Coleoptera: Cerambycidae) to Volatile and Contact Pheromones Gabriel Patrick Hughes Purdue University

Purdue University Purdue e-Pubs

Open Access Dissertations Theses and Dissertations

January 2016 The nflueI nce of Chirality on the Behavioral Responses of Longhorned Beetles (Coleoptera: Cerambycidae) to Volatile and Contact Pheromones Gabriel Patrick Hughes Purdue University

Follow this and additional works at: https://docs.lib.purdue.edu/open_access_dissertations

Recommended Citation Hughes, Gabriel Patrick, "The nflueI nce of Chirality on the Behavioral Responses of Longhorned Beetles (Coleoptera: Cerambycidae) to Volatile and Contact Pheromones" (2016). Open Access Dissertations. 1216. https://docs.lib.purdue.edu/open_access_dissertations/1216

This document has been made available through Purdue e-Pubs, a service of the Purdue University Libraries. Please contact [email protected] for additional information. THE INFLUENCE OF CHIRALITY ON THE BEHAVIORAL RESPONSES OF LONGHORNED BEETLES (COLEOPTERA: CERAMBYCIDAE) TO VOLATILE AND CONTACT PHEROMONES by Gabriel P. Hughes

A Dissertation Submitted to the Faculty of Purdue University In Partial Fulfillment of the Requirements for the degree of

Doctor of Philosophy

Department of Entomology West Lafayette, Indiana December 2016 ii

THE PURDUE UNIVERSITY GRADUATE SCHOOL STATEMENT OF DISSERTATION APPROVAL

Dr. Matthew D. Ginzel, Chair Department of Entomology Dr. Michael E. Scharf Department of Entomology Dr. Clifford S. Sadof Department of Entomology Dr. Richard Meilan Department of Forestry and Natural Resources

Approved by: Dr. Stephen L. Cameron Head of the Departmental Graduate Program

ACKNOWLEDGMENTS

I would like to thank God and my family for their tireless help and support as I have pursued my education. I thank my advisor, Dr. Matthew Ginzel, for training me in the ways of a true scientist. I thank my committee members for their support and encouragement. I have many people to thank for their assistance on individual chapters of this dissertation.

Chapter 2: I thank the Indiana Department of Natural Resources, Division of Nature Preserves and NICHES Land Trust Corporation for permitting me to collect beetles at Black Rock Barrens Nature Preserve. This research was funded by Purdue University Agricultural Research Programs, and this work was in published in Canadian Entomologist, and I express my thanks to the co-authors of this work. The manuscript is reprinted here with permission.

Hughes GP, Zou Y, Millar JG, Ginzel MD (2013) Male-produced pheromone of the North American lamiine Astyleiopus variegatus (Coleoptera: Cerambycidae) is composed of (S)-fuscumol and (S)-fuscumol acetate. Can Entomol 145: 327–332

Chapter 3: I thank the Northern Indiana Citizens Helping Ecosystems Survive (NICHES) Land Trust and Tippecanoe County Parks and Recreation Department for allowing me to conduct experiments on their properties, and B. Blood, M. Paschen, T. Stewart, and K. Strack for assistance with field work and identifying beetles. I appreciate funding support from the Alphawood Foundation of Chicago (to LMH), and the Purdue Research Foundation (to MDG). This chapter has been accepted for publication in Environmental Entomology, and I thank the coauthors of this work. This manuscript is reprinted here with permission.

Hughes GP, Meier LR, Zou Y, Millar JG, Hanks LM, Ginzel MD (accepted) Stereochemistry of fuscumol and fuscumol acetate influences attraction of longhorned beetles (Coleoptera: Cerambycidae) of the subfamily Lamiinae. Environ Entomol DOI: http://dx.doi.org/10.1093/ee/nvw101, 1271–1275 v

Chapter 4: I thank L. M. Hanks for providing pheromone lures to collect Neoclytus a. acuminatus and for supplying female N. a. acuminatus for the CHC isolation and polarimetric studies. I thank J. Hesser, T. Stewart, and K. Strack for assisting with bioassays. I thank B. Blood and T. Stewart for reviewing an early draft of the manuscript. This research was funded in part by the Purdue Research Foundation, and by Hatch project CA-R*ENT-5181-H to J.G.M. This work was published in the Journal of Chemical Ecology, and I thank the coauthors of this work. This manuscript is reprinted here with permission.

Hughes GP, Bello JE, Millar JG, Ginzel MD (2015) Determination of the absolute configuration of female-produced contact sex pheromone components of the longhorned beetle, Neocyltus acuminatus (F). J Chem Ecol 41:1050-1057

Chapter 5: I thank M. E. Scharf for his collaboration and letting me use his lab space. I thank B. F. Peterson for her guidance with experimental setup, and for reading a draft of this chapter. I thank S. Rajarapu for teaching me qRT-PCR, and M. Dittmann, A. Meyers, G. Price, and M. Rushton for their assistance in the lab. This project was funded by USDA NIFA-AFRI Predoctoral Fellowship. # 2015-03631 vi

TABLE OF CONTENTS

LIST OF TABLES ...... ix LIST OF FIGURES ...... x ABSTRACT ...... xi CHAPTER 1: REVIEW OF CHIRALITY IN THE CHEMICAL COMMUNICATION SYSTEMS OF THE LONGHORNED BEETLES (COLEOPTERA: CERAMBYCIDAE) ...... 1 1.1 Introduction ...... 1 1.1.1 Longhorned Beetles ...... 1 1.1.2 Chirality and Insect Chemical Communication ...... 2 1.2 Volatile Pheromones ...... 3 1.2.1 Male-Produced Pheromones ...... 3 1.2.2 Female-Produced Pheromones...... 5

1.3 Contact Pheromones ...... 6 1.4 Summary ...... 7 1.5 References ...... 9 CHAPTER 2: (S)-FUSCUMOL AND (S)-FUSCUMOL ACETATE PRODUCED BY A MALE ASTYLEIOPUS VARIEGATUS (COLEOPTERA: CERAMBYCIDAE) ...... 15 2.1 Abstract ...... 15 2.2 Introduction ...... 16 2.3 Methods and Materials ...... 17 2.4 Results ...... 20 2.5 Discussion ...... 21 2.6 References ...... 22 CHAPTER 3: STEREOCHEMISTRY OF FUSCUMOL AND FUSCUMOL ACETATE INFLUENCES ATTRACTION OF LONGHORNED BEETLES OF THE SUBFAMILY LAMIINAE ...... 27 3.1 Abstract ...... 27 3.2 Introduction ...... 28 vii

3.3 Methods and Materials ...... 30 3.3.1 Sources of Chemicals...... 30 3.3.2 Study Sites ...... 30 3.3.3 Field Screening Experiments ...... 30 3.4 Results ...... 32 3.5 Discussion ...... 33 3.6 References ...... 35 CHAPTER 4: DETERMINATION OF THE ABSOLUTE CONFIGURATION OF FEMALE-PRODUCED CONTACT SEX PHEROMONE COMPONENTS OF THE LONGHORNED BEETLE, NEOCLYTUS ACUMINATUS ACUMINATUS (F.) (COLEOPTERA: CERAMBYCIDAE) ...... 45 4.1 Abstract ...... 45 4.2 Introduction ...... 46 4.3 Methods and Materials ...... 48 4.3.1 Sources of Beetles ...... 48 4.3.2 Authentic Standards of Methyl-Branched CHC Enantiomers ...... 49 4.3.3 Extraction of CHCs from Female N. a. acuminatus ...... 49 4.3.4 Preparation, Fractionation, and Analysis of Cuticular Extracts ...... 50 4.3.5 Bioassays ...... 51 4.4 Results ...... 53 4.4.1 Isolation and Polarimetric Analysis fo the Most Abundant Pheromone Component of N. a. acuminatus...... 53 4.4.2 Bioassays ...... 54

4.5 Discussion ...... 54 4.6 References ...... 57 CHAPTER 5: INVESTIGATION OF PHEROMONE BIOSYNTHETIC GENES IN THE LONGHORNED BEETLE, NEOCLYTUS MUCRONATUS MUCRONATUS (F.) (COLEOPTERA: CERAMBYCIDAE) USING A DIFFERENTIAL GENE EXPRESSION APPROACH ...... 64 5.1 Abstract ...... 64 viii

5.2 Introduction ...... 65 5.2.1 Pheromone Chemistry in the Cerambycidae ...... 66 5.2.2 Pheromone Biosynthesis ...... 67 5.2.3 Pheromone Biosynthetic Genes ...... 68 5.3 Methods and Materials ...... 69 5.3.1 Source of Beetles ...... 69 5.3.2 Experimental Design...... 69 5.3.3 RNA Extraction and Sequencing ...... 69 5.3.4 Differential Gene Expression Validation ...... 70 5.4 Results ...... 71 5.4.1 RNA Sequencing and Assembly Summary ...... 71 5.4.2 Differential Gene Expression Validation ...... 71 5.5 Discussion ...... 72 5.6 References ...... 75 CHAPTER 6: CONCLUSION ...... 87 6.1 References ...... 90

VITA ...... 91

LIST OF TABLES

Table 3.1 Study sites for field experiments conducted in northwestern Indiana and east- central Illinois during 2012-2014 ...... 38 Table 3.2 Treatments for two field experiments that tested attraction of adult longhorned beetles to various chiral pheromone components and blends of components ...... 39 Table 3.3 Taxonomy and number of adult cerambycid beetles that were captured during field experiments in Indiana and Illinois in Experiments 1 and 2 ...... 40

Table 4.1 Specific rotations of 7-MeC25 isolated from N. a. acuminatus and of authentic standards of the two synthetic enantiomers. The negative specific rotation of the isolated pheromone component closely matches the specific rotation of the (R)-7-MeC25 standard ...... 63 Table 4.2 Behavioral responses of male N. a. acuminatus toward solvent-washed carcasses of females treated with enantiomers of components of the contact pheromone, as individual components or blends ...... 64 Table 5.1 List of primers used in qRT-PCR ...... 80 Table 5.2 Summary of sequencing and assembly statistics ...... 81 Table 5.3 Summary of differential expression in planned comparisons of treatments ..... 82

LIST OF FIGURES

Figure 2.1 Synthesis of chiral fuscumol and fuscumol acetate...... 24 Figure 2.2 Analyses on chiral stationary phase Cyclodex B column ...... 25 Figure 2.3 Representative total ion chromatogram of the headspace volatiles collected from male A. variegatus ...... 26 Figure 3.1 Mean (± 1 SE) number of beetles captured per trap and count period during Experiment 1 ...... 43 Figure 3.2 Mean (± 1 SE) number of beetles captured per trap and count period during Experiment 2 ...... 44

Figure 4.1 Isolation of 7-MeC25 from CHC extracts of female N. a. acuminatus. GC chromatograms ...... 61 Figure 5.1 Heatmap showing the Euclidean distances between replicates of each treatment as calculated from the regularized log transformation in Bioconductor ...... 83 Figure 5.2 Results of a validation experiment showing the correlation between fold change from qPCR analyses vs. logFC ...... 84 Figure 5.3 Box plot of normalized counts from Illumina sequencing of the putative short- chain dehydrogenase/reductase compared between the predawn and noon groups ...... 85 Figure 5.4 Box plot of normalized counts from Illumina sequencing of the putative α- esterase compared between the predawn and noon groups ...... 86

ABSTRACT

Author: Hughes, Gabriel, P. Ph.D. Institution: Purdue University Degree Received: December 2016 Title: The Influence of Chirality on the Behavioral Responses of Longhorned Beetles (Coleoptera: Cerambycidae) to Volatile and Contact Pheromones Major Professor: Matthew D. Ginzel

In this dissertation, I present research I conducted to test the hypothesis that chirality influences the behavioral resposnses of longhorned beetles to volatile and contact pheromones. Structures of pheromones in the longhorned beetles generally fall along taxonomic lines, and various structural modifications such as functional groups and stereochemistry are used to grant species spcecificity to these signals. Effects of chirality on the bioactivity of volatile pheromones has been documented in the longhorned beetle subfamily Cerambycinae, but little is known about how stereochemistry affects behavioral responses of conspecifics to contact pheromones in this subfamily, and volatile pheromones in the Lamiinae.

In Chapter 1, I review the current literature on pheromones in the longhorned beetles. I summarize known components and discuss how chirality affects behavioral responses to these compounds.

In Chapter 2, I test the hypothesis that males of the North American lamiine species, Astyleiopus vareigatus, produces fuscumol, fuscumol acetate or both, concordant with field trials in which members of this species were attracted to these compounds. I found that male A. variegatus pheromone consists of (S)-fuscumol and (S)-fuscumol acetate in a ratio of approximately 1:2.

In Chapter 3, I test the hypothesis that stereochemistry grants species specificity to the common lamiine pheromones fuscumol and fuscumol acetate. I found that traps baited with enantiomers of fuscumol or fuscumol acetate, either singly or in pairs, captured the following species in a treatment-specific way: Astyleiopus variegatus, Graphisurus xii fasciatus, Aegomorphus modestus, Astylidius parvus, and Astylopsis macula. My data suggest that chirality plays a role in maintaining species specificity in the pheromone channel, and that these compounds are likely produced by these species.

In Chapter 4, I test the hypothesis that chirality of the methyl group on the hydrocarobon contact sex pheromones of Neoclytus acuminatus acuminatus influence the behavioral response of males. I found that chirality of the major component is most important, and that the natural R-enantiomer is more bioactive than the S-enantiomer. I also found that the minor components augment the response of the male to the major component, and that even S-minor coponents appear to have a small degree of bioactivity.

In Chapter 5, I use a differential expression approach to investigate genes involved in pheromone biosynthesis in the cerambycine Neoclytus mucronatus mucronatus. I used RNA-seq to compare the expression levels of pheromone biosynthetic genes in predawn, calling and non-calling beetles at noon. I found that expression levels of both of the noon treatments appeared similar, but that non-calling beetles expressed levels of short-chain dehydrogenase/reductase and α-esterase transcripts that were greater than that expressed in the predawn beetles. These are among the first steps towards understanding pheromone biosynthesis in this subfamily of longhorned beetles. Moreover, identifying genes responsibe for the specific stereochemistry of pheromones will lead to a better understanding of how these insects establish and maintain species-specific chemical signals. 1

CHAPTER 1: REVIEW OF CHIRALITY IN THE CHEMICAL COMMUNICATION SYSTEMS OF THE LONGHORNED BEETLES (COLEOPTERA: CERAMBYCIDAE)

1.1 Introduction

1.1.1 Longhorned Beetles

The family Cerambycidae is a diverse group of beetles with over 35,000 species in ~4,000 genera worldwide (Lawrence 1982). Longhorned beetles are named for the conspicuously long, filamentous antennae of many species in the family. The larvae colonize a variety of hosts, especially trees and woody shrubs, which vary in quality from healthy to stressed, and even dead or decaying plants (Hanks 1999). Developing larvae bore into the vascular tissues of the host, which damages living plants by disrupting the flow of nutrients.

Some longhorned beetles are among the most economically important pests of natural and managed forest systems worldwide (Solomon 1995). Cerambycids are difficult to control with sprayed insecticides because much of their life cycle is spent hidden beneath the bark of trees. Longhorned beetles can also remain undetected in pallets and solid- wood packing materials that accompany transcontinental cargo shipments (USDA- APHIS 2008), providing the means for introduction to new localtions, where they have the potential to become serious pests. One notable example is the Asian longhorned beetle (ALB), Anoplophora glabripennis (Motchulsky), an exotic pest from China which infests a wide array of hardwood trees. Since its introduction in 1996, ALB has caused severe damage to trees in the northeastern US (USDA-APHIS 2008). Over 8,000 infested trees have been removed from New York, Illinois and New Jersey in an effort to control the beetle (USDA-APHIS 2005). Other longhorned beetles that are pests include the eucalyptus longhorned borer, Phoracantha semipunctata (F.), the citrus longhorned beetle, Anoplophora chinensis (Förster), and the brown fir longhorned beetle, Callidiellum villosulum (Fairmaire). 2

The morphologies, geographical ranges and host preferences of these beetles are well characterized (see volumes indexed by Linsley and Chemsak 1997), and over the past 15 years, the role and diversity of semiochemicals in host location and mating behaviors of adult longhorned beetles has grown considerably (reviewed in Millar et al. 2009). Cerambycid species in the subfamilies Cerambycinae, Lamiinae, Lepturinae, Prioninae and Spondylidinae locate suitable hosts and mates using semiochemicals, including host plant volatiles, male-produced volatile pheromones and female-produced volatile pheromones. Furthermore, males recognize females by contact pheromones in their epicuticular wax layer. A thorough understanding of the activity of these chemicals is necessary for monitoring and management efforts, and will also aid in surveying biodiversity and conservation efforts.

1.1.2 Chirality and Insect Chemical Communication

The first use of the term chirality was by Lord Kelvin (Sir William Thomson) in 1884, in a lecture at Oxford University (Kelvin 1884). Two objects are said to be chiral if they are non-superimposable mirror images. The most familiar example is the human hand; no matter how the right hand is oriented, it cannot match the left hand on all planes at once. In fact, the word chiral comes from the Greek word for hand, χειρ (cheir), and is sometimes referred to as ‘handedness’ (Riehl 2010). A pair of objects that are non- superimposable mirror images are referred to as enantiomorphs, or in the case of chemical compounds, enantiomers. A mixture containing both enantiomers is said to be racemic.

Chirality plays an important role in the chemical communication systems of insects. The first insect pheromone was identified in 1959, when Adolf Butendadt determined that female silk moths(Bombyx mori) produce the compound (10E,12Z)-hexadeca-10,12-dien- 1-ol, which he termed ‘Bombykol’ (Butenandt 1963). This was a monumental breakthrough in the science of insect communication, demonstrating that a single chemical compound was responsible for the attraction of male B. mori. However, this discovery was only the beginning of pheromone research in insects, and nearly a decade later a chiral pheromone, exo-brevicomin, was identified from Dendroctonus brevicomis 3

LeConte (Silverstein et al. 1968). This discovery confirmed that at least some insects were capable of distinguishing the differences between stereoisomers of their pheromones. Since that time, numerous examples have been discovered regarding the ways insects respond to stereoisomers of their pheromone components.

In this review, I discuss the diversity of pheromone structures and the role of chirality in the host and mate location behaviors of longhorned beetles that are mediated by volatile pheromones and contact pheromones.

1.2 Volatile Pheromones

1.2.1 Male-Produced Pheromones

Male-produced pheromones of some cerambycine species attract conspecifics across distances in excess of 100m (Lacey et al. 2004). Many of these pheromones share a common structural motif: a six-, eight- or ten-carbon chain with hydroxyl or carbonyl

groups on C2 and C3. Hydroxyl groups on these compounds are located at chiral centers, and the absolute stereochemistry has implications in the attraction of beetles in this subfamily. For example, inhibition by enantiomers or diastereomers has been observed in the subfamily Cerambycinae. Male Neoclytus mucronatus mucronatus (F.) produce the pheromone (R)-3-hydroxyhexan-2-one, and traps baited with a racemic mixture capture significantly fewer beetles than those baited with the (R)-enantiomer alone (Lacey et al. 2007). Males of the congener Neoclytus acuminatus acuminatus (F.) produce (2S,3S)-2,3- 4

hexanediol, and the opposite enantiomer does not inhibit attraction in this species. However, when both enantiomers are presented along with the diastereomers (2S,3R)- and (2R,3S)-2,3-hexanediol attraction is significantly inhibited. In yet another cerambycine, Xylotrechus colonus (F.), males produce a blend of enantiomers that are also produced by the aforementioned Neoclytus species: ~70% (R)- and 10% (S)-3- hydroxyhexan-2-one and 17% (2S,3S)- and 3% (2R,3R)-2,3-hexanediol (Lacey et al. 2009). Not surprisingly, the blend of all four compounds is most attractive to X. colonus, while traps baited with the individual components produced by the sympatric cerambycine species are less attractive (Lacey et al. 2009). Thus, it appears that chirality of pheromones may be an efficient means to maintain speciation in sympatric, synchronic species, though individual pheromone components, such as hydroxyketones and diols, can be used as generic lures to attract a variety of cerambycines (Hanks et al. 2007, Lacey et al. 2009). This topic is discussed in more detail in Chapter 3.

In spite of the widespread use of hydoxyketones and diols by members of the subfamily, a few species do not follow this general pattern. Male Megacyllene caryae (Gahan), for example, produce a pheromone that is a mixture of alkanediols, terpenoids, and aromatic alcohols, none of which are attractive individually (Lacey et al. 2008). Even (2S,3R)- and (2R,3S)-2,3-hexanediol, common pheromone components of other cerambycines, are no more attractive to female M. caryae than solvent controls unless the other compounds are present. Moreover, Rosalia funebris Motschulsky diverges from the general cerambycine pattern not only in the structure of its pheromone, (Z)-3-decenyl (E)-2-hexenoate, but also in that males do not have prothoracic gland pores, suggesting that pheromone is released from structures somewhere else on the body (Ray et al. 2009b).

(E)-6,10-Dimethyl-5,9-undecadien-2-ol (fuscumol) was first identified from the spondylidine, Tetropium fuscum (Silk et al. 2007), and represents another structural motif in male-produced pheromones. This compound has since been found to attract the congeners Tetropium castaneum and Tetropium cinnamopterum (Sweeney et al. 2010) and even a lamiine, Hedypathes betulinus (Fonseca et al. 2010). Tetropium fuscum and T. cinnamopterum produce (S)-fuscumol, while H. betulinus produces a blend of (R)- and (S)-fuscumol (82.3% and 17.6%, respectively), (R)-fuscumol acetate, and geranyl acetone 5

(Vidal et al. 2010). Fuscumol and fuscumol acetate have been shown to be general attractants for lamiines (Mitchell et al. 2011), and chirality likely plays a role in imparting specificity to these pheromone signals, as in the Cerambycinae. The influence of stereochemistry of the pheromones on the attraction of lamiines is the subject of Chapter 3.

Other lamiines appear to employ a different structure of compound in their pheromones. Male Monochamus galloprovincialis (Olivier) produce the aggregation pheromone 2- (undecyloxy)-ethanol, termed “monochamol” (Pajares et al. 2010), which is also a pheromone of several other Monochamus species, including Monochamus alternatus (Teale et al. 2011), Monochamus carolinensis (Allison et al. 2012), Monochamus s. scutellatus (Fierke et al .2012), Monochamus sutor (Pajares et al. 2013), and Monochamus titillator (Allison et al. 2012). Even though monochamol has been identified from six species in this genus, no other components have been identified (Hanks and Millar 2016). Because monochamol is achiral, it is unclear what mechanisms may lend specificity to the pheromone signal, although host plant volatiles are a likely candidate (Macias-Samano et al. 2012), and future work should investigate this matter.

1.2.2 Female-Produced Pheromones

While pheromone structure appears to generally fall along taxonomic lines, pheromone structures are occasionally shared between subfamilies and even between the sexes. Female Tragosoma pilosicorne in the subfamily Prioninae are attracted to (2S,3R)-2,3- hexanediol (Ray et al. 2012a), a pheromone structure commonly produced by male cerambycines. Field assays using diastereomers of 2,3-hexanediol revealed that the congener Tragosoma depsarium “harrisi” was also attracted to traps baited with (2S,3R)- 2,3-hexanediol, and that addition of the (R,S)-enantiomer did not inhibit attraction for either species. An additional species, Tragosoma depsarium “sp. nov Laplante”, is attracted to the (R,R)-enantiomer, and headspace volatile collection confirmed that females produce this enantiomer (Ray et al. 2012a). Cross-attraction appears to be prevented by inhibition from one or more of the diastereomers. The (S,R)- and (R,S)- diastereomers repel T. depsarium “sp. nov Laplante”, while the (R,R)-diastereomer repels 6

the other two species, lending further support to the hypothesis that chirality serves to maintain reproductive isolation among sympatric species. Further research is needed to determine how T. depsarium “harrisi” and T. pilosicorne maintain species-specific attraction, including possible differences in active period, host plant, or additional pheromone components. This study also demonstrates that pheromones, especially specific stereoisomers, are valuable tools for identifying new or cryptic species, even in species with purportedly low population densities.

Female-produced pheromones appear to be a hallmark of the subfamily Prioninae. Female Prionus californicus (Prioninae) attract males with the chemical (3R,5S)-3,5- dimethyldodecanoic acid released from an eversible sac associated with the ovipositor (Barbour et al. 2006, Rodstein et al. 2011). A female exhibits a characteristic calling behavior, whereby she raises her abdomen and extends her ovipositor while contracting the abdomen in a rhythmic pumping manner (Barbour et al. 2006, Cervantes et al. 2006). This same behavior has since been observed in numerous prionine females, including Mallodon dasystomas (Say) (Spikes et al. 2010), suggesting that female-produced sex pheromones represent a common theme within the subfamily Prioninae.

Recently the female-produced pheromone (Z)-11-octadecen-1-yl has been identified for Ortholeptura valida (LeConte), representing the first identified volatile pheromone for the subfamily Lepturinae (Ray et al. 2011). Subsequently a new pheromone motif was discovered for the Lepturinae, termed desmolactone [(4R,9Z)-hexadec-9-en-4-olide] collected from Desmocerus californicus californicus and Desmocerus aureipennis aureipennis (Ray et al. 2012b, 2014). To date only (R)-desmolactone appears to be bioactive, with two additional species attracted to baited traps: Desmocerus aureipennis cribripennis and Desmocerus californicus dimorphus, and two additional Desmocerus species were caught in traps, but not in a treatment-specific way (Ray et al. 2014).

1.3 Contact Pheromones

Once on the larval host, there is intense scramble competition for mates, and males course along the surface of the host in search of females (Hanks 1999). Males recognize females as mates only after contacting them with their antennae. After antennal contact is 7

made, a male immediately begins mating with the female, providing evidence that contact pheromones are used for mate recognition. Contact sex pheromones are located in the epicuticular wax layer of females, and have been identified for species in the subfamilies Prioninae (e.g., Barbour et al. 2007, Spikes et al. 2010), Cerambycinae (e.g., Ginzel and Hanks 2003, Ginzel et al. 2003a, b, 2006, Lacey et al. 2007a), and Lamiinae (e.g., Wang 1998, Fukaya et al. 2000, Ginzel and Hanks 2003). Most of these compounds are hydrocarbons, but ketones (Yasui et al. 2003) and lactones (Yasui et al. 2007) act as contact pheromones in Anoplophora malasiaca (Thomson). To date, contact chemoreception appears to be a universal mate recognition strategy in the Cerambycidae. The contact pheromone of female Megacyllene robiniae (Förster) is comprised of a single compound, (Z)-9-pentacosene (Ginzel et al. 2003b), as is the contact pheromone of M. caryae (Gahan), (Z)-9-nonacosene (Ginzel et al. 2006). Others, such as those found on female Xylotrechus colonus, are comprised of three separate compounds: n-pentacosane, 9-methylpentacosane, and 3-methylpentacosane (Ginzel et al. 2003a). Chemoreceptors in the antennae allow males to detect these compounds on the surface of females (Lopes et al. 2005). For many species, visual cues play little or no part in mate recognition. In fact, males attempt to mate with glass rods or gelatin capsule models treated with female extract, demonstrating that visual or behavioral cues are absent or subordinate to contact chemoreception (Kim et al. 1992, Fukaya et al. 1996, Barbour et al. 2007).

As with host volatiles, the effect of chirality in the contact chemoreception of longhorned beetles is poorly understood. Effects of chirality in the contact chemoreception of other insects is reviewed in Chapter 4.

1.4 Summary

Chemical communication plays an integral role in the mating systems of longhorned beetles. With over 35,000 species worldwide, we have only just begun to understand the diversity of compounds and behavioral strategies employed by members of this family. Patterns of attraction and pheromone chemistry have been observed in many longhorned beetles, but variations in those patterns exist. In many species, males are the pheromone- producing sex, but female-produced sex pheromones are found in the Prioninae and 8

Lepturinae (Barbour et al. 2006; Cervantes et al. 2006; Ray et al. 2011, 2012a, 2012; Spikes et al. 2010). Alkanediols and hydroxyketones were once thought to be unique to the cerambycines, but are now known to be used by female prionines, as well (Ray et al. 2012a). Emerging phylogenetic trends in both behavior and pheromone structure may facilitate more rapid progress toward our understanding of this family, and deviations from these patterns may lend insights into the evolution of longhorned beetles.

It is clear that chirality plays a role in limiting cross-attraction of species with structurally similar pheromones. Advances in our understanding of the semiochemistry of the Cerambycidae may lead to new methods for monitoring endemic and exotic beetle pests. In fact, generic lures have been used in several studies to trap a variety of longhorned beetles with just a few compounds (see chapter 3). Pheromone components, host volatiles, and even bark beetle pheromones have been used to capture longhorned beetles, and further studies will likely result in more effective lures.

The overall goal of this research was to fill gaps in our knowledge regarding the effects of chirality on chemical signaling in the Cerambycidae. Specifically, I tested the hypotheses that 1) Lamiines produce and respond to specific enantiomers of fuscumol and fuscumol acetate; 2) longhorned beetles are capable of discriminating between enantiomers of their contact pheromone components; and 3) pheromone biosynthetic genes are more highly expressed in actively calling male Neoclytus m. mucronatus, allowing for identification of genes that may confer specific stereochemistry to the pheromone.

1.5 References

Allison JD, McKenney JL, Millar JG, McElfresh JS, Mitchell RF, Hanks LM (2012) Response of the woodborers Monochamus carolinensis and Monochamus titillator (Coleoptera: Cerambycidae) to known cerambycid pheromones in the presence and absence of the host plant volatile α-pinene. Environ Entomol 41:1587–1596 Barbour JD, Cervantes DE, Lacey ES, Hanks LM (2006) Calling behavior in the primitive longhorned beetle Prionus californicus Mots. J Insect Behav 19:623– 629 Barbour JD, Lacey ES, Hanks LM (2007) Cuticular hydrocarbons mediate mate recognition in a species of longhorned beetle (Coleoptera: Cerambycidae) of the primitive subfamily Prioninae. Ann Entomol Soc Am 100:333–338 Butenandt A (1963) Bombycol, sex-attractive substance of silkworm, Bombyx mori. J Endocrinol 27:9. Cervantes DE, Hanks LM, Lacey ES, Barbour JD (2006) First documentation of a volatile sex pheromone in a longhorned beetle (Coleoptera: Cerambyicidae) of the primitive subfamily Prioninae. Ann Entomol Soc Am 99:718–722 Collignon RM, Swift IP, Zou Y, McElfresh JS, Hanks LM, Millar JG (2016) The influence of host plant volatiles on the attraction of longhorn beetles to pheromones. J Chem Ecol 42:215–229 Fierke MK, Skabeikis DD, Millar JG, Teale SA, McElfresh JS, Hanks LM (2012) Identification of a male-produced aggregation pheromone for Monochamus scutellatus scutellatus and an attractant for the congener Monochamus notatus (Coleoptera: Cerambycidae). J Econ Entomol 105:2029-2034e Fonseca MG, Vidal DM, Zarbin PHG (2010) Male-produced sex pheromone of the cerambycid beetle Hedypathes betulinus: chemical identification and biological activity. J Chem Ecol 36:1132–1139

Fukaya M, Akino T, Yasuda T, Wakamura S, Satoda S, Senda S (2000) Hydrocarbon components in contact sex pheromone of the white-spotted longicorn beetle, Anoplophora malasiaca (Thomson) (Coleoptera: Cerambycidae) and pheromonal activity of synthetic hydrocarbons. Entomol Sci 3:211–218 Fukaya M, Yasuda T, Wakamura S, Honda H (1996) Reproductive biology of the yellow- spotted longicorn beetle, Psacothea hilaris (Pascoe) (Coleoptera: Cerambycidae). 3. Identification of contact sex pheromone on female body surface. J Chem Ecol 22:259–270 Ginzel MD (2010) Hydrocarbons as contact pheromones of longhorned beetles (Coleoptera: Cerambycidae). In: Blomquist GJ, Bagnères AG (eds) Insect hydrocarbons: biology, biochemistry and chemical ecology. Cambridge Press, New York Ginzel MD, Blomquist GJ, Millar JG, Hanks LM (2003a) Role of contact pheromones in mate recognition in Xylotrechus colonus. J Chem Ecol 29:533–545 Ginzel MD, Hanks LM (2003) Contact pheromones as mate recognition cues of four species of longhorned beetles (Coleoptera: Cerambycidae). J Insect Behav 16:181–187 Ginzel MD, Hanks LM (2005) Role of host plant volatiles in mate location for three species of longhorned beetles. J Chem Ecol 31:213–217 Ginzel MD, Millar JG, Hanks LM (2003b) (Z)-9-Pentacosene – contact sex pheromone of the locust borer, Megacyllene robiniae. Chemoecology 13:135–141 Ginzel MD, Moreira JA, Ray AM, Millar JG, Hanks LM (2006) (Z)-9-nonacosene-major component of the contact sex pheromone of the beetle Megacyllene caryae. J Chem Ecol 32:435–451 Hanks LM (1999) Influence of the larval host plant on reproductive strategies of cerambycid beetles. Annu Rev Entomol 44:483–505 Hanks LM, Millar JG (2016) Sex and aggregation-sex pheromones of cerambycid beetles: Basic science and practical applications. J Chem Ecol 42:631–654

Hanks LM, Millar JG, Moreira JA, Barbour JD, Lacey ES, McElfresh JS, Reuter FR, Ray AM (2007) Using generic pheromone lures to expedite identification of aggregation pheromones for the cerambycid beetles Xylotrechus nauticus, Phymatodes lecontei, and Neoclytus modestus modestus. J Chem Ecol 33:889– 907 Kelvin WT (1884) The second Robert Boyer lecture. J. Oxford Univ Junior Sci Club 18:25 Kim GH, Takabayashi J, Takahashi S, Tabata K (1992) Function of pheromones in mating behavior of the Japanese pine sawyer, Monochamus alternatus Hope. Appl Entomol Zool 27:489–497 Lacey ES, Ginzel MD, Millar JG, Hanks LM (2004) Male-produced aggregation pheromone of the Cerambycid beetle Neoclytus acuminatus acuminatus. J Chem Ecol 30: 1493–1507 Lacey ES, Millar JG, Moreira JA, Hanks LM (2009) Male-produced aggregation pheromones of the cerambycid beetles Xylotrechus colonus and Sarosesthes fulminans. J Chem Ecol 35:733–740 Lacey ES, Moreira JA, Millar JG, Hanks LM (2008) A male-produced aggregation pheromone blend consisting of alkanediols, terpenoids, and an aromatic alcohol from the cerambycid beetle Megacyllene caryae. J Chem Ecol 34:408–417 Lacey ES, Moreira JA, Millar JG, Ray AM, Hanks LM (2007a) Male-produced aggregation pheromone of the cerambycid beetle Neoclytus mucronatus mucronatus. Entomol Exp Appl 122:171–179 Lawrence JF (1982) Coleoptera. In: Parker SP (ed) Synopsis and Classification of Living Organisms, Vol. 2, pp. 482–553. New York: McGraw-Hill Linsley EG, Chemsak JA (1997) The Cerambycidae of North America, Part VIII: Bibliography, index, and host plant index. Univ Calif Publ Entomol 117:1–534 Lopes O, Marques PC, Araujo J (2005) The role of antennae in mate recognition in Phoracantha semipunctata (Coleoptera: Cerambycidae). J Insect Behav 18:243– 257

Macias-Samano JE, Wakarchuk D, Millar JG, Hanks LM (2012) 2-Undecyloxy-1-ethanol in combination with other semiochemicals attracts three Monochamus species (Coleoptera: Cerambycidae) in British Columbia, Canada. Can. Entomol. 144:821–825 Millar JG, Hanks LM, Moreira JA, Barbour JD, Lacey ES (2009) Pheromone Chemistry of Cerambycid Beetles. In: Nakamuta K, Millar JG (eds) Chemical Ecology of Wood-boring Insects. Forestry and Forest Products Research Institute, Ibaraki, Japan, pp 52–79 Noldt U, Fettkötther R, Dettner K (1995) Structure of the sex pheromone-producing prothoracic glands of the male old house borer, Hylotrupes bajulus (L.) (Coleoptera: Cerambycidae). Int J Insect Morphol Embryol 24:223–234 Pajares JA, Alvarez G, Ibeas F, Gallego D, Hall DR, Farman DI (2010) Identification and field activity of a male-produced aggregation pheromone in the pine sawyer beetle, Monochamus galloprovincialis. J Chem Ecol 36:570–583 Pajares JA, Álvarez G, Hall DR, Douglas P, Centeno F, Ibarra N, Schroeder M, Teale SA, Wang Z, Yan S, Millar J, Hanks LM (2013) 2-(Undecyloxy)-ethanol is a major component of the male-produced aggregation pheromone of Monochamus sutor. Entomol Exp Appl 149:118-127 Ray AM, Arnold RA, Swift IP, Schapker PA, McCann S, Marshall CJ, McElfresh JS, Millar JG (2014) (R)-Desmolactone is a sex pheromone or sex attractant for the endangered valley elderberry longhorn beetle Desmocerus californicus dimorphus and several congeners (Cerambycidae: Lepturinae) PLos ONE 9(12):e115498. doi: 10.1371/journal.pone.0115498 Ray AM, Barbor JD, McElfresh JS, Moreira JA, Swift IP, Wright IM, Alenka W, Žunič A, Mitchell RF, Graham EE, Alten RL, Millar JG, Hanks LM (2012a) 2,3- hexanediols as sex attractants and a female-produced sex pheromone for cerambycid beetles in the prionine genus Tragosoma J Chem Ecol 38:1151–1158 Ray AM, Lacey ES, Hanks LM (2006) Predicted taxonomic patterns in pheromone production by longhorned beetles. Naturwissenschaften 93:543–550 13

Ray AM, Millar JG, McElfresh JS, Swift IP, Barbour JD, Hanks LM (2009a) Male- produced aggregation pheromone of the cerambycid beetle Rosalia funebris. J Chem Ecol 35:96–103 Ray AM, Swift IP, McElfresh JS, Alten RL, Millar JG (2012b) (R)-Desmolactone, a female-produced sex pheromone component of the cerambycid beetle Desmocerus californicus californicus (subfamily Lepturinae) J Chem Ecol 38:157–167 Ray AM, Žunič A, Alten RL, McElfresh JS, Hanks LM, Millar JG (2011) cis-Vaccenyl acetate, a sex attractant pheromone of Ortholeptura valida, a longhorned beetle in the subfamily Lepturinae. J Chem Ecol (online) Riehl JP (2010) Mirror-Image Asymmetry: An Introduction to the Origin and Consequences of Chirality. John Wiley & Sons, Inc., Hoboken, New Jersey Rodstein J, Millar JG, Barbour JD, McElfresh JS, Wright IM, Barbour KS, Ray AM, Hanks LM (2011) Determination of the relative and absolute configurations of the female-produced sex pheromone of the cerambycid beetle Prionus californicus. J Chem Ecol 37:114–124 Silk PJ, Sweeney J, Wu JP, Price J, Gutowski JM, Kettela EG (2007) Evidence for a male-produced pheromone in Tetropium fuscum (F.) and Tetropium cinnamopterum (Kirby) (Coleoptera: Cerambycidae). Naturwissenschaften 94:697–701 Silverstein RM, Brownlee RG, Bellas TE, Wood DL, Browne LE (1968) Brevicomin: principal sex attractant in the frass of the female western pine beetle. Science 159:889–91 Solomon JD (1995) Guide to Insect Borers in North American Broadleaf Trees and Shurbs. USDA Forest Service Agric Handbk 706m Washington, DC Spikes AE, Paschen MA, Millar JG, Moreira JA, Hamel PB, Schiff NM, Ginzel MD (2010) First contact pheromone identified for a longhorned beetle (Coleoptera: Cerambycidae) in the subfamily Prioninae. J Chem Ecol 36:943–954

Sweeney JD, Silk PJ, Gutowski JM, Wu J, Lemay MA, Mayo PD, Magee DI (2010) Effect of chirality, release rate, and host volatiles on response of Tetropium fuscum (F.), Tetropium cinnamopterum Kirby, and Tetropium castaneum (L.) to the aggregation pheromone, fuscumol. J Chem Ecol 36:1309–1321 USDA-APHIS (2005) Asian longhorned beetle cooperative eradication program strategic plan, http://www.aphis.usda.gov/plant_health/plant_pest_info/asian_lhb/downloads/stra tegic.pdf, last accessed March, 27, 2011 USDA-APHIS (2008) Emergency domestic programs: Asian longhorned beetle, http://www.aphis.usda.gov/plant_health/plant_pest_info/asian_lhb/background.sht ml, last accessed April 10, 2009 Vidal DM, Fonseca MG, Zarbin PHG (2010) Enantioselective synthesis and absolute configuration of the sex pheromone of Hedypathes betulinus (Coleoptera: Cerambycidae). Tetrahedron Lett 51:6704–6706 Wang Q (1998) Evidence for a contact female sex pheromone in Anoplophora chinensis (Förster) (Coleoptera: Cerambycidae: Lamiinae). Coleopts Bull 52:363–368 Yasui H, Akino T, Yasuda T, Fukaya M, Ono H, Wakamura S (2003) Ketone components in the contact sex pheromone of the white-spotted longicorn beetle, Anoplophora malasiaca, and pheromonal activity of synthetic ketones. Entomol Exp Appl 107:167–176 Yasui H, Akino T, Yasuda T, Fukaya M, Wakamura S, Ono H (2007) Gomadalactones A, B, and C: novel 3-oxabicyclo[3.3.0]octane compounds in the contact sex pheromone of the white-spotted longicorn beetle, Anoplophora malasiaca. Tet Lett 48:2395–2400 15

CHAPTER 2: (S)-FUSCUMOL AND (S)-FUSCUMOL ACETATE PRODUCED BY A MALE ASTYLEIOPUS VARIEGATUS (COLEOPTERA: CERAMBYCIDAE)

2.1 Abstract

Within the family Cerambycidae (Coleoptera), (E)-6,10-dimethyl-5,9-undecadien-2-ol (fuscumol), and (E)-6,10-dimethyl-5,9-undecadien-2-yl acetate (fuscumol acetate) have been shown to attract several species in the subfamily Lamiinae. However, it is not yet clear whether beetles within the subfamily actually produce these compounds as pheromones or rather respond to them as kairomones. I report here that male Astyleiopus variegatus (Haldeman) produce both fuscumol and fuscumol acetate, suggesting that the compounds are indeed pheromones for this species. The absolute configurations of these compounds were determined to be (S)-fuscumol and (S)-fuscumol acetate by synthesis of both enantiomers of each. 16

2.2 Introduction

The chemical structures of volatile sex and aggregation pheromones of cerambycid beetles (Coleoptera: Cerambycidae) are often highly conserved within genera and subfamilies. For example, males of a number of species in the subfamily Cerambycinae produce pheromones that are 6, 8, or 10 carbons in length with hydroxyl or carbonyl groups on C2 and C3 (reviewed in Millar et al. 2009). In the subfamily Lamiinae, male Monochamus galloprovincialis (Olivier) produce the aggregation pheromone 2- (undecyloxy)-ethanol, termed “monochamol” (Pajares et al. 2010), which is also a pheromone of several other Monochamus Dejean species (Teale et al. 2011, Hanks et al. 2012). Moreover, several other lamiine species are attracted to (E)-6,10-dimethyl-5,9- undecadien-2-ol (fuscumol), the pheromone of Tetropium fuscum (Fabricius) (Cerambycidae: Spondylidinae) (Silk et al. 2007, Mitchell et al. 2011). The analogue (E)- 6,10-dimethyl-5,9-undecadien-2-yl acetate (fuscumol acetate), which is a pheromone component of the South American Hedypathes betulinus (Klug) (Cerambycidae: Lamiinae), is also attractive to several other lamiine species (Fonseca et al. 2010, Mitchell et al. 2011). There is evidence that some cerambycid beetles are attracted to pheromone components that are not produced by their species (Hanks et al. 2007, Mitchell et al. 2011), and to date, it was unclear whether lamiines that were attracted to fuscumol and fuscumol acetate actually produced these compounds, or instead exploited them as kairomones to find desirable hosts. Until now, there have been no reports that North American lamiines produce either of these two compounds.

Astyleiopus variegatus (Haldeman) is a North American lamiine species in the tribe Acanthocinini. The larvae feed in the branches of Kentucky coffeetree (Gymnocladus dioicus (Linnaeus) Koch, Fabaceae) and red buckeye (Aesculus pavia Linnaeus; Sapindaceae); they also infest various hardwoods, shrubs, vines, and conifers (Yanega 1996, Lingafelter 2007). Adult beetles are attracted to ultraviolet lights, suggesting they may be nocturnal (Yanega 1996). Both sexes are attracted to racemic (E/Z)-fuscumol or (E/Z)-fuscumol acetate as individual components or as a blend (Mitchell et al. 2011, Hanks et al. 2012). Here, I report that males of A. variegatus do indeed produce both 17

fuscumol and fuscumol acetate, and determine the absolute configurations of these two pheromone components.

2.3 Methods and Materials

One live male A. variegatus was collected on 8 August 2011 from a cross-vane flight- intercept panel trap (Alpha Scents Inc., Portland, Oregon, United States of America) located at Purdue University Martell Forest, Tippecanoe Co., Indiana, United States of America. One live female A. variegatus was captured on 22 July 2012 and two males were captured on 8 August 2012 in panel traps located at Black Rock Barrens Nature Preserve, Warren Co., Indiana, United States of America (Permit # NP12-26). Traps were suspended from frames constructed of polyvinyl chloride (PVC) pipe (see Graham et al. 2010) and baited with a lure that contained 100 mg of a 1:1 mixture of racemic (E/Z)- fuscumol mixed with 1 ml of ethanol in a polyethylene sachet suspended from the center of the trap.

On the day beetles were captured, a single A. variegatus was placed in a glass vacuum trap (0.3 L) with aluminum screen provided as a perch. An adsorbent filter made of a disposable glass pipette containing 100 mg of 80/100 mesh HayeSep®-Q (Ohio Valley Specialty Company, Marietta, Ohio, United States of America) was attached to one end of the vacuum trap with a 5-cm long section of Tygon® tubing (Saint-Gobain Precision Plastics, Aurora, OH, United States of America), and a filter containing 0.3 g of activated charcoal was attached to the other end. Air was pulled through the charcoal filter and into the apparatus by a vacuum attached to a variable power source to control the flow (~0.8 L min-1). Aerations were conducted in a greenhouse under natural day/night cycle. In 2011, headspace volatiles were collected for a diurnal (10:00–18:00 hours) and a nocturnal period (18:00–10:00 hours) over four consecutive periods from 8–10 August. Volatiles were also collected concurrently from an empty vacuum trap as a control. A single female A. variegatus was aerated for one diurnal (10:00–18:00 hours) and one nocturnal period (18:00–10:00 hours) from 20–21 July 2012. Two males were also aerated simultaneously in separate vacuum traps for a diurnal and nocturnal period from 8–9 August 2012. After each collection period, the adsorbent filter was eluted with three 0.5- 18

mL aliquots of methylene chloride (CH2Cl2) and replaced with a new filter. Extracts were stored at -20 °C until analysis.

Samples were analysed by coupled gas chromatography-mass spectrometry (GC-MS) with electron impact ionization (EI, 70 eV) using a Hewlett-Packard 6890 GC (Hewlett- Packard, Sunnyvale, CA, United States of America) equipped with a DB-5MS capillary column (30 m × 0.25 mm × 0.25 μm film; J&W Scientific, Folsom, California, United States of America) in splitless mode, interfaced to an HP 5973 mass selective detector (Hewlett-Packard, Sunnyvale, CA, United States of America), with helium carrier gas. The oven temperature was programmed from 40 °C for 1 min, ramped to 250 °C at 10 °C min-1, and held for 5 min at 250 °C. Injector temperature was 100 °C. Compounds were identified by matching their retention times and mass spectra with those of authentic standards (see below).

Chiral fuscumol and fuscumol acetate were prepared by kinetic resolution of fuscumol with an immobilised lipase, similar to the method of Vidal et al. (2010; see Fig. 2.1) by Y. Zou and J. G. Millar. Thus, racemic fuscumol (2 g, Bedoukian Research, Danbury, CT, United States of America), 4 mL vinyl acetate, 25 mL methyl t-butyl ether (MTBE), and 0.6 g of Candida antarctica lipase immobilised on acrylic resin (Sigma-Aldrich, St. Louis, MO, United States of America, product L4777) were combined in a 125-mL Erlenmeyer flask, and the mixture was stirred on an orbital shaker (32 °C, 100 rpm) for 35 min, at which point the ratio of fuscumol to fuscumol acetate was determined to be 53:46. The enzyme was removed by filtration, and after concentration, the residue was purified by vacuum flash chromatography on silica gel (hexane/EtOAc, 95:5 to 5:1) to give (R)-fuscumol acetate (0.96 g, 97.6% ee) and (S)-fuscumol (1.08 g, 75.8% ee). The immobilised enzyme was dried and saved for reuse.

Enantiomeric purities were determined by analysis on a Cyclodex B column (J&W Scientific, Folsom, CA, United States of America) programmed from 40 °C for 2 minutes, then ramped at 3 °C min-1 to 220 °C. The fuscumol acetate enantiomers were resolved to baseline (Fig. 2.2A (S): 41.82 minutes, (R): 42.11 minutes). However, fuscumol was not well resolved, so a sample of the enantiomerically enriched (S)- 19

fuscumol was converted to its acetate. Thus, 0.020 g (S)-fuscumol, 1 mL CH2Cl2, 16 μl pyridine, 14 μL acetic anhydride, and a catalytic amount of dimethylaminopyridine

(DMAP) were stirred overnight. Saturated aqueous NaHCO3 was then added and the mixture was stirred for 20 min. The mixture was then extracted with hexane, and the

hexane layer was washed with 1 M HCl and brine, then dried over anhydrous Na2SO4 before analysis on the Cyclodex B column as described above.

The enantiomerically enriched (S)-fuscumol was subjected to kinetic resolution again (0.3 g lipase, 2 ml vinyl acetate, 13 ml MTBE) for 90 min (GC ratio: fuscumol 84.3%, fuscumol acetate 14.9%). After filtration and concentration, the residue was purified by vacuum flash chromatography to give (S)-fuscumol (0.89 g, 98.8% ee).

(R)-fuscumol was obtained from reduction of (R)-fuscumol acetate with LiAlH4. Thus, a solution of (R)-fuscumol acetate (3.94 g, 16.5 mmol) in THF (10 mL) was added to a

suspension of LiAlH4 (0.63 g, 16.5 mmol) in THF (35 mL) cooled at 0 °C. The mixture was stirred for 2.5 h while gradually warming to room temperature, then cooled to 0 °C and quenched by sequential addition of water (0.63 mL), 15% aqueous NaOH (0.63 mL), and water (1.89 mL). After stirring for 10 min, the mixture was filtered through Celite® (Fisher Scientific, Fairlawn, New Jersey, United States of America) to remove the white

granular precipitate, and the filtrate was dried over anhydrous Na2SO4 and concentrated to give (R)-fuscumol (3.08 g, 95% yield).

(S)-Fuscumol acetate was obtained from acetylation of (S)-fuscumol. A solution of (S)- fuscumol (2.38 g, 12.1 mmol), pyridine (2.0 mL, 24.2 mmol), and DMAP (0.074 g, 0.61

mmol) in CH2Cl2 (25 mL) was cooled to 0 °C and acetic anhydride (1.7 mL, 18.2 mmol) was added. The mixture was stirred for 3 h at room temperature, then saturated aqueous

NaHCO3 was added and the mixture was stirred for 20 min. The mixture was extracted with hexane and the organic layer was washed with 1 M HCl, water, and brine, and dried

over Na2SO4. The crude product was purified by vacuum flash chromatography (hexane/EtOAc = 95:5) to give (S)-fuscumol acetate (2.72 g, 94% yield).

For long-term storage, the enantiomers of fuscumol and fuscumol acetate were Kugelrohr distilled to remove traces of silica gel and other nonvolatile impurities that might catalyse 20

degradation. Fuscumol was distilled at an oven temperature of ~90–95 ºC (0.1 Torr), and fuscumol acetate distilled at ~95–100 ºC (0.1 Torr).

The absolute configurations of fuscumol and fuscumol acetate in extracts of insect- produced volatiles were determined on a Cyclodex B column as described above. The extract was first analysed without derivatisation to determine the absolute configuration of the insect-produced fuscumol acetate. Because the fuscumol enantiomers were not resolved, the extract was then acetylated, and reanalysed. Thus, ~100 μL of extract was mixed with 25 μL of a 20-mg/mL solution of acetyl chloride in ether and 25 μL of a 40- mg/mL solution of pyridine in ether in a 1-mL glass test tube. The test tube was sealed and held at room temp for 4 h. Then 5 μL of ethanol was added, and the solution was held a further 2 h. The mixture was then concentrated under a stream of nitrogen, and partitioned between 100 μL water and 200 μL of pentane, vortexing to mix. The pentane layer was removed, and the aqueous layer was extracted with a further 100 μL of pentane.

The combined pentane extracts were dried over anhydrous Na2SO4 and analysed on the Cyclodex B column as described above.

2.4 Results

Two of the extracts of volatiles collected from the male A. variegatus captured in 2011 were dominated by two large peaks (Fig. 2.3) that were identified as fuscumol (diagnostic ions: m/z 196, 178, 109, 69) and fuscumol acetate (diagnostic ions: m/z 248, 178, 109, 69) by comparison of their mass spectra and retention times with those of standards. These two compounds were only present in overnight aerations (18:00–10:00 hours), suggesting that males release pheromone at night. Fuscumol and fuscumol acetate were also absent in both of thedaytime aerations taken between the two nocturnal aerations, and all of the control samples, proving that these compounds were not simply contaminants. Furthermore, at the time of these collections, we also did not have fuscumol and fuscumol acetate enantiomers available, whereas the fuscumol and fuscumol acetate found in the aeration extracts were enantiomerically pure (see below). Fuscumol and fuscumol acetate were not detected in extracts from either of the males or the one female A. variegatus aerated in 2012. 21

Fuscumol and fuscumol acetate were released in an approximately 1:2 ratio during each calling period (n = 2; 184 ± 60 μg and 396 ± 71 μg, respectively). In field tests, both male and female A. variegatus were attracted to traps baited with either fuscumol or fuscumol acetate, but displayed a stronger response to a blend of both compounds (Mitchell et al. 2011, Hanks et al. 2012). The fact that males produce both compounds provides an explanation for their increased attraction to the blend.

Analysis of an underivatised aliquot of the aeration extract on a chiral stationary phase GC column showed that the insects produced (S)-fuscumol acetate of at least 97% enantiomeric purity (Fig. 2.2B). Reanalysis of the extract after acetylation showed that only the peak due to (S)-fuscumol acetate was enhanced (Fig. 2.2D), confirming that the insects produced (S)-fuscumol, as might be expected from the presence of (S)-fuscumol acetate.

(S)-Fuscumol is also produced by male T. fuscum and Tetropium cinnamopterum Kirby in the subfamily Spondylidinae (Sweeney et al. 2010). In contrast, in the subfamily Lamiinae, male Hedypathes betulinus (Klug) (tribe Acanthoderini) are reported to produce a scalemic blend of (R)- and (S)-fuscumol (82.3% and 17.6%, respectively), (R)- fuscumol acetate, and geranyl acetone (Vidal et al. 2010).

2.5 Discussion

Despite my attempts to collect pheromones from 10 other species of lamiines on 31 different occasions in Indiana, United States of America, I have successfully collected and characterised possible pheromone compounds only from this single male A. variegatus to date, suggesting that lamiines do not readily call under the unnatural conditions imposed by headspace analyses in the laboratory. I believe this to be the first report of a North American cerambycid species in the subfamily Lamiinae being shown to produce fuscumol and its acetate, and the first report of a cerambycid producing (S)- fuscumol acetate. Although various species may superficially appear to use similar pheromones composed of fuscumol and/or fuscumol acetate, the chirality of each compound must be taken into consideration because the enantiomers may be perceived as different structures by the insect species that use these compounds as pheromones. 22

2.6 References

Fonseca MG, Vidal DM, Zarbin PG (2010) Male-produced sex pheromone of the cerambycid beetle Hedypathes betulinus: chemical identification and biological activity. J Chem Ecol 36:1132–1132 Graham EE, Mitchell RF, Reagel PF, Barbour JD, Millar JG, Hanks LM (2010) Treating panel traps with flouropolymer enhances their efficiency in capturing cerambycid beetles. J Econ Entomol 103:641–647 Hanks LM, Millar JG, Mongold-Diers JA, Wong JCH, Meier LR, Reagel PF, Mitchell RF (2012) Using blends of cerambycid beetle pheromones and host plant volatiles to simultaneously attract a diversity of cerambycid species. Can J Forest Res 42:1050–1059 Hanks LM, Millar JG, Moreira JA, Barbour JD, Lacey ES, McElfresh JS, Reuter FR, Ray AM (2007) Using generic pheromone lures to expedite identification of aggregation pheromones for the cerambycid beetles Xylotrechus nauticus, Phymatodes lecontei, and Neoclytus modestus modestus. J Chem Ecol 33:889– 907 Lingafelter SW (2007) Illustrated key to the longhorned woodboring beetles of the eastern United States. The Coleopterists Society Miscellaneous Publication No. 3, North Potomac, Maryland, United States of America, pp. 206 Millar JG, Hanks LM, Moreira JA, Lacey ES (2009) Pheromone chemistry of cerambycid beetles. In: Chemical ecology of wood-boring insects. Nakamuta K and Millar J (eds) Forestry and Forest Products Research Institute, Ibaraki, Japan. pp. 52–79 Mitchell RF, Graham EE, Wong JCH, Reagel PF, Striman BL, Hughes GP, Paschen MA, Ginzel MD, Millar JG, Hanks LM (2011) Fuscumol and fuscumol acetate are general attractants for many species of cerambycid beetles in the subfamily Lamiinae. Entomol Exp Appl 141:71–77 Pajares JA, Álvarez G, Ibeas F, Gallego D, Hall DR, Farman DI (2010) Identification and field activity of a male-produced aggregation pheromone in the pine sawyer beetle, Monochamus galloprovincialis. J Chem Ecol 36:570–583 23

Silk PJ, Sweeney J, Wu JP, Price J, Gutowski JM, Kettela EG (2007) Evidence for a male-produced pheromone in Tetropium fuscum (F.) and Tetropium cinnamopterum (Kirby) (Coleoptera: Cerambycidae). Naturwissenschaften 94:697–701 Sweeney JD, Silk PJ, Gutowski JM, Wu J, Lemay MA, Mayo PD, Magee DI (2010) Effect of chirality, release rate, and host volatiles on response of Tetropium fuscum (F.), Tetropium cinnamopterum Kirby, and Tetropium castaneum (L.) to the aggregation pheromone, fuscumol. J Chem Ecol 36:1309–1321 Teale SA, Wickham JD, Zhang F, Su J, Chen Y, Xiao W, Hanks LM, Millar JG (2011) A male-produced aggregation pheromone of Monochamus alternatus (Coleoptera: Cerambycidae), a major vector of pine wood nematode. J Econ Entomol 104:1592–1598 Vidal DM, Fonseca MG, Zarbin PHG (2010) Enantioselective synthesis and absolute configuration of the sex pheromone of Hedypathes betulinus (Coleoptera: Cerambycidae). Tetrahedron Lett 51:6704–6706 Yanega D (1996) Field guide to northeastern longhorned beetles (Coleoptera: Cerambycidae). Illinois Natural History Survey Manual 6, Illinois Natural History Survey, Urbana, Illlinois, United States of America

Figure 2.1 Synthesis of chiral fuscumol and fuscumol acetate.

Figure 2.2 Analyses on chiral stationary phase Cyclodex B column. A) Standards of racemic fuscumol (1) and fuscumol acetate (2 = (S)-enantiomer, 3 = (R)-enantiomer); B) Insect extract; C) Insect extract spiked with racemic fuscumol acetate; D) Insect extract after partial acetylation of fuscumol, showing that only the peak due to (S)-fuscumol acetate increases in size. Peak marked with an asterisk is an impurity.

Figure 2.3 Representative total ion chromatogram of the headspace volatiles collected from male Astyleiopus variegatus. 27

CHAPTER 3: STEREOCHEMISTRY OF FUSCUMOL AND FUSCUMOL ACETATE INFLUENCES ATTRACTION OF LONGHORNED BEETLES OF THE SUBFAMILY LAMIINAE

3.1 Abstract

The chemical structure of aggregation-sex pheromones of longhorned beetles (Coleoptera: Cerambycidae) appears to be conserved among closely related taxa. In the subfamily Lamiinae, adult males and females of several species are attracted by racemic blends of (E)-6,10-dimethyl-5,9-undecadien-2-ol (termed fuscumol) and/or the structurally related (E)-6,10-dimethyl-5,9-undecadien-2-yl acetate (fuscumol acetate). Both compounds have a chiral center, so each can exist in two enantiomeric forms. Adults of many species of longhorned beetles are attracted only to the specific enantiomers that are produced by their males, and attraction may be reduced by the presence of enantiomers that are not produced by the insect. In a previous publication, headspace aerations of adult beetles of the lamiine species Astyleiopus variegatus (Haldeman) revealed that males produced (S)-fuscumol and (S)-fuscumol acetate, the presumed pheromone. Here, I describe field screening experiments of synthesized enantiomers of fuscumol and fuscumol acetate, conducted in Indiana and Illinois, that confirmed attraction of A. variegatus to its species-specific blend, but also assessed attraction of other native lamiine species. Adults of four other species showed significant attraction to different chemicals: Aegomorphus modestus (Gyllenhall) to (S)-fuscumol acetate, Astylidius parvus (LeConte) to (R)-fuscumol, Astylopsis macula (Say) to (S)- fuscumol, and Graphisurus fasciatus (DeGeer) to a blend of (R)-fuscumol and (R)- fuscumol acetate. These results suggest that chirality may be important in the attraction of lamiines, and that specific stereoisomers are likely produced by each species.

3.2 Introduction

The longhorned beetles (Coleoptera: Cerambycidae) are a large family of insects that exhibit considerable diversity in their chemical communication systems (reviewed by Millar and Hanks 2016). Males or females of many species produce volatile aggregation- sex pheromones (sensu Cardé 2014) that serve to bring the sexes together on host plants (Millar et al. 2009). Among species in the subfamily Cerambycinae, males commonly produce volatile pheromones which are typically 6, 8, or 10 carbons in length, with hydroxyl or carbonyl groups on carbons 2 and 3 (Millar and Hanks 2016).

Less is known of longhorned beetles in the subfamily Lamiinae, but the evidence to date suggests that pheromone structures vary across tribes. That is, males of species in the Lamiini and Monochamini produce hydroxyethers and related compounds, including 4- (heptyloxy)butanol and/or the corresponding aldehyde from species in the genus Anoplophora (Zhang et al. 2002, Hansen et al. 2015), and 2-(undecyloxy)ethanol (termed monochamol) from many species in the genus Monochamus (e.g., Pajares et al. 2010, Teale et al. 2011, Allison et al. 2012, Fierke et al. 2012). Attraction to monochamol in other species in the Lamiini (Wickham et al. 2014) provides further evidence that this compound is a conserved pheromone component within the subfamily.

In contrast, males of the South American lamiine Hedypathes betulinus (Klug) (tribe Acanthoderini) produce the sesquiterpene degradation product (E)-6,10-dimethyl-5,9- undecadien-2-one (geranylacetone), the corresponding alcohol (fuscumol), and the acetate ester of fuscumol (dominant; Fonseca et al. 2010). Blends of these compounds were attractive to beetles in laboratory experiments, although attraction in the field has yet to be confirmed. Fuscumol was first identified as the pheromone of the European longhorned beetle Tetropium fuscum (F.), in the small subfamily Spondylidinae (Silk et al. 2007, Sweeney et al. 2010). Field screening experiments in North America have revealed that several species of native lamiines in the Acanthoderini and Acanthocinini are attracted by fuscumol and/or fuscumol acetate (Mitchell et al. 2011, Hanks and Millar 2013), suggesting that this motif crosses subfamily boundaries. 29

Attraction of cerambycids to their aggregation-sex pheromones may be affected by compounds produced by related species, including stereoisomers of their pheromone components (Millar and Hanks 2016). For example, males of the cerambycine Neoclytus acuminatus acuminatus (F.) produce a single-component pheromone comprising (2S,3S)- 2,3-hexanediol, and attraction of both sexes to synthesized pheromone is unaffected by the unatural (2R,3R)-enantiomer, but reduced by the (2S,3R)- and/or (2R,3S)- diastereomers (Lacey et al. 2004). Because fuscumol and fuscumol acetate have chiral centers, chirality could play an important role in imparting species specificity to pheromones of species utilizing these compounds. For example, male H. betulinus produce a pheromone blend of geranylacetone, (R)-fuscumol acetate, and a mixture of (R)- and (S)-fuscumol in a ratio of ~82% and 18%, respectively (Vidal et al. 2010); however, further experiments are needed to directly test the behavioral activity of individual enantiomers. Although, these compounds also have a stereocenter at the C5 double bond, the (Z)-isomer has yet to be isolated from any longhorned beetle species to date.

Headspace collections of a male of the North American lamiine Astyleiopus variegatus (Haldeman) (Acanthocinini) contained a blend of (S)-fuscumol and (S)-fuscumol acetate (~1:2 ratio; Hughes et al. 2013). This species already was known to be attracted by racemic fuscumol + fuscumol acetate from field experiments (Mitchell et al. 2011). Here, I describe field experiments using the enantiomers of fuscumol and fuscumol acetate, conducted in Indiana and Illinois, that confirmed attraction of A. variegatus to its species- specific blend, and also assessed attraction of other sympatric lamiine species to particular chemicals. My results provide evidence that the pheromones of lamiines may be delineated by chirality, and that the chirality of fuscumol and fuscumol acetate allows for a variety of distinct blends that could serve as species-specific pheromones among sympatric species.

3.3 Methods and Materials

3.3.1 Sources of Chemicals

(R)-fuscumol (96.6% enantiomeric excess, ee), (S)-fuscumol (98% ee), (R)-fuscumol acetate (96.6% ee), and (S)-fuscumol acetate (98% ee) were synthesized by enzymatic kinetic resolution of the racemic compounds as described in Hughes et al. (2013) and Sweeney et al. (2010), and were provided by J. G. Millar.

3.3.2 Study Sites

Experiments to assess attraction of beetles to synthesized candidate pheromones were conducted at two study sites in northwestern Indiana and four study sites in east-central Illinois (Table 1), all of which were wooded with mature second-growth or successional hardwoods and dominated by oak (Quercus species), hickory (Carya species), maple (Acer species), and ash (Fraxinus species).

3.3.3 Field Screening Experiments

Attraction of beetles to chemicals was tested using cross-vane panel traps (black corrugated plastic; AlphaScents, West Linn, OR) that were coated with undiluted Fluon® PTFE (Northern Products Inc., Woonsocket, RI, USA) to improve trap efficiency (Graham et al. 2010, Allison et al. 2016). The supplied trap basins were replaced with ~2- liter plastic jars (General Bottle Supply Company, Los Angeles, CA, USA) which had their threaded lids modified to accommodate a plastic funnel that received captured beetles, allowing for quick removal of the jar when collecting specimens. Traps were suspended from L-shaped stands constructed of polyvinylchloride irrigation pipe (Graham et al. 2010). Collection jars were filled with approximately 0.1 l concentrated aqueous NaCl solution to kill and preserve specimens. Trap lures consisted of resealable polyethylene sachets (2 mil, 7 × 5 cm; Fisher Scientific, Waltham, MA, USA) that were loaded with 25 mg per enantiomer of synthesized pheromone, dissolved in 1 ml isopropanol, which was chosen as a solvent carrier because it has not been shown to attract longhorned beetles. 31

Two field experiments were conducted to assess attraction of adult beetles to enantiomers of fuscumol and fuscumol acetate. Experiment 1 tested attraction of beetles to individual (R)- and (S)-enantiomers and blends of (R)- and (S)-enantiomers (Table 2). Seven traps were set up in a linear transect (10 m apart), with one trap per treatment assigned randomly. The experiment was conducted during 24 June – 4 July 2012 at Black Rock Barrens Nature Preserve and Ross Hills Park in Indiana, 28 June – 3 October 2012 at Robert Allerton Park in Illinois, and repeated during 20 June – 25 July 2014 in Illinois at the same site and at Nettie Hart Memorial Woods (Table 1). Traps were serviced three times per week, at which time traps were moved along transects to control for positional bias. Lures were replaced when they had little liquid remaining in the sachets, which was approximately every two to three weeks, but varied with the weather.

Experiment 2 tested attraction of beetles to individual enantiomers of fuscumol and fuscumol acetate (Table 2), with five traps set up in linear transects, and one treatment randomly assigned to each trap. During 2013, the experiment was conducted in Indiana at Black Rock Barrens Nature Preserve and Ross Hills Park during 31 May – 20 September, and in Illinois at Robert Allerton Park during 8 May – 26 August and Forest Glen Preserve during 9 July – 27 August (Table 1). The experiment was repeated at Black Rock Barrens during 19 June – 26 September 2014.

I tested differences between treatments, separately for each beetle species, using the nonparametric Friedman’s Test (PROC FREQ, option CMH; SAS Institute Inc., 2015) because data violated the homoscedasticity assumption of ANOVA. Data were analyzed across six sites between 2012 and 2014 and, because the model revealed no significant year or site effect, data were pooled such that experimental replicates for each species were defined solely by collection date. Differences between pairs of treatment means were tested with the REGWQ means separation test, which controls maximum experiment-wise error rates (PROC GLM; SAS Institute 2015). For each beetle species, only replicates with at least one specimen were included in the analysis so as to account for variation in seasonally and meteorologically affected flight patterns of species. 32

Taxonomy of captured beetles following Monné and Hovore (2005). Representative specimens from Illinois and Indiana are available from the laboratory collections of L. M. Hanks and M. D. Ginzel, respectively. Voucher specimens collected in Illinois have been deposited with the collection of the Illinois Natural History Survey, Champaign, IL.

3.4 Results

A total of 970 longhorned beetles representing 48 species were captured during the two experiments (Table 3), including species in the subfamilies Cerambycinae, Lamiinae, Lepturinae, Parandrinae, Prioninae, and one species in the closely related family Disteniidae. The lamiine species that were captured in greatest numbers across experiments were Graphisurus fasciatus (DeGeer) and the target species A. variegatus (Table 3). Although more than 100 adults of the cerambycine Xylotrechus colonus (F.), and relatively high numbers of cerambycines such as N. a. acuminatus and its congener Neoclytus. m. mucronatus (F.), were captured during our study, none of these species showed significant treatment effects, suggesting that adults of these species were captured passively by traps.

During Experiment 1, adults of A. variegatus were significantly attracted only to traps

baited with the blend of (S)-fuscumol and (S)-fuscumol acetate (Fig. 1; Friedman’s Q31,112 = 5.76; P < 0.0001; Fig. 1), consistent with the composition of the blend produced by males (Hughes et al. 2013). Additionally, adults of G. fasciatus were more attracted to the blend of (R)-fuscumol and (R)-fuscumol acetate than to the individual R-components

(Fig. 1; Q34,112 = 3.96, P < 0.0001).

During Experiment 2, adults of A. variegatus were not caught in sufficient numbers for analysis, but three other lamiine species showed significant treatment effects, each to a different treatment, as follows (Fig. 2): 1) adults of Astylidius parvus (LeConte) were

attracted only by (R)-fuscumol (Q14,5 = 5.75; P = 0.032); 2) adults of Astylopsis macula

(Say) were attracted only by (S)-fuscumol (Q9,10 = 5.14; P = 0.0087); and 3) adults of

Aegomorphus modestus (Gyllenhal) were attracted only by (S)-fuscumol acetate (Q24,115 = 2.6; P = 0.0004). 33

3.5 Discussion

Attraction of A. variegatus by the specific blend of the (S)-enantiomers of fuscumol and fuscumol acetate which simulated the blend produced by males confirmed the pheromone chemistry of this species, and demonstrated that the two compounds are both necessary and sufficient for trap capture. However, Mitchell et al. (2011) had reported that adults of A. variegatus were significantly attracted to racemic fuscumol acetate during field experiments, but the blend of racemic fuscumol + racemic fuscumol acetate was more attractive when also present as another treatment. Moreover, G. fasciatus had previously been shown to be attracted to racemic fuscumol acetate (Mitchell et al. 2011), but was attracted by the blend of (R)-fuscumol and (R)-fuscumol acetate in this study. These findings suggest that weak attraction to incomplete simulations of pheromones may result in statistically significant treatment effects for some species of lamiines. On the other hand, the results of Experiment 2, when compared to field experiments of racemic compounds in earlier studies, suggest that some species are attracted by synthetic blends, even though they include unnatural components. That is, A. modestus was known to be attracted by racemic fuscumol acetate, A. parvus to racemic fuscumol, and A. macula to the blend of racemic fuscumol and racemic fuscumol acetate (Mitchell et al. 2011, Hanks et al. 2012, Hanks and Millar 2013). However, the present study determined that the actual attractive components for these species were (S)-fuscumol acetate, (R)-fuscumol, and (S)-fuscumol alone, respectively. Thus, significant treatment effects in field experiments of racemic fuscumol and fuscumol acetate, and their individual enantiomers, should be interpreted with caution, because lamiine beetles may be attracted to traps by incomplete simulations of their synthesized pheromones, or blends that include components which are not produced by their conspecific males, such as the enantiomers of their pheromone components.

Attraction to pheromones may also be augmented by host volatiles, as is the case with T. fuscum, adults of which are more attracted by a combination of fuscumol and spruce volatiles than by fuscumol alone (Sweeney et al. 2004, 2010). In fact, fuscumol-baited traps fail to capture any more beetles than control traps. In the Lamiinae, H. betulinus females are more attracted to the male-produced pheromone when host volatiles are also 34 present than to the pheromone alone (Fonseca et al. 2010). Thus, it appears that host plant volatiles play an important role in the attraction of spondylidine and lamiine longhorned beetles, and future studies should investigate the effect of host volatiles on the attraction of those species captured in the present study.

Although the pheromones of A. modestus, A. macula, A. parvus, and G. fasciatus have yet to be formally identified (i.e., by confirming that the compounds to which they are attracted are indeed produced by males), the present study provides evidence that all five species, including A. variegatus, differ as to which combinations of fuscumol and fuscumol acetate stereoisomers attract their adults. These findings lend support to the hypothesis that the chirality of fuscumol and fuscumol acetate allows for a sufficient number of distinct stereoisomeric blends to provide species-specific pheromones for a community of lamiine species. Moreover, attraction to specific geometric isomers or host volatiles may serve to further separate species with similar pheromone compositions. Thus, in the present study we may have missed some species because we tested only a subset of the total number of possible combinations. For example, adults of Sternidius alpha (Say) are reportedly attracted by racemic (E/Z)-fuscumol, and not affected by (E/Z)-fuscumol acetate (Mitchell et al. 2011, Hanks and Millar 2013), and the low numbers caught in our studies may be due to the absence of treatments that included both enantiomers of fuscumol, or the absence of the (Z)-isomer. Overall, the cumulative results to date suggest that lamiine species in the tribes Acanthocinini and Acanthoderini, which overlap broadly in seasonal flight period, may remain segregated by differences in the stereochemistry of their pheromones. 35

3.6 References

Allison J D, Graham EE, Poland TM, Strom BL (2016) Dilution of Fluon before trap surface treatment has no effect on longhorned beetle (Coleoptera: Cerambycidae) captures. J Econ Entomol 109:1215–1219 Allison JD, McKenna JL, Millar JG, McElfresh JS, Mitchell RF, Hanks LM (2012) Response of the woodborers Monochamus carolinensis and Monochamus titillator (Coleoptera: Cerambycidae) to known cerambycid pheromones in the presence and absence of the host plant volatile α-pinene. Environ Entomol 41:1587–1596 Cardé RT (2014) Defining attraction and aggregation pheromones: teleological versus functional perspectives. J Chem Ecol 40:519–520 Fierke MK, Skabeikis JG, Millar JG, Teale SA, McElfresh JS, Hanks LM (2012) Identification of a male-produced aggregation pheromone for Monochamus scutellatus scutellatus and an attractant for the congener Monochamus notatus (Coleoptera: Cerambycidae). J Econ Entomol 105:2029–2034 Fonseca, MG, Vidal DM, Zarbin PHG (2010) Male-produced sex pheromone of the cerambycid beetle Hedypathes betulinus: chemical identification and biological activity. J Chem Ecol 36:1132–1139 Graham EE, Mitchell RF, Reagel PF, Barbour JD, Millar JG, Hanks LM (2010) Treating panel traps with a fluoropolymer enhances their efficiency in capturing cerambycid beetles. J Econ Entomol 102:641–647 Hanks LM, Millar JG (2013) Field bioassays of cerambycid pheromones reveal widespread parsimony of pheromone structures, enhancement by host plant volatiles, and antagonism by components from heterospecifics. Chemoecology 23:21–44 Hanks LM Millar JG, Mongold-Diers JA, Wong JCH, Meier LR, Reagel PF, Mitchell RF (2012) Using blends of cerambycid beetle pheromones and host plant volatiles to simultaneously attract a diversity of cerambycid species. Can J For Res 42:1050– 1059

Hanks LM, Reagel PF, Mitchell RF, Wong JCH, Meier LR, Silliman CA, Graham EE, Striman BL, Robinson KKP, Mongold-Diers JA, Millar JG (2014) Seasonal phenology of the cerambycid beetles of east-central Illinois. Ann Entomol Soc Am 107:211–226 Hansen L, Xu T, Wickham J, Chen Y, Hao D, Hanks LM, Millar JG, Teale SA (2015) Identification of a male-produced pheromone component of the citrus longhorned beetle, Anoplophora chinensis. PloS One 10:e0134358 Hughes, GP, Zou Y, Millar JG, Ginzel MD (2013) (S)-fuscumol and (S)-fuscumol acetate produced by a male Astyleiopus variegatus (Coleoptera: Cerambycidae). Can Entomol 145:327–332 Lacey, ES, Ginzel MD, Millar JG, Hanks LM (2004) Male-produced aggregation pheromone of the cerambycid beetle Neoclytus acuminatus acuminatus. J Chem Ecol 30:1493–1507 Millar JG, Hanks LM (2016) Chemical ecology of cerambycid beetles. In Q. Wang (ed.) Cerambycidae of the world: biology and pest management. CRC Press/Taylor & Francis, Boca Raton, FL (in press) Millar JG, Hanks LM, Moreira JA, Lacey ES. (2009) Pheromone chemistry of cerambycid beetles, pp. 52–79. In K. Nakamuta and J. Millar (eds.) Chemical ecology of wood-boring insects. Forestry and Forest Products Research Institute, Ibaraki, Japan. Mitchell, RF, Graham EE, Wong JCH, Reagel PF, Striman BL, Hughes GP, Paschen MA, Ginzel MD, Millar JG, Hanks LM (2011) Fuscumol and fuscumol acetate are general attractants for many species of cerambycid beetles in the subfamily Lamiinae. Entomol Exp Appl 141:71–77 Monné MA, Hovore FT (2005) Electronic checklist of the Cerambycidae of the Western Hemisphere. http://www.cerambycoidea.com/titles/monnehovore2005.pdf. Last accessed 24 May 2016 Pajares, JA, Álvarez G, Ibeas F, Gallego D, Hall DR, Farman DI (2010) Identification and field activity of a male-produced aggregation pheromone in the pine sawyer beetle, Monochamus galloprovincialis. J Chem Ecol 36:570–58 SAS Institute Inc. 2015. Base SAS® 9.4. Cary, NC: SAS Institute Inc. 37

Silk, PJ, Sweeney J, Wu JP, Price J, Gutowski JM, Kettela EG (2007) Evidence for a male-produced pheromone in Tetropium fuscum (F.) and Tetropium cinnamopterum (Kirby) (Coleoptera: Cerambycidae). Naturwissenschaften 94:697–701 Sweeney J, Silk PJ, Gutowski J, Wu J, Lemay MA, Mayo PD, Magee D (2010) Effect of chirality, release rate, and host volatiles on response of Tetropium fuscum (F.), Tetropium cinnamopterum Kirby, and Tetropium castaneum (L.) to the aggregation pheromone, fuscumol. J Chem Ecol 36:1309–1321 Teale SA, Wickham JD, Zhang F, Su J, Chen Y, Xiao W, Hanks LM, Millar JG (2011) A male-produced aggregation pheromone of Monochamus alternatus (Coleoptera: Cerambycidae), a major vector of pine wood nematode. J Econ Entomol 104:1592– 1598 Vidal DM, Fonseca MG, Zarbin PHG (2010) Enantioselective synthesis and absolute configuration of the sex pheromone of Hedypathes betulinus (Coleoptera: Cerambycidae) Tetrahedron Lett 51:6704–6706 Wickham JD, Harrison RD, Lu W, Guo Z, Millar JG, Hanks LM, Chen Y (2014) Generic lures attract cerambycid beetles in a tropical montane rain forest in southern China. J Econ Entomol 107:259–267 Zhang A, Oliver JE, Aldrich JR, Wang B, Mastro VC (2002) Stimulatory beetle volatiles for the Asian longhorned beetle, Anoplophora glabripennis. Z Naturforschung C 57:553–558 38

Table 3.1 Study sites for field experiments conducted in northwestern Indiana and east- central Illinois during 2012-2014 GPS coordinates State/ County Name (long., lat.) Area (ha) IN/ Warren Black Rock Barrens Nature Preservea 40.358, -87.114 40 IN/ Tippecanoe Ross Hills Parkb 40.404, -87.072 68 IL/ Champaign Brownfield Woodsc 40.145, -88.165 26 IL/ Vermillion Forest Glen Preserved 40.015, -87.567 3 IL/ Champaign Nettie Hart Memorial Woodsc 40.229, -88.358 16 IL/ Piatt Robert Allerton Parkc 39.996, -88.651 600 a NICHES Land Trust (http://nicheslandtrust.org/) b Tippecanoe County Parks and Recreation Department (http://www.tippecanoe.in.gov/187/) c Property of the University of Illinois (http://research.illinois.edu/cna/) d Vermilion County Conservation District (http://www.vccd.org/)

Table 3.2 Treatments for two field experiments that tested attraction of adult longhorned beetles to various chiral pheromone components and blends of components Treatment Expt. 1 (R)-fuscumol (R)-fuscumol acetate (R)-fuscumol + (R)-fuscumol acetate (S)-fuscumol (S)-fuscumol acetate (S)-fuscumol + (S)-fuscumol acetate Solvent control Expt. 2 (R)-fuscumol (S)-fuscumol (R)-fuscumol acetate (S)-fuscumol acetate Solvent control 40

Table 3.3 Taxonomy and number of adult cerambycid beetles that were captured during field experiments in Indiana and Illinois in Experiments 1 and 2 Taxonomy Expt. 1 Expt. 2 Total Cerambycinae Anaglyptini Cyrtophorus verrucosus (Olivier) 1 29 30 Bothriospilini Knulliana cincta cincta (Drury) 5 5 Clytini Clytoleptus albofasciatus (Laporte & Gory) 1 1 Clytus ruricola (Olivier) 1 1 Neoclytus acuminatus acuminatus (F.) 17 10 27 Neoclytus mucronatus mucronatus (F.) 14 7 21 Neoclytus scutellaris (Olivier) 10 1 11 Sarosesthes fulminans (F.) 1 1 Xylotrechus colonus (F.) 49 68 117 Eburiini Eburia quadrigeminata (Say) 9 2 11 Elaphidiini Anelaphus parallelus (Newman) 2 15 17 Anelaphus villosus (F.) 4 78 82 Elaphidion mucronatum (Say) 14 9 23 Parelaphidion aspersum (Haldeman) 13 13 Parelaphidion incertum (Newman) 3 3 Neoibidionini Heterachthes quadrimaculatus Haldeman 2 2 Obriini Obrium maculatum (Olivier) 9 16 25 Tillomorphini Euderces picipes (F.) 1 1 Lamiinae 41

Acanthocinini Astyleiopus variegatus (Haldeman) 127 6 133 Astylidius parvus (LeConte) 2 7 9 Astylopsis collaris (Haldeman) 1 1 2 Astylopsis macula (Say) 4 5 9 Graphisurus despectus (LeConte) 13 36 49 Graphisurus fasciatus (DeGeer) 108 69 177 Leptostylus transversus (Gyllenhal) 1 6 7 Lepturges angulatus (LeConte) 6 6 Lepturges confluens (Haldeman) 12 16 28 Lepturges symmetricus (Haldeman) 1 1 2 Sternidius alpha (Say) 10 8 18 Urgleptes querci (Fitch) 2 1 3 Acanthoderini Aegomorphus modestus (Gyllenhal) 10 49 59 Desmiphornini Eupogonius pauper LeConte 1 1 Dorcaschematini Dorcaschema cinereum (Olivier) 5 5 Onciderini Oncideres cingulata (Say) 1 1 Pogonocherini Ecyrus dasycerus (Say) 2 6 8 Saperdini Saperda discoidea F. 5 5 Saperda imitans Felt & Joutel 1 1 2 Saperda tridentata Olivier 2 2 Lepturinae Lepturini Brachyleptura rubrica (Say) 3 3 Strangalia bicolor (Swederus) 4 4 42

Strangalia luteicornis (F.) 1 1 Typocerus deceptus Knull 1 1 Typocerus lugubris (Say) 1 2 3 Typocerus velutinus velutinus (Olivier) 3 3 Rhagiini Gaurotes cyanipennis (Say) 1 1 Parandrinae Parandrini Neandra brunnea (F.) 1 4 5 Prioninae Prionini Orthosoma brunneum (Forster) 15 4 19 Disteniidae Disteniini Elytrimitatrix undata (F.) 5 8 13 Total number of specimens: 476 494 970 Number of unique species: 39 37 48

Fig. 3.1 Mean (± 1 SE) number of beetles captured per trap and count period during Experiment 1. Means with different letters within species are significantly different (REGWQ means-separation test; P < 0.05).

Fig. 3.2 Mean (± 1 SE) number of beetles captured per trap and count period during Experiment 2. Means with different letters within species are significantly different (REGWQ means-separation test: P < 0.05).

CHAPTER 4: DETERMINATION OF THE ABSOLUTE CONFIGURATION OF FEMALE-PRODUCED CONTACT SEX PHEROMONE COMPONENTS OF THE LONGHORNED BEETLE, NEOCLYTUS ACUMINATUS ACUMINATUS (F.) (COLEOPTERA: CERAMBYCIDAE)

4.1 Abstract

Cuticular hydrocarbon components play important roles in contact chemical communication in insects. Many of these compounds are methyl-branched hydrocarbons with one or more chiral centers, which can exist in two or more stereoisomeric forms. Although the importance of chirality for the volatile semiochemicals which insects use for long-range communication is well established, almost nothing is known about the role of chirality in insect contact chemoreception. Here, reverse phase high performance liquid chromatography (RP-HPLC) and digital polarimetry were used to isolate and determine the absolute configuration of a female-produced contact sex pheromone component of the cerambycid beetle, Neoclytus acuminatus acuminatus (F.). The pheromone consists of 7-methylpentacosane (7-MeC25), 7-methylheptacosane (7-MeC27),

and 9-methylheptacosane (9-MeC27). The absolute configuration of the most abundant

pheromone component, 7-MeC25, was found to be (R). I then utilized enantiomerically pure synthetic pheromone components to test the hypothesis that males would respond more strongly to (R)- than to (S)-enantiomers of the three pheromone components. We also tested blends of (R)-7-MeC27, the most bioactive component, with the (S)- enantiomers of the minor components, and vice versa, to determine if unnatural stereoisomers might decrease behavioral responses. Males responded most strongly to solvent-washed females treated with the blend of (R)-pheromone components, and to a lesser extent to (R)-7-MeC27 alone. A blend of (R)-7-MeC27 with the (S)-minor components elicited an intermediate response. Together, these findings suggest that the insects can discriminate the absolute configuration of the major and minor pheromone components, and that the configuration of all three components is likely to be (R).

4.2 Introduction

The wax layer on the surface of the insect cuticle is composed of a complex mixture of nonvolatile organic compounds, including long-chain alkanes, alkenes, and minor polar components such as aldehydes, aliphatic alcohols, fatty acids, ketones, and triglycerides, which function primarily to protect the insect from desiccation (Gibbs 1998). Cuticular hydrocarbons (CHCs) can also act as chemical signals that have diverse functions in insects (Howard and Blomquist 2005). Hydrocarbon contact sex pheromones are known from several insect orders including Diptera (Carlson et al. 1998a, Stoffolano et al. 1997, Wicker-Thomas 2007), Hymenoptera (Böröczky et al. 2009, Kühbandner et al. 2013, Steiner et al. 2006, Syvertsen et al. 1995), and Coleoptera (Geiselhardt et al. 2009, Ginzel 2010, McGrath et al. 2003, Silk et al. 2009, Sugeno et al. 2006). Many of these contact semiochemicals contain methyl branches, which form chiral centers. Thus, each of these compounds can exist in two or more stereoisomeric forms, depending on the number and position(s) of these branch points. Unfortunately, the absolute configurations of these compounds have been determined in only a few cases (e.g. Bello et al. 2015), despite the large number of methyl-branched hydrocarbons that have been identified in CHC extracts of insects.

Although there is an extensive literature on the critical importance of chirality for volatile insect pheromones (Ando et al. 2015, Birch et al. 1980, Levinson and Mori 1983, Mori 2007, Tumlinson et al. 1977), few studies have investigated the effect of chirality in contact chemoreception. In one of the few examples reported to date, male Tetropium fuscum (F.) responded more strongly to solvent-washed female carcasses treated with (S)-

11-methylheptacosane ((S)-11-MeC27), the major contact sex pheromone component of females, than to the (R)-enantiomer, whereas both (S)-11-MeC27 and (Z)-9-heptacosene were required to elicit a full mating response from male Tetropium cinnamopterum Kirby (Silk et al. 2011). In the parasitic wasp Lariophagus distinguendus Förster, males did not

respond when 3-methylheptacosane (3-MeC27) was presented alone on a solvent-washed cadaver, but rather, the entire suite of CHCs was required in conjunction with the pheromone to elicit a response (Kühbandner et al. 2012). Moreover, males responded to

both (R)- and (S)-3-MeC27 when applied to cadavers with the other CHCs (Kühbandner et 47

al. 2012, Kühbandner et al. 2013), suggesting that both enantiomers were being perceived, and both elicited similar behavioral responses. Likewise, male Psacothea hilaris Pascoe responded as strongly to both (8Z,21R)- and (8Z,21S)-21- methylpentatriacont-8-ene, demonstrating no preference for either enantiomer, although they clearly distinguished the (E)- from the (Z)-stereoisomers (Fukaya et al. 1997). (3S,11S)-3,11-Dimethylnonacosan-2-one, the contact sex pheromone of female German cockroaches, Blatella germanica (L.), stimulated courtship behaviors in males (Eliyahu et al. 2004), but unexpectedly, at physiological doses the natural (S,S)-enantiomer was the least effective of the four possible stereoisomers at eliciting courtship behaviors. Overall, these and other studies suggest that the influence of chirality on the bioactivity of contact sex pheromones varies among insect species, and that combinations of CHCs may be necessary to stimulate courtship and mating behaviors.

Here, we investigated the effect of chirality on the responses of males of the cerambycid beetle Neoclytus acuminatus acuminatus (F.) to CHC components of the contact sex pheromone of females. Mate location in N. a. acuminatus involves mutual attraction of both sexes to host plant volatiles and a volatile male-produced aggregation pheromone, and at close range, mate recognition by males via a contact sex pheromone on the cuticle of females (Ginzel and Hanks 2005, Lacey et al. 2004, Lacey et al. 2008). The volatile aggregation pheromone, produced from glands in the prothorax of males, has been identified as (2S,3S)-2,3-hexanediol (Lacey et al. 2004). The (2R,3R)-enantiomer was not attractive, nor did it inhibit responses to (2S,3S)-2,3-hexanediol when the racemic mixture was used as a trap bait. However, a blend of all four stereoisomers was significantly less attractive, indicating that one or both of the diastereomeric (2R,3S)- or (2S,3R)-2,3-hexanediols inhibit attraction (Lacey et al. 2004). Thus, these beetles are clearly capable of discriminating among the stereoisomers of their volatile aggregation pheromone.

The contact sex pheromone of female N. a. acuminatus has been shown to consist of three chiral CHCs: 7-methylpentacosane (7-MeC25), 7-methylheptacosane (7-MeC27),

and 9-methylheptacosane (9-MeC27) (Lacey et al. 2008). In this species, the most

abundant pheromone component is 7-MeC25, but the most bioactive component appears 48

__ to be the much less abundant 7-MeC27 henceforth referred to as the major component. In the study by Lacey et al. (2008), which used racemic compounds, only 10 % of tested males attempted to mate with solvent-washed female cadavers treated with the racemate

of the major component, 7-MeC27 (Lacey et al. 2008). However, 40 % of males attempted to mate with solvent-washed cadavers treated with a blend of the three racemic compounds (Lacey et al. 2008), indicating additive or synergistic effects between the components. The relatively low level of responses obtained with the blend, in contrast to responses to freeze-killed females, suggested that the unnatural enantiomers present in the racemic synthetic pheromone components might have inhibited the responses of males to solvent-washed female cadavers treated with mixtures of these compounds. However, the lack of efficient syntheses of the pure enantiomers of methyl-branched hydrocarbons, and the difficulty in determining the natural stereoisomers present in insect CHCs, hindered further investigation into the role of chirality in the functions of these contact pheromones. Methodology has recently been developed that allows the determination of the absolute configurations of at least the most abundant methyl- branched components in CHC extracts (Bello et al. 2015). This study found that 36 methyl-branched CHCs isolated from 20 different insect species all possessed the (R)- configuration, suggesting that these compounds are produced via biosynthetic pathways that are highly conserved among insects. In the present study, my collaborators exploited this newly developed methodology to isolate the most abundant methyl-branched hydrocarbon component of the contact sex pheromone of female N. a. acuminatus, and determined its absolute configuration to be (R). Each of the two enantiomers of the three methyl-branched hydrocarbon components of the contact pheromone were synthesized, and the biological activities of these compouns were tested in bioassays with male N. a. acuminatus.

4.3 Methods and Materials

4.3.1 Source of Beetles

Live N. a. acuminatus were collected from flight intercept panel traps (Alpha Scents Inc., West Linn, OR) baited with 5 × 7.5 cm resealable polyethylene bags (Fisher Scientific, 49

Waltham, MA) containing 50 mg of racemic syn-2,3-hexanediol (synthesized as described in Lacey et al. 2004) in 1 ml of 2-propanol. Traps were deployed at Martell Forest, a mixed hardwood forest in Tippecanoe Co., Indiana, and mixed hardwood forests in Champaign, Illinois, during July–September 2013 and July–August 2014. Neoclytus a. acuminatus infest a wide variety of hardwoods, but most commonly attack ash (Fraxinus spp.), oak, hickory, persimmon, and common hackberry (Solomon 1995). Additional beetles were reared from infested common hackberry (Celtis occidentalis L.) logs throughout both summers as described by Browne (1972). Beetles from Illinois were washed in hexane, and the resulting extracts were sent to JE Bello and JG Millar for isolation of individual CHCs and polarimetric analysis. Beetles captured or reared in Indiana were held in a greenhouse, in individual cylindrical screen cages with 9-cm glass Petri dishes covering the top and bottom. Each beetle was provided a feeder of 10 % sucrose solution in an 8-ml vial with a 4-cm long cotton dental wick (Patterson Dental, St. Paul, MN). Feeders were replaced every 2–3 d. Only apparently healthy and active beetles were used in bioassays.

4.3.2 Authentic Standards of Methyl-Branched CHC Enantiomers

The enantiomers of the methyl-branched hydrocarbon pheromone components of N. a. acuminatus were synthesized as described in Bello et al. (2013). All of these compounds were estimated to be >99 % enantiomerically pure because they were prepared from intermediates that were at least 99 % enantiomerically pure (98 % enantiomeric excess, by chiral stationary phase GC), with no chance of epimerization in subsequent steps leading to the final products. Furthermore, the final hydrocarbon products were purified by recrystallization, which would remove virtually all trace amounts of enantiomeric impurities present.

4.3.3 Extraction of CHCs from Female N. a. acuminatus

To remove CHCs from the cuticle, each female N. a. acuminatus was subjected to two successive washes in hexane. For each wash, the female was placed in a 4-ml vial and immersed in 2 ml of hexane (Avantor Performance Materials, Center Valley, PA), vortexed for 2 min and placed in a sonic bath for an additional 2 min (Ginzel et al. 2003). 50

The female was removed from the solvent while the vial was in the sonication bath to reduce the amount of hydrocarbons adhering to the cuticle. The first wash was used for analysis of CHCs (see below). Analysis by GC-MS showed that the second wash contained a minimal amount of CHCs, so it was discarded.

4.3.4 Preparation, Fractionation, and Analysis of Cuticular Extracts

A composite extract of 170 N. a. acuminatus females in hexane was prepared and filtered to remove particulates, concentrated to dryness, and then reconstituted in 1 ml hexane (Optima grade, Fisher Scientific). The extract was loaded onto a liquid chromatography

column containing 500 mg of AgNO3 impregnated silica gel (10 % wt/wt, +230 mesh; Aldrich Chemical Co., Milwaukee, WI), preconditioned by eluting with hexane. The column was eluted with 4 ml of hexane to recover alkanes, followed by 4 ml of 5 % (vol/vol) cyclohexene in hexane to elute alkenes, and finally 4 ml of diethyl ether to elute more polar components (Bello et al. 2015). Fractions were analyzed using a Hewlett- Packard (HP) 6890 gas chromatograph coupled to an HP5973 mass selective detector (GC-MS; Hewlett-Packard, now Agilent Technologies, Santa Clara, CA). The GC-MS was equipped with a DB-17MS capillary column (25m × 0.2 mm × 0.33 µm film thickness, J&W Scientific, Folsom, CA) and run in full-scan mode with electron impact ionization (70 eV). Samples were analyzed in splitless injection mode with the injector temperature set to 280 ºC, and a temperature program of 100 ºC/1 min, then 5 ºC/min to 280 ºC, held for 20 min. Compounds were identified from their mass spectra by the enhanced diagnostic fragments from cleavages on either side of methyl groups, and by retention indices relative to straight-chain alkane standards (Carlson et al. 1998b).

The alkane fraction was concentrated to dryness, reconstituted in 10 ml of isooctane, and 4 g of 5Å powdered, activated molecular sieves were added (100 mg of sieves per mg of sample). The resulting slurry was stirred overnight, then centrifuged, and the supernatant was removed. The remaining pellet was resuspended in 10 ml of isooctane and recentrifuged. The resulting supernatants were combined and filtered through a glass wool plug into a tared vial, and concentrated to obtain a fraction containing only methyl- branched hydrocarbons. This fraction was dissolved in 500 µl of ethyl acetate and 51

fractionated on an Infinity 1220 HPLC coupled to a Model 380 evaporative light scattering detector (ELSD; Agilent Technologies). The HPLC was equipped with an Eclipse XDB-C18 reverse phase column (5 µm particles, 4.6 mm i.d. × 250 mm length; Agilent Technologies) and a 100-µl sample loop. Twenty 5-µl injections were made sequentially. The column oven was set to 50 ºC, the ELSD nebulizer was set to 40 ºC, and the evaporation temperature was set to 70 ºC. The nitrogen gas flow through the ELSD evaporation chamber was set to 1.2 standard liters per minute (SLM). The column was eluted with EtOAc/MeOH (35:65) at a flow rate of 1 ml/min. The eluent was split

80:20 between the fraction collector and detector, and fractions containing 7-MeC25 were collected between 10.80 min and 11.25 min. Each isolated fraction was then analyzed by GC-MS to determine purity. Fractions from sequential analyses were pooled in a tared vial, and concentrated for polarimetric analysis. The other two pheromone components,

7-MeC27 and 9-MeC27, could not be isolated in sufficient purity and quantity for polarimetric analysis.

The specific rotation of the isolated 7-MeC25 was measured with an Autopol IV digital polarimeter (Rudolph Research Analytical, Hackettstown, NJ) operated in high accuracy specific rotation mode. The temperature of the polarimetric chamber was set to 25 ºC and the light source was set to 589 nm. 7-Methylpentacosane isolated from female N. a. acuminatus (0.8 mg, c=0.32 g/100 ml) was dissolved in 250 µl of dichloromethane and transferred to a T-32 small volume optical sample cell (2.5 mm i.d. × 50 mm length; 250 µl volume; Rudolph Research Analytical.) Specific rotation values were measured 10 times and averaged. Specific rotations of the synthetic standards were taken in the same manner. The results of the polarimetric analysis are shown in Table 1.

4.3.5 Bioassays

The mating behavior of many cerambycid beetles, including N. a. acuminatus, can be divided into four sequential steps (Ginzel et al. 2003, Ginzel and Hanks 2005, Lacey et al. 2008). Upon antennal contact with a female, a male will 1) stop walking, 2) align his body with the female, 3) mount the female, and 4) bend his abdomen to couple the genitalia. Bioassays measuring the mating responses of males to possible contact sex 52

pheromone components were conducted during the normal diel activity period of the beetle between 1000 and 1800 h, in the laboratory at room temperature under fluorescent lighting. A female N. a. acuminatus was presented to a male in a covered 9-cm Petri dish arena lined with Whatman filter paper (GE Healthcare UK Limited, Buckinghamshire, UK). The male was allowed 10 min to respond to the female. If the male did not display any mating response (steps 1–4), he was excluded from the study. A female was presented to no more than 5 males on the same day, each in his own Petri dish arena. The female was then freeze-killed, and after thawing at room temperature for 10 min, was presented to each male again for 10 min or until step 4 mating behavior was observed. The strength of the response of the male to the female carcass was recorded (steps 1–4, or 0 for no response), and served as the positive control for each male’s response in a subsequent bioassay testing a particular treatment.

The CHCs of the female were then removed as described above, and the carcass was left to air dry for 1 h, to allow the solvent to evaporate. The female carcass was then presented to the same males individually for 10 min each, and the mating response was recorded. Lack of response by males indicated that signals responsible for mate recognition had been removed by the extraction treatment. If any male displayed mating behavior, the female was washed a third time, allowed to air dry, and presented again to the male. A third wash was necessary for six females. Response to the solvent-washed female carcass served as a negative control.

The enantiomers of each of the synthetic standards of the female contact sex pheromone components were mixed in 100 µl of hexane in one female equivalent (FE) amounts of

the individual components found on the cuticle of female beetles, i.e., 12 µg of 7-MeC25,

3 µg of 7-MeC27, and 6 µg of 9-MeC27 (Lacey et al. 2008). We tested the bioactivity of

the individual enantiomers of the major pheromone component, 7-MeC27, and then as mixtures with either the (R)- or (S)-enantiomers of the minor components (Table 2). We did not assay individual minor components or pairwise mixtures of the major component with a single minor component, because Lacey et al. (2008) found that racemic blends of these mixtures resulted in mating responses that were significantly weaker than those toward unwashed cadavers. Each mixture of 1 FE was gradually applied with a pipet over 53

the entire surface of the solvent-extracted carcass. A full FE was used because N. a. acuminatus males responded to treated female carcasses after application of an average of 0.73 ± 0.18 FE in a previous study (Lacey et al. 2008). The solvent was allowed to evaporate for 1 h, after which the treated carcass was presented to individual males, and the graded response of each male to the treated carcass was recorded.

Over the course of the study, 157 males were tested against 42 females. Because these data are dependent and do not meet the assumptions of normality, Friedman’s test was used to compare the strength of the response of males towards the freeze-killed, solvent washed, and synthetically treated females in Statistica version 12 (Statsoft Inc. 2013). Separate analyses were performed for each synthetic treatment group and corresponding controls (six groups total; Table 2). Two planned comparisons were then performed with a Wilcoxon signed-rank test: 1) the response of males to freeze-killed females (positive control) was compared to that elicited by synthetic pheromone treatment, and 2) the response of males to the solvent-washed female carcass (negative control) was compared to that elicited by synthetic pheromone treatment. A Bonferroni correction was applied, resulting in a significance level set at P < 0.025. For those treatments that were significantly different from the solvent-washed control, a Kruskal-Wallis test followed by multiple comparisons were used to identify treatments that elicited a significant response from males, again applying a Bonferroni correction and a significance level of P < 0.025. (Statsoft Inc. 2013). Bioassays were conducted from 15 July–10 September 2013 and 30 July–23 August 2014.

4.4 Results

4.4.1 Isolation and Polarimetric Analysis of the Most Abundant Pheromone Component of N. a. acuminatus

The methyl-branched fraction of the cuticular hydrocarbon extract was fractionated by reverse phase high performance liquid chromatography (RP-HPLC) eluting with a completely nonaqueous solvent system of ethyl acetate/methanol (35:65), yielding 0.8 mg

of the most abundant methyl-branched pheromone component 7-MeC25 with a purity of >

96 % (Figure 4.1A-D). The optical rotation of the isolated 7-MeC25 was measured by 54

digital polarimetry, giving a specific rotation of -0.29 ± 0.03. Comparison with the

specific rotations of authentic standards of (R)-7-MeC25 and (S)-7-MeC25 confirmed that

the 7-MeC25 isolated from N. a. acuminatus was the (R)-enantiomer (Table 4.1).

4.4.2 Bioassays

We recorded the responses of male N. a. acuminatus toward 1) freeze-killed females (positive control), 2) solvent-washed cadavers (negative control), and 3) solvent-washed cadavers treated with various synthetic pheromone components. More males responded to the freeze-killed female controls than to any combination of synthetic pheromone components (Wilcoxon signed-rank test, P > 0.025, data not shown), indicating that males do not respond as strongly to the synthetic contact pheromone components as they do toward the unaltered profile of female beetles. No males responded to the solvent- washed female controls, so this negative control served as a baseline to test the extent to which males responded to the synthetic blends. Males did not respond significantly to any of the three treatments that included (S)-7-MeC27 (Table 4.2). However, more males

responded to (R)-7-MeC27 whether alone or in combination with either (R)- or (S)-minor components than toward the solvent-washed controls (Wilcoxon signed-rank test, P < 0.025). Moreover, males displayed a greater response toward solvent-washed cadavers

treated with (R)-7-MeC27 in combination with the (R)-minor components than toward the major component alone (Table 4.2, P < 0.05). Solvent-washed female cadavers treated with (R)-major component combined with (S)-minor components did not differ from either (R)-7-MeC27 alone (P = 0.18) or the combination of (R)-7-MeC27 with (R)-minor components (P = 0.71).

4.5 Discussion

The analytical and bioassay results show that the contact pheromone of female N. a. acuminatus is composed of the (R)-enantiomer of the most abundant component, 7-

MeC25, and our bioassay results suggest that the two other pheromone components, 7-

MeC27 and 9-MeC27, also have the (R)-configuration. The bioassays also confirmed the roles of the two minor components, because the combination of all three components was more active than the major component alone. However, contrary to my expectations, the 55

(S)-enantiomers were not entirely inactive or inhibitory; males displayed copulatory behaviors toward female carcasses treated with (R)-7-MeC27 and the (S)-minor components comparable to those displayed to the all-(R) blend (Table 4.2). The fact that the (S)-enantiomers were not inhibitory also explains the results from a previous study in which female carcasses treated with racemic blends of the pheromone components did indeed elicit copulatory responses from males, albeit at lower levels than the responses to freeze-killed females (Lacey et al. 2008). Overall, my results provide evidence that males of this species can distinguish the differences in the three-dimensional structures of the two enantiomeric forms of each pheromone component. The enantiomeric discrimination is most important for the major component of the contact pheromone, 7-MeC27, because

the unnatural (S)-7-MeC27 in a blend with the (R)-enantiomers of the two minor components did not elicit significant responses from males. Stereochemical variation in the minor components, 7-MeC25 and 9-MeC27, also had an effect because activity of the blend with the (S)-enantiomers of both of the minor components was intermediate between all (R)-enantiomers together and the (R)-major component alone (Table 4.2). The addition of minor components to the (S)-major component did not affect its activity, regardless of the stereochemistry of the minor components.

None of the synthetic blend treatments in this study yielded a mating response from males as strong as that toward freeze-killed females (positive controls), and this reduced response may be an indication that other minor components are necessary for a complete and consistent mating response. In addition to the contact pheromone components, there are at least four other female-specific methyl-branched hydrocarbons in hexane extracts of female N. a. acuminatus (Lacey et al. 2008), and one or more of these compounds may produce further enhancements in the copulatory responses of males. Moreover, compounds that are not specific to females may also contribute to the activity of the contact pheromone. It also must be noted that many insects respond less strongly to a solvent-washed cadaver treated with crude cuticular extracts or synthetic compounds than toward an unextracted insect, suggesting that not only the composition, but also the arrangement and distribution of cuticular lipids may influence behavioral responses (Ginzel et al. 2003, Ginzel et al. 2006, Hughes et al. 2011, Rutledge et al. 2014, Silk et al. 2011). The arrangement of CHCs may be stratified within the cuticular wax layer of 56

some cerambycids, with compounds that function as semiochemicals concentrated on the surface (Hughes et al. 2011). Solvent extraction and reapplication of the cuticular wax layer may scramble the CHCs, such that contact pheromones that are naturally abundant on the surface of the insect may become masked by other components of the wax layer, diminishing their bioactivity. This rearrangement of CHCs may explain the reduced response of males to solvent-washed females treated with cuticular extract, but it is unclear how stratification might affect male response to synthetic compounds. The hypothesis that the insect cuticular wax layer is stratified has yet to be empirically tested, and warrants further investigation.

To date, although there is evidence of contact chemoreception in over 20 species of longhorned beetles (reviewed in Ginzel 2010, Spikes et al. 2010, Silk et al. 2011), contact pheromone components have been identified for only a handful of species. The stereochemistry of contact pheromone components has been determined for only three other species: T. fuscum and T. cinnamopterum (Silk et al. 2011), and Xylotrechus colonus (Fabricius) (Bello et al. 2015). (S)-11-Methylheptacosane was reported to be a contact pheromone component in both Tetropium species, in contrast to the (R)- configurations of the pheromone components of N. a. acuminatus and X. colonus, and from the configurations of 36 insect-produced methyl-branched CHCs for which absolute configurations have been determined, all of which were (R) (Bello et al. 2015).

In summary, the analytical and bioassay data from this study support the hypothesis that a large majority of insect-produced methyl-branched CHCs have the (R)-configuration (Bello et al. 2015). The bioassay data also suggest that male N. a. acuminatus can distinguish between the stereoisomers of methyl-branched CHCs, but that the unnatural (S)-enantiomers are not inhibitory, and can to some extent substitute for the natural (R)- enantiomers. It remains to be seen whether this will be a general phenomenon, or whether different species will exhibit different sensitivities and responses to the enantiomers of methyl-branched CHCs that have signaling functions as contact pheromone components.

4.6 References

Ando T, Yamakawa R (2015) Chiral methyl-branched pheromones. Nat Prod Rep 32:1007–1041 Bello JE, Millar JG (2013) Efficient asymmetric synthesis of long chain methyl-branched hydrocarbons, components of the contact sex pheromone of females of the cerambycid beetle, Neoclytus acuminatus acuminatus. Tetrahedron: Asymmetry 24:822–826 Bello JE, McElfresh JS, Millar JG (2015) Isolation and determination of absolute configurations of insect-produced methyl-branched hydrocarbons. Proc Nat Acad Sci USA 112:1077–1082 Birch MC, Light DM, Wood DL, Browne LE, Silverstein RM, Bergot BJ, Ohloff G, West JR, Young JC (1980) Pheromonal attraction and allomonal disruption of Ips pini in California by the two enantiomers of ipsdienol. J Chem Ecol 6:703–717 Böröczky K, Crook DJ, Jones TH, Kenny JC, Zylstra KE, Mastro VC, Tumlinson JH (2009) Monoalkanes as sex pheromone components of the woodwasp Sirex noctilio. J Chem Ecol 35:1202–1211 Browne LE (1972) An emergence cage and refrigerator collector for wood-boring insects and their associates. J Econ Entomol 65:1499–1501 Carlson DA, Offor II, El Messoussi S, Matsuyama K, Mori K, Jallon J-M (1998a) Sex pheromone of Glossina tachinoides: isolation, identification, and synthesis. J Chem Ecol 24:1563–1575 Carlson DA, Bernier UR, Sutton BD (1998b) Elution patterns from capillary GC for methyl-branched alkanes. J Chem Ecol 24:1845–1865 Eliyahu D, Mori K, Takikawa H, Leal WS, Schal C (2004) Behavioral activity of stereoisomers and a new component of the contact sex pheromone of female German cockroach, Blatella germanica. J Chem Ecol 30:1839–1848 Fukaya M, Wakamura S, Yasuda T, Senda S, Omata T, Fukusaki E (1997) Sex pheromonal activity of geometric and optical isomers of synthetic contact pheromone to males of the yellow-spotted longicorn beetle, Psacothea hilaris (Pascoe) (Coleoptera: Cerambycidae). Appl Entomol Zool 32:654–656 58

Geiselhardt S, Otte T, Hilker M (2009) Role of cuticular hydrocarbons in male mating behavior of the mustard leaf beetle, Phaedon cochleariae (F.). J Chem Ecol 35:1162– 1171 Gibbs AG (1998) Water-proofing properties of cuticular lipids. Amer Zool 38:471–482 Ginzel MD (2010) Hydrocarbons as contact pheromones of longhorned beetles (Coleoptera: Cerambycidae). In: Blomquist GJ and Bagnéres A-G (eds) Insect Hydrocarbons: Biology, Biochemistry, and Chemical Ecology. Cambridge University Press, New York, pp. 375–389 Ginzel MD, Millar JG, Hanks LM (2003) (Z)-9-Pentacosene—contact sex pheromone of the locust borer, Megacyllene robiniae. Chemoecology 13:135–141 Ginzel MD, Hanks LM (2005) Role of host plant volatiles in mate location for three species of longhorned beetles. J Chem Ecol 31:213–217 Ginzel MD, Moreira JA, Ray AM, Millar JG, Hanks LM (2006) (Z)-9-Nonacosene— major component of the contact sex pheromone of the beetle Megacyllene caryae. J Chem Ecol 32:435–451 Howard RW, Blomquist GJ (2005) Ecological, behavioral, and biochemical aspects of insect hydrocarbons. Annu Rev Entomol 50:371–393 Hughes GP, Spikes AE, Holland JD, Ginzel MD (2011) Evidence for the stratification of hydrocarbons in the epicuticular wax layer of female Megacyllene robiniae (Coleoptera: Cerambycidae). Chemoecology 21:99–105 Kühbandner S, Sperling S, Mori K, Ruther J (2012) Deciphering the signature of cuticular lipids with contact sex pheromone function in a parasitic wasp. J Exp Biol 215:2471–2478 Kühbandner S, Bello JE, Mori K, Millar JG, Ruther J (2013) Elucidating structure- bioactivity relationships of methyl-branched alkanes in the contact sex pheromone of the parasitic wasp Lariophagus distinguendus. Insects 4:743–760 Lacey ES, Ginzel MD, Millar JG, Hanks LM (2004) Male-produced aggregation pheromone of the cerambycid beetle Neoclytus acuminatus acuminatus. J Chem Ecol 30:1493–1507 59

Lacey ES, Ginzel MD, Millar JG, Hanks LM (2008) 7-Methylheptacosane is a major component of the contact sex pheromone of the cerambycid beetle Neoclytus acuminatus acuminatus. Physiol Entomol 33:209–216 Levinson HZ, Mori K (1983) Chirality determines pheromone activity for flour beetles. Naturwissenschaften 70:190–192 McGrath MJ, Fletcher MT, König WA, Moore CJ, Cribb BW, Allsopp PG, Kitching W (2003) A suite of novel allenes form Australian melolonthine scarab beetles. Structure, synthesis, and stereochemistry. J Org Chem 68:3739–3748 Mori K (2007) The significance of chirality in pheromone science. Bioorg Med Chem 15:7505–7523 Mori K, Masuda S, Suguhiro T (1981) Stereocontrolled synthesis of all of the possible stereoisomers of 3,11-dimethylnoncosan-2-one and 29-hydroxy-3,11- dimethylnonacosan-2-one—the female sex pheromone of the German cockroach. Tetrahedron 37:1329–1340 Rutledge CE, Silk PJ, Mayo P (2014) Use of contact chemical cues in prey discrimination by Cerceris fumipennis. Entomol Exp Appl 153:93–105 Silk PJ, Ryall K, Lyons DB, Sweeny J, Wu J (2009) A contact sex pheromone component of the emerald ash borer Agrilus planipennis Fairmaire (Coleoptera: Buprestidae). Naturwissenschaften 96:601–608 Silk PJ, Sweeny J, Wu J, Sopow S, Mayom PD, Magee D (2011) Contact sex pheromones identified for two species of longhorned beetles (Coleoptera: Cerambycidae) Tetropium fuscum and T. cinnamopterum in the subfamily Spondylidinae. Environ Entomol 40:714–726 Solomon JD (1995) Guide to insect borers of North American broadleaf trees and shrubs. Agric Handbk 706. Washington, DC: U.S. Department of Agriculture, Forest Service Spikes AE, Paschen MA, Millar JG, Moreira JA, Hamel PB, Schiff NM, Ginzel MD (2010) First contact pheromone identified for a longhorned beetle (Coleoptera: Cerambycidae) in the subfamily Prioninae. J Chem Ecol 36:943–954 Statsoft, Inc. (2013) Statistica version 12. http://www.statsoft.com Steiner S, Hermann N, Ruther J (2006) Characterization of a female-produced courtship pheromone in the parasitoid Nasonia vitripennis. J Chem Ecol 32:1687–1702 60

Stoffolano JG, Schauber E, Yin C, Tillman JA, Blomquist GJ (1997) Cuticular hydrocarbons and their role in copulatory behavior in Phormia regina. J Insect Physiol 43:1065–1076 Sugeno W, Hori M, Matsuda K (2006) Identification of the contact sex pheromone of Gastrophysa atrocyanea (Coleoptera: Chrysomelidae). Appl Entomol Zool 41:269– 276 Syvertsen TC, Jackson LL, Blomquist GJ, Vinson SB (1995) Alkadienes mediating courtship in the parasitoid Cardiochiles nigriceps (Hymenoptera: Braconidae). J Chem Ecol 21:1971–1989 Tumlinson JH, Klein MG, Doolittle RE, Ladd TL, Proveaux AT (1977) Identification of the female Japanese beetle sex pheromone: Inhibition of male response by an enantiomer. Science 197:789–792 Wicker-Thomas C (2007) Pheromonal communication involved in courtship behavior in Diptera. J Insect Physiol 53:1089–1100 61

Figure 4.1 Isolation of 7-MeC25 from CHC extracts of female N. a. acuminatus. GC chromatograms of (A) the alkanes fraction, (B) the methyl-branched alkanes fraction after

removal of n-alkanes with 5Å molecular sieves, (C) isolated 7-MeC25 (96 % pure with a

minor 3-MeC25 impurity), (D) HPLC-evaporative light scattering detection chromatogram of the methyl-branched alkanes fraction during the isolation procedure.

The three contact pheromone components of N. a. acuminatus, 7-Me-C25, 9-Me-C27, 7-

Me-C27 are labeled as compounds 1, 2, and 3, respectively on each chromatogram. 62

Isolated 7-MeC25 0.8 0.32 -0.29 ± 0.03

Synthetic (R)-7-MeC25 8.9 3.56 -0.26 ± 0.01

Synthetic (S)-7-MeC25 9.2 3.71 +0.24 ± 0.01

Table 4.2 Behavioral responses of male N. a. acuminatus toward solvent-washed carcasses of females treated with enantiomers of components of the contact pheromone, as individual components or blends

% of males responding per step in the behavioral sequencea Treatment(s) N Step 1 Step 2 Step 3 Step 4b , a (R)-7-MeC27 26 38 23 23 23* , b (R)-7-MeC27; (R)-7-MeC25; (R)-9-MeC27 30 77 73 73 73* , ab (R)-7-MeC27; (S)-7-MeC25; (S)-9-MeC27 26 62 62 62 54*

(S)-7-MeC27 26 12 8 8 8

(S)-7-MeC27; (S)-7-MeC25; (S)-9-MeC27 24 25 13 13 13

(S)-7-MeC27; (R)-7-MeC25; (R)-9-MeC27 25 16 12 12 12

aMales display a sequence of behaviors upon antennal contact with a female: 1) the male stops walking, 2) aligns his body with the female, 3) mounts the female, and 4) bends his abdomen to couple the genitalia. Displayed as percentage of males responding to treated females bResponse of males to females treated with synthetic compounds versus solvent-washed controls was first compared using Friedman’s test (*P < 0.001). Responses to bioactive treatments were then compared using the Kruskal-Wallis test followed by multiple comparisons of mean ranks (entries marked with different letters are significantly different; P < 0.025)

CHAPTER 5: INVESTIGATION OF PHEROMONE BIOSYNTHETIC GENES IN THE LONGHORNED BEETLE, NEOCLYTUS MUCRONATUS MUCRONATUS (F.) (COLEOPTERA: CERAMBYCIDAE) USING A DIFFERENTIAL GENE EXPRESSION APPROACH

5.1 Abstract

The longhorned beetles (Coleoptera: Cerambycidae) are among the most economically important pests of natural and managed forest systems worldwide. Many species produce volatile pheromones to unite the sexes on an appropriate host, and display a characteristic posture while releasing pheromone, or “calling.” Pheromones have been identified for several species and are used in monitoring efforts, but little is known about the biosynthesis of cerambycid pheromones. In this study, we used a differential gene expression approach to identify genes that may be involved in pheromone production. Total RNA was extracted from male Neoclytus m. mucronatus that were 1) dormant in the morning before dawn, 2) actively calling at noon, or 3) actively feeding beetles that were not calling at noon (n=3 for each group). I tested the hypothesis that transcripts from pheromone biosynthetic genes are expressed at higher levels in actively calling than in resting beetles. A transcriptome was assembled from the extracts using RNA-Seq, and the relative expression levels between each treatment were compared using edgeR and DESeq2 packages in R/Bioconductor. We found 72 contigs that were differentially expressed between the predawn and noon treatments, 68 contigs that differed between the predawn and calling treatments, and 23 contigs that differed between the noon and calling treatments. Among the differentially expressed contigs were a short-chain dehydrogenase/reductase resembling a pheromone biosynthetic gene found in Musca domestica, and an alpha-esterase from Tribolium castaneum. Understanding genes and key enzymes in this biosynthetic pathway may open new avenues for controlling these pests. 65

5.2 Introduction

Longhorned beetles (Coleoptera: Cerambycidae) are among the most economically important pests of natural and managed forest systems worldwide (Solomon 1995). Developing larvae bore into the vascular tissues of the host damaging living plants by disrupting the flow of nutrients. Because much of their life cycle is spent hidden beneath the bark of trees, cerambycids are difficult to control with sprayed insecticides. They can also remain undetected in pallets and solid-wood packing materials that accompany transcontinental cargo shipments (USDA-APHIS 2005), providing a means for their introduction to new locales. For example, the Asian longhorned beetle (ALB), Anoplophora glabripennis (Motchulsky), is an exotic pest from China that infests a wide variety of hardwood tree species. Since its introduction in 1996, ALB has caused severe damage to natural and urban forests in the northeastern U.S. (USDA-APHIS 2005). As of 2005, over 8,000 infested trees were removed in an effort to eradicate infestations in New York, Illinois, and New Jersey (USDA-APHIS 2005). The European species Tetropium fuscum (F.) is devastating spruce trees in Nova Scotia, Canada, where it was introduced in 1999 (Smith and Hurley 2000). Other longhorned beetle pests include the eucalyptus longhorned borer, Phoracantha semipunctata (F.); the citrus longhorned beetle, Anoplophora chinensis (Förster); and the brown fir longhorned beetle, Callidiellum villosulum (Fairmaire).

In recent years, it has become apparent that many of these beetles employ sex and aggregation pheromones to unite the sexes on a host plant (Allison et al. 2004, Millar et al. 2009). Volatile pheromones have been the target of research to develop effective methods for monitoring and controlling these pests (Fonseca et al. 2010, Nehme et al. 2010, Nehme et al. 2014, Silk et al. 2007). To fully exploit the pheromone-mediated behavior of longhorned beetles, a thorough understanding of the regulation and expression of these chemical signals is paramount. Elucidating pheromone biosynthetic pathways may lead to new management tectics that target the chemical communication systems of these beetles (Renwick 1992).

5.2.1 Pheromone Chemistry in the Cerambycidae

Much of our understanding of the chemical ecology of longhorned beetles is centered on the subfamily Cerambycinae. In many cerambycine species, males produce an aggregation pheromone from glands in the prothorax (Lacey et al. 2004, Noldt et al.1995, Ray et al. 2006). Both male and female cerambycines are attracted to volatiles emanating from the larval host, and once on an appropriate host, males release pheromones to attract conspecifics over shorter distances (Ginzel and Hanks 2005). As a male releases pheromone, he exhibits a distinct calling behavior termed the “pushup” stance, wherein he elevates his prothorax off the substrate by extending his front legs and remains motionless for some time (Lacey et al. 2007). Male-produced pheromones of some cerambycine species attract conspecifics across distances in excess of 100 m (Lacey et al. 2004). Many of these pheromones share a common structural motif: a six-, eight- or ten- carbon chain with hydroxyl or carbonyl groups on C2 and C3. Some males produce a single compound as their aggregation pheromone, such as Neoclytus a. acuminatus (F.) which produces (2S,3S)-2,3-hexanediol (Lacey et al. 2004). Other species produce blends of compounds. For example, male Xylotrechus colonus (F.) produce a complex blend consisting of ~70% (R)- and 10% (S)-3-hydroxyhexan-2-one and 17% (2S,3S)- and 3% (2R,3R)-2,3-hexanediol (Lacey et al. 2009). Some pheromone components are also more bioactive than others. Traps baited with (R)-3-hydroxyhexan-2-one lures attract significantly more X. colonus than either of the hexanediols, but the complete blend is more attractive than any individual component (Lacey et al. 2009). Because pheromones of some cerambycines share components that are identical to those of other species, ratios of individual compounds may be important as pre-zygotic mating isolation mechanisms (see Hanks et al. 2007, Lacey et al. 2009). However, individual pheromone components, such as hydroxyketones and diols, can be used as generic lures to attract a variety of cerambycines (Hanks et al. 2007, Lacey et al. 2009, Mitchell et al. 2011). The similarity in pheromone chemistry among the Cerambycinae implies a common biosynthetic origin, and suggests that populations may be managed by disrupting pheromone biosynthesis.

5.2.2 Pheromone Biosynthesis

Little is known about pheromone biosynthesis in the longhorned beetles. Studies using topically applied, deuterium-labeled precursors suggest that pheromones are synthesized de novo in at least two species: Xylotrechus pyrrhoderus and Hedypathes betulinus (Kiyota et al. 2009, Zarbin et al. 2013). Male X. pyrrhoderus produce both (S)-hydroxy- 3-octanone and (2S,3S)-2,3-octanediol. When deuterated (S)-hydroxy-3-octanone is topically applied to the prothorax of males, about 10% of the (2S,3S)-2,3-octanediol collected from beetles contains deuterated pheromone, indicating that the diol is produced

from the ketol (Kiyota et al. 2009). Likewise, male H. betulinus produce D5-labeled fuscumol acetate when the prothorax is topically treated with D5-labeled geranyl acetone (Zarbin et al. 2013). Similarly, Tetropium fuscum (F.) and Tetropium cinnamopterum Kirby produce labled fuscumol when treated with labeled farnesol (Mayo et al. 2013). These studies indicate that pheromone is biosynthesized via the mevalonate pathway in the subfamilies Lamiinae and Spondylidinae.

Pheromones of the Cerambycinae may be produced via a different biosynthetic pathway. The short-chain diols and hydroxyketones characteristic of cerambycine pheromones resemble products of fatty acid origin. In fatty acid biosynthesis, acetyl-CoA is typically extended with malonate units to ultimately assemble even chain-length fatty acids. Reverse reactions with similar intermediates also take place as fatty acids are degraded through the β-oxidation pathway. Several beetles synthesize fatty acid-derived aggregation pheromones de novo. For example, males in the family Cucujidae incorporate radiolabeled fatty acids (e.g., oleic, linoleic, and palmitic acids) into their macrolide pheromones (Vanderwel et al. 1990). The female cupreous chafer, Anomala cuprea (Coleoptera: Scarabaeidae), also produces a fatty acid-derived sex pheromone with two lactone components: (R,Z)-5-(–)-(1-octenyl)oxacyclopentan-2-one and (R,Z)-5- (–)-(1-decenyl)oxacyclopentan-2-one. These compounds result from the Δ9 desaturation of 16- and 18- carbon fatty acids, then a hydroxylation of C8, followed by two cycles of β-oxidation and cyclization (Leal 1998). It appears that the bark beetle anti-aggregation pheromone exo-brevicomin is produced by fatty-acid synthesis (Vanderwel et al. 1992, Perez et al. 1996, Song et al. 2014). 68

5.2.3 Pheromone Biosynthetic Genes

Despite the growing body of knowledge regarding cerambycid semiochemistry, there is a paucity of information concerning the molecular mechanisms involved in pheromone production. Much of the existing literature on pheromone biosynthesis focuses on moths (Tillman et al. 1999, Jurenka 2003, 2004, Rafaeli 2005), and, to a lesser extent, bark beetles (reviewed in Blomquist et al. 2010, Tittiger and Blomquist 2016). Numerous enzymes have been identified in the biosynthetic pathway of both fatty acid- and isoprenoid-derived pheromones. For example, there are more than five subgroups of desaturases, enzymes commonly found in moth pheromone production, that introduce a double bond into a hydrocarbon chain (reviewed by Xue et al. 2012). Isoprenoid biosynthesis involves various reductases and cytochrome P450s (Sandstrom et al. 2006, Huber et al. 2007). A farnesyl diphosphate synthase has recently been identified in T. fuscum (Mayo et al. 2013), but this gene is associated with the mevalonate pathway. It is currently unknown what genes are involved in pheromone production in the Cerambycinae, but transcriptomic approaches may reveal novel insight into pheromone biosynthesis in this group of longhorned beetles.

The overall goal of this research is to identify the biochemical pathways and physiological processes that regulate pheromone production in the longhorned beetles. Our studies will focus on the cerambycine Neoclytus m. mucronatus as a model for pheromone biosynthesis within the subfamily because it is an abundant species in the Midwest, and its pheromone comprises a single compound, (R)-3-hydroxyhexan-2-one, making identification of genes simpler. Several longhorned beetles in the subfamily with a structurally similar pheromones are pests of crops and forest lands. The coffee white stem borer, Xylotrechus quadripes Chevrolat, is a serious pest of Coffea arabica, and up to $40 million is spent annually for replacement of trees and loss of crops in India (Hall et al. 2006). The grape borer, Xylotrechus pyrrhoderus Bates, is a harmful pest of grape vines in Japan (Kiyota et al. 2009). Here in the United States, the red oak borer, Enaphalodes rufulus (Haldeman), was responsible for widespread decline of oaks during an outbreak period from 2001-2005, even though it is usually only a minor pest of oaks (Riggins et al. 2009). Understanding the biosynthetic pathway involved in pheromone 69 production may reveal novel methods of control by targeting key steps in pheromone biosynthesis. The objective of this chapter is to identify pheromone biosynthetic genes by comparing transcripts of calling male N. m. mucronatus and those not actively calling. My working hypothesis is that transcripts of genes involved in pheromone production will be more highly expressed in males that are actively releasing pheromone.

5.3 Materials and Methods

5.3.1 Source of Beetles

I collected live beetles from flight-intercept panel traps baited with insect pheromone (R)- 3-hydroxyhexan-2-one. Age and mating status was indeterminable for field-collected beetles, so specimens were also reared from felled hardwoods brought into the lab according to the methods described by Browne (1972). Adult N. m. mucronatus were reared from shagbark hickory, Carya ovata (Mill.) K. Koch.

5.3.2 Experimental Design

Nine males were flash-frozen in liquid nitrogen at various time points in September 2013. Three males were frozen at 0500 h, before dawn (predawn), three were frozen at noon while displaying the characteristic calling posture indicative of pheromone release (calling), and three were frozen while feeding (noon). Immediately after a beetle was flash-frozen, I removed the legs and elytra with a sterilized razor blade, separated the head, prothorax, and posterior (meso- and meta-thorax, and abdomen), and placed all three parts in 500 ml of RNAlater (Ambion Inc., Austin, TX, USA) to stabilize RNA. Beetles were stored at 4°C for no longer than four weeks prior to extractions.

5.3.3 RNA Extraction and Sequencing

RNA was isolated using Promega SV Total RNA Isolation System (Promega Corporation, Madison, WI, USA) following manufacturer instructions, except for two modifications: 1) during the purification by centrifugation step I cleared the lysate twice with 200µl of 95% ethanol, and 2) suspended the RNA in only 100µl of nuclease-free water. RNA quantity and purity was determined using a NanoDrop 2500 70

spectrophotometer, and the quality of RNA was further assessed using gel electrophoresis. There were three males in each of three treatments: pre-dawn, beetles calling at noon, and beetles feeding at noon.

All nine samples were submitted to the Purdue University Genomics Core (PUGC) facility where their quality was verified using the Agilent Bioanalyzer (nano/pico) RNA chip. Total RNA was converted into a library of template molecules using an Illumina® TruSeq® Stranded mRNA Sample Preparation Kit (Illumina, San Diego, CA, USA). The manufacturer’s protocol was followed, except that 0.8:1.0 volumes were used instead of half volumes, and shearing was carried out for 4 min at 95 °C. Samples were then sequenced using 1.5 lanes of Illumina Hi-Seq 2500 to produce 2x100 paired-end reads. Quality and adapter-clipped reads from all samples were combined and assembled de novo into a single library of contigs using Trinity 2.1.1 by the PUGC staff. Sequences of all contigs were compared to the National Center from Biotechnology Information (NCBI) databaseusing the basic local alignment tool (BLAST), and the best match for each contig was recorded. All contigs matching virus, bacteria, fungus, or rRNA were removed from the dataset, as well as contigs for which total counts across all treatments was less than 10.

5.3.4 Differential Gene Expression Validation

Assembled contigs were used as BLAST queries against Coleoptera sequence data at NCBI. Sequences retrieved from this search were used to identify putative genes involved in pheromone biosynthesis. Total RNA was collected as before from additional beetles in 2016, except that only two treatments were used (calling beetles at noon and resting beetles at predawn) and RNA was extracted only from the prothorax, where the pheromone glands are located. Sensi-Fast cDNA Synthesis Kit (Bioline, Taunton, MA) wasused to construct cDNA following the manufacturer’s protocol. The resulting cDNA was then used in quantitative real-time polymerase chain reaction (qRT-PCR) using 1 μl cDNA, 0.5 μl each of contig-specific forward/reverse primer (Table 5.1), 3 μl nuclease- free water, and 5 μl Sensi-Fast SYBR No-ROX qPCR master mix (Bioline). Reactions were performed on a BioRad CFX-96 system. After an initial denaturation step (10 min. 71

at 95 °C), 45 cycles of denaturing (5 s at 95 °C), and annealing/extension (30 s. at 65 °C), were performed with a real-time scan of fluorescence taken after each cycle. Cycle threshold (CT) values of genes of interest and a reference gene (α-elongation factor) were -ΔΔCT used to calculate fold change (2 ), which was regressed against log2 fold change calculated from Illumina counts as a measure of congruency. Regression data were analyzed using a linear regression model in SigmaPlot (Systat, 2015).

5.4 Results

5.4.1 RNA Sequencing and Assembly Summary

A total of 104,786 contigs were assembled de novo from total RNA of whole bodies of male N. m. mucronatus (Table 5.2). A total of 2,382 contigs matched non-target taxa or rRNA, and were removed from the dataset, resulting in the 102,404 contigs that were used in the analysis. A comparison of sample-sample distances based on Euclidian distance revealed considerable overlap among treatment groups (Fig. 5.2). This is likely due to a lack of genetic diversity of the male N. m. mucronatus used in this experiment that came from different populations. Although there is no overall difference between treatments, it is conceivable that individual genes, such as those involved in pheromone biosynthesis, would be differentially expressed.

5.4.2 Differential Gene Expression Validation

Using Deseq2 analysis, a total of 162 contigs were differentially expressed across experimental conditions (Table 5.3). Comparison between fold change of qRT-PCR was correlated with the log-fold change from the RNA-seq analysis, suggesting that there is congruency between both methods (Fig. 5.2). Of the 68 contigs that were differentially expressed between predawn and calling beetles, 33 contigs have no known annotation, and the remaining annotated contigs have not been previously associated with pheromone biosynthesis. However, a putative short-chain dehydrogenase/reductase (SDR) was differentially expressed in the Predawn vs. Noon comparison, showing significantly higher expression in the Noon sample (Fig. 5.3). An α-esterase was similarly differentially expressed in the same comparison (Fig. 5.4). 72

5.5 Discussion

Through the use of RNA-seq and a differential expression analysis, several transcripts contigs were identified that may play an important role in pheromone biosynthesis in N. m. mucronatus. There is evidence that in males of the cerambycine species X. pyrrhoderus an enzyme acts on a pheromone precursor within the pheromone glands. This species produces a blend of (S)-2-hydroxy-3-octanone and (2S,23)-2,3-octanediol, and topical applications of the deuterated hydroxyketone results in the production of the deuterated diol, suggesting that the ketone group is stereospecifically converted to produce the (2S,3S) enantiomer (Iwabuchi et al. 2014). Moreover, the ketone appears to only be produced in the (S)-configuration, suggesting that other enzymes, such as a short- chain dehydrogenase/reductase (SDR) may act to dictate the absolute configuration of this precursor. SDRs play a role in pheromone biosynthesis in Nasonia wasps (Niehuis et al. 2013) and the mountain pine beetle, Dendroctonus ponderosae Hopkins (Song et al. 2014). In Nasonia wasps, an SDR is thought to be involved in switching the chirality of the hydroxyl group, via a ketone intermediate. N. m. mucronatus also has a chiral hydroxyl group, making this SDR a likely candidate to be involved in the biosynthesis of the pheromone (3R)-3-hydroxy-2-hexanone. α-Esterases cleave an ester via hydrolysis, resulting in an alcohol and an aldehyde. Aldehydes are commonly found in the pheromones of moths, so α-esterases are expected to play a role in pheromone biosynthesis of moth pheromones. N. m. mucronatus utilizes an alkanediol pheromone, and the production of an alcohol from the reaction with the esterase could be a potential pathway by which this beetle produces its pheromone.

Contrary to my hypothesis, differential expression between predawn and calling beetles did not include any contigs that matched known pheromone biosynthetic genes, including the putative SDR. Despite the lack of differential expression in the calling period, it appears that expression of the putative SDR was low in only one of the biological reps (calling 3). Thus, it is likely that the calling behavior is less indicative of active pheromone biosynthesis than the time of day. One possible cause of this variation may be the age of beetles at the time of sampling. In male T. fuscum, genes involved in the mevalonate pathway are more highly expressed three days after the adult emerges (Mayo 73

et al. 2013), with 16- and 22-day-old beetles expressing farnesyl diphosphate synthase at decreasing levels, though transcript levels varied considerably between samples. Adult N. m. mucronatus do not feed, and live for fewer than 16 days under laboratory conditions (Lacey et al. 2007). Given that the age of the beetles in the present study is unknown, age-related decreases in pheromone biosynthesis could not be controlled for. Additionally, it is possible that expression level of pheromone biosynthesis genes is impacted by genetic background. In the moth Ostrinia nubialis, for example, the ratio of (E)- and (Z)-isomers of the pheromone varies widely across geographic populations, and exhibits moderate variability within populations (Löfstedt 1990). Using only lab-reared beetles in future studies may eliminate some of the variation caused by age and genetic differences.

Timing and expression of pheromone biosynthetic genes has been described in other taxa. For bark beetles in the genera Ips and Dendroctonus timing of expression is usually in reference to an applied treatment, rather than time of day (Tittiger and Blomquist 2016). Moreover, many insects with mevalonate-derived pheromone biosynthesis require a period of maturation feeding, which differs strongly from adult N. m. mucronatus, which do not feed. Many species of moths release pheromone at night, and the timing of biosynthesis and calling posture is synchronized by a pheromone biosynthesis activating neuropeptide (PBAN) (Blomquist et al. 2012). Results of the present experiment indicate that there may be less synchronization between biosynthesis and calling behavior, with putative biosynthetic genes highly expressed even in beetles that were not displaying the calling posture. Indeed, it appears that expression of genes involved in pheromone biosynthesis may be expressed for the duration of the calling period. This would make sense considering that N. m. mucronatus releases pheromones in microgram quantities, compared to the nanograms of pheromone produced by moths (Lacey et al. 2007, Blomquist et al. 2012).

With the identification of a putative pheromone biosynthetic gene, the next step will be to determine its specific role. RNA interference could be used to knock down the expression of the SDR, followed by collection and analysis of headspace volatiles to determine the absolute configuration of the emitted compound. If the pheromone differs from the 74 natural enantiomer, it would be conclusive evidence that this SDR is responsible for the absolute configuration of the pheromone of N. m. mucronatus. This project has laid the groundwork for investigation of pheromone biosynthesis in this subfamily of beetles for which nothing prior was known. In addition to identifying candidate genes with roles in pheromone biosynthesis, the assembly generated herein provides genetic and transcriptomic information from N. m. mucronatus which will add to a growing body of research aimed at elucidating the identity, expression, and function of key genes associated with pheromone production in the Cerambycinae. 75

5.6 References

Allison JD, Borden JH, Seybold SJ (2004) A review of the chemical ecology of the Cerambycidae (Coleoptera). Chemoecology 14:123–150 Barkawi LS, Francke W, Blomquist GJ, Seybold SJ (2003) Frontalin: De novo biosynthesis of an aggregation pheromone component by Dendroctonus spp. bark beetles (Coleoptera: Scolytidae). Insect Biochem Mol Biol 33:773–788 Bellés X, Martín D, and Piulachs M (2005) The mevalonate pathway and the synthesis of juvenile hormone in insects. Annu Rev Entomol 50:181–199 Blomquist GJ, Figuero-Teran R, Aw M, Song M, Gorzalski A, Abbott NL, Chang E, Tittiger C (2010) Pheromone production in the bark beetles. Insect Biochem Mol Biol 40:699–712 Blomquist GJ, Jurenka R, Schal C, Tittiger C (2012) Pheromone production: Biochemistry and molecular biology. In: Gilbert L (ed) Insect Endocrinology. Academic Press, Massachusetts, pp 523–567 Browne, LE (1972) An emergence cage and refrigerator collector for wood-boring insects and their associates. J Econ Entomol 65:1499–1501 Fonseca MG, Vidal DM, Zarbin PHG (2010) Male-produced sex pheromone of the cerambycid beetle Hedypathes betulinus: chemical identification and biological activity. J Chem Ecol 36:1132–1132 Ginzel MD, Hanks LM (2005) Role of host plant volatiles in mate location for three species of longhorned beetles. J Chem Ecol 31:213–217 Hall DR, Cork, A, Phythian SJ, Chittamuru S, Jayarama BK, Ventakesha MG, Sreedharan K, Vinod Kumar PK, Seetharama, HG, Naidu R (2006) Identification of components of male-produced pheromone of coffee white stemborer, Xylotrechus quadripes. J Chem Ecol 32:195–219 Hanks LM, Millar JG, Moreira JA, Barbour JD, Lacey ES, McElfresh JS, Reuter FR, Ray AM (2007) Using generic pheromone lures to expedite identification of aggregation pheromones for the cerambycid beetles Xylotrechus nauticus, Phymatodes lecontei, and Neoclytus modestus modestus. J Chem Ecol 33:889– 907 76

Huber DPW, Erickson ML, Leutenegger CM, Bohlman J, Seybold SJ (2007) Isolation and extreme sex-specific expression of cytochrome P450 genes in the bark beetle, Ips paraconfusus, following feeding on the phloem of host ponderosa pine, Pinus ponderosa. Insect Mol Biol 16:335–349 Iwabuchi K, Arakwa M, Kiyota R, Hoshino K, Ando T (2014) Carbonyl reduction in the biosynthesis of a male sex pheromone secreted by the grape borer Xylotrechus pyrrhoderus. J Chem Ecol 40:1146–1151 Jurenka R (2003) Biochemistry of female moth sex pheromones. In: Insect pheromone biochemistry and molecular biology. Blomquist GJ, Vogt R (eds) London, UK: Elsevier Academic Press, pp. 53–80

Jurenka R (2004) Insect pheromone biosynthesis. Top Curr Chem 239:97–131 Kim J, Matsuyama S, Suzuki T (2005) 4,8-Dimethyldecanal, the aggregation pheromone of Tribolium castaneum, is biosynthesized through the fatty acid pathway. J Chem Ecol 31:1381–1400 Kiyota, R., Yamakwa R, Iwabuchi K, Hoshino K, Ando T (2009) Synthesis of the deuterated sex pheromone components of the grape borer, Xylotrechus pyrrhoderus. Biosci Biotech Bioch 73:2252–2256 Lacey ES, Ginzel MD, Millar JG, Hanks LM (2004) Male-produced aggregation pheromone of the Cerambycid beetle Neoclytus acuminatus acuminatus. Chem Ecol 30:1493–1507 Lacey ES, Ray AM, Hanks, LM (2007) Calling behavior of the cerambycid beetle Neoclytus acuminatus acuminatus (F.). J Insect Behav 20:117–128 Lacey ES, Millar JG, Moreira JA, Hanks LM (2009) Male-produced aggregation pheromones of the cerambycid beetles Xylotrechus colonus and Sarosesthes fulminans. J Chem Ecol 35: 733–740 Leal WS (1998) Chemical ecology of phytophagous scarab beetles. Ann Rev Entomol 43:39–61 Levinson, A Levinson H (1995) Reflections on structure and function of pheromone glands in storage insect species. Anz Schädlkd Pflanzenschutz Umweltschutz 68:99–118 77

Löfstedt C (1990) Population variation and genetic-control of pheromone communication systems in moths. Entomol Exp Appl 54:199–218 May PD, Silk PJ, Cusson M, Béliveau C (2013) Steps in the biosynthesis of fuscumol in the longhorn beetles Tetropium fuscum (F.) and Tetropium cinnamopterum Kirby. J Chem Ecol 39:377–389 Millar JG, Hanks LM, Moreira JA, Barbour JD, Lacey ES (2009) Pheromone chemistry of cerambycid beetles. In: Nakamuta K, Millar JG (eds.) Chemical Ecology of Wood-boring Insects, pp. 52-79. Forestry and Forest Products Research Institute, Ibaraki, Japan. Mitchell RF, Graham EE, Wong JCH, Regel PF, Streiman BL, Hughes GP, Paschen MA, Ginzel MD, Millar JG, Hanks LM (2011) Fuscumol and fuscumol acetate are gneral attractants for many species of cerambycid beetles in the subfamily Lamiinae. Entomol Exp Appl 141:71–77 Mitchell RF, Hughes DT, Luetje CW, Millar JG, Soriano-Agatón F, Hanks LM, Robertson HM (2012) Sequencing and characterizing receptors of the cerambycid beetle Megacyllene caryae. Insect Biochem Mol Biol 42:499–505 Nehme ME, Trotter RT, Keena MA, McFarland C, Coop J, Hull-Sanders HM, Meng P, De Moraes CM, Mescher MC, Hoover K (2014) Development and evaluation system for Anoplophora glabripennis (Coleoptera: Cerambycidae) in the United States. Environ Entomol 43:1034–1044 Nehme ME, Keena MA, Zhang A, Baker TC, Xu Z, Hoover K (2010) Evaluating the use of male-produced pheromone components and plant volatiles in two trap designs to monitor Anoplophora glabripennis. Enviorn Entomol 39:169–176 Niehuis O, Buellesbach J, Gibson JD, Pthmann D, Hanner C, Mutti NS, Judson AK, Gadau, J, Ruther J, Schmitt T (2013) Behavioural and genetic analyses of Nasonia shed light on the evolution of sex pheromones. Nature 494:345–348 Noldt U, Fettköther R, Dettner K (1995) Structure of the sex pheromone-producing prothoracic glands of the male old house borer, Hylotrupes bajulus (L.) (Coleoptera: Cerambycidae). Int J Insect Morpho Embryo 24:223–234 78

Perez AL, Gries R, Gries G, Oehlschlager AC (1996) Transformation of presumptive precursors to frontalin and exo-brevicomin by bark beetles and the West Indian sugarcane weevil (Coleoptera). Bioorg Med Chem 4:445–450 R Core Team (2013). R: A language and environment for statistical computing. R Foundation for Satistical Computing, Vienna, Austria. http://www.R-project.org/ Ragaeli A (2005) Mechanisms involved in the control of pheromone production in female moths: recent developments. Ent Exp Appl 115:7–15 Ray AM, Lacey ES, Hanks LM (2006) Predicted taxonomic patterns in pheromone production by longhorned beetles. Naturwissenschaften 93:543–550 Renwick JAA (1992) New directions in semiochemical research. J Appl Entomol 114:431–438 Riggins JJ, Galligan LD, Stephen FM (2009) Rise and fall of red oak borer (Coleoptera: Cerambycidae) in the Ozark Mountains of Arkansas, USA. Florida Entomol 92:426–433 Robinson JD, Bradley RM, Brady RO (1963) Biosynthesis of fatty acids .4. studies with inhibitors. J Lipid Res 4:144–150 Sandstrom P, Welch WH, Blomquist GJ, Tittiger C (2006) Functional expression of a bark beetle cytochrome P450 that hydroxylates myrcene to ipsdienol. Insect Biochem Mol Biol 36:835–845 Song M, Delaplain P, Nguyen TT, Liu X, Wickenberg CJ, Blomquist GJ, Tittiger C (2014) Exo-Brevicomin biosynthetic pathway enzymes from the Mountain Pine Beetle, Dendroctonus ponderosae. Insect Biochem Mol Biol 53:73–80 Silk PJ, Sweeney J, Wu, JP, Price J, Gutowski JM, Kettela EG (2007) Evidence for a male-produced pheromone in Tetropium fuscum (F.) and Tetropium cinnamopterum (Kirby) (Coleoptera: Cerambycidae). Naturwissenschaften 94:697–701 Smith G, Hurley JE (2000) First North American record of the Palearctic species Tetropium fuscum (Fabricius) (Coleoptera: Cerambycidae). Coleopt Bull 54:540 Solomon JD (1995) Guide to Insect Borers in North American Broadleaf Trees and Shrubs. Agric. Handbk. Washington, D.C.: U.S. Department of Agriculture, Forest Service 79

Tillman JA, Seybold SJ, Jurenka RA, Blomquist GJ (1999) Insect pheromones—an overview of biosynthesis and endocrine regulation. Insect Biochem Mol Biol 29:481–514 USDA-APHIS (2005) Asian longhorned beetle cooperative eradication program strategic plan, http://www.aphis.usda.gov/plant_health/plant_pest_info/asian_lhb/downloads/stra tegic.pdf (last accessed: November 5, 2012) Vanderwel D, Pierce HD, Oehschlager AC, Borden JH, Pierce AM (1990) Macrolide (cucujolide) biosynthesis in the rusty grain beetle, Cryptolestes ferrugineus. Insect Biochem 20:567–572 Vanderwel D, Gries G, Singhi SM, Borden JH, Oehlschlager AC (1992) (E)- and (Z)-6- nonen-2-one: biosynthetic precursors of endo- and exo-brevicomin in two bark beetles (Coleoptera: Scolytidae). J Chem Ecol 18:1389–1404 Xue B, Rooney AP, Roelofs WL (2012) Genome-wide screening and transcriptional profile analysis of desaturase genes in the European corn borer moth. Insect Sci 19:55–63 Zarbin PHG, Fonseca MG, Szczerbowski D, Oliveira ARM (2013) Biosynthesis and production site of the sex pheromone components of the cerambycid beetle, Hedypathes betulinus. J Chem Ecol 39:358–363

Table 5.1 List of primers used in qPCR experiment Gene Sequence Fragment size (bp) α-esterase 5’CAACCAGTCTCTGCCTGTCA3’ 149 5’AAAACCCGAAAGGTCCAATC3’ Short-chain 5’ TGGACATCACCAGACGTTGT3’ 150 dehydrogenase/ 5’ ACCTGGTGCTTTGGATGTGT3’ reductase

β-tubulin 5’ TCACAGACGGCAGTCTTCAC3’ 153 5’ TCCTAGACATGGCCGTTACC3’ α-elongation 5’ CTTATCGAGGCTTTGGATGC3’ 151 5’ CTACCATGCCGGGTTTTAGA3’ Actin 5’ CGGCTTATCGCAGTATGACA3’ 150 5’ CTCTCTCCACCTTCCAGCAG3’

Table 5.2 Summary of sequencing and assembly statistics A Sequencing statistics Sample # reads rRNA M1 42,635,818 1.0% M2 55,139,772 1.7% M3 48,718,010 1.8% N1 25,402,396 1.5% N2 44,460,910 1.3% N3 53,257,072 0.8%% C1 45,818,174 2.1% C2 40,756,778 1.0% C3 44,248,804 1.7% B Assembly statistics All No. Contigs 104,786 N50 1,635 Avg. Length 822 >500 bases No. Contigs 41,337 N50 2,150 Avg. Length 1,628 A) Summary of sequencing statistics. B) Summary of de novo Trinity assembly. Samples are labeled with a letter indicating their treatment (M = predawn, N = noon non-calling, C = noon calling). 82

Table 5.3 Summary of differential expression in planned comparisons of treatments aComparison # of contigs # of contigs Totalb with +FCb with -FCb Predawn vs. 36 36 72 Noon Predawn vs. 34 34 68 Calling Noon vs. Calling 10 12 22 aThe first treatment listed in each comparison was set as the baseline. bFDR<10-2

Figure 5.1 Heatmap showing the Euclidean distances between replicates of each treatment as calculated from the regularized log transformation in Bioconductor.

Figure 5.2 Results of a validation experiment showing the correlation between fold change from qRT-PCR analyses (2-ΔΔCT) vs. logFC (counts per million of treatment/counts per million of control). The calculated r2 value reported shows a significant, positive correlation (p = 0.03). Each data point represents a single gene (n = 5).

Figure 5.3 Box plot of normalized counts from Illumina sequencing of the putative short- chain dehydrogenase/reductase (SDR) compared between the predawn and noon groups (Wald test, p<0.05). 86

Figure 5.4 Box plot of normalized counts from Illumina sequencing of the putative α- esterase compared between the predawn and noon groups (Wald test, p<0.05). 87

CHAPTER 6: CONCLUSION

The research presented herein provides new and essential information regarding pheromone systems in the family Cerambycidae. My research on Astyleiopus variegatus served to validate previous trapping studies which hinted that this beetle produces fuscumol and fuscumol acetate as pheromones. Indeed, this was the first time a pheromone had been identified from a North American species of longhorned beetle in the subfamily Lamiinae. This work demonstrated that the same pheromone component is produced by a Canadian spondylidine (Tetropium cinnamopterum), a European spondylidine invading Canada (Tetropium fuscum), and a Brazilian lamiine (Hedypathes betulinus), suggesting a geographically robust pattern in pheromone production. This is in contrast to the Cerambycinae, in which chain length appears to vary by geographic location. There had previously been little success in collecting pheromone from headspace samples of lamiines, and this research spurred efforts to investigate pheromone production in other species native to the U.S. The determination of the absolute configuration of the pheromone components was also conducted, revealing the use of the (S)-enantiomer of fuscumol, the same as that reported for T. fuscum, and the structurally similar (S)-fuscumol aceate.

Field trapping was the logical next step following identification of the pheromone of A. variegatus. I conducted field experiments that tested the attraction of lamiines to enantiomers of fuscumol, either singly or in pairs, determining that several species responded in a treatment-specific way. Notably, A. variegatus responds to the blend of (S)-fuscumol and (S)-fuscumol acetate, corroborating my previous work in identifying the pheromone of this species. Fewer beetles responded in a treatment-specific way to traps baited with fuscumols in this experiment, compared to previous results using racemic blends of fuscumol (five beetles vs. eight beetles). It appears that although species-specific blends are highly attractive, as seen for A. variegatus, there is some level of cross-attraction among these species. This natural variation may be a manifestation of the plasticity necessary for the evolution of pheromones in this family of beetles. Moreover, responses to components not found in the pheromone blend is likely granted 88

by either additional, specific odorant receptors in the antennae, or non-specific receptors capable of detecting other components. Others have already begun work to characterize odorant receptors and odorant binding proteins in longhorned beetles to better understand the physiological underpinnings of cross-attraction (Mitchell et al. 2012, Li et al. 2014). Finally, this work demonstrated that beetles do respond to specific stereoisomers in the field, confirming that chirality is important in segregating species that share similar pheromones. There are likely several key stereoisomers that serve to inhibit attraction among insects with similar pheromones, as well. The ratio of stereoisomers along with specific host volatiles may further contribute to specificity in the pheromone signal of these species. In fact, recent work has shown that host volatiles are necessary to induce pheromone production in many lamiines, which may explain the aforementioned difficulty in collecting pheromone from beetles in this subfamily in the past. Characterizing pheromones, host volatiles, and odorant receptors will be important next steps in understanding this increasingly complex system of chemical signaling in these beetles.

My research on chirality in contact sex pheromones came on the heels of the discovery that monomethyl-branched alkanes across Insecta appear to be (R)-enantiomers. My experiments demonstrated that even with such conserved structure in cuticular waxes across the insects, male Neoclytus acuminatus acuminatus are capable of discriminating between (R)- and (S)-enantiomers, and that the (R)-enantiomer of major and minor components is bioactive. My results also suggest that (S)-minor components may elicit small responses by these beetles. Once again, a thorough study of the odorant receptors that detect these substances will provide additional insights into the chemically mediated contact chemoreception of these beetles.

Shifting my focus to a molecular level, I sought to gain a better understanding of the biosynthesis and regulation/expression of pheromones in the longhorned beetles. It is curious that much is known about pheromone structural motifs, including the effects of chirality, in the Cerambycinae, yet little is known about pheromone biosynthesis. In fact, more is known about lamiine/spondylidine pheromone biosynthesis, despite the fact that we are just beginning to understand structural motifs in that subfamily. I conducted an 89

experiment investigating differential gene expression based on biology and behaviors of Neoclytus mucronatus mucronatus, in order to identify pheromone biosynthetic genes. Through this work, I identified two transcript contigs that may function in pheromone biosynthesis in this beetle. Confirming their role in biosynthesis will be the next step, and may involve the use of RNA interference to knock down expression of these genes, and observe the effect on pheromone structure. Particularly exciting is the prospect that one of these contigs may be a short-chain dehydrogenase/reductase that may effect the absolute configuration of the pheromone of this beetle, 3-hydroxy-2-hexanone. The transcriptome of the cerambycine N. m. mucronatus that was assembled as part of my doctoral research will be an important resource for future work involving genetic and molecular questions in the Cerambycinae.

The work presented in this dissertation expands upon current knowledge of the chemically-mediated mate-location behaviors of longhorned beetles. Pheromone structures of cerambycids can vary greatly between species, and some volatile aggregation pheromoens have conserved motifs that appear to fall along taxonomic lines. However, some characteristics of pheromones (e.g., differences in chain-length, functional groups, blends of compounds, and stereoisomerization) impart species specificity to these signals and allow them to act as prezygotic mating isolation mechanisms among sympatric species. My work demonstrates that stereochemistry is important in mate location of longhorned beetles, not only in the volatile pheromones of cerambycines, but also those in the Lamiinae. Moreover, this research has demonstrated that chirality plays a vital role in contact chemoreception. Future work should investigate the roles of blends of stereoisomers to gain further understanding of how longhorned beetles utilize structurally similar pheromones. Such work will lead to a more thorough understanding of the diverse and complex chemical signals used in this economically and ecologically important family of insects. 90

6.1 REFERENCES

Li H, Zhang AJ, Chen LZ, Zhang GA, Wang MQ (2014) Construction and analysis of cDNA libraries from the antenna of Batocera horsfieldi and expression pattern of putative odorant binding proteins. J Insect Sci volume 14 article 57 Mitchell RF, Hughes DT, Luetje CW, Millar JG, Soriano-Agaton F, Hanks LM, Robertson HM (2012). Sequencing and characterizing odorant receptors from the cerambycid beetle Megacyllene caryae. Insect Biochem Mol Biol 47:499–505 91

VITA

Gabriel Patrick Hughes was born and raised in California, growing up in sunny San Diego. After his freshman year of college, he spent two years in Hiroshima, Japan, serving as a missionary for the Church of Jesus Christ of Latter-Day Saints. His experiences led him to pursue a career in entomology, and he earned a bachelor’s degree in Integrative Biology from Brigham Young University in 2008. Gabriel then participated in an internship at the Max Planck Institute for Chemical Ecology in Jena, Germany, where he became interested in chemical signaling in insects. Upon completion of the internship, he began his graduate research in Dr. Ginzel’s forest entomology laboratory at Purdue University, studying pheromones in longhorned beetles. He earned his master’s degree in 2011, and continued on as a doctoral student in Dr. Ginzel’s lab. Gabriel’s time at Purdue University was instructive and productive, as he authored or co-authored eight peer-reviewed research articles, and received a NIFA-AFRI predoctoral fellowship to complete research on pheromone biosynthesis in the longhorned beetles. After graduation he will return to California to begin work as a postdoctoral fellow at the University of California, Riverside, where he will study the pheromone communication systems of Helicoverpa moths with Dr. Ring Cardé.