〔Med. Entomol. Zool. Vol. 71 No. 3 p. 225‒243 2020〕 225 reference DOI: 10.7601/mez.71.225

Original Article

RNA virome analysis of hematophagous Chironomoidea ies (Diptera: Ceratopogonidae and Simuliidae) collected in Tokyo, Japan

Daisuke K *, 1), Katsunori M 1), 2), Astri Nur F1), Michael A -B  1), Yukiko H1), Toshihiko H1), Yoshio T1), Kyoko S1) and Haruhiko I 1)

* Corresponding author: [email protected] 1) Department of Medical Entomology, National Institute of Infectious Diseases, 1‒23‒1 Toyama, Shinjuku-ku, Tokyo 162‒8640, Japan 2) Kyushu Research Station, National Institute of Animal Health, NARO, 2702 Chuzan-cho, Kagoshima City, Kagoshgima 891‒0105, Japan

(Received: 26 June 2020; Accepted: 3 August 2020)

Abstract: e development of sequencing technologies, in recent years, gives novel insights into the diversity of viruses in arthropods. Human pathogenic or possible pathogenic arthropod-borne viruses (arboviruses) including novel viruses from mosquitoes and ticks have been found by RNA virome analysis using a high-throughput sequencer. However, virome studies for other blood-sucking arthropods like biting midges as well as black ies are relatively scarce. In this study, to nd viruses in hematophagous Chironomoidea ies, we performed RNA virome analyses of eld-caught female Culicoides arakawae and Simulium aureohirtum as a pilot study. In the analyses, six novel viruses belonging to ve virus taxa were detected, showing that RNA virome analysis using the next- generation sequencer was a strong method for understanding the viruses in both biting midges and black ies. is study indicated that C. arakawae and S. aureohirtum, which are not a popular vector for human pathogenic viruses, have a variety of viruses which are as many as other important vectors including mosquitoes and ticks. Furthermore, RNA virome analysis of a variety of blood-sucking insects will aid in not only discovering novel arboviruses but also understanding novel importance for arboviral vectors.

Key words: virome, metagenome, biting midge, black y, insect-speci c virus, Jingmenvirus

I    (reviewed in Mullen and Murphree, 2019). e genus Culicoides is the main taxon within the family e blood-sucking property in arthropods is needed from the aspect of disease vectors for both humans for disease transmission to occur in animal hosts. and animals. Oropouche fever due to Oropouche Among hematophagous insects, ies in Diptera such orthobunyavirus is a Culicoides-borne human as mosquitoes and tsetse ies are important vectors viral disease which is endemic in the entire Latin of several types of pathogens (viruses, protozoans, America (Mullen and Murphree, 2019). Except for and larial nematodes) and causes serious public human diseases, Culicoides midges pass on a variety health problems in several areas of the world (Durden of pathogenic viruses to domesticated animals and Mullen, 2019). Among the dipteran insects, the (Mullen and Murphree, 2019). In Japan, for instance, blood-sucking properties have been evolved in an Akabane disease caused by Akabane virus and independent manner several times (Wiegmann et transmitted by Culicoides midges is a serious issue al., 2011). Many famous disease vectors (e.g., biting for livestock ruminants with stillbirth and congenital midge, black y, mosquito, and sand y) are known in malformations, etc. (Yanase, 2009). suborder Nematocera in Diptera. e biting midges More than 2,200 species of black ies have and black ies are in close association taxonomically been descried worldwide (reviewed in Adler and within Nematocera since the families Ceratopogonidae McCreadie, 2019). Black ies are well known vectors (including biting midges) and Simuliidae (including of human onchocercasis caused by the larial black ies) are categorized into the same superfamily, nematode Onchocerca, which is endemic in several Chironomoidea. countries in the central belt of Africa and in tropical e Ceratopogonidae are widespread with America (reviewed in Adler and McCreadie, 2019). 6,267 surviving described species in 123 genera In Japan, 11 human cases of zoonotic onchocercasis 226 Med. Entomol. Zool. due to O. dewittei japonica Uni, Bain & Takaoka al., 2001) with primer A and primer B designated by have been reported so far (Fukuda et al., 2019), and Xiong and Kocher (1991). Moreover, the sequence Simulium bidentatum (Shiraki) was pointed out as of the DNA barcoding region of the cytochrome c the vector species of this nematode (Fukuda et al., oxidase subunit I (COI) gene was ampli ed with the 2010). Moreover, some species in Simuliidae were primer set LCO1490 and HCO2198 (Folmer et al., regarded as the vectors for an avian blood parasite, 1994). e amplicons were puri ed and as well as Leucocytozoon lovati (Sato et al., 2009). In contrast, sequenced as reported previously (Kobayashi et al., vesicular stomatitis virus is just known as a virus that 2018). e specimens were stored at -80°C until the is transmitted by a black y in the Americas (reviewed following analyses. in Adler and McCreadie, 2019). e development of sequencing technologies, in Next-generation sequencing recent years, gives novel insights into the diversity A basic technique of next-generation sequencing of viruses in nature (e.g., Shi et al., 2016a, 2018). (NGS) was the same as reported previously Present-day studies have shown that quite diverse (Kobayashi et al., 2020). Shortly, the pooled female viruses present in arthropods (e.g., Li et al., 2015; Shi C. arakawae and S. aureohirtum were homogenized et al., 2016a) and several studies indicated human with the medium. e supernatant of the centrifuged pathogenic or possible pathogenic arthropod-borne homogenates was passed through a sterilized 0.45 µm viruses (arboviruses) including novel viruses by RNA lter. To digest DNA and RNA derived from host virome analysis of hematophagous arthropods (Tokarz insects, nuclease treatment was conducted. Nuclease et al., 2014, 2018; Moutailler et al., 2016; Bouquet et cocktail [14 units of TURBO DNase (Invitrogen), 12.5 al., 2017; de Souza et al.,2018; Brinkmann et al., 2018; units of Baseline-ZERO DNase (epicentre), and 5 µg Harvey et al., 2019a; Temmam et al., 2019; Faizah et of RNase A (Nippon gene)] was added to the 380 µL al., 2020; Kobayashi et al., 2020). Additionally, a lot ltrate and incubated at a temperature of 37°C for 1 of viruses have been discovered from mosquitoes by hour. RNA extraction was carried out by ISOGEN II virome analyses so far (reviewed in Atoni et al., 2019). (Nippon gene), and cDNA was synthesized with the Almost all studies were principally conducted on use of NEBNext RNA rst-strand and second-strand mosquitoes and ticks, and the studies for other blood- synthesis modules (New England Biolabs). Eventually, sucking arthropods are relatively scarce (Temmam et library preparation steps were done with the use of al., 2016; Harvey et al., 2019b; Modha et al., 2019). TruSeq Nano DNA library prep kit (illumina) or In this manuscript, to quest as well as characterize NEBNext Ultra II End Repair/dA-Tailing Module viruses in biting midges and black ies, we have (New England Biolabs) and NEBNext Ultra II Ligation accomplished the RNA virome analysis of eld-caught Module (New England Biolabs). e prepared library female C. arakawae (Arakawa) and S. aureohirtum was ampli ed as needed by PCR enzyme and primer Brunetti as a pilot study. In the course of the analyses, cocktail which are supplied with the TruSeq nano six various types of virus-like sequences were found, DNA library prep kit or NEB Next Ultra II Q5 Master and further genetic and phylogenetic analyses were Mix (New England Biolabs). e puri ed library was done for the characterization of virus properties. assessed with the use of the MiniSeq system (Illumina) with the MiniSeq Mid Output kit (300 cycles) M    M  (Illumina). e acquired reads were imported into the Collection and identication of biting midges and CLC Genomics Workbench version 12 (Qiagen), and black ies de novo assembly was conducted. e possible viral Biting midges and black ies were collected in sequence was pointed out by BLAST searches from the the continual mosquito surveillance in the National resulting contigs. Institute of Infectious Diseases which is located at Shinjuku, Tokyo, Japan (Tsuda and Hayashi, 2014). Conrmation of the endogenous viral elements of e collection methods were reported previously detected viruses (Tsuda and Hayashi, 2014). In brief, a battery- Endogenous viral elements (EVEs) of various operated CDC-like suction trap with 1 kg dry ice was viruses were found in diverse arthropods (Shi et used for the collection, and the trap was utilized for al., 2016a). For the possibilities of EVEs of detected 24 hours. Collected biting midges were identi ed by viruses to be con rmed, viral genome-speci c primer morphology. Contrarily, molecular identi cation was sets were designated based on the resultant contigs attempted for the identi cation of the species of black (Table 1). RNA and DNA were extracted from the ies with the use of genomic DNA that is extracted by ltrate and then subjected to RT-PCR and PCR with alkaline lysis (Rudbeck and Dissing, 1998) from their the use of the primers (Table 2), the same method one or two legs. e mitochondrial 16S ribosomal previously described (Kobayashi et al., 2020). Internal RNA (rRNA) gene was utilized for this experiment controls in this experiment were ampli ed using the in accordance with the previous study (Otsuka et primer sets for the 28S rRNA gene of C. arakawae Vol. 71 No. 3 2020 227 ** ** 56 ‒ 70 50 61 46 39 45 46 46 29 61 26 37 28 43 51 39 ‒ 46 30 25 Identity (%) ** 8e-37 7e-86 9e-84 1e-90 3e-21 3e-134 1e-165 0.0 3e-10 2e-92 6e-07 2e-43 6e-54 2e-140 1e-71 2e-113 ‒ 0.008 8e-22 0.001 e-value APG76533 ASM93481 APG76299 AAF97860 QBL75888 QBL75886 QBL75886 AAO60068 QID77675 QDZ59195 AJG39296 AJG39319 APT68154 APT68154 BBV14756 ALL52901 QDF44112 ALL52906 Accession No. Result of blastx search Contigs related to viral sequence hypothetical protein 2 [Wuhan insect virus 21] capsid [Caninovirus sp.] hypothetical protein [Shuangao insect virus 11] RNA dependent polymerase protein A [Nodamura virus] putative structural polyprotein [Solenopsis invicta virus 6] putative non-structural polyprotein [Solenopsis invicta virus 6] putative non-structural polyprotein [Solenopsis invicta virus 6] RNA-dependent RNA polymerase [Macrobrachium rosenbergii nodavirus] RNA-dependent RNA polymerase [Pink bollworm virus 2] L protein, partial [Niukluk phantom virus] glycoprotein precursor [Wuhan mosquito virus 1] nucleopasid protein [Wuchang Cockroach Virus 1] RNA-dependent RNA polymerase [Ganda bee virus] RNA-dependent RNA polymerase [Ganda bee virus] non-structural protein 1 [Wuhan aphid virus 1] NS3-like protein [Wuhan aphid virus 1] putative capsid protein [Wuhan aphid virus 2] putative glycoprotein [Shuangao insect virus 7] Highest score protein name 5.37 15.22 14.45 20.45 870.01 1249.69 1088.99 8.35 4.21 3.1 3.12 6.16 5 3.97 4.05 4.69 6.91 Average coverage 5.04 19 114 65 176 4297 30457 30327 176 16 16 17 63 57 47 18 74 121 Total read count 33 Table 1. List of virus-like contigs found by BLAST search. 528 1103 668 1240 696 3484 3967 3142 557 776 816 1486 1691 1774 666 2358 2611 Length (nt) 984 Several frames were opened inside one contig. e range of number shows the value in each frame. Contig name 18BF1_c37 18BF1_c31 18BF1_c34 18BF1_c27 18BF1_c5 18BF1_c3 18BF1_c1 nC1_c11 nC1_c39 nC1_c38 nC1_c36 nC1_c21 nC1_c22 nC1_c10 nC1_c33 nC1_c26 nC1_c24 nC1_c7 ** unclassi ed Nodaviridae Dicistroviridae Nodaviridae Phasmaviridae Virus taxon Jingmenvirus * 46 No. of contig 43 464240 No. of total read 97620 Total number of contigs more than 500 nt in length. * S. aureohirtum Source C. arakawae 228 Med. Entomol. Zool.

Table 2. Primers used for EVE examinations. Virus Prime name Sequence (5′-3′) Carajing virus segment 1 CaJin-s1-FW TTGCACGACCTCGGAATGCGATT CaJin-s1-RV GCATATCCTTGCGTGGAAATCCT segment 2 CaJin-s2-FW AAACTCCTGTCGTAGAGGCTGCA CaJin-s2-RV TGTGTTTCATGCAGTACGTCGAG segment 3 CaJin-s3-FW2 ACGGATATCGCGGAATGCGGAAT CaJin-s3-RV2 GGGTGGTCGTCCTTCTCGCAGAA segment 4 CaJin-s4-FW AGCAAGCCCTAGACAAATTGCCT CaJin-s4-RV ACGCATTGCAATCAAGCACTAGT Carapha virus L segment CaPhas-Lc38-FW TAGTGCCTTAGTCTCCAAGGTGC CaPhas-Lc10-RV AATGAGCACGATAATATAGAAGA M segment CaPhas-Mc36-FW AAGAGATGTTGGGTCACAGCCAA CaPhas-Mc36-RV GGTGATGACGTGACATACTACAT S segment CaPhas-Sc21-FW GTGCTCAGTAGTCATTAGGTGAC CaPhas-Sc21-RV AGAGACTGCTGCATCATCACGTT Carano virus RNA 1 CaNoda-RNA1-FW AGACTGTCCAGACAGAGCATTGG CaNoda-RNA1-RV GAGCTCACCAGTGAAGTGCTGAC Sacri virus Scrip-4F ATGCCCGATATGGTAGGCAATAA Scrip-4R GAACGTCAGGATTAGGCCAAGAA Sano virus RNA 1 SNoda1-2F AAAGAGAAACCGTATTGGCTAAC SNoda1-2R GGAAGTCTCTGGATTTGCTCTAT RNA 2 SNoda2-1F GGAGACCTGTTCTCTCGAATAGT SNoda2-1R GTACCTGAATGATGCGTAATTGT Simulium aureohirtum associated A virus SCPL-1F CTAACTCCAAGCGCAAAGTGTA SCPL-1R GCACAACCAAGTGAGGAAGTAAT

(Ca28SrRNA-FW, 5′-AGC TCA GCA CGT AGG alignments were performed by MAFFT online service CCG ACA AC-3′; Ca28SrRNA-RV, 5′-CCC TTA AAC (Katoh et al., 2019). e multiple alignments of all GGT TTC ACG TAC TT-3′) and Simuliidae universal viruses were performed using MAFFT-L-INS-i (Katoh (Sim28S-F, 5′-TGA AGT GTC TAA ATA TCT GAA et al., 2005). e conserved amino acid sequences T-3′; Sim28S-R: 5′-GAC TTC TTG GTC CGT GTT among associated viruses were extracted with the use TCA A-3′). of the Gblocks program (Castresana, 2000). Selections of the appropriate amino acid substitution models Determination and characterization of viral genome and constructions of phylogenetic dendrogram were sequences carried out using MEGA 6 (Tamura et al., 2013). Speci c primer sets for virus sequences lled the R  sequence gaps of each contig with the use of RT-PCR, and the resultant amplicons were sanger-sequenced RNA virome analysis of hematophagous with the use of ABI 3130 Genetic Analyzer (Applied Chironomoidea ies Biosystems) as described previously (Kobayashi et Female biting midges were collected on June 13 and al., 2018). e 3′ terminal sequence of the Sacri virus 20, 2017, and they were all classi ed as C. arakawae was determined by the rapid ampli cation of cDNA by morphology. On the other hand, three female ends method as described previously (Kobayashi Simulium spp. were collected on July 10, 2018, and et al., 2016, 2017). e open reading frame (ORF) molecular identi cation was performed. A total of and the encoded amino acid sequences of each 516 nucleotides (nt) of the mitochondrial 16S rDNA virus were determined using the Genetyx version 13 was sequenced, showed 100% identity to each other, soware (Genetyx). e secondary structure of the which suggests that three individuals were of the internal ribosome entry site (IRES) was speculated same species. e sequences were compared with the by the mfold program (Zuker, 2003) and constructed deposited sequences in the International Nucleotide manually. Sequence Database (DDBJ/EMBL/GenBank), and they shared 99% identity with that of S. aureohirtum Phylogenetic analysis (GenBank accession nos. KP793690 and AB056735). e determined amino acid sequences of each virus Moreover, the COI sequence has also shown to be were used for phylogenetic analysis. Multiple sequence 99% identical to that of the same species (KF289401), Vol. 71 No. 3 2020 229

Fig. 1. Examinations of the endogenous viral element (EVE) of detected viruses. (A) EVE detections from C. arakawae. e upper image, RT-PCR products with the use of RNA as a template; middle image, PCR products with the use of RNA as a template; lower image, PCR products with the use of DNA as a template. First to fourth lines from the le side, detection of dierent segments of CaJV by various primer sets [CaJin-s1-FW and CaJin-s1-RV (segment 1), CaJin-s2- FW and CaJin-s2-RV (segment 2), CaJin-s3-FW2 and CaJin-s3-RV2 (segment 3), and CaJin-s4-FW and CaJin-s4-RV (segment 4); Table 2]. Fih to seventh lines from the le side, detection of L, M, and S segments of CaPhV by various primer sets (for L segment, CaPhas-Lc38-FW and CaPhas-Lc10-RV; for M segment, CaPhas-Mc36-FW and CaPhas-Mc36-RV; for S segment, CaPhas-Sc21-FW and CaPhas-Sc21-RV; Table 2). Eighth line from the le side, detection of the RNA 1 of CaNoV by the speci c primer set (CaNoda- RNA1-FW and CaNoda-RNA1-RV, Table 2). Second line from the right side, 28S rRNA gene amplicon of C. arakawae as a positive control. Far-right lane, a 100-bp DNA marker. (B) EVE examinations from S. aureohirtum. e same meaning and order from upper to lower images as Fig. 1A. Far-le lane, detection of SaCV by the speci c primer sets (Scrip-4F and Scrip-4R, Table 2). Second and third lines from the le side, detection of dierent segments of SaNoV (for RNA 1, SNoda1-2F and SNoda1-2R; for RNA 2, SNoda2- 1F and SNoda2-1R; Table 2). Fourth line from the le side, detection of SAAV by the speci c primer set (SCPL-1F and SCPL-1R, Table 2). Second line from the right side, 28S rRNA gene amplicon of S. aureohirtum as a positive control. Far-right lane, a 100-bp DNA marker. suggesting that the Simulium species collected is S. virus-like sequences were found in C. arakawae by aureohirtum. blastx search, and the sequences fell into three general A total of 30 C. arakawae (collected from 26 and virus categories including jingmenvirus, phasmavirus, 4 individuals on June 13 and 20, respectively) and and nodavirus (Table 1). Contrarily, contigs, containing 3 S. aureohirtum samples were mixed into a single three dierent types of virus-like sequences pool, respectively, and NGS analysis was carried out. (dicistrovirus, nodavirus, and unclassi ed virus) were Total read numbers acquired from C. arakawae and identi ed from S. aureohirtum (Table 1). e amino S. aureohirtum were 97,620 and 464,240, respectively acid sequences of all contigs shared low sequence (Table 1). As a result of the de novo assembly, 43 and identities to already known viruses, indicating that 46 contigs, which were more than 500 nt in length, these contigs were derived from novel viruses. were acquired from C. arakawae and S. aureohirtum, RNA and DNA forms of each virus-like sequences respectively (Table 1). A total of 11 contigs containing were analyzed for the con rmation of the EVEs. All 230 Med. Entomol. Zool. Vol. 71 No. 3 2020 231 sequences were identi ed only by RT-PCR with the use from a single virus. of the template RNA, showing that all viruses detected Highly conserved amino acid sequences are by NGS present as RNA forms in the specimens and encoded on the NSP1 ( aviviral NS5-like protein) no EVEs in the host genome (Fig. 1). and NSP2 ( aviviral NS3-like protein) among the related viruses. us, these sequences were Characterization of a novel jingmenvirus named used for phylogenetic analyses for the assessment Carajing virus from C. arakawae of the evolutionary relationships among related ere were four resultant contigs that are related viruses. ese are two distinct clades, which are the to jingmenvirus and all of them have low amino acid named clusters of tick-borne and insect-associated sequence similarities to already known jingmenviruses jingmenviruses in both dendrograms (Fig. 2B and C). (Table 1). A 666 nt sequence (contig name nC1_c33) e jingmenvirus detected in this study has formed was acquired as segment 1 of jingmenvirus and non- a clade with the insect-associated jingmenviruses structural protein 1 (NSP1) of Wuhan aphid virus 1 (Fig. 2B and C). e phylogenetic relationships with (WHAV 1) (GenBank accession no. BBV14756), which other associated viruses based on the NSP1 (NS5- was detected from corn leaf aphid Rhopalosiphum like protein) are still hidden since the nodes of the maidis in Japan (Kondo et al., 2020), has shown the dendrogram were supported with low bootstrap values highest amino acid similarity (51%) by blastx search (Fig. 2B). On the contrary, NSP2 (NS3-like protein) (Table 1). Segment 1 encodes NSP1, which is related formed a robust clade with Wuhan cricket virus, which to aviviral NS5-like protein, and the length of that was discovered from Conocephalus sp. in China (Shi et in related viruses is about 3,000 nt (Shi et al., 2016b). al., 2016b), with con dential bootstrap supports (Fig. us, quite partial sequence of NSP1 was acquired in 2C). this examination (Fig. 2A). e contig name nC1_c7 Altogether, jingmenvirus detected in this study was alike the putative glycoprotein (named VP1) of has novel virus features since it belongs to the Shuangao insect virus 7 (SAIV 7), which was encoded jingmenvirus. us, this virus was tentatively on segment 2 of the virus (Table 1). is sequence named Carajing virus (CaJV) by the initial words of also is half the length of the segment since the length Culicoides arakawae jingmenvirus (Table 3). of that in other viruses is about 2,000 nt (Fig. 2A) (Shi et al., 2016b). On the contrary, the most part Analysis of the genome structure and phylogenetic of the ORF of segments 3 and 4 were detected (Fig. characterization of a novel phasmavirus, Carapha 2A). Aer the sequence gaps on the contig nC1_c26 virus from C. arakawae had been lled by sanger sequencing, the length was ere are total of 6 contigs which are associated to 2,357 nt, similar to the segment 3 encoding NS3-like the phasmavirus detected in the C. arakawae sample. protein (called NSP2) of WHAV 1 (Table 1). On the Four contigs (nC1_c10, nC1_c 22, nC1_c 38, and contig nC1_c24, two ORFs (encoded proteins named nC1_c 39) have shown similarities to the L segment of VP2 and VP3, respectively) were observed (Fig. 2A), phasmavirus (Table 1). To con rm if these sequences and the rst ORF was 30% identical to the putative are from a single virus or not, RT-PCR and sanger capsid protein of Wuhan aphid virus 2 (WHAV 2) sequencing were carried out. e sequence gaps (Table 1). Interestingly, the hepta-nucleotide sequences were lled, and the contigs were connected into one (GGUUUUU) were contained at the end of the rst sequence of with a length of 6,036 nt. e sequence ORF (Fig. 2A) like the related viruses (Shi et al., 2016b; had 39% similarity to the RdRp of Ganda bee virus, Ladner et al., 2016), indicating a potential ribosomal which was belonging to the genus Orthophasmavirus frameshi signal. A prior study has shown that in the family Phasmaviridae (Schoonvaere et al., WHAV 1, WHAV 2, and SAIV 7 formed a cluster in a 2016). Both contig nC1_c36 and nC1_c21 are 26% phylogenetic dendrogram (Shi et al., 2016b), indicating and 37% identical to the glycoprotein precursor of that all contigs related to jingmenvirus detected were Wuhan mosquito virus 1 and nucleocapsid protein

Fig. 2. Genome structure of a novel jingmenvirus, CaJV, and phylogenetic dendrograms between CaJV and related viruses. (A) A schematic illustration of the genome organization of CaJV. e gray dotted boxes and lines indicate the whole ORF and UTR, respectively, expected based upon related viruses. e gray areas in the ORF as well as the black lines represent the sequenced regions of this study. e numbers shown above indicate nucleotides that are sequenced, and protein names are shown below. A black arrow in segment 4 indicates the -1 frameshiing site expected. e phylogenetic dendrogram was constructed based on the amino acid conserved regions of the viral NS5-like protein (about 145 amino acids) by the maximum likelihood method with the use of the LG+G + I model (B) and NS3-like protein (about 230 amino acids) by the maximum likelihood method with the use of LG+G + I model (C). e percentage of replicate trees in which the related taxa are clustered together in the bootstrap test (1,000 replicates) is manifested in the succeeding branches (Felsenstein, 1985). Jingmenviruses that are detected from the hematophagous insects are represented using illustrations. Insect-associated jinmenviruses and tick-borne jingmenviruses are indicated by a framed rectangle shown by solid and dotted lines, respectively. CaJV which is identi ed in this study is indicated by a black circle and is bold-faced. Pegivirus (GB virus-A) and Hepacivirus (Hepatitis C virus) were utilized as an outgroup. e accession numbers of viruses used in this analysis are shown in Appendix 1. 232 Med. Entomol. Zool.

of Wuchang Cockroach Virus 1, respectively, both of which are the members of the genus Orthophasmavirus (Table 1). ese results indicated that M and S segments were derived from the same virus as that of the L segment. e viral L protein is highly conserved among the LC552046 LC552043 (RNA 1) LC552044 (RNA 2) LC552045 LC552042 (RNA 1) LC552039 (L segment) LC552040 (M segment) LC552041 (S segment) LC552035 (segment 1) LC552036 (segment 2) LC552037 (segment 3) LC552038 (segment 4) GenBank accession No. related viruses, and the longest resultant sequence was acquired during the analysis (Fig. 3A). erefore, based on the amino acid sequence of L protein, phylogenetic analysis was performed. e virus detected from C. arakawae formed a clade with viruses unclassi ed Nodaviridae Dicistroviridae Nodaviridae Phasmaviridae unclassi ed Virus family that are members of Orthophasmavirus (Fig. 3B). As a result of the prior analyses, the virus seems to be a * novel virus which belongs to a member of the genus Orthophasmavirus and tentatively named Carapha virus (CaPhV, Culicoides arakawae phasmavirus) (Table 3). unclassi ed Alphanodavirus Cripavirus Alphanodavirus Orthophasmavirus Jingmenvirus Virus genus

Genetic and phylogenetic characterizations of novel nodaviruses from C. arakawae and S. aureohirtum Nodavirus-like sequences were discovered in three SAAV SaNoV SaCV CaNoV CaPhV CaJV Abbreviation contigs (18BF1_c27, 18BF1_c31, and 18BF1_c34) from S. aureohirtum and all contigs shared 46‒61% identities with the already known nodaviruses (Table 1). e sequence gap between the contigs 18BF1_c27 and 18BF1_c34 was lled by the sanger sequence, and the resultant sequence length was 2,213 nt (Fig. 4A). On the other hand, from C. arakawae, only one contig (nC1_c11) related to nodavirus was detected, and the sequence was the most related to the RdRp gene of Macrobrachium rosenbergii nodavirus by blastx search (Table 1 and Fig. 4B). ere was no sequence similar to capsid protein (CP) of nodavirus detected from the Simulium aureohirtum associated A virus Sano virus Sacri virus Carano virus Carapha virus Carajing virus Viruses Name resultant contigs of C. arakawae. e phylogenetic analysis based on the RdRp sequences encoded

Table 3. Summary of viruses detected in this study. on the RNA 1 has shown that both nodavirus-like viruses detected in this study are found in the genus Alphanodavirus in family Nodaviridae. e virus 10 July, 2018 13, 20 June, 2017 Collection date from C. arakawae formed a clade with the Midge associated nodavirus M1C9 which was detected in C. impunctatus in Scotland (Modha et al., 2019) (Fig. 4C). In fact, the amino acid sequence of the Midge associated nodavirus M1C9 was not deposited on the International Nucleotide Sequence Database (DDBJ/ EMBL/GenBank). us, the result of blastx search was Shinjuku, Tokyo, Japan Shinjuku, Tokyo, Japan Collection site not re ected, such as this virus. Actually, the amino acid sequence of the nC1_c11 shared 63.1% identity to the translated sequence of the Midge associated nodavirus M1C9 (GenBank accession no. LR701648) (data no shown), indicating that the contig nC1_c11 was most related to the Midge associated nodavirus 3 females 30 females No. of individuals M1C9. Elseways, the virus from S. aureohirtum had distinct positions to the already known nodaviruses (Fig. 4C). Based on the novelty of the sequence, the viruses were novel species in Alphanodavirus and

Proposed genus. were tentatively named Sano virus (SaNoV, Simulium * S. aureohirtum C. arakawae Species Source aureohirtum nodavirus) and Carano virus (CaNoV, Vol. 71 No. 3 2020 233

Culicoides arakawae nodavirus), respectively. this study has novel virus features that are part of the genus Cripavirus in Dicistroviridae. us, this virus Genetic and phylogenetic analysis of a novel was tentatively named Sacri virus (SaCV, Simulium cripavirus from S. aureohirtum aureohirtum cripavirus) (Table 3). From S. aureohirtum, dicistrovirus-like three contigs called 18BF1_c1, 18BF1_c3, and 18BF1_c5 Unclassied virus from S. aureohirtum were found by blastx search (Table 1). All contigs Within the contig 18BF1_c37, several frames were have shown highly average coverages compared opened, sharing 56‒70% identities to the hypothetical with the others, showing that a high titer of the virus protein 2 of Wuhan insect virus 21 (Table 1). presented in the specimen. Additionally, all contigs Subsequent to the resequencing on the contig, the 522 shared low sequence identities (39‒46%) to the nt resultant sequences were the same as the putative corresponding region of the already known viruses RdRp of Linepithema humile C virus 1 (GenBank (Table 1), indicating that these contigs were derived accession no. AXA52557) with 64% identity (data no from a novel virus. ree contigs were connected into shown). In addition that, the sequence was also similar one sequence by RT-PCR and sanger sequence, and to the RdRp sequences of the chronic bee paralysis the resultant had a length of 8,528 nt, such as those virus (QEI22811) and anopheline-associated C virus from the most part of the rst ORF to the 3′ terminal (AGW51774) or the hypothetical protein 2 of Hubei (Fig. 5A). Conserved protein domain search on the tombus-like virus 42 (APG76280) (data not shown). NCBI Conserved Domains Database (Marchler-Bauer ese associated viruses have not been categorized et al., 2015) has shown that various protein domains into a virus taxon yet. Even though we detected only [RNA_helicase (accession; pfam00910), RdRP_1 a short sequence of the virus, we have tentatively (pfam00680), Waikav_capsid_1 (pfam12264), rhv_like designated the virus as Simulium aureohirtum (cd00205), and CRPV_capsid (pfam08762)] were associated A virus (SAAV) based on the novelty of the seen on the viral genome (Fig. 5A). Dicistrovirus sequence (Table 3). has 2 IRESs at the 5′ untranslated region (UTR) and D  intergenic region (IGR) (Valles et al., 2017). e latter is known as IGR-IRES as distinguished from the In this study, the RNA virome of Japanese IRES of 5′ UTR. Even though the authoritative genus hematophagous Chironomoidea ies (C. arakawae demarcation criteria have not been established, three and S. aureohirtum) were analyzed using the NGS. virus genera (Aparavirus, Cripavirus, and Triatovirus) Even though C. arakawae is a major vector species in the family Dicistroviridae have been categorized of chicken leucocytozoonosis due to L. caulleryi in using their topological characteristics in the IGR- Japan (Sakai, 2007), both y species have not been IRES and phylogenetic analysis (Valles et al., 2017). reported to play a role for the arboviral vectors in However, there is no conserved nucleotide within the nature to our knowledge. A total of six novel viruses Pseudo-knot (PK) I in the IGR-IRES. PK structures belonging to various virus taxa were detected in called PK I-III and several domains in the IGR-IRES this study. Recent studies outside Japan have shown which are conserved among dicistroviruses were that biting midges and black ies harbor several seen in the virus from S. aureohirtum (Fig. 5B). Two types of viruses by analyzing of their RNA and DNA dierent structural types of Domain 3 in the IGR-IRES viromes (Temmam et al., 2015, 2016; Kraberger et al., (called Type I and Type II) were reported (Nakashima 2019; Modha et al., 2019). Particularly, Modha et al. and Uchiumi, 2009), and the Type I structure of (2019) have been investigating the RNA virome of C. Domain 3 was recognized in the virus (Fig. 5B). Triplet impunctatus Goetghebuer, which is a major nuisance codon UCA was anticipated to be the start codon of human-biting midge and the vector of avian malaria the second ORF encoding viral capsid protein (Fig. in Scotland, and found viruses that are part of at least 5B). 11 virus families including 7 novel viruses among the To understand the phylogenetic relationships pooled 30 midges (Modha et al., 2019). is result among already known dicistroviruses, the dendrogram showed that the diversity of viruses was higher than was constructed based on the conserved amino acid what was observed in C. arakawae in this study. In sequences of non-structural proteins of the viruses by that analysis, the Illumina Miseq system was used for the maximum likelihood method (Fig. 5C). e virus the analysis, and 1.6‒2.1 million reads were acquired detected from S. aureohirtum is placed in the cluster of (Modha et al., 2019). On the contrary, the total read the genus Cripavirus in the family Dicistroviridae and number from the C. arakawae sample was 97,620 in is related to Solenopsis invicta virus 6 and Bundaberg this study. is output data amount was about 16‒21 bee virus 1, both of which were found in the insects in times lower than that of a prior study by Modha et al., the order Hymenoptera (Roberts et al., 2018; Valles et (2019). Moreover, Modha et al. (2019) assessed the al., 2019). total RNA from the midge samples with no nuclease Altogether, the dicistrovirus-like virus found in treatment. Our previous studies have shown that the 234 Med. Entomol. Zool. Vol. 71 No. 3 2020 235 treatment by several types of nucleases was eective jingmenviruses is quite limited; for instance, the for selective extraction of viral RNA from mosquitoes presence of the viruses in the saliva or salivary gland as well as ticks (Faizah et al., 2020; Kobayashi et of mosquitoes was not speci ed. us, it is hard to al., 2020). erefore, nuclease treatment was also discuss the possibilities of their arboviral properties. carried out in this study. In fact, the half volume of Further information on the insect-associated RNase A was used in this study compared with the jingmenviruses will help in the understanding for the case of mosquitoes and ticks in our previous studies potential as an emerging arbovirus. mentioned previously due to the body size of biting Phasmavirus is a tri-segmented negative-stranded midges and black ies being smaller than mosquitoes virus recently found from phantom midges (Ballinger and adult ticks. us, further studies are needed to et al., 2014). Aerward, several phasmavirus-like improve the system of virome analysis for small insects viruses were seen in various insects (Li et al., 2015; Shi including biting midges. et al., 2016a). e new virus family Phasmaviridae was A novel jingmenvirus, CaJV was discovered from C. established in the order Bunyavirales (Abudurexiti et arakawae in this study. Jingmenvirus was rst found al., 2019) and six viral genera (Feravirus, Inshuvirus, from ticks in China, and succeeding related viruses Jonvirus, Orthophasmavirus, Sawastrivirus, and have been recognized as emerging human infecting Wuhivirus) were acknowledged within the family. tick-borne viruses (Qin et al., 2014; Emmerich et Orthophasmavirus is the most disparate genus in the al., 2018; Jia et al., 2019; Wang et al., 2019). e family (Abudurexiti et al., 2019), and CaPhV seemed virus usually has four viral segments, two of which to be a new member of this genus. e recent study has encode NSPs and are genetically related to both NS3 shown the possibility that a novel Orthophasmavirus and NS5 proteins of the genus Flavivirus (Qin et al., [Niukluk phanton virus (NUKV)] from a phantom 2014). Jingmenviruses have been found from various midge, Chaoborus americanus (Johannsen), has been arthropods so far (Shi et al., 2016b) and were classi ed infecting the host continuously for millions of years into two groups, tick-borne and insect-associated (Ballinger et al., 2019). Based on this knowledge, jingmenviruses phylogenetically. CaJV formed a coevolution between host and virus easily occur. clade with the insect-associated jingmenviruses in the However, our analysis has shown that CaPhV was phylogenetic analyses in this study. Within the cluster phylogenetically distant from Kigluaik phantom virus of insect-associated jingmenvirus, Guaico Culex virus and NUKV derived from phantom midges, which (GCXV), Mole Culex virus (MoCV), and Wuhan ea are part of the same superfamily Chironomoidea virus were found in hematophagous insects including as biting midges. is suggests that the virus may mosquitoes and eas (Shi et al., 2016b; Ladner et al., possibly be transmitted horizontally between dierent 2016; Amoa-Bosompem et al., 2020). Indeed, the insect taxa. Various biting midges are known to feed infectivity of these viruses in humans or other animals on hemolymph of arthropods including Odonata and has not been observed. In addition, it was reported Hymenoptera (Borkent and Spinelli, 2007). Perhaps, that the viral replication of GCXV was seen in several the horizontal transmission of the phasmaviruses mosquito cell lines but not in tick- or sand y-derived may occur through hemolymph feeding of other cells (Ladner et al., 2016). Moreover, the virus was not arthropods. To know the evolutionary relationships seen in the progenies of experimentally infected adult between hosts and viruses, further virus discoveries mosquitoes, showing that vertical transmission was are needed. absent or there was a low occurrence in the previous Two dierent viruses that belong to the genus study (Ladner et al., 2016). ese viruses appear to Alphanodavirus in the family Nodaviridae were found have opportunities to transmit to animals since GCXV in this study. e family name is derived from the and MoCV were isolated from adult mosquitoes village name “Noda-mura” which is found in the and CaJV was also found in adult biting midges. Chiba Prefecture in Japan, where Nodamura virus However, the information on the insect-associated (NoV) was rst isolated from Culex tritaeniorhynchus

Fig. 3. Genome organization of a novel phasmavirus, CaPhV, and phylogenetic characterization. (A) e schematic illustration of the genome organization of CaPhV. e gray dotted open arrows and lines represent the entire ORF and UTR, respectively, expected based on that of associated viruses. e gray areas in the ORF and black lines represent the regions that are sequenced in this study. e italicized faces in each ORF indicate viral protein names: L protein (L), glycoprotein precursor (GP), and nucleoprotein (N). e numbers shown above indicate sequenced nucleotides. (B) e phylogenetic dendrogram was constructed based on the amino acid conserved regions of the viral L protein (about 1,000 amino acids) by the maximum likelihood method with the use of the LG+G + I+F model. e percentage of replicate trees in which the associated taxa are clustered together in the bootstrap test (1,000 replicates) is shown next to the branches (Felsenstein, 1985). Virus genera in the family Phasmaviridae recognized by Abudurexiti et al. (2019) are indicated by symbols [Feravirus (black circle), Inshuvirus (open circle), Jonvirus (black square), Orthophasmavirus (open square), Sawastrivirus (black triangle), and Wuhivirus (open triangle)]. CaPhV detected in this study is indicated by a black arrow and is bold-faced. Hantaviridae viruses (Hainan oriental leaf-toed gecko virus, Hantaan virus, ottopalayam virus, and Wenling yellow goose sh virus) were used as an outgroup. e accession numbers of viruses used in this analysis are shown in Appendix 1. 236 Med. Entomol. Zool.

Fig. 4. Genome organization and phylogenetic relationship between SaNoV, CaNoV, and related nodaviruses. Schematic illustration of the genome organization of both SaNoV (A) and CaNoV (B). e gray dotted open boxes and lines represent the entire ORF and UTR, respectively, predicted based on that of related viruses. e gray areas in the ORF and black lines represent the sequenced regions in this study. e characters in each ORF indicate viral protein names: RNA-dependent RNA polymerase (RdRp) and CP. e numbers shown on the boxes above indicate sequenced nucleotides. (C) e phylogenetic dendrogram was constructed based on the amino acid conserved regions of the viral RdRp (about 500 amino acids) by the maximum likelihood method with the use of the LG+G model. e percentage of replicate trees in which the associated taxa are clustered together in the bootstrap test (1,000 replicates) is shown next to the branches (Felsenstein, 1985). Virus genera in the family Nodaviridae acknowledged by Hameed et al. (2019) are indicated by symbols: Alphanodavirus (black circle) and Betanodavirus (open circle). Detected viruses in this study are indicated by black triangles and are bold-faced. e accession numbers of viruses used in this analysis are shown in Appendix 1. Vol. 71 No. 3 2020 237

Fig. 5. Genetic characterization of a novel cripavirus, SaCV, and phylogenetic position among related viruses. (A) Schematic illustration of the genome organization of SaCV. e gray boxes and black solid line represent the sequenced ORF and UTR in this study, respectively. e dotted area indicates the unsequenced region. e dark gray areas in the ORF show the regions that have conserved domains seen on the NCBI Conserved Domains Database. e numbers shown on the boxes above indicate sequenced nucleotides. (B) Predicted secondary structure of the IGR-IRES of SaCV comprised of three main domains. Sites of pseudoknots are designated by PK I, PK II, and PK III. Conserved nucleotides among IGR-IRES in dicistroviruses are represent by circled. (C) e phylogenetic dendrogram was constructed based on the amino acid conserved regions of the non-structural protein (about 540 amino acids) by the maximum likelihood method with the use of the LG+G + I model. e percentage of replicate trees in which the related taxa are clustered together in the bootstrap test (1,000 replicates) is shown next to the branches (Felsenstein, 1985). Virus genera in the family Dicistroviridae recognized by Valles et al. (2017) are indicated by symbols: Cripavirus (black circle) and Aparavirus (open circle). SaCV found in this study is indicated by black triangles and is bold-faced as well. e accession numbers of viruses that are utilized in this analysis are shown in Appendix 1. 238 Med. Entomol. Zool.

Giles mosquitoes (Hameed et al., 2019). NoV has have a variety of viruses which are as many as other been categorized as an arbovirus since the virus can arboviral vectors including mosquitoes and ticks. infect both mosquito and hamster cell lines with no Further RNA virome analysis for a variety of blood- cytopathic eects as well as cause paralysis and death sucking insects will help to not only discover novel in suckling mouse (reviewed in Kuwata, 2014). Even arboviruses but also understand novel importance for though the antibodies against NoV were found in the arboviral vectors. swine and herons, the isolation of the virus has not A     been detailed from the 1970s onward (reviewed in Kuwata, 2014). Other than NoV, there have been no is work was supported by grants-in-aid for reports on mammal infectious nodaviruses so far since the Research Program on Emerging and Re- the recognized virus members of Alphanodavirus were emerging Infectious Diseases from Japan Agency isolated from non-blood-sucking insects including for Medical Research and Development (AMED), beetles and armyworms in nature (Venter et al., and JSPS KAKENI Grant Numbers JP18K19220 and 2010). Recently, a novel nodavirus called hypnovirus JP20K15671. e authors would like to thank Enago was found in the blood of the fruit bat Hypsignathus (www.enago.jp) for the English language review. monstrosus Allen in the Republic of Congo (Bennett et R  al., 2019), indicating the possibility that the virus has an arboviral potential. Because of the detection from Abudurexiti, A., Adkins, S., Alioto, D., Alkhovsky, S. V., Avšič- hematophagous insects, both CaNoV and SaNoV have Županc, T., Ballinger, M. J., Bente, D. A., Beer, M., Bergeron, É., Blair, C. D., Briese, T., Buchmeier, M. J., Burt, F. J., Calisher, C. H., opportunities to infect animals. Further analyses are Cháng, C., Charrel, R. N., Choi, I. R., Clegg, J. C. S., de la Torre, J. needed to understand their properties for arboviruses. C., de Lamballerie, X., Dèng, F., Di Serio, F., Digiaro, M., Drebot, Viruses belonging to Dicistroviridae are insect- M. A., Duàn, X., Ebihara, H., Elbeaino, T., Ergünay, K., Fulhorst, speci c (Valles et al., 2017). However, detections of C. F., Garrison, A. R., Gāo, G. F., Gonzalez, J. J., Groschup, M. novel dicistroviruses from the blood or organs of H., Günther, S., Haenni, A. L., Hall, R. A., Hepojoki, J., Hewson, R., Hú, Z., Hughes, H. R., Jonson, M. G., Junglen, S., Klempa, B., human and bats have been reported recently (Phan Klingström, J., Kòu, C., Laenen, L., Lambert, A. J., Langevin, S. et al., 2018; Bennett et al., 2019; Cordey et al., 2019; A., Liu, D., Lukashevich, I. S., Luò, T., Lǚ, C., Maes, P., de Souza, Fumagalli et al., 2019), although their pathogenicities W. M., Marklewitz, M., Martelli, G. P., Matsuno, K., Mielke- in humans or animals are still unknown. A report Ehret, N., Minutolo, M., Mirazimi, A., Moming, A., Mühlbach, proposed that the novel dicistrovirus was found in H. P., Naidu, R., Navarro, B., Nunes, M. R. T., Palacios, G., Papa, the blood of febrile Tanzanian children (Cordey et al., A., Pauvolid-Corrêa, A., Pawęska, J. T., Qiáo, J., Radoshitzky, S. R., Resende, R. O., Romanowski, V., Sall, A. A., Salvato, M. S., 2019). In fact, the seasonality detection of the virus Sasaya, T., Shěn, S., Shí, X., Shirako, Y., Simmonds, P., Sironi, M., was observed, and the authors proposed that the virus Song, J. W., Spengler, J. R., Stenglein, M. D., Sū, Z., Sūn, S., Táng, is transmitted by some kinds of insects (Cordey et S., Turina, M., Wáng, B., Wáng, C., Wáng, H., Wáng, J., Wèi, T., al., 2019). Even though the diversity of dicistrovirus Whit eld, A. E., Zerbini, F. M., Zhāng, J., Zhāng, L., Zhāng, Y., has been quite limited in blood-sucking insects, a Zhang, Y. Z., Zhāng, Y., Zhou, X., Zhū, L. and Kuhn, J. H. 2019. recent study has reported several dicistroviruses were Taxonomy of the order Bunyavirales: update 2019. Arch. Virol., 164: 1949‒1965. detected from mosquitoes (Sadeghi et al., 2018). In Adler, P. H. and McCreadie, J. W. 2019. Black ies (Simuliidae). In: this study, a novel dicistrovirus called SaCV was also Medical and Veterinary Entomology. ird Edition (ed. Mullen, found in the black y, which is not a popular vector G. R. and Durden, L. A.), pp. 237‒259, Academic Press, London, for human pathogenic viruses so far. us, further United Kingdom. virus discovery from a wide variety of hematophagous Amoa-Bosompem, M., Kobayashi, D., Murota, K., Faizah, A. insects may show novel vectors for human viral N., Itokawa, K., Fujita, R., Osei, J. H. N., Agbosu, E., Pratt, D., Kimura, S., Kwo e, K. D., Ohashi, M., Bonney, J. H. K., Dadzie, diseases. S., Sasaki, T., Ohta, N., Isawa, H., Sawabe, K. and Iwanaga, In conclusion, there were a total of six novel RNA S. 2020. Entomological assessment of the status and risk of viruses in C. arakawae and S. aureohirtum collected mosquito-borne arboviral transmission in Ghana. Viruses, 12: in Tokyo, showing that RNA virome analysis utilizing 147. NGS was an ecient method for studying and Atoni, E., Zhao, L., Karungu, S., Obanda, V., Agwanda, B., Xia, H. and Yuan, Z. 2019. e discovery and global distribution of novel understanding the diversity of the virome of small mosquito-associated viruses in the last decade (2007‒2017). Rev. hematophagous ies. e results have also revealed Med. Virol., 29: e2079. that C. arakawae and S. aureohirtum harbor various Ballinger, M. J., Bruenn, J. A., Hay, J., Czechowski, D. and Taylor, D. types of viruses. is study is the rst RNA virome J. 2014. Discovery and evolution of bunyavirids in arctic phantom report of the black y and a third report of the midges and ancient bunyavirid-like sequences in insect genomes. ‒ RNA virome analysis of biting midges in the world. J. Virol., 88: 8783 8794. Ballinger, M. J. and Taylor, D. J. 2019. Evolutionary persistence ousands of species of blood-sucking Chironomoidea of insect bunyavirus infection despite host acquisition and ies are present on the earth, and the role of most expression of the viral nucleoprotein gene. Virus Evol., 5: vez017. of these species in the transmission of arboviruses Bennett, A. J., Bushmaker, T., Cameron, K., Ondzie, A., Niama, F. remains unknown. is study has shown that they R., Parra, H. J., Mombouli, J. V., Olson, S. H., Munster, V. J. and Vol. 71 No. 3 2020 239

Goldberg, T. L. 2019. Diverse RNA viruses of arthropod origin in Harvey, E., Rose, K., Eden, J. S., Lo, N., Abeyasuriya, T., Shi, M., the blood of fruit bats suggest a link between bat and arthropod Doggett, S. L. and Holmes, E. C. 2019a. Extensive diversity of viromes. Virology, 528: 64‒72. RNA viruses in Australian ticks. J. Virol., 93: e01358-18. Brinkmann, A., Dinçer, E., Polat, C., Hekimoğlu, O., Hacıoğlu, S., Harvey, E., Rose, K., Eden, J. S., Lawrence, A., Doggett, S. L. Földes, K., Özkul, A., Öktem, İ. M. A., Nitsche, A. and Ergünay, and Holmes, E. C. 2019b. Identi cation of diverse arthropod K. 2018. A metagenomic survey identi es Tamdy orthonairovirus associated viruses in native Australian eas. Virology, 535: 189‒ as well as divergent phlebo-, rhabdo-, chu-and avi-like viruses 199. in Anatolia, Turkey. Ticks Tick Borne Dis., 9: 1173‒1183. Jia, N., Liu, H. B., Ni, X. B., Bell-Sakyi, L., Zheng, Y. C., Song, J. L., Borkent, A. and Spinelli, G. R. 2007. Neotropical Ceratopogonidae Li, J., Jiang, B. G., Wang, Q., Sun, Y., Wei, R., Yuan, T. T., Xia, (Diptera: Insecta). In: Aquatic Biodiversity in Latin America. Vol. L. Y., Chu, Y. L., Wei, W., Li, L. F., Ye, J. L., Lv, Q. Y., Cui, X. M., 4. (ed. Adis, J., Arias, J. R., Rueda-Delgado, G. and Wnatzen, K. Guan, Y., Tong, Y. G., Jiang, J. F., Lam, T. T. and Cao, W. C. 2019. M.). pp. 1‒198, Penso, So a, Bulgaria. Emergence of human infection with Jingmen tick virus in China: Bouquet, J., Melgar, M., Swei, A., Delwart, E., Lane, R. S. and Chiu, A retrospective study. EBioMedicine, 43: 317‒324. C. Y. 2017. Metagenomic-based surveillance of Paci c Coast tick Kraberger, S., Schmidlin, K., Fontenele, R., Walters, M. and Varsani, Dermacentor occidentalis identi es two novel bunyaviruses and A. 2019. Unravelling the single-stranded DNA virome of the New an emerging human ricksettsial pathogen. Sci. Rep., 7: 12234. Zealand black y. Viruses, 11: 532. Castresana, J. 2000. Selection of conserved blocks from multiple Katoh, K., Kuma, K. I., Toh, H. and Miyata, T. 2005. MAFFT alignments for their use in phylogenetic analysis. Mol. Biol. Evol., version 5: Improvement in accuracy of multiple sequence 17: 540‒552. alignment. Nucleic Acids Res., 33: 511‒518. Cordey, S., Laubscher, F., Hartley, M. A., Junier, T., Pérez-Rodriguez, Katoh, K., Rozewicki, J. and Yamada, K. D. 2019. MAFFT online F. J., Keitel, K., Vieille, G., Samaka, J., Mlaganile, T., Kagoro, F., service: Multiple sequence alignment, interactive sequence choice Boillat-Blanco, N., Mbarack, Z., Docquier, M., Brito, F., Eibach, and visualization. Brief. Bioinform., 20: 1160‒1166. D., May, J., Sothmann, P., Aldrich, C., Lusingu, J., Tapparel, C., Kobayashi, D., Isawa, H., Ejiri, H., Sasaki, T., Sunahara, T., Futami, D’Acremont, V. and Kaiser, L. 2019. Detection of dicistroviruses K., Tsuda, Y., Katayama, Y., Mizutani, T., Minakawa, N., Ohta, RNA in blood of febrile Tanzanian children. Emerg. Microbes N. and Sawabe, K. 2016. Complete genome sequencing and Infect., 8: 613‒623. phylogenetic analysis of a Getah virus strain (genus Alphavirus, de Souza, W. M., Fumagalli, M. J., Torres Carrasco, A. O., Romeiro, family Togaviridae) isolated from Culex tritaeniorhynchus M. F., Modha, S., Seki, M. C., Gheller, J. M., Dare, S., Nunes, M. mosquitoes in Nagasaki, Japan in 2012. Vector Borne Zoonotic R. T., Murcia, P. R., Acrani, G. O. and Figueiredo, L. T. M. 2018. Dis., 16: 769‒776. Viral diversity of Rhipicephalus microplus parasitizing cattle in Kobayashi, D., Isawa, H., Fujita, R., Murota, K., Itokawa, K., southern Brazil. Sci. Rep., 8: 16315. Higa, Y., Katayama, Y., Sasaki, T., Mizutani, T., Iwanaga, S., Durden, L. A. and Mullen, G. R. 2019. Arthropod-borne diseases. Ohta, N., Garcia-Bertuso, A. and Sawabe, K. 2017. Isolation In: Medical and Veterinary Entomology. ird Edition (ed. and characterization of a new i avirus from Armigeres spp. Mullen, G. R. and Durden, L. A.), pp. 6-7. Academic Press, San mosquitoes in the Philippines. J. Gen. Virol., 98: 2876‒2881. Diego, CA. Kobayashi, D., Murota, K., Fujita, R., Itokawa, K., Kotaki, A., Emmerich, P., Jakupi, X., von Possel, R., Berisha, L., Halili, B., Moi, M. L., Ejiri, H., Maekawa, Y., Ogawa, K., Tsuda, Y., Sasaki, Günther, S., Cadar, D., Ahmeti, S. and Schmidt-Chanasit, J. 2018. T., Kobayashi, M., Takasaki, T., Isawa, H. and Sawabe, K. 2018. Viral metagenomics, genetic and evolutionary characteristics of Dengue virus infection in Aedes albopictus during the 2014 Crimean-Congo hemorrhagic fever orthonairovirus in humans. autochthonous dengue outbreak in Tokyo Metropolis, Japan. Am. Kosovo. Infect. Genet. Evol., 65: 6‒11. J. Trop. Med. Hyg., 98: 1460‒1468. Faizah, A. N., Kobayashi, D., Isawa, H., Amoa-Bosompem, M., Kobayashi, D., Murota, K., Itokawa, K., Ejiri, H., Amoa-Bosompem, Murota, K., Higa, Y., Futami, K., Shimada, S., Kim, K. S., Itokawa, M., Faizah, A. N., Watanabe, M., Maekawa, Y., Hayashi, T., K., Watanabe, M., Tsuda, Y., Minakawa, N., Miura, K., Hirayama, Noda, S., Yamauchi, T., Komagata, O., Sawabe, K. and Isawa, K. and Sawabe, K. 2020. Deciphering the virome of Culex vishnui H. 2020. RNA virome analysis of questing ticks from Hokuriku subgroup mosquitoes, the major vectors of Japanese encephalitis, District, Japan, and the evolutionary dynamics of tick-borne in Japan. Viruses, 12: 264. phleboviruses. Ticks Tick Borne Dis., 11: 101364. Felsenstein, J. 1985. Con dence limits on phylogenies: an approach Kondo, H., Fujita, M., Hisano, H., Hyodo, K., Andika, I. B. and using the bootstrap. Evolution, 39: 783‒791. Suzuki, N. 2020. Virome analysis of aphid populations that infest Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrigenhoek, R. 1994. the barley eld: e discovery of two novel groups of nege/kita- DNA primers for ampli cation of mitochondrial cytochrome c like viruses and other novel RNA viruses. Front. Microbiol., 11: oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. 509. Biol. Biotechnol., 3: 294‒299. Kuwata, R. 2014. Virus species associated with mosquito Culex Fukuda, M., Otsuka, Y., Uni, S., Bain, O. and Takaoka, H. 2010. tritaeniorhynchus Giles. Med. Entomol. Zool., 65: 1‒11 (In Molecular identi cation of infective larvae of three species Japanese with English abstract). of Onchocerca found in wild-caught females of Simulium Ladner, J. T., Wiley, M. R., Beitzel, B., Auguste, A. J., Dupuis, A. bidentatum in Japan. Parasite, 17: 39‒45. P. 2nd, Lindquist, M. E., Sibley, S. D., Kota, K. P., Fetterer, D., Fukuda, M., Uni, S., Igari, T., Utsumi, Y., Otsuka, Y., Nakatani, J., Eastwood, G., Kimmel, D., Prieto, K., Guzman, H., Aliota, M. Uga, S., Hara, T., Hasegawa, H. and Takaoka, H. 2019. Human T., Reyes, D., Brueggemann, E. E., St John, L., Hyeroba, D., case of Onchocerca dewittei japonica infection in Fukushima, Lauck, M., Friedrich, T. C., O’Connor, D. H., Gestole, M. C., Northeastern Honshu, Japan. Parasitol. Int., 72: 101943. Cazares, L. H., Popov, V. L., Castro-Llanos, F., Kochel, T. J., Fumagalli, M. J., de Souza, W. M., de Araujo, J., Modha, S., Queiroz, Kenny, T., White, B., Ward, M. D., Loaiza, J. R., Goldberg, T. L., L. H., Durigon, E. L., Murcia, P. R. and Figueiredo, L. T. M. 2019. Weaver, S. C., Kramer, L. D., Tesh, R. B. and Palacios, G. 2016. Krykféie dicistrovirus: A novel dicistrovirus in velvety free-tailed A multicomponent animal virus isolated from mosquitoes. Cell bats from Brazil. Infect. Genet. Evol., 75: 104036. Host Microbe, 20: 357‒367. Hameed, A. S., Ninawe, A. S., Nakai, T., Chi, S. C. and Johnson, K. Li, C. X., Shi, M., Tian, J. H., Lin, X. D., Kang, Y. J., Chen, L. J., Qin, L. 2019. ICTV virus taxonomy pro le: Nodaviridae. J. Gen. Virol., X. C., Xu, J., Holmes, E. C. and Zhang, Y. Z. 2015. Unprecedented 100: 3‒4. genomic diversity of RNA viruses in arthropods reveals the 240 Med. Entomol. Zool.

ancestry of negative-sense RNA viruses. eLife, 4: e05378. 2018. e evolutionary history of vertebrate RNA viruses. Nature, Marchler-Bauer, A., Derbyshire, M. K., Gonzales, N. R., Lu, S., 556: 197‒202. Chitsaz, F., Geer, L. Y., Geer, R. C., He, J., Gwadz, M., Hurwitz, D. Tamura, K., Stecher, G., Peterson, D., Filipski, A. and Kumar, S. I., Lanczycki, C. J., Lu, F., Marchler, G. H., Song, J. S., anki, N., 2013. MEGA6: Molecular evolutionary genetics analysis version Wang, Z., Yamashita, R. A., Zhang, D., Zheng, C. and Bryant, S. 6.0. Mol. Biol. Evol., 30: 2725‒2729. H. 2015. CDD: NCBI’s conserved domain database. Nucleic Acids Temmam, S., Monteil-Bouchard, S., Sambou, M., Aubadie-Ladrix, Res., 43: D222‒D226. M., Azza, S., Decloquement, P., Khalil, J. Y. B., Baudoin, J., Jardot, Modha, S., Hughes, J., Bianco, G., Ferguson, H., Helm, B., Tong, P., Robert, C., Scola, B., Mediannikov, O., Raoult, D. and Desnues, L., Wilkie, G., Kohl, A. and Schnettler, E. 2019. Metaviromics C. 2015. Faustovirus-like asfarvirus in hematophagous biting reveals unknown viral diversity in the biting midge Culicoides midges and their vertebrate hosts. Front. Microbiol., 6: 1406. impunctatus. Viruses, 11: 865. Temmam, S., Monteil-Bouchard, S., Robert, C., Baudoin, J., Moutailler, S., Popovici, I., Devillers, E., Vayssier-Taussat, M. Sambou, M., Aubadie-Ladrix, M., Labas, N., Raoult, D., and Eloit, M. 2016. Diversity of viruses in Ixodes ricinus, and Mediannikov, O. and Desnues, C. 2016. Characterization of characterization of a neurotropic strain of Eyach virus. New viral communities of biting midges and identi cation of novel Microbes New Infect., 11: 71‒81. thogotovirus species and rhabdovirus genus. Viruses, 8: 77. Mullen, G. R. and Murphree, C. S. 2019. Biting Midges Temmam, S., Chrétien, D., Bigot, T., Dufour, E., Petres, S., (Ceratopogonidae). In: Medical and Veterinary Entomology Desquesnes, M., Devillers, E., Dumarest, M., Yous , L., ird Edition (ed. Mullen, G. R. and Durden, L. A.), pp. 213‒236, Jittapalapong, S., Karnchanabanthoeng, A., Chaisiri, K., Academic Press, London, United Kingdom. Gagnieur, L., Cosson, J. F., Vayssier-Taussat, M., Morand, S., Nakashima, N. and Uchiumi, T. 2009. Functional analysis of Moutailler, S. and Eloit, M. 2019. Monitoring silent spillovers structural motifs in dicistroviruses. Virus Res., 139: 137‒147. before emergence: A pilot study at the tick/human interface in Otsuka, Y., Aoki, C., Saito, K., Hadi, U. K., Suzuki, H. and Takaoka, ailand. Front. Microbiol., 10: 2315. H. 2001. Phylogenetic analyses of a black y subgenus Simulium Tokarz, R., Williams, S. H., Samero, S., Leon, M. S., Jain, K. and (Nevermannia) based on mitochondrial 16S ribosomal RNA gene Lipkin, W. I. 2014. Virome analysis of Amblyomma americanum, sequences. Jpn. J. Trop. Med. Hyg., 29: 261‒266. Dermacentor variabilis, and Ixodes scapularis ticks reveals novel Phan, T. G., del Valle Mendoza, J., Sadeghi, M., Altan, E., Deng, X. highly divergent vertebrate and invertebrate viruses. J. Virol., 88: and Delwart, E. 2018. Sera of Peruvians with fever of unknown 11480‒11492. origins include viral nucleic acids from non-vertebrate hosts. Tokarz, R., Samero, S., Taglia erro, T., Jain, K., Williams, S. H., Virus Genes, 54: 33‒40. Cucura, D. M., Rochlin, I., Monzon, J., Carpi, G., Tus, D., Diuk- Qin, X. C., Shi, M., Tian, J. H., Lin, X. D., Gao, D. Y., He, J. Wasser, M., Brinkerho, J. and Lipkin, W. I. 2018. Identi cation R., Wang, J. B., Li, C. X., Kang, Y. J., Yu, B., Zhou, D. J., Xu, J., of novel viruses in Amblyomma americanum, Dermacentor Plyusnin, A., Holmes, E. C. and Zhang, Y. Z. 2014. A tick-borne variabilis, and Ixodes scapularis ticks. MSphere, 3: e00614‒e00617. segmented RNA virus contains genome segments derived from Tsuda, Y. and Hayashi, T. 2014. Results of mosquito surveillance unsegmented viral ancestors. Proc. Natl. Acad. Sci. U.S.A., 111: using dry-ice traps from 2003 to 2013 at the National Institute of 6744‒6749. Infectious Diseases, Tokyo, Japan. Med. Entomol. Zool., 65: 131‒ Roberts, J. M., Anderson, D. L. and Durr, P. A. 2018. Metagenomic 137. analysis of Varroa-free Australian honey bees (Apis mellifera) Valles, S. M., Chen, Y., Firth, A. E., Guérin, D. M. A., Hashimoto, shows a diverse Picornavirales virome. J. Gen. Virol., 99: 818‒826. Y., Herrero, S., de Miranda, J. R., Ryabov, E. and ICTV Report Rudbeck, L. and Dissing, J. 1998. Rapid, simple alkaline extraction of Consortium. 2017. ICTV virus taxonomy pro le: Dicistroviridae. human genomic DNA from whole blood, buccal epithelial cells, J. Gen. Virol., 98: 355‒356. semen and forensic stains for PCR. Biotechniques, 25: 588‒592, 592. Valles, S. M. and Rivers, A. R. 2019. Nine new RNA viruses Sadeghi, M., Altan, E., Deng, X., Barker, C. M., Fang, Y., Coey, associated with the re ant Solenopsis invicta from its native L. L. and Delwart, E. 2018. Virome of >12 thousand Culex range. Virus Genes, 55: 368‒380. mosquitoes from throughout California. Virology, 523: 74‒88. Venter, P. A., Jovel, J. and Schneemann, A. 2010. Insect nodaviruses. Sakai, T. 2007. Current status and countermeasures of Chicken In: Insect Virology (ed. Asgari, S. and Johnson, K.), pp. 251‒282. leucocytozoonosis in Japan. J. Anim. Protozooses, 22: 14‒21 (In Caister Academic Press, Norfolk, UK. Japanese with English abstract). Wang, Z. D., Wang, B., Wei, F., Han, S. Z., Zhang, L., Yang, Z. T., Sato, Y., Tamada, A., Mochizuki, Y., Nakamura, S., Okano, E., Yan, Y., Lv, X. L., Li, L., Wang, S. C., Song, M. X., Zhang, H. J., Yoshida, C., Ejiri, H., Omori, S., Yukawa, M. and Murata, K. Huang, S. J., Chen, J., Huang, F. Q., Li, S., Liu, H. H., Hong, J., Jin, 2009. Molecular detection of Leucocytozoon lovati from probable Y. L., Wang, W., Zhou, J. Y. and Liu, Q. 2019. A new segmented vectors, black ies (Simuliudae) collected in the alpine regions of virus associated with human febrile illness in China. N. Engl. J. Japan. Parasitol. Res., 104: 251‒255. Med., 380: 2116‒2125. Schoonvaere, K., De Smet, L., Smagghe, G., Vierstraete, A., Wiegmann, B. M., Trautwein, M. D., Winkler, I. S., Barr, N. B., Braeckman, B. P. and de Graaf, D. C. 2016. Unbiased RNA Kim, J. W., Lambkin, C., Bertone, M. A., Cassel, B. K., Bayless, shotgun metagenomics in social and solitary wild bees detects K. M., Heimberg, A. M., Wheeler, B. M., Peterson, K. J., Pape, associations with eukaryote parasites and new viruses. PLoS One, T., Sinclair, B. J., Skevington, J. H., Blagoderov, V., Caravas, J., 11: e0168456. Kutty, S. N., Schmidt-Ott, U., Kampmeier, G. E., ompson, F. C., Shi, M., Lin, X. D., Tian, J. H., Chen, L. J., Chen, X., Li, C. X., Qin, Grimaldi, D. A., Beckenbach, A. T., Courtney, G. W., Friedrich, X. C., Li, J., Cao, J. P., Eden, J. S., Buchmann, J., Wang, W., Xu, J., M., Meier, R. and Yeates, D. K. 2011. Episodic radiations in the y Holmes, E. C. and Zhang, Y. Z. 2016a. Rede ning the invertebrate tree of life. Proc. Natl. Acad. Sci. U.S.A., 108: 5690‒5695. RNA virosphere. Nature, 540: 539‒543. Xiong, B. and Kocher, T. D. 1991. Comparison of mitochondrial Shi, M., Lin, X. D., Vasilakis, N., Tian, J. H., Li, C. X., Chen, L. J., DNA sequences of seven morphospecies of black ies (Diptera: Eastwood, G., Diao, X. N., Chen, M. H., Chen, X., Qin, X. C., Simuliidae). Genome, 34: 306‒311. Widen, S. G., Wood, T. G., Tesh, R. B., Xu, J., Holmes, E. C. and Yanase, T. 2009. Arboviruses transmitted by Culicoides biting Zhang, Y. Z. 2016b. Divergent viruses discovered in arthropods midges to live-stock. Med. Entomol. Zool., 60: 195‒212 (In and vertebrates revise the evolutionary history of the Flaviviridae Japanese with English abstract). and related viruses. J. Virol., 90: 659‒669. Zuker, M. 2003. Mfold web server for nucleic acid folding and Shi, M., Lin, X. D., Chen, X., Tian, J. H., Chen, L. J., Li, K., Wang, hybridization prediction. Nucleic Acids Res., 31: 3406‒3415. W., Eden, J. S., Shen, J. J., Liu, L., Holmes, E. C. and Zhang, Y. Z. Vol. 71 No. 3 2020 241 Accession No. AVM87659 CAA39394 AVM87653 ABH09886 AKN56888 AJG39250 AKN56871 ASA47278 APT68154 AIA24559 APG79264 APG79275 AOF41423 AJG39258 AJG39267 AJG39268 AJG39245 AJG39262 QGA70910 QBK47217 ARO50046 QHA33845 QHA33854 APG79291 APG79278 APG79294 APG79296 QDZ58984 AWA82264 QIJ70042 QID77675 QIJ56910 AXV43873 Strain or isolate name XQTMS34106 76-118 LPXYF84819 VRC 66412 C51-CI-2004 QSA03 B81-CI-2004 mos172gb37606 S33-2 G10N QTM19232 QTM74767 UW1 WCZL-5 WT3-15 QN2-7 SXSSP02 WHDL02 OTU20 AMA RI-A CV/Mati1754-5 GV/Mati1754-5 SCM48138 QTM75064 SCM95079 SCM173098 C7 Jap1 GudgCaA_DN61930-20 St_USA YBV1/16-0052/ROK/2016 Virus name Wenling yellow goose sh hantavirus Hantaan virus Hainan oriental leaf-toed gecko virus ottopalayam virus Ferak virus Shuangao insect virus 2 Jonchet virus Culex phasma-like virus Ganda bee virus Kigluaik phantom virus Hubei odonate virus 8 Hubei odonate virus 9 Seattle Prectang virus Wuchang Cockroach Virus 1 Wuhan mosquito virus 1 Wuhan Mosquito Virus 2 Sanxia Water Strider Virus 2 Wuhan Insect virus 2 Anjon virus Anopheles triannulatus orthophasmavirus Apis bunyavirus 2 Coredo virus Guagua virus Hubei bunya-like virus 8 Hubei bunya-like virus 9 Hubei diptera virus 6 Hubei diptera virus 7 Niukluk phantom virus Notori virus Peralta bunya-like virus Pink bollworm virus 2 Scaphoideus titanus bunya-like virus 1 Yongsan bunyavirus 1 Genus Actinovirus Orthohantavirus Reptillovirus ottimvirus Feravirus Inshuvirus Jonvirus Orthophasmavirus Sawastrivirus Wuhivirus unclassi ed Family Hantaviridae Phasmaviridae Order Bunyavirales Appendix 1. List of virus sequences used in this study. 242 Med. Entomol. Zool. AAN61470 AAF80998 AAC58807 AAC95509 AAF72337 BAA32553 AAF00472 ALS55295 AYH52674 ATI98940 AWK77854 AXQ04775 AXQ04777 ALV83314 APG77974 APG77985 AIY53985 QBL75886 APG78465 BAH83667 AAF70829 BAF36740 AAB58782 AAA81554 AAQ91607 CAC82912 AAF82240 CAA27332 AAB66324 NP_045010 AAM14417 Accession No. EB South African Ngousso NZ S37 QLD-6 CDicV1/Fresno CDicV2/Contra Costa UW1 QTM26191 QTM27139 Formosa WHYY3291 Narita-21 ApMAR Tokyo 16681 JaOArS982 It P9605 M544 Vasilchenko 17D H77 A/T1053 Tr127154 Strain or isolate name Appendix 1. Continued. Aphid lethal paralysis virus Cricket paralysis virus Drosophila C virus Rhopalosiphum padi virus Black queen cell virus Himetobi P virus Triatoma virus Anopheles C virus Aphis gossypii virus Big Sioux River virus Bundaberg bee virus 1 Culex dicistrovirus 1 Culex dicistrovirus 2 Goose dicistrovirus Hubei picorna-like virus 14 Hubei picorna-like virus 15 Nilaparvata lugens C virus Solenopsis invicta virus 6 Wuhan insect virus 33 Aedes avivirus Apoi virus Culex avivirus Dengue virus 2 Japanese encephalitis virus Kyasanur Forest disease virus Modoc virus Tick-borne encephalitis virus Yello fever virus Hepatitis C virus GB virus-A Tamana bat virus Virus name Cripavirus Triatovirus unclassi ed Flavivirus Hepacivirus Pegivirus unclassi ed Genus Dicistroviridae Flaviviridae Family Picornavirales Order Vol. 71 No. 3 2020 243 AXE71876 AVL26135 APG76082 not recorded AKL90461 AHZ31671 QCW07569 AGL39759 BBO25557 QCB64649 ALL52907 ALL52901 ALL52895 ALL52919 ALL52913 QBQ65082 AXE71873 AVL26136 APG76081 AKH40309 AKL90460 AHZ31740 QCW07567 AGL39760 BBO25556 QCB64647 ALL52904 ALL52898 ALL52892 ALL52916 ALL52910 QBQ65056 CAA26238 AAK15751 CAA54399 AAF97860 AAF71691 ACF36168 AAQ90061 BAB64329 ABY87293 APG76155 APG76125 ACU32794 QIJ70031 AAO60068 LR701648 AMO03244 ADV74764 APG76299 APG76300 Accession No. H3 GXTV108 CJLX28200 LO35 SY84 KITV/2017/1 MGTV/V4/11 16GH38 YNTV4 SKC WHYC-1 WHYC-2 WHXS-1 WHZM YG BF93Hok SGWak97 TPKag93 BHWZXX15622 BHJJX6144 GUNChsp_DN2936-39 M1 Dimm_PoolSeq3 Belize insectZJ65889 insectZJ94204 Strain or isolate name Appendix 1. Continued. Alongshan virus Amblyomma virus Changjiang Jingmen-like virus Charvil virus Guaico Culex virus Jingmen tick virus Kindia tick virus Mogiana tick virus Mole Culex virus Rhipicephalus associated avi-like virus Shuangao insect virus 7 Wuhan aphid virus 1 Wuhan aphid virus 2 Wuhan cricket virus Wuhan ea virus Yanggou tick virus Black beetle virus Boolarra virus Flock House virus Nodamura virus Pariacoto virus Bar n ounder virus Sevenband grouper nervous necrosis virus Striped jack nervous necrosis virus Tiger puer nervous necrosis virus Beihai noda-like virus 29 Beihai noda-like virus 30 Drosophila melanogaster American nodavirus Gungahlin Chrysomya noda-like virus Macrobrachium rosenbergii nodavirus Midge associated nodavirus M1C9 Newington virus Penaeus vannamei nodavirus Shuangao insect virus 11 Shuangao noda-like virus 1 Virus name * Jingmenvirus Alphanodavirus Betanodavirus unclassifed Genus Nodaviridae Family Order Proposed genus. *