A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
GHENT UNIVERSITY
FACULTY OF SCIENCE
DEPARTMENT OF BIOLOGY
ACADEMIC YEAR 2017-2018
Validation of The Novel Loop-mediated Isothermal Amplification (LAMP) for Specific-
detection of Meloidogyne mali in Belgium
ARUNEE SUWANNGAM
Promoter: Prof. dr. ir. Wim Wesemael A thesis submitted to Ghent University in
partial fulfilment of the requirements for
the degree of International Master of
Science in Agro- and Environmental
Nematology
1
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
Validation of The Novel Loop-mediated Isothermal Amplification (LAMP) for
Specific-detection of Meloidogyne mali in Belgium
Arunee Suwanngam¹
¹Ghent University, Department of Biology, Ledeganckstraat 35, 9000 Ghent, Belgium
Abstract. The root-knot nematode, Meloidogyne mali has recently been added to the EPPO A2 list as a quarantine pest. This nematode cause damage to various economically important crops and the deterioration of woody plants in different geographical regions. To imply effective phytosanitary measure, control and prevention, fast and accurate diagnostics methods are required. The Mma-specific detection assays described by Zhou et al in 2017 were validated and optimized. The results showed that the specific PCR assay could detect as low as 36 pg of genomic DNA and corresponded with the detection limits of the LAMP reaction under optimized conditions. The specificity of both PCR and LAMP assay was high, without cross- amplification reaction with other related nematode species. Notably, the LAMP reaction successfully detected M. mali in 40 minutes. This assay was also adapted for on-site detection using the OptiGene plant lysis buffer to replace the full nucleic acid extraction method. In April
2018, 10 root samples (Ulmaceae) were collected from elm trees at the INBO research station where in the 1970s and 1990s possible infected elm trees from the Netherlands were planted.
The results revealed that the ten samples were greatly amplified by PCR and LAMP assay.
Moreover, these diagnosis results were confirmed by nucleotide sequences that shared 99-100% similarity with accession number KM887145, KM887146, KY433449 and KM433450 respectively. This analysis confirmed the presence of M. mali in Belgium 30 to 40 years after the introduction with infected elm trees. The Mma-specific detection assay offered high specificity, sensitivity and simplicity for rapid detection of Meloidogyne mali for further reliable pest risk analysis and assessment.
Keywords: Meloidogyne mali, quarantine nematode, LAMP
2
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
INTRODUCTION
Meloidogyne species are one of the prominent plant-parasitic nematodes that cause damage to the most important economic plants. They have a wide range of habitats, such as rivers and deserts. Meloidogyne mali, apple root-knot nematode causes significant damage to different kind of plants, especially apple and mulberry trees by stimulating gall-like swellings.
This nematode is known as polyphagous with various host plants such as shrubs, perennials or herbaceous plants and particularly Ulmaceae and Rosaceae. Meloidogyne mali was first found in the northern part of Japan (Itoh et al., 1969). It was officially reported in several continents and countries including Italy, the Netherlands, France and United States of America. In addition, Meloidogyne mali has been defined as a quarantine pest in the EPPO A2 list (EPPO,
2017).
In 1969, Meloidogyne mali was first reported in apple trees in Nagano Prefecture and its distribution was limited to the northern part of Japan (Itoh et al., 1969). Otherwise in 1984, it was abundantly found in the mulberry orchards in Hokkaido and Honshu province (Toida and Yaegashi, 1984). Later in 1988, it was found again in Kyushu island in the southern part of
Japan. The epidemic in these areas may have been caused by the introduction of infected mulberry seedlings from other provinces of Japan (Araki, 1988). For the intercontinental spread to Europe, it has been estimated that Meloidogyne mali contaminated plant material from Asia was exported prior to the World War II. The plant material was used in the breeding program in the Netherlands for the Dutch Elm Disease. In 1979, this nematode was reported for the first time in Italy from the roots of the elm trees at San Rossore ( Pisa, Toscana region) and
Mantignano (Firenze, Toscana region). From 2008-2014, it was widespread found in several areas in the Netherlands such as Baarn, Wageningen (Dutch Elm Disease Experimental Fields
3
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
on Ulmus), The Hague (on street trees) and Haarlem district (NPPO of the Netherlands, 2014; de Nijs et al., 2016). In France, this nematode was firstly identified in 2014-2015 at the nursey of INRA Nancy (Champenoux North-Eastern) and later in 2016 at Champenoux and Vincennes forest (Ile-de-France region) (NPPO of France, 2016). Most recently, it was found in New
York, USA (EPPO, 2017; Eisenback et al., 2017). The epidemic of Meloidogyne mali in these countries was estimated that it was introduced by importing infected Elm trees from the
Netherlands. Elm trees are important for the traditional rural landscape due to its highly tolerance to severe environmental conditions. Additionally, the elm trees are alternatively being used as ornamental plants, roadside trees and natural windbreaks or shelterbelts to prevent the damage caused by wind. This could be the reason why the elm trees have been planted in several territories of European countries (Harwood et al, 2011; Caudullo and Rigo, 2016). Under those circumstances, EPPO reported the possibility of Meloidogyne mali distribution in various countries such as Belgium, Denmark, France, Germany, Ireland, Italy, Spain, Slovakia,
Romania and England by importing young elm trees from the original outbreak site in the
Netherlands under the breeding program to increase the resistance of Elm trees against Dutch
Elm Disease (Ahmed et al., 2013). The status of Meloidogyne mali in Belgium will be assessed in 2018.
The pathogenesis of Meloidogyne mali starts after penetration of the second stage juvenile ( J2) into the roots and begins to feed on the host tissues, which is conducive to encouraging adjacent cells be separated and developed into specialized hypertrophied feeding cells necessary for growth and development of nematodes. The knot formation occurs with multiple infections, which cause the deformation of roots and the appearance of a chain-of- beads. In addition, infected roots cause deterioration of the plant as well as hindering the minerals and water uptakes, resulting in extremely decline of the plant growth. In the most
4
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
severe cases, the root system is completely destroyed when population density increases, leading to the easily overthrow of the plants (EPPO, 2017).
Early detection is one of a prerequisite supporting role for effective prevention, control and elimination of pests. For Meloidogyne species, the classical taxonomy depending on morphological characteristics and perennial pattern assay of second-stage juvenile (J2) and adult females are commonly used ( Jepson, 1983; Handoo et al, 2005; Eisenback, 2014) .
Although, traditional morphological identification assays relied upon microscopic examination, which limits its routine uses because of requiring an extra performing time, high experience and specialized skills. Unfortunately, misidentification occurred quite often with Meloidogyne mali, especially with close related species including M. arenaria and M. aredenensis (Itoh et al., 1969), M. hapla (Greco, 1981), M. suginamensis (Toida, 1984), M. thamesi (Toida and
Yaegashi, 1991) and M. ulmi (Ahmed, 2013). Isozyme electrophoresis is another technique for nematode identification. This detection technique can be performed with adult females and second- stage juveniles has limitations resulting in unreliable diagnosis ( Esbenshade &
Triantaphyllou, 1990). Moreover, the main drawback of this technique is time consuming, requires, manual skills and extra working resources such as the roots with females, microscope, microscopy slide, lactic acid and glycerin. Alternatively, molecular biology techniques such as
PCR (Polymerase chain reaction) and LAMP (loop-mediated isothermal amplification) is a currently accepted reliable nematology detection method. The most desirable traits to develop detection methods is a straightforward implementation, precision and cost-effectiveness. PCR diagnostics is a highly reliable, sensitive, specific amplification and short-duration technique, which can be applied for several successful nematode detection assays as M. incognita, M. arenaria, M. hapla (Dong et al, 2001; Adam et al, 2007; Ye et al, 2015). Although, an important limitation in various PCR methods was the detection limits that must be considered to avoid
5
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
unreliable results. Recently, a novel molecular technique called LAMP was developed. LAMP is an isothermal nucleic acid sequence-based amplification technique that can amplify the target gene at a constant temperature with rapidity results in less than thirty minutes, highly sensitivity and specificity without the need of sophisticated instruments (Wong et al, 2017). Additionally, this technique is an efficient and reliable alternative detection method that can be taken to represent the weakness of PCR because it can operate without thermocyclers which are necessary for PCR. Furthermore, the LAMP product does not require the inspecting and quantification by electrophoresis, which consumes considerable time and extra resources
(Sahoo et al, 2016). The main strength of LAMP is its cost-effectiveness and robustness, which has the ability to selectively amplify few copies of target DNA. In view of this detection technique is useful due to simply implement effectively and potentially to be field surveillance instruments, making this technique as fundamentals for on-site application (Notomi et al., 2000;
Niu et al. , 2012; Abdullahi et al, 2015). The LAMP method has been successful considerably in diagnosing a wide range of organisms, for example in the detection of bacteria (Kaewphinit et al, 2013; Yin et al, 2016), fungi (Luo et al. 2014; Nakayama et, al. 2017), phytoplasma
(Kogovsek et al, 2016; De Jonghe et al, 2017), virus (Kobayashi et al, 2014; Wang et al, 2015;
Ziros et al, 2015; Zhao et al, 2016; Niihara et al, 2017), viroid (Tsutsumi et al., 2010; Lenarcic et al., 2013; Tangkanchanapas et al, 2018) and the infectious disease in humans (Abdullah et al, 2014; Fan et al, 2015; Pham et al, 2015; Bakhtiari et al, 2016; Yari et al, 2016). Moreover, a LAMP assay has also been used to detect nematodes such as Bursaphelenchus xylophilus
(Kikuchi et al. 2009; Kang et al. 2015; Meng et al., 2017), B. cocophilus (Ide et al., 2017),
Radopholus similis (Peng et al., 2012), Tylenchulus semipenetrans (Lin et al., 2016; Song et al., 2017), Pratylenchus zeae (Liu et al., 2017) and Anguina wevelli (Yu et al., 2018). Recently, it has been used the LAMP technique in the diagnosis of root-knot nematode species such as
Meloidogyne spp., M. enterolobii (Niu et al., 2011), M. hapla (Peng et al., 2017) and M. mali
6
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
(Zhou et al., 2017). In fact, the detection methods should be integrated from several techniques to satisfy all expectations efficiently and reliably.
The discovery of Meloidogyne mali has not yet been known among Belgian populations.
This research aims were therefore focused on the optimization and validation of previous PCR and LAMP assay for specific-detection of the recent quarantine root-knot nematode in Belgium.
The second aim was an evaluation of on-site adaptation and field detection including specific- sampling to be used as the basis of pest risk analysis and assessment to be applied for the further risk management.
MATERIALS AND METHODS
1. Nematode populations
1.1 Sample collection
Nematode samples were obtained from the stock cultures of the Flanders Research
Institute for Agriculture, Fisheries and Food (ILVO) (see Table 1). For Meloidogyne mali sampling was done at the Research Institute for Nature and Forest (INBO) in Belgium by collecting root samples around elm trees that were originally coming from field trials in the
Netherlands that were found to be infected with M. mali. The root samples were stored in cold room (4°C) and kept for the further diagnosis.
7
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
Table 1. Meloidogyne species and other nematodes used to assess PCR and LAMP assay
Species Source Other information Original material for M. mali was provided Meloidogyne mali ILVO by Prof. Gerrit Karssen and the INBO site was sampled. Meloidogyne chitwoodi ILVO - Meloidogyne fallax ILVO - Meloidogyne hapla ILVO - Original material was provided by Prof. Meloidogyne minor ILVO Gerrit Karssen Meloidogyne incognita ILVO - Original material was provided by Prof. Meloidogyne enterolobii ILVO Gerrit Karssen Meloidogyne javanica ILVO - Herterodera schachtii ILVO - Ditylenchus destructor ILVO -
1.2 Nematode extraction
Nematodes were extracted from the plant roots with the Baermann’s funnel (Baermann,
1917). Roots were carefully washed to remove the soil and chopped into small pieces of 1-2 cm. Then, the root pieces were placed on the filter paper and put in the funnel in a mist chamber.
The nematode suspensions were tapped after 24 hours and observed under light microscope.
8
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
2. Morphological identifications
2.1 Perineal pattern preparations
The preparation of perineal patterns was performed according to the method described by Taylor and Netscher (1974). The root galls containing adult females were selected and washed gently. The adult females were teased out of the roots and stored in 0.9% sodium chloride. The neck of Meloidogyne females were cut off and the body was fixed in 45% lactic acid for 5 minutes. The body tissue was gently cleaned and all debris was removed from the pattern. The cuticle was cut off in one third and then carefully trimmed to obtain the given perineal pattern in a square shape. After that, the perineal pattern was transferred onto a drop of glycerin on a perspex slide surrounded by a paraffin ring. A cover slip was gradually placed on a glycerin drop and sealed with nail polish.
2.2 Permanent mount preparations
The second-stage juveniles of M. mali were hand-picked and transferred to a drop of water in staining blocks. Solution I (4% formalin 99 parts and glycerin 1 part) was heated up to
60-80 °C and filled in the staining blocks with an equal amount of water. Staining blocks containing killed nematodes were then uncovered stored in a desiccator containing 96% ethanol and placed in an incubator oven at 37 °C. After 12 hours, the stain blocks were brought out from the desiccator and the amount of excess liquid was reduced by pipetting. Solution II (96% ethanol 95 parts and glycerin 5 parts) was added and staining blocks were then stored in an incubator oven at 37°C while being partially cover (three-quarters) to allow the evaporation of ethanol. A few drops of solution II were then added in staining blocks every two hours for three times and solution III (96% ethanol 50 parts and glycerin 50 parts) was filled later. After 16-24 hours, the nematodes were removed from the oven and placed in a desiccator containing
9
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
calcium chloride to allow the remaining water to evaporate until they become mounted (De
Grisse, 1969).
Observations on both perineal patterns and second-stage juveniles were performed and pictures taken under an optical microscope installed with differential interference contrast
(DIC) and stream essentials included an imaging analysis software cellSens Entry 1.9 (Olympus
BX51-SC30). Morphometrics and morphological characters were compared with the existing reports such as Itoh et al. (1969), Toida (1979), Araki (1988) and Ahmed et al. (2013).
3. DNA template preparations
Genomic DNAs (gDNA) was isolated from nematode individually according to the method described by Holterman et al (2006). Nematodes were picked up and transferred into
0.2 µl PCR tube containing 25 µl of nuclease-free water (MilliQ). Afterwards, 25 μl of Worm
Lysis Buffer Plus (200mM NaCl, 200mM Tris-HCl pH 8.0, 0.1M Dithiotreitol and 800 μg / ml
Proteinase K) were added and incubated in a thermocycler for one and a half hour at 65 °C followed by 99 °C for 5 minutes. gDNAs were then stored at -20 °C for further PCR amplification analysis.
The concentrations of gDNA were prepared in a range of 10⁰ to 10 ̄ ⁷. Each concentration was prepared with 5 µl gDNA dissolved with 45 µl sterile water and used for both PCR and
LAMP assays.
10
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
Purification of PCR amplification products was conducted using Smartpure PCR kit
(Eurogentec) following manufacturer’s protocol to evaluate the detection Mma-specific PCR assay. The genomic DNA quantifications were assessed by a full-spectrum spectrophotometer
(NanoDrop 1000 3.8.1) and analyzed by Macrogen, Inc (MACROGEN group)
4. The optimization and validation of the Meloidoyne mali specific PCR reaction
To determine the optimal concentration of LAMP-inner primers, Mg²⁺ and annealing temperature that provides the Meloidogyne mali (Mma) specific PCR amplification products, different primer concentrations were evaluated using Mma-F3 and Mma-B3 concentrations of about 0.2 – 0.5 µM. The concentration of Mg²⁺ was also tested in a range of 2.0 – 4.0 mM. All reaction mixture had a total volume of 25 μl comprised of BIO-X-ACT™ Short Mix (Bioline
Reagents Ltd.) plus 10 µM of each forward and reverse inner primers, 2 µl DNA template and dissolved with nuclease-free water to the final volume. PCR amplification cycling was operated with the cycling conditions of denaturation at 94°C for 1 minutes, followed by 94 °C for 30 seconds, annealing for 30 seconds, 72 °C for 30 seconds, and a final extension at 72 °C for 10 min.
The determine the optimum annealing temperature to be used in DNA amplification method, a range of temperatures between 54- 58 °C was examined with optimized primer and
Mg²⁺ concentrations. All reactions were conducted in the Bio-Rad C1000 Thermal Cycler (Bio-
Rad, Hercules, Ca, USA).
11
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
The sensitivity of Mma-specific PCR assay was operated using gDNA from a single second-stage juvenile and a serial 10-fold dilution was performed later and subjected to PCR.
All reaction mixtures were carried out as described before.
To examine the quality of PCR amplification products, 5 µl PCR products were stained with Midori Green Direct stain (Nippon Gene Co., Ltd., Düren, Germany) and separated in 2% agarose gel (0.5X TBE) together with 100 bp plus DNA ladder H3 RTU (Nippon Gene Co.,
Ltd., Düren, Germany). The PCR products were visualized and imaged under blue light using an Azure c150 Gel Imaging Workstation (Azure Biosystems, Inc., Ca, USA).
5. LAMP reaction
5.1. Optimization of the LAMP reaction conditions
The M. mali specific LAMP assay by Zhou et al (2017) was optimized and validated by testing different concentrations of hybrid inner primers (Mma-FIP and Mma-BIP) at 0.4 - 1.6
μM and the external primers (Mma-F3 and Mma-B3) at 0.1 - 0.6 μM with or without adding
0.4 μM of loop primers, LoopF and LoopB. The reaction mixture was carried out with 15 μl of
GspSSD Isothermal Master Mix ISO -001, 2 μl of DNA extracted solution and adjusted with nuclease-free water to the final volume of 25 μl. The mixture was then incubated at 63 ° C for
50 minutes.
12
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
The incubation time and temperature for the LAMP amplification assays were tested at a temperature range of 55-70 °C and 20-50 minutes of incubation time using optimized primer concentrations, including loop primers. All LAMP reactions were tested using a Genie® II instrument (OptiGene Ltd., Horsham, West Sussex, UK), which detected the products in real time by fluorescence measurement.
5.2 Validation of LAMP detection
Genomic DNA of M. mali was used in the analysis of sensitivity and the limit of detection (LOD) of LAMP reactions using a 10-fold dilution series from 10⁰ (3.6 × 10³ pg/μL) to 10 ̄ ⁷ (3.6 × 10 ̄ ⁴ pg/μL). Sensitivity tests were repeated three times.
To determine the specificity of LAMP amplification for M. mali, genomic DNA of M. mali was compared with seven other Meloidogyne species and two other plant-parasitic nematodes in this LAMP reaction test (Table 1). Specificity tests were repeated three times.
All LAMP tests were carried out in Genie® II instrument and the LAMP amplification reaction were conducted as described before.
Table 2. The LAMP primers used for detection of Meloidogyne mali (Zhou et al., 2017)
Primer Type Primer sequence 5’ -3’ CGACGTATCCTCCCAATCTTGTCGCAATG LAMP–Mma FIP forward outer primer AGCCTTGTTATTG CGACTCTCGTCGTGTAACGGGATGGCAC LAMP–Mma BIP backward outer primer AACTGCTCAG LAMP–Mma F3 forward inner primer TGCTGCTGGATCATTACAC LAMP–Mma B3 backward inner primer TCCTGGGCTCATTAAGTCT LAMP–Mma LB forward loop primer CTACGCTGGTGTCTGTGT LAMP–Mma LF backward loop primer CGTGGAGTAGACGAAGAAATCT
13
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
6. On-site adaptation
The OptiGene plant lysis buffer (OptiGene Ltd., UK), Worm Lysis Buffer Minus (1M
NaCl, 1M Tris-HCl pH8) and Worm Lysis Buffer Plus (WLB ̄, 1mol/l DTT, 20mg/ml
Proteinase K) were tested for the extraction of nucleic acid from the root samples. All reactions were carried out with 25 μl LAMP reaction mixture consisting of 15 μl of GspSSD Isothermal
Master Mix ISO-001, 2 μl of each lysate concentrations, each optimized primer concentrations and adjusted with nuclease-free water (MilliQ) to the final volume. The reaction mixtures were incubated at 63°C for 40 minutes and the annealing step was performed slowly by cooling down the temperature from 98°C to 80°C in order to confirm the reaction by detecting fluorescence in a Genie® II portable machine.
To find the optimal concentrations of the LAMP reaction to detect M. mali in the infected root samples, extraction with OptiGene plant lysis buffer was implemented on a single root gall. The lysate was then diluted 10, 100, 1000, 10000 and 100000 times with the reaction mixture described above.
7. LAMP testing from nematode field samples in Belgium
To determine the reliability of our validated method, nematode samples collected in
Belgium were tested for the M. mali-specific PCR and LAMP assays. Under the optimized conditions, gDNAs of second-stage juveniles were carried analysed with different primer pairs as shown in Table 3. Furthermore, the infected root samples were examined with the Mma- specific LAMP assays and compared with the root samples of M. chitwoodi and M. fallax. The positive root gall samples were repeated and compared with more related Meloidogyne species.
14
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
Table 3. Primers used in PCR detection
Primer code Primer sequence 5’ -3’ Specificity and source
LAMP–Mma F3 TGCTGCTGGATCATTACAC ITS-5.8S rDNA
LAMP–Mma B3 TCCTGGGCTCATTAAGTCT Zhou et al., 2017
JB3 TTTTTTGGGCATCCTGAGGTTTAT COI gene
JB5 AGCACCTAAACTTAAAACATAATGAAAATG Derycke et al., 2010
28-81for TTAAGCATATCATTTAGCGGAGGAA 28S ribosomal DNA
28-1006rev GTTCGATTAGTCTTTCGCCCCT Holterman et al., 2008
Nematode nucleic acids were obtained from the Diagnostic Center for Plants (DCP,
Belgium), which were collected from Ulmus minor (botanical garden, Ghent University) and
Zelkova serrata (Arboretum Wespelaar, Haacht). The Mma-specific LAMP assays were carried out and compared with Meloidogyne fallax, M. chitwoodi, M. hapla, Globodera pallida using the reaction mixture containing 15 µl of GspSSD Isothermal Master Mix ISO-001, 1.2 µM hybrid inner primers (Mma-FIP and Mma-BIP), 0.2 µM external primers (Mma-F3 and Mma-
B3), 0.4 µM loop primers (Mma-LB and Mma-LF) and adjusted to the final volume with nuclease-free water. The LAMP amplification reactions were performed in a Genie® II device at a constant temperature of 65 °C for 40-50 minutes and the amplification results were visualized by real-time fluorescence monitoring.
15
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
RESULTS
1. Morphological identifications
Morphological characteristics of Meloidogyne mali second-stage juveniles and adult females were investigated. The second-stage juveniles are characterized with a slender body, conspicuous annulated, the head region slightly offset from the rest of the body with low lip, stylet slender with small knobs, rounded and sloped backwardly, median esophageal bulb oval, lateral fields with four incisures and tail regions mostly straight. Its length varies from short to medium with conoid to a finely pointed tip. The hyaline tail terminus has various lengths, anterior part obviously delimitated. The average of all measurements approximated to those previously reported but minor difference was found in some features on the condition that more specimens were observed (Fig. 1A-D). The female perineal patterns were diagnosed as oval, enclosed of smooth striae, dorsal arch low and flat, large phasmids with striae always bending downwards. Vulva arch flat and striae partially towards both ends of vulval slit, its length similar to the distance between phasmids. The lateral fields distinct with one incisure while not being observed double incisures (Figure1E).
16
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
B D
E A D C
Figure 1. Light microscope photographs of Meloidogyne mali. A-D: second-stage juvenile. A: entire body; B: anterior region; C: posterior part; D: lateral field with four incisures. E: female perineal pattern.
17
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
Table 4. Morphometric characters of Meloidogyne mali second-stage juveniles (J2). All measurements are in µm.
Meloidogyne mali Character Itoh et al. (1969) Ahmed et al. (2013) Observed N 25 5 21 28.5 30.2±0.7 24.9±3.7 a (27-31) (27.1-34.8) (19.58-31.09) 13.3 14.4±2.3 11.6±1.6 c (12-15) (12.5-17.4) (7.94-14.46) 3.7 3.3±0.7 3.6±0.5 c' (3-5) (2.5-3.9) (2.74-4.75) 418 420±21.7 354.4±19.5 Body length (390-450) (390-446) (321.03-392.93) 14.5 14.0±1.1 14.5±2.2 Body width (14-16) (12.2-15.2) (10.94-18.33) 8.5 9.4±1.8 8.8±1.4 Body width at anus (7-9) (8.3-11.5) (6.27-10.83) 14 12.1±1.5 10.6±1.2 Stylet length (12-15) (10.9-13,.8) (8.26-12.81) 31 30.2±4.3 31.1±4.8 Tail length (30-34) (27.1-34.8) (22.54-43.72) 7.0±2.1 9.8±0.9 Tail terminus length - (5.1-9.8) (7.21-10.82)
18
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
2. The optimization of and validation of the Meloidoyne mali specific PCR reaction
The optimization of LAMP-inner primer concentration was determined to be 0.2 µM, which provided a single sharp amplicon band of approximately 300 bp on the agarose gel electrophoresis when compared with the other concentrations (Fig. 2A). The optimal Mg²⁺ concentrations for the Meloidogyne mali specific PCR was determined to be 3.0 mM, which provided slightly clearer amplification results than 2.0 mM. While no amplicon was synthesized when the concentration of Mg²⁺ was increased to 4.0 mM. (Fig. 2B).
The optimal annealing temperature for the Mma-specific PCR assay was 56°C as its represented a rather distinct amplification product size (Fig. 2C).
0.2 µM 0.3 µM 0.5 µM
M M1 M2 P N B M M1 M2 P N M M1 M2 P N B B (A)
2.0 mM 3.0 mM 4.0 mM
M M1 M2 P N B M M1 M2 P N B M M1 M2 P N B (B)
19
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
58 °C 56 °C 54 °C
M M1 N B M M1 N B M M1 N B (C)
Figure 2. Optimization of LAMP-inner primer, Mg²⁺ concentrations and annealing temperature in agarose gel electrophoresis. A: Primer concentrations. B: Mg²⁺ concentrations. C: Anneal temperature. M1, INBO sample 8; M2, INBO sample 9; P, positive control (Meloidogyne mali);
N, (Meloidogyne chitwoodi); B, buffer; M, 100 bp Plus DNA ladder H3 RTU (NIPPON Gene
Co., Ltd., Duren, Germany).
The detection limits of Mma-specific PCR assay shown the amplified DNA size from
3.6×10³ to 3.6 pg gDNA but its amplicon band was very faint (Fig. 3). Hence, the sensitivity of
PCR assay was 36 pg and similar to the previously reported at about 200 pg (Zhou et al., 2017)
(Fig. 3).
M 10³ 10² 10¹ 10⁰ 10 ¹̄ 10 ²̄ 10 ³̄ M
Figure 3. The limit of detection (LOD) of Mma-specific PCR assay using serial dilutions of
Meloidogyne mali genomic DNAs.
20
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
3. LAMP reaction
3.1 Optimization of the LAMP reaction conditions
The hybrid inner primer of 1.2 µM and the external primer of 0.2 µM were the optimal concentrations. The optimized conditions showed initial fluorescence signal at about 17-34 minutes (figure 4A, 4C). The anneal derivative showed the peak of melting curves at average of 89.33 °C (figure 4B, 4D).
(A)
(B)
21
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
(C)
(D)
Figure 4. Optimization of hybrid inner primer and the external primer by LAMP assay using the GspSSD Isothermal Master Mix ISO-001 enzyme kit. Amplification signal: (A) Mma-
FIP/Mma-BIP, (C) Mma-F3/Mma-B3. Specific melting temperature: (B) Mma-FIP/Mma-BIP,
(D) Mma-F3/Mma-B3. Samples in the LAMP reactions are color-coded as shown.
22
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
The optimal incubation temperature was found, at 63-65°C demonstrating the fastest reaction speed at about 12 minutes and highest fluorescence intensity signals (Fig. 5). The positive fluorescence signal occurred during the entire assays.
55 °C 60 °C
63 °C 65 °C
70 °C
Figure 5. Determination of the optimal temperature requirement for the Mma-specific LAMP assay. LAMP reactions were performed for 50 minutes at 55, 60, 63, 65 and 70 °C in Genie II.
Samples in the LAMP reactions are color-coded as shown.
23
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
3.2 Validation of LAMP detection
The analytical sensitivity of Mma-specific LAMP assay showed that the exponential growth in the LAMP amplification reactions occurred within in a range of 3.6×10³ pg/µl
(undiluted) to 36 pg (10 ̄ ²) (figure 6). In a comparative diagnosis with conventional PCR assay, it was found that limitation of detection was 100 times higher than LAMP assay. The amplified
Mma-specific PCR assay was faint at the concentration of 3.6 pg (see above). Therefore, the sensitivity of both PCR and LAMP detection techniques was equal at about 36 pg (Figure 3;
Table 5). Moreover, the detection limits of this Mma-specific LAMP assay at 36 pg was similar to the LOD value at about 2 pg of what was previously reported by Zhou et al. (2017).
M 10⁰ 10 ¹̄ 10 ²̄ 10 ³̄ 10 ⁴̄ 10 ⁵̄ 10 ⁶̄
24
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
Figure 6. Sensitivity assessment of the LAMP assay in comparison with conventional PCR method using serial dilutions of Meloidogyne mali genomic DNAs
Table 5. Comparative sensitivities of the loop-mediated isothermal amplification (LAMP) with conventional polymerase chain reaction (PCR) assay systems and previous description using a
10-fold serial DNA concentration for detecting Meloidogyne mali.
Detection methods gDNA (pg/µl) LAMP assay (Genie® II) Zhou et al. (2017) PCR assay Ampl.time (m:s)/Tm (°C) 10⁴ - - 2×10⁴ 11.75 ± 0.40 3.6×10³ + 2×10³ 89.05 ± 0.04 12.74 ± 0.79 3.6×10² + 2×10² 88.83 ± 0.03 19.02 ± 0.64 3.6×10¹ + 2×10¹ 88.34 ± 0.56 3.6 not detected +* 2 3.6×10 ̄ ¹ not detected - not detected 3.6×10 ̄ ² not detected - - 3.6×10 ̄ ³ not detected - - 3.6×10 ̄ ⁴ not detected - - * faint band
25
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
To determine the specificity of LAMP detection assays, the DNA extracted from closely related Meloidogyne species and two others plant-parasitic nematodes were included (Fig. 7).
The appearance of positive fluorescence signal indicated that the optimized LAMP condition could detect the specific DNA sequence of Meloidogyne mali without cross-amplification with other species.
Figure 7. The amplification curves and specific anneal temperatures of the LAMP specificity assays for Meloidogyne mali compared with nine other nematode species.
26
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
4. On-site adaptation
The results showed that OptiGene plant lysis buffer (OptiGene Ltd., UK) provided positive fluorescence signal curves in comparison with Worm Lysis Buffer Minus and Worm
Lysis Buffer Plus, which is commonly used to extract DNA from nematodes (figure 8). The reaction for OptiGene plant lysis buffer started giving initial amplification signal at about 12 minutes whereas for WLB⁺ this was at 21 minutes for the reaction of WLB⁺. The amplification signal of the nucleic acid extracted with WLB ̄ was not detected.
(A)
(B)
Figure 8. Comparison of lysis buffer with optimized LAMP assay using Worm Lysis Buffer
Plus, Worm Lysis Buffer Minus and OptiGene plant lysis buffer. A: fluorescence signals. B: melting derivative curves.
27
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
The OptiGene plant lysis buffer worked greatly when diluted 10-100 times. The amplification curves of both concentrations (10¹, 10²) increased the fluorescence signal at about
20 minutes, which was close to the positive control (Figure 9A). The melting temperature indicated a specific melting peak abound 88°C (Figure 9B).
(A)
(B)
Figure 9. Optimization of lysate buffer concentration within a range of 10³-10 ̄ ⁴ pg/µl by Mma- specific LAMP assay using infected root plants A: amplification signals. B: the anneal reaction curves.
28
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
5. Specific-field sampling of Meloidogyne mali in Belgium
Under the optimized Mma-specific LAMP conditions, gDNA of nematodes collected from
INBO were examined. The amplification of DNA fragments in cytochrome oxidase subunit I regions using JB3 / JB5 primers and large subunit ribosomal DNA with 28-81for / 28-1006rev primers provided non-specific PCR products as a single or multiple band sizes, as shown in
Figure 10A-B. In contrast, DNA fragments amplified by the inner primer; Mma-F3/Mma-B3 in the internal transcribed spacer and 5.8S ribosomal DNA (ITS-5.8S) regions represented a unique band size and greater quality as shown in figure 10C.
A B C
10 3 5 6 10 M 2 3 3 4 4 5 6 8 10 12 M 2 3 4 5 6 8 10 12 2 3 4 5 M 6 8 10 12
Figure 10. PCR amplification results after amplified at different regions. A: Cytochrome oxidase subunit I, B: 28S ribosomal DNA, C: Internal transcribed spacer and 5.8S ribosomal
DNA regions (ITS-5.8S). 2-12, INBO sample 2-12; M, 100 bp Plus DNA ladder H3 RTU; grey, non-specific band.
29
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
For the specific M. mali monitoring, five of the ten samples gave positive amplification results as shown in figure 11. The period to reach the melting temperature to initiate amplification signals ranged from 14 to 43 minutes. All positive products showed anneal reaction peak in a range of 87.81-88.84°C.
Figure 11. Fluorescence results from the detection of infected root galls using the GspSSD
Isothermal Master Mix ISO-001 enzyme kit under the optimized conditions. A: fluorescence signal curves B: derivative of fluorescence intensity. Samples in the LAMP reactions are color- coded as shown.
30
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
The LAMP amplicons assay was successful to detect the root gall samples containing
M. mali as indicated in figure 12. The real-time fluorescence intensity was detected initial amplification signal at about 27 minutes (Fig. 12A) and the melting derivative emitted fluorescence intensity at 88°C (Fig. 12B). This optimized LAMP technique did not generated amplification of other Meloidogyne samples.
(A)
(B)
Figure 12. Real-time amplification signals of infected root gall using the GspSSD Isothermal
Master Mix ISO-001 enzyme kit under the optimized conditions. A: the fluorescence signals
B: melting temperature. Samples in the LAMP reactions are color-coded as shown.
31
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
The LAMP assays successfully amplified DNA fragments were done with samples from the diagnostic lab originating from elm trees. The fluorescence intensity in both samples were increased at about 12-14 minutes. The LAMP amplicons showed a single peak of anneal derivative of 88°C (Figure 13).
(A)
(B)
(C)
32
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
(D)
Figure 13. LAMP amplification curves of nematode specimens given by diagnostic center for plants (DCP) using LAMP assay. Amplification signal curves: (A) specimen 1; (C) specimen
2. Melting temperature: (B) specimen 1, (D) specimen 2.
Table 6. Detection of nematode samples collected in Belgium using PCR and LAMP assay.
Detection assay PCR LAMP Sample COI 28S rDNA No. Sampling site (Zhou et ITS-5.8S code (Derycke (Holterman al., (Zhou et et al., et al., 2017) al., 2017) 2010) 2008) 1 INBO2 Ulmaceae, INBO + + + + 2 INBO3 Ulmaceae, INBO + + - - 3 INBO4 Ulmaceae, INBO + + - + 4 INBO5 Ulmaceae, INBO + + + - 5 INBO6 Ulmaceae, INBO + + + - 6 INBO8 Ulmaceae, INBO + + - + 7 INBO10 Ulmaceae, INBO + + - - 8 INBO12 Ulmaceae, INBO + + + + Ulmus minor, 9 1892 - Not apllicable Botanical garden Zelkova kerrata, 10 2315 - Not apllicable Arboretum Wespelaar
33
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
Nucleotide sequences were analyzed by the basic local alignment search tool (BLAST) in GenBank and found that the positive sequences gave the best fits with their statistics about
99% identity, 800-832 bits score and expect value of 0.0. Thus, analysis proved that the nematode specimens were Meloidogyne mali. Nucleotide sequences are shown in figure 14.
> Mma isolate 8 TGAGGTTTATGTTTTAATCGCGCCTGTATTTGGTTTAGTTAGAATATCAACAATACTAATTTCAT CGAAAAAAGATTTATATGGTCATAAAGGAATAATTATAGCTATTTTATCTATTGGTTTTGTAGG TTGTTTGGTTTGGGCTCATCATATATTTACTGTAGGAATAGATCATGATTCTCGGGCTTATTTTA GATCTGCAACTATAATTATTGCTATTCCAACTGGAATAAAAGTTTTTAGTTGACTAATAACTTT ATTTGGAATAATAAAAAATAAAAGAGATTATTTATTATATTGAGTTTTAGGTTTTATTTTTATAT TTGTTGTTGGAGGATTATCTGGATTAGTTTTAAGAAATGCTGGTTTAGATATTTTTTTACATGAC ACTTATTATGTGGTAGCTCATTTTCATTATGTTTTAAGTTTAGGTGCT
> Mma isolate 10 TGAGGTTTATGTTTTAATCGCGCCTGTATTTGGTTTAGTTAGAATATCAACAATACTAATTTCAT CGAAAAAAGATTTATATGGTCATAAAGGAATAATTATAGCTATTTTATCTATTGGTTTTGTAGG TTGTTTGGTTTGGGCTCATCATATATTTACTGTAGGAATAGATCATGATTCTCGGGCTTATTTTA GATCTGCAACTATAATTATTGCTATTCCAACTGGAATAAAAGTTTTTAGTTGACTAATAACTTT ATTTGGAATAATAAAAAATAAAAGAGATTATTTATTATATTGAGTTTTAGGTTTTATTTTTATAT TTGTTGTTGGAGGATTATCTGGATTAGTTTTAAGAAATGCTGGTTTAGATATTTTTTTACATGAC ACTTATTATGTGGTAGCTCATTTTCATTATGTTTTAAGTTTAGGTGCT
Figure 14. Nucleotide sequence of Meloidogyne mali isolated from elm trees in Belgium
34
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
DISCUSSION
Meloidogyne mali is a root-knot nematode causing damage in several plant species particularly in Ulmaceae and Rosaceae. Recently it was listed as quarantine nematode in
European countries. Nevertheless, specific-surveys of M. mali have not yet been conducted in
Belgium so the likelihood of establishment is still unknown (EPPO, 2017). Simplicity and rapid diagnosis will result in more effective outcomes. Unfortunately, misidentification was a critical issue which caused pest risk analysis failure.
In morphological characteristics, the most important characters to distinguish M. mali from other close related species based on the female perennial pattern and second-stage juveniles (Itoh et al., 1969). All morphometrics values of J2 are resemble to the original described of M. mali from the report of Itoh et al. (1969) and Ahmed et al. (2013) such as body breadth, stylet length, tail length, tail terminus long. However, some feature like the body length is a bit shorter, which might be due to intraspecies variant among populations. In addition to the perineal pattern that showed high similarity to Okamoto et al. (1983) and Araki (1988), for example large phasmids and lateral lines.
PCR-based molecular techniques are the most valuable detection methods, which are commonly used in the identification of plant-parasitic nematodes. The revalidated PCR assay from the original report of Zhou et al (2017) has been established. The results revealed that 0.2
µM of inner primers and 3 mM of Mg²⁺ final concentration gave the best results because there was no inhibitory effect. The optimum temperature for the inner primers to amplified DNA fragments was 58°C, which was slightly different from Zhou et al. (2017) who found an optimum temperature of 56°C that might be caused by the components of the reaction kits ()
35
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
used for the reaction mixture (BIO-X-ACT™ Short DNA Polymerase, MgCl2, ultra-pure dNTPs manufactured by Bioline). The sensitivity of PCR reactions was tested in the range of
10³ to 10 ̄ ³ using initial concentration of 3.6 × 10³ pg/μl. The Mma-specific PCR assay under optimized conditions could detect as little as 10¹ pg/µl (36 pg) of gDNA which corresponded to conventional PCR of original described (Zhou et al., 2017), with detection limits 10² (200 pg) of DNA that may be related to the DNA quantitative being used to test.
LAMP reactions need to be modified to be suitable for application. In the current work, the optimal concentrations were1.2 µM of the hybrid inner primer and 0.2 µM of the external primers with the optimal constant temperature at 65°C was correlated to the stability reaction with initial gDNA concentration of 10⁴ pg/μl of previously reported (Zhou et al., 2017). The species-specific primers used in this study came from the report of Zhou et al. (2017). The detection limits of LAMP assay under optimized conditions was 10¹ pg/μl (36 pg) of gDNA and corresponded to the sensitivity previously reported who found 10⁰ pg/μl (2 pg) as detection limit. The difference might be related to the quantity and purity of DNA isolated by Qiagen
DNeasy blood and tissue kit different from other extraction methods (worm lysis buffer). The
LAMP specificity assay proved to be successful in detecting all isolates of Meloidogyne mali without cross-reacting with other nematode species or natural intraspecific variables, leading to mismatch at primer-binding site.
For the on-site LAMP adaptation, the OptiGene plant lysis buffer worked efficiently with infected root samples (J2 and females) and can be used for nucleic acid extraction methods.
In comparison with worm lysis buffer as used in several previous articles, the OptiGene plant lysis buffer has great speediness and sensitivity over the other two. Hence, it is possible to use this lysis buffer to monitor for on-site application.
36
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
Remarkably, an ideal nucleic acid extraction method must be considered. In order to compare the quantitation of gDNA, Qiagen DNeasy Blood and Tissue Kit (QIAGEN group) provided the best quality and purity (3.6×10³ pg/µl) of genomic DNA which greater than original assays (Data not show). This, might be related to its ability to overcome various substances like proteins, fats, salts as well as nucleic acids from non-target organisms.
To confirm the effectiveness of this revalidated assay, selection of an appropriate target gene is a key for the DNA amplification-based testing success. Nucleic acid amplified in the
ITS-5.8S rDNA genes demonstrated highly conservation among populations, unique amplicon products and greatly divergent from other nematode species (Zhou et al., 2017). The ITS-rDNA region is a crucial marker for the identification and distinguishing of Meloidogyne species. The effectiveness of this LAMP detection method was greatly improved and successfully amplified
DNA fragments from root samples in Belgium, without cross-reaction with other nematode species. Moreover, nucleotide sequences also confirmed that nematode specimens tested were
Meloidogyne mali with 99% similarity shared with the available sequence (KM887145,
KM887146, KY433449 and KM433450) in GenBank database. This is the first report of M. mali in Belgium. The place where samples were collected is an elm tree collection that contains elm trees that were imported from The Netherlands in the 1970s and 1990s after the termination of the breeding programme for Dutch elm disease. Similar spreading of M. mali to Italy has been reported (EPPO, 2017)
In this present study, M. mali was successfully detected by the revalidated detection assay. The reaction was completed in 40 minutes on the Genie® II portable instrument with high specificity. This LAMP assay also provided great simplicity and is a more cost-effective molecular technique for rapid detection of Meloidogyne mali from infected root plants. A large-
37
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
scale investigation (import and export) necessary to perform in order to avoid further establishment of this important root-knot nematode. Therefore, these Mma-specific detection assay was ideally suitable to develop for on-site application in order to analyze and assess pest risk management reliably.
REFERENCES
Abdullah, J., Saffie, N., Sjasri, F.A., Husin, A., Abdul-Rahman, Z., Ismail, A., Aziah, I. And
Mohamed, M. (2014). Rapid detection of Salmonella Typhi by loop-mediated
isothermal amplification (LAMP) method. Braz J Microbiol 45, 1385–1391.
Abdullahi, U. F., Igwenagu, E. And Jumli, M.N. (2015). Comparative Advantage of the Novel
Loop-Mediated Isothermal Amplification Technique over the Conventional Polymerase
Chain Reaction. International Journal of Scientific Study 3, 172-177.
Adam, M. A. M., Phillips, M. S., and Blok, V. C. (2007). Molecular diagnostic key for
identification of single juveniles of seven common and economically important species
of root-knot nematode ( Meloidogyne spp.). Plant Pathology 56, 190 –197.
Ahmed, M. (2013a). On the species status of the root-knot nematode Meloidogyne ulmi
Palmisano & Ambrogioni, 2000 (Nematoda: Meloidogynidae). M.S. dissertation, Ghent
University, Belgium.
38
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
Ahmed, M., van de Vossenberg, B.T., Cornelisse, C. and Karssen, G. (2013b). On the species
status of the root–knot nematode Meloidogyne ulmi Palmisano and Ambrogioni, 2000
(Nematoda, Meloidogynidae). ZooKeys 362, 1-27.
Araki, M. (1988). Detection of Meloidogyne mali in Kyushu island. Proc. Assoc.Pl.Prot 34,
205-207.
Baermann, G. (1917). Eine einfache Methode zur Auffindung von Ankylostomum (nematoden)
Larven in Erdproben. . Geneesk. Tijdschr. Ned-Indië 57, 131-137.
Bakhtiari, S., Alvandi, A., Pajavand, H., Navabi, J., Najafi, F. And Abiri, R. (2016).
Development and diagnostic evaluation of loop-mediated isothermal amplification
using a new gene target for rapid detection of Helicobacter pylori. Jundishapur J
Microbiol 9, e28831.
Caudullo, G. and De Rigo, D. (2016). Ulmus - elms in Europe: distribution, habitat, usage and
threats. . Publ. Off. EU, Luxembourg, e01bd40+ pp.
De Grisse, A.T. (1969). Redescription ou modification de quelques techniques utilissée dans
l’étude des nematodes phytoparasitaires. . Mededelingen Rijksfaculteti der
Landbouveten Gent, 351–369.
De Jonghe, K., De Roo, I., and Maes, M. (2017). Fast and sensitive on-site isothermal assay
(LAMP) for diagnosis and detection of three fruit tree phytoplasmas. European Journal
of Plant Pathology 147, 749–759.
39
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
Den Nijs, L. J. M. F., Van Bruggen, A.S., and Karssen, G. (2016). Importing plants into the
Netherlands: an assessment of the risk of plant parasitic nematodes and a survey on their
entry with adhering soil. EPPO Bulletin 46, 94–102.
Derycke, S., Vanaverbeke, J.,, Rigaux, A., Backeljau, T., and Moens, T. (2010). Exploring the
Use of Cytochrome Oxidase c Subunit 1 (COI) for DNA Barcoding of Free-Living
Marine Nematodes. Plos one 5, e13716.
Dong, K., Dean, R.A., Fortnum, B.A., and Lewis, S.A. (2001). Development of PCR primers
to identify species of root-knot nematodes: Meloidogyne arenaria, M. hapla, M.
incognita and M. javanica. Nematropica 31, 273-282.
Eisenback JD, Hirschmann H, Triantaphyllou A. (1980). Morphological comparison of
Meloidogyne female head structures, perineal patterns, and stylets. J. Nematol 12:300–
313.
Eisenback, J.D., Graney, L.S., and Vieira P. (2017). First report of the apple root-knot nematode
(Meloidogyne mali) in North America, found parasitizing Euonymus in New York.
Plant Disease 101, 510.
EPPO (2017). EPPO A1 and A2 lists of pests recommended for regulations as quarantine pests.
European and Mediterranean Plant Protection Organization, Paris, France.
Esbenshade, P. R., and Triantaphyllou, A. C. (1990). Isozyme Phenotypes for the Identification
of Meloidogyne Species Journal of Nematology 22, 10-15.
40
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
Fan, F., Du, P., Kan, B. And Yan, M. (2015). The development and evaluation of a loop-
mediated isothermal amplification method for the rapid detection of Salmonella
enterica serovar Typhi. Plos one 10, e0124507.
NPPO of France. (2016). First report of Meloidogyne mali in France.
Handoo, Z. A., Skantar, A.M., Carta, L.K., and Schmitt, D.P. (2005). Morphological and
molecular evaluation of a Meloidogyne hapla population damaging coffee (Coffea
arabica) in Maui, Hawaii. Journal of Nematology 37, 136-145.
Harwood, T. D., Tomlinsonb, I., Potterb, C.A. and Knight, J. D. (2011). Dutch elm disease
revisited: past, present and future management in Great Britain. Plant Pathology 60,
545–555.
Holterman, M., van der Wurff, A., van den Elsen, S., van Megen, H., Bongers, T., Holovachov,
O., Bakker, J., and Helder, J. (2006). Phylum-Wide Analysis of SSU rDNA Reveals
Deep Phylogenetic Relationships among Nematodes and Accelerated Evolution toward
Crown Clades. Molecular Biology and Evolution 23, 1792–1800.
Holterman, M., , Karssen, G., Van Den Elsen, S., Van Megen, H.,, Bakker, J., and Helder, J.
(2008). Small Subunit rDNA-Based Phylogeny of the Tylenchida Sheds Light on
Relationships Among Some High-Impact Plant-Parasitic Nematodes and the Evolution
of Plant Feeding. Phytopathology 99, 227-235.
41
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
Ide, T., Kanzaki, N., Giraldo, P.P.P., and Gilbin-Davis, R.M. (2017). Loop-mediated isothermal
amplification (LAMP) for detection of the red ring nematode, Bursaphelenchus
cocophilus. Nematology 19, 559-565.
Itoh, Y., Ohshima, Y., and Ichinohe, M. (1969). A root-knot nematode, Meloidogyne mali n.
sp. on apple-tree from Japan (Tylenchida; Heteroderidae). Applied Entomology and
Zoology 4, 194-202.
Jebson, S. B. (1983). Identification of Meloidogyne : a general assessment and a comparison of
male morphology Üsing light rnicroscopy, with a key to 24 species. Revue Nématol 6,
291-309.
Kaewphinit, T., Arunrut, N., Kiatpathomchai, W., Santiwatanakul, S., Jaratsing, P., and
Chansiri, K. (2013). Detection of Mycobacterium tuberculosis by using loop-mediated
isothermal amplification combined with a lateral flow dipstick in clinical samples.
BioMed Research International 2013: 926230.
Kang, J.S., Kim, A-Y., Han, H.R., Moon, Y.S. and Koh, Y.H. (2015). Development of two
alternative Loop-mediated isothermal amplification tools for detecting pathogenic pine
wood nematodes. Forest Pathology 45, 127–133.
Kikuchi, T., Aikawa, T., Oeda, Y.,, Karim, N and Kanzaki, N. (2009). A Rapid and Precise
Diagnostic Method for Detecting the Pinewood Nematode Bursaphelenchus xylophilus
by Loop-Mediated Isothermal Amplification. The American Phytopathological Society
99, 1365-1369.
42
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
Kobayashi, T., Yagami, A., Suzuki, K., Yoshikawa, T. and Matsunaga, K. (2014). Concurrent
reactivation of herpes simplex and varicella zoster viruses confirmed by the loop-
mediated isothermal amplification assay. Case Rep Dermatol 6, 5-9.
Kogovsek, P., Mehle, N., Pugelj, A., Jakomin, T., Schroers, H-J., Ravnikar, M. (2016). Rapid
loop-mediated isothermal amplification assays for grapevine yellows phytoplasmas on
crude leaf-vein homogenate has the same performance as qPCR. European Journal of
Plant Pathology 148, 75–84.
Lenarcic R., Morisset, D., Mehle, N. and Ravnikar, M. (2013). Fast real-time detection of Potato
spindle tuber viroid by RT-LAMP. Plant Pathology 62, 1147–1156.
Lin, B., Wang, H., Zhou, K., and Liao, J. (2016). Loop-mediated isothermal amplification for
the detection of Tylenchulus semipenetrans in soil. Plant Disease 100, 877-883.
Liu, X., Wang, H., Lin, B., Tao, Y., Zhou, K., and Liao J. (2017). Loop-mediated isothermal
amplification based on the mitochondrial COI region to detect Pratylenchus zeae. Eur
J Plant Pathol 148, 435–446.
Luo, J., Taniwaki, M.H., Iamanaka, B.T., Vogel, R.F., and Niessen, L. (2014). Application of
loop-mediated isothermal amplification assays for direct identification of pure cultures
of Aspergillus flavus, A. nomius, and A. caelatus and for their rapid detection in shelled
Brazil nuts. Int J Food Microbiol 172, 5-12.
43
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
Meng, F., Wang, X., Wang, L., Gou, D., Liu, H., Wang, Y., and Piao, C. (2017). A loop-
mediated isothermal amplification-based method for detecting Bursaphelenchus
xylophilus from Monochamus alternatus. Forest Pathology 48, e12404.
Greco, N. (1981). Infestazioni di Meloidogyne hapla su Olmo montano. Informatore
Fitopatologico Anno XXXI 6, 27.
Nakayama, T., Yamazaki, T., Yo, A., Tone, K., Alshahni, M., Fujisaki, R. and Makimura, K.
(2017). Detection of fungi from an indoor environment using loop-mediated isothermal
amplification (LAMP) method. Biocontrol Sci 22, 97–104.
NPPO of the Netherlands. (2014). Findings of Meloidogyne mali in trees of Ulmus in urban
area.
Niihara, H., Kohno, K., Tobita, R., Ishikawa, N. and Morita, E. (2017). Rapid diagnosis of
herpes zoster by loop-mediated isothermal amplification in a pregnant woman showing
folliculitis-like eruption without vesicles. Dermatol 44, e174–e175.
Niu, J.-H., Guo, Q-X., Jian, H., Chen, C-L., Yang, D., Liu, Q and Guo, Y-D. (2011). Rapid
detection of Meloidogyne spp. by LAMP assay in soil and roots. Crop Protection 30,
1063-1069.
Niu, J. H., Jiana, H., Guo, Q. X., Chena, C. L., Wang, X. Y., Liu, Q and Guo, Y. D. (2012).
Evaluation of loop-mediated isothermal amplification (LAMP) assays based on 5S
44
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
rDNA-IGS2 regions for detecting Meloidogyne enterolobii. Plant Pathology 61, 809–
819.
Notomi T, O. H., Masubuchi H, Yonekawa T, Watanabe K, Amino N and Hase T. (2000).
Loop-mediated isothermal amplification of DNA. Nucleic Acids Research 28, e63.
Peng, H., Peng, D, Hu, X., He, X., Wang, Q., Huang, W and He, W. (2012). Loop-mediated
isothermal amplification for rapid and precise detection of the burrowing nematode,
Radopholus similis, directly from diseased plant tissues. Nematology 14, 977-986.
Peng, H., Long, H., Huang, W., Liu, J., Cui, J., Kong, L., Hu, X., Gu, J., and Peng, D. (2017).
Rapid, simple and direct detection of Meloidogyne hapla from infected root galls using
loop-mediated isothermal amplification combined with FTA technology. Scientific
Reports 7.
Pham, N. T., Trinh, Q.D., Khamrin, P., Ukarapol, N., Kongsricharoern, T., Yamazaki, W.,
Komine-Aizawa, S., Okitsu, S. Et Al. (2015). Loop-mediated isothermal amplification
(LAMP) for detection of Campylobacter jejuni and C. coli in Thai children with
diarrhea. Jpn J Infect Dis 68, 432–433.
Sahoo, P. R., Sethy, K., Mohapatra, S. and Panda, D. (2016). Loop mediated isothermal
amplification: An innovative gene amplification technique for animal diseases.
Veterinary World 9, 465-469.
45
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
Song, Z.-Q., Cheng, J-E., Zhang, D-Y., and Liu, Y. (2017). Development and Evaluation of
Loop-Mediated Isothermal Amplification Assay for Rapid Detection of Tylenchulus
semipenetrans Using DNA Extracted from Soil. Plant Pathology 33, 184-192.
Subbotin, S. A., Vierstraete, A., De Ley, P., Rowe, J., Waeyenberge, L., Moens, M., &
Vanfleteren, J. R. (2001). Phylogenetic relationships within the cyst-forming nematodes
(Nematoda, Heteroderidae) based on analysis of sequences from the ITS regions of
ribosomal DNA. Molecular Phylogenetics and Evolution, 21(1), 1–16.
Tangkanchanapas P, H. M., De Jonghe K. (2018). Reverse transcription loop-mediated
isothermal amplification (RT-LAMP) designed for fast and sensitive on-site detection
of Pepper chat fruit viroid (PCFVd). Journal of Virological Methods 259, 81-91.
Taylor, D.P. and Netscher, C. (1974). An improved technique for preparing perineal patterns
of Meloidogyne spp. Nematologica 20, 268-269.
Toida, Y. (1979). Host plants and morphology of the 2nd stage larvae of Meloidogyne mali
from mulberry. Japanese Journal of Nematology 9, 20-24
Toida, Y. (1984). Nematode species from mulberry fields and thier geographical distribution in
Japan. Japanese Journal of Nematology 14, 20-27.
Toida, Y., and Yaegashi, T. (1984). Description of Meloidogyne suginamiensis n. sp.
(Nematoda: Meloidogynidae) from Mulberry in Japan. Japanese Journal of Nematology
14, 49-57.
46
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
Toida, Y., and Yaegashi, T. (1991). Revision of a record on Meloidogyne thamesi from
Mulberry in Japan. Japanese Journal of Nematology 21, 48.
Tsutsumi N., Yanagisawa, H., Fujiwara, Y and Ohara, T. (2016). Fast real-time detection of
Potato spindle tuber viroid by RT-LAMP. Res. Bull. Pl. Prot. Japan 46, 61-67.
Wang, X., Li, X., Hu, S., Qu, H., Zhang, Y., Ni, H. and Wang, X. (2015). Rapid detection of
active human cytomegalovirus infection in pregnancy using loopmediated isothermal
amplification. Mol Med Rep 12, 2269–2274.
Wong, Y.-P., Othman, S., Lau, Y.-L., Radu, S. and Chee, H.-Y. (2017). Loop-mediated
isothermal amplification (LAMP): a versatile technique for detection of micro-
organisms. Journal of Applied Microbiology 124, 626--643.
Yari, F., Abiri, R., Aryan, E., Ahmadi Jouybari, T., Navabi, J. and Alvandi, A. (2016). Loop-
mediated isothermal amplification as a fast noninvasive method of Helicobacter pylori
diagnosis. J Clin Lab Anal 30, 464-470.
Ye, W., Zeng, Y., and Kerns, J. (2015). Molecular Characterisation and Diagnosis of Root-
Knot Nematodes (Meloidogyne spp.) from Turfgrasses in North Carolina, USA. Plos
one 10, e0143556.
Yin, H. Y., Fang, T. J., and Wen, H. W. (2016). Combined multiplex loop-mediated isothermal
amplification with lateral flow assay to detect sea and seb genes of enterotoxic
Staphylococcus aureus. Lett. Appl. Microbiol 63.
47
A. Suwanngam Validation of LAMP assay for specific-detection of M.mali in Belgium
Yu, L-Z., Song, Z-Y., Yu, C.,Qi, L-J., Yu, Z-X., Jiao, B-B., and Yang, J. (2018). A loop
mediated isothermal amplification (LAMP) assay for rapid and reliable detection of
Anguina wevelli, a grass parasitic nematode. Eur J Plant Pathol 150.
Zhao, N., Liu, J.X., Li, D. And Sun, D.X. (2016). Loop-mediated isothermal amplification for
visual detection of hepatitis B virus. Zhonghua Gan Zang Bing Za Zhi 24, 406–411.
Zhou, Q. J., Cai, Y., Gu, J.F., Wang, X and Chen, J. (2017). Rapid and sensitive detection of
Meloidogyne mali by loop-mediated isothermal amplification combined with a lateral
flow dipstick. Eur J Plant Pathol 148, 755–769.
Ziros, P. G., Kokkinos, P. A., Allard, A. and Vantarakis, A. (2015). Development and
evaluation of a loop-mediated isothermal amplification assay for the detection of
adenovirus 40 and 41. Food Environ Virol 7, 276–285.
48