DOCSLIB.ORG

A Universal Scaling Law for Atomic Diffusion in Condensed Matter Initial

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Universal Scaling Law for Atomic Diffusion in Condensed Matter Initial letters to nature 22. Wolpert, L. Positional information and the spatial pattern of cellular differentiation. J. Theor. Biol. 25, Supplementary information is available from Nature's World-Wide Web site 1±47 (1969). (http://www.nature.com) or as paper copy from the London editorial of®ce of Nature. 23. Burke, R. et al. Dispatched, a novel sterol-sensing domain protein dedicated to the release of cholesterol-modi®ed hedgehog from signaling cells. Cell 99, 803±815 (1999). 24. The, I., Bellaiche, Y. & Perrimon, N. Hedgehog movement is regulated through tout velu-dependent Acknowledgements synthesis of a heparan sulfate proteoglycan. Mol. Cell 4, 633±639 (1999). We thank the members of the Robbins' laboratory and A. J. Capobianco, Y. Sanchez, 25. Guy, R. K. Inhibition of sonic hedgehog autoprocessing in cultured mammalian cells by sterol T. Doetschman, L. A. Woollett, S. M. Bell, X. Lin and K. E. Yutzey for discussions. D.J.R. is a deprivation. Proc. Natl Acad. Sci. USA 97, 7307±7312 (2000). recipient of a Burroughs Wellcome Career Development Award.This work was supported 26. Porter, J. A., Young, K. E. & Beachy, P. A. Cholesterol modi®cation of hedgehog signaling proteins in by Grants from the National Institutes of Health. animal development. Science 274, 255±259 (1996). 27. Robbins, D. J. et al. Hedgehog elicits signal transduction by means of a large complex containing the Correspondence and requests for materials should be addressed to D.J.R. kinesin-related protein COSTAL2. Cell 90, 225±234 (1997). (e-mail: [email protected]). 28. Bell, S. M., Schreiner, C. M. & Scott, W. J. Transspecies grafting as a tool to understand the basis of ................................................................................................................................................................................................murine developmental limb abnormalities. Methods Mol. Biol. 136, 219±226 (2000). ....................................................................... addendum erratum A universal scaling law for atomic Homologues of Twisted gastrulation diffusionincondensedmatter are extracellular cofactors in M. Dzugutov antagonism of BMP signalling Nature 381, 137±139 (1996). Ian C. Scott, Ira L. Blitz, William N. Pappano, Sarah A. Maas, .................................................................................................................................. The author inadvertently omitted to mention an earlier result1 Ken W. Y. Cho & Daniel S. Greenspan relating diffusion D, excess entropy s, density r and temperature 1=3 1=2 Bs 2 Nature 410, 475±478 (2001). T in liquids as Dr m=kBT Ae . It was interpreted as a .................................................................................................................................. convenient approximation of an essentially algebraic relation with Figures 2 and 3g contained a number of errors. The correct ®gures B changing from 0.65 for hard spheres to 0.8 for soft spheres, and A are reproduced below. M varying within 30%. The diffusion model presented in this Letter is conceptually distinct from these earlier results in recognizing that (1) liquid dynamics is controlled by the Enskog collisional mechanism, and a Chordin-Flag++ + ++ + b Chordin-Flag++ + Tsg–– + –+ + Tsg–– + (2) the rate of structural relaxation is proportional to the phase-space BMP1–+ + volume, that is, ~ es.ThisleadstoD Cj2Ges,wherej is the atomic BMP1–+ + –– – mTll-1–– – ++ – Mr 116K diameter, G is the collision frequency and C is a universal constant; Mr 116K 84K (1) is corroborated by the ®nding3 that the Kolmogorov±Sinai 84K 50K entropy in liquids, scaled by G, is universally related to s. In contrast 50K 36K 36K to the timescale used in ref. 1, G is explicitly structure dependent; 29K 29K 21K therefore, the variations of parameters in ref. 1 can be explained by 7K 21K non-universality of liquid structures. This Letter uses two-particle 7K approximation of s, but a comprehensive test for full s was reported4. cdNCI CR1CR2 CR3 CR4 Tsg-pc–+ – + –Tsg An advantage of this relation involving no adjustable parameters 15K83K 13K BMP1-Flag++ – – is that it makes it possible to test unambiguously the diffusion mTll-1-Flag ––+ + NCAnti-Flag model it quanti®es. Besides liquids, this model holds for solid ionic CR1CR2 CR3 CR4 IP: Anti-PC +Tsg Anti-PC conductors and quasicrystals. On the other hand, the relation can be 15K65K 29K 13K used to detect a dynamical transition in supercooled liquids5. M efBMP4+– + + 1. Rosenfeld, Y. Phys. Rev. A 15, 2545±2549 (1977). Tsg-pc +–+ Chordin-Flag–+ + + 2. Rosenfeld, Y. J. Phys. Cond. Matter 11, 5415±5427 (1999). Chordin-Flag –++ Tsg-pc ––– + 3. Dzugutov, M., Aurell, E. & Vulpiani, A. Phys. Rev. Lett. 81, 1762±1765 (1998). Anti-Flag Anti-Flag IP: Anti-PC IP: Anti-BMP4 4. Hoyt, J., Asta, M. & Sadigh, B. Phys. Rev. Lett. 85, 594±597 (2000). Anti-PC Anti-BMP4 .................................................................5. Dzugutov, M. J. Phys. Cond. Matter 11, 253±260 (1999). ghBMP4 +–+ Tsg-pc+– + errata Tsg-pc –++ BMP4 –++ Anti-BMP4 Anti-PC IP: Anti-PC IP: Anti-BMP4 Anti-PC Anti-BMP4 Initial sequencing and analysis Figure 2 of the human genome g CR1-Flag –++ – – – – International Human Genome Sequencing Consortium CR2/3-Flag ––– + + – – CR4-Flag –– –– – + + Tsg-pc +– +– + – + Mr 29K Nature 409, 860±921 (2001). Anti-Flag 21K .................................................................................................................................. IP: anti-PC 7K In this Article, the last name of Joseph Szustakowski was misspelled Anti-PC in the author list under the section Genome Analysis Group. (His name appeared as `Joseph Szustakowki'.) M Figure 3g 720 © 2001 Macmillan Magazines Ltd NATURE | VOL 411 | 7 JUNE 2001 | www.nature.com articles Initial sequencing and analysis of the human genome International Human Genome Sequencing Consortium* * A partial list of authors appears on the opposite page. Af®liations are listed at the end of the paper. ............................................................................................................................................................................................................................................................................ The human genome holds an extraordinary trove of information about human development, physiology, medicine and evolution. Here we report the results of an international collaboration to produce and make freely available a draft sequence of the human genome. We also present an initial analysis of the data, describing some of the insights that can be gleaned from the sequence. The rediscovery of Mendel's laws of heredity in the opening weeks of coordinate regulation of the genes in the clusters. the 20th century1±3 sparked a scienti®c quest to understand the X There appear to be about 30,000±40,000 protein-coding genes in nature and content of genetic information that has propelled the human genomeÐonly about twice as many as in worm or ¯y. biology for the last hundred years. The scienti®c progress made However, the genes are more complex, with more alternative falls naturally into four main phases, corresponding roughly to the splicing generating a larger number of protein products. four quarters of the century. The ®rst established the cellular basis of X The full set of proteins (the `proteome') encoded by the human heredity: the chromosomes. The second de®ned the molecular basis genome is more complex than those of invertebrates. This is due in of heredity: the DNA double helix. The third unlocked the informa- part to the presence of vertebrate-speci®c protein domains and tional basis of heredity, with the discovery of the biological mechan- motifs (an estimated 7% of the total), but more to the fact that ism by which cells read the information contained in genes and with vertebrates appear to have arranged pre-existing components into a the invention of the recombinant DNA technologies of cloning and richer collection of domain architectures. sequencing by which scientists can do the same. X Hundreds of human genes appear likely to have resulted from The last quarter of a century has been marked by a relentless drive horizontal transfer from bacteria at some point in the vertebrate to decipher ®rst genes and then entire genomes, spawning the ®eld lineage. Dozens of genes appear to have been derived from trans- of genomics. The fruits of this work already include the genome posable elements. sequences of 599 viruses and viroids, 205 naturally occurring X Although about half of the human genome derives from trans- plasmids, 185 organelles, 31 eubacteria, seven archaea, one posable elements, there has been a marked decline in the overall fungus, two animals and one plant. activity of such elements in the hominid lineage. DNA transposons Here we report the results of a collaboration involving 20 groups appear to have become completely inactive and long-terminal from the United States, the United Kingdom, Japan, France, repeat (LTR) retroposons may also have done so. Germany and China to produce a draft sequence of the human X The pericentromeric and subtelomeric regions of chromosomes genome. The draft genome sequence was generated from a physical are ®lled with large recent segmental duplications of sequence from map covering more than 96% of the euchromatic part of the human elsewhere in the genome. Segmental duplication is much more genome and, together with additional sequence in public databases, frequent in humans than in
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Mechanisms and Impact of Post-Transcriptional Exon Shuffling
    Mechanisms and impact of Post-Transcriptional Exon Shuffling (PTES) Ginikachukwu Osagie Izuogu Doctor of Philosophy Institute of Genetic Medicine Newcastle University September 2016 i ABSTRACT Most eukaryotic genes undergo splicing to remove introns and join exons sequentially to produce protein-coding or non-coding transcripts. Post-transcriptional Exon Shuffling (PTES) describes a new class of RNA molecules, characterized by exon order different from the underlying genomic context. PTES can result in linear and circular RNA (circRNA) molecules and enhance the complexity of transcriptomes. Prior to my studies, I developed PTESFinder, a computational tool for PTES identification from high-throughput RNAseq data. As various sources of artefacts (including pseudogenes, template-switching and others) can confound PTES identification, I first assessed the effectiveness of filters within PTESFinder devised to systematically exclude artefacts. When compared to 4 published methods, PTESFinder achieves the highest specificity (~0.99) and comparable sensitivity (~0.85). To define sub-cellular distribution of PTES, I performed in silico analyses of data from various cellular compartments and revealed diverse populations of PTES in nuclei and enrichment in cytosol of various cell lines. Identification of PTES from chromatin-associated RNAseq data and an assessment of co-transcriptional splicing, established that PTES may occur during transcription. To assess if PTES contribute to the proteome, I analyzed sucrose-gradient fractionated data from HEK293, treated with arsenite to induce translational arrest and dislodge ribosomes. My results showed no effect of arsenite treatment on ribosome occupancy within PTES transcripts, indicating that these transcripts are not generally bound by polysomes and do not contribute to the proteome.
    [Show full text]
  • The Treasure Vault Can Be Opened: Large-Scale Genome Skimming Works Well Using Herbarium and Silica Gel Dried Material
    The Treasure Vault Can be Opened: Large-Scale Genome Skimming Works Well Using Herbarium and Silica Gel Dried Material Inger Greve Alsos, Sebastien Lavergne, Marie Kristine Føreid Merkel, Marti Boleda, Youri Lammers, Adriana Alberti, Charles Pouchon, France Denoeud, Iva Pitelkova, Mihai Pușcaș, et al. To cite this version: Inger Greve Alsos, Sebastien Lavergne, Marie Kristine Føreid Merkel, Marti Boleda, Youri Lammers, et al.. The Treasure Vault Can be Opened: Large-Scale Genome Skimming Works Well Using Herbarium and Silica Gel Dried Material. Plants, MDPI, 2020, 9 (4), pp.432. 10.3390/plants9040432. hal- 02612289 HAL Id: hal-02612289 https://hal.archives-ouvertes.fr/hal-02612289 Submitted on 12 Nov 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License plants Article The Treasure Vault Can be Opened: Large-Scale Genome Skimming Works Well Using Herbarium and Silica Gel Dried Material Inger Greve Alsos 1,* , Sebastien Lavergne 2, Marie Kristine Føreid Merkel 1, Marti Boleda 2, Youri Lammers 1, Adriana Alberti 3 , Charles Pouchon 2, France Denoeud 3, Iva Pitelkova 1, 4 2,5 6 2 Mihai Pus, cas, , Cristina Roquet , Bogdan-Iuliu Hurdu , Wilfried Thuiller , Niklaus E.
    [Show full text]
  • "Evolutionary Emergence of Genes Through Retrotransposition"
    Evolutionary Emergence of Advanced article Genes Through Article Contents . Introduction Retrotransposition . Gene Alteration Following Retrotransposon Insertion . Retrotransposon Recruitment by Host Genome . Retrotransposon-mediated Gene Duplication Richard Cordaux, University of Poitiers, Poitiers, France . Conclusion Mark A Batzer, Department of Biological Sciences, Louisiana State University, Baton Rouge, doi: 10.1002/9780470015902.a0020783 Louisiana, USA Variation in the number of genes among species indicates that new genes are continuously generated over evolutionary times. Evidence is accumulating that transposable elements, including retrotransposons (which account for about 90% of all transposable elements inserted in primate genomes), are potent mediators of new gene origination. Retrotransposons have fostered genetic innovation during human and primate evolution through: (i) alteration of structure and/or expression of pre-existing genes following their insertion, (ii) recruitment (or domestication) of their coding sequence by the host genome and (iii) their ability to mediate gene duplication via ectopic recombination, sequence transduction and gene retrotransposition. Introduction genes, respectively, and de novo origination from previ- ously noncoding genomic sequence. Genome sequencing Variation in the number of genes among species indicates projects have also highlighted that new gene structures can that new genes are continuously generated over evolution- arise as a result of the activity of transposable elements ary times. Although the emergence of new genes and (TEs), which are mobile genetic units or ‘jumping genes’ functions is of central importance to the evolution of that have been bombarding the genomes of most species species, studies on the formation of genetic innovations during evolution. For example, there are over three million have only recently become possible.
    [Show full text]
  • Anti-DFNA5 Antibody (Internal) Rabbit Anti Human Polyclonal Antibody Catalog # ALS17405
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 Anti-DFNA5 Antibody (Internal) Rabbit Anti Human Polyclonal Antibody Catalog # ALS17405 Specification Anti-DFNA5 Antibody (Internal) - Product Information Application WB, IHC-P Primary Accession O60443 Predicted Human, Mouse, Rat Host Rabbit Clonality Polyclonal Calculated MW 54555 Anti-DFNA5 Antibody (Internal) - Additional Information Gene ID 1687 Alias Symbol DFNA5 Other Names DFNA5, ICERE-1, Deafness, autosomal dominant 5, ICERE1 Target/Specificity Recognizes endogenous levels of DFNA5 protein. Reconstitution & Storage PBS, pH 7.3, 0.01% sodium azide, 30% glycerol. Store at -20°C. Aliquot to avoid freeze/thaw cycles. Precautions Anti-DFNA5 Antibody (Internal) is for research use only and not for use in diagnostic or therapeutic procedures. Anti-DFNA5 Antibody (Internal) - Protein Information Name GSDME {ECO:0000303|PubMed:28459430, ECO:0000312|HGNC:HGNC:2810} Function [Gasdermin-E]: Precursor of a pore-forming protein that converts non-inflammatory apoptosis to pyroptosis (PubMed:<a href=" Page 1/2 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 http://www.uniprot.org/citations/27281216" target="_blank">27281216</a>, PubMed:<a href="http://www.uniprot.org/ci tations/28459430" target="_blank">28459430</a>). This form constitutes the precursor of the pore- forming protein: upon cleavage, the released N-terminal moiety (Gasdermin-E, N-terminal) binds to membranes and forms pores, triggering pyroptosis (PubMed:<a hr ef="http://www.uniprot.org/citations/28459 430" target="_blank">28459430</a>). Cellular Location [Gasdermin-E, N-terminal]: Cell membrane; Multi-pass membrane protein {ECO:0000250|UniProtKB:Q5Y4Y6} Tissue Location Expressed in cochlea (PubMed:9771715).
    [Show full text]
  • CD29 Identifies IFN-Γ–Producing Human CD8+ T Cells With
    + CD29 identifies IFN-γ–producing human CD8 T cells with an increased cytotoxic potential Benoît P. Nicoleta,b, Aurélie Guislaina,b, Floris P. J. van Alphenc, Raquel Gomez-Eerlandd, Ton N. M. Schumacherd, Maartje van den Biggelaarc,e, and Monika C. Wolkersa,b,1 aDepartment of Hematopoiesis, Sanquin Research, 1066 CX Amsterdam, The Netherlands; bLandsteiner Laboratory, Oncode Institute, Amsterdam University Medical Center, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands; cDepartment of Research Facilities, Sanquin Research, 1066 CX Amsterdam, The Netherlands; dDivision of Molecular Oncology and Immunology, Oncode Institute, The Netherlands Cancer Institute, 1066 CX Amsterdam, The Netherlands; and eDepartment of Molecular and Cellular Haemostasis, Sanquin Research, 1066 CX Amsterdam, The Netherlands Edited by Anjana Rao, La Jolla Institute for Allergy and Immunology, La Jolla, CA, and approved February 12, 2020 (received for review August 12, 2019) Cytotoxic CD8+ T cells can effectively kill target cells by producing therefore developed a protocol that allowed for efficient iso- cytokines, chemokines, and granzymes. Expression of these effector lation of RNA and protein from fluorescence-activated cell molecules is however highly divergent, and tools that identify and sorting (FACS)-sorted fixed T cells after intracellular cytokine + preselect CD8 T cells with a cytotoxic expression profile are lacking. staining. With this top-down approach, we performed an un- + Human CD8 T cells can be divided into IFN-γ– and IL-2–producing biased RNA-sequencing (RNA-seq) and mass spectrometry cells. Unbiased transcriptomics and proteomics analysis on cytokine- γ– – + + (MS) analyses on IFN- and IL-2 producing primary human producing fixed CD8 T cells revealed that IL-2 cells produce helper + + + CD8 Tcells.
    [Show full text]
  • Serum Albumin OS=Homo Sapiens
    Protein Name Cluster of Glial fibrillary acidic protein OS=Homo sapiens GN=GFAP PE=1 SV=1 (P14136) Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 Cluster of Isoform 3 of Plectin OS=Homo sapiens GN=PLEC (Q15149-3) Cluster of Hemoglobin subunit beta OS=Homo sapiens GN=HBB PE=1 SV=2 (P68871) Vimentin OS=Homo sapiens GN=VIM PE=1 SV=4 Cluster of Tubulin beta-3 chain OS=Homo sapiens GN=TUBB3 PE=1 SV=2 (Q13509) Cluster of Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 (P60709) Cluster of Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 (P68363) Cluster of Isoform 2 of Spectrin alpha chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTAN1 (Q13813-2) Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1 PE=1 SV=2 Cluster of Spectrin beta chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTBN1 PE=1 SV=2 (Q01082) Cluster of Pyruvate kinase isozymes M1/M2 OS=Homo sapiens GN=PKM PE=1 SV=4 (P14618) Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 Clathrin heavy chain 1 OS=Homo sapiens GN=CLTC PE=1 SV=5 Filamin-A OS=Homo sapiens GN=FLNA PE=1 SV=4 Cytoplasmic dynein 1 heavy chain 1 OS=Homo sapiens GN=DYNC1H1 PE=1 SV=5 Cluster of ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide OS=Homo sapiens GN=ATP1A2 PE=3 SV=1 (B1AKY9) Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 Dihydropyrimidinase-related protein 2 OS=Homo sapiens GN=DPYSL2 PE=1 SV=1 Cluster of Alpha-actinin-1 OS=Homo sapiens GN=ACTN1 PE=1 SV=2 (P12814) 60 kDa heat shock protein, mitochondrial OS=Homo
    [Show full text]
  • The Mystery of the Missing Centriole Solved!
    Downloaded from Carmichael’s Concise Review The Mystery of the Missing Centriole https://www.cambridge.org/core Coming Events Solved! 2018 European Microbiology Research Stephen W. Carmichael* and Jeffery L. Salisbury Conference December 3–5, 2018 Mayo Clinic, Rochester, MN 55905 Valencia, Spain http://europeanmicrobiology.madridge.com *[email protected] From Images to Knowledge with . IP address: ImageJ & Friends December 6–8, 2018 Heidelberg, Germany www.embl.de/training/events/2018/IMJ18-01 Most mammalian cells contain two centrioles that duplicate during cell division. One 170.106.33.19 American Society for Cell Biology would expect the human zygote to have two centrioles during interphase and four centrioles (ASCB) 2018 Annual Meeting during mitosis. However, four centrioles have never been shown in any mammalian zygote, December 8–12, 2018 only three. Since the human oocyte lacks centrioles, it seems the centrioles of the embryo are San Diego, CA paternally inherited. The paternal centrioles reside in the sperm neck, a region at the junction , on http://ascb.org/future-ascb-annual-meetings of the nucleus and flagellum. The neck also contains the striated columns and capitulum, 28 Sep 2021 at 15:40:20 2D Materials and Technologies which surround a relatively clear region called the vault. December 10–13, 2018 Melbourne, Australia The current dogma is that the centrioles in the sperm undergo reduction so that a www.fleet.org.au/icon2dmat sperm cell then contains one typical centriole, called the proximal centriole (PC), while the Smart NanoMaterials 2018: distal centriole (DC) disintegrates and the protein surrounding it is eliminated and replaced Advances, Innovation and Application by the vault.
    [Show full text]
  • Supplementary Figure S4
    18DCIS 18IDC Supplementary FigureS4 22DCIS 22IDC C D B A E (0.77) (0.78) 16DCIS 14DCIS 28DCIS 16IDC 28IDC (0.43) (0.49) 0 ADAMTS12 (p.E1469K) 14IDC ERBB2, LASP1,CDK12( CCNE1 ( NUTM2B SDHC,FCGR2B,PBX1,TPR( CD1D, B4GALT3, BCL9, FLG,NUP21OL,TPM3,TDRD10,RIT1,LMNA,PRCC,NTRK1 0 ADAMTS16 (p.E67K) (0.67) (0.89) (0.54) 0 ARHGEF38 (p.P179Hfs*29) 0 ATG9B (p.P823S) (0.68) (1.0) ARID5B, CCDC6 CCNE1, TSHZ3,CEP89 CREB3L2,TRIM24 BRAF, EGFR (7p11); 0 ABRACL (p.R35H) 0 CATSPER1 (p.P152H) 0 ADAMTS18 (p.Y799C) 19q12 0 CCDC88C (p.X1371_splice) (0) 0 ADRA1A (p.P327L) (10q22.3) 0 CCNF (p.D637N) −4 −2 −4 −2 0 AKAP4 (p.G454A) 0 CDYL (p.Y353Lfs*5) −4 −2 Log2 Ratio Log2 Ratio −4 −2 Log2 Ratio Log2 Ratio 0 2 4 0 2 4 0 ARID2 (p.R1068H) 0 COL27A1 (p.G646E) 0 2 4 0 2 4 2 EDRF1 (p.E521K) 0 ARPP21 (p.P791L) ) 0 DDX11 (p.E78K) 2 GPR101, p.A174V 0 ARPP21 (p.P791T) 0 DMGDH (p.W606C) 5 ANP32B, p.G237S 16IDC (Ploidy:2.01) 16DCIS (Ploidy:2.02) 14IDC (Ploidy:2.01) 14DCIS (Ploidy:2.9) -3 -2 -1 -3 -2 -1 -3 -2 -1 -3 -2 -1 -3 -2 -1 -3 -2 -1 Log Ratio Log Ratio Log Ratio Log Ratio 12DCIS 0 ASPM (p.S222T) Log Ratio Log Ratio 0 FMN2 (p.G941A) 20 1 2 3 2 0 1 2 3 2 ERBB3 (p.D297Y) 2 0 1 2 3 20 1 2 3 0 ATRX (p.L1276I) 20 1 2 3 2 0 1 2 3 0 GALNT18 (p.F92L) 2 MAPK4, p.H147Y 0 GALNTL6 (p.E236K) 5 C11orf1, p.Y53C (10q21.2); 0 ATRX (p.R1401W) PIK3CA, p.H1047R 28IDC (Ploidy:2.0) 28DCIS (Ploidy:2.0) 22IDC (Ploidy:3.7) 22DCIS (Ploidy:4.1) 18IDC (Ploidy:3.9) 18DCIS (Ploidy:2.3) 17q12 0 HCFC1 (p.S2025C) 2 LCMT1 (p.S34A) 0 ATXN7L2 (p.X453_splice) SPEN, p.P677Lfs*13 CBFB 1 2 3 4 5 6 7 8 9 10 11
    [Show full text]
  • RNA Editing at Baseline and Following Endoplasmic Reticulum Stress
    RNA Editing at Baseline and Following Endoplasmic Reticulum Stress By Allison Leigh Richards A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Human Genetics) in The University of Michigan 2015 Doctoral Committee: Professor Vivian G. Cheung, Chair Assistant Professor Santhi K. Ganesh Professor David Ginsburg Professor Daniel J. Klionsky Dedication To my father, mother, and Matt without whom I would never have made it ii Acknowledgements Thank you first and foremost to my dissertation mentor, Dr. Vivian Cheung. I have learned so much from you over the past several years including presentation skills such as never sighing and never saying “as you can see…” You have taught me how to think outside the box and how to create and explain my story to others. I would not be where I am today without your help and guidance. Thank you to the members of my dissertation committee (Drs. Santhi Ganesh, David Ginsburg and Daniel Klionsky) for all of your advice and support. I would also like to thank the entire Human Genetics Program, and especially JoAnn Sekiguchi and Karen Grahl, for welcoming me to the University of Michigan and making my transition so much easier. Thank you to Michael Boehnke and the Genome Science Training Program for supporting my work. A very special thank you to all of the members of the Cheung lab, past and present. Thank you to Xiaorong Wang for all of your help from the bench to advice on my career. Thank you to Zhengwei Zhu who has helped me immensely throughout my thesis even through my panic.
    [Show full text]
  • Role of Gasdermins in the Biogenesis of Apoptotic Cell–Derived Exosomes
    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.27.441709; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. 1 Role of Gasdermins in the Biogenesis of Apoptotic Cell–Derived Exosomes 2 Running title: Gasdermins-mediated increase of apoptotic exosomes 3 4 Jaehark Hur1,2,*, Yeon Ji Kim1,2,*, Da Ae Choi1,2,*, Dae Wook Kang1,2,*, Jaeyoung Kim3,4,*, Hyo Soon Yoo1,2, Sk 5 Abrar Shahriyar1,2, Tamanna Mustajab1,2, Dong Young Kim3,5, Yong-Joon Chwae1,2 6 7 1Department of Microbiology, Ajou University School of Medicine, Suwon, 8 Gyeonggi-do 16499, South Korea; 2Department of Biomedical Science, Graduate School of Ajou University, 9 Suwon, Gyeonggi-do 16499, South Korea; 3Department of Medicine, Graduate School of Ajou University, 10 Suwon, Gyeonggi-do 16499, South Korea; 4CK-Exogene Inc., Seoul 54853, South Korea; 5Department of 11 Otolaryngology, Ajou University School of Medicine, Suwon, Gyeonggi-do 16499, South Korea 12 13 *These authors contributed equally to this work. 14 15 Address correspondence to: Yong-Joon Chwae, Department of Microbiology, Ajou University School of 16 Medicine, 164 World Cup Road, Yeongtong-gu, Suwon, Gyeonggi-do 443-380, South Korea. Tel: +82 31 219 17 5073; Fax: +82 31 219 5079; E-mail: [email protected] 18 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.27.441709; this version posted April 27, 2021.
    [Show full text]
  • FKBP52 Regulates TRPC3-Dependent Ca<Sup>
    © 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs231506. doi:10.1242/jcs.231506 RESEARCH ARTICLE FKBP52 regulates TRPC3-dependent Ca2+ signals and the hypertrophic growth of cardiomyocyte cultures Sandra Bandleon1, Patrick P. Strunz1, Simone Pickel2, Oleksandra Tiapko3, Antonella Cellini1, Erick Miranda-Laferte2 and Petra Eder-Negrin1,* ABSTRACT A single TRPC subunit is composed of six transmembrane The transient receptor potential (TRP; C-classical, TRPC) channel domains with a pore-forming loop connecting the transmembrane ‘ ’ TRPC3 allows a cation (Na+/Ca2+) influx that is favored by the domains 5 and 6, a preserved 25 amino acid sequence called a TRP domain and two cytosolic domains, an N-terminal ankyrin repeat stimulation of Gq protein-coupled receptors (GPCRs). An enhanced TRPC3 activity is related to adverse effects, including pathological domain and a C-terminal coiled-coil domain (Eder et al., 2007; Fan hypertrophy in chronic cardiac disease states. In the present study, et al., 2018). The cytosolic domains mediate ion channel formation we identified FK506-binding protein 52 (FKBP52, also known as and are implicated in ion channel regulation and plasma membrane FKBP4) as a novel interaction partner of TRPC3 in the heart. FKBP52 targeting (Eder et al., 2007). Among several protein interaction sites, was recovered from a cardiac cDNA library by a C-terminal TRPC3 the C-terminus of all TRPC subunits harbors a highly conserved fragment (amino acids 742–848) in a yeast two-hybrid screen. proline-rich sequence that corresponds to the binding domain in the Drosophila Downregulation of FKBP52 promoted a TRPC3-dependent photoreceptor channel TRPL for the FK506-binding hypertrophic response in neonatal rat cardiomyocytes (NRCs).
    [Show full text]