growth factors, signaling factors, immune modulators and genes involved in apoptosis, cell cycle, DNA repair and cell adhesion in Jurkat T lymphocytes 48. A recent study identified cancer progression associated genes in ATLL using oligonucleotide array analysis of infected

T cells from patients who evolved from chronic to acute crisis ATLL 57. Additionally, many genes including T cell differentiated antigen (MAL) and a lymphoid specific member of the G-protein-coupled receptor family (EBI-1/CCR7) were found to be upregulated in PBMC from chronic ATLL patients 38.

Based on these previous studies, we hypothesized that HTLV-1 p12I regulates the expression of cellular genes in a calcium-dependent manner. In the present study, we report that p12I expression in Jurkat T-lymphocytes using a recombinant lentiviral system resulted in alteration of genes involved in cell proliferation, apoptosis, cell adhesion, immune response modulation and T cell signaling predominantly in a calcium-dependent manner. Moreover, we have confirmed that p12I altered gene expression in a calcium mediated fashion in primary human CD4+ T lymphocytes.

Intriguingly, p12I expression was associated with upregulated expression of p300, a rate limiting central cellular transcriptional co-adaptor, which plays a crucial role in HTLV-

130 1 pathogenesis. We are the first to demonstrate a viral protein mediated enhancement of p300 expression in T lymphocytes. Our data indicates that p12I appears to be play a vital role in HTLV-1 mediated T cell activation by activating calcium mediated transcription and augmenting the amounts of p300 within T lymphocytes. Collectively, our data indicates that this complex retrovirus, which is associated with lymphoproliferative diseases, relies upon the p12I accessory protein to modify the cellular environment by enhancement of T-cell activation and thereby facilitates early events of the viral infection.

3.2 MATERIALS AND METHODS

Cell lines

The 293T cell line (American Type Culture Collection) which stably expresses the simian virus 40 (SV40) T antigen, were maintained in Dulbecco’s modified Eagle medium (DMEM, Invitrogen) supplemented with 10% fetal bovine serum (FBS), 100

µg/ml streptomycin/penicillin plus 2 mM L-glutamine (complete DMEM, cDMEM).

Human peripheral blood mononuclear cells (PBMC) were obtained from buffy coats of healthy donors from Red cross and maintained in RPMI 1640 media (Invitrogen) supplemented with 15% FBS, 100 µg/ml streptomycin/penicillin and 2 mM L- glutamine, complete RPMI, cRPMI). Jurkat T cells (clone E6-1, American Type

Culture Collection) were maintained in cRPMI containing 10 mM HEPES (Invitrogen).

131 Lentiviral vectors and other plasmids

The internal ribosome entry site (IRES) sequence from pHR’CMV/Tax1/eGFP

(Dr. Gerold Feuer, SUNY, Syracuse) was cloned into the pWPT-GFP plasmid (Dr.

Didier Trono, University of Geneva, Geneva, Switzerland) to create pWPT-IRES-GFP

(control plasmid). pWPT-p12IHA-IRES-GFP was generated by cloning p12IHA from pME-p12I 45 (a kind gift from G. Franchini, NCI, NIH) into pWPT-IRES-GFP (Fig. 1

A). Fidelity of plasmids were checked by Sanger sequencing while expression of GFP and p12-HA was confirmed by flow cytometry (ELITE ESP flow cytometer, Beckman

Coulter) and Western blot (monoclonal anti- hemagglutinin antibody (1:1000) Covance) respectively as previously described 19. Plasmid p5XGT-TATA-Luc (a kind gift of P.

Quinn, The Pennsylvania State University, Hershey, PA), contains five tandem Gal4

DNA-binding sequences upstream of a TATA box, derived from positions -264 to +11 of the phosphoenolpyruvate carboxykinase (PEPCK) gene in a luciferase reporter gene plasmid. The pRSV-B-Gal and 12SE1A (a kind gift from T. Kouzarides, University of

Cambridge, Cambridge, UK) have been described previously 62,63. pCMV-p300 expresses the full-length p300 protein from a CMV I/E promoter (Upstate Biotech).

Recombinant lentiviral vector production stable p12I expression in Jurkat T lymphocytes

Recombinant lentiviral vectors, pseudotyped with VSV-G (vesicular stomatitis virus envelope glycoprotein), expressing p12I and GFP were produced as described previously 19. Briefly, 5 µg of pHCMV-G, 25 µg of pCMV∆R8.2 and 25 µg of pWPT- 132 p12IHA-IRES-GFP or pWPT-IRES-GFP were transfected to 293T cells using the calcium phosphate method. Supernatant was collected at 24, 48 and 72 h post transfection, cleared of cellular debris by centrifugation at 1000 rpm for 10 min at room temp and then filtered through a 0.2 µm filter. Recombinant vectors were then concentrated by centrifugation of the supernatant at 6,500 x g for 16 h at 4° C. The viral pellet was suspended in cDMEM overnight at 4° C and concentrated virus was aliquoted and stored at –80° C until use. Virus titer was determined by spin infecting

293T cells 19. Jurkat T lymphocytes were spin infected with recombinant lentiviral vectors at a multiplicity of infection (MOI) of 3 in the presence of 8 µg/ml polybrene

(Sigma) at 2700 rpm for 1 h at 28o C. At 7 days post-infection, cells were tested for

GFP production by FACS analysis and p12I expression by RT-PCR.

Isolation of primary CD4 T lymphocytes and expression of p12I

Peripheral blood mononuclear cells (PBMC) were isolated from buffy coat using ficoll paque plus (Amersham Biosciences) as described by manufacturer. Primary

CD4+ T cells were extracted using CD4 positive isolation kit (Dynal Biotech) according to manufacturer’s instructions. The purity of CD 4 isolation was tested by staining the cells with Phycoerythrin (PE) conjugated anti-CD4 antibody and subsequent FACS analysis. Primary CD4+ T cells were stimulated with Phytohemagglutinin (PHA) for 48 h, transduced with recombinant virus at multiplicity of infection of 25 in the presence of

8 µg/ml polybrene (Sigma) and spin-infected at 2700 rpm for 1 h at 28o C. At 7 days post-infection, GFP expression of controls and samples were verified to be above 90%

133 by FACS analysis and the presence of p12I mRNA expression in the samples (and absence in controls) was verified by RT-PCR. Expression of selected genes was also quantified by semi-quantitative RT-PCR from these cells at 7 days post-infection.

RNA isolation and probe preparation

Total cellular RNA was isolated from Jurkat T lymphocytes using RNAqueous according to manufacturer’s instructions (Ambion). Complementary DNA was synthesized using Genechip T7-Oligo (dT) promoter primer kit (Affymetrix) and superscript double stranded cDNA synthesis kit (Invitrogen) and in vitro transcription was done with ENZO RNA Transcript labeling kit (Affymetrix). Biotin labeled cRNA was fragmented and hybridized to U133A (Affymetrix) arrays using GeneChip

Hybridization Oven (Affymetrix). Arrays were washed and stained using GeneChip

Fluidics Station 400 (Affymetrix) and scanned by GeneArray Scanner (Affymetrix).

Differential gene expression and comparative analysis was done using Data Mining

Tool (Microarray suite 5) to identify probes with at least 1.5 fold difference in expression between GFP control and p12I expressing Jurkat T-cells and verified for cluster formation by dCHIP software 41. Functional grouping of these probes was done using Mining Tool (Affymetrix) 5.

134 Semi-quantitative RT-PCR in Jurkat and primary CD4 T lymphocytes

Total cellular RNA was isolated from control and p12I spin infected Jurkat T lymphocytes as well as primary CD 4+ T lymphocytes, using RNAqueous as described by the manufacturer (Ambion). One µg RNA was converted to cDNA with Reverse

Transcription system (Promega) as described by the manufacturer. cDNA from 100 ng of total RNA was then PCR amplified with AmpliTaq DNA polymerase (Perkin Elmer).

The PCR primers for p12I were as follows: CCTCTTTCTCCCGCTCTTTT (forward) and GGCCAAGCTAGCGTAATCTG (reverse). The PCR primers for candidate genes selected for confirmation by semi-quantitative RT-PCR are as follows:

TNFSF10:GGCCGCAAAATAAACTCCTG (forward),

CCGAAAAAACTGGCTTCATG (reverse);

GADD45A:CTGAACGGTGATGGCATCTG (forward),

CCAAAAATACCCAAACTATGGCT (reverse);

BAK1:AGAGCTGTCTGAACTCACGTGTC

(forward),GGAGGATCCACCTCTGGGA (reverse);

IL6ST:TGTCCAGTATTCTACCGTGGTACAC (forward),

GCATGCCTTCATCAGTCGC (reverse);

STK18:GCAGAATGAAACTTGAGTCACTTAC

(forward),CCAGCAGGTTTTGTCCATG (reverse);

CDC2L1:CTGCTGACTCAGAAGCCTCTGT (forward),GCTTCACACGCTGCTGCT

(reverse); P300:GTAGCCTAAAAGACAATTTTCCTTG (forward),

ATGTCAACCATCTGCACCAGTA (reverse). 135 PCR products were separated by agarose gel electrophoresis. Densitometric analysis was done using alpha imager spot densitometry (Alpha Innotech) as described previously 2. Statistical analysis was performed using Student’s t test, P < 0.05. DNA contamination was ruled out by performing a control with no reverse transcriptase.

Functional gene expression analysis

Jurkat T lymphocytes (2x106) were transfected with 500 ng of 5xGT-luc, 100 ng of pM-VP16, 500 ng of pRSV-βgal and increasing amounts of either pME-p12IHA, pME-18s or pCMV-p300 in the presence or absence of 1µg 12sE1A using Superfect transfection protocol (Qiagen). At 72 h post transfection, cells were lysed with passive lysis buffer (Promega) at room temperature for 15 min. Twenty microliters of each lysate was used to test luciferase reporter gene activity using an enhanced luciferase assay kit (Promega) according to the manufacturer’s protocol. Transfection efficiency was normalized by staining with 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside

(X-Gal) (Sigma) and counting β-Gal expressing cells. Results were expressed as mean of normalized luciferase activity in arbitrary light units (ALU) with standard error (SE) from a minimum of triplicate experiments. Statistical analysis was performed using

Student’s t test, P < 0.05.

136 3.3 RESULTS

Expression of HTLV-1 p12I in Jurkat T lymphocytes

To establish a stable expression system to test the effects of p12I in the natural target target cell of HTLV-1, we constructed lentivirus vectors to express the viral protein in Jurkat T cells (Fig. 3.1A). The lentivirus vector system allows us to stably express p12I as a bicistronic RNA concurrently with green fluorescent protein (GFP) marker gene. Jurkat T cells spin infected with recombinant lentivirus expressing GFP alone (controls) or p12I and GFP (samples), were analyzed 7 days post-transduction by

FACS analysis for GFP expression (Fig. 3.1B). All the controls and samples expressed more than 95% GFP. Expression of HTLV-1 p12I mRNA, in control and sample Jurkat

T lymphocytes, was tested 7 days post- infection by RT-PCR. All the samples were positive for p12I mRNA by RT-PCR, as indicated by the presence of a ~221 bp band

(Fig. 3.1C) while the controls remained negative.

Calcium-dependent gene expression in Jurkat T lymphocytes expressing p12I

HTLV-1 p12I upregulated the expression of 288 genes and downregulated the expression of 407 genes with known biological functions. In addition to several calcium-regulated genes, we identified that p12I modulated expression various genes whose transcriptional-regulation has not been identified to be calcium-dependent. We classified these genes based on their function in various cellular processes, such as apoptosis, cell proliferation, T cell activation or cell signaling, cell adhesion and

137 immune response (Fig. 3.2 – 3.6). Consistent with our previous findings of calcium- dependent T cell activation by p12I, we found that Jurkat T cells expressing p12I exhibited a pattern of expression of calcium mediated gene expression, including cell division cycle-2 like-1 (CDC2L1), interleukin-6 signal transducer (IL6ST), transcription factor , colony stimulating factor (CSF-1), TNF super family members, adenosine receptor, tumor necrosis factor (TNF) receptor associated factor (TRAF) and serine threonine kinase-18 (STK18) 20.

Apoptosis

Cells expressing p12I demonstrated altered expression of many key apoptosis- related proteins (Fig 3.2). Consistent with its known effects upon intracellular calcium, p12I expression correlated with increased expression of adenosine A1 receptor

(ADORA1) and lowered levels of protein phosphatase-1 inhibitor subunit-15A

(PPP1R15A) and apoptosis inhibitor-5 (API5), all known to be calcium-dependent genes. Mobilization of ER calcium stores has been reported to initiate the activation of cytoplasmic death pathways as well as sensitize mitochondria to direct proapoptotic stimuli. Apoptotic programmed cell death pathways are activated by diverse extrinsic and intrinsic signals, propagated through mitochondria resulting in the activation of effector caspases. Regulation of the mitochondrial checkpoint is obtained through a complex interplay between members of the BCL-2 family 11. Calcium release from the

ER is known to regulate the BCL-2 family members. In addition, privileged transport of

Ca2+ between juxtaposed ER and mitochondrial membranes may sensitize mitochondria to the effects of proapoptotic BCL-2 family members through Ca2+-induced opening of 138 the mitochondrial permeability transition pore 26. Expression of p12I induced downregulation of Bcl-2 related/interacting genes such as pro-apoptotic BCL2- antagonist/killer-1 (BAK1), anti-apoptotic protein, BCL2-associated athanogene-4

(BAG4) and myeloid cell leukemia sequence (MCL1). p12I expression also correlated with downregulation of several genes associated with Fas-mediated apoptosis pathways such as TNF receptor-associated factor-3 (TRAF3), TRAF-interacting anti-apoptotic protein BIRC4 and TNF receptor superfamily member-6b decoy (TNFRSF6B). Jurkat T cells expressing p12I also had upregulation of genes such as TNF superfamily member-

10 and TNF receptor superfamily member-1A. p12I expression was also associated with increased expression of caspase-1 and decreased expression of genes associated with the DNA fragmentation pathway (CIDE-B).

T lymphocyte proliferation

p12I expression altered the expression of multiple cell cycle dependent kinases and related proteins, and proteins involved in cytokine signaling, initiation of DNA replication and G protein coupled signaling (Fig. 3.3). p12 upregulated the expression of cell division cycle -2 like-1 and 5 (CDC2L1, CDC2L5) and downregulated the expression of cyclin-dependent kinase-9 (CDK9) and CDC45 cell division cycle-45 like

(CDC45L). Interestingly, CDK9 has been reported to associate with the HIV-1 preinitiation complex, where it interacts with HIV-1 Tat protein causing increased transcriptional elongation 64. p12I expression was associated with downregulation of

Cip1-interacting finger protein (CIZ1), which inhibits the interaction of p21 with

CDK2 42. Jurkat T cells expressing p12I were found to have decreased levels of cell- 139 cycle regulatory proteins such as growth-arrest and DNA-damage-inducible-α

(GADD45A), which plays an important role in G(2)-M checkpoint, FK506 binding protein 12-rapamycin associated protein-1 (FRAP1), a phosphatidylinositol kinase- related kinase, critical for the progression through G1 phase of the cell cycle, mitogen activated protein kinase kinase-6 (MAP2K6), a signaling protein known to induce G(2) arrest and cell cycle progression-2 protein (CPR2), which helps to overcome G1-arrest.

Cytokine mediated cell signaling is an important mechanism involved in T cell proliferation and p12I expression correlated with upregulation of cytokines such as interleukin 12A (IL12A) and CSF1 as well as cytokine receptors such as TNF receptor superfamily member-1 (TNFRSF1), which cause increased synthesis of PIP2, a key molecule in calcium mediated T cell signaling. Interestingly, HTLV-1 p12I upregulated origin recognition complex subunit 4-like (ORC4L) and transcription factor-5

(E2F5), which are essential for initiation of DNA replication. p12I expression also increased the expression of adrenergic-α1B receptor (ADRA1B) and decreased the expression of coagulation factor II (thrombin) receptor (F2R), both G protein coupled proteins. Other proteins known to be involved in cell proliferation that were modulated by p12I include fragile histidine triad gene (FHIT) (upregulated) and Rho guanine nucleotide exchange factor (GEF1) (downregulated).

140 T cell activation / cell signaling

We have previously reported that HTLV-1 p12I specifically activated NFAT mediated transcription in a calcium-dependent manner 3. Consistent with our previous studies, we found that HTLV-1 p12I modulated the expression of several proteins associated with calcium-signaling pathway (Fig. 3.4). HTLV-1 p12I expression in

Jurkat T cells was associated with downregulation of inositol polyphosphate phosphatase (SHIP2), responsible for increased biosynthesis of IP3, diacylglycerol kinase ε 64 kDa (DGKE), involved in the regeneration of phosphatidylinositol inositol

1,3,4,5-tetra phosphate (IP4) and 3-phosphoinositide-dependent protein kinase-1

(PDPK1).

p12I expression was associated with upregulation of mitogen-activated protein kinase-activated protein kinase-2 (MAPKAPK2), mitogen-activated protein kinase-10

(MAPK10) and down regulation of MAP-kinase activating death domain (MADD) and dual specificity phosphatase-2 (DUSP2). In addition, p12I expression was associated with decreased expression of several proteins associated with Ras-mediated signaling such as RAS p21 protein activator-2 and 3 (RASA2 and 3), which are suppressors of

RAS function and RAB6A, a GTP-binding protein associated with intra-Golgi protein transport. Furthermore, p12I upregulated son of sevenless (SOS1; a positive regulator of

RAS), small GTPase Rab2, a Ras oncogene family member required for protein transport from the ER to the Golgi and protein kinase-Cι, which interacts with Rab2.

141 Interestingly, Jurkat T-cells expressing p12I had higher levels of p300, a critical transcriptional co-adaptor,highly related to CREB binding protein (CBP). DNA-binding factors such as NFAT, c-Jun, Fos, p53, Stat1, Ets-1, NFκB, cMyb, TBP, TFIIB, RNA helicase A, CREB and RNA polymerase II form complexes with p300/CBP 25,31,58.

Interestingly, p300/CBO co-activators form complexes with other transcription factors at the HTLV-1 promoter, and are known to play a critical role in the regulation of

HTLV-1 transcription in infected T-cells 40. In addition, two proteins of HTLV-1, Tax and p30II, binds p300 at the KIX domain and regulate viral gene transcription from the

LTR 60,62.

HTLV-1 p12I expression correlated with a decrease in protein tyrosine phosphatase receptor type, C (PTPRC, CD45), a signaling molecule involved in regulation of a variety of cellular processes including cell growth, differentiation, mitotic cycle and oncogenic transformation. In particular, PTPRC regulates T cell antigen receptor signaling either by directly interacting with components of the antigen receptor complexes or by activating various Src family kinases required for antigen receptor signaling 56. Interestingly, IL-2-independent HTLV-1-transformed T-cell lines also have lower expression of CD45RO, an isoform of PTPRC. More importantly,

HTLV-1 Tax alone was not able to suppress the expression of CD45RO 43 and therefore it is possible that p12I contributes to the suppression of CD45RO. Additionally, p12I modulated the expression of various proteins associated with cytokine signaling such as interleukin-13 receptor-α (IL13RA), a common subunit shared between IL-13 and IL-4 receptor as well as suppressor of cytokine signaling-2 and 5 (SOCS2, SOCS5).

142 Immune response

The ability of HTLV-1 proteins to modulate cellular immune responses is critical in establishing persistent infection 8. HTLV-1 p12I has been reported to downregulate

MHC-1 and is believed to help infected cells to evade immune recognition 32,33.

Interestingly, p12I upregulated the expression of calcium-dependent ADP-ribosylation factor-6 (ARF6), which increases receptor mediated and downregulate cell surface expression of MHC-1 14 and downregulated MHC-I polypeptide-related sequence-A (MICA) (Fig. 3.5). Intriguingly, p12I modulated the expression of various proteins associated with MHC-II antigen presentation as well. These included downregulation of proteins that are critical in peptide loading of MHC class II molecules such as MHC-II-DMβ (HLA-DMB), MHC-II-DRβ5 (HLA-DRB5), as well as MHC-II, DRβ1 (HLA-DRB1) and upregulation of interferon-γ inducible MHC-II-

DPα1 (HLA-DPA1) and cathepsin-S (CTSS), a cysteine proteinase involved in MHC-II antigen presentation. In addition, p12I expression correlated with decreased expression of other immune response-associated genes such as transporter-2 ATP-binding cassette subfamily-B (TAP2), CD80, CD1E and apolipoprotein-L2 (APOL2) (Fig. 3.5). In addition, p12I downregulated calcium regulated Angiotensin-II receptor type-1

(AGTR1) which regulates lymphocyte proliferation and cellular immune response through a calcineurin dependent pathway 47. Furthermore, p12I upregulated the expression of several cytokines and associated proteins involved in immune response, including IL-6 signal transducer (IL6ST), IL-12A, interferon-α7, CSF1, interferon-γ

143 and interferon consensus sequence binding protein-1 (ICSBP1). In parallel, interferon-γ plays an important role in the pathogenesis of other viruses infections such as measles virus, herpes simplex virus-1, and vesicular stomatitis virus 12.

Cell adhesion

Intracellular calcium concentration plays a crucial role in regulating cell-cell adhesion (Fig. 3.6). Consistent with its ability to increase cytosolic calcium levels, we found that p12I modulated the expression of various proteins involved in cell adhesion.

Cells expressing p12I had increased levels of two calcium dependent cell adhesion molecules namely, cadherin-2 type-1 (CDH2) and protocadherin-9 (PCDH9), two lectin family proteins that promotes cell adhesion namely, galectin-8 and sialoadhesin

(CD169) and selectin P ligand (CD162). In addition, p12I downregulated two calcium dependent adhesion molecules namely desmocollin-3 (DSC3) and sialophorin (CD43), leptin receptor (LEPR), laminin-β1 and laminin-β2 (LAMB1, LAMB2). Interestingly,

CD43 cross-linking is known to potentiate viral LTR promoter-driven activity and virus production, independent of the CD28 in HIV-1 infected cells 9.

Confirmation of the role of p12I mediated gene expression in Jurkat T cells and primary CD4+ T lymphocytes by RT-PCR .

In order to confirm our gene array findings, we selected several candidate genes based on the crucial role of these gene products in various cellular processes like transcriptional regulation (p300), apoptosis (BAK1 and TNFSF10), cell cycle regulation

144 (CDC2L1 and GADD45) and signal transduction (STK18 and IL6ST). CDC2L1, IL6ST and STK18 were of additional interest since their expression is calcium-regulated 20.

We confirmed the modulation of the expression of these selected genes in response to p12I by performing semi-quantitative RT-PCR and subsequent densitometric analyses as described in materials and methods. Consistent with our gene array findings, Jurkat T cells expressing p12I demonstrated increased expression of p300, IL6ST, CDC2L1 and

TNFSF10 by 2.2, 2.1, 2.2 and 1.8 fold respectively and decreased expression of BAK1,

GADD45 and STK18 by 1.9, 2.0 and 2.4 fold respectively (Fig. 3.7A and B). Since the target cells of HTLV-1 infection are CD4+ T lymphocytes, we similarly tested the ability of p12I to modulate gene expression in primary CD4+ T cells. In parallel to our gene array data and our findings in Jurkat T cells, primary CD4+ T lymphocytes expressing p12I exhibited increased expression of p300, IL6ST, CDC2L1 and TNFSF10 by 3.9, 2.7, 2.1 and 1.7 fold respectively and decreased expression of BAK1, GADD45, and STK18 by 2.4, 2.9 and 1.8 fold respectively (Fig. 3.8A and B).

HTLV-1 p12I enhances p300 transcription in Jurkat T lymphocytes.

The cellular transcriptional co-adaptor, p300 is known to interact with key transcriptional molecules involved in T cell activation such as NFAT, NF-κB and AP-1

23,50,55. To test if p12I enhances p300 levels in Jurkat T lymphocytes to biologically significant levels, we performed functional gene expression analysis as described in materials and methods. The schematic illustration of our p300-dependent reporter system is shown figure3. 9. Briefly, acidic activation domain of herpes simplex virus

145 protein VP16 interacts with p300 for transcriptional activation and VP16 fused to Gal4

DNA binding domain is known to activate transcription from a minimal promoter containing Gal4 binding site 59. To validate the functional gene expression analysis system, we transfected a p300 expression plasmid (pCMV-p300) into Jurkat T cells along with a luciferase reporter plasmid driven by a Gal4 promoter and a Gal4 DBD-

VP16 fusion plasmid (Fig.3.10 A). As expected, p300 enhanced VP16 mediated transcription in a dose dependent manner and the transctivation was blocked in the presence of adenovirus E1A protein (Fig.3.10 A). E1A protein is known to bind p300 and make it unavailable for transcription 29. We tested the ability of p12I to enhance p300 levels by transfecting Jurkat T cells with increasing concentrations of pME- p12IHA or pME-18s empty plasmid control in the presence of the Gal4 luciferase reporter gene construct and a Gal4 DBD-VP16 fusion plasmid. HTLV-1 p12I caused up to a 3.2 fold increase in VP16-mediated activation of transcription in a dose dependent manner (Fig. 10 B). To confirm that the increase in VP16-mediated transcription was due to p300, we transfected adenovirus E1A expression plasmid into the Jurkat T cells along with the plasmids. We found that the enhancement of VP16 mediated transactivation by p12I could be blocked in the presence of the p300 binding E1A protein (Fig. 3.10 B).

146 3.4 DISCUSSION

Our study presents a comprehensive analysis of changes in gene expression patterns caused by HTLV-1 p12I, an accessory protein critical for the virus replication in vivo. We included methods to strengthen the reliability of our data specifically by (a) using triplicate samples and appropriate controls (b) using multiple software for data analysis (c) minimizing nonspecific hybridization and background signals by using

Affymetrix chip 46 (d) using a well-characterized T lymphocyte system (Jurkat T cells) and (e) validating microarray data by RT-PCR and functional gene expression assays, all of which were consistent with our gene array data. Overall, this study confirms that p12I is a regulator of cellular genes, and identifies several potential new functional roles for p12I, in T cell activation , cell signaling, in regulation of apoptosis, cell proliferation, cell adhesion and in the modulation of immune responses.

Gene array approaches have previously been used to study HTLV-1-related changes in cellular gene expression. Using human cDNA array analysis of normal and

HTLV-1 immortalized T cells, Harhaj et al 27 demonstrated that the expression of a large number of genes involved in apoptosis were deregulated in HTLV-1 immortalized

T cells. Subsequently, the same type of cDNA arrays were employed by De La Fuente et al 15 to study regulation of transcription factors in HTLV-1-infected cells, including zinc fingers, paired domains, and basic helix-loop-helix (bHLH) proteins. Gene expression profiles of fresh peripheral blood mononuclear cells (PBMC) from acute and chronic ATL patients were used to identify the genes associated with progression of

147 ATL including a T cell differentiated antigen (MAL), a lymphoid specific member of the G-protein-coupled receptor family (EBI-1/CCR7) and MNLL, a novel human homolog to a subunit of the bovine ubiquinone oxidoreductase complex 37. Recently,

Tsukasaki et al reported that membrane receptors such as selectin and CD47, cell cycle regulatory proteins such as CDC2L1 and adhesion molecules such as galectins are upregulated while Rho GTPase activating protein-4, as well as several MHC-1 and II proteins are downregulated in acute ATLL 57. Using NIH OncoChip cDNA arrays containing 2304 cancer related cDNA elements, Ng et al, 2001 48 compared normal and

Tax-expressing Jurkat T lymphocytes and identified Tax induced changes in gene expression, associated with apoptosis, cell cycle, DNA repair, signaling factors, immune modulators, cytokines, growth factors, and adhesion molecules. Affymetrix

GeneChip microarrays containing oligonucleotide hybridization probes representative of ~7000 genes were used to compare the expression profiles of normal activated peripheral blood lymphocytes to HTLV-1-immortalized and transformed cell lines 51. In our study presented herein, we tested the role of p12I expression on an extensive number of cellular genes (~33,000 )in the natural target cells of the virus.

I We have previously reported that HTLV-1 p12 increases intracellular calcium concentration by releasing calcium from the ER and also by capacitative calcium entry

18. Calcium plays an essential role in lymphocyte activation and maturation. NFAT, a calcium/calcineurin dependent transcriptional factor, is vital for proliferation of peripheral lymphocytes during HTLV-1 infection 61. Similarly, activation of NFAT is necessary for efficient infectivity in primary lymphocytes and early stages of HIV

148 replication, especially at the completion of reverse transcription 35,36. Studies from our laboratory has demonstrated that HTLV-1 accessory protein p12I specifically activates

NFAT mediated transcription in a calcium dependent manner and thereby increase infectivity of the virus to quiescent T cells 3. Feske et al 20 investigated the role of calcium on regulation of gene expression in T lymphocytes and identified expression patterns of proteins involved in cell signaling and cell cycle regulators such as CDC2L1 and CDC2L5, cytokines and cytokine associated proteins such as IL6ST, TNF super family members, TRAF and CSF-1, transcription factors such as E2F5, cell surface receptors like adenosine receptor and protein kinases like STK18. Interestingly, these gene expression profiles were similar to patterns displayed by Jurkat T cells expressing p12I. Additionally, we found that HTLV-1 p12I modulated the expression of several genes associated with calcium signaling pathways in Jurkat T cells, including IP4,

PDPK1, and SHIP2. These proteins are responsible for increased biosynthesis of IP3 and DGKE, which is involved in the regeneration of phosphatidylinositol.

p300 and cAMP response element-binding protein (CREB)-binding protein

(CBP) are coactivators involved in the regulation of transcription and chromatin. p300 is a multifunctional co-activator with histone acetyltransferase properties known to regulate several transcription factors. Histone acetyltransferases (HATs) and histone deacetylases play a crucial role in transcriptional activation and repression of multiple genes 58. Binding of p300 to transcription factor activation domains is known to position

HATs near specific nucleosomes in targeted gene promoter regions. Interaction of p300 with components of the general transcriptional machinery, such as TFIID, TFIIB and

149 RNA polymerase-II holoenzyme (RNAPII) is thought to be critical for its transcriptional function. Simultaneous interaction of multiple transcription factors with p300 has been proposed to contribute to transcriptional synergy while competition to interact with p300, which is expressed in limited amounts, has been suggested to mediate transcriptional repression 58. Additionally, p300/CBP are multifunctional adaptors that coordinate cell cycle progression with transcriptional regulation 50.

Interestingly, these coactivators are recruited in p53 dependent signaling pathways important in tumorigenesis 6,53. Furthermore, certain cases of acute myeloid leukemia have been linked to recurrent chromosomal translocations that result in frame fusions of

CBP or p300 to the monocytic leukemia protein 10 and myeloid/lymphoid leukemia gene products 30,54. Moreover, adenoviral oncoprotein E1A inhibits host gene transcription by binding and presumably using the HAT activities of p300/CBP 53.

Overall, p300 mediated transcriptional regulation have been extensively investigated, however the transcriptional regulation of the p300 gene itself remains unclear. Herein, we are the first to demonstrate that a viral protein, HTLV-1 p12I, augments the expression of p300 and enhances p300-mediated transcription.

p300 interacts with transcription factors such as NFAT, AP-1 and NF-κB which are essential for IL-2 production, T cell activation and proliferation 23,50,55. In addition, these interactions are critical for viral gene expression and replication in retroviral infections like HIV-1 and HTLV-1 29. HIV-1 proteins Tat and Vpr have been shown to interact with p300. Moreover, chromatin immunoprecipitation analysis of the integrated

HTLV-1 provirus in infected T cells revealed the presence of Tax, a variety of

150 ATF/CREB and AP-1 family members (CREB, CREB-2, ATF-1, ATF-2, c-Fos and c-

Jun) and p300 at the HTLV-1 promoter 40. HTLV-1 tax has been shown to bind p300, stabilize the transcriptional machinery on the proviral LTR and thereby increasing viral gene transcription while another HTLV-1 accessory protein, p30II, has been demonstrated to compete with Tax for binding p300 at the KIX domain of p300 62,63.

This competition between different proteins of the same virus is thought to play an important role in balancing viral gene expression during different phases of HTLV-1 replication.

HTLV-1 persists in immunocompetent infected individuals suggesting that the virus may have developed strategies for immune evasion. MHC molecules essential for presentation of foreign peptides are the targets of many viral proteins and HTLV-1 p12I is known to interact with factors involved with MHC-1 antigen presentation 32.

Interestingly, p12I downregulated MHC-I polypeptide-related sequence A (MICA) and upregulated the expression of MHC-1 associated protein calcium dependent ADP- ribosylation factor-6, which is known to increase receptor mediated endocytosis and thereby results in the downregulation of cell surface expression of MHC-1 14. More importantly, downregulation of MHC-II associated proteins such as HLA-DMB, HLA-

DRB5 and HLA-DRB1 by p12I followed a similar pattern as observed in acute crisis

ATLL patients 57. Since alterations in the expression of MHC proteins is a well-known mechanism of cellular defense against viral infection, the role of p12I in modulation of

MHC-1 and II may correlate with the ability of HTLV to maintain proviral loads in vivo.

151 HTLV-1 mediated interference with normal T cell apoptosis is thought to be a mechanism of tumorigenesis 28, but specific mechanisms by which HTLV-1 infection or any particular HTLV-1 gene products influence on T cell survival are not fully understood 28. Similar to the effect of HTLV-1 Tax on apoptosis related genes 27,48, we found that p12I was associated with the alteration of expression of multiple genes with both pro-apoptotic and anti-apoptotic properties. Several members of the cell cycle machinery display alterations in gene expression in HTLV-1 infected cells 51 and a number of studies examined the aberrations in cell cycle caused by HTLV-1 Tax 28.

Based on data presented herein, p12I appears to modulate the cell cycle and further studies will be required to test its role in the context of other HTLV-1 regulatory proteins such as Tax.

Overall, our current study extends our earlier reports 1,3,13,17-19 and sheds light on the novel mechanisms by which p12I functions in HTLV-1 pathogenesis. It is possible that HTLV-1accessory proteins act synergistically. We postulate that, HTLV-1 differentially uses its regulatory and accessory gene products to subvert the cellular mileu in order to support optimal viral replication and maintain persistent infection.

However, since information on the expression profile of HTLV-1 proteins during different stages of the infection is limited, additional studies will be required to explore these possibilities. Future studies might provide new directions in the development of therapeutic interventions against HTLV-1 lymphoproliferative disorders.

152 3.5 REFERENCES

1. Albrecht, B., N. D. Collins, M. T. Burniston, J. W. Nisbet, L. Ratner, P. L. Green, and M. D. Lairmore. 2000. Human T-lymphotropic virus type 1 open reading frame I p12(I) is required for efficient viral infectivity in primary lymphocytes. J. Virol. 74:9828-9835.

2. Albrecht, B., N. D. Collins, G. C. Newbound, L. Ratner, and M. D. Lairmore. 1998. Quantification of human T-cell lymphotropic virus type 1 proviral load by quantitative competitive polymerase chain reaction. J VIROL METH 75:123-140.

3. Albrecht, B., C. D. D'Souza, W. Ding, S. Tridandapani, K. M. Coggeshall, and M. D. Lairmore. 2002. Activation of nuclear factor of activated T cells by human T- lymphotropic virus type 1 accessory protein p12(I). J. Virol. 76:3493- 3501.

4. Albrecht, B. and M. D. Lairmore. 2002. Critical role of human T- lymphotropic virus type 1 accessory proteins in viral replication and pathogenesis. Microbiol. Mol. Biol. Rev. 66:396-406.

5. Ashburner, M., C. A. Ball, J. A. Blake, D. Botstein, H. Butler, J. M. Cherry, A. P. Davis, K. Dolinski, S. S. Dwight, J. T. Eppig, M. A. Harris, D. P. Hill, L. Issel-Tarver, A. Kasarskis, S. Lewis, J. C. Matese, J. E. Richardson, M. Ringwald, G. M. Rubin, and G. Sherlock. 2000. Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat. Genet. 25:25-29.

6. Avantaggiati, M. L., V. Ogryzko, K. Gardner, A. Giordano, A. S. Levine, and K. Kelly. 1997. Recruitment of p300/CBP in p53-dependent signal pathways. Cell 89:1175-1184.

7. Bangham, C. R. 2000. The immune response to HTLV-I. Curr. Opin. Immunol. 12:397-402.

8. Bangham, C. R. 2003. Human T-lymphotropic virus type 1 (HTLV-1): persistence and immune control. Int. J Hematol. 78:297-303.

9. Barat, C. and M. J. Tremblay. 2002. Engagement of CD43 enhances human immunodeficiency virus type 1 transcriptional activity and virus production that is induced upon TCR/CD3 stimulation. J Biol. Chem. 277:28714-28724.

153 10. Borrow, J., V. P. Stanton, J. M. Andresen, R. Becher, F. G. Behm, R. S. K. Chaganti, C. I. Civin, C. Disteche, I. Dube, A. M. Frischauf, D. Horsman, F. Mitelman, S. Volinia, A. E. Watmore, and D. E. Housman. 1996. The translocation t(8;l6)(pll p13) of acute myeloid leukaemia fuses a putative acetyltransferase to the CREB binding protein. Nat. Genet. 14:33-41.

11. Breckenridge, D. G., M. Germain, J. P. Mathai, M. Nguyen, and G. C. Shore. 2003. Regulation of apoptosis by endoplasmic reticulum pathways. Oncogene 22:8608-8618.

12. Chesler, D. A. and C. S. Reiss. 2002. The role of IFN-gamma in immune responses to viral infections of the central nervous system. Cytokine Growth Factor Rev. 13:441-454.

13. Collins, N. D., G. C. Newbound, B. Albrecht, J. L. Beard, L. Ratner, and M. D. Lairmore. 1998. Selective ablation of human T-cell lymphotropic virus type 1 p12I reduces viral infectivity in vivo. Blood 91:4701-4707.

14. D'Souza-Schorey, C., G. Li, M. I. Colombo, and P. D. Stahl. 1995. A regulatory role for ARF6 in receptor-mediated endocytosis. Science 267:1175- 1178.

15. de La, F. C., L. Deng, F. Santiago, L. Arce, L. Wang, and F. Kashanchi. 2000. Gene expression array of HTLV type 1-infected T cells: Up-regulation of transcription factors and cell cycle genes. AIDS Res. Hum. Retroviruses 16:1695-1700.

16. Derse, D., J. Mikovits, and F. Ruscetti. 1997. X-I and X-II open reading frames of HTLV-I are not required for virus replication or for immortalization of primary T-cells in vitro. Virology 237:123-128.

17. Ding, W., Albrecht B., R. E. Kelley, N. Muthusamy, S. Kim, R. A. Altschuld, and M. D. Lairmore. 2002. Human T lymphotropic virus type 1 p12(I) expression increases cytoplasmic calcium to enhance the activation of nuclear factor of activated T cells. J Virol 76:10374-10382.

18. Ding, W., B. Albrecht, R. Luo, W. Zhang, J. R. Stanley, G. C. Newbound, and M. D. Lairmore. 2001. Endoplasmic Reticulum and cis-Golgi Localization of Human T- Lymphotropic Virus Type 1 p12(I): Association with Calreticulin and Calnexin. J. Virol. 75:7672-7682.

19. Ding, W., S. J. Kim, A. M. Nair, B. Michael, K. Boris-Lawrie, A. Tripp, G. Feuer, and M. D. Lairmore. 2003. Human T-Cell Lymphotropic Virus Type 1 p12(I) Enhances Interleukin-2 Production during T-Cell Activation. J Virol 77:11027-11039.

154 20. Feske, S., J. Giltnane, R. Dolmetsch, L. M. Staudt, and A. Rao. 2001. Gene regulation mediated by calcium signals in T lymphocytes. Nat. Immunol. 2:316- 324.

21. Franchini, G. 1995. Molecular mechanisms of human T-cell leukemia/lymphotropic virus type I infection. Blood 86:3619-3639.

22. Franchini, G. and H. Streicher. 1995. Human T-cell leukaemia virus. Baillieres Clin. Haematol. 8:131-148.

23. Garcia-Rodriguez, C. and A. Rao. 1998. Nuclear factor of activated T cells (NFAT)-dependent transactivation regulated by the coactivators p300/CREB- binding protein (CBP). J. Exp. Med. 187:2031-2036.

24. Gessain, A. and R. Mahieux. 2000. [A virus called HTLV-1. Epidemiological aspects]. Presse Med. 29:2233-2239.

25. Goodman, R. H. and S. Smolik. 2000. CBP/p300 in cell growth, transformation, and development. Genes Dev. 14:1553-1577.

26. Hajnoczky, G., G. Csordas, M. Madesh, and P. Pacher. 2000. The machinery of local Ca2+ signalling between sarco-endoplasmic reticulum and mitochondria. J Physiol 529 Pt 1:69-81.

27. Harhaj, E. W., L. F. Good, G. T. Xiao, and S. C. Sun. 1999. Gene expression profiles in HTLV-I-immortalized T cells: deregulated expression of genes involved in apoptosis regulation. Oncogene 18:1341-1349.

28. Hollsberg, P. 1999. Mechanisms of T-cell activation by human T-cell lymphotropic virus type I. Microbiol. Mol. Biol. Rev. 63:308-333.

29. Hottiger, M. O. and G. J. Nabel. 2000. Viral replication and the coactivators p300 and CBP. Trends Microbiol. 8:560-565.

30. Ida, K., I. Kitabayashi, T. Taki, M. Taniwaki, K. Noro, M. Yamamoto, M. Ohki, and Y. Hayashi. 1997. Adenoviral E1A-associated protein p300 is involved in acute myeloid leukemia with t(11;22)(q23;q13). Blood 90:4699-4704.

31. Janknecht, R. 2002. The versatile functions of the transcriptional coactivators p300 and CBP and their roles in disease. Histol. Histopathol. 17:657-668.

32. Johnson, J. M., J. Fullen, L. Casareto, and J. C. Mulloy. 2000. p12(I) May Contribute TO HTLV-1 Escape from Immune Detection. Leukemia 14:558.

155 33. Johnson, J. M., J. C. Mulloy, V. Ciminale, J. Fullen, C. Nicot, and G. Franchini. 2000. The MHC class I heavy chain is a common target of the small proteins encoded by the 3' end of HTLV type 1 and HTLV type 2. AIDS Res. Hum. Retroviruses 16:1777-1781.

34. Kim, S. J., W. Ding, B. Albrecht, P. L. Green, and M. D. Lairmore. 2003. A conserved calcineurin-binding motif in human T lymphotropic virus type 1 p12I functions to modulate nuclear factor of activated T cell activation. J Biol. Chem. 278:15550-15557.

35. Kinoshita, S., B. K. Chen, H. Kaneshima, and G. P. Nolan. 1998. Host control of HIV-1 in T cells by the nuclear factor of activated T cells. Cell 95:595-604.

36. Kinoshita, S., L. Su, M. Amano, L. A. Timmerman, H. Kaneshima, and G. P. Nolan. 1997. The T cell activation factor NF-ATc positively regulates HIV-1 replication and gene expression in T cells. Immunity. 6:235-244.

37. Kohno, T., R. Moriuchi, S. Katamine, Y. Yamada, M. Tomonaga, and T. Matsuyama. 2000. Identification of genes associated with the progression of adult T cell leukemia (ATL). Jpn. J Cancer Res. 91:1103-1110.

38. Kohno, T., R. Moriuchi, S. Katamine, Y. Yamada, M. Tomonaga, and T. Matsuyama. 2000. Identification of genes associated with the progression of adult T cell leukemia (ATL). Jpn. J Cancer Res. 91:1103-1110.

39. Koralnik, I. J., J. Fullen, and G. Franchini. 1993. The p12I, p13II, and p30II proteins encoded by human T-cell leukemia/lymphotropic virus type I open reading frames I and II are localized in three different cellular compartments. J Virol 67:2360-2366.

40. Lemasson, I., N. J. Polakowski, P. J. Laybourn, and J. K. Nyborg. 2002. Transcription factor binding and histone modifications on the integrated proviral promoter in human T-cell leukemia virus-I-infected T-cells. J Biol. Chem. 277:49459-49465.

41. Li, C. and W. H. Wong. 2001. Model-based analysis of oligonucleotide arrays: expression index computation and outlier detection. Proc. Natl. Acad. Sci U. S. A 98:31-36.

42. Mitsui, K., A. Matsumoto, S. Ohtsuka, M. Ohtsubo, and A. Yoshimura. 1999. Cloning and characterization of a novel p21(Cip1/Waf1)-interacting zinc finger protein, ciz1. Biochem. Biophys. Res. Commun. 264:457-464.

156 43. Moro, H., K. Iwai, N. Mori, M. Watanabe, M. Fukushi, M. Oie, M. Arai, Y. Tanaka, T. Miyawaki, F. Gejyo, M. Arakawa, and M. Fujii. 2001. Interleukin-2-dependent but not independent T-cell lines infected with human T- cell leukemia virus type 1 selectively express CD45RO, a marker for persistent infection in vivo. Virus Genes 23:263-271.

44. Mortreux, F., A. S. Gabet, and E. Wattel. 2003. Molecular and cellular aspects of HTLV-1 associated leukemogenesis in vivo. Leukemia 17:26-38.

45. Mulloy, J. C., R. W. Crownley, J. Fullen, W. J. Leonard, and G. Franchini. 1996. The human T-cell leukemia/lymphotropic virus type 1 p12I proteins bind the interleukin-2 receptor beta and gammac chains and affects their expression on the cell surface. J Virol 70:3599-3605.

46. Murphy, D. 2002. Gene expression studies using microarrays: principles, problems, and prospects. Adv. Physiol Educ. 26:256-270.

47. Nataraj, C., M. I. Oliverio, R. B. Mannon, P. J. Mannon, L. P. Audoly, C. S. Amuchastegui, P. Ruiz, O. Smithies, and T. M. Coffman. 1999. Angiotensin II regulates cellular immune responses through a calcineurin-dependent pathway. J Clin. Invest 104:1693-1701.

48. Ng, P. W., H. Iha, Y. Iwanaga, M. Bittner, Y. Chen, Y. Jiang, G. Gooden, J. M. Trent, P. Meltzer, K. T. Jeang, and S. L. Zeichner. 2001. Genome-wide expression changes induced by HTLV-1 Tax: evidence for MLK- 3 mixed lineage kinase involvement in Tax-mediated NF-kappaB activation. Oncogene 20:4484-4496.

49. Nicot, C., J. C. Mulloy, M. G. Ferrari, J. M. Johnson, K. Fu, R. Fukumoto, R. Trovato, J. Fullen, W. J. Leonard, and G. Franchini. 2001. HTLV-1 p12(I) protein enhances STAT5 activation and decreases the interleukin-2 requirement for proliferation of primary human peripheral blood mononuclear cells. Blood 98:823-829.

50. Perkins, N. D., L. K. Felzien, J. C. Betts, K. Leung, D. H. Beach, and G. J. Nabel. 1997. Regulation of NF-kappaB by cyclin-dependent kinases associated with the p300 coactivator. Science 275:523-527.

51. Pise-Masison, C. A., M. Radonovich, R. Mahieux, P. Chatterjee, C. Whiteford, J. Duvall, C. Guillerm, A. Gessain, and J. N. Brady. 2002. Transcription profile of cells infected with human T-cell leukemia virus type I compared with activated lymphocytes. Cancer Res. 62:3562-3571.

52. Robek, M. D., F. H. Wong, and L. Ratner. 1998. Human T-Cell leukemia virus type 1 pX-I and pX-II open reading frames are dispensable for the immortalization of primary lymphocytes. J. Virol. 72:4458-4462.

157 53. Shikama, N., J. Lyon, and N. B. Lathangue. 1997. The p300/CBP family: Integrating signals with transcription factors and chromatin. Tr. Cell Biol. 7:230-236.

54. Sobulo, O. M., J. Borrow, R. Tomek, S. Reshmi, A. Harden, B. Schlegelberger, D. Housman, N. A. Doggett, J. D. Rowley, and L. Zeleznik. 1997. MLL is fused to CBP, a histone acetyltransferase, in therapy-related acute myeloid leukemia with a t(11;16)(q23;p13.3). Proc. Natl. Acad. Sci U. S. A 94:8732-8737.

55. Subbaramaiah, K., D. T. Lin, J. C. Hart, and A. J. Dannenberg. 2001. Peroxisome proliferator-activated receptor gamma ligands suppress the transcriptional activation of cyclooxygenase-2. Evidence for involvement of activator protein-1 and CREB-binding protein/p300. J Biol. Chem. 276:12440- 12448.

56. Tchilian, E. Z. and P. C. Beverley. 2002. CD45 in memory and disease. Arch. Immunol. Ther. Exp. (Warsz. ) 50:85-93.

57. Tsukasaki, K., S. Tanosaki, S. DeVos, W. K. Hofmann, W. Wachsman, A. F. Gombart, J. Krebs, A. Jauch, C. R. Bartram, K. Nagai, M. Tomonaga, J. W. Said, and H. P. Koeffler. 2004. Identifying progression-associated genes in adult T-cell leukemia/lymphoma by using oligonucleotide microarrays. Int. J Cancer 109:875-881.

58. Vo, N. and R. H. Goodman. 2001. CREB-binding protein and p300 in transcriptional regulation. J. Biol. Chem. 276:13505-13508.

59. Wang, L., S. R. Grossman, and E. Kieff. 2000. Epstein-Barr virus nuclear protein 2 interacts with p300, CBP, and PCAF histone acetyltransferases in activation of the LMP1 promoter. Proc. Natl. Acad. Sci. U. S. A 97:430-435.

60. Yan, J. P., J. E. Garrus, H. A. Giebler, L. A. Stargell, and J. K. Nyborg. 1998. Molecular interactions between the coactivator CBP and the human T-cell leukemia virus Tax protein. J. Mol. Biol. 281:395-400.

61. Yoshida, H., H. Nishina, H. Takimoto, L. E. Marengere, A. C. Wakeham, D. Bouchard, Y. Y. Kong, T. Ohteki, A. Shahinian, M. Bachmann, P. S. Ohashi, J. M. Penninger, G. R. Crabtree, and T. W. Mak. 1998. The transcription factor NF-ATc1 regulates lymphocyte proliferation and Th2 cytokine production. Immunity 8:115-124.

62. Zhang, W., J. W. Nisbet, B. Albrecht, W. Ding, F. Kashanchi, J. T. Bartoe, and M. D. Lairmore. 2001. Human T-lymphotropic virus type 1 p30(II) regulates gene transcription by binding CREB binding protein/p300. J. Virol. 75:9885-9895.

158 63. Zhang, W., J. W. Nisbet, J. T. Bartoe, W. Ding, and M. D. Lairmore. 2000. Human T-lymphotropic virus type 1 p30(II) functions as a transcription factor and differentially modulates CREB-responsive promoters. J. Virol. 74:11270- 11277.

64. Zhou, M., M. A. Halanski, M. F. Radonovich, F. Kashanchi, J. Peng, D. H. Price, and J. N. Brady. 2000. Tat modifies the activity of CDK9 to phosphorylate serine 5 of the RNA polymerase II carboxyl-terminal domain during human immunodeficiency virus type 1 transcription. Mol. Cell Biol. 20:5077-5086.

159

Genes upregulated by HTLV-1 p12 with role in apoptosis Gene Probe Set ID Title Symbol Map Location 216220_s_at adenosine A1 receptor ADORA1 1q32.1 205084_at B-cell receptor-associated protein BAP29 7q22.2 206727_at complement component 9 C9 5p14-p12 209970_x_at caspase 1 CASP1 11q23 207428_x_at cell division cycle 2-like 1 CDC2L1 1p36 40273_at D site of albumin promoter DBP 19q13.3 3p21.1- 205554_s_at deoxyribonuclease I-like 3 DNASE1L3 3p14.3 208588_at apoptosis inhibitor FKSG2 8p11.2 218573_at APR-1 protein MAGEH1 Xp11.22 217465_at NCK-associated protein 1 NCKAP1 2q32 protein phosphatase 1, regulatory 37028_at (inhibitor) subunit 15A PPP1R15A 19q13.2 211546_x_at synuclein, alpha SNCA 4q21 tumor necrosis factor receptor 207643_s_at superfamily, member 1A TNFRSF1A 12p13.2 tumor necrosis factor (ligand) 202687_s_at superfamily, member 10 TNFSF10 3q26 tumor necrosis factor (ligand) 214329_x_at superfamily, member 10 TNFSF10 3q26

Continued

Table 3.1 Genes modulated by HTLV-1 p12I

Details of genes whose expression is modulated by HTLV-1 p12I, as identified from gene array analysis. The genes have been classified based on their functional associations within the cell. Genes with multiple functional roles have been included in all the categories. The table includes details such as the probe set ID used in Affymetrix® gene chip, complete title of the gene, gene symbol (used in the figures) and chromosome map location within .

160 Table 3.1 Continued

Genes downregulated by HTLV-1 p12 with role in apoptosis Gene Probe Set ID Title Symbol Map Location 214960_at apoptosis inhibitor 5 API5 11p12-q12 214953_s_at amyloid beta (A4) precursor protein APP 21q21.3 219624_at BCL2-associated athanogene 4 BAG4 8p11.21 203728_at BCL2-antagonist/killer 1 BAK1 6p21.3 206536_s_at baculoviral IAP repeat-containing 4 BIRC4 Xq25 BCL2/adenovirus E1B 19kDa 207829_s_at interacting protein 1 BNIP1 5q33-q34 211464_x_at caspase 6 CASP6 4q25 cell death-inducing DFFA-like 221188_s_at effector b CIDEB 14q11.2 coagulation factor II (thrombin) 203989_x_at receptor F2R 5q13 growth arrest and DNA-damage- 203725_at inducible, alpha GADD45A 1p31.2-p31.1 214057_at myeloid cell leukemia sequence 1 MCL1 1q21 tumor necrosis factor receptor 213829_x_at superfamily, member 6b, decoy TNFRSF6B 20q13.3 208315_x_at TNF receptor-associated factor 3 TRAF3 14q32.33 Genes upregulated by HTLV-1 p12 with role in cell growth and maintenance 210635_s_at Kelch motif containing protein AB026190 1q24.1-q24.3 ATP-binding cassette, sub-family C 214979_at (CFTR/MRP), member 3 ABCC3 17q22 210461_s_at actin binding LIM protein 1 ABLIM1 10q25 216220_s_at adenosine A1 receptor ADORA1 1q32.1 207589_at adrenergic, alpha-1B-, receptor ADRA1B 5q23-q32 213095_x_at allograft inflammatory factor 1 AIF1 6p21.3 205359_at A kinase (PRKA) anchor protein 6 AKAP6 14q12 anaphase-promoting complex subunit 218555_at 2 ANAPC2 9q34.3

Continued

161

Table 3.1 Continued

adaptor-related protein complex 3, 205678_at beta 2 subunit AP3B2 15q 216933_x_at adenomatosis polyposis coli APC 5q21-q22 221087_s_at apolipoprotein L, 3 APOL3 22q13.1 203586_s_at ADP-ribosylation factor 4-like ARF4L 17q12-q21 203311_s_at ADP-ribosylation factor 6 ARF6 7q22.1 206129_s_at arylsulfatase B ARSB 5p11-q13 ATPase, H+/K+ exchanging, beta 207546_at polypeptide ATP4B 13q34 alpha thalassemia/mental retardation 208859_s_at syndrome X-linked ATRX Xq13.1-q21.1 205084_at B-cell receptor-associated protein BAP29 7q22.2 210201_x_at bridging integrator 1 BIN1 2q14 219191_s_at bridging integrator 2 BIN2 12q13 41553_at chromosome 8 open reading frame 1 C8orf1 8q21 207428_x_at cell division cycle 2-like 1 CDC2L1 1p36 210965_x_at cell division cycle 2-like 5 CDC2L5 7p13 cholinergic receptor, nicotinic, beta 207859_s_at polypeptide 3 CHRNB3 8p11.2 216296_at clathrin, light polypeptide (Lca) CLTA 9p13 colony stimulating factor 1 209716_at (macrophage) CSF1 1p21-p13 210835_s_at C-terminal binding protein 2 CTBP2 10q26.2 D site of albumin promoter (albumin 40273_at D-box) binding protein DBP 19q13.3 DEAD/H (Asp-Glu-Ala-Asp/His) box 204909_at polypeptide 6 (RNA helicase, 54kDa) DDX6 11q23.3 217341_at dynamin 1 DNM1 9q34 217309_s_at Down syndrome critical region gene 3 DSCR3 21q22.2 glutamyl aminopeptidase 204845_s_at (aminopeptidase A) ENPEP 4q25 213579_s_at E1A binding protein p300 EP300 22q13.2 206492_at fragile histidine triad gene FHIT 3p14.2 56821_at hypothetical protein FLJ10815 FLJ10815 16q12.2 gamma-aminobutyric acid (GABA) 208217_at receptor, rho 2 GABRR2 6q13-q16.3

Continued 162 Table 3.1 Continued

210872_x_at growth arrest-specific 7 GAS7 17p golgi SNAP receptor complex 210009_s_at member 2 GOSR2 17q21 206087_x_at hemochromatosis HFE 6p21.3 210354_at interferon, gamma IFNG 12q14 interleukin 12A ( stimulatory factor 1, cytotoxic 207160_at lymphocyte maturation factor 1, p35) IL12A 3p12-q13.2 potassium voltage-gated channel, 211006_s_at Shab-related subfamily, member 1 KCNB1 20q13.2 potassium channel, subfamily K, 204678_s_at member 1 KCNK1 1q42-q43 212947_at KIAA0939 protein KIAA0939 20q13.13 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, 212079_s_at Drosophila) MLL 11q23 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, 216509_x_at Drosophila); translocated to, 10 MLLT10 10p12 206022_at Norrie disease (pseudoglioma) NDP Xp11.4 214321_at nephroblastoma overexpressed gene NOV 8q24.1 neurotrophic tyrosine kinase, receptor, 217377_x_at type 3 NTRK3 15q25 origin recognition complex, subunit 4- 203352_at like (yeast) ORC4L 2q22-q23 protein phosphatase 1, regulatory 37028_at (inhibitor) subunit 15A PPP1R15A 19q13.2 208733_at RAB2, member RAS oncogene family RAB2 8q12.1 ribosome binding protein 1 homolog 201205_at 180kDa (dog) RRBP1 20p12 runt-related transcription factor 1 (acute myeloid leukemia 1; aml1 211180_x_at oncogene) RUNX1 21q22.3 runt-related transcription factor 216361_s_at binding protein 2 RUNXBP2 8p11 204344_s_at Sec23 homolog A (S. cerevisiae) SEC23A 14q13.2

Continued

163 Table 3.1 Continued

solute carrier family 16 (monocarboxylic acid transporters), 202855_s_at member 3 SLC16A3 17q25 solute carrier family 16 (monocarboxylic acid transporters), 202856_s_at member 3 SLC16A3 17q25 solute carrier family 16 (monocarboxylic acid transporters), 210807_s_at member 7 SLC16A7 12q13 solute carrier family 17 (sodium- dependent inorganic phosphate 204230_s_at cotransporter), member 7 SLC17A7 19q13 solute carrier family 24 (sodium/potassium/calcium 220867_s_at exchanger), member 2 SLC24A2 9p22-p13 solute carrier family 31 (copper 203971_at transporters), member 1 SLC31A1 9q31-q32 solute carrier family 4, sodium bicarbonate transporter-like, member 206830_at 10 SLC4A10 2q23-q24 SWI/SNF related, matrix associated, actin dependent regulator of 204099_at chromatin, subfamily d, member 3 SMARCD3 7q35-q36 Sjogren's syndrome/scleroderma 203114_at autoantigen 1 SSSCA1 11q13.1 signal transducing adaptor molecule 215044_s_at (SH3 domain and ITAM motif) 2 STAM2 2q23.3 203330_s_at syntaxin 5A STX5A 11q12.2 sudD suppressor of bimD6 homolog 202131_s_at (A. nidulans) SUDD 18q11.2 suppressor of variegation 3-9 homolog 219262_at 2 SUV39H2 10p13 TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated 216711_s_at factor, 250kDa TAF1 Xq13.1 transporter 1, ATP-binding cassette, 202307_s_at sub-family B (MDR/TAP) TAP1 6p21.3

Continued

164

Table 3.1 Continued

tight junction protein 1 (zona 202011_at occludens 1) TJP1 15q13 transient receptor potential cation 206425_s_at channel, subfamily C, member 3 TRPC3 4q27 221326_s_at ortholog of mouse tubulin, delta 1 TUBD1 17q23.2 209950_s_at villin-like VILL 3p21.3 X-ray repair complementing defective 207598_x_at repair in Chinese hamster cells 2 XRCC2 7q36.1 Genes downregulated by HTLV-1 p12 with role in cell growth and maintenance ATP-binding cassette, sub-family A 203504_s_at (ABC1), member 1 ABCA1 9q31.1 amiloride-sensitive cation channel 2, 205156_s_at neuronal ACCN2 12q12 221653_x_at apolipoprotein L, 2 APOL2 22q12 amyloid beta (A4) precursor protein 214953_s_at (protease nexin-II, Alzheimer disease) APP 21q21.3 204425_at Rho GTPase activating protein 4 ARHGAP4 Xq28 Rho guanine nucleotide exchange 203055_s_at factor (GEF) 1 ARHGEF1 19q13.13 202564_x_at ADP-ribosylation factor-like 2 ARL2 11q13 ATX1 antioxidant protein 1 homolog 203454_s_at (yeast) ATOX1 5q32 ATPase, Na+/K+ transporting, alpha 3 214432_at polypeptide ATP1A3 19q13.31 ATPase, H+ transporting, lysosomal 214149_s_at 9kDa, V0 subunit e ATP6V0E 5q35.2 216873_s_at ATPase, Class I, type 8B, member 2 ATP8B2 1q21.3 204129_at B-cell CLL/lymphoma 9 BCL9 1q21 basic leucine zipper nuclear factor 1 32088_at (JEM-1) BLZF1 1q24 208292_at bone morphogenetic protein 10 BMP10 2p13.2 bullous pemphigoid antigen 1, 212254_s_at 230/240kDa BPAG1 6p12-p11 CDC45 cell division cycle 45-like (S. 204126_s_at cerevisiae) CDC45L 22q11.21 cyclin-dependent kinase 9 (CDC2- 203198_at related kinase) CDK9 9q34.1

Continued

165

Table 3.1 Continued

chromodomain protein, Y 203098_at chromosome-like CDYL 6p25.1 214785_at chorea acanthocytosis CHAC 9q21 cholinergic receptor, nicotinic, alpha 207568_at polypeptide 6 CHRNA6 8p11.1 213976_at Cip1-interacting zinc finger protein CIZ1 9q34.1 collagen, type IV, alpha 3 216368_s_at (Goodpasture antigen) COL4A3 2q36-q37 220789_s_at cell cycle progression 2 protein CPR2 7p14-p13 204264_at carnitine palmitoyltransferase II CPT2 1p32 chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating 204470_at activity, alpha) CXCL1 4q21 cytochrome P450, family 27, 12q13.1- 205676_at subfamily B, polypeptide 1 CYP27B1 q13.3 218362_s_at mitotic control protein dis3 homolog DIS3 13q21.32 216870_x_at deleted in lymphocytic leukemia, 2 DLEU2 13q14.3 209725_at down-regulated in metastasis DRIM 12q23 203635_at Down syndrome critical region gene 3 DSCR3 21q22.2 E2F transcription factor 5, p130- 221586_s_at binding E2F5 8q21.13 219454_at EGF-like-domain, multiple 6 EGFL6 Xp22 epidermal growth factor receptor 217886_at pathway substrate 15 EPS15 1p32 211051_s_at exostoses (multiple)-like 3 EXTL3 8p21 coagulation factor II (thrombin) 203989_x_at receptor F2R 5q13 fer (fps/fes related) tyrosine kinase 206412_at (phosphoprotein NCP94) FER 5q21 206451_at hypothetical protein FLJ10560 FLJ10560 3q28 205238_at hypothetical protein FLJ12687 FLJ12687 Xq22.1 220321_s_at hypothetical protein FLJ13646 FLJ13646 2p23.3 218666_s_at hypothetical protein FLJ20651 FLJ20651 9q22.33 219558_at hypothetical protein FLJ20986 FLJ20986 3q29 FK506 binding protein 12-rapamycin 202288_at associated protein 1 FRAP1 1p36.2

Continued

166

Table 3.1 Continued

gamma-aminobutyric acid (GABA) A 216895_at receptor, gamma 3 GABRG3 15q11-q13 growth arrest and DNA-damage- 1p31.2- 203725_at inducible, alpha GADD45A p31.1 gap junction protein, alpha 7, 45kDa 208460_at (connexin 45) GJA7 17q21.31 high density lipoprotein binding 200643_at protein (vigilin) HDLBP 2q37 213926_s_at HIV-1 Rev binding protein HRB 2q36 216210_x_at Tara-like protein HRIHFB2122 22q13.1 210141_s_at inhibin, alpha INHA 2q33-q36 19p13.3- 213792_s_at insulin receptor INSR p13.2 inositol 1,4,5-triphosphate receptor, 216944_s_at type 1 ITPR1 3p26-p25 Janus kinase 2 (a protein tyrosine 205842_s_at kinase) JAK2 9p24 v-jun sarcoma virus 17 oncogene 213281_at homolog (avian) JUN 1p32-p31 potassium voltage-gated channel, shaker-related subfamily, beta 221413_at member 3 KCNAB3 17p13.1 potassium inwardly-rectifying 220776_at channel, subfamily J, member 14 KCNJ14 19q13 202358_s_at KIAA0254 gene product KIAA0254 11q25 202359_s_at KIAA0254 gene product KIAA0254 11q25 213304_at KIAA0423 protein KIAA0423 14q21.1 karyopherin alpha 5 (importin alpha 206241_at 6) KPNA5 6q22.31 karyopherin alpha 6 (importin alpha 1p35.1- 212101_at 7) KPNA6 p34.3 v-Ki-ras2 Kirsten rat sarcoma 2 viral 204010_s_at oncogene homolog KRAS2 12p12.1 206235_at ligase IV, DNA, ATP-dependent LIG4 13q33-q34 204674_at lymphoid-restricted membrane protein LRMP 12p12.1 mitogen-activated protein kinase 205698_s_at kinase 6 MAP2K6 17q24.3

Continued

167 Table 3.1 Continued

MAP/microtubule affinity-regulating 221047_s_at kinase 1 MARK1 1q42.11 206132_at mutated in colorectal cancers MCC 5q21-q22 36830_at mitochondrial intermediate peptidase MIPEP 13q12 215731_s_at M-phase phosphoprotein 9 MPHOSPH9 12q24.31 37408_at mannose receptor, C type 2 MRC2 17q23.3 MRE11 meiotic recombination 11 205395_s_at homolog A (S. cerevisiae) MRE11A 11q21 221432_s_at putative mitochondrial solute carrier MRS3/4 10q23-q24 210533_at mutS homolog 4 (E. coli) MSH4 1p31 11q12- 203444_s_at metastasis-associated 1-like 1 MTA1L1 q13.1 nuclear cap binding protein subunit 2, 201517_at 20kDa NCBP2 3q29 NIMA (never in mitosis gene a)- 211089_s_at related kinase 3 NEK3 13q14.13 nuclear factor of kappa light polypeptide gene enhancer in B-cells 207535_s_at 2 (p49/p100) NFKB2 10q24 neurotrophic tyrosine kinase, receptor, 215115_x_at type 3 NTRK3 15q25 par-3 partitioning defective 3 homolog 210094_s_at (C. elegans) PARD3 10p11.21 procollagen C-endopeptidase 219295_s_at enhancer 2 PCOLCE2 3q21-q24 206474_at PCTAIRE protein kinase 2 PCTK2 12q23.1 212424_at programmed cell death 11 PDCD11 10q24.32 204873_at peroxisome biogenesis factor 1 PEX1 7q21-q22 205246_at peroxisome biogenesis factor 13 PEX13 2p14-p16 phosphatidylinositol binding clathrin 212511_at assembly protein PICALM 11q14 209193_at pim-1 oncogene PIM1 6p21.2 17p12- 210139_s_at peripheral myelin protein 22 PMP22 p11.2 polymerase (RNA) mitochondrial 203783_x_at (DNA directed) POLRMT 19p13.3 RAB33B, member RAS oncogene 221014_s_at family RAB33B 4q28

Continued

168 Table 3.1 Continued

RAB6A, member RAS oncogene 201048_x_at family RAB6A 11q13.3 203749_s_at , alpha RARA 17q12 209936_at RNA binding motif protein 5 RBM5 3p21.3 reversion-inducing-cysteine-rich 216153_x_at protein with kazal motifs RECK 9p13-p12 replication factor C (activator 1) 2, 203696_s_at 40kDa RFC2 7q11.23 206306_at ryanodine receptor 3 RYR3 15q14-q15 19p13.3- 213635_s_at scaffold attachment factor B SAFB p13.2 5q13.3- 212425_at secretory carrier membrane protein 1 SCAMP1 q14.1 sodium channel, voltage-gated, type 208578_at X, alpha polypeptide SCN10A 3p22-p21 203155_at SET domain, bifurcated 1 SETDB1 1q21 SHC (Src homology 2 domain 201469_s_at containing) transforming protein 1 SHC1 1q21 solute carrier family 11 (proton- coupled divalent metal ion 203123_s_at transporters), member 2 SLC11A2 12q13 solute carrier family 19 (folate 209776_s_at transporter), member 1 SLC19A1 21q22.3 solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), 213664_at member 1 SLC1A1 9p24 solute carrier family 25, member 13 203775_at (citrin) SLC25A13 7q21.3 solute carrier family 2 (facilitated 202499_s_at glucose transporter), member 3 SLC2A3 12p13.3 solute carrier family 31 (copper 204204_at transporters), member 2 SLC31A2 9q31-q32 solute carrier family 6 (neurotransmitter transporter), 219795_at member 14 SLC6A14 Xq23-q24

Continued

169 Table 3.1 Continued

SWI/SNF related, matrix associated, actin dependent regulator of 203873_at chromatin, subfamily a, member 1 SMARCA1 Xq25 synaptosomal-associated protein, 209131_s_at 23kDa SNAP23 15q14 220140_s_at sorting nexin 11 SNX11 17q21.32 203372_s_at suppressor of cytokine signaling 2 SOCS2 12q 209648_x_at suppressor of cytokine signaling 5 SOCS5 2p21 sialophorin (gpL115, leukosialin, 206056_x_at CD43) SPN 16p11.2 sialophorin (gpL115, leukosialin, 206057_x_at CD43) SPN 16p11.2 204011_at sprouty homolog 2 (Drosophila) SPRY2 13q22.1 208920_at sorcin SRI 7q21.1 214060_at single-stranded DNA binding protein SSBP1 7q34 204886_at serine/threonine kinase 18 STK18 4q27-q28 212112_s_at syntaxin 12 STX12 1p35-34.1 214441_at syntaxin 6 STX6 1q24.3 203457_at syntaxin 7 STX7 6q23.1 206161_s_at synaptotagmin V SYT5 19q TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)- 213209_at associated factor, 65kDa TAF6L 11q12.2 transporter 2, ATP-binding cassette, 204769_s_at sub-family B (MDR/TAP) TAP2 6p21.3 transporter 2, ATP-binding cassette, 204770_at sub-family B (MDR/TAP) TAP2 6p21.3 cargo selection protein (mannose 6 202122_s_at phosphate receptor binding protein) TIP47 19p13.3 209890_at tetraspan 5 TM4SF9 4q22.3 208184_s_at transmembrane protein 1 TMEM1 21q22.3 translocating chain-associating 210733_at membrane protein TRAM 8q13.1 tubulin, gamma complex associated 214876_s_at protein 5 TUBGCP5 15q11.2 vesicle-associated membrane protein 207101_at 1 (synaptobrevin 1) VAMP1 12p 210512_s_at vascular endothelial growth factor VEGF 6p12

Continued

170 Table 3.1 Continued

Genes upregulated by HTLV-1 p12 with role in signal transduction 216220_s_at adenosine A1 receptor ADORA1 1q32.1 207589_at adrenergic, alpha-1B-, receptor ADRA1B 5q23-q32 210201_x_at bridging integrator 1 BIN1 2q14 calcium channel, voltage-dependent, 19p13.2- 214933_at P/Q type, alpha 1A subunit CACNA1A p13.1 cholinergic receptor, nicotinic, beta 207859_s_at polypeptide 3 CHRNB3 8p11.2 chemokine (C-X-C motif) ligand 6 206336_at (granulocyte chemotactic protein 2) CXCL6 4q21 217341_at dynamin 1 DNM1 9q34 205107_s_at ephrin-A4 EFNA4 1q21-q22 glutamyl aminopeptidase 204845_s_at (aminopeptidase A) ENPEP 4q25 gamma-aminobutyric acid (GABA) 208217_at receptor, rho 2 GABRR2 6q13-q16.3 5-hydroxytryptamine () 211479_s_at receptor 2C HTR2C Xq24 208259_x_at interferon, alpha 7 IFNA7 9p22 210354_at interferon, gamma IFNG 12q14 210136_at myelin basic protein MBP 18q23 206022_at Norrie disease (pseudoglioma) NDP Xp11.4 205204_at neuromedin B NMB 15q22-qter tumor necrosis factor (ligand) 202687_s_at superfamily, member 10 TNFSF10 3q26 tumor necrosis factor (ligand) 214329_x_at superfamily, member 10 TNFSF10 3q26 216220_s_at adenosine A1 receptor ADORA1 1q32.1 207589_at adrenergic, alpha-1B-, receptor ADRA1B 5q23-q32 205294_at BAI1-associated protein 2 BAIAP2 17q25 D site of albumin promoter (albumin 40273_at D-box) binding protein DBP 19q13.3 guanine nucleotide binding protein (G protein), alpha activating activity 18p11.22- 206355_at polypeptide, olfactory type GNAL p11.21 guanine nucleotide binding protein (G 222034_at protein), beta polypeptide 2-like 1 GNB2L1 5q35.3

Continued 171 Table 3.1 Continued

guanine nucleotide binding protein (G 205184_at protein), gamma 4 GNG4 1q42.3 221469_at G protein-coupled receptor 32 GPR32 19q13.3 221394_at G protein-coupled receptor 58 GPR58 6q24 6q16.1- 220993_s_at G protein-coupled receptor 63 GPR63 q16.3 5-hydroxytryptamine (serotonin) 211479_s_at receptor 2C HTR2C Xq24 210354_at interferon, gamma IFNG 12q14 201887_at interleukin 13 receptor, alpha 1 IL13RA1 Xq24 interleukin 6 signal transducer (gp130, 204864_s_at oncostatin M receptor) IL6ST 5q11 205204_at neuromedin B NMB 15q22-qter olfactory receptor, family 12, 6p22.2- 221344_at subfamily D, member 2 OR12D2 p21.31 olfactory receptor, family 2, 221460_at subfamily C, member 1 OR2C1 16p13.3 208048_at tachykinin receptor 1 TACR1 2p12 205926_at class I cytokine receptor WSX1 19p13.11 207589_at adrenergic, alpha-1B-, receptor ADRA1B 5q23-q32 203586_s_at ADP-ribosylation factor 4-like ARF4L 17q12-q21 203311_s_at ADP-ribosylation factor 6 ARF6 7q22.1 212724_at ras homolog gene family, member E ARHE 2q23.3 217208_s_at discs, large (Drosophila) homolog 1 DLG1 3q29 204813_at mitogen-activated protein kinase 10 MAPK10 4q22.1-q23 mitogen-activated protein kinase- 201461_s_at activated protein kinase 2 MAPKAPK2 1q32 205934_at phospholipase C-like 1 PLCL1 2q33 209677_at protein kinase C, iota PRKCI 3q26.3 213518_at protein kinase C, iota PRKCI 3q26.3 208733_at RAB2, member RAS oncogene family RAB2 8q12.1 ribosomal protein S6 kinase, 90kDa, 204906_at polypeptide 2 RPS6KA2 6q27 SH3 and multiple ankyrin repeat 213307_at domains 2 SHANK2 11q13.1 son of sevenless homolog 1 212780_at (Drosophila) SOS1 2p22-p21

Continued 172 Table 3.1 Continued

218207_s_at stathmin-like 3 STMN3 20q13.3 tight junction protein 1 (zona 202011_at occludens 1) TJP1 15q13 218184_at tubby super-family protein TUSP 6q25-q26 Details of genes downregulated by HTLV-1 p12 with role in signal transduction Map Probe Set ID Title Gene Symbol Location carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific 211657_at cross reacting antigen) CEACAM6 19q13.2 cholinergic receptor, nicotinic, alpha 207568_at polypeptide 6 CHRNA6 8p11.1 gamma-aminobutyric acid (GABA) A 216895_at receptor, gamma 3 GABRG3 15q11-q13 growth factor receptor-bound protein 209409_at 10 GRB10 7p12-p11.2 growth factor receptor-bound protein 210999_s_at 10 GRB10 7p12-p11.2 216264_s_at laminin, beta 2 (laminin S) LAMB2 3p21 210139_s_at peripheral myelin protein 22 PMP22 17p12-p11.2 sodium channel, voltage-gated, type 208578_at X, alpha polypeptide SCN10A 3p22-p21 solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), 213664_at member 1 SLC1A1 9p24 204011_at sprouty homolog 2 (Drosophila) SPRY2 13q22.1 208920_at sorcin SRI 7q21.1 206161_s_at synaptotagmin V SYT5 19q tachykinin 3 (neuromedin K, 219992_at neurokinin beta) TAC3 12q13-q21 206134_at ADAM-like, decysin 1 ADAMDEC1 8p21.1 205357_s_at angiotensin II receptor, type 1 AGTR1 3q21-q25 bone morphogenetic protein receptor, 204832_s_at type IA BMPR1A 10q22.3 chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating 204470_at activity, alpha) CXCL1 4q21

Continued

173 Table 3.1 Continued

216288_at cysteinyl leukotriene receptor 1 CYSLTR1 Xq13.2-21.1 epidermal growth factor receptor 217886_at pathway substrate 15 EPS15 1p32 coagulation factor II (thrombin) 203989_x_at receptor F2R 5q13 fibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfeiffer 8p11.2- 210973_s_at syndrome) FGFR1 p11.1 204451_at frizzled homolog 1 (Drosophila) FZD1 7q21 gamma-aminobutyric acid (GABA) A 216895_at receptor, gamma 3 GABRG3 15q11-q13 205696_s_at GDNF family receptor alpha 1 GFRA1 10q26 growth factor receptor-bound protein 209409_at 10 GRB10 7p12-p11.2 growth factor receptor-bound protein 210999_s_at 10 GRB10 7p12-p11.2 210904_s_at interleukin 13 receptor, alpha 1 IL13RA1 Xq24 210141_s_at inhibin, alpha INHA 2q33-q36 19p13.3- 213792_s_at insulin receptor INSR p13.2 201124_at , beta 5 ITGB5 3q21.2 211356_x_at leptin receptor LEPR 1p31 38398_at MAP-kinase activating death domain MADD 11p11.2 MAD, mothers against decapentaplegic homolog 1 210993_s_at (Drosophila) MADH1 4q28 olfactory receptor, family 10, 208558_at subfamily H, member 1 OR10H1 19p13.1 olfactory receptor, family 10, 208520_at subfamily H, member 3 OR10H3 19p13.1 3-phosphoinositide dependent protein 204524_at kinase-1 PDPK1 16p13.3 protein tyrosine phosphatase, receptor 212588_at type, C PTPRC 1q31-q32 SHC (Src homology 2 domain 201469_s_at containing) transforming protein 1 SHC1 1q21 tachykinin 3 (neuromedin K, 219992_at neurokinin beta) TAC3 12q13-q21

Continued

174 Table 3.1 Continued

Genes upregulated by HTLV-1 p12 with role in immune response 216220_s_at adenosine A1 receptor ADORA1 1q32.1 213095_x_at allograft inflammatory factor 1 AIF1 6p21.3 activated leukocyte cell adhesion 201951_at molecule ALCAM 3q13.1 221087_s_at apolipoprotein L, 3 APOL3 22q13.1 206727_at complement component 9 C9 5p14-p12 CD58 antigen, (lymphocyte function- 216322_at associated antigen 3) CD58 1p13 CD58 antigen, (lymphocyte function- 216942_s_at associated antigen 3) CD58 1p13 colony stimulating factor 1 209716_at (macrophage) CSF1 1p21-p13 202901_x_at cathepsin S CTSS 1q21 chemokine (C-X-C motif) ligand 6 206336_at (granulocyte chemotactic protein 2) CXCL6 4q21 cytochrome b-245, beta polypeptide 203923_s_at (chronic granulomatous disease) CYBB Xp21.1 206217_at ectodermal dysplasia 1, anhidrotic ED1 Xq12-q13.1 220491_at hepcidin antimicrobial peptide HAMP 19q13.1 206087_x_at hemochromatosis HFE 6p21.3 hematopoietically expressed 215933_s_at HHEX 10q23.32 major histocompatibility complex, 211990_at class II, DP alpha 1 HLA-DPA1 6p21.3 interferon consensus sequence binding 204057_at protein 1 ICSBP1 16q24.1 208259_x_at interferon, alpha 7 IFNA7 9p22 210354_at interferon, gamma IFNG 12q14 interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic 207160_at lymphocyte maturation factor 1, p35) IL12A 3p12-q13.2 interleukin 6 signal transducer (gp130, 204864_s_at oncostatin M receptor) IL6ST 5q11 210136_at myelin basic protein MBP 18q23 219281_at methionine sulfoxide reductase A MSRA 8p23.1

Continued 175 Table 3.1 Continued

subfamily 4, group 204622_x_at A, member 2 NR4A2 2q22-q23 protein phosphatase 1, regulatory 37028_at (inhibitor) subunit 15A PPP1R15A 19q13.2 207096_at serum amyloid A4, constitutive SAA4 11p15.1-p14 44673_at sialoadhesin SN 20p13 superoxide dismutase 2, 215223_s_at mitochondrial SOD2 6q25.3 208048_at tachykinin receptor 1 TACR1 2p12 transporter 1, ATP-binding cassette, 202307_s_at sub-family B (MDR/TAP) TAP1 6p21.3 tumor necrosis factor (ligand) 202687_s_at superfamily, member 10 TNFSF10 3q26 tumor necrosis factor (ligand) 214329_x_at superfamily, member 10 TNFSF10 3q26 215769_at T cell receptor alpha locus TRA 14q11.2 216920_s_at T cell receptor gamma variable 9 TRGV9 7p15 205926_at class I cytokine receptor WSX1 19p13.11 X-ray repair complementing defective 207598_x_at repair in Chinese hamster cells 2 XRCC2 7q36.1

Genes downregulated by HTLV-1 p12 with role in immune response 214783_s_at annexin A11 ANXA11 10q23 221653_x_at apolipoprotein L, 2 APOL2 22q12 ATX1 antioxidant protein 1 homolog 203454_s_at (yeast) ATOX1 5q32 208592_s_at CD1E antigen, e polypeptide CD1E 1q22-q23 CD80 antigen (CD28 antigen ligand 207176_s_at 1, B7-1 antigen) CD80 3q13.3-q21 cell death-inducing DFFA-like 221188_s_at effector b CIDEB 14q11.2 chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating 204470_at activity, alpha) CXCL1 4q21

Continued

176 Table 3.1 Continued

216288_at cysteinyl leukotriene receptor 1 CYSLTR1 Xq13.2-21.1 coagulation factor II (thrombin) 203989_x_at receptor F2R 5q13 growth arrest and DNA-damage- 1p31.2- 203725_at inducible, alpha GADD45A p31.1 214091_s_at glutathione peroxidase 3 (plasma) GPX3 5q23 major histocompatibility complex, 203932_at class II, DM beta HLA-DMB 6p21.3 major histocompatibility complex, 215193_x_at class II, DR beta 1 HLA-DRB1 6p21.3 major histocompatibility complex, 204670_x_at class II, DR beta 5 HLA-DRB5 6p21.3 214569_at interferon, alpha 5 IFNA5 9p22 inter-alpha (globulin) inhibitor H4 (plasma Kallikrein-sensitive 37201_at glycoprotein) ITIH4 3p21-p14 lymphocyte antigen 6 complex, locus 206773_at H LY6H 8q24.3 mitogen-activated protein kinase 205698_s_at kinase 6 MAP2K6 17q24.3 mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra- 206449_s_at reactive factor) MASP1 3q27-q28 MHC class I polypeptide-related 205904_at sequence A MICA 6p21.3 MHC class I polypeptide-related 205905_s_at sequence A MICA 6p21.3 major histocompatibility complex, 207565_s_at class I-related MR1 1q25.3 major histocompatibility complex, 210224_at class I-related MR1 1q25.3 MRE11 meiotic recombination 11 205395_s_at homolog A (S. cerevisiae) MRE11A 11q21 phospholipase A2, group VII (platelet-activating factor 206214_at acetylhydrolase, plasma) PLA2G7 6p21.2-p12 peptidylprolyl isomerase A 217602_at (cyclophilin A) PPIA 7p13-p11.2

Continued

177 Table 3.1 Continued

207777_s_at SP140 nuclear body protein SP140 2q37.1 sialophorin (gpL115, leukosialin, 206056_x_at CD43) SPN 16p11.2 sialophorin (gpL115, leukosialin, 206057_x_at CD43) SPN 16p11.2 transporter 2, ATP-binding cassette, 204769_s_at sub-family B (MDR/TAP) TAP2 6p21.3 transporter 2, ATP-binding cassette, 204770_at sub-family B (MDR/TAP) TAP2 6p21.3 Genes upregulated by HTLV-1 p12 with role in cell adhesion activated leukocyte cell adhesion 201951_at molecule ALCAM 3q13.1 216933_x_at adenomatosis polyposis coli APC 5q21-q22 212724_at ras homolog gene family, member E ARHE 2q23.3 CD58 antigen, (lymphocyte function- 216322_at associated antigen 3) CD58 1p13 CD58 antigen, (lymphocyte function- 216942_s_at associated antigen 3) CD58 1p13 cadherin 2, type 1, N-cadherin 203441_s_at (neuronal) CDH2 18q11.2 214701_s_at fibronectin 1 FN1 2q34 lectin, galactoside-binding, soluble, 8 210731_s_at (galectin 8) LGALS8 1q42-q43 osteoblast specific factor 2 (fasciclin 210809_s_at I-like) OSF-2 13q13.1 13q14.3- 219737_s_at protocadherin 9 PCDH9 q21.1 polycystic kidney disease 1 202328_s_at (autosomal dominant) PKD1 16p13.3 protein tyrosine phosphatase, non- 202896_s_at receptor type substrate 1 PTPNS1 20p13 209880_s_at selectin P ligand SELPLG 12q24 44673_at sialoadhesin SN 20p13 203476_at trophoblast glycoprotein TPBG 6q14-q15 golgi SNAP receptor complex 210009_s_at member 2 GOSR2 17q21

Continued

178 Table 3.1 Continued

Genes downregulated by HTLV-1 p12 with role in cell adhesion 206134_at ADAM-like, decysin 1 ADAMDEC1 8p21.1 amyloid beta (A4) precursor protein 214953_s_at (protease nexin-II, Alzheimer disease) APP 21q21.3 cadherin 4, type 1, R-cadherin 206866_at (retinal) CDH4 20q13.3 collagen, type IV, alpha 3 216368_s_at (Goodpasture antigen) COL4A3 2q36-q37 206032_at desmocollin 3 DSC3 18q12.1 201124_at integrin, beta 5 ITGB5 3q21.2 201505_at laminin, beta 1 LAMB1 7q22 216264_s_at laminin, beta 2 (laminin S) LAMB2 3p21 MHC class I polypeptide-related 205904_at sequence A MICA 6p21.3 MHC class I polypeptide-related 205905_s_at sequence A MICA 6p21.3 7q31.1- 216959_x_at neuronal cell adhesion molecule NRCAM q31.2 platelet/endothelial cell adhesion 208983_s_at molecule (CD31 antigen) PECAM1 17q23 201929_s_at plakophilin 4 PKP4 2q23-q31 protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), 210236_at interacting protein (liprin), alpha 1 PPFIA1 11q13.1 sialophorin (gpL115, leukosialin, 206056_x_at CD43) SPN 16p11.2 sialophorin (gpL115, leukosialin, 206057_x_at CD43) SPN 16p11.2 209890_at tetraspan 5 TM4SF9 4q22.3 210512_s_at vascular endothelial growth factor VEGF 6p12 synaptosomal-associated protein, 209131_s_at 23kDa SNAP23 15q14

179

Figure 3.1 Stable expression of HTLV-1 p12I in Jurkat T-lymphocytes using lentiviral vectors.

(A)Schematic illustration of lentiviral vector expressing both p12I-HA and GFP (sample vector) as bicistronic messages and GFP alone (control vector) from Elongation factor 1 α promoter. Abbreviations: LTR-Long Terminal Repeats; RRE-Rev Response Element; EFIα- Elongation factor 1 α promoter; IRES-Internal Ribosome Entry Site; WPRE- Woodchuck Hepatitis Post-transcriptional Regulatory Element. (B) Flow cytometric analysis illustrating the expression of GFP in Jurkat T-cells 7 days post spin-infection with lentiviral vectors. Both sample (expressing p12I-HA and GFP) and control (GFP alone) group contains relatively high and similar levels of GFP. (C) RT-PCR demonstrating the expression of p12I-HA in Jurkat T-cells 7 days post spin-infection with lentiviral vectors. Jurkat cells spin-infected with sample vector express p12I while the control vector spin-infected cells do not express p12I. RT-PCR was performed with triplicate samples and controls. GAPDH was used as a control for the integrity of the message.

180

Figure 3.2 Modulation of the expression of genes associated with apoptosis by HTLV-1 p12I

Graph illustrating the differential expression of apoptosis related genes in control and p12I expressing Jurkat T-cells from gene array. A minimum of 1.5 fold difference between control and sample was considered significant. Gene symbols are given on the left side of the graph.

181

Figure 3.3 Modulation of the expression of genes associated with T-cell proliferation by HTLV-1 p12I

Graph illustrating the differential expression of cell-proliferation related genes in control and p12I expressing Jurkat T-cells from gene array. A minimum of 1.5 fold difference between control and sample was considered significant. Gene symbols are given on the left side of the graph.

182

Figure 3.4 Modulation of the expression of genes associated with T-lymphocyte signaling by HTLV-1 p12I

Graph illustrating the differential expression of genes associated with signal transduction in control and p12I expressing Jurkat T-cells from gene array. A minimum of 1.5 fold difference between control and sample was considered significant. Gene symbols are given on the left side of the graph.

183

Figure 3.5 Modulation of the expression of genes associated with immune response by HTLV-1 p12I

Graph illustrating the differential expression of immune response related genes in control and p12I expressing Jurkat T-cells from gene array. A minimum of 1.5 fold difference between control and sample was considered significant. Gene symbols are given on the left side of the graph.

184

Figure 3.6 Modulation of the expression of genes associated with cell adhesion by HTLV-1 p12I

Graph illustrating the differential expression of genes involved in cell adhesion in control and p12I expressing Jurkat T-cells from gene array. A minimum of 1.5 fold difference between control and sample was considered significant. Gene symbols are given on the left side of the graph.

185

Figure 3.7 Semiquantitative RT-PCR and densitometric analysis of selected genes in controls and p12I expressing Jurkat T-lymphocytes

(A) Semi-quantitative RT-PCR demonstrating the differential expression of selected genes in Jurkat T-cells expressing p12I. Total cellular RNA was extracted 7 days post spin-infection with recombinant lentiviral vectors. Semi-quantitative RT-PCR was performed on cDNA from 100ng total cellular RNA. RT-PCR was performed with triplicate samples and controls. GAPDH was used as a control for the integrity of the message. (B) Graph demonstrating densitometric analysis of semi-quantitative RT-PCR of selected genes in Jurkat T-cells expressing p12I. Fold difference between control and sample is given on top of each gene. Results are expressed as mean with standard error (SE) from a minimum of triplicate experiments. BAK1, GADD45A and STK18 were downregulated while p300, CDC2L1, TNFSF10 and IL6ST were upregulated by p12I. Statistical analysis was performed using Student’s t test. * indicates P value < 0.05.

186

Figure 3.8 Semiquantitative RT-PCR and densitometric analysis of selected genes in controls and p12I expressing primary CD4+ T-lymphocytes

(A) RT-PCR demonstrating the expression of p12I-HA in primary CD4+ T cells 7 days post spin-infection with lentiviral vectors. Primary CD4+ T cells spin-infected with sample vector express p12I while cells spin-infected with control vector do not express p12I. (B) Semi-quantitative RT-PCR demonstrating differential expression of selected genes in primary CD4+ T cells expressing p12I. Total cellular RNA was extracted 7 days post spin-infection with recombinant lentiviral vectors. Semi-quantitative RT-PCR was performed on cDNA from 100ng total cellular RNA. RT-PCR was performed with triplicate samples and controls. GAPDH was used as a control for the integrity of the message. (C) Densitometric analysis of semi-quantitative RT-PCR of selected genes in primary CD4+ T cells expressing p12I. Fold difference between control and sample is given on top of each gene. Results are expressed as mean with standard error (SE) from a minimum of triplicate experiments. BAK1, GADD45A and STK18 were downregulated while p300, CDC2L1, TNFSF10 and IL6ST were upregulated by p12I. Statistical analysis was performed using Student’s t test. * indicates P value < 0.05.

187

Figure 3.9 Schematic illustration of functional gene expression analysis

Schematic illustration of functional gene expression analysis. 2 million Jurkat T-cells were transfected with 500ng Gal4-luciferase reporter plasmid, 100ng of pM-VP16 expression plasmid and increasing concentrations of p12I-HA expression plasmid. Luciferase activity was measured 72 hours post transfection. In order to block p300 mediated transcription, 1.0µg E1A expression plasmid was transfected into these cells and luciferase activity was measured 72 hours post transfection.

188

Figure 3.10 HTLV-1 p12I enhances p300-dependent VP16 mediated transcription (A) Graph showing luciferase activity from Jurkat T cells transfected with p300 expression plasmid along with Gal4-luciferase reporter plasmid and pM-VP16 expression plasmid to confirm that VP16 mediated transcription is p300 dependent. Various plasmids used for transfection and the amounts are given on X axis. There was a dose dependent increase in the luciferase activity with increasing amounts of p300 up to 2.6 fold. (B) Graph showing luciferase activity from Jurkat T cells transfected with p12I expression plasmid along with Gal4-luciferase reporter plasmid and pM-VP16 expression plasmid to confirm that p12I enhances p300 to biologically significant levels. There was a dose dependent increase in the luciferase activity with increasing amounts of p12I up to 3.3 fold. Fold differences are given above each column. Results are expressed as mean luciferase activity with standard error from a minimum of triplicate experiments. Statistical analysis was performed using Student’s t test. * indicates P value < 0.05.

189

CHAPTER 4

CALCIUM-DEPENDENT ENHANCED TRANSCRIPTION OF P300 BY

HUMAN T LYMPHOTROPIC VIRUS TYPE-1 P12I

4.1 INTRODUCTION

Transcriptional co-activators p300 and CREB binding protein (CBP) mediate transcriptional control of various cellular and viral DNA binding transcription factors.

These co-activators are highly related in nucleotide sequence, evolutionarily conserved, share many functional properties and are commonly referred to as p300/CBP 12,30,51. A large number of sequence-specific, DNA-binding factors form complexes with p300/CBP, including c-Jun, Fos, p53, Stat1, Ets-1, NFκB, cMyb, TBP, TFIIB, RNA helicase A, CREB and RNA polymerase II 30,34,51. Several viral proteins also interact with p300/CBP, including HTLV-1 p30II and Tax, adenovirus E1A, HIV-1 Vpr and Tat,

Kaposi’s sarcoma-associated herpes virus (KSHV) viral interferon regulatory factor protein (vIRF), simian virus 40 large T antigen, HPV E6 and E7, small delta antigen of hepatitis delta virus, Epstein-Barr virus (EBV) nuclear antigen 3C (EBNA3C) and 190 33,54 EBNA2, and herpes simplex virion protein-16 (VP16) . While p300 and CBP mediate the activities of various transcription factors, their availability in the cell is at limiting concentrations and even small reductions in these co-activators may disrupt transcriptional regulation of the cell 43. In addition, in circumstances where the amount of p300/CBP is limiting, proteins may compete for binding p300/CBP and there could be selective preference of one over the other for p300/CBP binding 18. Such an environment of co-activator competition between transcription factors provides an additional layer of gene expression control. Competition between viral and cellular proteins for p300/CBP binding has been reported for a variety of viruses including human immunodeficiency virus (HIV), adenovirus and simian virus 40 (SV40) 32,32,53.

The mechanism of how p300/CBP mediates transcriptional control has been the focus of many investigations. These studies demonstrated two non-mutually exclusive mechanisms - competitive protein-protein interactions and post-translational modifications such as phosphorylation and acetylation 16,28. However, the transcriptional regulation of p300 remains to be elucidated. We have recently demonstrated using gene arrays, that the level of p300 is increased by human T lymphotropic virus type-1 (HTLV-1) accessory protein p12I (Nair et al, in preparation).

Previous findings from our laboratory have demonstrated that p12I elevates cytosolic calcium levels by depleting endoplasmic reticulum (ER), stores of calcium 19. We have also reported that p12I selectively activates nuclear factor of activated T cells (NFAT) mediated transcription in a calcium dependent manner 2. Based on these data, we

191 hypothesized that the transcription of p300 is calcium-dependent and sustained low magnitude increase in intracellular calcium concentration upregulates the transcription of p300.

In the present study, using p12I, we report that the expression of p300 is regulated in a calcium dependent, but calcineurin independent manner in T lymphocytes.

We demonstrate that ionomycin, a well-characterized calcium ionophore, triggers calcium release in Jurkat T cells, resulting in increased RNA and protein levels of p300.

Calcium-responsive p300-mediated transcription was completely inhibited by the p300- binding protein, adenovirus E1A and E1A∆CR2 (mutated for retinoblastoma binding, but retaining p300 binding). In contrast, E1A∆CR1 (mutated for p300 binding) failed to inhibit p300-dependent transcription mediated by calcium. Furthermore, this calcium- mediated increase in p300-dependent transcriptional activity could be blocked by

BAPTA-AM, a known calcium chelator, while cyclosporine A, a calcineurin inhibitor, did not have any effect on the p300-dependent transcriptional activity. In addition, using an ER-localization deficient mutant of HTLV-1 p12I, herein, we demonstrate that ER localization of p12I and subsequent calcium release are required for its ability to increase p300. Our data are the first to demonstrate calcium-dependent transcriptional regulation of p300. HTLV-1 p12I, an essential protein that mediates calcium dependent transcription in lymphocytes appears also to influence expression of p300, a rate limiting co-adaptor critical for long-term cell survival.

192 4.2 MATERIALS AND METHODS

Cells and plasmids

Jurkat T cells (clone E6-1, catalog # TIB-152, American Type Culture

Collection) were maintained in RPMI 1640 media (Invitrogen) supplemented with 15%

FBS, 100 µg/ml streptomycin/penicillin, 2 Mm L-glutamine and 10 Mm HEPES

(Invitrogen). The Pme-18S and Pme-p12I plasmids 41 were provided by G. Franchini

(National Cancer Institute, National Institutes of Health). The Pme-p12I plasmid expresses the of HTLV-1 p12I tagged with the hemagglutinin

(HA1) tag. Generation of p12I truncation mutants in the Pme-18S vector were previously described 20. Mutant p12I15-47KKLL which was constructed by inserting an

ER targeting 29,44 KKLL sequence, has been described previously 21. Plasmid p5XGT-

TATA-Luc (a kind gift of P. Quinn, Pennsylvania State University, Hershey, PA), contains five tandem Gal4 DNA-binding sequences upstream of a TATA box, derived from positions -264 to +11 of the phosphoenolpyruvate carboxykinase (PEPCK) gene in a luciferase reporter gene plasmid. The Prsv-B-Gal, 12SE1A, 12SE1A-∆CR1 and

12SE1A-∆CR2 (a kind gift from T. Kouzarides, University of Cambridge, Cambridge,

UK) have been described previously 54,55. The Ptre-Luc plasmid and Prsv-B-Gal have been described previously 54,55. Pme-p30IIHA plasmid which was created by cloning the p30II sequence from HTLV-1 molecular clone, ACH with downstream influenza hemagglutinin (HA1) tag, into Pme-18S plasmid (G. Franchini, National Cancer

193 Institute) between 5’ EcoRI and 3’ NotI sites, has been described previously (Michael et al, in preparation). The lentiviral vector system for stable expression of HTLV-1 p12I has been described previously.

Stimulation of Jurkat T cells

To identify the optimal concentration and time frame for calcium mediated enhancement of the transcription of p300, Jurkat T cells were stimulated with 25, 50,

100, 500 and 1000 Nm ionomycin. To identify Mrna levels of p300, RT-PCR was performed between 36 to 48 h post stimulation, while Western blot and luciferase assays were performed at 60 h post stimulation. In order to attain a sustained increase, stimulation with ionomycin involved growing cells in ionomycin supplemented growth medium, until cells were used for analysis. For investigation of the calcium dependent mechanism involved in the regulation of the transcription of p300, calcium chelator

BAPTA-AM [glycine, N,N_-1,2-ethanediylbis(oxy-2,1-phenylene)-bis-N-2-(acetyloxy) methoxy-2-oxoethyl]-[bis(acetyloxy)methyl ester] (Molecular Probes) and calcineurin inhibitor Cyclosporine A (CsA) (Sigma), was added to Jurkat T cells 24 h post transfection or post stimulation with ionomycin for 1 h at 37 ° C. The transfected cells were washed and resuspended in cRPMI, while cells stimulated with ionomycin were resuspended in cRPMI containing appropriate concentrations of ionomycin.

194 Semi-quantitative RT-PCR for p300

Total cellular RNA was isolated from Jurkat T lymphocytes stimulated with ionomycin, using RNAqueous as described by the manufacturer (Ambion). One µg

RNA was converted to Cdna with Reverse Transcription system as described by the manufacturer (Promega). Cdna from 100 ng of total RNA was then PCR amplified with

AmpliTaq DNA polymerase (Perkin Elmer) using primers specific for p300 and

GAPDH. The PCR primers were as follows: p300: GTAGCCTAAAAGACAATTTTCCTTG (forward),

ATGTCAACCATCTGCACCAGTA (reverse) and GAPDH:

TGCACCACCAACTGCTTAG (forward), GAGGCAGGGATGATGTTC (reverse).

PCR was performed at multiple cycles to maintain the amplification in a linear range. PCR products were separated by agarose gel electrophoresis and densitometric analysis was performed using alpha imager spot densitometry (Alpha Innotech) as described previously 1. The densitomertic values for p300 were normalized using the values for GAPDH. Statistical analysis was performed using Student’s t test, P < 0.05.

DNA contamination was ruled out by performing a control with no reverse transcriptase.

Western Immunoblot assays

Western immunoblotting for the detection of p300 was performed as described previously 54,55. Briefly cells were lysed in RIPA buffer containing phosphate-buffered saline, 1% Nonidet P-40, 0.5% sodium deoxycholate, and 0.1% sodium dodecyl sulfate

195 (SDS). Cell lysates were prepared by centrifugation at 14,000 rpm (Beckman) for 20 min at 4°C. Equal amounts of proteins were mixed with Laemmli buffer (62.5 Mm Tris

[Ph 6.8], 2% SDS, 10% glycerol, 0.2% bromophenol blue, 100 Mm dithiothreitol).

After boiling for 5 min, samples were electrophoresed through 5 % polyacrylamide gels.

The fractionated proteins were transferred to nitrocellulose membranes (Amersham

Pharmacia Biotechnology) at 100 V for 1 h at 4°C. Membranes were then blocked in

Tris-buffered saline containing 5% nonfat milk and 0.1% Tween 20. p300 was detected with the rabbit anti-p300 (Santa Cruz biotechnology) primary antibody, followed by an anti-rabbit (upstate) immunoglobulin G (IgG)-horseradish peroxidase-conjugated goat antibody. GAPDH, used as a normalization control, was detected using goat anti-

GAPDH primary antibody (Santa cruz Biotechnology) followed by an anti-goat (Santa cruz biotechnology) immunoglobulin G (IgG)-horseradish peroxidase-conjugated donkey antibody. Blots were developed using an enhanced chemiluminescence detection system (Cell signaling technologies). Densitometric analysis of radiograph was performed using Gel pro® analyzer software (Media Cybernatic Inc.) and normalized to GAPDH. Increasing concentrations of protein as well as different exposure times were used for the detection of proteins in a linear fashion. Statistical analysis was performed using Student’s t test, P < 0.05.

196 Reporter gene assays

Unless otherwise mentioned, all the transfections of Jurkat T cells were performed using Superfect transfection reagent (Qiagen) according to manufacturer’s instructions. Jurkat T lymphocytes (2x106) were transfected with 500 ng of 5XGT-luc,

100 ng of pM-VP16, 500 ng of pRSV-βgal in the presence or absence of increasing amounts of wild type or mutant 12SE1A and stimulated with appropriate amounts of ionomycin. When the effect of HTLV-1 p12I on p300 expression was tested, either pME-p12IHA or Pme-18s was transfected along with above described plasmids in the absence if ionomycin. To test the effect of p12I on HTLV-1 p30II mediated LTR repression, 0.2 µg of pTRE-Luc reporter plasmid was co-transfected with 1.2 µg pME- p30IIHA and increasing concentrations (0.0 µg, 0.6 µg, 1.2 µg, and 2.4 µg) of Pme- p12IHA, using Lipofectamine Plus (Invitrogen). To test if the rescue of p30II mediated

HTLV-1 LTR repression by p12I is p300 dependent, 1.0 µg E1A expression plasmid was also co-transfected. As an internal control for transfection efficiency, 0.1 µg of pRSV-βGal (Invitrogen) was also used in each transfection. Pme-18S was used as carrier DNA to equalize DNA concentrations for each transfection.

At 60 h post transfection, cells were lysed with passive lysis buffer (Promega) at room temperature for 15 min. Twenty microliters of each lysate was used to test luciferase reporter gene activity using an enhanced luciferase assay kit (Promega) according to the manufacturer’s protocol. Staining with 5-bromo-4-chloro-3-indolyl-beta-D- galactopyranoside (X-Gal) (Sigma) and counting β-Gal expressing cells was performed

197 to normalize the transfection efficiency. Results were expressed as mean of normalized luciferase activity in arbitrary light units (ALU) with standard error (SE) from a minimum of triplicate experiments. Statistical analysis was performed using Student’s t test, P < 0.05.

4.3 RESULTS

HTLV-1 p12I enhances expression of p300

We have previously reported that the expression of p12I is associated with enhanced levels of p300 mRNA in Jurkat T cells and primary CD4 T lymphocytes (Nair et al, manuscript in submission). In addition, our recent report demonstrated that the

HTLV-1 p12I mediated increased levels of p300-mediated transcription in Jurkat T cells.

To test whether the increased levels of p300 RNA resulted in increased protein levels of p300, we performed Western immunoblotting from Jurkat T cells spin infected with recombinant lentiviral vectors expressing p12I. Our data indicated that the Jurkat T cells expressing p12I had ~ 2.1 fold higher protein levels of p300 compared to mock vector infected control Jurkat T cells (Fig. 4.1A and B). These results further support our previous studies and indicate that HTLV-1 p12I expression is associated with p300 expression.

198 Sustained low magnitude increases in intracellular calcium enhances p300 expression

Previous reports from our laboratory demonstrated that HTLV-1 p12I increases cytosolic calcium concentration by enhancing release from ER stores 19. Increased intracellular calcium levels have been extensively studied using calcium ionophores, such as ionomycin 39. Ionomycin is routinely used for investigating calcium mediated T cell activation and proliferation. At high concentrations (0.5 – 2.0 µM), typically used to study proliferative responses of cells to calcium, ionomycin mediates passive calcium influx by directly inserting into the plasma membrane 24. However, at 10-100 fold lower concentrations (50 – 100 nM), ionomycin binds cellular endomembranes and increases cytosolic calcium concentration by depletion of intra-cellular calcium stores and capacitative calcium entry 24,45. Thus stimulation of T cells with 50 – 100 nM concentration of ionomycin causes calcium influx similar to HTLV-1 p12I 20.

To test if low magnitude increase in intracellular calcium concentration mediated through ionomycin, enhances the expression of p300, we performed semi- quantitative RT-PCR on total RNA extracted from Jurkat T cells stimulated with ionomycin. The cells were stimulated with 25, 50, 100, 500 and 1000 nM of ionomycin for 36 h before RNA extraction. A dose dependent increase in the expression of p300

RNA was observed in Jurkat T cells stimulated with 25, 50 and 100 nM of ionomycin.

The fold increase in p300 mRNA levels with 25, 50 and 100 nM of ionomycin was 1.5,

199 1.8 and 2.4 respectively (Fig. 4.2A and B). p300 RNA levels were not significantly altered at higher concentrations of ionomycin, most likely due to reduction in cell viability observed at higher concentrations of ionomycin over prolonged periods of time.

To investigate if increased levels of RNA correlated with a corresponding increase in protein levels of p300, we performed Western immunoblotting of Jurkat T cells stimulated with ionomycin. The cells were stimulated for 60 h with the same concentration of ionomycin before total protein was extracted for Western immunoblotting. A dose dependent increase in protein levels of p300 was observed in

Jurkat T cells stimulated with these lower concentrations of ionomycin. The fold increase in p300 protein levels with 25, 50 and 100 nM of ionomycin was 1.2, 1.6 and

2.4 respectively (Fig. 4.3A and B). The densitometry values were normalized to

lyceraldehydes-3-phosphate dehydrogenase (GAPDH) in both RT-PCR and Western immunoblotting assay.

Low dose ionomycin enhances p300-mediated transcription

To investigate whether the increased levels of p300 observed during low dose ionomycin treatment results in enhanced transcription from p300-dependent promoters, we tested the effect of low dose ionomycin on p300-dependent VP16 mediated transactivation. The functional gene expression analysis system has been previously described 52. A dose dependent increase in VP16 mediated transactivation of Gal4 promoter was observed at low levels of ionomycin. Significant 3.3 to 4.4 fold higher

200 luciferase activity was observed at 50 and 100 nM of ionomycin (Fig.4.4A). To further confirm that this increased luciferase activity is specific to increased levels of p300, we co-transfected adenoviral E1A protein, which completely inhibits p300 transcription by directly binding to the transcriptional co-adaptor. Plasmids expressing wildtype E1A or mutants of E1A, including ∆CR1 that contains a mutation in the p300 binding region and ∆CR2 containing a mutation in the retinoblastoma binding region were transfected along with the luciferase reporter plasmid and pM-VP16. Wild type E1A and the ∆CR2 mutant of E1A were able to inhibit the transactivation of VP16 on Gal4 promoter in a dose dependent manner. Our data indicated up to 82.3% reduction in luciferase activity with wild type E1A and approximately 70.0% reduction with the ∆CR2 mutant of E1A

(Fig.4.4B). The ∆CR1 mutant, which is unable to bind p300, did not have any effect on luciferase activity, suggesting the p300 dependent nature of VP16 mediated transactivation (Fig.4.4B). These findings indicate that low magnitude increase in intracellular calcium enhances p300 expression to biologically significant levels.

Enhanced expression of p300 is calcium-dependent, but calcineurin-independent

To confirm that p12I enhancement of p300 dependent VP16 driven transactivation is mediated by calcium, we transfected the p12I expression plasmid into

Jurkat T cells in the presence of the calcium chelator BAPTA-AM. In addition, we also stimulated Jurkat T cells with ionomycin with increasing concentrations of BAPTA-AM.

P300 dependent VP16 mediated transactivation of Gal4 promoter was inhibited in the

201 presence of BAPTA-AM in a dose dependent manner in both p12I transfected and ionomycin stimulated Jurkat T cells. We observed an approximately 55% reduction in luciferase activity with 10 µM BAPTA-AM in Jurkat T cells expressing p12I and an approximately 64% reduction in luciferase activity in Jurkat T cells stimulated with

100nM ionomycin respectively (Fig.4.5A and B). To further elucidate the transcriptional mechanism involved in the enhanced expression of p300, we blocked the calcium dependent phosphatase calcineurin, involved in the activation of a key transcriptional molecule, NFAT using cyclosporine A (CsA). Both p12I expressing and ionomycin stimulated Jurkat T cells, showed no significant difference in luciferase activity with increasing concentrations of CsA up to 200nm (Fig.4.5A and B). These data indicate that the expression of p300 is dependent on calcium, but not on calcineurin mediated cell signaling.

Localization of p12I to ER is required for enhanced expression of p300

Previous studies from our laboratory demonstrated that ER localization of

HTLV-1 p12I is critical for the release of calcium and its enhancement of NFAT- mediated transcription 21. We therefore, tested whether ER localization of p12I is necessary for its ability to enhance the expression of p300. An N and C-terminal deletion mutant of p12I containing amino acids 15-47 has been previously reported to localize to the nucleus, while the ER localization of this mutant was re-established by the addition of an ER targeting signal KKLL 21. We tested whether the ER localization of p12I is important in its ability to enhance p300-dependent VP16-mediated

202 transactivation, by transfecting Jurkat T cells with equal amounts of either the empty vector, wild type p12I, 15-47 mutant of p12I or the ER redirected 15-47-KKLL chimeric mutant along with the luciferase reporter and Gal4-VP16 expression plasmids. A marked reduction in the luciferase activity, up to 70%, was observed in Jurkat T cells expressing the 15-47 mutant of p12I, suggesting that ER localization of p12I is important for its ability to enhance the expression of p300 (Fig.6). This was further confirmed by the ability of the ER targeted 15-47-KKLL mutant of p12I to partially

(80% of the wild type levels) restore the luciferase activity (Fig.4.6).

HTLV-1 p12I partially inhibits the transcriptional repression of p30II on HTLV-1

LTR

p300 plays a crucial role in the regulation of viral gene transcription from

HTLV-1 LTR in infected cells by forming complexes with other transcriptional factors

37. HTLV-1 Tax transactivates LTR driven transcription of HTLV-1 genes through its interaction with the p300 11. In addition, studies from our laboratory have demonstrated that an accessory protein of HTLV-1, p30II inhibits transcription of viral genes from the

HTLV-1 LTR. This inhibition is mediated, in part, through the interaction of p30II with p300 and there by making it less available for transcriptional co-activation at the viral

LTR 54. By transiently transfecting increasing concentrations of pCMV-p300 with constant concentration of pME-p30IIHA plasmid, studies from our laboratory demonstrated that p300 expression reverses the p30II-dependent repression of LTR- luciferase reporter gene activity (Michael et al, in preparation). Since p12I has the

203 ability to increase the levels of p300, we hypothesized that p12I expression will result in reversal of the inhibitory effect of p30II on HTLV-1 LTR driven transcription. To test this, we transiently transfected increasing concentrations of pME-p12IHA plasmid with constant concentration of pME-p30IIHA plasmid. Our data indicated that p12I expression reverses the p30II-dependent repression of LTR-luciferase reporter gene activity, in a dose-dependent manner (Fig.4.7). Furthermore, to test if this was indeed p300 dependent, we co-transfected adenoviral E1A expression plasmid along with pME-p12IHA and pME-p30IIHA plasmids, and herein, we demonstrate that the expression of E1A blocked the effect of HTLV-1 p12I on p30II mediated LTR repression (Fig.4.7). This data further confirms that HTLV-1 p12I inhibits the transcriptional repression of p30II on HTLV-1 LTR in a p300 dependent manner and establishes a new role of p12I in modulating HTLV-1 gene expression.

4.4 DISCUSSION

Our study is the first to indicate a calcium-dependent mechanism of transcriptional regulation of p300 and to demonstrate that sustained low magnitude increase in intracellular calcium concentration enhances expression of p300 independent of calcineurin. HTLV-1, a human delta retrovirus associated with chronic infectious and lymphoproliferative disorders encodes accessory proteins that modulate viral and cellular gene expression by interaction with p300 and through calcium- dependent mechanisms 3. Using HTLV-1 p12I, which increases cytosolic calcium concentration, we demonstrate that the ER localization of p12I is required for its ability

204 to increase p300. In addition, we found that p12I reverses the repression of HTLV-1

LTR-driven transcription by HTLV-1 p30II. HTLV-1 p12I mediated enhancement of p300 expression represents a novel mechanism of regulation of cellular gene expression by viral proteins. By targeting a ubiquitous second messenger such as calcium, a viral protein such as p12I appears to regulate the expression of a cellular transcriptional co- activator such as p300 and thereby modulate viral gene expression, clonal expansion and cell survival.

Calcium is a universal and highly versatile intracellular messenger, which plays a critical role in many varied biological processes such as fertilization, proliferation, cell cycle, transcription, signal transduction, and apoptosis. Complex and versatile nature of the calcium fluxes in mammalian cells are achieved by a wide range of temporal and spatial distribution as well as the amplitude of intracellular calcium concentrations 5,7-

10,13,14. Calcium mobilization in lymphocytes and other non-excitable cells is accomplished by (a) the binding of inositol 1,4,5-trisphosphate (IP3) to its receptor in the ER membrane and subsequent rapid but transient release of Ca2+ from ER stores 6 and (b) involving a sustained extracellular Ca2+ influx across the plasma membrane, by store-operated or capacitative Ca2+ entry, which is activated by depletion of intracellular

Ca2+ stores and operated through store-operated Ca2+ channels (SOC) or calcium release-activated Ca2+ channels (CRAC)17,17,42,45,45.

205 The mechanism by which calcium induces gene expression has been the focus of many investigations. Based on DNA microarray analysis, Feske et al 26 demonstrated that Ca2+ signals modulate the expression of various genes involved in transcription, including c-Myc, c-Jun, c-rel, STAT5B, STAT4, STAT-1, CREM, NFAT4, FosB,

BRF2, E2F3, IRF-1, IRF-2, NF-IL3A, Fra-2, FLI1, MINOR, NOT and SMBP2.

Calcium-dependent activation of a wide variety of transcription factors, such as NFAT,

NFκB, Elk-1, Nur77, AP-1, ATF-2 and CREB, is known to be by means of calmodulin- dependent protein kinases and phosphatases 4,46,49. While a small transient spike of Ca2+ increase by store depletion activates signaling pathways and transcription factors such as NFκB and JNK 22, capacitative calcium entry and a sustained Ca2+ increase is necessary to activate other transcription factors, such as NFAT 22,23,38.

The effect of calcium on cellular gene expression has been studied in detail; however, p300 has not been identified in such studies. Typically, the role of calcium in various signal transduction pathways has been investigated using relatively high concentrations (0.5 - 2.0 µM) of calcium ionophore, ionomycin for short periods of time

(6 - 18 h). This stimulation condition simulates calcium dependent T cell activation upon antigen binding to the T cell receptor, however, such stimulation protocols overlooks the effect of prolonged stimulation with calcium. Higher concentrations of ionomycin are cytotoxic, limiting the possibility of long term stimulation. This might explain why previous studies did not identify p300 as a calcium-regulated gene. At low concentrations (50 – 100 nM), ionomycin binds cellular endomembranes and increases cytosolic calcium concentration by depletion of intra-cellular calcium stores and

206 capacitative calcium entry 24,45. Low concentrations of ionomycin, therefore, simulate exogenous viral protein, such as HTLV-1 p12I-mediated sustained increase in intracellular calcium concentration.

A number of viruses encode proteins which modulates the cellular Ca2+ homeostasis to regulate various aspects of viral pathogenesis 27. For instance, X protein (HBx) activate Pyk2 or Ca2+ signaling mediated by mitochondrial Ca2+ channels, which is necessary for HBV replication 15 while rotavirus encodes NSP4, a nonstructural glycoprotein, which increases the cytosolic calcium in rotavirus-infected cells 48. In addition, kaposi's sarcoma-associated herpesvirus (KSHV) mitochondrial protein K7 targets CAML, a cellular Ca2+-modulating protein to increase the cytosolic

Ca2+ response, which consequently protects cells from mitochondrial damage and apoptosis, thereby allowing the completion of viral lytic replication, maximizes the production of viral progeny for maintenance of persistent infection in the infected host

25. Coxsackievirus protein 2B is known to induce the influx of extracellular Ca2+ and to release Ca2+ from ER stores, modifies plasma membrane permeability and facilitates virus release 50 while HIV-1 pathogenicity factor Nef is known to modulate calcium signaling in host cells, involving atypical IP3R-triggered activation of plasma membrane calcium influx channels in a manner that is uncoupled from depletion of intracellular calcium stores 40. Furthermore, calcium plays a critical role in the replication cycles and pathogenesis of other viral diseases such as poliovirus, cytomegalovirus, vaccinia and measles virus 47.

207 Interestingly, CBP/p300 co-activators form complexes with other transcription factors at the HTLV-1 promoter, and are known to play a critical role in the regulation of HTLV-1 transcription in infected T-cells 37. HTLV-1 Tax, a transactivator of LTR mediated transcription, is critical in the activation of the HTLV-1 viral genes through its interaction with the p300 and CBP co-activators 11. Besides, CBP is known to stimulate

Tax-mediated HTLV-1 LTR transcription initiation and reinitiation from a naked DNA template in vitro 36 while p300 acts as co-activator for Tax-dependent HTLV-1 LTR transcription 35. HTLV-1 Tax directly interacts with p300/CBP in a multi-histone acetyltransferase/ activator-enhancer complex 31. Previous reports from our laboratory demonstrated that HTLV-1 accessory protein p30II binds CBP/p300 at the highly conserved KIX region 54. Intriguingly, KIX domain is the binding site of CBP/p300 for

HTLV-1 Tax protein as well. At lower concentration, p30II activates HTLV-1 LTR mediated transcription and at higher concentration, p30II represses the LTR mediated transcription 55. In addition, p30II was able to disrupt CREB-Tax-CBP/p300 complexes bound to the viral 21-bp TRE repeats 54. Recent findings from our laboratory indicate that HTLV-1 p30II and Tax appear to compete with each other in modulating the transcriptional activity from the LTR, possibly through competitive binding to

CBP/p300 (Michael et al, in preparation). Our present study demonstrates that HTLV-1 p12I enhances the expression of p300, thereby reverses the transcriptional repression of p30II on HTLV-1 LTR in a p300 dependent manner and establishes a new role of p12I in modulating HTLV-1 gene expression.

208 4.5 REFERENCES

1. Albrecht, B., N. D. Collins, G. C. Newbound, L. Ratner, and M. D. Lairmore. 1998. Quantification of human T-cell lymphotropic virus type 1 proviral load by quantitative competitive polymerase chain reaction. J VIROL METH 75:123-140.

2. Albrecht, B., C. D. D'Souza, W. Ding, S. Tridandapani, K. M. Coggeshall, and M. D. Lairmore. 2002. Activation of nuclear factor of activated T cells by human T- lymphotropic virus type 1 accessory protein p12(I). J. Virol. 76:3493- 3501.

3. Albrecht, B. and M. D. Lairmore. 2002. Critical role of human T-lymphotropic virus type 1 accessory proteins in viral replication and pathogenesis. Microbiol. Mol. Biol. Rev. 66:396-406.

4. Aramburu, J., A. Rao, and C. B. Klee. 2000. Calcineurin: from structure to function. Curr. Top. Cell Regul. 36:237-295.

5. Berridge, M., P. Lipp, and M. Bootman. 1999. Calcium signalling. Curr. Biol. 9:R157-R159.

6. Berridge, M. J. 1993. Inositol trisphosphate and calcium signalling. Nature 361:315-325.

7. Berridge, M. J. 1997. Lymphocyte activation in health and disease. [Review] [155 refs]. Critical Reviews in Immunology 17:155-178.

8. Berridge, M. J., M. D. Bootman, and P. Lipp. 1998. Calcium--a life and death signal. Nature 395:645-648.

9. Berridge, M. J., P. Lipp, and M. D. Bootman. 2000. Signal transduction. The calcium entry pas de deux. Science 287:1604-1605.

10. Berridge, M. J., P. Lipp, and M. D. Bootman. 2000. The versatility and universality of calcium signalling. Nat. Rev. Mol. Cell Biol. 1:11-21.

11. Bex, F. and R. B. Gaynor. 1998. Regulation of gene expression by HTLV-I Tax protein. Methods 16:83-94.

12. Blobel, G. A. 2000. CREB-binding protein and p300: molecular integrators of hematopoietic transcription. Blood 95:745-755.

13. Bootman, M. D., M. J. Berridge, and P. Lipp. 1997. Cooking with calcium: the recipes for composing global signals from elementary events. Cell 91:367-373.

209 14. Bootman, M. D., T. J. Collins, C. M. Peppiatt, L. S. Prothero, L. Mackenzie, P. de Smet, M. Travers, S. C. Tovey, J. T. Seo, M. J. Berridge, F. Ciccolini, and P. Lipp. 2001. Calcium signalling--an overview. Semin. Cell Dev. Biol. 12:3-10.

15. Bouchard, M. J., L. H. Wang, and R. J. Schneider. 2001. Calcium signaling by HBx protein in hepatitis B virus DNA replication. Science 294:2376-2378.

16. Chan, H. M. and N. B. La Thangue. 2001. p300/CBP proteins: HATs for transcriptional bridges and scaffolds. J Cell Sci 114:2363-2373.

17. Clapham, D. E. 1995. Calcium siganling. Cell 80:259-268.

18. Colgin, M. A. and J. K. Nyborg. 1998. The human T-cell leukemia virus type 1 oncoprotein Tax inhibits the transcriptional activity of c-Myb through competition for the CREB binding protein. J. Virol. 72:9396-9399.

19. Ding, W., Albrecht B., R. E. Kelley, N. Muthusamy, S. Kim, R. A. Altschuld, and M. D. Lairmore. 2002. Human T lymphotropic virus type 1 p12(I) expression increases cytoplasmic calcium to enhance the activation of nuclear factor of activated T cells. J Virol 76:10374-10382.

20. Ding, W., B. Albrecht, R. Luo, W. Zhang, J. R. Stanley, G. C. Newbound, and M. D. Lairmore. 2001. Endoplasmic Reticulum and cis-Golgi Localization of Human T- Lymphotropic Virus Type 1 p12(I): Association with Calreticulin and Calnexin. J. Virol. 75:7672-7682.

21. Ding, W., S. J. Kim, A. M. Nair, B. Michael, K. Boris-Lawrie, A. Tripp, G. Feuer, and M. D. Lairmore. 2003. Human T-Cell Lymphotropic Virus Type 1 p12(I) Enhances Interleukin-2 Production during T-Cell Activation. J Virol 77:11027-11039.

22. Dolmetsch, R. E., R. S. Lewis, C. C. Goodnow, and J. I. Healy. 1997. Differential activation of transcription factors induced by Ca2+ response amplitude and duration. Nature 386:855-858.

23. Dolmetsch, R. E., K. Xu, and R. S. Lewis. 1998. Calcium oscillations increase the efficiency and specificity of gene expression. Nature 392:933-936.

24. Donnadieu, E., G. Bismuth, and A. Trautmann. 1995. The intracellular Ca2+ concentration optimal for T cell activation is quite different after ionomycin or CD3 stimulation. Pflugers Arch. 429:546-554.

210 25. Feng, P., J. Park, B. S. Lee, S. H. Lee, R. J. Bram, and J. U. Jung. 2002. Kaposi's sarcoma-associated herpesvirus mitochondrial K7 protein targets a cellular calcium-modulating cyclophilin ligand to modulate intracellular calcium concentration and inhibit apoptosis. J Virol 76:11491-11504.

26. Feske, S., J. Giltnane, R. Dolmetsch, L. M. Staudt, and A. Rao. 2001. Gene regulation mediated by calcium signals in T lymphocytes. Nat. Immunol. 2:316- 324.

27. Ganem, D. 2001. Virology. The X files--one step closer to closure. Science 294:2299-2300.

28. Giordano, A. and M. L. Avantaggiati. 1999. p300 and CBP: partners for life and death. J. Cell Physiol 181:218-230.

29. Gomord, V., E. Wee, and L. Faye. 1999. Protein retention and localization in the endoplasmic reticulum and the golgi apparatus. Biochimie 81:607-618.

30. Goodman, R. H. and S. Smolik. 2000. CBP/p300 in cell growth, transformation, and development. Genes Dev. 14:1553-1577.

31. Harrod, R., Y. L. Kuo, Y. Tang, Y. Yao, A. Vassilev, Y. Nakatani, and C. Z. Giam. 2000. p300 and p300/cAMP-responsive element-binding protein associated factor interact with human T-cell lymphotropic virus type-1 Tax in a multi- histone acetyltransferase/activator-enhancer complex. J. Biol. Chem. 275:11852- 11857.

32. Hottiger, M. O., L. K. Felzien, and G. J. Nabel. 1998. Modulation of cytokine- induced HIV gene expression by competitive binding of transcription factors to the coactivator p300. EMBO J. 17:3124-3134.

33. Hottiger, M. O. and G. J. Nabel. 2000. Viral replication and the coactivators p300 and CBP. Trends Microbiol. 8:560-565.

34. Janknecht, R. 2002. The versatile functions of the transcriptional coactivators p300 and CBP and their roles in disease. Histol. Histopathol. 17:657-668.

35. Jiang, H., H. Lu, R. L. Schiltz, C. A. Pise-Masison, V. V. Ogryzko, Y. Nakatani, and J. N. Brady. 1999. PCAF interacts with tax and stimulates tax transactivation in a histone acetyltransferase-independent manner [published erratum appears in Mol Cell Biol 2000 Mar;20(5):1897]. Mol. Cell Biol. 19:8136- 8145.

211 36. Kashanchi, F., J. F. Duvall, R. P. Kwok, J. R. Lundblad, R. H. Goodman, and J. N. Brady. 1998. The coactivator CBP stimulates human T-cell lymphotrophic virus type I Tax transactivation in vitro. J. Biol. Chem. 273:34646-34652.

37. Lemasson, I., N. J. Polakowski, P. J. Laybourn, and J. K. Nyborg. 2002. Transcription factor binding and histone modifications on the integrated proviral promoter in human T-cell leukemia virus-I-infected T-cells. J Biol. Chem. 277:49459-49465.

38. Li, W., J. Llopis, M. Whitney, G. Zlokarnik, and R. Y. Tsien. 1998. Cell- permeant caged InsP3 ester shows that Ca2+ spike frequency can optimize gene expression. Nature 392:936-941.

39. Liu, C. and T. E. Hermann. 1978. Characterization of ionomycin as a calcium ionophore. J Biol. Chem. 253:5892-5894.

40. Manninen, A. and K. Saksela. 2002. HIV-1 Nef interacts with inositol trisphosphate receptor to activate calcium signaling in T cells. J Exp. Med. 195:1023-1032.

41. Mulloy, J. C., R. W. Crownley, J. Fullen, W. J. Leonard, and G. Franchini. 1996. The human T-cell leukemia/lymphotropic virus type 1 p12I proteins bind the interleukin-2 receptor beta and gammac chains and affects their expression on the cell surface. J Virol 70:3599-3605.

42. Parekh, A. B. and R. Penner. 1997. Store depletion and calcium influx. Physiol Rev. 77:901-930.

43. Petrij, F., R. H. Giles, H. G. Dauwerse, J. J. Saris, R. C. Hennekam, M. Masuno, N. Tommerup, G. J. van Ommen, R. H. Goodman, and D. J. Peters. 1995. Rubinstein-Taybi syndrome caused by mutations in the transcriptional co- activator CBP [see comments]. Nature 376:348-351.

44. Plemper, R. K., A. L. Hammond, and R. Cattaneo. 2001. Measles virus envelope glycoproteins hetero-oligomerize in the endoplasmic reticulum. J Biol. Chem. 276:44239-44246.

45. Putney, J. W., Jr. 1990. Capacitative calcium entry revisited. Cell Calcium 11:611-624.

46. Rao, A., C. Luo, and P. G. Hogan. 1997. Transcription factors of the NFAT family: regulation and function. Annu. Rev. Immunol. 15:707-747.

47. Ruiz, M. C., J. Cohen, and F. Michelangeli. 2000. Role of Ca2+in the replication and pathogenesis of rotavirus and other viral infections. Cell Calcium 28:137-149.

212 48. Tian, P., M. K. Estes, Y. Hu, J. M. Ball, C. Q. Zeng, and W. P. Schilling. 1995. The rotavirus nonstructural glycoprotein NSP4 mobilizes Ca2+ from the endoplasmic reticulum. J. Virol. 69:5763-5772.

49. Tokumitsu, H., H. Enslen, and T. R. Soderling. 1995. Characterization of a Ca2+/calmodulin-dependent protein kinase cascade. Molecular cloning and expression of calcium/calmodulin-dependent protein kinase kinase. J Biol. Chem. 270:19320-19324.

50. van Kuppeveld, F. J., J. G. Hoenderop, R. L. Smeets, P. H. Willems, H. B. Dijkman, J. M. Galama, and W. J. Melchers. 1997. Coxsackievirus protein 2B modifies endoplasmic reticulum membrane and plasma membrane permeability and facilitates virus release. EMBO J. 16:3519-3532.

51. Vo, N. and R. H. Goodman. 2001. CREB-binding protein and p300 in transcriptional regulation. J. Biol. Chem. 276:13505-13508.

52. Wang, L., S. R. Grossman, and E. Kieff. 2000. Epstein-Barr virus nuclear protein 2 interacts with p300, CBP, and PCAF histone acetyltransferases in activation of the LMP1 promoter. Proc. Natl. Acad. Sci U. S. A 97:430-435.

53. Yang, X. J., V. V. Ogryzko, J. Nishikawa, B. H. Howard, and Y. Nakatani. 1996. A p300/CBP-associated factor that competes with the adenoviral oncoprotein E1A. Nature 382:319-324.

54. Zhang, W., J. W. Nisbet, B. Albrecht, W. Ding, F. Kashanchi, J. T. Bartoe, and M. D. Lairmore. 2001. Human T-lymphotropic virus type 1 p30(II) regulates gene transcription by binding CREB binding protein/p300. J. Virol. 75:9885-9895.

55. Zhang, W., J. W. Nisbet, J. T. Bartoe, W. Ding, and M. D. Lairmore. 2000. Human T-lymphotropic virus type 1 p30(II) functions as a transcription factor and differentially modulates CREB-responsive promoters. J. Virol. 74:11270-11277.

213

Figure 4.1 HTLV-1 p12I enhances p300 protein levels in Jurkat T lymphocytes

(A) 2 x 106 Jurkat T lymphocytes were spin infected with lentiviral vectors expressing p12I at an MOI of 5. Total protein was extracted and Western immunoblot analysis for the detection of p300 was performed. Jurkat T cells expressing p12I demonstrated increased protein levels of p300. The figure is representative of three separate experiments. (B) Densitometric analysis of radiograph was performed using Gel pro analyzer software and normalized to GAPDH. Jurkat T cells expressing p12I showed ~ 2.1 fold increased expression of p300. Statistical analysis was performed using Student’s t test. * indicates P value < 0.05. Results are expressed as mean of the fold differences with standard error (SE) from a minimum of three separate experiments.

214

Figure 4.2 Sustained low magnitude increase in intra cellular calcium concentration enhances transcription of p300

(A) Jurkat T cells were stimulated with varying concentrations of ionomycin for 36 hours. The cells were maintained at a concentration of 1 million per ml. Total cellular RNA was extracted and semi-quantitative RT-PCR was performed to identify the mRNA levels of p300. There was a dose dependent increase in p300 expression in Jurkat T cells stimulated with low concentrations of ionomycin (25, 50 and 100 nM). The figure is representative of three separate experiments. (B) Densitometric analysis was performed using alpha imager software and normalized to GAPDH. Dose dependent increase in p300 mRNA levels up to 2.4 fold were observed with 100 nM ionomycin stimulation of Jurkat T cells. Statistical analysis was performed using Student’s t test. * indicates P value < 0.05. Results are expressed as mean of the fold differences with standard error (SE) from a minimum of three separate experiments.

215

Figure 4.3 Enhanced mRNA levels of p300 correlates with increased protein levels of p300

(A) Jurkat T cells were stimulated with varying concentrations of ionomycin for 60 hours. The cells were maintained at a concentration of 1 million per ml. Total protein was extracted and Western immunoblot analysis for the detection of p300 protein. There was a dose dependent increase in p300 expression in Jurkat T cells stimulated with low concentrations of ionomycin (25, 50 and 100 nM). The figure is representative of three separate experiments. (B) Densitometric analysis of radiograph was performed using Gel pro analyzer software and normalized to GAPDH. Dose dependent increase in p300 protein levels up to 2.5 fold were observed with 100 nM ionomycin stimulation of Jurkat T cells. The protein levels were in parallel with mRNA levels observed at similar concentrations of ionomycin. Statistical analysis was performed using Student’s t test. * indicates P value < 0.05. Results are expressed as mean of the fold differences with standard error (SE) from a minimum of three separate experiments.

216

Figure 4.4 Ionomycin mediated increase in p300 levels is significant for its function as a transcriptional co-activator

(A) 2 x 106 Jurkat T cells were transfected with 5xGT-Luc and pM-VP16. The transfected cells were maintained in cRPMI medium containing increasing concentrations of ionomycin. The luciferase activity was tested 60 h post transfection. A dose dependent increase in VP16 mediated p300 dependent luciferase activity was noted with increasing concentrations of ionomycin. (B) The increase in VP16 mediated luciferase activity was confirmed to be p300 dependent by transfecting wild type and mutants of adenoviral E1A protein. 2 x 106 Jurkat T cells were transfected with 5xGT- Luc, pM-VP16 and increasing concentrations of wild type or mutants of adenoviral E1A protein. The transfected cells were incubated in cRPMI medium supplemented with 100 nM ionomycin. ∆CR1 mutant of E1A is incapable of binding p300 while ∆CR2 mutant is capable of binding p300 but not . VP16 mediated p300 dependent luciferase activity was inhibited in a dose dependent fashion in the presence of wild type as well as ∆CR2 mutant of E1A. No effect on luciferase activity was noted in the presence of ∆CR1 mutant of E1A. Statistical analysis was performed using Student’s t test. * indicates P value < 0.05. Results are expressed as mean of the fold differences with standard error from a minimum of 3 separate experiments.

217

Figure 4.5. Enhanced expression of p300 is calcium dependent but calcineurin independent

(A) 2 x 106 Jurkat T cells were transfected with 5xGT-Luc and pM-VP16. The transfected cells were incubated in cRPMI medium supplemented with 100 nM ionomycin. The cells were treated with increasing concentrations of BAPTA-AM or CsA. A dose dependent reduction in VP16 mediated p300 dependent luciferase activity was noticed in the presence of BAPTA-AM while no significant difference in luciferase activity was observed in the presence of CsA. * indicates P value < 0.05. Results are expressed as mean of the fold differences with standard error from a minimum of 3 separate experiments. (B) 2 x 106 Jurkat T cells were transfected with 5xGT-Luc, pM- VP16 and pME-p12I. The transfected cells were incubated in cRPMI medium. The cells were treated with increasing concentrations of BAPTA-AM or CsA. A dose dependent reduction in VP16 mediated p300 dependent luciferase activity was noticed in the presence of BAPTA-AM while no significant difference in luciferase activity was observed in the presence of CsA. Statistical analysis was performed using Student’s t test. * indicates P value < 0.05. Results are expressed as mean of the fold differences with standard error (SE) from a minimum of three separate experiments.

218

Figure 4.6 Binding of p12I to ER is required for enhanced expression of p300

2 x 106 Jurkat T cells were transfected with 5xGT-Luc, pM-VP16 along with either of the following plasmids - pME control vector, pME-p12I, pME-15-47 or pME-15- 47KKLL. The transfected cells were incubated in cRPMI medium. pME-15-47, which localizes to the nucleus, showed marked reduction in the VP16 mediated p300 dependent luciferase activity. This could be partially restored by redirecting the protein to the ER. Statistical analysis was performed using Student’s t test. * indicates P value < 0.05. Results are expressed as mean of the fold differences with standard error (SE) from a minimum of three separate experiments.

219

Figure 4.7 HTLV-1 p12I partially inhibits the transcriptional repression of p30II on HTLV-1 LTR

(A) 2 x 106 Jurkat T cells were transfected with pTRE-Luc, pME-p30II and increasing concentrations of pME-p12I. The transfected cells were incubated in cRPMI medium. A dose dependent increase in luciferase activity was observed with increasing concentrations of p12I. Statistical analysis was performed using Student’s t test. * indicates P value < 0.05. Results are expressed as mean of the fold differences with standard error (SE) from a minimum of three separate experiments. (B) To confirm that the increased luciferase activity from pTRE-Luc was dependent on increased levels of p300, we transfected adenoviral E1A protein along the above described plasmids. There was a statistically significant reduction in luciferase activity in the presence of E1A. Statistical analysis was performed using Student’s t test. * indicates P value < 0.05. Results are expressed as mean of the fold differences with standard error (SE) from a minimum of three separate experiments.

220

CHAPTER 5

SYNOPSIS AND FUTURE DIRECTIONS

Retrovirus-derived recombinant vectors provide efficient means of gene transfer and are comprehensively used in gene therapy trials as well as in molecular and cellular biology research. These vectors are considered to be excellent tools for therapeutic intervention against congenital or inherited disorders by in utero gene therapy and for gene transfer into dividing cells both in vitro and in vivo. In order to improve gene transfer efficiency and safety, modifications such as envelope substitution are made on retroviral vectors.

Data presented in this thesis demonstrate that careful selection of envelope glycoproteins for pseudotyping plays a critical role in tissue directed gene transfer efficiency of retroviral vectors. RD114 envelope enhanced the gene transfer ability of retroviral vectors to peripheral blood, thymus, kidney and brain, while amphotropic envelope pseudotyped vectors had significantly higher gene transfer to thymus, spleen, kidney, brain and gonads. The ability of retroviral vectors to transduce myeloid progenitors was highest for ecotropic envelope pseudotype followed by amphotropic,

RD114, VSV-G, GALV and rabies. Gene transfer to erythroid progenitors was more

221 efficient with ecotropic pseudotype followed by RD114, VSV-G, GALV, amphotropic and rabies. Further improvements of viral vectors are required for better gene transfer efficiency and tissue-specific gene expression. In order to obtain a stable high-level expression for HTLV-1 accessory protein p12I in T lymphocytes, we developed a lentiviral vector system. Data presented in the chapters show the successful use of recombinant lentiviral vectors in our investigations to elucidate the pathogenesis of

HTLV-1.

The development of ATLL by HTLV-1 involves a series of cellular events resulting in

T cell activation, immortalization eventually leading to transformation of T lymphocytes. The molecular mechanisms involved in T lymphocyte transformation by

HTLV-1 have been extensively investigated. The studies are centered on the transcriptional activator protein Tax. However, the early events of viral infection, including viral entry, viral particles uncoating, reverse transcription, proviral DNA integration, early viral gene transcription and viral regulation of cellular genes early in infection remains poorly understood. Our laboratory identified the role of an HTLV-1 accessory protein p12I in the establishment of productive infection in rabbit model and on viral infectivity in quiescent peripheral blood mononuclear cells (PBMC) 2,8.

Subsequent studies, from our laboratory, to identify the molecular mechanisms of p12I on viral infectivity have demonstrated that p12I specifically enhances nuclear factor of activated T-cells (NFAT) mediated transcription in a calcium dependent manner3,10 and demonstrated that p12I expression increases interleukin-2 (IL-2) production from Jurkat cells11. Data presented in this thesis demonstrates that a highly conserved viral

222 accessory protein, p12I, modulates the expression of various cellular genes involved in biological processes such as cell cycle, apoptosis, cell adhesion, immune response and transcriptional regulation predominantly in a calcium dependent manner. In addition, data presented in this thesis identifies a novel mechanism of calcium-dependent transcriptional regulation of a critical rate limiting transcriptional co-adaptor protein p300. Thus p12I mediates calcium dependent transcription in lymphocytes, enhances p300 expression in a calcium dependent manner to hasten the activation of T- lymphocytes, thereby promote efficient viral infection and long-term survival of infected cells.

5.1 Improved retroviral vectors for lineage-specific gene expression in

hematopoietic cells.

Congenital/inherited disorders of hematopoietic cells are excellent candidates for therapeutic intervention using retroviral vector mediated in utero gene therapy. The unique feature of hematopoietic stem cells to self-renew and differentiate along all lineages, to completely reconstitute bone marrow hematopoiesis makes it an attractive target cell population for gene delivery. Targeting these cells prenatally, by in utero gene transfer, when they are rapidly dividing, overcomes this major obstacle in the treatment of hematopoietic disorders. However, somatic gene transfer using currently available vector systems typically results in ectopic and non-regulated expression of the transgene. Cellular control elements and designer promoters have been modified to provide lineage-specific expression with limited efficiency23,24,27,31,39. This calls for 223 further improvement of retroviral vectors with additional cellular or viral elements capable of regulating gene expression. This should be accomplished considering the safety of viral vectors as well.

5.2 Further characterization of p12I mediated enhancement of p300 expression.

Transcriptional co-activator p300 mediate transcriptional control of various cellular and viral DNA binding transcription factors. The limiting availability of p300 within the cells renders even small reductions in the concentrations of this co-activator detrimental in many instances 28. Studies on how the cell directs the activities of p300 in a specific and timely-regulated fashion have demonstrated that two non mutually exclusive mechanisms exist - competitive protein-protein interactions and post-translational modifications such as phosphorylation and acetylation 6,15. However, the transcriptional regulation of p300 is not completely characterized. P300 plays a critical role in the development of ATLL and previous results from our laboratory demonstrated that

HTLV-1 Tax and p30II both bind p300 at the KIX domain and appear to compete with each other for modulating HTLV-1 LTR mediated transcription and viral gene expression 43. Recent studies from our laboratory indicated that p30II activates the

HTLV-1 LTR mediated transcription at lower concentrations, and represses the LTR mediated transcription at higher concentrations44. Data presented in this thesis, demonstrates that HTLV-1p12I enhances the transcription of p300 in a calcium dependent manner independent of calcineurin. In addition, this data also reveal the importance of ER localization of p12I for this enhancement of p300 expression. These studies have identified a novel mechanism for transcriptional regulation of p300.

224 However, this mechanism is not fully characterized and the role of other proteins or physiologic stimuli involved in the enhancement of p300 transcription by p12I in a calcium dependent manner is not completely understood. Interestingly, our results demonstrate that p12I partially inhibits the transcriptional repression of HTLV-1 LTR driven transcription by another accessory protein p30II. Therefore, it appears that the relative amounts of Tax, p30II and p12I may be crucial in modulating the LTR mediated transcription of viral genes from the HTLV-1 viral promoter. Considering the critical nature of p300 in HTLV-1 pathogenesis and cellular gene transcription, additional studies designed to fully characterize the transcriptional regulation of this rate limiting transcriptional co-adaptor will be valuable. Additionally, experiments to identify the promoter region of p300 and mutational analysis of the promoter to discover the transcriptional factor binding regions would further elucidate the mechanism of p300 trnascription.

5.3 Is p12I virion-associated or selectively expressed before viral integration?

The ability of p12I to activate T cells and increase the levels of transcriptional co-adaptor molecule p300 strongly indicates its role in early viral infection. A similar

HIV accessory protein, Nef, has been reported to be associated with HIV virions 19,45 and has been reported to enhance HIV infectivity during the early stage of viral life cycle from post-entry to integration 1,7,25,33. In addition, Nef has been demonstrated to be selectively expressed before viral integration and thereby involved in activation of T cells 42. Therefore, it will be critical to test if p12I is present in HTLV-1 viral particles as preformed protein or selectively expressed before viral integration. These questions 225 have been difficult to address due to the lack of an antibody against p12I and unsuccessful cell-free HTLV-1 infection assays. In contrast to HIV, HTLV-1 requires cell-to-cell contact for efficient infection of the target cells. Thus, further dissection of the early stages of viral life cycle using single-round infection assays, reverse transcriptase inhibitor and integrase deficient proviral clone, will be helpful in identifying the function of p12I in viral life cycle. Additionally, tagging p12I sequence with an epitope, such as HA or AU1, in the proviral clone will aid in detecting the protein during HTLV-1 infection. If p12I is detected after viral integration, p12I most likely influences late events, such as viral replication, particle assembly and release.

5.4 Temporal expression pattern and interaction between HTLV-1 regulatory

and accessory proteins during various stages of the HTLV-1 infection

Similar to p12I, Tax is able to induce the IL-2Rα and IL-2 expression by a different mechanism involving activation of NFATp 16,17,32 and NFκB 34,35,40. This demonstrates a mutually independent functional redundancy of HTLV-1 proteins involved in T cell activation. Tax is also able to activate both AP-1 and NFκB, and may thus provide the synergistic signals required for p12I mediated IL-2 production. As a consequence, viral infected T lymphocytes could be highly activated to produce IL-2 in the absence of T cell receptor engagement. Based on these findings, it is possible that these proteins act coordinately or synergistically. By modulating the expression of various HTLV-1 proteins, the virus might employ selective use of different viral proteins during different stages of the infection. Thus, studies designed to test the temporal expression patterns of both genes during viral replication and different stages 226 of the disease are required to answer this question. Particularly, it will be important to test if p12I act synergistically or compete with other viral proteins in modulating cellular and viral gene expression. However, since information on the expression profile of HTLV-1 proteins during different stages of the infection is limited, additional studies designed to test the temporal expression patterns of HTLV-1 regulatory and accessory proteins during viral infection are required to explore this possibility.

5.5 Does p12I affect cell cycle progression in T lymphocytes?

Following T cell receptor engagement, series of signaling events lead to activation and subsequent proliferation of T lymphocytes. Secondary signaling messengers such as calcium play a critical role in these molecular events. Calcium mediated NFAT dependent T cell growth factor IL-2 promotes cell cycle progression of T cells from G1 to S phase. Gene array analysis presented in this thesis demonstrate that p12I modulates the expression of several genes involved in cell cycle progression of T lymphocytes such as CDC2L1, CDC2L5, CDK9 and CDC45. In addition, p12I expression enhances

Stat5 activation and decreases the IL-2 requirement for PBMC proliferation 26. Thus, it is possible that p12I facilitates cell cycle progression in a calcium dependent manner, by increasing IL-2 production and further activating the IL-2R pathway. However, based on these findings, future studies are essential not only to verify the gene array findings, but also to test the functional role of p12I in cell cycle progression and its biological significance in HTLV-1 tumorigenesis.

227 5.6 Does p12I affect apoptosis in T lymphocytes?

In addition to its role in cell cycle progression, calcium is also involved in the regulation of several genes involved in apoptosis. Data presented in this thesis have demonstrated HTLV-1 p12I mediated modulation of several apoptosis related genes such as BAK1, BAG4, Caspase 1 and TNF superfamily members. In addition, increased

IL-2 stimulation renders T lymphocytes sensitive to Fas induced cell death due to upregulation of the Fas ligand (FasL), a process named activation induced cell death

(AICD) 5. In fact, activation of Stat5 or NFAT is able to upregulate FasL 30,38. Similar to p12I, anti-apoptotic cellular protein Bcl-2 increases ER calcium release and reduce

ER calcium content 13. However, expression of Bcl-2 blocks NFAT-induced FasL transcription 36 and delays the G0 to S phase transition 21, whereas p12I is able to activate NFAT. This elucidates the complex nature of gene regulation involved in apoptosis and p12I may regulate apoptosis by either direct or indirect mechanisms.

Clearly, more experiments are necessary to identify the role of p12I in apoptosis of T lymphocytes and biological relevance in the pathogenesis of ATLL.

5.7 Does p12I affect cell to cell adhesion between T lymphocytes?

HTLV-1 is a highly cell associated virus and detectable numbers of cell-free infectious HTLV-1 particles are not produced from naturally infected T lymphocytes

9,12. However, the mechanism of cell-to-cell spread of HTLV-1 was not clear until

Igakura et al demonstrated that cell contact rapidly induces polarization of the cytoskeleton of the HTLV-1 infected cell to the cell-cell junction. All the players

228 involved in this process are not completely understood, however, cell adhesion proteins are thought to play a significant role facilitating this event. HTLV-1 is known to upregulate the expression levels of certain adhesion molecules such as integrins29,37, which increases the chances of cell to cell adhesion. Gene array data presented in this thesis shed light on the adhesion molecules whose expression is modulated by p12I.

These genes fall into different categories of adhesion proteins such as protocadherins, laminin, lectin, selectin and sialoadhesion. Regulation of adhesion molecules by HTLV-

1 p12I is not surprising since transmembrane calcium flux is associated with modulation of the expression of adhesion-related proteins such as cadherin41, protocadherin14 and sialophorin 4. Additional studies are necessary to identify the role of p12I in cell to cell adhesion between T lymphocytes and its functional and biological significance in

HTLV-1 pathogenesis.

I I 5.8 Does p12 interact with IP3R and how does p12 affect the ER store calcium

release?

Elevation of intracellular calcium is an essential signal for T cell activation triggered by cross-linking the TCR. IP3R, an ER membrane calcium channel, is necessary for calcium release from the ER store following TCR engagement 18,20.

Studies from our laboratory have previously demonstrated that ER localization of p12I is critical for the activation of calcium dependent NFAT mediated transcription11. In addition, data presented in this thesis demonstrates that a mutant of HTLV-1 p12I,

229 which is not capable of localizing to ER, had considerable reduction in p300 dependent

VP16 driven transcription. Interestingly, redirecting the mutant to ER significantly restored this reduction, strongly indicating that ER localization of p12I is critical for the enhanced transcription of p300. The receptor of p12I on ER and the mechanism by which this viral protein releases calcium from ER is not understood. Two mechanisms might account for the possible p12I mediated ER calcium release. First, p12I may interact with IP3R and modulate the activity of this calcium channel. This hypothesis is

I supported by our earlier findings that IP3R inhibitor is able to block the p12 mediated

NFAT activation 3. Another viral protein with similar mode of action, HIV-1 Nef, associates with IP3R and this interaction is required for NFAT activation induced by

22 I Nef . Thus, studies designed to test the potential interaction between p12 and IP3R

I will clarify the interaction between IP3R and p12 as well as identify the ER receptor for p12I. Another possible mechanism is p12I itself forming a calcium channel in the ER membrane to facilitate calcium release. Future studies are essential not only to identify the ER receptor of p12I, but also to understand the molecular mechanism by which p12I increases cytosolic calcium concentration.

In summary, a variety of questions regarding the detailed mechanism by which p12I regulates viral infection, viral and cellular gene regulation and various cellular processes remain to be understood. Further studies aimed at solving some of these and related questions are currently in progress. Nonetheless, it is apparent that p12I, an important HTLV-1 accessory protein, is able to promote T cell activation, promote

230 long-term survival of infected cells through modulation of calcium homeostasis. More importantly, studies on p12I helped us identify a novel mechanism involved in the transcription of a rate limiting transcriptional co-adapter molecule p300.

231 5.9 REFERENCES

1. Aiken, C. and D. Trono. 1995. Nef stimulates human immunodeficiency virus type 1 proviral DNA synthesis. J. Virol. 69:5048-5056.

2. Albrecht, B., N. D. Collins, M. T. Burniston, J. W. Nisbet, L. Ratner, P. L. Green, and M. D. Lairmore. 2000. Human T-lymphotropic virus type 1 open reading frame I p12(I) is required for efficient viral infectivity in primary lymphocytes. J. Virol. 74:9828-9835.

3. Albrecht, B., C. D. D'Souza, W. Ding, S. Tridandapani, K. M. Coggeshall, and M. D. Lairmore. 2002. Activation of nuclear factor of activated T cells by human T- lymphotropic virus type 1 accessory protein p12(I). J. Virol. 76:3493- 3501.

4. Barat, C. and M. J. Tremblay. 2002. Engagement of CD43 enhances human immunodeficiency virus type 1 transcriptional activity and virus production that is induced upon TCR/CD3 stimulation. J Biol. Chem. 277:28714-28724.

5. Budd, R. C. 2001. Activation-induced cell death. Curr. Opin. Immunol. 13:356- 362.

6. Chan, H. M. and N. B. La Thangue. 2001. p300/CBP proteins: HATs for transcriptional bridges and scaffolds. J Cell Sci 114:2363-2373.

7. Chowers, M. Y., M. W. Pandori, C. A. Spina, D. D. Richman, and J. C. Guatelli. 1995. The growth advantage conferred by HIV-1 nef is determined at the level of viral DNA formation and is independent of CD4 downregulation. Virology 212:451-457.

8. Collins, N. D., G. C. Newbound, B. Albrecht, J. L. Beard, L. Ratner, and M. D. Lairmore. 1998. Selective ablation of human T-cell lymphotropic virus type 1 p12I reduces viral infectivity in vivo. Blood 91:4701-4707.

9. Derse, D., S. A. Hill, P. A. Lloyd, H. Chung, and B. A. Morse. 2001. Examining human t-lymphotropic virus type 1 infection and replication by cell- free infection with recombinant virus vectors. J. Virol. 75:8461-8468.

10. Ding, W., Albrecht B., R. E. Kelley, N. Muthusamy, S. Kim, R. A. Altschuld, and M. D. Lairmore. 2002. Human T lymphotropic virus type 1 p12(I) expression increases cytoplasmic calcium to enhance the activation of nuclear factor of activated T cells. J Virol 76:10374-10382.

232 11. Ding, W., S. J. Kim, A. M. Nair, B. Michael, K. Boris-Lawrie, A. Tripp, G. Feuer, and M. D. Lairmore. 2003. Human T-Cell Lymphotropic Virus Type 1 p12(I) Enhances Interleukin-2 Production during T-Cell Activation. J Virol 77:11027-11039.

12. Fan, N., J. Gavalchin, B. Paul, K. H. , M. J. Lane, and B. J. Poiesz. 1992. Infection of Peripheral Blood Mononuclear Cells and Cell Lines by Cell-Free Human T-Cell Lymphoma/Leukemia Virus Type 1. J. Clin. Microbiol. 30:905- 910.

13. Foyouzi-Youssefi, R., S. Arnaudeau, C. Borner, W. L. Kelley, J. Tschopp, D. P. Lew, N. Demaurex, and K. H. Krause. 2000. Bcl-2 decreases the free Ca2+ concentration within the endoplasmic reticulum. Proc. Natl. Acad. Sci. U. S. A 97:5723-5728.

14. Frank, M. and R. Kemler. 2002. Protocadherins. Curr. Opin. Cell Biol. 14:557- 562.

15. Giordano, A. and M. L. Avantaggiati. 1999. p300 and CBP: partners for life and death. J. Cell Physiol 181:218-230.

16. Good, L., S. B. Maggirwar, E. W. Harhaj, and S. C. Sun. 1997. Constitutive dephosphorylation and activation of a member of the nuclear factor of activated T cells, NF-AT1, in Tax-expressing and type I human T-cell leukemia virus-infected human T cells. J. Biol. Chem. 272:1425-1428.

17. Good, L., S. B. Maggirwar, and S. C. Sun. 1996. Activation of the IL-2 gene promoter by HTLV-I tax involves induction of NF-AT complexes bound to the CD28-responsive element. EMBO Journal. 15:3744-3750.

18. Jayaraman, T., E. Ondriasova, K. Ondrias, D. J. Harnick, and A. R. Marks. 1995. The inositol 1,4,5-trisphosphate receptor is essential for T-cell receptor signaling. Proc. Natl. Acad. Sci. U. S. A %20;92:6007-6011.

19. Kotov, A., J. Zhou, P. Flicker, and C. Aiken. 1999. Association of Nef with the human immunodeficiency virus type 1 core. J Virol 73:8824-8830.

20. Lewis, R. S. 2001. Calcium signaling mechanisms in T lymphocytes. Annu. Rev. Immunol. 19:497-521.:497-521.

21. Linette, G. P., Y. Li, K. Roth, and S. J. Korsmeyer. 1996. Cross talk between cell death and cell cycle progression: BCL-2 regulates NFAT-mediated activation. Proc. Natl. Acad. Sci. U. S. A 93:9545-9552.

233 22. Manninen, A. and K. Saksela. 2002. HIV-1 Nef Interacts with Inositol Trisphosphate Receptor to Activate Calcium Signaling in T Cells. J. Exp. Med. 195:1023-1032.

23. May, C., S. Rivella, J. Callegari, G. Heller, K. M. Gaensler, L. Luzzatto, and M. Sadelain. 2000. Therapeutic haemoglobin synthesis in beta-thalassaemic mice expressing lentivirus-encoded human beta-globin. Nature 406:82-86.

24. May, C., S. Rivella, A. Chadburn, and M. Sadelain. 2002. Successful treatment of murine beta-thalassemia intermedia by transfer of the human beta-globin gene. Blood 99:1902-1908.

25. Miller, M. D., M. T. Warmerdam, K. A. Page, M. B. Feinberg, and W. C. Greene. 1995. Expression of the human immunodeficiency virus type 1 (HIV- 1) Nef gene during HIV-1 production increases progeny particle infectivity independently of gp160 or viral entry. J. Virol. 69:579-584.

26. Nicot, C., J. C. Mulloy, M. G. Ferrari, J. M. Johnson, K. Fu, R. Fukumoto, R. Trovato, J. Fullen, W. J. Leonard, and G. Franchini. 2001. HTLV-1 p12(I) protein enhances STAT5 activation and decreases the interleukin-2 requirement for proliferation of primary human peripheral blood mononuclear cells. Blood 98:823-829.

27. Pawliuk, R., K. A. Westerman, M. E. Fabry, E. Payen, R. Tighe, E. E. Bouhassira, S. A. Acharya, J. Ellis, I. M. London, C. J. Eaves, R. K. Humphries, Y. Beuzard, R. L. Nagel, and P. Leboulch. 2001. Correction of sickle cell disease in transgenic mouse models by gene therapy. Science 294:2368-2371.

28. Petrij, F., R. H. Giles, H. G. Dauwerse, J. J. Saris, R. C. Hennekam, M. Masuno, N. Tommerup, G. J. van Ommen, R. H. Goodman, and D. J. Peters. 1995. Rubinstein-Taybi syndrome caused by mutations in the transcriptional co- activator CBP [see comments]. Nature 376:348-351.

29. Pise-Masison, C. A., M. Radonovich, R. Mahieux, P. Chatterjee, C. Whiteford, J. Duvall, C. Guillerm, A. Gessain, and J. N. Brady. 2002. Transcription profile of cells infected with human T-cell leukemia virus type I compared with activated lymphocytes. Cancer Res. 62:3562-3571.

30. Rao, A., C. Luo, and P. G. Hogan. 1997. Transcription factors of the NFAT family: regulation and function. Annu. Rev. Immunol. 15:707-747.

234 31. Richard, E., M. Mendez, F. Mazurier, C. Morel, P. Costet, P. Xia, A. Fontanellas, F. Geronimi, M. Cario-Andre, L. Taine, C. Ged, P. Malik, H. de Verneuil, and F. Moreau-Gaudry. 2001. Gene therapy of a mouse model of protoporphyria with a self-inactivating erythroid-specific lentiviral vector without preselection. Mol. Ther. 4:331-338.

32. Rivera, I., E. W. Harhaj, and S. C. Sun. 1998. Involvement of NF-AT in type I human T-cell leukemia virus tax-mediated Fas ligand promoter transactivation. J Biol Chem 273:22382-22388.

33. Schwartz, O., V. Marechal, O. Danos, and J. M. Heard. 1995. Human immunodeficiency virus type 1 Nef increases the efficiency of reverse transcription in the infected cell. J. Virol. 69:4053-4059.

34. Siekevitz, M., M. Feinberg, N. J. Holbrook, F. Wong-Staal, and W. C. Greene. 1987. Activation of interleukin 2 and interleukin 2 receptor (Tac) promoter expression by the trans-activator () gene product of human T-cell leukemia virus type I. Proc. Natl. Acad. Sci. USA 84:5389.

35. Siekevitz, M., S. F. Josephs, M. Dukovich, N. Peffer, F. Wongstaal, and W. C. Greene. 1987. Activation of the HIV-1 LTR by T Cell Mitogens and the Trans- Activator Protein of HTLV-1. Science 238:1575-1578.

36. Srivastava, R. K., C. Y. Sasaki, J. M. Hardwick, and D. L. Longo. 1999. Bcl- 2-mediated drug resistance: inhibition of apoptosis by blocking nuclear factor of activated T lymphocytes (NFAT)-induced Fas ligand transcription. J Exp. Med. 190:253-265.

37. Valentin, H., I. Lemasson, S. Hamaia, H. Casse, S. Konig, C. Devaux, and L. Gazzolo. 1997. Transcriptional activation of the vascular cell adhesion molecule-1 gene in T lymphocytes expressing human T-Cell leukemia virus type 1 Tax protein. J. Virol. 71:8522-8530.

38. Van Parijs, L., Y. Refaeli, J. D. Lord, B. H. Nelson, A. K. Abbas, and D. Baltimore. 1999. Uncoupling IL-2 signals that regulate T cell proliferation, survival, and Fas-mediated activation-induced cell death. Immunity. 11:281-288.

39. Vigna, E., S. Cavalieri, L. Ailles, M. Geuna, R. Loew, H. Bujard, and L. Naldini. 2002. Robust and efficient regulation of transgene expression in vivo by improved tetracycline-dependent lentiviral vectors. Mol. Ther. 5:252-261.

40. Wano, Y., M. Feinberg, J. B. Hosking, H. Bogerd, and W. C. Greene. 1988. Stable expression of the tax gene of type I human T-cell leukemia virus in human T cells activates specific cellular genes involved in growth. Proc. Natl. Acad. Sci. 85:9733-9737.

235 41. Wheelock, M. J. and K. R. Johnson. 2003. Cadherins as modulators of cellular phenotype. Annu. Rev. Cell Dev. Biol. 19:207-235.

42. Wu, Y. and J. W. Marsh. 2001. Selective transcription and modulation of resting T cell activity by preintegrated HIV DNA. Science 293:1503-1506.

43. Zhang, W., J. W. Nisbet, B. Albrecht, W. Ding, F. Kashanchi, J. T. Bartoe, and M. D. Lairmore. 2001. Human T-lymphotropic virus type 1 p30(II) regulates gene transcription by binding CREB binding protein/p300. J. Virol. 75:9885-9895.

44. Zhang, W., J. W. Nisbet, J. T. Bartoe, W. Ding, and M. D. Lairmore. 2000. Human T-lymphotropic virus type 1 p30(II) functions as a transcription factor and differentially modulates CREB-responsive promoters. J. Virol. 74:11270-11277.

45. Zhou, J. and C. Aiken. 2001. Nef enhances human immunodeficiency virus type 1 infectivity resulting from intervirion fusion: evidence supporting a role for Nef at the virion envelope. J Virol 75:5851-5859.

236

BIBLIOGRAPHY

Adam, M. A., N. Ramesh, A. D. Miller, and W. R. Osborne. 1991. Internal initiation of translation in retroviral vectors carrying picornavirus 5' nontranslated regions. J Virol 65:4985-4990.

Adedayo, O., G. Grell, and P. Bellot. 2003. Hospital admissions for human T-cell lymphotropic virus type-1 (HTLV-1) associated diseases in Dominica. Postgrad. Med. J 79:341-344.

Ahmed, Y. F., G. M. Gilmartin, S. M. Hanly, J. R. Nevins, and W. C. Greene. 1991. The HTLV-1 Rex Response Element Mediates a Novel Form of mRNA Polyadenylation. Cell 64:727-737.

Aiken, C. and D. Trono. 1995. Nef stimulates human immunodeficiency virus type 1 proviral DNA synthesis. J. Virol. 69:5048-5056.

Akagi, T., H. Ono, and K. Shimotohno. 1995. Characterization of T cells immortalized by Tax1 of human T-cell leukemia virus type 1. Blood 86:4243-4249.

Alamy, A. H., F. B. Menezes, A. C. Leite, O. M. Nascimento, and A. Q. Araujo. 2001. Dysautonomia in human T-cell lymphotrophic virus type I-associated myelopathy/tropical spastic paraparesis. Ann. Neurol. 50:681-685.

Albrecht, B., N. D. Collins, M. T. Burniston, J. W. Nisbet, L. Ratner, P. L. Green, and M. D. Lairmore. 2000. Human T-lymphotropic virus type 1 open reading frame I p12(I) is required for efficient viral infectivity in primary lymphocytes. J. Virol. 74:9828-9835.

Albrecht, B., N. D. Collins, G. C. Newbound, L. Ratner, and M. D. Lairmore. 1998. Quantification of human T-cell lymphotropic virus type 1 proviral load by quantitative competitive polymerase chain reaction. J VIROL METH 75:123-140.

Albrecht, B., C. D. D'Souza, W. Ding, S. Tridandapani, K. M. Coggeshall, and M. D. Lairmore. 2002. Activation of nuclear factor of activated T cells by human T- lymphotropic virus type 1 accessory protein p12(I). J. Virol. 76:3493-3501.

237 Albrecht, B. and M. D. Lairmore. 2002. Critical role of human T-lymphotropic virus type 1 accessory proteins in viral replication and pathogenesis. Microbiol. Mol. Biol. Rev. 66:396-406.

Albritton, L. M., L. Tseng, D. Scadden, and J. M. Cunningham. 1989. A putative murine ecotropic retrovirus receptor gene encodes a multiple membrane-spanning protein and confers susceptibility to virus infection. Cell 57:659-666.

Anderson, D. W., J. S. Epstein, T. H. Lee, M. D. Lairmore, C. Saxinger, V. S. Kalyanaraman, D. Slamon, W. Parks, B. J. Poiesz, L. T. Pierik, and . 1989. Serological confirmation of human T-lymphotropic virus type I infection in healthy blood and plasma donors 5242. Blood 74:2585-2591.

Arai, T., M. Takada, M. Ui, and H. Iba. 1999. Dose-dependent transduction of vesicular stomatitis virus G protein-pseudotyped retrovirus vector into human solid tumor cell lines and murine fibroblasts. Virology 260:109-115.

Aramburu, J., A. Rao, and C. B. Klee. 2000. Calcineurin: from structure to function. Curr. Top. Cell Regul. 36:237-295.

Aramburu, J., M. B. Yaffe, C. Lopez-Rodriguez, L. C. Cantley, P. G. Hogan, and A. Rao. 1999. Affinity-driven peptide selection of an NFAT inhibitor more selective than cyclosporin A. Science 285:2129-2133.

Ashburner, M., C. A. Ball, J. A. Blake, D. Botstein, H. Butler, J. M. Cherry, A. P. Davis, K. Dolinski, S. S. Dwight, J. T. Eppig, M. A. Harris, D. P. Hill, L. Issel-Tarver, A. Kasarskis, S. Lewis, J. C. Matese, J. E. Richardson, M. Ringwald, G. M. Rubin, and G. Sherlock. 2000. Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat. Genet. 25:25-29.

Asher, D. M., J. Goudsmit, K. Pomeroy, R. M. Garruto, M. Bakker, S. Ono, N. Elliot, K. Harris, H. Askins, Z. Eldadah, A. L. Goldstein, and D. C. Gajdusek. 1988. Antibodies to HTLV-I in populations of the southWestern Pacific. J. Med. Virol. 26:339.

Avantaggiati, M. L., V. Ogryzko, K. Gardner, A. Giordano, A. S. Levine, and K. Kelly. 1997. Recruitment of p300/CBP in p53-dependent signal pathways. Cell 89:1175-1184.

Azimi, N., J. Mariner, S. Jacobson, and T. A. Waldmann. 2000. How does interleukin 15 contribute to the pathogenesis of HTLV type 1- associated Myelopathy/Tropical spastic paraparesis? AIDS Res. Hum. Retroviruses 16:1717-1722.

Ballard, D. W. 2001. Molecular mechanisms in lymphocyte activation and growth. Immunol. Res. 23:157-166.

238 Ballaun, C., G. K. Farrington, M. Dobrovnik, J. Rusche, J. Hauber, and E. Bohnlein. 1991. Functional Analysis of Human T-Cell Leukemia Virus Type 1 rex-Response Element: Direct RNA Binding of Rex Protein Correlates with In Vivo Activity. J. Virol. 65:4408-4413.

Bangham, C. R. 2000. HTLV-1 infections. J. Clin. Pathol. 53:581-586.

Bangham, C. R. 2000. The immune response to HTLV-I 5156. Curr. Opin. Immunol. 12:397-402.

Bangham, C. R. 2003. Human T-lymphotropic virus type 1 (HTLV-1): persistence and immune control. Int. J Hematol. 78:297-303.

Bangham, C. R. 2003. The immune control and cell-to-cell spread of human T- lymphotropic virus type 1. J Gen. Virol 84:3177-3189.

Barat, C. and M. J. Tremblay. 2002. Engagement of CD43 enhances human immunodeficiency virus type 1 transcriptional activity and virus production that is induced upon TCR/CD3 stimulation. J Biol. Chem. 277:28714-28724.

Barmak, K., E. Harhaj, C. Grant, T. Alefantis, and B. Wigdahl. 2003. Human T cell leukemia virus type I-induced disease: pathways to cancer and neurodegeneration. Virology 308:1-12.

Barrette, S. and D. Orlic. 2000. Alternative viral envelopes for oncoretroviruses to increase gene transfer into hematopoietic stem cells. Curr. Opin. Mol. Ther. 2:507-514.

Barshira, A., A. Panet, and A. Honigman. 1991. An RNA Secondary Structure Juxtaposes Two Remote Genetic Signals for Human T-Cell Leukemia Virus Type 1 RNA 3'-End Processing. J. Virol. 65:5165-5173.

Bartoe, J. T., B. Albrecht, N. D. Collins, M. D. Robek, L. Ratner, P. L. Green, and M. D. Lairmore. 2000. Functional role of pX open reading frame II of human T- lymphotropic virus type 1 in maintenance of viral loads in vivo. J. Virol. 74:1094-1100.

Berneman, Z. N., R. B. Gartenhaus, M. S. Reitz, W. A. Blattner, A. Manns, B. Hanchard, O. Ikehara, R. C. Gallo, and M. E. Klotman. 1992. Expression of alternatively spliced human T-lymphotropic virus type 1 pX mRNA in infected cell lines and in primary uncultured cells from patients with adult T-cell leukemia/lymphoma and healthy carriers. Proc. Natl. Acad. Sci. USA 89:3005-3009.

Berridge, M., P. Lipp, and M. Bootman. 1999. Calcium signalling. Curr. Biol. 9:R157- R159.

Berridge, M. J. 1993. Inositol trisphosphate and calcium signalling. Nature 361:315-325.

239 Berridge, M. J. 1997. Lymphocyte activation in health and disease. [Review] [155 refs]. Critical Reviews in Immunology 17:155-178.

Berridge, M. J., M. D. Bootman, and P. Lipp. 1998. Calcium--a life and death signal. Nature 395:645-648.

Berridge, M. J., P. Lipp, and M. D. Bootman. 2000. Signal transduction. The calcium entry pas de deux. Science 287:1604-1605.

Berridge, M. J., P. Lipp, and M. D. Bootman. 2000. The versatility and universality of calcium signalling. Nat. Rev. Mol. Cell Biol. 1:11-21.

Bex, F. and R. B. Gaynor. 1998. Regulation of gene expression by HTLV-I Tax protein. Methods 16:83-94.

Black, A. C., I. S. Y. Chen, S. Arrigo, C. T. Ruland, T. Allogiamento, E. Chin, and J. D. Rosenblatt. 1991. Regulation of HTLV-II gene expretion by rex involves positive and negative cis-Acting elements in the 5 long terminal repeat. Virology 181:433-444.

Black, A. C., C. Ruland, M. T. Yip, J. Luo, B. Tran, A. Kalssi, E. Quan, M. Aboud, I. S. Y. Chen, and J. D. Rosenblatt. 1991. Human T-Cell Leukemia Virus Type II Rex Binding and Activity Require an Intact splice Donor Site and a Specific RNA Secondary Structure. J. Virol. 65:6645-6653.

Blattner, W., V. Kalyanaraman, M. Robert-Guroff, T. Lister, D. Galton, P. S. Sarin, M. Crawford, D. Catovsky, M. Greaves, and R. C. Gallo. 1982. The human type-C retrovirus, HTLV, in blacks from the Caribbean region and relationchip to adult T-cell leukemia/lymphoma. Int. J. Cancer 30:257.

Blobel, G. A. 2000. CREB-binding protein and p300: molecular integrators of hematopoietic transcription. Blood 95:745-755.

Bogerd, H. P., A. Echarri, T. M. Ross, and B. R. Cullen. 1998. Inhibition of human immunodeficiency virus Rev and human T- cell leukemia virus Rex function, but not Mason-Pfizer monkey virus constitutive transport element activity, by a mutant human nucleoporin targeted to Crm1. J Virol 72:8627-8635.

Bootman, M. D., M. J. Berridge, and P. Lipp. 1997. Cooking with calcium: the recipes for composing global signals from elementary events. Cell 91:367-373.

Bootman, M. D., T. J. Collins, C. M. Peppiatt, L. S. Prothero, L. Mackenzie, P. de Smet, M. Travers, S. C. Tovey, J. T. Seo, M. J. Berridge, F. Ciccolini, and P. Lipp. 2001. Calcium signalling--an overview. Semin. Cell Dev. Biol. 12:3-10.

Borrow, J., V. P. Stanton, J. M. Andresen, R. Becher, F. G. Behm, R. S. K. Chaganti, C. I. Civin, C. Disteche, I. Dube, A. M. Frischauf, D. Horsman, F. Mitelman, S. Volinia, A.

240 E. Watmore, and D. E. Housman. 1996. The translocation t(8;l6)(pll p13) of acute myeloid leukaemia fuses a putative acetyltransferase to the CREB binding protein. Nat. Genet. 14:33-41.

Bosselut, R., J. F. Duvall, A. Gegonne, M. Bailly, A. Hemar, J. Brady, and J. Ghysdael. 1990. The product of the c-ets-1 proto-oncogene and the related Ets2 protein act as transcriptional activators of the long terminal repeat of human T cell leukemia virus HTLV-1. EMBO J. 9:3137-3144.

Bosselut, R., F. Lim, P. C. Romond, J. Frampton, J. Brady, and J. Ghysdael. 1992. Myb protein binds to multiple sites in the human T cell lymphotropic virus type 1 long terminal repeat and transactivates LTR-mediated expression Virology 186:764-769.

Bouchard, M. J., L. H. Wang, and R. J. Schneider. 2001. Calcium signaling by HBx protein in hepatitis B virus DNA replication. Science 294:2376-2378.

Bowles, N. E., R. C. Eisensmith, R. Mohuiddin, M. Pyron, and S. L. Woo. 1996. A simple and efficient method for the concentration and purification of recombinant retrovirus for increased hepatocyte transduction in vivo. Hum. Gene Ther. 7:1735-1742.

Brady, J. N., K. T. Jeang, J. Duvall, and G. Khoury. 1987. Identification of p40x- Responsive Regulatory Sequences within the Human T-Cell Leukemia Virus Type 1 Long Terminal Repeat. J. Virol. 61:2175-2181.

Bramson, J. L., F. L. Graham, and J. Gauldie. 1995. The use of adenoviral vectors for gene therapy and gene transfer in vivo. Curr. Opin. Biotechnol. 6:590-595.

Brauweiler, A., J. E. Garrus, J. C. Reed, and J. K. Nyborg. 1997. Repression of Bax gene expression by the HTLV-I tax protein: Implications for suppression of apoptosis in virally infected cells. Virology 231:135-140.

Breckenridge, D. G., M. Germain, J. P. Mathai, M. Nguyen, and G. C. Shore. 2003. Regulation of apoptosis by endoplasmic reticulum pathways. Oncogene 22:8608-8618.

Breyer, B., W. Jiang, H. Cheng, L. Zhou, R. Paul, T. Feng, and T. C. He. 2001. Adenoviral vector-mediated gene transfer for human gene therapy. Curr. Gene Ther. 1:149-162.

Budd, R. C. 2001. Activation-induced cell death. Curr. Opin. Immunol. 13:356-362.

Bukrinsky, M. I., N. Sharova, M. P. Dempsey, T. L. Stanwick, A. G. Bukrinskaya, S. Haggerty, and M. Stevenson. 1992. Active nuclear import of human immunodeficiency virus type 1 preintegration complexes. Proc. Natl. Acad. Sci U. S. A 89:6580-6584.

241 Bunnell, B. A., L. M. Muul, R. E. Donahue, R. M. Blaese, and R. A. Morgan. 1995. High-efficiency retroviral-mediated gene transfer into human and nonhuman primate peripheral blood lymphocytes. Proc. Natl. Acad. Sci U. S. A 92:7739-7743.

Cann, A. J., J. D. Rosenblatt, W. Wachsman, N. P. Shah, and I. S. Chen. 1985. Identification of the gene responsible for human T-cell leukaemia virus transcriptional regulation. Nature 318:571-574.

Cantrell, D. 1996. T cell antigen receptor signal transduction pathways. Annu. Rev. Immunol. 14:259-274.

Caplan, A. L. and J. M. Wilson. 2000. The ethical challenges of in utero gene therapy. Nat. Genet. 24:107.

Caplen, N. J., J. N. Higginbotham, J. R. Scheel, N. Vahanian, Y. Yoshida, H. Hamada, R. M. Blaese, and W. J. Ramsey. 1999. Adeno-retroviral chimeric viruses as in vivo transducing agents. Gene Ther. 6:454-459.

Castillo, L. C., F. Gracia, G. C. Roman, P. Levine, W. C. Reeves, and J. Kaplan. 2000. Spinocerebellar syndrome in patients infected with human T-lymphotropic virus types I and II (HTLV-I/HTLV-II): report of 3 cases from Panama. Acta Neurol. Scand. 101:405-412.

Cereseto, A., Z. Berneman, I. Koralnik, J. Vaughn, G. Franchini, and M. E. Klotman. 1997. Differential expression of alternatively spliced pX mRNAs in HTLV-I-infected cell lines. Leukemia 11:866-870.

Chan, H. M. and N. B. La Thangue. 2001. p300/CBP proteins: HATs for transcriptional bridges and scaffolds. J Cell Sci 114:2363-2373.

Chang, L. J. and J. He. 2001. Retroviral vectors for gene therapy of AIDS and cancer. Curr. Opin. Mol. Ther. 3:468-475.

Chen, B. F., L. H. Hwang, and D. S. Chen. 1993. Characterization of a bicistronic retroviral vector composed of the swine vesicular disease virus internal ribosome entry site. J Virol 67:2142-2148.

Chen, S., A. Agarwal, O. Y. Glushakova, M. S. Jorgensen, S. K. Salgar, A. Poirier, T. R. Flotte, B. P. Croker, K. M. Madsen, M. A. Atkinson, W. W. Hauswirth, K. I. Berns, and C. C. Tisher. 2003. Gene delivery in renal tubular epithelial cells using recombinant adeno-associated viral vectors. J Am Soc Nephrol. 14:947-958.

242 Chen, Y. M., S. H. Chen, C. Y. Fu, J. Y. Chen, and M. Osame. 1997. Antibody reactivities to tumor-suppressor protein p53 and HTLV-I Tof, Rex and Tax in HTLV-I- infected people with differing clinical status. International. Journal. of. Cancer 71:196- 202.

Chesler, D. A. and C. S. Reiss. 2002. The role of IFN-gamma in immune responses to viral infections of the central nervous system. Cytokine Growth Factor Rev. 13:441-454.

Cheung, S. T., T. Y. Tsui, W. L. Wang, Z. F. Yang, S. Y. Wong, Y. C. Ip, J. Luk, and S. T. Fan. 2002. Liver as an ideal target for gene therapy: expression of CTLA4Ig by retroviral gene transfer. J Gastroenterol. Hepatol. 17:1008-1014.

Chou, K. S., A. Okayama, N. Tachibana, T. H. Lee, and M. Essex. 1995. Nucleotide sequence analysis of a full-length human T-cell leukemia virus type I from adult T-cell leukemia cells: A prematurely terminated pX open reading frame II. Int. J. Cancer 60:701-706.

Chowers, M. Y., M. W. Pandori, C. A. Spina, D. D. Richman, and J. C. Guatelli. 1995. The growth advantage conferred by HIV-1 nef is determined at the level of viral DNA formation and is independent of CD4 downregulation. Virology 212:451-457.

Chuah, M. K., H. Brems, V. Vanslembrouck, D. Collen, and T. VandenDriessche. 1998. Bone marrow stromal cells as targets for gene therapy of hemophilia A. Hum. Gene Ther. 9:353-365.

Chuah, M. K., D. Collen, and T. VandenDriessche. 1998. Gene therapy for hemophilia: hopes and hurdles. Crit Rev. Oncol. Hematol. 28:153-171.

Ciminale, V., D. D'Agostino, L. Zotti, G. Franchini, B. K. Felber, and L. Chieco- Bianchi. 1995. Expression and characterization of proteins produced by mRNAs spliced into the X region of the human T-cell leukemia/lymphotropic virus type II. Virology 209:445-456.

Ciminale, V., D. M. D'Agostino, L. Zotti, and L. Chieco-Bianchi. 1996. Coding potential of the X region of human T-cell leukemia/lymphotropic virus type II. J. Acquir. Immune. Defic. Syndr. Hum. Retrovirol. 13 Suppl 1:S220-S227.

Ciminale, V., G. N. Pavlakis, D. Derse, C. P. Cunningham, and B. K. Felber. 1992. Complex splicing in the human T-cell leukemia virus (HTLV) family of retroviruses: Novel mRNAs and proteins produced by HTLV type I. J. Virol. 66:1737-1745.

Ciminale, V., L. Zotti, D. M. Dagostino, T. Ferro, L. Casareto, G. Franchini, P. Bernardi, and L. Chiecobianchi. 1999. Mitochondrial targeting of the p13(II) protein coded by the x-II ORF of human T-cell leukemia/lymphotropic virus type I (HTLV-I). Oncogene 18:4505-4514.

243 Clapham, D. E. 1995. Calcium siganling. Cell 80:259-268.

Clapp, D. W., L. L. Dumenco, M. Hatzoglou, and S. L. Gerson. 1991. Fetal liver hematopoietic stem cells as a target for in utero retroviral gene transfer. Blood 78:1132- 1139.

Clark, N. M., M. J. Smith, J. M. Hilfinger, and D. M. Markovitz. 1993. Activation of the human T-cell leukemia virus type I enhancer is mediated by binding sites for Elf-1 and the pets factor. J. Virol. 67:5522-5528.

Cleghorn, F. R., A. Manns, R. Falk, P. Hartge, B. Hanchard, N. Jack, E. Williams, E. Jaffe, F. White, C. Bartholomew, and W. Blattner. 1995. Effect of human T- lymphotropic virus type I infection on non- Hodgkin's lymphoma incidence. J. Nat. Cancer Inst. 87:1009-1014.

Coffin, J. M. 1992. Structure and Classification of Retroviruses. The Retroviridae. 1:19- 49.

Coffin, J. M. Retroviridae: The Viruses and Their Replication. 1767-1835. 1996. Phildaelphia, PA, Lippinocott-Raven Publishers. Ref Type: Generic

Coffin, J. M., S. H. Hughes, and H. Varmus. 2001. Retroviruses. CHSL Pr, Plainview, N.Y.

Colgin, M. A. and J. K. Nyborg. 1998. The human T-cell leukemia virus type 1 oncoprotein Tax inhibits the transcriptional activity of c-Myb through competition for the CREB binding protein. J. Virol. 72:9396-9399.

Collins, N. D., C. D'Souza, B. Albrecht, M. D. Robek, L. Ratner, W. Ding, P. L. Green, and M. D. Lairmore. 1999. Proliferation response to interleukin-2 and Jak/Stat activation of T cells immortalized by human T-cell lymphotropic virus type 1 is independent of open reading frame I expression. J. Virol. 73:9642-9649.

Collins, N. D., G. C. Newbound, B. Albrecht, J. L. Beard, L. Ratner, and M. D. Lairmore. 1998. Selective ablation of human T-cell lymphotropic virus type 1 p12I reduces viral infectivity in vivo. Blood 91:4701-4707.

Coscoy, L. and D. Ganem. 2003. PHD domains and E3 ubiquitin ligases: viruses make the connection. Trends Cell Biol. 13:7-12.

Courouce, A. M., J. Pillonel, J. M. Lemaire, and C. Saura. 1998. HTLV testing in blood transfusion. Vox Sang. 74 Suppl 2:165-169.

244 Cowan, E. P., R. K. Alexander, S. Daniel, F. Kashanchi, and J. N. Brady. 1997. Induction of tumor necrosis factor alpha in human neuronal cells by extracellular human T-cell lymphotropic virus type 1 Tax(1). J. Virol. 71:6982-6989.

Crabtree, G. R. 2001. Calcium, calcineurin, and the control of transcription. J. Biol. Chem. 276:2313-2316.

Craig, H. M., T. R. Reddy, N. L. Riggs, P. P. Dao, and J. C. Guatelli. 2000. Interactions of HIV-1 nef with the mu subunits of adaptor protein complexes 1, 2, and 3: role of the dileucine-based sorting motif. Virology 271:9-17.

Cullen, B. R. 1998. Retroviruses as model systems for the study of nuclear RNA export pathways. Virology 249:203-210.

D'Agostino, D. M., L. Ranzato, G. Arrigoni, I. Cavallari, F. Belleudi, M. R. Torrisi, M. Silic-Benussi, T. Ferro, V. Petronilli, O. Marin, L. Chieco-Bianchi, P. Bernardi, and V. Ciminale. 2002. Mitochondrial alterations induced by the p13II protein of human T-cell leukemia virus type 1. Critical role of arginine residues. J Biol. Chem. 277:34424- 34433.

D'Agostino, D. M., L. Zotti, T. Ferro, G. Franchini, L. Chieco-Bianchi, and V. Ciminale. 2000. The p13II protein of HTLV type 1: comparison with mitochondrial proteins coded by other human viruses. AIDS Res. Hum. Retroviruses 16:1765-1770.

D'Souza-Schorey, C., G. Li, M. I. Colombo, and P. D. Stahl. 1995. A regulatory role for ARF6 in receptor-mediated endocytosis. Science 267:1175-1178.

Daenke, S., S. Nightingale, J. K. Cruickshank, and C. R. M. Bangham. 1990. Sequence variants of human T-cell lymphotropic virus type I from patients with tropical spastic paraparesis and adult T-cell leukemia do not distinguish neurological from leukemic isolates. J. Virol. 64:1278-1282.

Daly, T. J., R. C. Doten, P. Rennert, M. Auer, H. Jaksche, A. Donner, G. Fisk, and J. R. Rusche. 1993. Biochemical characterization of binding of multiple HIV-1 Rev monomeric proteins to the Rev responsive element. Biochemistry 32:10497-10505.

Dando, J. S., F. Ficara, S. Deola, M. G. Roncarolo, C. Bordignon, and A. Aiuti. 2004. Efficient gene transfer into primitive hematopoietic progenitors using a bone marrow microenvironment cell line engineered to produce retroviral vectors. Haematologica 89:462-470.

Dantuma, N. P. and M. G. Masucci. 2003. The ubiquitin/proteasome system in Epstein- Barr virus latency and associated malignancies. Semin. Cancer Biol. 13:69-76.

245 Datta, S., N. H. Kothari, and H. Fan. 2000. In vivo genomic footprinting of the human T-cell leukemia virus type 1 (HTLV-1) long terminal repeat enhancer sequences in HTLV-1-infected human T-cell lines with different levels of Tax I activity. J. Virol. 74:8277-8285. de La, F. C., L. Deng, F. Santiago, L. Arce, L. Wang, and F. Kashanchi. 2000. Gene expression array of HTLV type 1-infected T cells: Up-regulation of transcription factors and cell cycle genes. AIDS Res. Hum. Retroviruses 16:1695-1700.

Dekaban, G. A., A. A. Peters, J. C. Mulloy, J. M. Johnson, R. Trovato, E. Rivadeneira, and G. Franchini. 2000. The HTLV-I orfI protein is recognized by serum antibodies from naturally infected humans and experimentally infected rabbits. Virology 274:86- 93.

Derse, D. 1987. Bovine leukemia virus transcription is controlled by a virus-encoded trans-acting factor and by cis-acting response elements. J Virol 61:2462-2471.

Derse, D., S. A. Hill, P. A. Lloyd, H. Chung, and B. A. Morse. 2001. Examining human t-lymphotropic virus type 1 infection and replication by cell-free infection with recombinant virus vectors. J. Virol. 75:8461-8468.

Derse, D., J. Mikovits, and F. Ruscetti. 1997. X-I and X-II open reading frames of HTLV-I are not required for virus replication or for immortalization of primary T-cells in vitro. Virology 237:123-128.

Ding, W., Albrecht B., R. E. Kelley, N. Muthusamy, S. Kim, R. A. Altschuld, and M. D. Lairmore. 2002. Human T lymphotropic virus type 1 p12(I) expression increases cytoplasmic calcium to enhance the activation of nuclear factor of activated T cells. J Virol 76:10374-10382.

Ding, W., B. Albrecht, R. Luo, W. Zhang, J. R. Stanley, G. C. Newbound, and M. D. Lairmore. 2001. Endoplasmic Reticulum and cis-Golgi Localization of Human T- Lymphotropic Virus Type 1 p12(I): Association with Calreticulin and Calnexin. J. Virol. 75:7672-7682.

Ding, W., S. J. Kim, A. M. Nair, B. Michael, K. Boris-Lawrie, A. Tripp, G. Feuer, and M. D. Lairmore. 2003. Human T-Cell Lymphotropic Virus Type 1 p12(I) Enhances Interleukin-2 Production during T-Cell Activation. J Virol 77:11027-11039.

Ding, W., S. J. Kim, A. M. Nair, B. Michael, K. Boris-Lawrie, A. Tripp, G. Feuer, and M. D. Lairmore. 2003. Human T-cell lymphotropic virus type 1 p12I enhances interleukin-2 production during T-cell activation. J Virol 77:11027-11039.

Dolmetsch, R. E., R. S. Lewis, C. C. Goodnow, and J. I. Healy. 1997. Differential activation of transcription factors induced by Ca2+ response amplitude and duration. Nature 386:855-858.

246 Dolmetsch, R. E., K. Xu, and R. S. Lewis. 1998. Calcium oscillations increase the efficiency and specificity of gene expression. Nature 392:933-936.

Donnadieu, E., G. Bismuth, and A. Trautmann. 1995. The intracellular Ca2+ concentration optimal for T cell activation is quite different after ionomycin or CD3 stimulation. Pflugers Arch. 429:546-554.

Douar, A. M., S. Adebakin, M. Themis, A. Pavirani, T. Cook, and C. Coutelle. 1997. Foetal gene delivery in mice by intra-amniotic administration of retroviral producer cells and adenovirus. Gene Ther. 4:883-890.

Douar, A. M., M. Themis, V. Sandig, T. Friedmann, and C. Coutelle. 1996. Effect of amniotic fluid on cationic lipid mediated transfection and retroviral infection. Gene Ther. 3:789-796.

Dull, T., R. Zufferey, M. Kelly, R. J. Mandel, M. Nguyen, D. Trono, and L. Naldini. 1998. A third-generation lentivirus vector with a conditional packaging system. J Virol 72:8463-8471.

Duyao, M. P., D. J. Kessler, D. B. Spicer, C. Bartholomew, J. L. Cleveland, M. Siekevitz, and G. E. Sonenshein. 1992. Transactivation of the c-myc Promoter by Human T Cell Leukemia virus Type 1 tax is Mediated by NFkB. J. Biol. Chem. 267:16288-16291.

Edlich, R. F., J. A. Arnette, and F. M. Williams. 2000. Global epidemic of human T-cell lymphotropic virus type-I (HTLV-I). J. Emerg. Med. 18:109-119.

Eglitis, M. A., R. D. Schneiderman, P. M. Rice, and M. V. Eiden. 1995. Evaluation of retroviral vectors based on the gibbon ape leukemia virus. Gene Ther. 2:486-492.

Emerman, M. and H. M. Temin. 1984. Genes with promoters in retrovirus vectors can be independently suppressed by an epigenetic mechanism. Cell 39:449-467.

Emerman, M. and H. M. Temin. 1986. Comparison of promoter suppression in avian and murine retrovirus vectors. Nucleic Acids Res. 14:9381-9396.

Evangelista, A., S. Maroushek, H. Minnigan, A. Larson, E. Retzel, A. Haase, D. Gonzalez-Dunia, D. McFarlin, E. Mingioli, S. Jacobson, and . 1990. Nucleotide sequence analysis of a provirus derived from an individual with tropical spastic paraparesis. Microb. Pathog. 8:259-278.

Fan, N., J. Gavalchin, B. Paul, K. H. Wells, M. J. Lane, and B. J. Poiesz. 1992. Infection of Peripheral Blood Mononuclear Cells and Cell Lines by Cell-Free Human T- Cell Lymphoma/Leukemia Virus Type 1. J. Clin. Microbiol. 30:905-910.

247 Fassati, A. and N. Bresolin. 2000. Retroviral vectors for gene therapy of Duchenne muscular dystrophy. Neurol. Sci 21:S925-S927.

Felber, B. K., H. Paskalis, and C. Kleinmanewing. 1985. The pX Protein of HTLV-1 is a Transcriptional Activator of its Long Terminal Repeats. Science 229:675-679.

Feng, P., J. Park, B. S. Lee, S. H. Lee, R. J. Bram, and J. U. Jung. 2002. Kaposi's sarcoma-associated herpesvirus mitochondrial K7 protein targets a cellular calcium- modulating cyclophilin ligand to modulate intracellular calcium concentration and inhibit apoptosis. J Virol 76:11491-11504.

Ferreira, O. C., V. Planelles, and J. D. Rosenblatt. 1997. Human T-cell leukemia viruses: Epidemiology, biology, and pathogenesis. Blood Rev. 11:91-104.

Feske, S., J. Giltnane, R. Dolmetsch, L. M. Staudt, and A. Rao. 2001. Gene regulation mediated by calcium signals in T lymphocytes. Nat. Immunol. 2:316-324.

Fink, D. J. and J. C. Glorioso. 1997. Herpes simplex virus-based vectors: problems and some solutions. Adv. Neurol. 72:149-156.

Foyouzi-Youssefi, R., S. Arnaudeau, C. Borner, W. L. Kelley, J. Tschopp, D. P. Lew, N. Demaurex, and K. H. Krause. 2000. Bcl-2 decreases the free Ca2+ concentration within the endoplasmic reticulum. Proc. Natl. Acad. Sci. U. S. A 97:5723-5728.

Franchini, G. 1995. Molecular mechanisms of human T-cell leukemia/lymphotropic virus type I infection. Blood 86:3619-3639.

Franchini, G., J. C. Mulloy, I. J. Koralnik, M. A. Lo, J. J. Sparkowski, T. Andresson, D. J. Goldstein, and R. Schlegel. 1993. The human T-cell leukemia/lymphotropic virus type I p12I protein cooperates with the E5 oncoprotein of bovine papillomavirus in cell transformation and binds the 16-kilodalton subunit of the vacuolar H+ ATPase. J Virol 67:7701-7704.

Franchini, G. and H. Streicher. 1995. Human T-cell leukaemia virus. Baillieres Clin. Haematol. 8:131-148.

Franchini, G., F. Wong-Staal, and R. C. Gallo. 1984. Human T-cell leukemia virus (HTLV-I) transcripts in fresh and cultured cells of patients with adult T-cell leukemia 5438. Proc. Natl. Acad. Sci. U. S. A 81:6207-6211.

Franchini, G., F. Wong-Staal, and R. C. Gallo. 1984. Molecular studies of human T-cell leukemia virus and adult T-cell leukemia. J Invest Dermatol. 83:63s-66s.

Frank, M. and R. Kemler. 2002. Protocadherins. Curr. Opin. Cell Biol. 14:557-562.

Freed, E. O. 1998. HIV-1 gag proteins: diverse functions in the virus life cycle. Virology 251:1-15. 248 Fu, S., D. Chen, X. Mao, N. Zhang, Y. Ding, and J. S. Bromberg. 2003. Feline immunodeficiency virus-mediated viral interleukin-10 gene transfer prolongs non- vascularized cardiac allograft survival. Am J Transplant. 3:552-561.

Fujii, M., P. Sassone-Corsi, and I. Verma. 1988. c-fos promotor trans-activation of cAMP on IL-2 stimulated gene expression. Proc. Natl. Acad. Sci. U. S. A.8526-8530.

Fujii, M., H. Tsuchiya, T. Chuhjo, T. Akizawa, and M. Seiki. 1992. Interaction of HTLV-1 Tax1 with p67SRF causes the aberrant induction of cellular immediate early genes through CArG boxes. Genes Dev. 6:2066-2076.

Fujii, M., H. Tsuchiya, X. B. Meng, and M. Seiki. 1995. c-Jun, c-Fos and their family members activate the transcription mediated by three 21-bp repetitive sequences in the HTLV-I long terminal repeat. Intervirology 38:221-228.

Fujisawa, J., M. Seiki, T. Kiyokawa, and M. Yoshida. 1985. Functional activation of the long terminal repeat of human T-cell leukemia virus type 1 by a trans-acting factor. Proc. Natl. Acad. Sci. USA 82:2277-2281.

Fukushima, T., T. Ikeda, E. Uyama, M. Uchino, H. Okabe, and M. Ando. 1994. Cognitive event-related potentials and brain magnetic resonance imaging in HTLV-1 associated myelopathy (HAM). J. Neurol. Sci. 126:30-39.

Furukawa, K., K. Furukawa, and H. Shiku. 1991. Alternatively spliced mRNA of the pX region of human T lymphotropic virus type I proviral genome. FEBS Lett. 295:141- 145.

Furukawa, Y., R. Kubota, N. Eiraku, M. Nakagawa, K. Usuku, S. Izumo, and M. Osame. 2003. Human T-cell lymphotropic virus type I (HTLV-I)-related clinical and laboratory findings for HTLV-I-infected blood donors. J Acquir. Immune. Defic. Syndr. 32:328- 334.

Galimi, F. and I. M. Verma. 2002. Opportunities for the use of lentiviral vectors in human gene therapy. Curr. Top. Microbiol Immunol. 261:245-254.

Ganem, D. 2001. Virology. The X files--one step closer to closure. Science 294:2299- 2300.

Garcia-Rodriguez, C. and A. Rao. 1998. Nuclear factor of activated T cells (NFAT)- dependent transactivation regulated by the coactivators p300/CREB-binding protein (CBP). J. Exp. Med. 187:2031-2036.

Gatza, M. L., J. C. Watt, and S. J. Marriott. 2003. Cellular transformation by the HTLV- I Tax protein, a jack-of-all-trades. Oncogene 22:5141-5149.

249 Gessain, A. 1996. Virological aspects of tropical spastic paraparesis/HTLV-I associated myelopathy and HTLV-I infection. J. Neurovirology. 2:299-306.

Gessain, A., F. Barin, J. Vernant, O. Gout, L. Maurs, A. Calender, and G. Dethe. 1985. Antibodies to human T lymphotropic virus type 1 in patients with tropical spastic paresis. Lancet 2:407-410.

Gessain, A. and R. Mahieux. 2000. [A virus called HTLV-1. Epidemiological aspects] Presse Med. 29:2233-2239.

Giordano, A. and M. L. Avantaggiati. 1999. p300 and CBP: partners for life and death. J. Cell Physiol 181:218-230.

Godoy, A. J., J. Kira, K. Hasuo, and I. Goto. 1995. Characterization of cerebral white matter lesions of HTLV- I- associated myelopathy tropical spastic paraparesis in comparison with multiple sclerosis and collagen-vasculitis: A semiquantitative MRI study. J. Neurol. Sci. 133:102-111.

Gomord, V., E. Wee, and L. Faye. 1999. Protein retention and localization in the endoplasmic reticulum and the golgi apparatus. Biochimie 81:607-618.

Good, L., S. B. Maggirwar, E. W. Harhaj, and S. C. Sun. 1997. Constitutive dephosphorylation and activation of a member of the nuclear factor of activated T cells, NF-AT1, in Tax-expressing and type I human T-cell leukemia virus-infected human T cells. J. Biol. Chem. 272:1425-1428.

Good, L., S. B. Maggirwar, and S. C. Sun. 1996. Activation of the IL-2 gene promoter by HTLV-I tax involves induction of NF-AT complexes bound to the CD28-responsive element. EMBO Journal. 15:3744-3750.

Goodman, R. H. and S. Smolik. 2000. CBP/p300 in cell growth, transformation, and development. Genes Dev. 14:1553-1577.

Gould, K. G. and C. R. Bangham. 1998. Virus variation, escape from cytotoxic T lymphocytes and human retroviral persistence. Semin Cell Dev Biol 9:321-328.

Grant, C., K. Barmak, T. Alefantis, J. Yao, S. Jacobson, and B. Wigdahl. 2002. Human T cell leukemia virus type I and neurologic disease: events in bone marrow, peripheral blood, and central nervous system during normal immune surveillance and neuroinflammation. J. Cell Physiol 190:133-159.

Green P.L. and Chen, B. K. Molecular features of the human T-cell leukemia virus: Mechanisms of transfromation and leukemogenicity. The Retroviridae. Vol. 3 (Levy J, ed.), 277-298. 1994. Plenum Publishing Corp. New York. Ref Type: Generic

250 Green P.L. and I. S. Y. Chen. 2000. Human T-cell leukemia virus types 1 and 2, p. 1941-1969. Lippincott, Williams & Wilkins.

Green, P. L. and I. S. Y. Chen. 1990. Regulation of human T cell leukemia virus expression. FASEB J. 4:169-175.

Green, P. L. and I. S. Y. Chen. 1994. Molecular features of the human T-cell leukemia virus. Mechanisms of transformation and leukemogenicity., p. 277-311. In J. A. Levy (ed.), The Retroviridae. Plenum Press, New York.

Hai, T. W., F. Liu, W. J. Coukos, and M. R. Green. 1989. Transcription factor ATF cDNA clones: an extensive family of leucine zipper proteins able to selectively form DNA-binding heterodimers. Genes Dev. 3:2083-2090.

Hajnoczky, G., G. Csordas, M. Madesh, and P. Pacher. 2000. The machinery of local Ca2+ signalling between sarco-endoplasmic reticulum and mitochondria. J Physiol 529 Pt 1:69-81.

Hakata, Y., T. Umemoto, S. Matsushita, and H. Shida. 1998. Involvement of human CRM1 (exportin 1) in the export and multimerization of the Rex protein of human T- cell leukemia virus type 1. J Virol 72:6602-6607.

Harhaj, E. W., L. F. Good, G. T. Xiao, and S. C. Sun. 1999. Gene expression profiles in HTLV-I-immortalized T cells: deregulated expression of genes involved in apoptosis regulation. Oncogene 18:1341-1349.

Harrod, R., Y. L. Kuo, Y. Tang, Y. Yao, A. Vassilev, Y. Nakatani, and C. Z. Giam. 2000. p300 and p300/cAMP-responsive element-binding protein associated factor interact with human T-cell lymphotropic virus type-1 Tax in a multi- histone acetyltransferase/activator-enhancer complex. J. Biol. Chem. 275:11852-11857.

Harrod, R., Y. Tang, C. Nicot, H. S. Lu, A. Vassilev, Y. Nakatani, and C. Z. Giam. 1998. An exposed KID-like domain in human T-cell lymphotropic virus type 1 Tax is responsible for the recruitment of coactivators CBP/p300. Mol. Cell Biol. 18:5052-5061.

Hattori, S., T. Kiyokawa, K. Imagawa, F. Shimizu, E. Hashimura, M. Seiki, and M. Yoshida. 1984. Identification of gag and env gene products of human T-cell leukemia virus (HTLV). Virology 136:338-347.

Hino, S. 1989. Milk-borne transmission of HTLV-I as a major route in the endemic cycle. Acta Paediatr. Jpn. 31:428-435.

Hino, S., K. Yamaguchi, S. Katamine, H. Sugiyama, T. Amagasaki, K. Kinoshita, Y. Yoshida, H. Doi, Y. Tsuji, and T. Miyamoto. 1985. Mother-to-child transmission of human T-cell leukemia virus type-I. Jpn. J. Cancer Res. 76:474-480.

251 Hinuma, Y., H. Komoda, T. Chosa, T. Kondo, M. Kohakura, T. Takenaka, M. Kikuchi, M. Ichimaru, K. Yunoki, I. Sato, R. Matsuo, Y. Takiuchi, H. Uchino, and M. Hanaoka. 1982. Antibodies to adult T-cell leukemia virus-associated antigen (ATLA) in sera from patients with ATL and controls in Japan: a nation-wide seroepidemiological study. Int. J. Cancer 29:631.

Hinuma, Y., K. Nagata, M. Hanaoka, M. Nakai, T. Matsumoto, K. Shirakawa, and I. Miyoshi. 1981. Adult T Cell Leukemia: Antigens in an ATL cell line and detection of antibodies to antigen in human sera. Proc. Natl. Acad. Sci. U. S. A. 78:6476-6480.

Holladay, S. D. and R. J. Smialowicz. 2000. Development of the murine and human immune system: differential effects of immunotoxicants depend on time of exposure. Environ. Health Perspect. 108 Suppl 3:463-473.

Hollsberg, P. 1999. Mechanisms of T-cell activation by human T-cell lymphotropic virus type I. Microbiol. Mol. Biol. Rev. 63:308-333.

Hollsberg, P., K. W. Wucherpfennig, L. J. Ausubel, V. Calvo, B. E. Bierer, and D. A. Hafler. 1992. Characterization of HTLV-1 In Vivo Infected T Cell Clones IL-2- independent Growth of Nontransformed T Cells. J. Immunol. 148:3256-3263.

Hottiger, M. O., L. K. Felzien, and G. J. Nabel. 1998. Modulation of cytokine-induced HIV gene expression by competitive binding of transcription factors to the coactivator p300. EMBO J. 17:3124-3134.

Hottiger, M. O. and G. J. Nabel. 2000. Viral replication and the coactivators p300 and CBP. Trends Microbiol. 8:560-565.

Hou, X., S. Foley, M. Cueto, and M. A. Robinson. 2000. The Human T-Cell Leukemia Virus Type I (HTLV-I) X Region Encoded Protein p13(II) Interacts with Cellular Proteins. Virology 277:127-135.

Ida, K., I. Kitabayashi, T. Taki, M. Taniwaki, K. Noro, M. Yamamoto, M. Ohki, and Y. Hayashi. 1997. Adenoviral E1A-associated protein p300 is involved in acute myeloid leukemia with t(11;22)(q23;q13). Blood 90:4699-4704.

Inoue, J., M. Seiki, and M. Yoshida. 1986. The second pX product p27 chi-III of HTLV-1 is required for gag gene expression. FEBS Lett. 209:187-190.

Inoue, J., M. Yoshida, and M. Seiki. 1987. Transcriptional (p40x) and post- transcriptional (p27x-III) regulators are required for the expression and replication of human t-cell leukemia virus type I genes. Proc. Natl. Acad. Sci. USA 84:3653-3657.

Inui, K., S. Okada, and G. Dickson. 1996. Gene therapy in Duchenne muscular dystrophy. Brain Dev. 18:357-361.

252 Jacobson, S. 2002. Immunopathogenesis of human T cell lymphotropic virus type I- associated neurologic disease. J Infect. Dis. 186 Suppl 2:S187-S192.

Janknecht, R. 2002. The versatile functions of the transcriptional coactivators p300 and CBP and their roles in disease. Histol. Histopathol. 17:657-668.

Janssens, W., M. K. Chuah, L. Naldini, A. Follenzi, D. Collen, J. M. Saint-Remy, and T. VandenDriessche. 2003. Efficiency of onco-retroviral and lentiviral gene transfer into primary mouse and human B-lymphocytes is pseudotype dependent. Hum. Gene Ther. 14:263-276.

Jayaraman, T., E. Ondriasova, K. Ondrias, D. J. Harnick, and A. R. Marks. 1995. The inositol 1,4,5-trisphosphate receptor is essential for T-cell receptor signaling. Proc. Natl. Acad. Sci. U. S. A %20;92:6007-6011.

Jeang, K. T., R. Chiu, E. Santos, and S. J. Kim. 1991. Induction of the HTLV-I LTR by Jun occurs through the Tax-responsive 21- bp elements. Virology 181:218-227.

Jeang, K. T., S. G. Widen, O. J. Semmes, and S. H. Wilson. 1990. HTLV-1 Trans- Activator Protein, Tax, Is a Trans-Repressor of the Human B-Ploymerase Gene. Science 247:1082-1083.

Jiang, H., H. Lu, R. L. Schiltz, C. A. Pise-Masison, V. V. Ogryzko, Y. Nakatani, and J. N. Brady. 1999. PCAF interacts with tax and stimulates tax transactivation in a histone acetyltransferase-independent manner [published erratum appears in Mol Cell Biol 2000 Mar;20(5):1897]. Mol. Cell Biol. 19:8136-8145.

Johnson, J. M. and G. Franchini. 2002. Retroviral proteins that target the major histocompatibility complex class I. Virus Res. 88:119-127.

Johnson, J. M., J. Fullen, L. Casareto, and J. C. Mulloy. 2000. p12(I) May Contribute TO HTLV-1 Escape from Immune Detection. Leukemia 14:558.

Johnson, J. M., J. C. Mulloy, V. Ciminale, J. Fullen, C. Nicot, and G. Franchini. 2000. The MHC class I heavy chain is a common target of the small proteins encoded by the 3' end of HTLV type 1 and HTLV type 2. AIDS Res. Hum. Retroviruses 16:1777-1781.

Johnson, J. M., C. Nicot, J. Fullen, V. Ciminale, L. Casareto, J. C. Mulloy, S. Jacobson, and G. Franchini. 2001. Free Major Histocompatibility Complex Class I Heavy Chain Is Preferentially Targeted for Degradation by Human T-Cell Leukemia/Lymphotropic Virus Type 1 p12(I) Protein. J. Virol. 75:6086-6094.

Kanamori, H., N. Suzuki, H. Siomi, T. Nosaka, A. Sato, H. Sabe, M. Hatanaka, and T. Honjo. 1990. HTLV-1 p27rex stabilizes human interleukin-2 receptor alpha chain mRNA. EMBO J. 9:4161-4166.

253 Kappes, J. C. and X. Wu. 2001. Safety considerations in vector development. Somat. Cell Mol. Genet. 26:147-158.

Kasahata, N., J. Shiota, Y. Miyazawa, I. Nakano, and S. Murayama. 2003. Acute human T-lymphotropic virus type 1-associated myelopathy: a clinicopathologic study. Arch. Neurol. 60:873-876.

Kashanchi, F., J. F. Duvall, R. P. Kwok, J. R. Lundblad, R. H. Goodman, and J. N. Brady. 1998. The coactivator CBP stimulates human T-cell lymphotrophic virus type I Tax transactivation in vitro. J. Biol. Chem. 273:34646-34652.

Kavanaugh, M. P., D. G. Miller, W. Zhang, W. Law, S. L. Kozak, D. Kabat, and A. D. Miller. 1994. Cell-surface receptors for gibbon ape leukemia virus and amphotropic murine retrovirus are inducible sodium-dependent phosphate symporters. Proc. Natl. Acad. Sci U. S. A 91:7071-7075.

Kawakami, K., A. Miyazato, Y. Iwakura, and A. Saito. 1999. Induction of lymphocytic inflammatory changes in lung interstitium by human T lymphotropic virus type I. AMER J RESPIR CRIT CARE MED 160:995-1000.

Kawano, F., K. Yamaguchi, H. Nishimura, H. Tsuda, and K. Takatsuki. 1985. Variation in the clinical courses of adult T-cell leukemia. Cancer 55:851-856.

Khabbaz, R. F., J. M. Douglas, F. N. Judson, R. A. Spiegel, M. E. St Louis, W. Whittington, T. M. Hartley, M. Lairmore, and J. E. Kaplan. 1990. Seroprevalence of human T-lymphotropic virus type I or II in sexually transmitted disease clinic patients in the USA. J. Infect. Dis. 162:241-244.

Khabbaz, R. F., I. M. Onorato, R. O. Cannon, T. M. Hartley, B. Roberts, B. Hosein, and J. E. Kaplan. 1992. Seroprevalence of HTLV-1 and HTLV-2 among intravenous drug users and persons in clinics for sexually transmitted diseases. N. Engl. J. Med. 326:375- 380.

Kim, J. H., P. A. Kaufman, S. M. Hanly, L. T. Rimsky, and W. C. Greene. 1991. Rex transregulation of human T-cell leukemia virus type II gene expression. J. Virol. 65:405-414.

Kim, S. J., W. Ding, B. Albrecht, P. L. Green, and M. D. Lairmore. 2003. A conserved calcineurin-binding motif in human T lymphotropic virus type 1 p12I functions to modulate nuclear factor of activated T cell activation. J Biol. Chem. 278:15550-15557.

Kimura, I., T. Tsubota, S. Tada, and J. Sogawa. 1986. Presence of antibodies against adult T cell leukemia antigen in the patients with chronic respiratory diseases 5241. Acta Med. Okayama 40:281-284.

254 Kimzey, A. L. and W. S. Dynan. 1998. Specific regions of contact between human T- cell leukemia virus type I Tax protein and DNA identified by photocross- linking. J Biol Chem 273:13768-13775.

Kimzey, A. L. and W. S. Dynan. 1999. Identification of a human T-cell leukemia virus type I tax peptide in contact with DNA. J Biol Chem 274:34226-34232.

Kinoshita, S., B. K. Chen, H. Kaneshima, and G. P. Nolan. 1998. Host control of HIV-1 parasitism in T cells by the nuclear factor of activated T cells. Cell 95:595-604.

Kinoshita, S., L. Su, M. Amano, L. A. Timmerman, H. Kaneshima, and G. P. Nolan. 1997. The T cell activation factor NF-ATc positively regulates HIV-1 replication and gene expression in T cells. Immunity. 6:235-244.

Kira, J., I. Goto, M. Otsuka, and Y. Ichiya. 1993. Chronic Progressive Spinocerebellar Syndrome Associated with Antibodies to Human T-Lymphotropic Virus Type-I - Clinico- Virological and Magnetic Resonance Imaging Studies. J. Neurol. Sci. 115:111- 116.

Kira, J. I., K. Fujihara, Y. Itoyama, I. Goto, and K. Hasuo. 1991. Leukoencephalopathy in HTLV-I-associated mylopathy/ tropical spastic paraparesis: MRI analysis and a two year follow up study after corticosteroid therapy. J. Neurol. Sci. 106:41-49.

Kitado, H., I. S. Chen, N. P. Shah, A. J. Cann, K. Shimotohno, and H. Fan. 1987. U3 sequences from HTLV-I and -II LTRs confer pX protein response to a murine leukemia virus LTR. Science 235:901-904.

Kitze, B. and K. Usuku. 2002. HTLV-1-mediated immunopathological CNS disease. Curr. Top. Microbiol. Immunol. 265:197-211.

Kiwaki, T., F. Umehara, Y. Arimura, S. Izumo, K. Arimura, K. Itoh, and M. Osame. 2003. The clinical and pathological features of peripheral neuropathy accompanied with HTLV-I associated myelopathy. J Neurol. Sci. 206:17-21.

Kiyokawa, T., M. Seiki, S. Iwashita, K. Imagawa, F. Shimizu, and M. Yoshida. 1985. p27x-III and p21x-III, proteins encoded by the pX sequence of human T-cell leukemia virus type 1. Proc. Natl. Acad. Sci. USA 82:8359-8363.

Kohno, T., R. Moriuchi, S. Katamine, Y. Yamada, M. Tomonaga, and T. Matsuyama. 2000. Identification of genes associated with the progression of adult T cell leukemia (ATL). Jpn. J Cancer Res. 91:1103-1110.

Kohno, T., R. Moriuchi, S. Katamine, Y. Yamada, M. Tomonaga, and T. Matsuyama. 2000. Identification of genes associated with the progression of adult T cell leukemia (ATL). Jpn. J Cancer Res. 91:1103-1110.

255 Kootstra, N. A. and I. M. Verma. 2003. Gene therapy with viral vectors. Annu. Rev. Pharmacol. Toxicol. 43:413-439.

Koralnik, I. J., J. Fullen, and G. Franchini. 1993. The p12I, p13II, and p30II proteins encoded by human T-cell leukemia/lymphotropic virus type I open reading frames I and II are localized in three different cellular compartments. J Virol 67:2360-2366.

Koralnik, I. J., A. Gessain, M. E. Klotman, A. Lo Monico, Z. N. Berneman, and G. Franchini. 1992. Protein isoforms encoded by the pX region of human T-cell leukemia/lymphotropic virus type 1. Proc. Natl. Acad. Sci. USA 89:8813-8817.

Koralnik, I. J., A. Gessain, M. E. Klotman, M. A. Lo, Z. N. Berneman, and G. Franchini. 1992. Protein isoforms encoded by the pX region of human T-cell leukemia/lymphotropic virus type I. Proc. Natl. Acad. Sci U. S. A 89:8813-8817.

Koralnik, I. J., J. C. Mulloy, T. Andresson, J. Fullen, and G. Franchini. 1995. Mapping of the intermolecular association of human T cell leukaemia/lymphotropic virus type I p12I and the vacuolar H+-ATPase 16 kDa subunit protein. J Gen. Virol 76 ( Pt 8):1909- 1916.

Korber, B., A. Okayama, R. Donnelly, N. Tachibana, and M. Essex. 1991. Polymerase chain reaction analysis of defective human T-cell leukemia virus type 1 proviral genomes in leukemic cells of patients with adult T-cell leukemia. J. Virol. 65:5471- 5476.

Kotov, A., J. Zhou, P. Flicker, and C. Aiken. 1999. Association of Nef with the human immunodeficiency virus type 1 core. J Virol 73:8824-8830.

Kubota, R., S. S. Soldan, R. Martin, and S. Jacobson. 2002. Selected cytotoxic T lymphocytes with high specificity for HTLV-I in cerebrospinal fluid from a HAM/TSP patient. J. Neurovirol. 8:53-57.

Kurata, H., H. J. Lee, A. O'Garra, and N. Arai. 1999. Ectopic expression of activated Stat6 induces the expression of Th2-specific cytokines and transcription factors in developing Th1 cells. Immunity. 11:677-688.

Kuroda, Y. and M. Matsui. 1993. Cerebrospinal Fluid Interferon-Gamma Is Increased in HTLV- I- Associated Myelopathy. J. Neuroimmunol. 42:223-226.

Kurre, P., H. P. Kiem, J. Morris, S. Heyward, J. L. Battini, and A. D. Miller. 1999. Efficient transduction by an amphotropic retrovirus vector is dependent on high-level expression of the cell surface virus receptor. J Virol 73:495-500.

Lagrenade, L., B. Hanchard, V. Fletcher, B. Cranston, and W. Blattner. 1990. Infective dermatitis of Jamaican children: a marker for HTLV-I infection. Lancet 336:1345-1347.

256 Lairmore, M. D., B. Albrecht, C. D'Souza, J. W. Nisbet, W. Ding, J. T. Bartoe, P. L. Green, and W. Zhang. 2000. In vitro and in vivo functional analysis of human T cell lymphotropic virus type 1 pX open reading frames I and II. AIDS Res. Hum. Retroviruses 16:1757-1764.

Lairmore, M. D. and R. Lal. 1995. Other Human Retrovirus Infections: HTLV-I and HTLV-II, p. 168-188. In G. Schocketman and J. R. George (eds.), AIDS Testing. Methodology and Management Issues. Springer-Verlag, New York.

Larson, J. E., S. L. Morrow, J. B. Delcarpio, R. P. Bohm, M. S. Ratterree, J. L. Blanchard, and J. C. Cohen. 2000. Gene transfer into the fetal primate: evidence for the secretion of transgene product. Mol. Ther. 2:631-639.

Larson, J. E., S. L. Morrow, L. Happel, J. F. Sharp, and J. C. Cohen. 1997. Reversal of cystic fibrosis phenotype in mice by gene therapy in utero. Lancet 349:619-620.

Le, B., I, A. R. Rosenberg, and M. C. Dokhelar. 1999. Multiple functions for the basic amino acids of the human T-cell leukemia virus type 1 matrix protein in viral transmission. J Virol 73:1860-1867.

Lechardeur, D. and G. L. Lukacs. 2002. Intracellular barriers to non-viral gene transfer. Curr. Gene Ther. 2:183-194.

Lefebvre, L., V. Ciminale, A. Vanderplasschen, D. D'Agostino, A. Burny, L. Willems, and R. Kettmann. 2002. Subcellular localization of the bovine leukemia virus R3 and G4 accessory proteins. J Virol 76:7843-7854.

Lefebvre, L., A. Vanderplasschen, V. Ciminale, H. Heremans, O. Dangoisse, J. C. Jauniaux, J. F. Toussaint, V. Zelnik, A. Burny, R. Kettmann, and L. Willems. 2002. Oncoviral Bovine Leukemia Virus G4 and Human T-Cell Leukemia Virus Type 1 p13(II) Accessory Proteins Interact with Farnesyl Pyrophosphate Synthetase. J. Virol. 76:1400-1414.

Lemasson, I., N. J. Polakowski, P. J. Laybourn, and J. K. Nyborg. 2002. Transcription factor binding and histone modifications on the integrated proviral promoter in human T-cell leukemia virus-I-infected T-cells. J Biol. Chem. 277:49459-49465.

Lemasson, I., V. Roberthebmann, S. Hamaia, M. D. Dodon, L. Gazzolo, and C. Devaux. 1997. Transrepression of lck gene expression by human T-cell leukemia virus type 1- encoded p40(tax). J. Virol. 71:1975-1983.

Lenzmeier, B. A., E. E. Baird, P. B. Dervan, and J. K. Nyborg. 1999. The Tax protein- DNA interaction is essential for HTLV-I transactivation in vitro. J Mol Biol 291:731- 744.

257 Leonmonzon, M., I. Illa, and M. C. Dalakas. 1994. Polymyositis in patients infected with human T-cell leukemia virus type I: The role of the virus in the cause of the disease. Ann. Neurol. 36:643-649.

Levin, M. C., S. M. Lee, F. Kalume, Y. Morcos, F. C. Dohan, Jr., K. A. Hasty, J. C. Callaway, J. Zunt, D. Desiderio, and J. M. Stuart. 2002. Autoimmunity due to molecular mimicry as a cause of neurological disease. Nat. Med. 8:509-513.

Levin, M. C., S. M. Lee, Y. Morcos, J. Brady, and J. Stuart. 2002. Cross-reactivity between immunodominant human T lymphotropic virus type I tax and neurons: implications for molecular mimicry. J Infect. Dis. 186:1514-1517.

Levin, M. C., T. J. Lehky, A. N. Flerlage, D. Katz, D. W. Kingma, E. S. Jaffe, J. D. Heiss, N. Patronas, H. F. Mcfarland, and S. Jacobson. 1997. Immunologic analysis of a spinal cord-biopsy specimen from a patient with human T-cell lymphotropic virus type I-associated neurologic disease. N. Engl. J Med. 336:839-845.

Lewis, R. S. 2001. Calcium signaling mechanisms in T lymphocytes. Annu. Rev. Immunol. 19:497-521.:497-521.

Li, C. and W. H. Wong. 2001. Model-based analysis of oligonucleotide arrays: expression index computation and outlier detection. Proc. Natl. Acad. Sci U. S. A 98:31-36.

Li, C. C., F. W. Ruscetti, N. R. Rice, E. Chen, N. S. Yang, J. Mikovits, and D. L. Longo. 1993. Differential expression of Rel family members in human T-cell leukemia virus type I-infected cells: transcriptional activation of c-rel by Tax protein. J. Virol. 67:4205- 4213.

Li, H. C., T. Fujiyoshi, H. Lou, S. Yashiki, S. Sonoda, L. Cartier, L. Nunez, I. Munoz, S. Horai, and K. Tajima. 1999. The presence of ancient human T-cell lymphotropic virus type I provirus DNA in an Andean mummy. NATURE MED 5:1428-1432.

Li, M., B. Damania, X. Alvarez, V. Ogryzko, K. Ozato, and J. U. Jung. 2000. Inhibition of p300 histone acetyltransferase by viral interferon regulatory factor. Mol. Cell Biol. 20:8254-8263.

Li, W., J. Llopis, M. Whitney, G. Zlokarnik, and R. Y. Tsien. 1998. Cell-permeant caged InsP3 ester shows that Ca2+ spike frequency can optimize gene expression. Nature 392:936-941.

Li-Weber, M., M. Giaisi, K. Chlichlia, K. Khazaie, and P. H. Krammer. 2001. Human T cell leukemia virus type I Tax enhances IL-4 gene expression in T cells. Eur. J Immunol. 31:2623-2632.

258 Liang, M. H., T. Geisbert, Y. Yao, S. H. Hinrichs, and C. Z. Giam. 2002. Human T- lymphotropic virus type 1 oncoprotein tax promotes S-phase entry but blocks mitosis. J Virol 76:4022-4033.

Lindholm, P. F., R. L. Reid, and J. N. Brady. 1992. Extracellular Tax Protein Stimulates Tumor Necrosis Factor-B and Immunoglobulin Kappa Light Chain Expression in Lymphoid Cells. J. Virol. 66:1294-1302.

Linette, G. P., Y. Li, K. Roth, and S. J. Korsmeyer. 1996. Cross talk between cell death and cell cycle progression: BCL-2 regulates NFAT-mediated activation. Proc. Natl. Acad. Sci. U. S. A 93:9545-9552.

Lipshutz, G. S., L. Flebbe-Rehwaldt, and K. M. Gaensler. 1999. Adenovirus-mediated gene transfer to the peritoneum and hepatic parenchyma of fetal mice in utero. Surgery 126:171-177.

Liu, C. and T. E. Hermann. 1978. Characterization of ionomycin as a calcium ionophore. J Biol. Chem. 253:5892-5894.

Lois, C., Y. Refaeli, X. F. Qin, and L. Van Parijs. 2001. Retroviruses as tools to study the immune system. Curr. Opin. Immunol. 13:496-504.

Lombard Platet, G. and P. Jalinot. 1993. Purification by DNA affinity precipitation of the cellular factors HEB1-p67 and HEB1-p94 which bind specifically to the human T- cell leukemia virus type-I 21 bp enhancer. Nucleic. Acids. Res. 21:3935-3942.

Lu, X., H. Yu, S. H. Liu, F. M. Brodsky, and B. M. Peterlin. 1998. Interactions between HIV1 Nef and vacuolar ATPase facilitate the internalization of CD4. Immunity. 8:647- 656.

Lundblad, J. R., R. P. Kwok, M. E. Laurance, M. S. Huang, J. P. Richards, R. G. Brennan, and R. H. Goodman. 1998. The human T-cell leukemia virus-1 transcriptional activator Tax enhances cAMP-responsive element-binding protein (CREB) binding activity through interactions with the DNA minor groove. J Biol Chem 273:19251- 19259.

MacKenzie, T. C., G. P. Kobinger, N. A. Kootstra, A. Radu, M. Sena-Esteves, S. Bouchard, J. M. Wilson, I. M. Verma, and A. W. Flake. 2002. Efficient transduction of liver and muscle after in utero injection of lentiviral vectors with different pseudotypes. Mol. Ther. 6:349-358.

Madore, S. J., L. S. Tiley, M. H. Malim, and B. R. Cullen. 1994. Sequence requirements for Rev multimerization in vivo. Virology 202:186-194.

259

Mahieux, R., F. Ibrahim, P. Mauclere, V. Herve, P. Michel, F. Tekaia, C. Chappey, B. Garin, E. Vanderryst, B. Guillemain, E. Ledru, E. Delaporte, G. Dethe, and A. Gessain. 1997. Molecular epidemiology of 58 new African human T-cell leukemia virus type 1 (HTLV-1) strains: Identification of a new and distinct HTLV-1 molecular subtype in central Africa and in pygmies. J. Virol. 71:1317-1333.

Manel, N., F. J. Kim, S. Kinet, N. Taylor, M. Sitbon, and J. L. Battini. 2003. The ubiquitous glucose transporter GLUT-1 is a receptor for HTLV. Cell 115:449-459.

Manninen, A., P. Huotari, M. Hiipakka, G. H. Renkema, and K. Saksela. 2001. Activation of NFAT-dependent gene expression by Nef: conservation among divergent Nef alleles, dependence on SH3 binding and membrane association, and cooperation with protein kinase C-theta. J. Virol. 75:3034-3037.

Manninen, A. and K. Saksela. 2002. HIV-1 Nef Interacts with Inositol Trisphosphate Receptor to Activate Calcium Signaling in T Cells. J. Exp. Med. 195:1023-1032.

Manninen, A. and K. Saksela. 2002. HIV-1 Nef interacts with inositol trisphosphate receptor to activate calcium signaling in T cells. J Exp. Med. 195:1023-1032.

Manns, A., R. J. Wilks, E. L. Murphy, G. Haynes, J. P. Figueroa, M. Barnett, B. Hanchard, and W. A. Blattner. 1992. A prospective study of transmission by transfusion of HTLV-I and risk factors associated with seroconversion. Int. J. Cancer 51:886-891.

Marriott, S. J., P. F. Lindholm, K. M. Brown, S. D. Gitlin, J. F. Duvall, M. F. Radonovich, and J. N. Brady. 1990. A 36-kilodalton cellular transcription factor mediates an indirect interaction of human T-cell leukemia/lymphoma virus type 1 Tax1 with a responsive element in the viral long terminal repeat. Mol. Cell Biol. 10:4192- 4201.

Martins, M. L., B. C. Soares, J. G. Ribas, G. W. Thorun, J. Johnson, E. G. Kroon, A. B. Carneiro-Prioetti, and C. A. Bonjardim. 2002. Frequency of p12K and p12R Alleles of HTLV Type 1 in HAM/TSP Patients and in Asymptomatic HTLV Type 1 Carriers. AIDS Res. Hum. Retroviruses 18:899-902.

Maruyama, M., H. Shibuya, H. Harada, M. Hatakeyama, M. Seiki, T. Fujita, J. Inoue, M. Yoshida, and T. Taniguchi. 1987. Evidence for aberrant activation of the interleukin-2 autocrine loop by HTLV-1-encoded p40x and T3/Ti complex triggering 5267. Cell 48:343-350.

Matsui, M., F. Nagumo, J. Tadano, and Y. Kuroda. 1995. Characterization of humoral and cellular immunity in the central nervous system of HAM/TSP. J. Neurol. Sci. 130:183-189.

260 May, C., S. Rivella, J. Callegari, G. Heller, K. M. Gaensler, L. Luzzatto, and M. Sadelain. 2000. Therapeutic haemoglobin synthesis in beta-thalassaemic mice expressing lentivirus-encoded human beta-globin. Nature 406:82-86.

May, C., S. Rivella, A. Chadburn, and M. Sadelain. 2002. Successful treatment of murine beta-thalassemia intermedia by transfer of the human beta-globin gene. Blood 99:1902-1908.

Mazarakis, N. D., M. Azzouz, J. B. Rohll, F. M. Ellard, F. J. Wilkes, A. L. Olsen, E. E. Carter, R. D. Barber, D. F. Baban, S. M. Kingsman, A. J. Kingsman, K. O'Malley, and K. A. Mitrophanous. 2001. Rabies virus glycoprotein pseudotyping of lentiviral vectors enables retrograde axonal transport and access to the nervous system after peripheral delivery. Hum. Mol. Genet. 10:2109-2121.

Merino, F., M. Robert-Guroff, J. Clark, M. Biondo-Bracho, W. Blattner, and R. C. Gallo. 1984. Natural antibodies to human T-cell leukemia/lymphoma virus in healthy Venezuelan populations. Int. J. Cancer 34:501.

Miller, A. D. and F. Chen. 1996. Retrovirus packaging cells based on 10A1 murine leukemia virus for production of vectors that use multiple receptors for cell entry. J Virol 70:5564-5571.

Miller, D. G. and A. D. Miller. 1994. A family of retroviruses that utilize related phosphate transporters for cell entry. J Virol 68:8270-8276.

Miller, M. D., M. T. Warmerdam, K. A. Page, M. B. Feinberg, and W. C. Greene. 1995. Expression of the human immunodeficiency virus type 1 (HIV- 1) Nef gene during HIV-1 production increases progeny particle infectivity independently of gp160 or viral entry. J. Virol. 69:579-584.

Mitchell, M., M. Jerebtsova, M. L. Batshaw, K. Newman, and X. Ye. 2000. Long-term gene transfer to mouse fetuses with recombinant adenovirus and adeno-associated virus (AAV) vectors. Gene Ther. 7:1986-1992.

Mitsui, K., A. Matsumoto, S. Ohtsuka, M. Ohtsubo, and A. Yoshimura. 1999. Cloning and characterization of a novel p21(Cip1/Waf1)-interacting zinc finger protein, ciz1. Biochem. Biophys. Res. Commun. 264:457-464.

Miyatake, S., M. Seiki, R. D. Malefijt, T. Heike, J. Fujisawa, Y. Takebe, J. Nishida, J. Shlomai, T. Yokota, M. Yoshida, and . 1988. Activation of T cell-derived lymphokine genes in T cells and fibroblasts: effects of human T cell leukemia virus type I p40x protein and bovine papilloma virus encoded E2 protein 5266. Nucleic Acids Res. 16:6547-6566.

261 Miyoshi, I., I. Kubonishi, M. Sumida, S. Hiraki, T. Tsubota, I. Kimura, K. Miyamoto, and J. Sato. 1980. A novel T-cell line derived from adult T-cell leukemia. Gann 71:155- 156.

Miyoshi, I., I. Kubonishi, S. Yoshimoto, and Y. Shiraishi. 1981. A T-cell line derived from normal human cord leukocytes by co-culturing with human leukemic T-cells. Gann 72:978-981.

Miyoshi, I., S. Yoshimoto, I. Kubonishi, H. Taguchi, Y. Shiraishi, Y. Ohtsuki, and T. Akagi. 1981. Transformation of normal human cord lymphocytes by co-cultivation with a lethally irradiated human T-cell line carrying type C virus particles. Gann 72:997-998.

Mochizuki, M., T. Watanabe, K. Yamaguchi, K. Takatsuki, K. Yoshimura, M. Shirao, S. Nakashima, S. Mori, S. Araki, and N. Miyata. 1992. HTLV-I Uveitis: A distinct clinical entity caused by HTLV-I. Jpn. J. Cancer Res. 83:236-239.

Moisset, P. A. and J. P. Tremblay. 2001. Gene therapy: a strategy for the treatment of inherited muscle diseases? Curr. Opin. Pharmacol. 1:294-299.

Mori, N., N. Mukaida, D. W. Ballard, K. Matsushima, and N. Yamamoto. 1998. Human T-cell leukemia virus type I Tax transactivates human interleukin 8 gene through acting concurrently on AP- 1 and nuclear factor-kappa B-like sites. Cancer Res 58:3993-4000.

Mori, N. and D. Prager. 1996. Transactivation of the interleukin-1 alpha promoter by human T- cell leukemia virus type I and type II tax proteins. Blood 87:3410-3417.

Moro, H., K. Iwai, N. Mori, M. Watanabe, M. Fukushi, M. Oie, M. Arai, Y. Tanaka, T. Miyawaki, F. Gejyo, M. Arakawa, and M. Fujii. 2001. Interleukin-2-dependent but not independent T-cell lines infected with human T-cell leukemia virus type 1 selectively express CD45RO, a marker for persistent infection in vivo. Virus Genes 23:263-271.

Mortreux, F., A. S. Gabet, and E. Wattel. 2003. Molecular and cellular aspects of HTLV-1 associated leukemogenesis in vivo. Leukemia 17:26-38.

Muchardt, C., J. S. Seeler, A. Nirula, S. Gong, and R. Gaynor. 1992. Transcription factor AP-2 activates gene expression of HTLV-I. EMBO Journal. 11:2573-2581.

Mueller, N., A. Okayama, S. Stuver, and N. Tachibana. 1996. Findings from the Miyazaki Cohort Study. J Acquir. Immune. Defic. Syndr. Hum. Retrovirol. 13 Suppl 1:S2-S7.

Mulloy, J. C., R. W. Crownley, J. Fullen, W. J. Leonard, and G. Franchini. 1996. The human T-cell leukemia/lymphotropic virus type 1 p12I proteins bind the interleukin-2 receptor beta and gammac chains and affects their expression on the cell surface. J Virol 70:3599-3605.

262 Muraoka, O., T. Kaisho, M. Tanabe, and T. Hirano. 1993. Transcriptional activation of the interleukin-6 gene by HTLV-1. Immunology Letters. 37(2-3):159-165.

Murata, K., M. Fujita, T. Honda, Y. Yamada, M. Tomonaga, and H. Shiku. 1996. Rat primary T cells expressing HTLV-I tax gene transduced by a retroviral vector: in vitro and in vivo characterization. Int. J Cancer 68:102-108.

Murphy, D. 2002. Gene expression studies using microarrays: principles, problems, and prospects. Adv. Physiol Educ. 26:256-270.

Murphy, E. L., M. P. Busch, M. Tong, P. Cornett, and G. N. Vyas. 1998. A prospective study of the risk of transfusion-acquired viral infections. Transfus. Med. 8:173-178.

Murphy, E. L., J. P. Figueroa, W. N. Gibbs, A. Brathwaite, M. Holding-Cobham, D. Waters, B. Cranston, B. Hanchard, and W. A. Blattner. 1989. Sexual transmission of human Y-lymphotropic virus type I (HTLV-I). Ann. Intern. Med. 111:555-560.

Murphy, E. L., S. A. Glynn, J. Fridey, J. W. Smith, R. A. Sacher, C. C. Nass, H. E. Ownby, D. J. Wright, and G. J. Nemo. 1999. Increased incidence of infectious diseases during prospective follow-up of human T-lymphotropic virus type II- and I-infected blood donors. ARCH INTERN MED 159:1485-1491.

Nagai, M. and M. Osame. 2003. Human T-cell lymphotropic virus type I and neurological diseases. J Neurovirol. 9:228-235.

Nagai, M., K. Usuku, W. Matsumoto, D. Kodama, N. Takenouchi, T. Moritoyo, S. Hashiguchi, M. Ichinose, C. R. Bangham, S. Izumo, and M. Osame. 1998. Analysis of HTLV-I proviral load in 202 HAM/TSP patients and 243 asymptomatic HTLV-I carriers: high proviral load strongly predisposes to HAM/TSP. J Neurovirol. 4:586-593.

Nakanishi, K., A. Moran, T. Hays, Y. Kuang, E. Fox, D. Garneau, R. M. de Oca, M. Grompe, and A. D. D'Andrea. 2001. Functional analysis of patient-derived mutations in the Fanconi anemia gene, FANCG/XRCC9. Exp. Hematol. 29:842-849.

Naldini, L., U. Blomer, P. Gallay, D. Ory, R. Mulligan, F. H. Gage, I. M. Verma, and D. Trono. 1996. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272:263-267.

Nam, S. H., T. D. Copeland, M. Hatanaka, and S. Oroszlan. 1993. Characterization of ribosomal frameshifting for expression of pol gene products of human T-cell leukemia virus type I. J. Virol. 67:196-203.

Nam, S. H., M. Kidokoro, H. Shida, and M. Hatanaka. 1988. Processing of gag Precursor Polyprotein of Human T-Cell Leukemia Virus Type 1 by Virus-Encoded Protease. J. Virol. 62:3718-3728.

263 Nanmoku, K., M. Kawano, Y. Iwasaki, and K. Ikenaka. 2003. Highly efficient gene transduction into the brain using high-titer retroviral vectors. Dev. Neurosci. 25:152- 161.

Nataraj, C., M. I. Oliverio, R. B. Mannon, P. J. Mannon, L. P. Audoly, C. S. Amuchastegui, P. Ruiz, O. Smithies, and T. M. Coffman. 1999. Angiotensin II regulates cellular immune responses through a calcineurin-dependent pathway. J Clin. Invest 104:1693-1701.

Ng, P. W., H. Iha, Y. Iwanaga, M. Bittner, Y. Chen, Y. Jiang, G. Gooden, J. M. Trent, P. Meltzer, K. T. Jeang, and S. L. Zeichner. 2001. Genome-wide expression changes induced by HTLV-1 Tax: evidence for MLK- 3 mixed lineage kinase involvement in Tax-mediated NF-kappaB activation. Oncogene 20:4484-4496.

Nicot, C., M. Dundr, J. M. Johnson, J. R. Fullen, N. Alonzo, R. Fukumoto, G. L. Princler, D. Derse, T. Misteli, and G. Franchini. 2004. HTLV-1-encoded p30(II) is a post-transcriptional negative regulator of viral replication. Nat. Med.

Nicot, C., R. Mahieux, S. Takemoto, and G. Franchini. 2000. Bcl-X(L) is up-regulated by HTLV-I and HTLV-II in vitro and in ex vivo ATLL samples. Blood 96:275-281.

Nicot, C., J. C. Mulloy, M. G. Ferrari, J. M. Johnson, K. Fu, R. Fukumoto, R. Trovato, J. Fullen, W. J. Leonard, and G. Franchini. 2001. HTLV-1 p12(I) protein enhances STAT5 activation and decreases the interleukin-2 requirement for proliferation of primary human peripheral blood mononuclear cells. Blood 98:823-829.

Nishioka, K., I. Maruyama, K. Sato, I. Kitajima, Y. Nakajima, and M. Osame. 1989. Chronic inflammatory arthropathy associated with HTLV-I [letter]. Lancet i:441.

Nitta, T., M. Tanaka, B. Sun, S. Hanai, and M. Miwa. 2003. The genetic background as a determinant of human T-cell leukemia virus type 1 proviral load. Biochem. Biophys. Res. Commun. 309:161-165.

Nyborg, J. K. and W. S. Dynan. 1990. Interaction of cellular proteins with the human T- cell leukemia virus type I transcriptional control region. Purification of cellular proteins that bind the 21-base pair repeat elements 5257. J. Biol. Chem. 265:8230-8236.

Ohshima, K., M. Kikuchi, Y. Masuda, Y. Sumiyoshi, F. Eguchi, H. Mohtai, M. Takeshita, and N. Kimura. 1992. Human T-cell leukemia virus type I associated lymphadenitis. Cancer 69:239-248.

Okochi, K., H. Sato, and Y. Hinuma. 1984. A retrospective study on transmission of adult T cell leukemia virus by blood transfusion: seroconversion in recipients. Vox Sang. 46:245-253.

264 Ootsuyama, Y., K. Shimotohno, M. Miwa, S. Oroszlan, and T. Sugimura. 1985. Myristylation of gag protein in human T-cell leukemia virus type-I and type-II. Jpn. J Cancer Res. 76:1132-1135.

Orlic, D., L. J. Girard, S. M. Anderson, L. C. Pyle, M. C. Yoder, H. E. Broxmeyer, and D. M. Bodine. 1998. Identification of human and mouse hematopoietic stem cell populations expressing high levels of mRNA encoding retrovirus receptors. Blood 91:3247-3254.

Orlic, D., L. J. Girard, C. T. Jordan, S. M. Anderson, A. P. Cline, and D. M. Bodine. 1996. The level of mRNA encoding the amphotropic retrovirus receptor in mouse and human hematopoietic stem cells is low and correlates with the efficiency of retrovirus transduction. Proc. Natl. Acad. Sci U. S. A 93:11097-11102.

Oroszlan, S. 1984. Chemical Analysis of HTLV-1 Structural proteins 5260, p. 101-110. In R. C. Gallo, M. E. Essex, and L. Gross (eds.), Human T-cell Leukemia Lymphoma Viruses. Cold Spring Harbor Laboratory Press.

Orwig, K. E., M. R. Avarbock, and R. L. Brinster. 2002. Retrovirus-mediated modification of male germline stem cells in rats. Biol. Reprod. 67:874-879.

Osame, M. 2002. Pathological mechanisms of human T-cell lymphotropic virus type I- associated myelopathy (HAM/TSP). J Neurovirol. 8:359-364.

Osame, M., R. Janssen, H. Kubota, H. Nishitani, A. Igata, S. Nagataki, M. Mori, I. Goto, H. Shimabukuro, R. Khabbaz, and J. Kaplan. 1990. Nationwide survey of HTLV-I- associated Myelopathy in Japan: Association with blood transfusion. Ann. Neurol. 28:50-56.

Osame, M., K. Usuku, S. Izumo, N. Ijichi, H. Amitani, A. Igata, M. Matsumoto, and M. Tara. 1986. HTLV-I associated myelopathy, a new clinical entity. Lancet i:1031-1032.

Overbaugh, J. 2004. HTLV-1 sweet-talks its way into cells. Nat. Med. 10:20-21.

Palu, G., C. Parolin, Y. Takeuchi, and M. Pizzato. 2000. Progress with retroviral gene vectors. Rev. Med Virol 10:185-202.

Pan, Y., P. Zhai, A. M. Dashti, S. Wu, X. Lin, and M. Wu. 2002. A combined gene delivery by co-transduction of adenoviral and retroviral vectors for cancer gene therapy. Cancer Lett. 184:179-188.

Parekh, A. B. and R. Penner. 1997. Store depletion and calcium influx. Physiol Rev. 77:901-930.

265 Pawliuk, R., K. A. Westerman, M. E. Fabry, E. Payen, R. Tighe, E. E. Bouhassira, S. A. Acharya, J. Ellis, I. M. London, C. J. Eaves, R. K. Humphries, Y. Beuzard, R. L. Nagel, and P. Leboulch. 2001. Correction of sickle cell disease in transgenic mouse models by gene therapy. Science 294:2368-2371.

Peng, Y. C., D. E. Breiding, F. Sverdrup, J. Richard, and E. J. Androphy. 2000. AMF- 1/Gps2 binds p300 and enhances its interaction with papillomavirus E2 proteins. J. Virol. 74:5872-5879.

Perini, G., S. Wagner, and M. R. Green. 1995. Recognition of bZIP proteins by the human T-cell leukaemia virus transactivator Tax. Nature 376:602-605.

Perkins, N. D., L. K. Felzien, J. C. Betts, K. Leung, D. H. Beach, and G. J. Nabel. 1997. Regulation of NF-kappaB by cyclin-dependent kinases associated with the p300 coactivator. Science 275:523-527.

Petit, C., F. Buseyne, C. Boccaccio, J. P. Abastado, J. M. Heard, and O. Schwartz. 2001. Nef is required for efficient hiv-1 replication in cocultures of dendritic cells and lymphocytes. Virology 286:225-236.

Petrij, F., R. H. Giles, H. G. Dauwerse, J. J. Saris, R. C. Hennekam, M. Masuno, N. Tommerup, G. J. van Ommen, R. H. Goodman, and D. J. Peters. 1995. Rubinstein- Taybi syndrome caused by mutations in the transcriptional co- activator CBP [see comments]. Nature 376:348-351.

Petrini, M., E. Pelosi-Testa, N. M. Sposi, G. Mastroberardino, A. Camagna, L. Bottero, F. Mavilio, U. Testa, and C. Peschle. 1989. Constitutive expression and abnormal glycosylation of transferrin receptor in acute T-cell leukemia. Cancer Res. 49:6989- 6996.

Piguet, V., O. Schwartz, S. Legall, and D. Trono. 1999. The downregulation of CD4 and MHC-I by primate lentiviruses: a paradigm for the modulation of cell surface receptors. Immunol Rev 168:51-63.

Pique, C., D. Pham, T. Tursz, and M. C. Dokhelar. 1992. Human T-Cell Leukemia Virus Type I Envelope Protein Maturation Process: Requirements for Syncytium Formation. J. Virol. 66:906-913.

Pique, C., A. Uretavidal, A. Gessain, B. Chancerel, O. Gout, R. Tamouza, F. Agis, and M. C. Dokhelar. 2000. Evidence for the chronic in vivo production of human T cell leukemia virus type I Rof and Tof proteins from cytotoxic T lymphocytes directed against viral peptides. J. Exp. Med. 191:567-572.

266 Pise-Masison, C. A., M. Radonovich, R. Mahieux, P. Chatterjee, C. Whiteford, J. Duvall, C. Guillerm, A. Gessain, and J. N. Brady. 2002. Transcription profile of cells infected with human T-cell leukemia virus type I compared with activated lymphocytes. Cancer Res. 62:3562-3571.

Plemper, R. K., A. L. Hammond, and R. Cattaneo. 2001. Measles virus envelope glycoproteins hetero-oligomerize in the endoplasmic reticulum. J Biol. Chem. 276:44239-44246.

Poiesz, B. J., F. W. Ruscetti, A. F. Gazdar, P. A. Bunn, J. D. Minna, and R. C. Gallo. 1980. Detection and isolation of type C retrovirus particles from fresh and cultured lymphocytes of a patient with cutaneous T-cell lymphoma. Proc. Natl. Acad. Sci. USA 77:7415-7419.

Pollard, V. W. and M. H. Malim. 1998. The HIV-1 Rev protein. Annu. Rev. Microbiol. 52:491-532.

Ponder, K. P., J. R. Melniczek, L. Xu, M. A. Weil, T. M. O'Malley, P. A. O'Donnell, V. W. Knox, G. D. Aguirre, H. Mazrier, N. M. Ellinwood, M. Sleeper, A. M. Maguire, S. W. Volk, R. L. Mango, J. Zweigle, J. H. Wolfe, and M. E. Haskins. 2002. Therapeutic neonatal hepatic gene therapy in mucopolysaccharidosis VII dogs. Proc. Natl. Acad. Sci U. S. A 99:13102-13107.

Porada, C. D., N. Tran, M. Eglitis, R. C. Moen, L. Troutman, A. W. Flake, Y. Zhao, W. F. Anderson, and E. D. Zanjani. 1998. In utero gene therapy: transfer and long-term expression of the bacterial neo(r) gene in sheep after direct injection of retroviral vectors into preimmune fetuses. Hum. Gene Ther. 9:1571-1585.

Porada, C. D., N. D. Tran, Y. Zhao, W. F. Anderson, and E. D. Zanjani. 2000. Neonatal gene therapy. transfer and expression of exogenous genes in neonatal sheep following direct injection of retroviral vectors into the bone marrow space. Exp. Hematol. 28:642- 650.

Porter, C. D., M. K. Collins, C. S. Tailor, M. H. Parkar, F. L. Cosset, R. A. Weiss, and Y. Takeuchi. 1996. Comparison of efficiency of infection of human gene therapy target cells via four different retroviral receptors. Hum. Gene Ther. 7:913-919.

Princler, G. L., J. G. Julias, S. H. Hughes, and D. Derse. 2003. Roles of viral and cellular proteins in the expression of alternatively spliced HTLV-1 pX mRNAs. Virology 317:136-145.

Putney, J. W., Jr. 1990. Capacitative calcium entry revisited. Cell Calcium 11:611-624.

Rabinowitz, J. E. and J. Samulski. 1998. Adeno-associated virus expression systems for gene transfer. Curr. Opin. Biotechnol. 9:470-475.

267 Rao, A., C. Luo, and P. G. Hogan. 1997. Transcription factors of the NFAT family: regulation and function. Annu. Rev. Immunol. 15:707-747.

Rasko, J. E., J. L. Battini, R. J. Gottschalk, I. Mazo, and A. D. Miller. 1999. The RD114/simian type D retrovirus receptor is a neutral amino acid transporter. Proc. Natl. Acad. Sci U. S. A 96:2129-2134.

Ratner, L. 1989. Regulation of expression of the c-sis proto-oncogene 5269. Nucleic Acids Res. 17:4101-4115.

Reeves, W., C. Saxinger, M. Brenes, E. Quinoz, M. Hoh, J. Clark, C. Holt, R. C. Gallo, and W. Blattner. 1988. Human T-cell lymphotropic virus type I (HTLV-I) and risk factors in metropolitan Panama. Am. J. Epidemiol. 127:539.

Relander, T., A. C. Brun, K. Olsson, L. Pedersen, and J. Richter. 2002. Overexpression of gibbon ape leukemia virus (GALV) receptor (GLVR1) on human CD34(+) cells increases gene transfer mediated by GALV pseudotyped vectors. Mol. Ther. 6:400-406.

Relander, T., S. Karlsson, and J. Richter. 2002. Oncoretroviral gene transfer to NOD/SCID repopulating cells using three different viral envelopes. J Gene Med 4:122- 132.

Ressler, S., G. F. Morris, and S. J. Marriott. 1997. Human T-cell leukemia virus type 1 Tax transactivates the human proliferating cell nuclear antigen promoter. J. Virol. 71:1181-1190.

Richard, E., M. Mendez, F. Mazurier, C. Morel, P. Costet, P. Xia, A. Fontanellas, F. Geronimi, M. Cario-Andre, L. Taine, C. Ged, P. Malik, H. de Verneuil, and F. Moreau- Gaudry. 2001. Gene therapy of a mouse model of protoporphyria with a self- inactivating erythroid-specific lentiviral vector without preselection. Mol. Ther. 4:331- 338.

Rivera, I., E. W. Harhaj, and S. C. Sun. 1998. Involvement of NF-AT in type I human T-cell leukemia virus tax-mediated Fas ligand promoter transactivation. J Biol Chem 273:22382-22388.

Robek, M. D., F. H. Wong, and L. Ratner. 1998. Human T-Cell leukemia virus type 1 pX-I and pX-II open reading frames are dispensable for the immortalization of primary lymphocytes. J. Virol. 72:4458-4462.

Roithmann, S., C. Pique, A. Le Cesne, L. Delamarre, D. Pham, T. Tursz, and M. C. Dokhelar. 1994. The open reading frame I (ORF I)/ORF II part of the human T-cell leukemia virus type 1 X region is dispensable for p40tax, p27rex, or envelope expression. J. Virol. 68:3448-3451.

268 Rosen, C. A., J. G. Sodroski, K. Campbell, and W. A. Haseltine. 1986. Construction of recombinant murine retroviruses that express the human T-cell leukemia virus type II and human T-cell lymphotropic virus type III trans activator genes. J Virol 57:379-384.

Royer-Leveau, C., E. Mordelet, F. Delebecque, A. Gessain, P. Charneau, and S. Ozden. 2002. Efficient transfer of HTLV-1 tax gene in various primary and immortalized cells using a flap lentiviral vector. J Virol Methods 105:133-140.

Ruiz, M. C., J. Cohen, and F. Michelangeli. 2000. Role of Ca2+in the replication and pathogenesis of rotavirus and other viral infections. Cell Calcium 28:137-149.

Saito, M., Y. Furukawa, R. Kubota, K. Usuku, S. Sonoda, S. Izumo, M. Osame, and M. Yoshida. 1995. Frequent mutation in pX region of HTLV-1 is observed in HAM/TSP patients, but is not specifically associated with the central nervous system lesions. J. Neurovirol. 1:286-294.

Saksena, N. K., A. Srinivasan, Y. C. Ge, S. H. Xiang, A. Azad, W. Bolton, V. Herve, S. Reddy, O. Diop, M. Mirandasaksena, W. D. Rawlinson, A. M. Vandamme, and F. Barresinoussi. 1997. Simian T cell leukemia virus type I from naturally infected feral monkeys from Central and West Africa encodes a 91-amino acid p12 (ORF-I) protein as opposed to a 99-amino acid protein encoded by HTLV type I from humans. AIDS Res. Hum. Retroviruses 13:425-432.

Sandrin, V., B. Boson, P. Salmon, W. Gay, D. Negre, R. Le Grand, D. Trono, and F. L. Cosset. 2002. Lentiviral vectors pseudotyped with a modified RD114 envelope glycoprotein show increased stability in sera and augmented transduction of primary lymphocytes and CD34+ cells derived from human and nonhuman primates. Blood 100:823-832.

Sandrin, V., S. J. Russell, and F. L. Cosset. 2003. Targeting retroviral and lentiviral vectors. Curr. Top. Microbiol Immunol. 281:137-178.

Satoh, T. and D. M. Fekete. 2003. Retroviral vectors to study cell differentiation. Front Biosci. 8:d183-d192.

Saxinger, W. C., W. Blattner, P. Levine, J. Clark, R. J. Biggar, M. Hoh, J. Moghissi, P. Jacobs, L. Wilson, R. Jacobson, R. Crookes, M. Strong, A. A. Ansari, A. Dean, F. Nkrumah, N. Mourali, and R. C. Gallo. 1984. Human T-cell leukemia virus (HTLV-I) antibodies in Africa. Science 225:1473.

Scheffner, M. and N. J. Whitaker. 2003. Human papillomavirus-induced carcinogenesis and the ubiquitin-proteasome system. Semin. Cancer Biol. 13:59-67.

Schlegel, R., T. S. Tralka, M. C. Willingham, and I. Pastan. 1983. Inhibition of VSV binding and infectivity by phosphatidylserine: is phosphatidylserine a VSV-binding site? Cell 32:639-646.

269 Schnitzer, T. J., R. A. Weiss, D. K. Juricek, and F. H. Ruddle. 1980. Use of vesicular stomatitis virus pseudotypes to map viral receptor genes: Assignment of RD114 virus receptor gene to human chromosome 19. J Virol 35:575-580.

Schreiber, G. B., E. L. Murphy, J. A. Horton, D. J. Wright, R. Garfein, H. C. Chien, and C. C. Nass. 1997. Risk factors for human T-cell lymphotropic virus types I and II (HTLV-I and -II) in blood donors: the Retrovirus Epidemiology Donor Study. NHLBI Retrovirus Epidemiology Donor Study. J Acquir. Immune. Defic. Syndr. Hum. Retrovirol. 14:263-271.

Schwartz, O., V. Marechal, O. Danos, and J. M. Heard. 1995. Human immunodeficiency virus type 1 Nef increases the efficiency of reverse transcription in the infected cell. J. Virol. 69:4053-4059.

Seiki, M., S. Hattori, Y. Hirayama, and M. Yoshida. 1983. Human adult T-cell leukemia virus: Complete nucleotide sequence of the provirus genome integrated in leukemia cell DNA. Proc. Natl. Acad. Sci. 80:3618-3622.

Seiki, M., A. Hikikoshi, T. Taniguchi, and M. Yoshida. 1985. Expression of the pX Gene of HTLV-1: General Splicing Mechanism in the HTLV Family. Science 228:1532-1534.

Seiki, M., J. Inoue, M. Hidaka, and M. Yoshida. 1988. Two cis-acting elements responsible for posttranscriptional trans-regulation of gene expression of human T-cell leukemia virus type I. Proc. Natl. Acad. Sci. U. S. A 85:7124-7128.

Sekhon, H. S. and J. E. Larson. 1995. In utero gene transfer into the pulmonary epithelium. Nat. Med 1:1201-1203.

Senut, M. C. and F. H. Gage. 1999. Prenatal gene therapy: can the technical hurdles be overcome? Mol. Med Today 5:152-156.

Shaw, G. M., M. A. Gonda, G. H. Flickinger, B. H. Hahn, R. C. Gallo, and F. Wongstaal. 1984. Genomes of evolutionarily divergent members of the human T-cell leukemia virus family (HTLV-I and HTLV-II) are highly conserved, especially in pX. Proc. Natl. Acad. Sci. USA 81:4544-4548.

Shikama, N., J. Lyon, and N. B. Lathangue. 1997. The p300/CBP family: Integrating signals with transcription factors and chromatin. Tr. Cell Biol. 7:230-236.

Shimotohno, K., M. Takano, T. Teruuchi, and M. Miwa. 1986. Requirement of multiple copies of a 21-nucleotide sequence in the U3 regions of human T-cell leukemia virus type I and type II long terminal repeats for trans-acting activation of transcription 5252. Proc. Natl. Acad. Sci. U. S. A 83:8112-8116.

270 Shimoyama, M. 1991. Diagnostic criteria and classification of clinical subtypes of adult T- cell leukaemia-lymphoma. A report from the Lymphoma Study Group (1984- 87). Br. J. Haematol. 79:428-437.

Siekevitz, M., M. Feinberg, N. J. Holbrook, F. Wong-Staal, and W. C. Greene. 1987. Activation of interleukin 2 and interleukin 2 receptor (Tac) promoter expression by the trans-activator (tat) gene product of human T-cell leukemia virus type I. Proc. Natl. Acad. Sci. USA 84:5389.

Siekevitz, M., S. F. Josephs, M. Dukovich, N. Peffer, F. Wongstaal, and W. C. Greene. 1987. Activation of the HIV-1 LTR by T Cell Mitogens and the Trans-Activator Protein of HTLV-1. Science 238:1575-1578.

Silverman, L. R., A. J. Phipps, A. Montgomery, L. Ratner, and M. D. Lairmore. 2004. Human T-cell lymphotropic virus type 1 open reading frame II-encoded p30II is required for in vivo replication: evidence of in vivo reversion. J Virol 78:3837-3845.

Sobulo, O. M., J. Borrow, R. Tomek, S. Reshmi, A. Harden, B. Schlegelberger, D. Housman, N. A. Doggett, J. D. Rowley, and L. Zeleznik. 1997. MLL is fused to CBP, a histone acetyltransferase, in therapy-related acute myeloid leukemia with a t(11;16)(q23;p13.3). Proc. Natl. Acad. Sci U. S. A 94:8732-8737.

Sodroski, J., C. Rosen, W. C. Goh, and W. Haseltine. 1985. A transcriptional activator protein encoded by the x-lor region of the human T-cell leukemia virus. Science 228:1430-1434.

Sodroski, J. G., C. A. Rosen, and W. A. Haseltine. 1984. Trans-Acting Transcriptional Activation of the Long Terminal Repeat of Human T Lymphotropic Viruses in Infected Cells. Science 223:381-385.

Soneoka, Y., P. M. Cannon, E. E. Ramsdale, J. C. Griffiths, G. Romano, S. M. Kingsman, and A. J. Kingsman. 1995. A transient three-plasmid expression system for the production of high titer retroviral vectors. Nucleic Acids Res. 23:628-633.

Srivastava, R. K., C. Y. Sasaki, J. M. Hardwick, and D. L. Longo. 1999. Bcl-2-mediated drug resistance: inhibition of apoptosis by blocking nuclear factor of activated T lymphocytes (NFAT)-induced Fas ligand transcription. J Exp. Med. 190:253-265.

Stitz, J., S. Steidl, H. Merget-Millitzer, R. Konig, P. Muller, F. Nocken, M. Engelstadter, M. Bobkova, I. Schmitt, R. Kurth, C. J. Buchholz, and K. Cichutek. 2000. MLV- derived retroviral vectors selective for CD4-expressing cells and resistant to neutralization by sera from HIV-infected patients. Virology 267:229-236.

271 Stuver, S. O., N. Tachibana, A. Okayama, S. Shioiri, Y. Tsunetoshi, K. Tsuda, and N. E. Mueller. 1993. Heterosexual transmission of human T cell leukemia/lymphoma virus type I among married couples in southWestern Japan: an initial report from the Miyazaki Cohort Study. J. Infect. Dis. 167:57-65.

Subbaramaiah, K., D. T. Lin, J. C. Hart, and A. J. Dannenberg. 2001. Peroxisome proliferator-activated receptor gamma ligands suppress the transcriptional activation of cyclooxygenase-2. Evidence for involvement of activator protein-1 and CREB-binding protein/p300. J Biol. Chem. 276:12440-12448.

Suzuki, T., J. Fujisawa, M. Toita, and M. Yoshida. 1993. The trans-activator Tax of human T-cell leukemia virus type 1 (HTLV-1) interacts with cAMP-responsive element (CRE) binding and CRE modulator proteins that bind to the 21-base-pair enhancer of HTLV-1. Proc. Natl. Acad. Sci. U. S. A. 90:610-614.

Takatsuki, K., T. Uchiyama, K. Sagawa, and J. Yodoi. 1977. Adult T-cell leukemia in Japan, p. 73-77. In S. Seno, F. Takaku, and S. Irino (eds.), Topics in Hematology. Excerpta Medica, Amsterdam.

Tan, T. H., R. Jia, and R. G. Roeder. 1989. Utilization of Signal Transduction Pathway by the Human T-Cell Leukemia Virus Type 1 Transcriptional Activator tax. J. Virol. 63:3761-3768.

Tanimura, A., H. Teshima, J. I. Fujisawa, and M. Yoshida. 1993. A New Regulatory Element that Augments the Tax-Dependent Enhancer of Human T-Cell Leukemia Virus Type 1 and Cloning of cDNAs Encoding Its Binding Proteins. J. Virol. 67:5375-5382.

Tarantal, A. F., C. I. Lee, J. E. Ekert, R. McDonald, D. B. Kohn, C. G. Plopper, S. S. Case, and B. A. Bunnell. 2001. Lentiviral vector gene transfer into fetal rhesus monkeys (Macaca mulatta): lung-targeting approaches. Mol. Ther. 4:614-621.

Tarantal, A. F., J. P. O'Rourke, S. S. Case, G. C. Newbound, J. Li, C. I. Lee, C. R. Baskin, D. B. Kohn, and B. A. Bunnell. 2001. Rhesus monkey model for fetal gene transfer: studies with retroviral- based vector systems. Mol. Ther. 3:128-138.

Tchilian, E. Z. and P. C. Beverley. 2002. CD45 in memory and disease. Arch. Immunol. Ther. Exp. (Warsz. ) 50:85-93.

Terada, K., S. Katamine, K. Eguchi, R. Moriuchi, M. Kita, H. Shimada, I. Yamashita, K. Iwata, Y. Tsuji, S. Nagataki, and T. Miyamoto. 1994. Prevalence of serum and salivary antibodies to HTLV-1 in Sjogren's syndrome. Lancet 344:1116-1119.

272 Themis, M., H. Schneider, T. Kiserud, T. Cook, S. Adebakin, S. Jezzard, S. Forbes, M. Hanson, A. Pavirani, C. Rodeck, and C. Coutelle. 1999. Successful expression of beta- galactosidase and factor IX transgenes in fetal and neonatal sheep after ultrasound- guided percutaneous adenovirus vector administration into the umbilical vein. Gene Ther. 6:1239-1248.

Thoulouze, M. I., M. Lafage, M. Schachner, U. Hartmann, H. Cremer, and M. Lafon. 1998. The neural cell adhesion molecule is a receptor for rabies virus. J Virol 72:7181- 7190.

Tian, P., M. K. Estes, Y. Hu, J. M. Ball, C. Q. Zeng, and W. P. Schilling. 1995. The rotavirus nonstructural glycoprotein NSP4 mobilizes Ca2+ from the endoplasmic reticulum. J. Virol. 69:5763-5772.

Tillmann, M., R. Wessner, and B. Wigdahl. 1994. Identification of human T-cell lymphotropic virus type I 21-base- pair repeat-specific and glial cell-specific DNA- protein complexes. J. Virol. 68:4597-4608.

Toedter, G. P., S. Pearlman, D. Hofheinz, J. Blakeslee, G. Cockerell, C. Dezzutti, J. Yee, R. B. Lal, and M. D. Lairmore. 1992. Development of a monoclonal antibody-based p24 capsid antigen detection assay for HTLV-I, HTLV-II, and STLV-I infection. AIDS Res. Hum. Retroviruses 8:527-532.

Tokumitsu, H., H. Enslen, and T. R. Soderling. 1995. Characterization of a Ca2+/calmodulin-dependent protein kinase cascade. Molecular cloning and expression of calcium/calmodulin-dependent protein kinase kinase. J Biol. Chem. 270:19320- 19324.

Tomita, N., H. Azuma, Y. Kaneda, T. Ogihara, and R. Morishita. 2003. Gene therapy with transcription factor decoy oligonucleotides as a potential treatment for cardiovascular diseases. Curr. Drug Targets. 4:339-346.

Torgeman, A., N. Morvaknin, and M. Aboud. 1999. Sp1 is involved in a protein kinase C-independent activation of human T cell leukemia virus type I long terminal repeat by 12-O-tetradecanoylphorbol-13-acetate. Virology 254:279-287.

Tran, N. D., C. D. Porada, G. Almeida-Porada, H. A. Glimp, W. F. Anderson, and E. D. Zanjani. 2001. Induction of stable prenatal tolerance to beta-galactosidase by in utero gene transfer into preimmune sheep fetuses. Blood 97:3417-3423.

Tran, N. D., C. D. Porada, Y. Zhao, G. Almeida-Porada, W. F. Anderson, and E. D. Zanjani. 2000. In utero transfer and expression of exogenous genes in sheep. Exp. Hematol. 28:17-30.

273 Tripp, A., Y. Liu, M. Sieburg, J. Montalbano, S. Wrzesinski, and G. Feuer. 2003. Human T-cell leukemia virus type 1 tax oncoprotein suppression of multilineage hematopoiesis of CD34+ cells in vitro. J Virol 77:12152-12164.

Trovato, R., J. C. Mulloy, J. M. Johnson, S. Takemoto, M. P. de Oliveira, and G. Franchini. 1999. A lysine-to-arginine change found in natural alleles of the human T- cell lymphotropic/leukemia virus type 1 p12(I) protein greatly influences its stability. J Virol 73:6460-6467.

Tsukahara, T., M. Kannagi, T. Ohashi, H. Kato, M. Arai, G. Nunez, Y. Iwanaga, N. Yamamoto, K. Ohtani, M. Nakamura, and M. Fujii. 1999. Induction of Bcl-x(L) expression by human T-cell leukemia virus type 1 tax through NF-kappa B in apoptosis-resistant T-cell transfectants with tax. J Virol 73:7981-7987.

Tsukasaki, K., S. Tanosaki, S. DeVos, W. K. Hofmann, W. Wachsman, A. F. Gombart, J. Krebs, A. Jauch, C. R. Bartram, K. Nagai, M. Tomonaga, J. W. Said, and H. P. Koeffler. 2004. Identifying progression-associated genes in adult T-cell leukemia/lymphoma by using oligonucleotide microarrays. Int. J Cancer 109:875-881.

Turkay, A., T. Saunders, and K. Kurachi. 1999. Intrauterine gene transfer: gestational stage-specific gene delivery in mice. Gene Ther. 6:1685-1694.

Uchiyama, T., J. Yodoi, K. Sagawa, K. Takatsuki, and H. Uchino. 1977. Adult T-cell leukemia: clinical and hematologic features of 16 cases. Blood 50:481-492.

Umehara, F., S. Izumo, M. Nakagawa, A. T. Ronquillo, K. Takahashi, K. Matsumoto, E. Sato, and M. Osame. 1993. Immunocytochemical analysis of the cellular infiltrate in the spinal cord lesions in HTLV-I-Associated myelopathy. J. Neuropathol. Exp. Neurol. 52:424-430.

Valentin, H., I. Lemasson, S. Hamaia, H. Casse, S. Konig, C. Devaux, and L. Gazzolo. 1997. Transcriptional activation of the vascular cell adhesion molecule-1 gene in T lymphocytes expressing human T-Cell leukemia virus type 1 Tax protein. J. Virol. 71:8522-8530. van Kuppeveld, F. J., J. G. Hoenderop, R. L. Smeets, P. H. Willems, H. B. Dijkman, J. M. Galama, and W. J. Melchers. 1997. Coxsackievirus protein 2B modifies endoplasmic reticulum membrane and plasma membrane permeability and facilitates virus release. EMBO J. 16:3519-3532.

Van Parijs, L., Y. Refaeli, A. K. Abbas, and D. Baltimore. 1999. Autoimmunity as a consequence of retrovirus-mediated expression of C-FLIP in lymphocytes. Immunity. 11:763-770.

274 Van Parijs, L., Y. Refaeli, J. D. Lord, B. H. Nelson, A. K. Abbas, and D. Baltimore. 1999. Uncoupling IL-2 signals that regulate T cell proliferation, survival, and Fas- mediated activation-induced cell death. Immunity. 11:281-288. van Zeijl, M., S. V. Johann, E. Closs, J. Cunningham, R. Eddy, T. B. Shows, and B. O'Hara. 1994. A human amphotropic retrovirus receptor is a second member of the gibbon ape leukemia virus receptor family. Proc. Natl. Acad. Sci U. S. A 91:1168-1172.

VandenDriessche, T., V. Vanslembrouck, I. Goovaerts, H. Zwinnen, M. L. Vanderhaeghen, D. Collen, and M. K. Chuah. 1999. Long-term expression of human coagulation factor VIII and correction of hemophilia A after in vivo retroviral gene transfer in factor VIII-deficient mice. Proc. Natl. Acad. Sci U. S. A 96:10379-10384.

Vigna, E., S. Cavalieri, L. Ailles, M. Geuna, R. Loew, H. Bujard, and L. Naldini. 2002. Robust and efficient regulation of transgene expression in vivo by improved tetracycline-dependent lentiviral vectors. Mol. Ther. 5:252-261.

Vile, R. G., R. M. Diaz, N. Miller, S. Mitchell, A. Tuszyanski, and S. J. Russell. 1995. Tissue-specific gene expression from Mo-MLV retroviral vectors with hybrid LTRs containing the murine tyrosinase enhancer/promoter. Virology 214:307-313.

Vo, N. and R. H. Goodman. 2001. CREB-binding protein and p300 in transcriptional regulation. J. Biol. Chem. 276:13505-13508.

Vogel, K. W., R. Briesewitz, T. J. Wandless, and G. R. Crabtree. 2001. Calcineurin inhibitors and the generalization of the presenting protein strategy. Adv. Protein Chem. 56:253-291. von Bulow, G. U. and R. J. Bram. 1997. NF-AT activation induced by a CAML- interacting member of the tumor necrosis factor receptor superfamily. Science 278:138- 141. von Kalle, C., H. P. Kiem, S. Goehle, B. Darovsky, S. Heimfeld, B. Torok-Storb, R. Storb, and F. G. Schuening. 1994. Increased gene transfer into human hematopoietic progenitor cells by extended in vitro exposure to a pseudotyped retroviral vector. Blood 84:2890-2897.

Wang, L., S. R. Grossman, and E. Kieff. 2000. Epstein-Barr virus nuclear protein 2 interacts with p300, CBP, and PCAF histone acetyltransferases in activation of the LMP1 promoter. Proc. Natl. Acad. Sci U. S. A 97:430-435.

Wang, L., S. R. Grossman, and E. Kieff. 2000. Epstein-Barr virus nuclear protein 2 interacts with p300, CBP, and PCAF histone acetyltransferases in activation of the LMP1 promoter. Proc. Natl. Acad. Sci. U. S. A 97:430-435.

275 Wang, Z. H., Y. Ji, W. Shan, B. Zeng, N. Raksadawan, G. M. Pastores, T. Wisniewski, and E. H. Kolodny. 2002. Therapeutic effects of astrocytes expressing both tyrosine hydroxylase and brain-derived neurotrophic factor on a rat model of Parkinson's disease. Neuroscience 113:629-640.

Wano, Y., M. Feinberg, J. B. Hosking, H. Bogerd, and W. C. Greene. 1988. Stable expression of the tax gene of type I human T-cell leukemia virus in human T cells activates specific cellular genes involved in growth. Proc. Natl. Acad. Sci. 85:9733- 9737.

Weichselbraun, I., J. Berger, M. Dobrovnik, H. Bogerd, R. Grassmann, W. C. Greene, J. Hauber, and E. Bohnlein. 1992. Dominant-negative mutants are clustered in a domain of the human T-cell leukemia virus type I Rex protein: implications for trans dominance. J Virol 66:4540-4545.

Wessner, R., M. Tillmann-Bogush, and B. Wigdahl. 1995. Characterization of a glial cell-specific DNA-protein complex formed with the human T cell lymphotropic virus type I (HTLV-I) enhancer. J Neurovirol. 1:62-77.

Wessner, R. and B. Wigdahl. 1997. AP-1 derived from mature monocytes and astrocytes preferentially interacts with the HTLV-I promoter central 21 bp repeat. Leukemia 11 Suppl 3:21-4.:21-24.

Wheelock, M. J. and K. R. Johnson. 2003. Cadherins as modulators of cellular phenotype. Annu. Rev. Cell Dev. Biol. 19:207-235.

White, J. D., S. L. Zaknoen, C. Kastensportes, L. E. Top, L. Navarroroman, D. L. Nelson, and T. A. Waldmann. 1995. Infectious complications and immunodeficiency in patients with human T-cell lymphotropic virus I-associated adult T- cell leukemia/lymphoma. Cancer 75:1598-1607.

Wiktor, S. Z., E. J. Pate, E. L. Murphy, T. J. Palker, E. Champegnie, A. Ramlal, B. Cranston, B. Hanchard, and W. A. Blattner. 1993. Mother-to-child transmission of human T-cell lymphotropic virus type I (HTLV-I) in Jamaica: association with antibodies to envelope glycoprotein (gp46) epitopes. J. Acquir. Immune. Defic. Syndr. 6:1162-1167.

Wilks, R., B. Hanchard, O. Morgan, E. Williams, B. Cranston, M. L. Smith, P. Rodgersjohnson, and A. Manns. 1996. Patterns of HTLV-I infection among family members of patients with adult T-cell leukemia/lymphoma and HTLV-I associated myelopathy tropical spastic paraparesis. Int. J. Cancer 65:272-273.

Wolin, M., M. Kornuc, C. Hong, S. K. Shin, F. Lee, R. Lau, and S. Nimer. 1993. Differential effect of HTLV infection and HTLV Tax on interleukin 3 expression. Oncogene 8:1905-1911.

276 Wong, W., J. S. Billing, S. A. Stranford, K. Hyde, J. Fry, P. J. Morris, and K. J. Wood. 2003. Retroviral transfer of donor MHC class I or MHC class II genes into recipient bone marrow cells can induce operational tolerance to alloantigens in vivo. Hum. Gene Ther. 14:577-590.

Wu, Y. and J. W. Marsh. 2001. Selective transcription and modulation of resting T cell activity by preintegrated HIV DNA. Science 293:1503-1506.

Xu, R. Z., Q. K. Gao, S. J. Wang, H. H. Kan, L. Y. Sheng, C. Q. Li, X. H. Zhang, G. B. Xu, and K. Q. Zhang. 1996. Human acute myeloid leukemias may be etiologically associated with new human retroviral infection. Leuk. Res. 20:449-455.

Yajima, A., A. Kawada, Y. Aragane, and T. Tezuka. 2001. Detection of HTLV-I proviral DNA in sarcoidosis. Dermatology 203:53-56.

Yamaguchi, K. 1994. Human T-lymphotropic virus type I in Japan. Lancet 343:213-216.

Yamaguchi, K., H. Nishimura, H. Kohrogi, M. Jono, Y. Miyamoto, and K. Takatsuki. 1983. A proposal for smoldering adult T-cell leukemia: a clinicopathologic study of five cases. Blood 62:758-766.

Yamaguchi, K. and K. Takatsuki. 1993. Adult T cell leukaemia-lymphoma. Clin. Haematol. 6:899-915.

Yamaguchi, K. and K. Takatsuki. 1993. Adult T cell leukaemia-lymphoma. Clin. Haematol. 6:899-915.

Yamamoto, N., M. Okada, Y. Koyanagi, M. Kannagi, and Y. Hinuma. 1982. Transformation of human Leukocytes by cocultivation with an adult T cell leukemia virus producer cell line. Science 217:737-739.

Yamano, Y., M. Nagai, M. Brennan, C. A. Mora, S. S. Soldan, U. Tomaru, N. Takenouchi, S. Izumo, M. Osame, and S. Jacobson. 2002. Correlation of human T-cell lymphotropic virus type 1 (HTLV-1) mRNA with proviral DNA load, virus-specific CD8(+) T cells, and disease severity in HTLV-1-associated myelopathy (HAM/TSP). Blood 99:88-94.

Yan, J. P., J. E. Garrus, H. A. Giebler, L. A. Stargell, and J. K. Nyborg. 1998. Molecular interactions between the coactivator CBP and the human T-cell leukemia virus Tax protein. J. Mol. Biol. 281:395-400.

Yang, E. Y., H. B. Kim, A. F. Shaaban, R. Milner, N. S. Adzick, and A. W. Flake. 1999. Persistent postnatal transgene expression in both muscle and liver after fetal injection of recombinant adenovirus. J Pediatr. Surg. 34:766-772.

277 Yang, X. J., V. V. Ogryzko, J. Nishikawa, B. H. Howard, and Y. Nakatani. 1996. A p300/CBP-associated factor that competes with the adenoviral oncoprotein E1A. Nature 382:319-324.

Ye, J., L. Silverman, M. D. Lairmore, and P. L. Green. 2003. HTLV-1 Rex is required for viral spread and persistence in vivo but is dispensable for cellular immortalization in vitro. Blood.

Yoshida, H., H. Nishina, H. Takimoto, L. E. Marengere, A. C. Wakeham, D. Bouchard, Y. Y. Kong, T. Ohteki, A. Shahinian, M. Bachmann, P. S. Ohashi, J. M. Penninger, G. R. Crabtree, and T. W. Mak. 1998. The transcription factor NF-ATc1 regulates lymphocyte proliferation and Th2 cytokine production. Immunity 8:115-124.

Yoshida, M., I. Miyoshi, and Y. Hinuma. 1982. Isolation and characterization of retrovirus from cell lines of human T-cell leukemia and its implication in the disease. Proc. Natl. Acad. Sci. USA 79:2031-2035.

Yoshida, M., M. Seiki, K. Yamaguchi, and K. Takatsuki. 1984. Monoclonal integration of human T-cell leukemia provirus in all primary tumors of adult T-cell leukemia suggests causative role of human T-cell leukemia virus in the disease. Proc. Natl. Acad. Sci. U. S. A. 81:2534-2537.

Yoshimura, T., J. Fujisawa, and M. Yoshida. 1990. Multiple cDNA clones encoding nuclear proteins that bind to the tax-dependent enhancer of HTLV-I: all contain a leucine zipper structure and basic amino acid domain. EMBO J. 9:2537-2542.

Yu, S. F., T. von Ruden, P. W. Kantoff, C. Garber, M. Seiberg, U. Ruther, W. F. Anderson, E. F. Wagner, and E. Gilboa. 1986. Self-inactivating retroviral vectors designed for transfer of whole genes into mammalian cells. Proc. Natl. Acad. Sci U. S. A 83:3194-3198.

Zhang, W., J. W. Nisbet, B. Albrecht, W. Ding, F. Kashanchi, J. T. Bartoe, and M. D. Lairmore. 2001. Human T-lymphotropic virus type 1 p30(II) regulates gene transcription by binding CREB binding protein/p300. J. Virol. 75:9885-9895.

Zhang, W., J. W. Nisbet, J. T. Bartoe, W. Ding, and M. D. Lairmore. 2000. Human T- lymphotropic virus type 1 p30(II) functions as a transcription factor and differentially modulates CREB-responsive promoters. J. Virol. 74:11270-11277.

Zhao, L. J. and C. Z. Giam. 1992. Human T-cell lymphotropic virus type I (HTLV-I) transcriptional activator, Tax, enhances CREB binding to HTLV-I 21-base-pair repeats by protein-protein interaction. Proceedings. of. the. National. Academy. of. Sciences. of. the. United. States. of. America. 89:7070-7074.

278 Zhou, J. and C. Aiken. 2001. Nef enhances human immunodeficiency virus type 1 infectivity resulting from intervirion fusion: evidence supporting a role for Nef at the virion envelope. J Virol 75:5851-5859.

Zhou, M., M. A. Halanski, M. F. Radonovich, F. Kashanchi, J. Peng, D. H. Price, and J. N. Brady. 2000. Tat modifies the activity of CDK9 to phosphorylate serine 5 of the RNA polymerase II carboxyl-terminal domain during human immunodeficiency virus type 1 transcription. Mol. Cell Biol. 20:5077-5086.

Zufferey, R., D. Nagy, R. J. Mandel, L. Naldini, and D. Trono. 1997. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat. Biotechnol. 15:871-875.

279