DOCSLIB.ORG

Processing During T Cell Development Dynamic Microrna

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Processing During T Cell Development Dynamic Microrna Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 is online at: average * The Journal of Immunology , 18 of which you can access for free at: 2012; 188:3257-3267; Prepublished online 29 from submission to initial decision 4 weeks from acceptance to publication February 2012; doi: 10.4049/jimmunol.1103175 http://www.jimmunol.org/content/188/7/3257 Dynamic MicroRNA Gene Transcription and Processing during T Cell Development Francis F. Kirigin, Kenneth Lindstedt, Maclean Sellars, Maria Ciofani, Siao Li Low, Lachlan Jones, Fiona Bell, Florencia Pauli, Richard Bonneau, Richard M. Myers, Dan R. Littman and Mark M. W. Chong J Immunol cites 47 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription http://www.jimmunol.org/content/suppl/2012/02/29/jimmunol.110317 5.DC1 This article http://www.jimmunol.org/content/188/7/3257.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Dynamic MicroRNA Gene Transcription and Processing during T Cell Development Francis F. Kirigin,*,† Kenneth Lindstedt,‡ Maclean Sellars,* Maria Ciofani,* Siao Li Low,‡ Lachlan Jones,‡ Fiona Bell,‡ Florencia Pauli,x Richard Bonneau,†,{ Richard M. Myers,x Dan R. Littman,*,‖ and Mark M. W. Chong‡,# By disrupting microRNA (miRNA) biogenesis, we previously showed that this pathway is critical for the differentiation and function of T cells. Although various cloning studies have shown that many miRNAs are expressed during T cell development, and in a dy- namic manner, it was unclear how comprehensive these earlier analyses were. We therefore decided to profile miRNA expression by next generation sequencing. Furthermore, we profiled miRNA expression starting from the hematopoietic stem cell. This analysis revealed that miRNA expression during T cell development is extremely dynamic, with 645 miRNAs sequenced, and the expression of some varying by as much as 3 orders of magnitude. Furthermore, changes in precursor processing led to altered mature miRNA Downloaded from sequences. We also analyzed the structures of the primary miRNA transcripts expressed in T cells and found that many were ex- tremely long. The longest was pri–mir-29b-1/29a at ∼168 kb. All the long pri-miRNAs also displayed extensive splicing. Our findings indicate that miRNA expression during T cell development is both a highly dynamic and a highly regulated process. The Journal of Immunology, 2012, 188: 3257–3267. http://www.jimmunol.org/ arly hematopoiesis occurs in the bone marrow (BM), ductive rearrangement is required for progression to the DN4 stage giving rise to progenitors of all leukocyte lineages. Thy- (1). DN4 thymocytes then rapidly proliferate and upregulate both E mocyte progenitors then leave the BM to seed the thymus coreceptors as they progress to the CD4+CD8+ double-positive where definitive T cell development occurs. Early thymocytes first (DP) stage. Appropriate selection then leads to differentiation of progress through four stages termed double-negative (DN) 1–4, mature CD8+ cytotoxic T cells or CD4+ Th cells (2). because they lack expression of the CD4 and CD8 coreceptors. Much of what is understood about T cell development is centered DN3 is a key stage. TCR b rearrangement occurs here, and pro- on proteins, such as those involved in transcription and signal transduction. However, there is an increasing appreciation for the role of non-protein–coding RNAs (ncRNAs). Both long ncRNAs by guest on September 25, 2021 *Kimmel Center for Biology and Medicine, Skirball Institute of Biomolecular Medicine, (lncRNAs) (3) and small ncRNAs (4–6) are expressed in T cells, New York University School of Medicine, New York, NY 10016; †Center for Genomics but the function of most ncRNA classes remains unknown. The and Systems Biology, New York University, New York, NY 10003; ‡Walter and Eliza Hall Institute of Medical Research, Parkville, Victoria 3052, Australia; xHudsonAlpha best understood class is the microRNAs (miRNAs), which are Institute for Biotechnology, Huntsville, AL 35806; {Courant Institute for Mathematical ∼22-nt small RNAs that inhibit the translation of protein-coding ‖ Sciences, New York, NY 10003; Howard Hughes Medical Institute, New York messenger RNAs (mRNAs). Thousands of miRNAs have so far University School of Medicine, New York, NY 10016; and #Department of Medical Biology, University of Melbourne, Parkville, Victoria 3010, Australia been identified in plants and animals, including some 1424 and Received for publication November 7, 2011. Accepted for publication January 22, 720 in humans and mice, respectively (miRBase) (7). miRNAs 2012. target protein-coding mRNAs via incomplete base pairings (8). This work was supported by grants from the Australian National Health and Medical Because only partial complementarity is required, numerous Research Council (637338 and 1004541; to M.M.W.C.), the National Institutes of mRNAs can be the target of each miRNA. Health (RC1 AI087266-01, RC4 AI092765-01, and PN2 EY016586-06; to R.B.), and the National Science Foundation (DBI-0820757; to R.B.) and funding from the miRNAs originate from long primary transcripts (known as pri- HudsonAlpha Institute for Biotechnology (to F.P. and R.M.M.). M.S. and M.C. were miRNAs) containing one or more secondary stem-loop structures. It supported by postdoctoral fellowships from the Cancer Research Institute and the is from this stem loop that the mature miRNA is eventually derived. Leukemia and Lymphoma Society, respectively. M.M.W.C. is a Queen Elizabeth II Fellow of the Australian Research Council, and D.R.L. is an Investigator of the In the canonical biogenesis pathway, the intermediate “pre-miRNA” Howard Hughes Medical Institute. This work was made possible through Victorian stem loop is released from the pri-miRNA in the nucleus by the State Government Operational Infrastructure Support and Australian National Health and Medical Research Council Research Institute Infrastructure Support Scheme. microprocessor complex. At the core of this complex is the RNase III enzyme Drosha (9). The excised pre-miRNA is then exported to The sequences presented in this article have been submitted to the Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo/) under accession number GSE30584. the cytoplasm where it is further processed by another RNase III Address correspondence and reprint requests to Dr. Mark M.W. Chong, Walter and enzyme complex containing Dicer, which clips off the loop struc- Eliza Hall Institute of Medical Research, Parkville, VIC 3052, Australia. E-mail ture (10). This is followed by loading of the miRNA-5p:miRNA-3p address: [email protected] duplex (i.e., the two arms of the stem loop) into the RNA-induced The online version of this article contains supplemental material. silencing complex (11), at which point one strand is degraded. Abbreviations used in this article: BM, bone marrow; ChIP, chromatin immunopre- We and others have shown that Drosha and Dicer, and therefore cipitation; DN, double-negative; DP, double-positive; ITU, independent transcrip- tional unit; lncRNA, long ncRNA; LSK, Lin2Sca1+kit+; MEF, murine embryonic miRNAs, are important throughout the T cell compartment. miR- fibroblast; miRNA, microRNA; MPP, multipotent progenitor; ncRNA, non-protein– NAs are required for early thymocytes to progress through the DN coding RNA; NGS, next generation sequencing; PolII, RNA polymerase II; pri- stages (12). miRNAs are also necessary for T cell function. In miRNA, primary microRNA; seq, sequencing. particular, they maintain the suppressor program of Foxp3+ regu- + Copyright Ó 2012 by The American Association of Immunologists, Inc. 0022-1767/12/$16.00 latory T cells. Mice with Foxp3 cell-specific Drosha or Dicer www.jimmunol.org/cgi/doi/10.4049/jimmunol.1103175 3258 MicroRNA DYNAMICS IN T CELLS deficiency die of a lymphoproliferative multiorgan inflammatory form as described previously (12, 23). Sequence reads were mapped to disease because of loss of suppressor function (13–15). known mature and pre-miRNAs deposited in miRBase (7). Nonmapping reads were then analyzed for potential novel miRNA species. In brief, this Compared with the posttranscriptional processing, less is known involved aligning the remaining reads to the Mus musculus genome (mm9 about the transcription of miRNA genes. This has been due, in assembly, National Center for Biotechnology Information Build 37) using large part, to a lack of information about the full-length primary Novoalign (NovoCraft V2.05.04). The genomic intervals in which novels transcript of most miRNAs, and thus, genomic databases have not reads clustered were then extracted, and the corresponding RNA was an- been able to annotate these genes. It is estimated that 30–40% of alyzed for putative secondary structure using UNAfold (24). Sequences with predicted stem-loop structure
Load more

Recommended publications
  • Recombinant Human ARFIP2 Protein Catalog Number: ATGP1695
    Recombinant human ARFIP2 protein Catalog Number: ATGP1695 PRODUCT INPORMATION Expression system E.coli Domain 1-341aa UniProt No. P53365 NCBI Accession No. NP_036534 Alternative Names Arfaptin 2, POR1 PRODUCT SPECIFICATION Molecular Weight 40.2 kDa (364aa) confirmed by MALDI-TOF Concentration 0.25mg/ml (determined by Bradford assay) Formulation Liquid in. 20mM Tris-HCl buffer (pH 8.0) containing 0.2M NaCl, 40% glycerol, 1mM DTT Purity > 90% by SDS-PAGE Tag His-Tag Application SDS-PAGE Storage Condition Can be stored at +2C to +8C for 1 week. For long term storage, aliquot and store at -20C to -80C. Avoid repeated freezing and thawing cycles. BACKGROUND Description Arfaptin 2, also known as ARFIP2, is a Rac1 binding protein necessary for Rac-mediated actin polymerization and the subsequent formation of membrane ruffles and lamellipodia. ARFIP2 has also been shown to interact with the ADP ribosylation factor ARF6, a GTPase that associates with the plasma membrane and intracellular endosome vesicles, in a GTP dependent manner. Arfaptin 2 also regulates the aggregation of mutant Huntingtin protein by possibly impairing proteasome function. Expression of ARFIP2 was shown to be increased at sites of neurodegeneration. Recombinant human ARFIP2 protein, fused to His-tag at N-terminus, was expressed in E. coli 1 Recombinant human ARFIP2 protein Catalog Number: ATGP1695 and purified by using conventional chromatography techniques. Amino acid Sequence MGSSHHHHHH SSGLVPRGSH MGSMTDGILG KAATMEIPIH GNGEARQLPE DDGLEQDLQQ VMVSGPNLNE TSIVSGGYGG SGDGLIPTGS GRHPSHSTTP SGPGDEVARG IAGEKFDIVK KWGINTYKCT KQLLSERFGR GSRTVDLELE LQIELLRETK RKYESVLQLG RALTAHLYSL LQTQHALGDA FADLSQKSPE LQEEFGYNAE TQKLLCKNGE TLLGAVNFFV SSINTLVTKT MEDTLMTVKQ YEAARLEYDA YRTDLEELSL GPRDAGTRGR LESAQATFQA HRDKYEKLRG DVAIKLKFLE ENKIKVMHKQ LLLFHNAVSA YFAGNQKQLE QTLQQFNIKL RPPGAEKPSW LEEQ General References D'Souza Schorey C., et al.
    [Show full text]
  • Translational Control in Cancer Etiology
    Downloaded from http://cshperspectives.cshlp.org/ on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press Translational Control in Cancer Etiology Davide Ruggero Helen Diller Cancer Center, School of Medicine, University of California, San Francisco, California 94158 Correspondence: [email protected] The link between perturbations in translational control and cancer etiology is becoming a primary focus in cancer research. It has now been established that genetic alterations in several components of the translational apparatus underlie spontaneous cancers as well as an entire class of inherited syndromes known as “ribosomopathies” associated with in- creased cancer susceptibility. These discoveries have illuminated the importance of dereg- ulations in translational control to very specific cellular processes that contribute to cancer etiology. In addition, a growing body of evidence supports the view that deregulation of translational control is a common mechanism by which diverse oncogenic pathways promote cellular transformation and tumor development. Indeed, activation of these key oncogenic pathways induces rapid and dramatic translational reprogramming both by in- creasing overall protein synthesis and by modulating specific mRNA networks. These trans- lational changes promote cellular transformation, impacting almost every phase of tumor development. This paradigm represents a new frontier in the multihit model of cancer for- mation and offers significant promise for innovative cancer therapies. Current research,
    [Show full text]
  • Table of Contents (PDF)
    July 26, 2011 u vol. 108 u no. 30 u 12187–12560 Cover image: Pictured is a Tasmanian devil (Sarcophilus harrisii), a carnivorous marsupial whose numbers are dwindling due to an infectious facial cancer called Devil Facial Tumor Disease. Webb Miller et al. sequenced the genome of devils from northwest and south- east Tasmania, spanning the range of this threatened species on the Australian island. The authors report that the sequences reveal a worrisome dearth of genetic diversity among devils, suggesting the need for genetically characterized stocks to help breed hardier devils that might be better equipped to fight diseases. See the article by Miller et al. on pages 12348–12353. Image courtesy of Stephan C. Schuster. From the Cover 12348 Decoding the Tasmanian devil genome 12283 Illuminating chromosomal architecture 12295 Symmetry of cultured cells 12319 Caloric restriction and infertility 12366 Genetic diversity among ants Contents COMMENTARIES 12189 Methyl fingerprinting of the nucleosome reveals the molecular mechanism of high-mobility group THIS WEEK IN PNAS nucleosomal-2 (HMGN2) association Catherine A. Musselman and Tatiana G. Kutateladze See companion article on page 12283 12187 In This Issue 12191 Examining the establishment of cellular axes using intrinsic chirality LETTERS (ONLINE ONLY) Jason C. McSheene and Rebecca D. Burdine See companion article on page 12295 E341 Difference between restoring and predicting 3D 12193 Secrets of palm oil biosynthesis revealed structures of the loops in G-protein–coupled Toni Voelker receptors by molecular modeling See companion article on page 12527 Gregory V. Nikiforovich, Christina M. Taylor, Garland R. Marshall, and Thomas J. Baranski E342 Reply to Nikiforovich et al.: Restoration of the loop regions of G-protein–coupled receptors Dahlia A.
    [Show full text]
  • Computational Genome-Wide Identification of Heat Shock Protein Genes in the Bovine Genome [Version 1; Peer Review: 2 Approved, 1 Approved with Reservations]
    F1000Research 2018, 7:1504 Last updated: 08 AUG 2021 RESEARCH ARTICLE Computational genome-wide identification of heat shock protein genes in the bovine genome [version 1; peer review: 2 approved, 1 approved with reservations] Oyeyemi O. Ajayi1,2, Sunday O. Peters3, Marcos De Donato2,4, Sunday O. Sowande5, Fidalis D.N. Mujibi6, Olanrewaju B. Morenikeji2,7, Bolaji N. Thomas 8, Matthew A. Adeleke 9, Ikhide G. Imumorin2,10,11 1Department of Animal Breeding and Genetics, Federal University of Agriculture, Abeokuta, Nigeria 2International Programs, College of Agriculture and Life Sciences, Cornell University, Ithaca, NY, 14853, USA 3Department of Animal Science, Berry College, Mount Berry, GA, 30149, USA 4Departamento Regional de Bioingenierias, Tecnologico de Monterrey, Escuela de Ingenieria y Ciencias, Queretaro, Mexico 5Department of Animal Production and Health, Federal University of Agriculture, Abeokuta, Nigeria 6Usomi Limited, Nairobi, Kenya 7Department of Animal Production and Health, Federal University of Technology, Akure, Nigeria 8Department of Biomedical Sciences, Rochester Institute of Technology, Rochester, NY, 14623, USA 9School of Life Sciences, University of KwaZulu-Natal, Durban, 4000, South Africa 10School of Biological Sciences, Georgia Institute of Technology, Atlanta, GA, 30032, USA 11African Institute of Bioscience Research and Training, Ibadan, Nigeria v1 First published: 20 Sep 2018, 7:1504 Open Peer Review https://doi.org/10.12688/f1000research.16058.1 Latest published: 20 Sep 2018, 7:1504 https://doi.org/10.12688/f1000research.16058.1 Reviewer Status Invited Reviewers Abstract Background: Heat shock proteins (HSPs) are molecular chaperones 1 2 3 known to bind and sequester client proteins under stress. Methods: To identify and better understand some of these proteins, version 1 we carried out a computational genome-wide survey of the bovine 20 Sep 2018 report report report genome.
    [Show full text]
  • Diseasespecific and Inflammationindependent Stromal
    Full Length Arthritis & Rheumatism DOI 10.1002/art.37704 Disease-specific and inflammation-independent stromal alterations in spondyloarthritis synovitis Nataliya Yeremenko1,2, Troy Noordenbos1,2, Tineke Cantaert1,3, Melissa van Tok1,2, Marleen van de Sande1, Juan D. Cañete4, Paul P. Tak1,5*, Dominique Baeten1,2 1Department of Clinical Immunology and Rheumatology and 2Department of Experimental Immunology, Academic Medical Center/University of Amsterdam, the Netherlands. 3Department of Immunobiology, Yale University School of Medicine, New Haven, CT, USA. 4Department of Rheumatology, Hospital Clinic de Barcelona and IDIBAPS, Spain. 5Arthrogen B.V., Amsterdam, the Netherlands. *Currently also: GlaxoSmithKline, Stevenage, U.K. Corresponding author: Dominique Baeten, MD, PhD, Department of Clinical Immunology and Rheumatology, F4-105, Academic Medical Center/University of Amsterdam, Meibergdreef 9, 1105 AZ Amsterdam, The Netherlands. E-mail: [email protected] This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an ‘Accepted Article’, doi: 10.1002/art.37704 © 2012 American College of Rheumatology Received: Apr 11, 2012; Revised: Jul 25, 2012; Accepted: Sep 06, 2012 Arthritis & Rheumatism Page 2 of 36 Abstract Objective: The molecular processes driving the distinct patterns of synovial inflammation and tissue remodelling in spondyloarthritis (SpA) versus rheumatoid arthritis (RA) remain largely unknown. Therefore, we aimed to identify novel and unsuspected disease- specific pathways in SpA by a systematic and unbiased synovial gene expression analysis. Methods: Differentially expressed genes were identified by pan-genomic microarray and confirmed by quantitative PCR and immunohistochemistry using synovial tissue biopsies of SpA (n=63), RA (n=28) and gout (n=9) patients.
    [Show full text]
  • Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-Like Mouse Models: Tracking the Role of the Hairless Gene
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2006 Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene Yutao Liu University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Life Sciences Commons Recommended Citation Liu, Yutao, "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino- like Mouse Models: Tracking the Role of the Hairless Gene. " PhD diss., University of Tennessee, 2006. https://trace.tennessee.edu/utk_graddiss/1824 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Yutao Liu entitled "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Life Sciences. Brynn H. Voy, Major Professor We have read this dissertation and recommend its acceptance: Naima Moustaid-Moussa, Yisong Wang, Rogert Hettich Accepted for the Council: Carolyn R.
    [Show full text]
  • Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
    Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897
    [Show full text]
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • Broad Poster Vivek
    A novel computational method for finding regions with copy number abnormalities in cancer cells Vivek, Manuel Garber, and Mike Zody Broad Institute of MIT and Harvard, Cambridge, MA, USA Introduction Results Cancer can result from the over expression of oncogenes, genes which control and regulate cell growth. Sometimes oncogenes increase in 1 2 3 activity due to a specific genetic mutation called a translocation (Fig 1). SMAD4 – a gene known to be deleted in pancreatic COX10 – a gene deleted in cytochrome c oxidase AK001392 – a hereditary prostate cancer protein This translocation allows the oncogene to remain as active as its paired carcinoma deficiency, known to be related to cell proliferation gene. Amplification of this mutation can occur, thereby creating the proper conditions for uncontrolled cell growth; consequently, each Results from Analysis Program Results from Analysis Program Results from Analysis Program component of the translocation will amplify in similar quantities. In this mutation, the chromosomal region containing the oncogene displaces to Region 1 Region 2 R2 Region 1 Region 2 R2 Region 1 Region 2 R2 a region on another chromosome containing a gene that is expressed Chr18:47044749-47311978 Chr17:13930739-14654741 0.499070821478475 Chr17:13930739-14654741 Chr18:26861790-27072166 0.47355172850856 Chr17:12542326-13930738 Chr8:1789292-1801984 0.406208680312004 frequently. Actual region containing gene Actual region containing gene Actual region containing gene chr18: 45,842,214 - 48,514,513 chr17: 13,966,862 - 14,068,461 chr17: 12,542,326 - 13,930,738 Fig 1. Two chromosomal regions (abcdef and ghijk) are translocating to create two new regions (abckl and ghijedf).
    [Show full text]
  • Supplementary Table 1. Primer Sequences Used in RT-PCR Analysis
    Supplementary Table 1. Primer sequences used in RT-PCR analysis L32 Forward TGAAGCAGGCATCTGAGGG Reverse CGAAGGTGGAAGAG TGGGAG LIFR Forward CTCTCAGGCCAGAGTTGAGC Reverse GCTGTTCAGTCAGCCCTCTC CCR2 Forward TGTCTTCCCTGAATTGAGCC Reverse AAACGCATTAGTGGACAGGG IL12R Forward CGCAATACGTCGTGCGCTGC Reverse CACTCTGACTCCCACGCGCC CSF1R Forward GCTGGTGCGGATTCGAGGGG Reverse TTCGGCGTTAGTGGCCGAGC TGFbR1 Forward ACGCGCTGACATCTATGCAA Reverse CGTCGAGCAATTTCCCAGAA TGFbR2 Forward GCGCATCGCCAGCACGATCC Reverse TGGGCTTCCATTTCCACATCCGA CXCR1 Forward TCCTCCTGCCGCTGCTCACT Reverse CATGCGCAGTGTGAGCCCGT CXCR2 Forward CCTCGTGCCGCTGCTCATCA Reverse GGTGCGCAGTGTGAACCCGT CXCR3 Forward GGTCGCACTGCTCTGCGTGT Reverse GGGGCAGCAGGAAACCAGCC CXCR4 Forward GAGGCGTTTGGTGCTCCGGT Reverse TCGGTTCCATGGCAACACTCGC VEGFR1 (Flt1) Forward CGCGTGAAGAGTGGGTCCT Reverse CACATGCACGGAGGTGTTG VEGFR2 (Flk1) Forward AGCCCAGACTGTGTCCCGCA Reverse GGTGTCCGCGGAATCGGGTC VEGFR3 (Flt4) Forward GCCCGAGGACGAGGGTGACT Reverse CCTGGCTGCGCCTATCCTGC human Flt1 Forward GCACGTCAGCGAAGGCAAGC Reverse CCAGCTCAGCGTGGTCGTAGG Supplementary Table 2. List of putative miR-200 target genes amplified in human cancers amplified in cancers (Tumorscape)a Gene Symbol Title various cancers NSCLC PCT Errfi1 ERBB receptor feedback inhibitor 1 - yes 0.94 D11Bwg0517e DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed - yes 0.91 Pvrl4 poliovirus receptor-related 4 yes - 0.91 Mecp2 methyl CpG binding protein 2 yes yes 0.9 Jun Jun oncogene yes - 0.88 Prdm16 PR domain containing 16 - yes 0.88 Flt1 FMS-like tyrosine kinase 1 yes
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 0.5) in Stat3∆/∆ Compared with Stat3flox/Flox
    Supplemental Table 2 Genes down-regulated (<0.5) in Stat3∆/∆ compared with Stat3flox/flox Probe ID Gene Symbol Gene Description Entrez gene ID 1460599_at Ermp1 endoplasmic reticulum metallopeptidase 1 226090 1460463_at H60c histocompatibility 60c 670558 1460431_at Gcnt1 glucosaminyl (N-acetyl) transferase 1, core 2 14537 1459979_x_at Zfp68 zinc finger protein 68 24135 1459747_at --- --- --- 1459608_at --- --- --- 1459168_at --- --- --- 1458718_at --- --- --- 1458618_at --- --- --- 1458466_at Ctsa cathepsin A 19025 1458345_s_at Colec11 collectin sub-family member 11 71693 1458046_at --- --- --- 1457769_at H60a histocompatibility 60a 15101 1457680_a_at Tmem69 transmembrane protein 69 230657 1457644_s_at Cxcl1 chemokine (C-X-C motif) ligand 1 14825 1457639_at Atp6v1h ATPase, H+ transporting, lysosomal V1 subunit H 108664 1457260_at 5730409E04Rik RIKEN cDNA 5730409E04Rik gene 230757 1457070_at --- --- --- 1456893_at --- --- --- 1456823_at Gm70 predicted gene 70 210762 1456671_at Tbrg3 transforming growth factor beta regulated gene 3 21378 1456211_at Nlrp10 NLR family, pyrin domain containing 10 244202 1455881_at Ier5l immediate early response 5-like 72500 1455576_at Rinl Ras and Rab interactor-like 320435 1455304_at Unc13c unc-13 homolog C (C. elegans) 208898 1455241_at BC037703 cDNA sequence BC037703 242125 1454866_s_at Clic6 chloride intracellular channel 6 209195 1453906_at Med13l mediator complex subunit 13-like 76199 1453522_at 6530401N04Rik RIKEN cDNA 6530401N04 gene 328092 1453354_at Gm11602 predicted gene 11602 100380944 1453234_at
    [Show full text]