Streptococcus Pneumoniae

Interactions phage-hôte chez Streptococcus pneumoniae

Thèse

SIHAM OUENNANE

Doctorat en microbiologie Philosophiae doctor (Ph. D.)

Québec, Canada

©Siham Ouennane, 2017

Interactions phage-hôte chez Streptococcus pneumoniae

Thèse

SIHAM OUENNANE

Sous la direction de :

Sylvain Moineau, directeur de recherche

RÉSUMÉ

Streptococcus pneumoniae est une bactérie à la fois commensale et pathogène opportuniste chez l’humain. Elle est responsable de nombreuses infections telles que la pneumonie, la méningite, l’otite moyenne et la sinusite. En maladie infectieuse, S. pneumoniae occupe une place importante en tant que l’une des principales causes de morbidité et de mortalité dans le monde. Elle est dotée de plusieurs capacités fascinantes, comme la compétence naturelle pour l’aider à résister aux antibiotiques et la grande diversité des sérotypes capsulaires pour contourner la vaccination. Puisque la résistance aux antibiotiques ne cesse de menacer l’efficacité des thérapies standards, la thérapie par phage est maintenant reconsidérée comme une des alternatives thérapeutiques. La réévaluation des phages fait renaitre l’espoir thérapeutique, mais sans élucider leur mécanisme d’interaction et décortiquer leur mystère cet espoir restera modeste.

Ce projet de doctorat consiste à mieux comprendre les phages infectant S. pneumoniae et les interactions phage-hôte. Dans un premier temps, le potentiel des pneumophages à infecter Streptococcus mitis, une espèce phylogénétiquement proche de S. pneumoniae, a été mis en évidence. Deux pneumophages se sont avérés les premiers phages virulents capables d’infecter S. mitis, bactérie pathogène responsable d’endocardite. Les deux phages pouvaient non seulement se répliquer dans S. mitis mais également produisent des plages de lyses plus visibles. Ensuite, la comparaison du génome des phages a confirmé que le changement de l’hôte n’induit aucune variation aux génomes des phages testés. Cependant, plusieurs mutations ont été observées dans la séquence génomique du podophage sauvage et il a fait ensuite l’objet d’une nouvelle annotation. Dans un deuxième temps, l’étude des interactions phage-hôte chez S. pneumoniae a été approfondie. Pour ce faire, l’implication de plusieurs facteurs de l’hôte dans la réplication des pneumophages a été étudiée. Plusieurs gènes pneumococciques se sont avérés nécessaires ou impliqués pour assurer l'efficacité de la réplication des phages seuls ou en cocktail. D’un autre côté, en étudiant ces facteurs de l’hôte, des gènes/ protéines potentiellement essentiels à la viabilité de S. pneumoniae ont été identifiés.

iii

Cette étude a aussi permis d’identifier de nouvelles cibles thérapeutiques et donne un nouvel aperçu du réseau complexe des interactions phage-hôte.

ABSTRACT

Streptococcus pneumoniae is a commensal and opportunistic pathogen bacterium, exclusively found in humans. It is the main agent of many infections such as pneumonia, meningitis, otitis media and sinusitis. S. pneumoniae infections are a major cause of morbidity and mortality worldwide. S. pneumoniae has several fascinating abilities, such as natural competence to facilitate the acquisition of antibiotic resistance genes and diversity of capsular serotypes to circumvent the vaccination. The rise of antibiotic resistant bacteria continues to threaten the effectiveness of standard therapies and as such phage therapy is now reconsidered as a therapeutic alternative. The reevaluation of phages as therapeutic agents must go through a better understanding of phage-bacterium interactions.

This PhD thesis aims to better understand S. pneumoniae virulent phages and phage- host interactions. First, the ability of pneumophages to infect Streptococcus mitis, a species phylogenetically related to S. pneumoniae, was demonstrated. The pneumophages are the first two virulent phages able to infect this pathogenic bacterium, the common cause of bacterial endocarditis. Both pneumophages could not only replicate in S. mitis but also produced more visible plaques on this host. The comparison of the genomes of each phage grown on both hosts produced identical nucleotide sequences, confirming that S. mitis as a host does not induce any nucleotide variation. However, the genomic sequence of wild-type podophage was different than the previously reported sequence and it was the subject of a new annotation. In addition, S. pneumoniae phage-host interactions were investigated. The involvement of several host factors in replication of both pneumophages was observed. Indeed, several pneumococcal genes were found to be necessary or involved to ensure efficient phage replication. Moreover, the study of these host factors has led to the identification of new genes that appear to be essential for viability and normal growth of S. pneumoniae.

This project led to identify new potential therapeutic targets and provided new insight into the complex network of phage-host interactions.

Table des matières

RÉSUMÉ ...... iii ABSTRACT ...... v Table des matières ...... vii Liste des tableaux ...... xi Liste des figures ...... xii Liste des abréviations ...... xiii Remerciements ...... xv Chapitre I. Introduction ...... 1 Avant-propos ...... 1 Streptococcus pneumoniae ...... 1 Présentation ...... 1 Mécanisme de la transformation naturelle ...... 3 Croissance et division cellulaire ...... 6 Physiopathologie des infections à S. pneumoniae ...... 12 Données épidémiologiques ...... 12 Mécanismes de la colonisation de l’hôte ...... 14 Processus d’infection et infections associées ...... 18 Facteurs de virulence ...... 19 Capsule polysaccharidique ...... 20 Pneumolysine ...... 22 Protéines de surface ...... 22 Traitements antipneumococciques ...... 25 Traitements préventifs ...... 25 Traitement et résistance aux antibiotiques ...... 27 Bactériophages ...... 30 Rappel historique ...... 30 Classification des bactériophages ...... 32 Réplication des bactériophages ...... 34 Phages infectant Streptococcus pneumoniae ...... 36 Problématique, hypothèses et objectifs du projet ...... 41

vii

Chapitre 2. Diverse virulent pneumophages infect Streptococcus mitis ...... 43 Résumé ...... 43 Avant-propos ...... 43 Contributions des auteurs...... 43 Publication ...... 44 Abstract ...... 44 Introduction ...... 44 Materials and Methods ...... 47 Results ...... 50 Discussion ...... 58 Acknowledgments ...... 60 References ...... 61 Supporting information ...... 65 Chapitre 3. Identification of host factors involved in the interaction of Streptococcus pneumoniae with its virulent phages ...... 68 Résumé ...... 68 Avant-propos ...... 69 Contributions des auteurs...... 69 Publication ...... 69 Abstract ...... 69 Introduction ...... 70 Results ...... 72 Discussion ...... 88 Materials and Methods ...... 91 Acknowledgements ...... 95 References ...... 98 Supporting Information ...... 102 Chapitre 4: Discussion et perspectives ...... 115 Conclusions ...... 124 Bibliographie ...... 125 Annexe ...... 149 Gagner la guerre contre les bactéries résistantes aux antibiotiques ...... 149

viii

Résumé de la publication ...... 149 Avant-propos ...... 149 Contributions des auteurs...... 149 Publication ...... 149 Abstract ...... 150 Introduction ...... 150 1. Bacteriophage therapy...... 153 Other phage applications in human diseases ...... 157 Phage applications in industries ...... 158 Phage components as antibacterial agents ...... 159 2. Immune modulation therapy ...... 159 3. Antimicrobial peptides ...... 163 4. Probiotics and prebiotics ...... 165 5. Other antimicrobial agents ...... 167 Medicinal Plants ...... 167 Essential oils ...... 168 Conclusions ...... 168 References ...... 169

Liste des tableaux

Table 2.1. Putative Open Reading Frames deduced from SOCP genome sequences and their predicted functions ...... 55 Table S2.1 Primers used in this study to confirm variations within the genome of phage SOCP...... 65 Table S2.2 Primer sequences of four housekeeping genes...... 65 Table S2.3 Differences between the genomes of phage SOCP and Cp-1...... 65 Table S2.4. Codon usage of pneumophages Dp-1 and SOCP for selected amino acids compared to the hosts S. pneumoniae and S. mitis...... 67 Table 3.1 A summary and general function of S. pneumoniae genes and the lytic phages used in this study, based on Y2H screens by Mariano et al...... 75 Table 3.2 Effect of gene inactivation and host-phage interactions of S. pneumoniae ...... 76 Table 3. 3 Bacterial strains, plasmids and phages used in this study ...... 91 Table S3.1 Protein-protein interaction in S. pneumoniae...... 104 Table S3.2 Primers used for gene knockout assays ...... 110 Table S3.3 Primers used for complementation assays ...... 112 Table A. 1 Summary of the bacterial anti-phage mechanisms and strategies used by phage to avoid host resistance...... 155

Liste des figures

Figure 1.1 Morphologie des colonies de diverses souches de S. pneumoniae cultivées sur gélose sang ...... 2 Figure 1.2 Principe de fratricide chez S. pneumoniae ...... 6 Figure 1.3 Représentation schématique de la synthèse de la paroi cellulaire...... 10 Figure 1.4 Interaction entre S. pneumoniae et les cellules épithéliales...... 17 Figure 1.5 Principaux facteurs de virulence de S. pneumoniae...... 20 Figure 2.1 Electron microscopy of virulent phage Dp-1 (A) and phage SOCP (D) ...... 51 Figure 2.2 Genome alignment of phages SOCP and Cp-1 ...... 54 Figure 2. 3 Comparison of the proteome of pneumophage SOCP/ Cp-1 ...... 58 Figure 3. 1 Schematic representation of the genes involved in host-phage interaction...... 73 Figure 3. 2 Efficiency of plating of two pneumococcal virulent phages on various knockouts in S. pneumoniae ...... 82 Figure 3. 3 Efficiency of plating of two pneumococcal virulent phages on S. pneumoniae strains complemented with wild-type genes ...... 84 Figure 3. 4 Schematic representation of construction of pFF3 plasmid, using TA cloning- like system ...... 94 Figure S3. 1 Map of pLS1RGFP vector showing key features of the plasmid ...... 102 Figure S3. 2 Comparison of the maltose effect on phage infection...... 103 Figure A. 1 Summary of antibiotic target site and resistance mechanisms in Gram-positive and Gram-negative bacteria...... 152 Figure A. 2 Main strategies of applying bacteriophages in phage ...... 154

xii

Liste des abréviations

ADN acide désoxyribonucléique ADNdb acide désoxyribonucléique double brin ADNsb acide désoxyribonucléique simple brin AMPs antimicrobial peptides ARN acide ribonucléique ARNr acide ribonucléique ribosomique ARNt acide ribonucléique de transfert BCWH hydrolases de la paroi bactérienne (bacterial cell wall hydrolases) BHI infusion de cœurs et cervelles (brain heart infusion) BIM mutant bactérien résistant aux bactériophages (bacteriophage insensitive mutant) CAP pneumonie communautaire acquise (community acquired pneumonia) CBPs protéines de liaison à la choline (choline-binding proteins) CRISPR clustered regularly interspaced short palindromic repeats CsCl chlorure de césium CSP peptide de stimulation de la compétence (competence stimulating peptide). EOP efficacité à former des plages de lyse (efficiency of plaquing) GFP green fluorescent protein IgA1 immunoglobuline A1 LytA autolysine majeure mAb anticorps monoclonaux (monoclonal antibodies)

MgSO4 sulfate de magnésium MitC mitomycine C MOI multiplicité d’infection NanA neuraminidase A OD densité optique ORFs cadre de lecture ouvert (open reading frame) PAF facteur d'activation plaquettaire PCR réaction en chaîne de la polymérase (polymerase chain reaction) PFU plaque forming units

xiii

PG peptidoglycan PLPs protéines liant la pénicilline PsaA adhésine A de surface du pneumocoque PspA protéine A de surface du pneumocoque RBP protéine de liaison au récepteur (receptor binding protein) TSA trypticase soy agar Y2H yeast 2-hybrid assay

xiv

Remerciements

C’est enfin l’accomplissement de plusieurs années de travail qui ont nécessité une grande volonté et beaucoup d’effort. Sans l’encouragement et le soutien de plusieurs personnes, je n’aurais pas pu voir la fin de cette thèse.

Tout d’abord, je remercie vivement mon directeur de thèse, Prof Sylvain Moineau, de m’avoir accueillie dans son laboratoire et de m’avoir fait découvrir le monde fascinant des bactériophages. Je vous suis infiniment reconnaissante pour votre disponibilité inconditionnelle, vos précieux conseils et votre grande expertise. Votre passion pour les phages et surtout pour les CRISPR m’a beaucoup impressionné et m’a donné de vraies leçons de la vie. J’ai appris grâce à vous qu’aimer ce qu’on fait est un véritable enjeu pour réussir la vie professionnelle. Je vous remercie pour votre simplicité, gentillesse et amabilité. Merci d’avoir était un leader exemplaire qui a toujours su comment rendre la vie d’un grand groupe au laboratoire un meilleur environnement d’échange, d’apprentissage et de brassage culturel.

Un grand merci à tous mes collègues de travail. Merci pour vos conseils et vos explications. Je remercie surtout ma collègue, ma sœur et mon amie Lynn. Merci pour ta présence, tes encouragements et pour les meilleurs moments de bonheur qu’on a partagé et ceux de stress que j’ai pu surmonter. Si simple si gentille et si franche tout simplement Lynn, merci pour tout. Je remercie également Geneviève. Merci pour tes conseils, tes explications et pour vos qualités humaines et professionnelles. Merci également à Denise pour l’ambiance et le sens d’organisation qui règne dans le laboratoire. Merci à mes amis et collègues Alfonso, Hany et Cas pour tous les meilleurs moments qu’on a pu partager.

Il y’a quelque années, je suis arrivée toute seule et me voilà aujourd’hui entourée de beaucoup d’amis. Merci à vous tous, vous avez su rendre mon intégration si facile et plaisante.

Merci à ma chère sœurette Houda et à mon adorable frère Reda. Merci de m’avoir encouragé et soutenu toujours. Merci pour les longues heures au téléphone. Vous avez toujours su me supporter et partager avec moi, même à distance, tous mes grands moments.

Que ce travail soit un témoignage de tous mes sentiments et toute ma gratitude pour le soutien, la compréhension, l’encouragement et la patience dont vous avez fait preuve.

Un grand merci infini à mes chers parents, Maria et Abdellah. C’était difficile d’être si loin de vous et malgré vous étiez toujours présents pour m’écouter et me faire sortir de ma solitude. Merci d’avoir toujours cru en moi, vos encouragements m’ont beaucoup aidé pour finir cette thèse. Merci pour tous les sacrifices, le soutien et l’affection. Sans vous je n’aurais jamais pu surpasser tous les écueils. Puisse ce modeste travail être le témoignage de ma profonde gratitude et mon profond amour.

Un grand Merci à Saleh. Par où commencer, ici t’étais pour moi toute ma famille! Merci d’avoir toujours été là pour moi et de m’avoir soutenu tout au long de cette thèse. Merci pour ton encouragement, ta confiance et ton support moral. Merci d’avoir toujours cru en moi et en mon potentiel. Merci pour ta compréhension et ton sens d’humour. Tu as toujours su me faire rire et me sortir de mes moments de stress et de panique. Merci pour tout.

xvi

Leonardo da Vinci

xvii

xviii

Chapitre I. Introduction

Avant-propos

L’introduction de cette thèse est divisée en plusieurs sections. Les deux premières sections permettent de décrire la bactérie Streptococcus pneumoniae qui fait l’objet de cette étude et traite de son phénotype de résistance aux antibiotiques et de son impact sur la santé publique. La troisième section présente l’histoire des phages, leurs diversités et leurs caractéristiques. Enfin, la dernière section de l’introduction aborde les méthodes alternatives pour le traitement des infections causées par des bactéries pathogènes résistantes aux antibiotiques, présentée sous la forme d’un article de revue en annexe. L’article fait aussi le point sur les différents aspects de la thérapie par phage, les produits de phage et leurs applications dans le domaine médical et agroalimentaire.

Streptococcus pneumoniae

Présentation

Streptococcus pneumoniae est une bactérie de grande importance clinique connue aussi sous le nom de pneumocoque en référence à sa morphologie et à la pneumonie communautaire acquise (PCA) causée principalement par cet agent pathogène. Cette bactérie à Gram-positif appartient à la famille des Streptococcaceae et au genre Streptococcus qui regroupe actuellement 72 espèces, incluant plusieurs bactéries très pathogènes pour l’homme (Richards, et al., 2014). Découverte pour la première fois en 1881 par Leo Escolar, elle a aussi été isolée simultanément par Louis Pasteur et George Miller Sternberg à partir d'échantillons de salive humaine (Watson, et al., 1993). Au fil du temps, cette bactérie a porté plusieurs noms pour mettre en évidence à la fois ses particularités bactériologique et taxonomique, passant de Microbe septicémique de la salive, nom donné par Pasteur, puis Micrococcus pasteuri par Sternberg à Pneumococcus par Albert Fraenkel (1886) (Watson, et al., 1993). Ce pathogène a été renommé

Diplococcus pneumoniae, de 1920 à 1974, avant d’être finalement rebaptisé à son nom actuel, Streptococcus pneumoniae (Watson, et al., 1993).

S. pneumoniae se présente sous forme de coque, de 0,5 à 1,25 micromètre de diamètre, souvent groupé en diplocoque ou en courte chaînette. Cette bactérie ne forme pas de spores et est non-motile malgré la présence de pili (Muschiol, et al., 2015). Le pneumocoque a un métabolisme anaérobie facultatif produisant une hémolyse partielle, de type alpha, due à la lyse des globules rouges, visible par une coloration verdâtre autour des colonies ayant poussé sur une gélose sang. Une hémolyse de type bêta a été aussi observée en conditions d'anaérobie lors d’une incubation à basse température (entre 6 et 22°C) (Lorian & Popoola, 1972). La forme virulente du pneumocoque est entourée d’une capsule polysaccharidique et présente une morphologie coloniale d’aspect lisse sur gélose sang, tandis qu’une souche non capsulée, avirulente, donne des colonies d’aspects rugueux (Belanger, et al., 2004) (Figure 1.1).

Figure 1.1 Morphologie des colonies de diverses souches de S. pneumoniae cultivées sur gélose sang. (A) souche D39; (B) R6; (C) AB2; (D) AB7; (E) AB28; (F) R36A; (G) AB14; (H) AB15. Figure tirée de Bélanger et al. (2004).

Cette bactérie est catalase négative donc elle a recourt à d’autres sources exogènes de catalase, dont celles dans une gélose sang frais, par exemple pour dégrader la grande quantité de peroxyde d'hydrogène produit lors de sa croissance (Ranjan, et al., 2014). Elle se différencie des autres Streptococcus par sa sensibilité à l’optochine, sa lyse par la bile et surtout par la caractérisation de ses antigènes polysaccharidiques capsulaires. S. pneumoniae est incapable d’obtenir l’énergie (ATP) par respiration et opte pour un métabolisme fermentaire homolactique en fermentant les sucres en acide lactique. En effet, le pneumocoque possède de nombreux gènes impliqués dans le métabolisme des sucres et

2 leur transport, ce qui permet le métabolisme d’une large variété de substrats carbonés (Hoskins, et al., 2001).

Mécanisme de la transformation naturelle

S. pneumoniae fait partie des bactéries ayant une capacité inhérente d’incorporer l’ADN exogène par la transformation génétique naturelle. En 1928, Frederick Griffith a démontré pour la première fois le phénomène de la transformation naturelle par transfert de caractères entre deux souches de S. pneumoniae. Ce n’est qu’en 1944 que cette découverte a été valorisée et reprise par Avery, MacLeod et McCarty qui ont montré que c’est l’ADN qui permet le transfert de caractères d’une bactérie à l’autre (Avery, et al., 1944). Leurs travaux ont permis d’identifier le principe de la transformation et de supporter l'hérédité génétique. Cette propriété a fait de cette bactérie un microorganisme modèle pour l’étude de la transformation, de l’acquisition d’ADN de l’environnement et de l’intégration dans son génome par recombinaison homologue. Actuellement, la transformation naturelle a été démontrée chez plus de 80 espèces bactériennes permettant à la cellule receveuse d’acquérir de nouveaux gènes pour mieux s’adapter et persister face aux changements des conditions environnementales (Johnston, et al., 2014). Chez la plupart des bactéries transformables, les protéines impliquées dans la transformation sont directement codées par le génome de la bactérie et ne s’expriment pas de façon permanente mais exigent des conditions spécifiques pour assurer leur expression. En effet, le pneumocoque a la capacité de s’adapter naturellement pour incorporer l’ADN exogène, et ceci lorsque la bactérie est dans un état spécifique nommé état de compétence, ou x-state, obtenue à un moment spécifique de sa phase exponentielle de croissance (Campbell, et al., 1998). L'induction de la compétence génétique est une stratégie utilisée par les bactéries afin d’augmenter leur répertoire génétique sous des conditions de stress (Perry, et al., 2009).

Chez S. pneumoniae, l’état physiologique transitoire est coordonné par un peptide de stimulation de la compétence CSP (Competence Stimulating Peptide). Le CSP est une sorte d’hormone polypeptidique extracellulaire de 17 acides aminés (Johnsborg & Havarstein, 2009). Il est particulièrement important pour initier la compétence et sa présence dans le milieu active la transcription de deux gènes, comX et comW. Il active également 15 autres

3 gènes précoces et 60 autres gènes tardifs impliqués soit dans les mécanismes de la fixation et d’internalisation de l’ADN exogène ou dans le devenir de cet ADN internalisé (Johnsborg & Havarstein, 2009, Piotrowski, et al., 2009). Chez le pneumocoque, il existe six isoformes de ce peptide, mais la majorité des souches produisent soit le CSP-1 ou le CSP-2, qui s’attachent respectivement aux récepteurs ComD-1 et ComD-2 et diffèrent de 12 acides aminés (Allan, et al., 2007, Johnsborg & Havarstein, 2009). Lors de la transformation chez le pneumocoque, la première étape du processus d’entrée est la fixation de l’ADN double brin à la surface des cellules transformables et qui requiert la présence de protéines codées par les gènes tardifs comGs. L’entrée d’un brin et la dégradation simultanée du brin complémentaire se produisent à des vitesses similaires, ~100 nucléotides s-1 à 30°C, et avec des polarités opposées, ce qui est compatible avec un modèle de couplage de la dégradation d’un brin et de l’internalisation de son complément (Mejean & Claverys, 1993, Berge, et al., 2002). Par ailleurs, il a été proposé que la rétraction de pili et la formation de pores par des protéines membranaires puissent avoir un rôle dans la fixation et l’internalisation d’ADN exogène dans la bactérie (Chen & Dubnau, 2004, Laurenceau, et al., 2013). Lee pore d’entrée de l’ADN est composé de deux pseudo-pili apparentés aux systèmes de sécrétion de type IV et ayant une structure homologue à la protéine majeure de piline ComGC (Muschiol, et al., 2015).

En 2005, il a été démontré que la transformation chez S. pneumoniae touche l’ensemble des cellules d’une culture bactérienne et que l’état de compétence induit la lyse de toutes les bactéries non compétentes, de la même espèce ou d’espèces proches, par les pneumocoques compétents, (Gilmore & Haas, 2005, Guiral, et al., 2005), un phénomène nommé au début allolyse puis fratricide (Claverys & Havarstein, 2007) (Figure 1.2).

Le phénomène fratricide implique l’activation d’un système enzymatique dont les cellules compétentes sont immunisées. La plupart des protéines intervenant dans ce phénomène sont codées par des gènes tardifs. Des enzymes lytiques, comme l’autolysine majeure LytA, sont requises pour induire le fratricide chez S. pneumoniae et pour lyser les cellules non compétentes. D’autres enzymes nécessaires incluent LytC codant pour une hydrolase du peptidoglycane dont l’expression est constitutive, CbpD codant pour une amidase et CibAB codant pour une bactériocine (Guiral, et al., 2005). Cependant, les bactéries compétentes

4 sont immunisées contre l’action de ces protéines lytiques par l’expression des protéines d’immunité comme CibC et ComM (Muschiol, et al., 2015).

Ce mécanisme de fratricide joue un rôle important en diminuant la compétition pour les nutriments, augmentant l’efficacité de la transformation et la libération de facteurs de virulence, comme la pneumolysine (Havarstein, et al., 2006). Cela permet de stimuler le système de défense des bactéries et surtout leur permet d’avoir un groupe de gènes communs qui représente une véritable voie pour échapper aux pressions de sélection comme les antibiotiques.

Figure 1.2 Principe de fratricide chez S. pneumoniae. Figure tirée et adaptée de Claverys & Havarstein (2007).

Croissance et division cellulaire

Comme tous les microorganismes, l’accroissement du nombre de cellules est un processus biologique fondamental pour assurer la survie de l’espèce. Chez les bactéries, la croissance implique la division des cellules mères en deux cellules filles. Cette croissance bactérienne est contrôlée par plusieurs mécanismes pour permettre à la fois de choisir le site exact de la

6 division, de dupliquer fidèlement le génome et de partager équitablement l’information génétique entre deux cellules filles. La disponibilité des nutriments dans le milieu et d’autres facteurs physicochimiques comme la température, le pH du milieu et la pression osmotique influencent fortement la division cellulaire (Monahan, et al., 2014).

Plusieurs études ont été déployées pour élucider les mécanismes intervenant au cours de la division bactérienne et pourtant ce processus vital reste encore relativement mal compris. La machinerie de la division bactérienne met en jeu plusieurs processus comme la synthèse du peptidoglycane (PG) septal, les protéines liant la pénicilline (PLPs) et plusieurs hydrolases pour l’autolyse, le clivage de septum de séparation et la séparation des cellules filles (Typas, et al., 2012, Sundararajan, et al., 2015). Durant la division cellulaire, le PG joue un rôle clé pour parvenir à l’augmentation du volume de la cellule, la formation du septum de séparation et la séparation des cellules filles. Ainsi, son intégrité est indispensable pour la survie bactérienne (Pinho, et al., 2013). Du point de vue général, les bactéries sont dotées de mécanismes de croissance différents étroitement liés à leur diversité morphologique pour guider la division bactérienne et la ségrégation des chromosomes (Pinho, et al., 2013). Jusqu’à tout récemment, les travaux pour élucider les mécanismes de la division bactérienne ont été réalisés essentiellement chez deux bacilles: E. coli et B. subtilis (den Blaauwen, et al., 2008). Dans le but d’élargir les connaissances sur les mécanismes sous-jacents de ce processus vital, plusieurs études récentes ont adopté comme modèle la forme la plus simple des bactéries; les coques dont les plus connus sont S. pneumoniae (ovocoque) et Staphylococcus aureus (bactérie sphérique) et ayant deux modes distincts de synthèse du PG (Pinho, et al., 2013).

Le PG est un composant majeur de la paroi bactérienne qui maintient la forme cellulaire et assure une protection mécanique contre la pression osmotique. D’autre part, son intégrité est cruciale pour la survie de la bactérie afin d’empêcher la lyse cellulaire. D’ailleurs, l’inhibition de la synthèse de la paroi bactérienne est la cible vitale des antibiotiques de la famille des β-lactamines. Toutefois, l’usage excessif des antibiotiques de cette famille dans le traitement des infections à pneumocoque a grandement favorisé l’émergence des souches de S. pneumoniae résistantes et multi-résistantes aux β-lactamines, comme on le verra plus loin dans cette présentation bibliographique. Une stratégie pour faire face au problème de la

7 résistance de S. pneumoniae aux β-lactamines consiste à étudier et à combler le manque de connaissances reliées à la composition et au mécanisme de remodelage du PG ainsi qu’au processus de la division cellulaire.

Le pneumocoque adopte à la fois deux modèles de synthèse du PG; périphérique (Higgins & Shockman, 1970) et septal (Tomasz, et al., 1964). La synthèse du PG, se déroule en trois étapes qui se produisent à trois endroits différents dans la cellule (Pinho, et al., 2013). D’abord, au niveau du cytoplasme, un ensemble de réactions enzymatiques permet la formation des précurseurs du PG grâce aux protéines de la famille Mur (Pagliero, et al., 2005), puis l’association à un groupement undécaprényl-phosphate au niveau interne de la membrane cytoplasmique pour former le lipide I (MurNAc-pentapeptide) (van Heijenoort, 2001, Pinho, et al., 2013). Après le groupe GlcNAc est ajouté par la protéine MurG pour générer le lipide II qui va être transloqué à travers la membrane (van Heijenoort, 2001). À ce stade, la biosynthèse du PG implique deux types d’activités pour polymériser l’unité monomère du PG: les glycosyltransférases (GTases) pour polymériser les chaînes glycanes et les DD-transpeptidases (dd-TPases) pour réticuler les peptides (Typas, et al., 2012). Ces deux réactions enzymatiques sont résidentes sur les domaines extracellulaires des PLPs, qui sont des molécules associées à la membrane (Pagliero, et al., 2005).

Les PLPs sont associées à la membrane et participent aux étapes finales de synthèse du PG. Le nombre de PLP varie considérablement chez les bactéries. Les bacilles en ont habituellement un grand nombre comme E. coli et B. subtilis ayant respectivement 12 et 16 PLPs. Elles sont moins nombreuses chez les coques, souvent entre quatre et sept (Zapun, et al., 2008). Les protéines PLPs sont fréquemment divisées en deux catégories: PLPs de haute masse moléculaire (HMM) et PLPs de faible masse moléculaire (FMM) (Goffin & Ghuysen, 1998). S. pneumoniae possède six PLPs dont cinq PLPs de HMM, regroupées en deux classes A et B, et une PLP de FMM. Les PLPs de classe A comprennent les protéines PLP1a, PLP1b et PLP2a qui sont bifonctionnelles ayant à la fois une activité GTase pour la synthèse des brins glycanes et une activité dd-TPase pour la réticulation du peptidoglycane. Les protéines PLP2b et PLP2x font partie de la classe B et sont monofonctionnelles ayant seulement une activité dd-TPase (Typas, et al., 2012, Pinho, et al., 2013). PLP3 est une protéine de FMM et a une activité carboxypeptidase. Chez d’autres bactéries, les protéines

8 de cette catégorie peuvent avoir une activité endopeptidase (Zapun, et al., 2008, Pinho, et al., 2013). La plupart des PLPs du pneumocoque ont des fonctions redondantes ce qui a rendu difficile d'assigner une fonction spécifique à chaque PLP (Zapun, et al., 2008).

Chez S. pneumoniae, l’utilisation de nouveaux outils comme le marquage avec la vancomycine fluorescente a démontré que la synthèse du PG survient au milieu de la cellule, nommé site de division, entre les anneaux équatoriaux (Daniel & Errington, 2003, Ng, et al., 2004, Zapun, et al., 2008). D’autre part, chez les ovocoques, la synthèse du PG périphérique et du septum de séparation se produisent lors de la division cellulaire (Pinho, et al., 2013). La synthèse du PG périphérique est catalysée par la protéine PLP2b qui se produit près du site de la division, conduisant à l’insertion du PG entre ce site et les futurs sites de division, anneaux équatoriaux, et provoquant une légère élongation longitudinale (Pinho, et al., 2013). De même, les protéines PLP1a et PLP2x catalysent la synthèse du septum de séparation qui conduit à la formation du septum perpendiculairement à l’axe longitudinal (Pinho, et al., 2013). Les gènes PLP2x et PLP2b sont essentiels pour S. pneumoniae et font partie du groupe de gènes dcw (division and cell wall) qui est un complexe multienzymatique codant pour des protéines impliquées dans la biosynthèse de la paroi cellulaire et la division cellulaire (Massidda, et al., 1998).

D’autres PLPs, comme PLP1b, PLP2a et PLP3, sont également impliquées dans l’insertion et la synthèse du néo-PG, cependant leurs rôles exacts restent inconnus (Pinho, et al., 2013). De même, le mode de recrutement des PLPs sur le site de la division n’est pas clair. Cependant, uniquement l’implication de la reconnaissance du substrat dans la localisation des PLPs de HMM a été observée (Pinho, et al., 2013). De plus, la protéine PLP3 est répartie uniformément dans les deux hémisphères du pneumocoque et semble être absente au futur site de division pendant les étapes initiales de la division pour permettre d’enrichir cette zone en substrats des PLPs. Une fois la croissance et la division en cours, PLP3 semble être plus concentrée au niveau du site de division cellulaire pour réguler le degré de réticulation du PG mature en inhibant toute réaction de trans-peptidation (Morlot, et al., 2004) (Figure 1.3).

La division cellulaire nécessite une identification précise du site de division et de placement de la machinerie de la division. La protéine FtsZ, en référence à la filamentation

9 thermosensible, est une protéine responsable de l’organisation du complexe de septation du PG et aussi la première protéine recrutée dans la formation du futur site de division, où elle polymérise pour former un anneau cytoplasmique (Pinho, et al., 2013, Fleurie, et al., 2014). Son positionnement est guidé par la protéine MapZ (Fleurie, et al., 2014). Également, MreB est une protéine essentielle pour la bactérie et homologue à la protéine d'actine intervenant dans l’organisation des protéines de la synthèse du PG ainsi que dans la voie de biosynthèse du PG, induisant ainsi un allongement préseptal chez les bacilles (Typas, et al., 2012).

Figure 1.3 Représentation schématique de la synthèse de la paroi cellulaire (PG septal et PG périphérique) chez les ovocoques (ex. S. pneumoniae). Figure tirée et adaptée de Pinho et al. (2013).

Toutefois, l’absence de la protéine MreB chez la plupart des ovocoques remet en question les mécanismes qui orchestrent la synthèse périphérique. Il est suggéré que FtsZ coordonne

10 et organise non seulement la synthèse du peptidoglycane septal, mais aussi la synthèse du peptidoglycane périphérique (Typas, et al., 2012). Certains chercheurs suggèrent aussi que chez les ovocoques, la protéine FtsZ agit comme un échafaudage topologique pour les PLPs impliquées à la fois dans la synthèse du PG septal et du PG périphérique (Pinho, et al., 2013). D’autres travaux ont montré que la protéine StkP, du type sérine-thréonine kinase, a un rôle clé dans la coordination et le contrôle de la synthèse du PG septale et périphérique de la paroi cellulaire et cette protéine pourrait fonctionnellement remplacer la protéine MreB (Beilharz, et al., 2012). L'analyse génomique de l’organisation des gènes du dcw chez S. pneumoniae a permis l'identification d'une région en aval des gènes FtsA et FtsZ, regroupant des gènes encore non caractérisés et des gènes codant pour des homologues de YlmG, YlmF/SepF et DivIVA qui sont généralement impliqués dans la ségrégation des chromosomes, la morphologie cellulaire et/ou la division cellulaire chez diverses espèces (Fadda, et al., 2007, Massidda, et al., 2013).

La séparation des cellules filles lors de la division de cellules bactériennes nécessite le clivage du PG septal. Chez les bactéries, plusieurs hydrolases du PG sont impliquées dans ce processus (Typas, et al., 2012). Les hydrolases ne sont pas essentielles pour la survie de la bactérie, mais importantes pour maintenir la morphologie de la cellule (Sun, et al., 2000). Chez S. pneumoniae, de nombreuses hydrolases ont été mises en évidence, mais le mécanisme moléculaire sous-jacent de ce processus fondamental reste encore mal compris (Bartual, et al., 2014). Chez le pneumocoque, les hydrolases LytA, LytB, LytC, PcsB et CbpD sont responsables du clivage du PG septal pour séparer les cellules (Bartual, et al., 2014). PcsB semble responsable de l’hydrolyse de la partie peptidique du peptidoglycane. D’ailleurs PcsB est essentiel pour la viabilité de S. pneumoniae et est considéré comme un des principaux candidats pour une nouvelle génération de vaccins contre le pneumocoque (Bartual, et al., 2014). Pmp23 catalyse l’hydrolyse des chaines glycanes et pourrait initier la synthèse septale en permettant le recrutement des PLPs (Barendt, et al., 2011). Les deux protéines Pmp23 et DacA semblent affecter la division cellulaire du pneumocoque et la forme des cellules (Barendt, et al., 2011).

Au cours des dernières années, des progrès considérables ont été réalisés, mais on est encore loin de la compréhension globale du mécanisme de synthèse du peptidoglycane et de son contrôle malgré que les coques soient la forme bactérienne la plus simple. De plus, le rôle exact de la plupart des acteurs fonctionnels impliqués dans ce processus reste encore mal compris. Aussi, il n’est pas clair comment ils sont connectés entre eux pour avoir une telle concordance spatiale et temporale. Une meilleure compréhension de la croissance et de la division permettra sans doute d’avoir de nouvelles cibles thérapeutiques pour le développement de nouveaux antimicrobiens.

Physiopathologie des infections à S. pneumoniae

Données épidémiologiques

S. pneumoniae colonise de façon asymptomatique les muqueuses des voies respiratoires supérieures de l’homme principalement au niveau du nasopharynx (Chao, et al., 2014). Ainsi, cette bactérie est reconnue comme étant à la fois commensale et pathogène opportuniste exclusivement chez l’humain. Jusqu’à nos jours, l’infection par S. pneumoniae représente encore un problème de santé publique majeur dans les pays développés et en voie de développement. Les infections par S. pneumoniae sont toujours l’une des principales causes de morbidité et de mortalité dans le monde, chez les enfants et les adultes avec une prédominance aux âges extrêmes. Le pneumocoque fait partie de la flore normale des voies nasales ou du pharynx de plus d'un tiers de la population et se transmet de personne à personne via les aérosols ou par le contact direct (Bedos, et al., 1999). Chez les enfants, S. pneumoniae colonise le nasopharynx au cours des premières années de la vie (Syrjänen, et al., 2001). En effet, le taux de colonisation augmente de la naissance jusqu’à ce qu’il culmine vers l’âge de deux à trois ans et puis il baisse avec l’âge (Donkor, 2013). Cependant, le taux de colonisation de S. pneumoniae est très élevé chez les enfants en comparaison avec les adultes, entre 20 à 50 % chez les enfants avec un maximum de colonisation vers l’âge de deux à trois ans et de 5 à 20% chez les adultes (Chao, et al., 2014). Le taux est encore plus élevé dans les pays en développement où presque 90% des

12 enfants et plus de la moitié des adules sont porteurs de la bactérie, et il est favorisé par le froid avec un niveau élevé durant la période de janvier à mars (Donkor, 2013, Chao, et al., 2014) (Figure 1.4).

Le pneumocoque est responsable de nombreuses infections telles que la pneumonie, la méningite, l’otite moyenne et la sinusite. Chaque année, environ un million de nouveaux cas d’infection par S. pneumoniae sont enregistrés partout dans le monde (Donkor, 2013). Chez les enfants, l’infection par le pneumocoque est considérée comme la deuxième cause de méningite bactérienne et d’otite moyenne après l’infection par Haemophilus influenzae (AlonsoDeVelasco, et al., 1995). Selon les données de l’Organisation mondiale de la Santé pour l’année 2015, la pneumonie est la cause du décès de 15% d’enfants de moins de 5 ans représentant ainsi 922 000 décès; dont environ 476 000 décès causés par la pneumonie due à S. pneumoniae (http://www.who.int/en). Chez les adultes, les données épidémiologiques ont montré que l’infection par S. pneumoniae est la deuxième cause de méningite bactérienne derrière Neisseria meningitidis et aussi la cause principale de la pneumonie communautaire acquise (CAP) avec 2 858 000 cas de pneumonie graves en 2011 (AlonsoDeVelasco, et al., 1995, Walker, et al., 2013).

Au Canada, le taux d’incidence générale des infections invasives à pneumocoque est plus élevé en hiver mais aussi au printemps, ce taux est d’environ 9,7 cas pour 100 000 habitants durant la période de 2008 à 2012, affectant principalement les jeunes enfants âgés de moins de cinq ans et les personnes âgées de 65 ans et plus (Agence de la santé publique du Canada, 2012). En 2014, ce taux a diminué à 8,9 cas par 100 000 habitants avec 16,9 cas pour 100 000 chez les nourrissons d’un an et moins, 11,0 cas pour 100 000 chez les enfants de 1 à 4 ans et 21,5 cas pour 100 000 chez les personnes âgées de 60 ans et plus (Agence de la santé publique du Canada, 2014).

Les enfants et les personnes âgées sont principalement affectés par des infections pneumococciques sévères, mais d’autres personnes sont aussi des cibles vulnérables. En outre, plusieurs facteurs influencent significativement le risque de contracter des infections à S. pneumoniae; comme l’alcoolisme, l’exposition à la fumée de cigarette, la drépanocytose, le diabète, l’infection par le virus de l’immunodéficience humaine, une maladie rénale ou cardiaque, une maladie hépatique y compris la cirrhose du foie, une

13 maladie pulmonaire (l’asthme, l’emphysème et la bronchite chronique) et aussi en cas d’un cancer ou une immunosuppression due à la maladie ou l'usage de médicaments comme les cortistéroïdes (Talbot, et al., 2005).

En raison du rôle clé de la colonisation du nasopharynx dans les maladies à pneumocoques et la propagation du pneumocoque au site d’infection, il est important de comprendre les différents éléments de cette colonisation et d’élucider les facteurs qui favorisent le passage d’un agent commensal à un agent pathogène capable d’induire des maladies sévères.

Mécanismes de la colonisation de l’hôte

La composition de la microflore du nasopharynx peut soutenir ou entraver la colonisation et l'invasion par symbiose ou par compétition de plusieurs espèces. On estime qu’environ 700 espèces diverses qui partagent cette niche écologique; comme Haemophilus influenzae, Moraxella catarrhalis, Staphylococcus aureus, Neisseria meningitidis et plusieurs espèces du genre Streptococcus, tel que S. mutans, S. gordonii, S. pyogenes, S. salivarius, S. pneumoniae, S. oralis et S. mitis (Donkor, 2013, Adegbola, et al., 2014). S. pneumoniae colonise les surfaces muqueuses du rhinopharynx et des voies respiratoires supérieures de l’homme et est un constituant normal de cette niche écologique dont la colonisation est asymptomatique. Cette spécificité d’hôte strict n’est pas encore claire, mais de nombreux facteurs bactériens et interactions hôte-pathogène assurent cette colonisation et jouent un rôle dans le développement des pathologies invasives et non invasives. Le mécanisme sous-jacent d’adhésion aux cellules de l'épithélium du nasopharynx ou d'autres cellules eucaryotes implique des interactions de type bactérie-bactérie et bactérie-hôte.

L'adhésion aux cellules épithéliales peut-être facilitée par des pili, qui sont attachés à la paroi de la cellule bactérienne et ils sont généralement codés par un ensemble de gènes groupés en îlots de pathogénicité (Zahner, et al., 2011). La découverte des ilots de pathogénicité dans le génome de S. pneumoniae (Brown, et al., 2001) a permis par la suite la découverte de gènes indispensables pour la synthèse des pili. Ces gènes sont contenus dans deux types d’ilots de pili différents, ilot PI-1 et ilot PI-2 (Barocchi, et al., 2006, Bagnoli, et al., 2008). PI-1 comprend sept gènes dont trois gènes (SrtC-1, SrtC-2 et SrtC-3) codent pour des sortases, plus trois gènes

14 qui codent pour des protéines structurales (RrgA, RrgB et RrgC) et un régulateur positif rlrA (Barocchi, et al., 2006). PI-2 code pour un deuxième pilus fonctionnel composé de deux gènes codant pour des protéines structurales pitA, pitB et les deux gènes srtG1 et srtG2 codant pour des sortases (Bagnoli, et al., 2008). L’analyse globale d’une collection d’isolats de S. pneumoniae a montré que PI-1 est présent dans 30% des souches notamment chez S. pneumoniae TIGR4, souche encapsulée et pathogène, et dans 50% des souches résistantes aux antibiotiques, alors que PI-2 est présent dans environ 16% des souches mais il est absent chez la souche S. pneumoniae TIGR4 (Bagnoli, et al., 2008). La présence de pili améliore la capacité des pneumocoques à adhérer aux cellules épithéliales et elle pourrait induire une exacerbation de la virulence comme rapportée dans le cas de pili de type PI-1 (Barocchi, et al., 2006).

S. pneumoniae produit plusieurs protéines de surface ayant probablement un rôle important dans la colonisation, la dissémination et l’invasion de l’hôte. En revanche, on sait peu de choses sur les adhésines bactériennes qui peuvent se comporter comme des facteurs stimulant la colonisation et/ou la virulence (Figure 1.4). Le pneumocoque adhère à des cellules différentes chez l’hôte selon le stade d’infection, et ce par divers mécanismes d’adhésion qui restent encore mal compris. Cependant, l’adhésion au nasopharynx est l’un des mécanismes les mieux élucidés. L’attachement du pneumocoque aux cellules épithéliales est médié par des récepteurs disaccharidiques retrouvés sur la fibronectine, qui est la matrice extracellulaire présente sur les cellules épithéliales pharyngées (Berry, et al., 1999). La colonisation asymptomatique nécessite l’adhésion du pneumocoque à la muqueuse épithéliale des voies respiratoires par des protéines de surface bactérienne comme les adhésines PsaA et CbpA ou par des enzymes de clivages comme les neuraminidases (Bogaert, et al., 2004). L’adhésine de surface PsaA est une lipoprotéine qui assure l’adhérence du pneumocoque aux cellules du nasopharynx par le biais d’une interaction avec la E-cadhérine et intervient aussi dans le transport du manganèse et du zinc (Hammerschmidt, 2006). Une fonction directe dans l’adhésion du pneumocoque est attribuée à l’adhésine majeure multifonctionnelle CbpA (aussi appelée PspC) dont le récepteur est un polymère d’immunoglobuline (plgR) et les acides sialiques, ce qui accroît la migration de la bactérie à travers la barrière muqueuse (Hammerschmidt, 2006).

L’acide sialique est un des hydrates de carbone importants pour le pneumocoque en raison de son rôle comme source de carbone et d'énergie (Gualdi, et al., 2012). Chez l’homme, cet acide sialique est l’acide N-acétylneuraminique utilisé par le pneumocoque comme récepteur pour l’adhésion nasopharyngée (Gualdi, et al., 2012). L’exposition de ces récepteurs nécessite

15 l’intervention des neuraminidases du pneumocoque pour cliver l’acide sialique. Cette bactérie a deux neuraminidases communes à tous les pneumocoques, NanA et NanB, permettant de révéler les récepteurs de surface pour l’adhésion (Fillon, et al., 2006). Ces deux enzymes possèdent des propriétés physicochimiques différentes permettant au pneumocoque de persister à des pH différents (Berry, et al., 1996). Ces enzymes participent aussi lors de l’invasion de l’hôte en raison de la présence de l’acide sialique à plusieurs endroits dont les muqueuses et fluides du corps comme les poumons et surtout le cerveau qui présente la plus grande concentration d’acide sialique dans le corps humain (Uchiyama, et al., 2009). L’acide sialique se caractérise aussi par sa capacité d’agir comme un signal moléculaire dans le cas d’infection invasive à S. pneumoniae, entrainant une augmentation de transport et la translocation du pneumocoque dans les poumons (Gualdi, et al., 2012).

Éventuellement, des facteurs de l'hôte sont aussi des éléments clés qui interviennent dans l'interaction des bactéries avec les cellules humaines en facilitant et en augmentant l'adhésion aux cellules (Mushtaq, et al., 2011). Ainsi, il a été démontré que le récepteur du facteur d'activation plaquettaire (PAF) est un ligand permettant l'adhésion des pneumocoques aux cellules endothéliales vasculaires et épithéliales pulmonaires humaines (Iovino, et al., 2013). PAF est aussi un puissant médiateur pro-inflammatoire ayant un rôle important en immunité innée (Iovino, et al., 2013). Un récepteur PAF reconnait des motifs moléculaires associés à des pathogènes et procure un système de reconnaissance inné à la phosphocholine exprimée à surface du pneumocoque et des pathogènes respiratoires bactériens à Gram-positif (Fillon, et al., 2006, Iovino, et al., 2013).

Figure 1.4 Interaction entre S. pneumoniae et les cellules épithéliales. Figure tirée et adaptée de Bogaert et al. 2004.

Malgré que la paroi bactérienne est pro-inflammatoire dans certaines circonstances, la liaison du récepteur PAF à la paroi bactérienne est silencieuse et n’induit pas de réponse des cellules endothéliales et des neurones (Fillon, et al., 2006).

L’attachement de la bactérie aux cellules épithéliales de l’hôte nécessite un rapprochement et un contact physique dont les mécanismes sont encore peu connus. L’adhésion du pneumocoque aux cellules épithéliales pulmonaires est augmentée en présence de l’immunoglobuline A1 (IgA1) (Bogaert, et al., 2004). Le pneumocoque synthétise une protéase IgA1 qui clive les IgA1 sécrétoires ce qui se traduit par une variation de la charge de la surface de la bactérie et un grand rapprochement physique de la protéine de liaison à la choline (CbpA) du pneumocoque et le récepteur PAF (Weiser, et al., 2003, Bogaert, et al., 2004). De même, le clivage des IgA1 permet à la bactérie de persister et d’échapper à l'opsonisation par le complément et la phagocytose par les leucocytes.

Les interactions virus-bactérie ont un impact important sur l’évolution des infections. En effet, les co-infections des voies respiratoires par les virus respiratoires permettent de promouvoir l’adhérence, la croissance et la virulence des bactéries par divers mécanismes

(Brealey, et al., 2015). Par exemple, l’infection par le virus de la grippe augmente la surface d’adhésion du pneumocoque aux cellules épithéliales en exposant plus de récepteurs pour le pneumocoque, grâce à l’action de la neuraminidase virale (Plotkowski, et al., 1986). De même, le virus respiratoire syncitial agit comme médiateur qui facilite l’adhésion entre le pneumocoque et les cellules épithéliales par un pont liant la glycoprotéine G du virus et la protéine PLP1a de S. pneumoniae (Smith, et al., 2014).

Processus d’infection et infections associées

La propagation du pneumocoque à partir du nasopharynx peut conduire à des infections locales telles que la sinusite ou l'otite moyenne. L'aspiration du pneumocoque peut entraîner une propagation directe dans les poumons, entraînant la pneumonie. La forme la plus commune des pneumonies bactériennes est celle de la pneumonie à S. pneumoniae qui représente la cause majeure de la pneumonie acquise en communauté (PAC). Il existe deux types de pneumonie; bronchique et lobaire selon la zone du poumon atteinte (Donkor, 2013). Au début de l’infection, S. pneumoniae se loge au niveau des alvéoles pulmonaires et sa multiplication à ce site induit une réaction inflammatoire qui se traduit par un remplissage de pus et mucus empêchant le fonctionnement normal des alvéoles, soit la distribution efficace de l’oxygène dans le sang (Kadioglu, et al., 2008, Donkor, 2013). L’emphysème pleural est une complication qui survient chez 5% des cas atteints de PAC (Fernandez-Cotarelo, et al., 2007). Le pneumocoque peut également se propager via le sang pour atteindre le cerveau, provoquant la méningite à pneumocoques qui est responsable d’un taux de mortalité très élevé d’environ 20% à 50% (Bogaert, et al., 2004). La méningite est généralement causée par des bactéries qui passent de la circulation sanguine au cerveau et ce à travers la barrière hémato-encéphalique (Mook-Kanamori, et al., 2011). La translocation du pneumocoque à travers cette barrière est facilitée par l’enzyme NanA qui favorise l’invasion des cellules endothéliales du cerveau. La pneumolysine et la protéine CbpA sont aussi importantes pour le développement de la méningite (Iovino, et al., 2016). La péritonite, l'arthrite et l'ostéomyélite sont des manifestations rares de la maladie à pneumocoque (Donkor, 2013). Chez les personnes âgées, la PAC est souvent accompagnée d’un risque de myocardite qui est une inflammation du cœur (Brown, et al., 2014). Dans ce

18 cas, le pneumocoque atteint le myocarde et forme des microlésions qui perturbent la fonction cardiaque induisant ainsi une insuffisance et une arythmie cardiaque (Brown, et al., 2014).

Facteurs de virulence

La connaissance des facteurs de virulence et de leur mode d’action représente une voie prometteuse dans la compréhension, la prévention et l’élaboration de traitements efficaces des infections à S. pneumoniae. Pendant plusieurs années, le pouvoir pathogène du pneumocoque a été attribué en grande partie à la capsule polysaccharidique qui s'oppose à la phagocytose et à un petit nombre de facteurs de virulence. Avec l’avancement des recherches et le séquençage du génome de S. pneumoniae R6 et TIGR4 en 2001, de nombreux autres facteurs de virulence ont été mis en évidence et la liste est probablement loin d’être terminée (Hoskins, et al., 2001, Tettelin, et al., 2001). En outre, environ 387 gènes sont impliqués dans la virulence du pneumocoque et exprimés de façon coordonnée pour contribuer à la colonisation, l’échappement à la phagocytose, l'invasion et la destruction des tissus de l’hôte (Hava & Camilli, 2002). Les facteurs de virulence du pneumocoque peuvent être classés en trois groupes: capsule, toxines, et protéines de surface (Figure 1.5). Dans cette section, seulement les principaux facteurs de chaque groupe seront détaillés.

Figure 1.5 Principaux facteurs de virulence de S. pneumoniae. Figure tirée et adaptée de van der Poll et al. 2009.

Capsule polysaccharidique

La capsule de nature polysaccharidique est probablement le facteur de virulence le plus important du pneumocoque. Elle forme une couche protectrice antiphagocytaire qui entoure et couvre diverses protéines de surface de S. pneumoniae. La capsule favorise l’échappement de la bactérie au système immunitaire et son expression réduit le piégeage par le mucus favorisant ainsi l’accès aux surfaces des cellules épithéliales (Kadioglu, et al., 2008). Cependant, la capsule induit une réaction immunogène qui reste gravée dans la mémoire de l’hôte et le protège contre toute attaque future par un pneumocoque portant le même antigène polysaccharidique capsulaire. Pour pallier cette reconnaissance immune, le locus codant pour la capsule du S. pneumoniae a subi plusieurs variations et ce en intégrant

20 un grand nombre de gènes codant pour diverses capsules par l’acquisition d'ADN étranger (Wen, et al., 2016). Actuellement, environ 97 sérotypes capsulaires contribuent à l’importance des infections par S. pneumoniae (Geno, et al., 2015). Cependant, seulement 20 à 30 sérotypes capsulaires du pneumocoque présentent un risque accru de maladies invasives (Geno, et al., 2015).

Une fois que le pneumocoque a atteint la surface de la cellule épithéliale, l'expression d'une capsule épaisse semble être désavantageuse pour la bactérie, en raison de son effet inhibiteur sur l'adhérence (Kadioglu, et al., 2008). En effet, le pneumocoque présente deux aspects de colonies : rugeuses (transparentes non-encapsulées ou faiblement encapsulées) et colonies lisses (opaques et encapsulées) qui sont en relation avec une variation de phase réversible entre les deux phénotypes sans changement de sérotype (Geno, et al., 2015). La variation de phase est une étape importante dans la virulence et aussi un processus adaptatif qui conduit à la propagation et la distribution des bactéries dans l’organisme de l’hôte, dont le mécanique est encore mal compris (Donkor, 2013). Ce mécanisme augmente jusqu'à six fois l'invasion du pneumocoque dans les cellules endothéliales du cerveau humain (Ring, et al., 1998). Les variations de phase induisent des altérations dans les structures et les composantes associés à la surface (Mitchell & Mitchell, 2010, Donkor, 2013). La présence de la capsule limite également l'autolyse et réduit l'exposition à plusieurs antibiotiques.

Les pneumocoques peuvent aussi altérer leur sérotype par des recombinaisons affectant la synthèse de la capsule polysaccharidique. Les sérotypes du pneumocoque sont regroupés en 48 sérogroupes en fonction de l'hétérogénéité des structures et de la composition chimique des polysaccharides ainsi que sur la base des propriétés antigéniques de polysaccharides capsulaires (Croucher, et al., 2015). Cette variation antigénique permet au pneumocoque de basculer d’un sérotype à un autre au sein du même sérogroupe et échappe au système immunitaire de l’hôte (Croucher, et al., 2015). Le pneumocoque peut alors causer des infections ou induire à nouveau les mêmes maladies puisqu’il sera considéré par l’immunité comme un nouvel agent pathogène. De même, la bactérie sera en mesure d’échapper à l’immunité induite par la vaccination dirigée vers un sérotype différent.

Pneumolysine La pneumolysine est un facteur de virulence puissant produit par tous les sérotypes de pneumocoque. C’est une hémolysine de la famille des thiol-activables qui utilise le cholestérol présent dans les membranes cellulaires comme un récepteur pour son activité cytolytique (Barocchi, et al., 2007). La pneumolysine représente la protéine principale de la virulence de S. pneumoniae dont la libération entraîne une réaction inflammatoire intense via l’induction des lésions tissulaires et provoque des pathologies plus graves (Marriott, et al., 2008). Cette cytotoxine est libérée sous l’action de l’autolysine majeure. La pneumolysine est produite sous la forme d'une protéine soluble de 52 kDa, la liaison au cholestérol, des cellules de l’hôte, est suivie de la formation de pores membranaires par oligomérisation (Kadioglu, et al., 2008). Deux modèles sont proposés pour le développement des pores sous l’action de la pneumolysine. Dans le premier modèle, il est suggéré que les unités se réunissent dans la membrane de la cellule hôte pour former des complexes oligomériques et des pores matures. Dans le deuxième modèle, il est proposé que les sous-unités subissent un pré-assemblage après la liaison à la membrane de la cellule hôte, et forment un complexe pré-pore avant l'insertion dans la membrane (Marriott, et al., 2008). La formation des pores provoque la lyse des cellules ciblées. Au niveau des voies respiratoires, cette toxine favorise l’accès au poumon par la lyse des cellules hôtes, l’inhibition du rythme mucociliaire des cellules respiratoires, et la séparation des jonctions serrées des cellules épithéliales (Henriques-Normark & Tuomanen, 2013). La pneumolysine active la voie classique du complément et peut induire une réponse inflammatoire ou des phénomènes d’apoptose chez les cellules hôtes (Henriques-Normark & Tuomanen, 2013). De plus, la libération de la pneumolysine au niveau du sang favorise l’accès au système nerveux central, en dégradant les tissus conjonctifs, et le passage de la barrière hémato-encéphalique provoquant ainsi la méningite pneumococcique et des dommages cérébraux importants (Mitchell & Mitchell, 2010).

Protéines de surface

Le pneumocoque possède une panoplie de protéines de surface dont beaucoup jouent un rôle dans la pathogénicité et la virulence. Ces protéines peuvent être divisées en trois groupes: les lipoprotéines, les protéines à motif LPxTG et les protéines liant la choline.

Toutes ces protéines peuvent être exportées à travers la membrane plasmique grâce à un peptide signal (Mitchell, 2003). Toutefois, peu est connu sur le mode de production (le terme expression est réservé aux gènes) de ses protéines, le tropisme tissulaire, l'invasion et l’évolution de la maladie.

1- Lipoprotéines La famille des lipoprotéines pneumocociques regroupe entre 42 à 47 lipoprotéines qui font partie des transporteurs de type ABC impliquées dans le transport des métaux (Kadioglu, et al., 2008). La protéine PsaA est une importante lipoprotéine présente chez tous les pneumocoques. Outre son rôle dans l’adhésion et la colonisation, comme mentionné précédemment, elle joue un rôle clé dans la virulence et le transport du manganèse (Bogaert, et al., 2004). Cette protéine présente un site potentiel de liaison divalent aux ions métalliques comme des ions zinc ou manganèse (Kadioglu, et al., 2008). L’importance de cette protéine dans la persistance du pneumocoque est en relation directe avec le manganèse qui joue le rôle de cofacteur pour plusieurs protéines de la virulence et dans la croissance bactérienne (Dintilhac, et al., 1997). De plus, le manganèse est impliqué dans la résistance au stress oxydatif qui peut résulter de la production de peroxyde d'hydrogène, au cours du métabolisme pneumococcique, ainsi que la production d'espèces réactives d'oxygène, lors de la réponse immunitaire innée de l'hôte (Kadioglu, et al., 2008). Plusieurs travaux ont élucidé le rôle de PsaA dans l’adhésion mais sans confirmer s’il s’agit d’une action directe ou indirecte en modulant l’expression d'autres adhésines via la concentration de manganèse (Mitchell, 2003).

2- Protéines à motif LPxTG Les protéines à motif LPxTG sont ancrées au peptidoglycane par une transpeptidase qui reconnaît la séquence d'acides aminés LPxTG. Comme plusieurs bactéries à Gram-positif, le pneumocoque utilise une sortase pour ce processus d'ancrage. Les sortases assurent l’assemblage et la fixation des pili au peptidoglycane, cependant c’est la sortase A qui catalyse l’ancrage des protéines à motif LPXTG et n’assure aucun rôle dans la synthèse des pili (Kadioglu, et al., 2008). Cette sortase influence la colonisation et la virulence du pneumocoque grâce son importance pour plusieurs protéines de surface (Paterson & Mitchell, 2006).

L’analyse du génome de S. pneumoniae a montré la présence de 19 et 13 gènes codant pour des protéines à motif LPXTG chez les souches TIGR4 et R6, respectivement (Hoskins, et al., 2001, Tettelin, et al., 2001). Les principales protéines de ce groupe sont les enzymes neuraminidase et hyaluronidase. Le rôle des neuraminidases NanA et NanB dans la colonisation et l’invasion de l’hôte est déjà mentionné dans cette revue de la littérature. La hyaluronidase est présente dans la majorité des isolats cliniques de S. pneumoniae et son rôle est l’hydrolyse de l’acide hyaluronique, un composant important des tissus conjonctifs et de la matrice extracellulaire des mammifères (Duran-Reynals, 1933). Cette action permet la migration du pneumocoque du site de la colonisation vers le système sanguin et facilite ainsi la dissémination et l’invasion de l’hôte. (Mitchell, 2003). Le génome du pneumocoque code aussi pour quatre métalloprotéases à motif LPXTG, protéases IgA1, ZmpB, ZmpC et ZmpD qui contribuent à la virulence de cette bactérie (Bergmann & Hammerschmidt, 2006).

3- Protéines liant la choline La famille des protéines liant la choline (CBPs) reconnaît la phosphorylcholine des acides lipoteichoiques et téichoiques. La phosphorylcholine ancre les CBPs à la paroi cellulaire (Bergmann & Hammerschmidt, 2006). La famille des CBPs comprend 13 à 16 protéines favorisant la virulence du pneumocoque (Bergmann & Hammerschmidt, 2006). Les CBPs incluent quatre hydrolases connues pour leur rôle dans la lyse cellulaire et la virulence: l'autolysine majeure LytA, LytB, lysozyme LytC et une phosphorylcholine estérase (Bergmann & Hammerschmidt, 2006). L’activation de LytA est induite par certaines conditions comme le stress et le traitement à la pénicilline (Mitchell, 2000). La contribution de LytA à la virulence est liée à l’hydrolyse du peptidoglycane qui peut provoquer une inflammation et aussi à la lyse cellulaire qui libère plusieurs toxines comme la pneumolysine. La protéine de surface PspA, présente à la surface de tous les pneumocoques, est nécessaire pour le développement de la virulence (Mitchell, 2000). PspA interfère avec la fixation du facteur de complément C3 à la surface bactérienne et inhibe ainsi l'activation du complément par S. pneumoniae (Bogaert, et al., 2004, Kadioglu, et al., 2008). De plus, PspA est une protéine de liaison à la lactoferrine. Cette activité protège la bactérie de l'activité bactéricide de l'apolactoferrine, une forme de

24 la lactoferrine pauvre en fer (Bergmann & Hammerschmidt, 2006). L'apolactoferrine bloque l’activité de plusieurs enzymes bactériennes dépendantes en fer et provoque généralement un effet bactériostatique ou bactéricide (Kadioglu, et al., 2008). La liaison du PspA à l’apolactoferrine bloque son activité et assure la survie du pneumocoque.

Traitements antipneumococciques

Comme on vient de le voir, le développement des maladies locales et invasives est sous le contrôle de plusieurs facteurs. Cette bactérie représente l'exemple d'un pathogène bactérien hautement invasif provoquant plus de décès que n’importe quel autre microorganisme évitable par la vaccination.

Traitements préventifs

Les premiers efforts pour développer des vaccins pneumococciques efficaces remontent au début du vingtième siècle. Les efforts visant à lutter contre l'infection par S. pneumoniae ont conduit au développement de deux types de vaccins contre le pneumocoque.

 Vaccin polysaccharidique

La reconnaissance de l'antigénicité des polysaccharides capsulaires a conduit au développement de vaccins antipneumococcique à base de polysaccharides capsulaires (Barocchi, et al., 2007). Le premier vaccin polysaccharidique était conçu pour immuniser contre six sérotypes capsulaires et était autorisé pour l’usage général après des essais sur des militaires durant la seconde guerre mondiale (Barocchi, et al., 2007). Un deuxième vaccin à base de quatorze sérotypes capsulaires a été développé en 1977 (Robbins & Schneerson, 1983). Ce vaccin a été rapidement remplacé en 1983 par le vaccin actuel (PPV23) couvrant plus de sérotypes capsulaires (1,2, 3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F, 33F) responsable d’environ 90% des infections causées par S. pneumoniae aux États-Unis (Robbins & Schneerson, 1983). Ce vaccin couvre 23 sérotypes capsulaires les plus fréquemment associés aux souches

25 responsables des infections pneumocociques invasives. PPV23 est destiné aux personnes âgées et aux personnes à haut risque d’infection pneumococcique. Il n’est pas recommandé pour les enfants de moins de 2 ans, car leur système immunitaire répond mal à la stimulation par des polysaccharides dû au niveau insuffisant de l’immaturité de leurs lymphocytes B, ce qui empêche le déclenchement d’une réponse immunitaire.

 Vaccins conjugués

Les vaccins conjugués ont été développés comme une solution alternative pour stimuler le système immunitaire des jeunes enfants. Le principe est basé sur l’association de façon covalente des polysaccharides capsulaires à une protéine porteuse. Cela permet de rendre le polysaccharide immunogène en le présentant au système immunitaire comme un antigène thymodépendant qui est normalement thymo-indépendant (AlonsoDeVelasco, et al., 1995). Ce vaccin permet de stimuler les lymphocytes T matures dès la première année de la vie. Dans le cas des vaccins antipneumocociques conjugués, trois vaccins ont été développés. Deux vaccins conjugués hepta-valent (4, 6B, 9V, 14, 18C, 19F et 23F) et 13-valent (1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F) utilisent comme protéine porteuse une toxine diphtérique modifiée (CRM197) liée aux sérotypes capsulaires. Pour le vaccin déca-valent, il couvre dix sérotypes (1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, 23F) qui sont conjugués à une protéine d’Haemophilus influenzae (Barocchi, et al., 2007, van der Poll & Opal, 2009). Les sérotypes incluent dans ces vaccins ont été choisis pour couvrir les principaux sérotypes causant les maladies invasives aux États-Unis, un choix qui signifie qu'ils ne sont pas bien adaptés à d'autres zones géographiques avec une distribution différente de sérotypes. Une autre limitation est en relation avec le nombre restreint de sérotypes capsulaires que peut contenir un vaccin conjugué, par rapport au vaccin polysaccharidique, qui est liée à l’immunogénicité de la protéine porteuse.

La diversité des sérotypes capsulaires du pneumocoque représente un sérieux obstacle dans la conception d'un vaccin universel. Les vaccins actuels sont basés sur un nombre limité de polysaccharides capsulaires alors que la bactérie présente un grand nombre de sérotypes capsulaires qui atteint 97 sérotypes. De plus, les sérotypes responsables des infections invasives se sont avérés différents d'une région géographique à l'autre et la distribution dépend également de la période étudiée. De même, la variation antigénique donne au

26 pneumocoque la possibilité de basculer d’un sérotype à un autre ce qui permet d’échapper à la vaccination.

 Vaccins protéiques

L’émergence rapide de sérotypes non-vaccinaux a encouragé le développement d’un vaccin indépendant du sérotype capsulaire. Au cours de la dernière décennie, l'intérêt a été déplacé vers les facteurs de virulence. Les protéines de surface sont des cibles potentielles pour assurer un effet protecteur contre une infection pneumococcique. Pour concevoir un vaccin efficace, ces protéines doivent être conservées chez la majorité des souches cliniques de S. pneumoniae. Bien que de nombreuses protéines du pneumocoque ont été proposées comme des vaccins potentiels, PspA, PsaA et la pneumolysine sont actuellement les plus prometteurs (AlonsoDeVelasco, et al., 1995, Barocchi, et al., 2007). L’application de vaccin à base de protéines de surface pourra conférer une meilleure protection puisque plusieurs protéines de surfaces sont impliquées dans la colonisation et l’infection par S. pneumoniae et cela pourrait limiter l’émergence de nouvelles souches et assurer une protection à long terme.

Traitement et résistance aux antibiotiques

En dépit de la disponibilité des antibiotiques, les infections à S. pneumoniae demeurent un problème de santé publique critique avec un impact significatif sur la morbidité et la mortalité. Cette situation est liée à un niveau inhabituellement élevé de résistance aux antibiotiques communs, chez les souches cliniques de S. pneumoniae, en particulier la résistance aux bêta-lactamines. Cette augmentation de souches résistantes est corrélée avec l’utilisation intensive de ces antibiotiques considérés pendant plusieurs décennies comme les plus efficaces de tous les antibiotiques contre les streptocoques oraux.

En 1941, l’introduction de la pénicilline pour le traitement des maladies infectieuses a été une étape importante dans le traitement des infections mortelles avec espoir d’éradiquer toutes les infections bactériennes. Les infections causées par S. pneumoniae ont été traitées

27 principalement par des bêta-lactamines surtout la pénicilline G. Cependant en 1970, une résistance intermédiaire des souches de S. pneumoniae à la pénicilline a été constatée (Ohsaki, et al., 2008). En 1980, un niveau élevé de résistance a été constaté dans plusieurs régions du monde. La résistance à la pénicilline n’était pas unique, le pneumocoque a acquis la résistance à plusieurs bêta-lactamines et même pour plusieurs familles d’antibiotiques. Aujourd’hui, environ 40% des souches de S. pneumoniae présentent des phénotypes multirésistants variables selon la distribution géographique (Reinert, 2009).

La résistance du pneumocoque aux bêta-lactamines est corrélée avec une diminution d'affinité de ces antibiotiques pour les PLPs (Ohsaki, et al., 2008). Les bêta-lactamines inhibent la synthèse du peptidoglycane en se liant avec les PLPs qui sont des transpeptidases responsables de l’étape finale de la synthèse du peptidoglycane. Les gènes codant pour les PLPs acquièrent des gènes exogènes avec des mutations génétiques ce qui altèrent l’affinité des bêta-lactamines aux PLPs. Ces évènements de recombinaison entre les gènes de PLPs des streptocoques et le pneumocoque produisant ainsi des gènes mosaïques (Reinert, 2009). L’analyse du génome de S. pneumoniae a montré la présence de six PLPs (PLP1a, PLP1b, PLP2x, PLP2a, PLP2b et PLP3) et que seulement trois gènes (PLP2b, PLP2x et PLP1a) sont en relation avec la résistance aux bêta-lactamines (Ohsaki, et al., 2008, Reinert, 2009).

Le pneumocoque possède aussi d’autres formes de résistance aux bêta-lactamines qui ont été récemment détectées. Comme le cas de la protéine MurM qui est impliquée dans la synthèse de branches peptidiques courtes dans la paroi cellulaire du pneumocoque (Fiser, et al., 2003). Une autre protéine impliquée dans le transport du phosphate, la protéine PstS qui semble être surexprimée seulement chez les souches résistantes aux bêta-lactamines et l’inactivation du gène codant pour cette protéine augmente la susceptibilité des souches à la pénicilline (Soualhine, et al., 2005).

Les macrolides inhibent la synthèse des protéines bactériennes en se liant à la grande sous- unité ribosomale 50S et en perturbant l'élongation de la synthèse de la traduction par la dissociation du peptidyl-ARNt (Schroeder & Stephens, 2016). La résistance de S. pneumoniae aux macrolides est due à plusieurs mécanismes. La méthylation de la cible ribosomale par les gènes ermA et ermB qui modifient l'ARNr 23S prévenant ainsi la liaison

28 aux antibiotiques chez les pneumocoques (Johnston, et al., 1998). Également, l’efflux actif des antibiotiques par des pompes de types MFS est un mécanisme de résistance aux macrolides et aux fluoroquinolones (Watson, et al., 1993, Reinert, 2009). Les gènes MefA et MefE confèrent au pneumocoque la résistance aux macrolides (Watson, et al., 1993).

La résistance de cette bactérie aux antibiotiques ne cesse d’augmenter au fil du temps limitant ainsi les moyens de contrôle des infections à S. pneumoniae.

Bactériophages

Rappel historique

Les bactériophages (virus des bactéries) constituent une variété particulière de virus dont l’hôte exclusif est une bactérie. Ils sont programmés pour accomplir une unique mission qui est d’infecter une bactérie spécifique et éventuellement la détruire. Les phages ont été découverts de façon indépendante par l’anglais Frederick Twort et le franco-canadien Félix d'Hérelle respectivement en 1915 et 1917 (Twort, 1915, D'Herelle, 2007). Même avant leur découverte formelle, le phénomène semble avoir été observé par plusieurs scientifiques, dont la première description d’activité antibactérienne aurait été faite par le chimiste britannique Ernest Hanbury Hankin en 1896 (Abedon, et al., 2011). Hankin a constaté l’action bactéricide des eaux troubles des rivières Gange et Jumna en Inde sur la bactérie du choléra, grâce à une substance qui traverse le filtre de Chamberland sans déterminer sa nature ni son origine. Au début, la nature de ces entités biologiques a été mal comprise. Toutefois, les travaux de d’Hérelle ont permis de conclure que l’action lytique est le résultat d’un virus spécifique de bactérie et non pas une enzyme ou produit chimique et que l’action est spécifique à une espèce bactérienne (Parisien, et al., 2008). Le nom bactériophage (mangeur de bactérie) a été proposé par d’Hérelle en référence à deux mots grec, baktêria qui signifie « bâton » en référence à la première forme de bactérie en bâtonnet et phagos qui désigne mangeur.

À cette époque, les épidémies bactériennes faisaient des ravages en Europe. En 1919, une épizootie de fièvre typhoïde a touché les volailles en France. Pour d’Hérelle, c’était une opportunité pour tester les phages et leur potentiel thérapeutique. Il a pu guérir la majorité des poules mettant ainsi en évidence l’efficacité des phages dans le traitement des infections chez les animaux (Dublanchet & Bourne, 2007). Au cours de la même année, il a fait les premiers essais cliniques sur des patients atteints de dysenterie bacillaire et il a pu assurer la convalescence de la totalité des patients en quelques heures, de quatre à vingt heures selon le cas du patient (d'Herelle, 1931). C’était la naissance de la thérapie par phage incitant ainsi plusieurs scientifiques à travers le monde à l’utiliser pour le traitement des infections pathogènes (Peitzman, 1969). D’Hérelle a rapidement commencé la

30 commercialisation des préparations phagiques et à partir de 1923 plusieurs articles sont apparus en relation avec les bactériophages, l’isolement et le traitement par phage (d'Herelle, 1931). Malgré le grand succès de la thérapie phagique la paternité du principe de la lyse a été toujours remise en question par les scientifiques, ainsi que la nature de la lyse bactérienne par le prétendu bactériophage. L’ampleur de la polémique a duré pendant de longues années et d’Hérelle a été toujours convaincu que la lyse est le résultat d’un nouveau microorganisme, le bactériophage. Jules Bordet et Mihai Ciuca présumaient que la lyse était le résultat d’une autolyse bactérienne résultant d’un fonctionnement anormal du métabolisme bactérien transmissible par l’hérédité (Duckworth, 1976). Cependant, les résultats de la croissance du phage en une seule étape suggéraient qu’il s’agissait d’un microorganisme, dont la croissance est divisée en trois périodes (adsorption, croissance et lyse bactérienne avec libération de nouveaux phages) (Ellis & Delbruck, 1939). Pour le visualiser, il fallait attendre jusqu’à la mise au point des microscopes électroniques en 1940 pour voir le bactériophage pour la première fois et reconnaitre qu’il s’agit d’une entité distincte et nouvelle (Luria & Anderson, 1942). Malgré toutes les évidences, le conseil scientifique avait beaucoup de doute en relation avec le danger d’application de la thérapie. phagique. En même temps, environ 10 ans après la découverte de la pénicilline, les chercheurs ont enfin pu la purifier et l’avoir en forme stable soulignant ainsi le début de l’antibiothérapie.

Au cours de la dernière décennie, le potentiel thérapeutique des phages a été réévalué. Cette redécouverte permet de mieux comprendre l’efficacité de la phagothérapie, en utilisant un seul phage ou un cocktail de phages dans le traitement des infections bactériennes. De même, les enzymes lytiques produites par les phages ont montré leur efficacité pour détruire la paroi bactérienne et lyser les bactéries ciblées. La phagothérapie et les applications en médecine ou en biotechnologie et comme un moyen de biocontrôle ont été largement abordées dans la revue (voir annexe).

Classification des bactériophages

Les phages sont ubiquitaires et représentent les entités biologiques les plus abondantes sur terre. On estime une population d’environ 1031 à 1032 particules de phage existant sur la planète à un moment donné et 1025 infections se produiraient chaque seconde pour de maintenir ce nombre (Breitbart & Rohwer, 2005, Deresinski, 2009). Jusqu’en 2009, plus de 5 500 bactériophages ont été examinés par microscopie électronique (Ackermann, 2009). La découverte de nombreux virus a favorisé le développement d’un système de classification universelle. En 1966, le Comité international de nomenclature des virus (ICNV) a été créé au Congrès international de microbiologie à Moscou. En 1973, ce comité est devenu le comité international de taxonomie des virus (ICTV) (International Committee on Taxonomy of Viruses) chargé de développer, de perfectionner et de maintenir une taxonomie universelle des virus (Fenner, 1995). La classification traditionnelle, basée sur la morphologie des virus, a subi un champ évolutif et s'est davantage déplacée vers la génomique, grâce au séquençage de génome (ADN/ARN, sb/db) qui est devenu beaucoup moins coûteux.

La morphologie des phages est caractérisée par une extrême diversité dans un petit groupe de phages isométriques, filamenteux ou pléomorphes représentant environ 4% des bactériophages isolés, alors qu'environ 96% des phages possèdent une queue et appartiennent à un seul ordre, les Caudovirales (Klumpp, et al., 2010) (Figure 1.6). Cet ordre est composé de trois familles Myoviridae, Podoviridae et Siphoviridae regroupant des phages à ADN double brin et qui diffèrent par leur morphologie et la taille de leur génome qui varie entre 15 000 et 500 000 paires de bases (Fokine & Rossmann, 2014).

Figure 1.6 Représentation schématique des différentes familles de virus des procaryotes. Figure tirée et adaptée de Hyman & Abedon. (2015).

Les phages de la famille des Myoviridae se caractérisent par leurs queues contractiles et représentent 25% des phages à queue caractérisés. Les phages de la famille des Podoviridae ont des queues courtes et non contractiles et ne représentent que 14% de l’ensemble des phages de cet ordre. La famille des Siphoviridae est la plus grande famille des bactériophages à queue représentant environ 61% et regroupe des phages à longues queues non contractiles (Ackermann, 2007). Récemment, l'ordre des Caudovirales a fait l’objet de modifications par l’introduction de plusieurs sous-familles (Adriaenssens, et al., 2012). D’après les données récentes de l’ICTV, la famille des Myoviridae regroupe 28 genres appartenant à 6 sous-familles et 39 genres non classés. De plus, la famille des Podoviridae regroupe 10 genres appartenant aux 3 sous-familles ainsi que 20 genres non classés. Le phage Cp-1 était une espèce non assignée dans cette famille et maintenant il est considéré comme l'espèce type d'un nouveau genre, Cp1virus dans la sous-famille des Picovirinae. Pour la famille des Siphoviridae, elle est divisée en 6 sous-familles regroupant 21 genres et aussi 94 genres non classés. Le pneumophage Dp-1 demeure un virus non classé dans la famille des Siphoviridae.

Réplication des bactériophages

Les bactériophages sont des prédateurs naturels et parasites obligatoires des bactéries. Pour infecter une bactérie hôte, le phage va se lier à un récepteur spécifique à la surface de la cellule bactérienne pour injecter son propre génome. Cette étape ne se fait pas au hasard, elle nécessite une étroite sélectivité entre le phage et son hôte. Chaque phage cible une souche particulière d'une espèce bactérienne pour s’adsorber à son récepteur bactérien. On distingue deux principaux cycles de réplication du phage; lytique et lysogénique, selon qu’il s’agisse d’un phage virulent ou tempéré, respectivement. Le choix du cycle de réplication des phages est défini par leur génétique, leur interaction avec l'hôte bactérien ainsi que les stimuli environnementaux.

Dans le cas des phages virulents, le phage débute immédiatement un cycle de réplication et la production de nouveaux virions. Le cycle s’achève par la lyse bactérienne et la libération d’une nouvelle progéniture. Pour les phages tempérés, le phage s’intègre au génome bactérien, on le nomme un prophage. Ce prophage reste en quiescence tout en se répliquant en même temps que son hôte bactérien sans induire une lyse bactérienne. Sous l’effet d’un stress tel que la température, le stress oxydatif, les rayons ultra-violets ou la mitomycine C, ce prophage s’excise et entame la réplication en rejoignant le cycle de réplication lytique comme les phages virulents (Figure 1.7).

Pour les deux types de phages, la première étape du cycle d’infection est l’adsorption. Les phages peuvent reconnaitre divers récepteurs dont la nature varie selon la bactérie ciblée (peptidoglycane, acides teichoïques, lipopolysaccharides, capsule ou oligosaccharides). Cette étape fait appel à des structures de la queue qui jouent un rôle dans la reconnaissance du récepteur et participent aussi dans la perforation des membranes cellulaires et l’injection de l’ADN viral (Salmond & Fineran, 2015). Pour la majorité des phages caudés, l’adsorption se déroule en deux parties, un premier attachement réversible et un deuxième irréversible.

Figure 1.7 Cycle de réplication des bactériophages. Cycle lytique des phages virulents (gauche) et cycle lysogénique des phages tempérés (droite). Figure tirée et adaptée de Salmond & Fineran. (2015).

Dans le cas du myophage T4, le premier attachement fait appel à un minimum de trois fibres caudales (fibres de la queue) puis la totalité des fibres pour augmenter la surface de contact avec la bactérie (Rakhuba, et al., 2010). Ensuite, le phage fait appel à une protéine de liaison au récepteur (RBP) qui assure l’attachement à un récepteur bactérien et stimulant ainsi l’altération de la conformation de la plaque basale et la contraction de la queue pour perforer la membrane bactérienne et injecter l’ADN viral. Le phage exploite la machinerie cellulaire pour assurer la réplication de son génome et pour la synthèse des protéines de la capside et de la queue. C’est alors que l’assemblage des composants du phage et l’encapsidation de l’ADN ont lieu pour générer des phages identiques qui seront libérés dans l’environnement suite à la lyse de la bactérie (Rakhuba, et al., 2010, Salmond & Fineran, 2015).

Contrairement aux phages virulents, les phages tempérés entrent en lysogénie et maintiennent une association à long terme avec leur hôte bactérien avant de rejoindre le cycle de réplication. Les prophages s’excisent alors du génome bactérien et se comportent comme un phage virulent pour le reste du cycle. Cependant, ce n’est pas l’unique cas où le prophage peut s’exciser du génome bactérien. De nouveaux travaux ont permis de mettre en évidence quelques circonstances où le prophage est capable de s’exciser du génome et de s’insérer à nouveau (Feiner, et al., 2015). Ce mécanisme conduit à la régulation de processus bactériens cruciaux. Par exemple, dans les cas de S. aureus, la synthèse d’une hémolysine de type bêta joue un rôle important pour passer de la colonisation à la pathogénicité. Cependant le gène codant pour cette hémolysine est interrompu par la présence d’un prophage. Pour cela, le prophage s’excise et s’insère à un autre locus ce qui permet la synthèse de cette toxine (Goerke, et al., 2006).

Phages infectant Streptococcus pneumoniae

Les phages infectant S. pneumoniae ont été isolés pour la première fois en 1975 par deux groupes indépendants, à partir de prélèvements (écouvillonnage) de la gorge de patients présentant une infection des voies respiratoires supérieures. Le premier groupe a isolé des phages nommés Omega () et le deuxième groupe; le premier phage lytique nommé Diplophage 1 (Dp-1) (McDonnell, et al., 1975, Tiraby, et al., 1975). En 1981, le phage Cp- 1 (phage complutence) a été isolé (Ronda, et al., 1981). Depuis, plusieurs phages tempérés ont été isolés de souches cliniques de S. pneumoniae, comme HB-3, MM1, SV1 et VO1. En effet, les phages tempérés ont été identifiés dans le génome d’environ 76% des isolats cliniques (Ramirez, et al., 1999). Ces prophages semblent avoir un rôle important dans la virulence du pneumocoque, toutefois la façon dont ces phages affectent leur hôte pendant la colonisation et la virulence demeure inconnue.

La présence d’un prophage intégré au chromosome bactérien peut induire un changement des propriétés d’une bactérie hôte. Ce phénomène est nommé la conversion lysogénique qui procure à la bactérie un nouvel arsenal pour mieux persister. Un prophage peut être un vecteur de gènes de résistance aux antibiotiques, de gènes de métabolisme pour utiliser de

36 nouvelles sources nutritives ou de gènes codant pour des facteurs de virulence (Feiner, et al., 2015). En effet, la virulence de plusieurs souches bactériennes est associée à la présence de toxines codées par des prophages, qui sont soit sécrétées ou libérées lors de la lyse bactérienne (Salmond & Fineran, 2015). Cependant, les prophages de S. pneumoniae ne codent pour aucune toxine et semblent jouer davantage un rôle dans la biologie de S. pneumoniae. Tous les phages tempérés du pneumocoque codent pour une enzyme lytique (endolysine) de 318 acides aminés, impliquée dans la lyse de la paroi bactérienne. Cette endolysine ressemble étroitement à l'enzyme LytA de S. pneumoniae, une N- acetylmuramoyl-L-alanine amidase (Morales, et al., 2010). Cette enzyme est absente dans le cas des phages virulents du pneumocoque. La présence du prophage SV1 semble améliorer la formation de biofilm et le prophage MM1 augmente l’adhérence de S. pneumoniae aux cellules épithéliales (Loeffler & Fischetti, 2006, Carrolo, et al., 2010).

À ce jour, la liaison entre la virulence et la présence des prophages dans le génome du pneumocoque demeure mal comprise. Cependant, environ 72% des prophages codent pour des facteurs de virulence (Brueggemann, et al., 2017). Les gènes putatifs de virulence pblA et pblB coderaient aussi pour des protéines de la queue d’un phage. Chez S. mitis, on retrouve des gènes similaires dans des prophages et ils coderaient pour des protéines associées à une liaison plaquettaire et à un risque accru d'endocardite (Bensing, et al., 2001, Mitchell, et al., 2007). Chez S. pneumoniae, la présence du gène pblB codé par un prophage, est associée à l'adhérence du pneumocoque aux cellules épithéliales pulmonaires humaines et à une persistance accrue dans le nasopharynx et le poumon (Brueggemann, et al., 2017). De plus, pblB est associée avec une mortalité accrue chez les patients atteints d’infections invasives à S. pneumoniae (Tunjungputri, et al., 2017). Les prophages peuvent aussi être des médiateurs de gènes de résistance aux antibiotiques. En effet, la résistance de S. pneumoniae à la tétracycline semble être liée à la présence d’un prophage qui code pour des gènes de résistance pour cet antibiotique (Wyres, et al., 2013).

Les génomes de souches cliniques du pneumocoque regorgent d’un grand nombre de prophages dont le maintien suggère que ces prophages apportent un bénéfice au pneumocoque. La contribution de ces prophages dans la pathogenèse et la virulence du pneumocoque nécessite une compréhension plus approfondie. La présence de ces

37 nombreux prophages dans le génome de S. pneumoniae représente aussi un véritable paradoxe vue le nombre restreint des phages virulents isolés. En effet, seulement deux phages virulents sont à présent disponibles, le phage Cp-1 et Dp-1, appartenant à la famille des Podoviridae et des Siphoviridae, respectivement. Récemment, le groupe de Clokie a isolé un nouveau phage virulent SPQS1 capable d’infecter des souches capsulées de S. pneumoniae D39. Le phage SPQS1 appartient à la famille des Siphoviridae et au genre de Sap6virus. Avec une taille du génome de 58305 pb, il code pour 104 protéines, le génome est disponible dans la base de données GenBank (numéro d’accession: NC_021868). Ce phage s’est avéré capable d’éliminer les infections pneumococciques invasives (pneumonie et septicémie) chez des souris. Toutefois, ces travaux ne sont pas encore publiés à ce jour. Après plusieurs années à l’ombre, les phages virulents Cp-1 et Dp- 1 ont reçu plus d’attention au cours de ces dernières années et ont fait l’objet de quelques études.

Le phage Dp-1 est le premier phage virulent à avoir été isolé pour S. pneumoniae et pourtant l’annotation complète de son génome n’a été faite que récemment. Son analyse génomique a montré que ce phage coderait pour 72 protéines (Sabri, et al., 2011). De plus, ces protéines structurales ont aussi été identifiées par spectrométrie de masse (Sabri, et al., 2011). Un réseau de ces protéines phagiques structurales a aussi été établi afin de mieux comprendre ce phage (Sabri, et al., 2011). Par ailleurs, l’étude des protéines du phage Cp-1 par SDS-PAGE et spectrométrie de masse a permis d’identifier une douzaine de protéines structurales (Hauser, et al., 2011). Pour ces deux phages, l’étude des interactions intravirales a permis de prédire la fonction de certaines protéines et de proposer un modèle structurel du phage Dp-1 et du phage Cp-1(Hauser, et al., 2011, Sabri, et al., 2011). À ce jour, la fonction de la moitié des protéines codées par les gènes de ces deux phages demeure inconnue, représentant ainsi un véritable obstacle à la compréhension globale de la biologie des phages virulents du pneumocoque.

Comme on le verra plus loin dans cette thèse, la relation des phages virulents avec leur bactérie hôte représente une étape clé dans la compréhension du mécanisme d’infection et dans la façon dont les phages interagissent avec la cellule bactérienne. L’étude des interactions des protéines de S. pneumoniae avec les protéines des deux phages Cp-1 et Dp-

1 par la technique de double hybride (Y2H) a récemment permis de cibler quelques protéines du pneumocoque qui semblent interagir avec des protéines phagiques, du moins in vitro (Mariano, et al., 2016). Dans le cas du phage Cp-1, un total de 11 interactions ont été détectées par Y2H (yeast 2-hybrid assay) entre 7 protéines du phage et 10 protéines de S. pneumoniae. Pour le phage Dp-1, 49 interactions ont été identifiées par Y2H entre 19 protéines du phage et 28 protéines du pneumocoque (Mariano, et al., 2016). Seulement deux protéines du pneumocoque auraient une interaction avec les deux phages, soit l’ADN hélicase RuvB et un regulateur transcriptionel de la famille de DeoR.

Une autre étude des interactions entre S. pneumoniae et les phages Cp-1 et Dp-1 a été réalisée récemment et cette étude était basée sur des souches mutantes résistantes aux pneumophages (Leprohon, et al., 2015). Le principe est relativement simple. Il s’agit de générer en laboratoire des mutants naturels résistants aux phages en mettant en contact une bactérie sensible aux phages avec des concentrations variables de phages. Après une période prolongée d’incubation, des colonies résistantes aux phages vont émerger sur des boites de Petri. Le séquençage du génome de ces bactéries mutantes permet ensuite d’identifier des mutations possiblement impliquées dans la résistance aux phages. Évidemment des tests de génétiques classiques (complémentation, reconstruction) sont nécessaires pour confirmer que ces mutations sont bel et bien impliquées dans la résistance aux phages. Toutefois avec S. pneumoniae cette approche a été un peu plus difficile puisque cela impliquait la disponibilité des méthodologies efficaces pour l’infection sur boite de Petri avec des pneumophages ainsi que des outils de modifications génétiques. Malgré les embuches techniques, cette étude a réussi à détecter plusieurs mutations dans le génome de pneumocoques résistants aux phages. Au total, onze mutations dans le cas de souches résistantes au phage Cp-1 ont été détectées, ciblant huit gènes dont trois mutations étaient additives pour augmenter la résistance à ce phage. De même, cinq mutations dans la souche résistante au phage Dp-1 ont été détectées, ciblant deux gènes du pneumocoque (Leprohon, et al., 2015). L’adsorption du phage Cp-1 à la souche mutante a été partiellement réduite alors que pour l’adsorption du phage Dp-1 n’a subi aucune réduction. Ces mutations ne semblent pas tout à fait liées au processus d’adsorption, mais plutôt auraient des rôles dans d’autres étapes du processus d’infection phagique.

Puisque les phages sont dépendants de leur bactérie hôte pour se reproduire et qu’ils font appel à un réseau d’interactions, ces études phages-bactéries sont cruciales pour améliorer notre compréhension du processus d’infection. Elles représentent une étape déterminante pour une éventuelle application de la thérapie par les phages.

Problématique, hypothèses et objectifs du projet

Les infections par S. pneumoniae demeurent l’un des grands chapitres de la pathologie infectieuse. S. pneumoniae est à l’origine de la pneumonie, la bronchite, la sinusite, l’otite moyenne et des infections invasives telles que la bactériémie, la septicémie et la méningite. Le pneumocoque est associé à un taux élevé de morbidité et de mortalité chez les enfants et les adultes avec une prédominance aux âges extrêmes. La prévalence des souches de S. pneumoniae résistantes et multirésistantes ne cesse d’augmenter au fil du temps. Face à ce problème de santé publique majeur; la recherche de nouveaux remèdes est imminente. La réévaluation de la thérapie par phages est maintenant considérée comme une alternative thérapeutique pour résoudre cette impasse thérapeutique.

Plusieurs travaux sont menés sur l’isolement des phages et l’étude de l’efficacité de la phagothérapie. Cependant, cela ne permet pas de comprendre le comportement des phages et leurs interactions avec leurs bactéries hôte ni les facteurs qui peuvent influencer leur efficacité. Le point de départ de ce travail de thèse est l’étude des interactions phage-hôte dans le cas de S. pneumoniae. Deux objectifs ont été envisagés, un objectif mineur et un objectif majeur.

1. Objectif mineur: Étude de l’efficacité des phages du pneumocoque à infecter S. mitis une bactérie proche de S. pneumoniae (chapitre 2)

Lors de ce projet, nous avons malheureusement obtenu un nombre limité de phages virulents infectant S. pneumoniae et même pour des bactéries proches du pneumocoque. Cela nous a incités à investir la capacité des pneumophages à infecter d’autre bactérie comme S. mitis. S. mitis est une bactérie pathogène responsable d’endocardite, pour laquelle aucun phage virulent n’a été encore isolé. Pour tester cette hypothèse, la capacité des pneumophages virulents Dp-1 et Cp-1 à infecter des souches de S. mitis a été vérifiée. Spécifiquement, des analyses microbiologiques et génomiques ont été effectuées pour comparer le comportement des phages chez les deux espèces bactériennes.

2. Objectif majeur: Étude des interactions phage-hôte chez S. pneumoniae (chapitre 3)

Cet objectif a pour but d’approfondir nos connaissances sur les interactions phage-hôte chez S. pneumoniae. Après l'infection par un phage virulent, le phage détourne la machinerie de l’hôte bactérienne par diverses interactions phage-hôte. Dans ce processus, des facteurs de l’hôte sont essentiels pour assurer la réplication du phage. Pour cela, nous avons étudié l’implication de plusieurs facteurs de l’hôte dans la réplication de ces deux pneumophages. Tout d’abord, nous avons inactivé indépendamment plusieurs gènes de S. pneumoniae et on a évalué l’effet de l’inactivation sur la croissance de la souche. L’étude de l’impact de ces altérations sur le pneumocoque pourra aider à identifier de nouvelles cibles thérapeutiques thérapeutiques. Par la suite, pour vérifier l’importance de ces facteurs d’hôte pour les phages, nous avons testé les deux phages sur toutes ces souches. Pour confirmer ces résultats, nous avons étudié l’effet de la complémentation et l’expression de ces gènes sur la réplication des pneumophages.

Chapitre 2. Diverse virulent pneumophages infect Streptococcus mitis

Résumé

Streptococcus mitis est une bactérie proche de Streptococcus pneumoniae, et elle a émergé comme l'une des principales causes d'endocardite bactérienne. La résistance aux antibiotiques a également augmenté chez les souches de S. mitis et de S. pneumoniae. Pour gérer les infections, les phages sont reconsidérés comme des alternatives aux antibiotiques. Dans cette étude, les deux phages virulents Cp-1 (Podoviridae) et Dp-1 (Siphoviridae), auparavant isolés de S. pneumoniae, se sont avérés capable d’infecter aussi S. mitis. Les essais microbiologiques ont montré que les deux pneumophages pouvaient non seulement se répliquer sur S. mitis mais également produisent des plaques plus visibles chez cet hôte. Cependant, la taille de la progéniture et les données d'adsorption étaient plus faibles chez S. mitis par rapport à S. pneumoniae. La comparaison génomique de chaque phage propagé sur les deux hôtes montre des séquences nucléotidiques identiques, confirmant que les mêmes phages infectent les deux espèces bactériennes. Nous avons également découvert que la séquence du génome du podophage Cp-1 de la collection de Félix d'Hérelle est différente de la séquence précédemment rapportée. Ainsi le phage de la collection a été renommé SOCP.

Avant-propos

Contributions des auteurs

Philippe Leprohon a sélectionné les souches de S. mitis potentiellement sensibles aux pneumophages. J’ai réalisé les expériences et rédigé l’article. Sylvain Moineau a co-rédigé le manuscrit en plus d’avoir supervisé le projet.

Publication

Siham Ouennane, Philippe Leprohon and Sylvain Moineau. 2015. Diverse virulent pneumophages infect Streptococcus mitis. PloS One. 10:e0118807.

Abstract

Streptococcus mitis has emerged as one of the leading causes of bacterial endocarditis and is related to Streptococcus pneumoniae. Antibiotic resistance has also increased among strains of S. mitis and S. pneumoniae. Phages are being reinvestigated as alternatives to antibiotics for managing infections. In this study, the two virulent phages Cp-1 (Podoviridae) and Dp-1 (Siphoviridae), previously isolated from S. pneumoniae, were found to also infect S. mitis. Microbiological assays showed that both pneumophages could not only replicate in S. mitis but also produced more visible plaques on this host. However, the burst size and phage adsorption data were lower in S. mitis as compared to S. pneumoniae. A comparison of the genomes of each phage grown on both hosts produced identical nucleotide sequences, confirming that the same phages infect both bacterial species. We also discovered that the genomic sequence of podophage Cp-1 of the Félix d’Hérelle collection is different than the previously reported sequence and thus renamed SOCP.

Introduction

The Mitis group of streptococci is a member of the viridans group of streptococci [VGS], which includes several species that reside in the human oral cavity and the upper respiratory tract. In the Mitis group, Streptococcus pneumoniae and Streptococcus mitis are closely related species, making discrimination between them very difficult (Arbique, et al., 2004). Although both bacteria are oral commensals they can cause a wide variety of human invasive diseases (Doern & Burnham, 2010). S. pneumoniae (pneumococcus) is the most common cause of community-acquired pneumonia worldwide and is also associated with a range of other diseases, including otitis media, meningitis, and septicemia (Joyce, et al.,

2009). S. mitis has traditionally been regarded as an innocuous commensal of the oropharynx, skin, and both the gastrointestinal and genitourinary tracts (Carrascosa, et al., 1994). Some S. mitis strains have been shown to cause endocarditis and blood stream infections (Mitchell, 2011). The transition from commensalism to pathogenesis is likely related to the acquisition of virulence genes.

S. pneumoniae and S. mitis have emerged as significant pathogens but differ in their expression of virulence factors. For example, phase variation is an important step in virulence and also an adaptive process that leads to the distribution of bacteria to other sites, causing disease (Donkor, 2013). The switching of phenotypes was noted in S. pneumoniae where phase variation changes the colony morphology from opaque to transparent without any change in the serotype. To our knowledge, this type of phase variation has not been observed for S. mitis (Arai, et al., 2011), however, strains of S. mitis were recently shown to have a capsule, a well known virulence factor in S. pneumoniae (Rukke, et al., 2012). In fact, genomic analysis of S. mitis revealed the presence of several virulence factors similar to those found in S. pneumoniae. However, it has not been confirmed whether these virulence factors are just implicated in adhesion and attachment of S. mitis or whether they are related to pathogenicity as in S. pneumoniae (Madhour, et al., 2011, Mitchell, 2011).

Strains nonsusceptible to the common antimicrobial drugs were detected among S. pneumoniae and S. mitis, especially to beta-lactams which have been widely used to treat such bacterial infections (Sunderkotter & Becker, 2014). It was also reported for S. pneumoniae and other bacterial species that low concentrations of some antibiotics induces natural transformation and mutagenesis (Henderson-Begg, et al., 2006, Prudhomme, et al., 2006, Gutierrez, et al., 2013). The ubiquitous nature of antibiotic resistance genes may also be due to horizontal gene transfer among strains of the naturally transformable Mitis group. Therefore, there is pressure to develop novel antibacterial alternatives.

Virulent phages may represent such an alternative strategy to combat antibiotic-resistant bacteria. Phages are recognized as the most abundant biological entities in the biosphere

(Serwer, et al., 2007). The study of phages of hemolytic streptococci began decades ago (Krause, 1957), and the vast majority of phages currently isolated from S. mitis and S. pneumoniae are temperate phages. In fact, both bacterial species contain many prophages in their genomes (Ramirez, et al., 1999, Romero, et al., 2009). Prophage carriage was identified in clinical isolates of S. pneumoniae by hybridation and also via induction by mitomycin C (Ramirez, et al., 1999, Romero, et al., 2009). At least seven phage-related gene clusters were detected in the genome of S. mitis B6 and two complete prophages (SM1 and phiB6) were isolated and sequenced (Siboo, et al., 2003, Denapaite, et al., 2010). Because temperate phages have the ability to transfer host DNA, which may encode virulence genes or toxins, into other bacterial strains (Gindreau, et al., 2000, Denapaite, et al., 2010), virulent phages are thought to be better suited for biocontrol purposes.

Very few lytic phages have been isolated for either of these two bacterial species. Despite the isolation of pneumophages, also called Omega phages (Tiraby, et al., 1975), only two virulent pneumococcus phages are readily available today. Phage Dp-1 was the first virulent pneumophage isolated in 1975 (McDonnell, et al., 1975, Tiraby, et al., 1975) and belongs to the Siphoviridae family. Phage Cp-1 was isolated in 1981 (Ronda, et al., 1981) and is a member of the Picovirinae subfamily of the Podoviridae family, with a linear double-stranded DNA genome (Martin, et al., 1998). One virulent phage of S. mitis, vB_SmM_GEC-SmitisM_2, was isolated in 2012 from sewage water and belongs to the Myoviridae family (Rigvava, et al., 2013).

Of interest, enzymes from virulent pneumococcal phages have also shown promise as antimicrobials (Nelson, et al., 2001, Loeffler, et al., 2003, Loeffler & Fischetti, 2003, Djurkovic, et al., 2005, McCullers, et al., 2007, Witzenrath, et al., 2009, Doehn, et al., 2013). At the end of their lytic cycle, virulent phages produce an enzyme [endolysin or lysin] that degrades the bacterial peptidoglycan to release new virions. A number of studies have demonstrated the potential of the lysin [Cpl-1] from phage Cp-1 to eradicate nasopharyngeal colonization and bacteremia (Loeffler, et al., 2003), and to prevent otitis media (McCullers, et al., 2007). The administration of Cpl-1 by inhalation (Doehn, et al.,

2013) or by repetitive intraperitoneal injections even rescued mice from severe pneumococcal pneumonia (Witzenrath, et al., 2009).

In this study, we show that the virulent pneumophages Dp-1 and Cp-1 can infect S. mitis. Microbiological assays and genomic analyses were performed to compare phage behavior in both bacterial species.

Materials and Methods

Bacterial strains and culture conditions The unencapsulated strain S. pneumoniae R6 (host of phage Cp-1), a derivative of S. pneumoniae strain R36A [host strain of phage Dp-1], was grown on TSA (Trypticase Soy

Agar) containing 5% sheep’s blood at 37°C in the presence of 5% CO2. Single colonies were suspended in filtered BHI (Brain heart infusion) broth containing 0.5% yeast extract and incubated at 37°C in the presence of 5% CO2. S. mitis CCRI-15019 was grown at 30°C in BHI supplemented with 0.2 mM magnesium sulfate and 0.25 mM calcium chloride to prevent cell aggregation. The bacterial strains are stored at the Félix d’Hérelle Reference Center for Bacterial Viruses (www.phage.ulaval.ca).

Bacterial species identification The bacterial housekeeping genes recA, recP, HexB, and xpt were amplified by PCR using the primers listed in Table S2.1 (McDonnell, et al., 1975). The PCR products were sequenced by the Plateforme de Séquençage et de Génotypage des Génomes service at the CHUL/CHUQ Research Center using the ABI data 3730XL DNA analyzer. Both DNA strands of the amplicons were sequenced using the same primer pairs used for PCR amplification. Sequences were aligned and analysed using the bioinformatics tools (Clustal W2 and BioEdit).

Phages Pneumophages Cp-1 (Ronda, et al., 1981) and Dp-1 (McDonnell, et al., 1975) were obtained from the Félix d’Hérelle Reference Center for Bacterial Viruses. For phage

47 amplification, and to facilitate enumeration, we used liquid BHI+ medium, which consisted of BHI supplemented with 8 µM MnCl2, 0.25 mM CaCl2, 0.2 mM MgSO4, Tris-HCl 50 Mm pH 7.5, 50 ng/µl choline chloride, 0.4% glycine, and 100 µl/ml catalase. Amplifications of phage Cp-1 on S. pneumoniae and on S. mitis were performed with agitation, as follows: a single colony, isolated from overnight culture on BHI blood agar, was used for cultivation in BHI. After overnight growth of the host strains an aliquot of the culture was transferred into fresh BHI and incubated until it reached an optical density at 600 nm (OD600nm) of 0.06-0.08. The culture was diluted with an equal volume of BHI+, phages were added and incubated overnight at 30°C. Phage titers were obtained using a standard, double-layer agar assay method. To maximize plaque visualization, the bottom layer of BHI+ contained 1.5% agarose while the top agar contained 0.4% agarose.

Microbiological assays Phage lytic development was assessed using a one-step growth curve assay, in triplicate, as described elsewhere (Moineau, et al., 1993). After overnight growth of the host strain in BHI, an aliquot of the culture was transferred into fresh BHI and incubated until it reached an OD600nm of 0.06-0.08. The bacterial culture was diluted 1:3 in BHI+ and then infected at a multiplicity of infection of 0.05 at 30°C. Phages were allowed to adsorb to the host cells for 10 min. Unadsorbed phages were removed by centrifugation, the bacterial pellet was washed twice with BHI media and then we proceeded as described elsewhere (Moineau, et al., 1993). The plates were incubated at 30°C overnight with 5% CO2, and the plaque forming units (PFU) were counted. The burst size was determined by calculating the ratio of the average phage titer after the exponential phase to the average titer before the infected cells began to release virions (Moineau, et al., 1993). Phage adsorption tests were also carried out on S. pneumoniae R6 and S. mitis CCRI-15019, in triplicate, essentially as previously reported (Duplessis & Moineau, 2001). Modifications: BHI+ broth was used,

CaCl2 was not added again at phage infection and the incubation was carried out at 30°C for 10 min.

Electron microscopy Phage preparations produced on S. pneumoniae and S. mitis were purified using a CsCl gradient, as previously described (Sambrook, et al., 1989). Phages were then centrifuged and 100 µl of the pellet were kept and washed with 1.5 ml of ammonium acetate (0.1 M, pH 7.5). This process was repeated twice and 100 µl from the final wash was retained for observation by transmission electron microscopy. Grid preparation and observation were performed as previously described (Rousseau & Moineau, 2009). Phages were observed at 80 kV using a JEOL 1230 transmission electron microscope.

Phage DNA preparation and sequencing Genomic DNAs of phages Cp-1 and Dp-1 amplified on S. mitis CCRI-15019 were isolated using a Lambda Maxi Kit (Qiagen). Phage Cp-1 DNA was also isolated after propagation on S. pneumoniae R6. Genome sequencing was performed on a 454 FLX instrument at the Plateforme d’Analyses Génomiques of the Université Laval (IBIS). The genomic sequences were completed by primer walking (primer sequences are listed in Table S2.1) and by sequencing of PCR products. All mutations were also confirmed by primer walking.

Phage genome analyses Genomic sequences were analyzed using BioEdit 7.2.0 (http://www.mbio.ncsu.edu/bioedit/bioedit.html) and the Staden package (Staden, et al., 2000, Kraemer, et al., 2009) (http://staden.sourceforge.net/). Sequence alignments were performed using BioEdit and Clustal W2 software (http://www.ebi.ac.uk/Tools/msa/clustalw2/). Open reading frames [ORFs] were identified using GenMark (http://exon.gatech.edu/) and ORFinder (http://www.ncbi .nlm.nih.gov/projects/gorf/). Sequences were considered to be ORFs if they showed a putative ribosome binding site (RBS) at a reasonable distance from the starting codon (AUG, UUG, or GUG) and they consisted of at least 29 amino acids (aa). Function was attributed to an ORF by comparing the translated product to proteins available at the National Center for Biotechnology Information (BLASTp, http://blast.ncbi.nlm.nih.gov/Blast.cgi). The annotations were reinforced by searching for protein functional domains using the NCBI Conserved Domain Database

(http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) and EMBL InterProScan (http://www.ebi.ac.uk/Tools/InterProScan/). The theoretical molecular masses [MM] and isoelectric points [pI] of each deduced phage protein were determined using the ProtParam software tool available on the bioinformatics resource portal ExPASy Web site (http://ca.expasy.org/tools/protparam.html). The genomes of phages Cp-1 and Dp-1 were searched for tRNAs using tRNAscan-SE (Lowe & Eddy, 1997) and BLASTn from NCBI. Bacterial codon usage for the host strains was obtained from the Kazusa DNA Research Institute database (http://www.kazusa.or.jp/codon/) while codon usage for the phages was determined using the DNA 2.0 web server (Menlo Park, CA); the frequency per thousand codons was then calculated. The complete genome sequence of phage SOCP has been deposited in GenBank under accession number KJ617393.

Results

Speciation of bacterial hosts The species identification of S. mitis from the closely related S. pneumoniae represents a challenge. For example, significant sequence conservation of the 16S rRNA gene sequence within the Mitis group limits the use of these sequences for species differentiation (Kilian, et al., 2008). To confirm the bacterial strains used in this study, degenerate primers were used and the PCR products of four housekeeping genes, recA, recP, hex B and xpt (Table S2.2) (Kilian, et al., 2008) were amplified and sequenced. Our results confirmed that the isolate CCRI-15019 is highly related to S. mitis B6 (Denapaite, et al., 2010). Our S. pneumoniae R6 and R36A strains were similarly confirmed.

Figure 2.1 Electron microscopy of virulent phage Dp-1 (A) and phage SOCP (D). Scale bars correspond to 50 nm. Photographic images (B, C, E, F) show plaques of phages Dp-1 and SOCP propagation in media containing agarose. Plaques produced by phage Dp-1 on strains S pneumoniae R6 (B) and S. mitis CCRI-15019 (C). Plaques produced by phage SOPC on strains S pneumoniae R6 (E) and S. mitis CCRI-15019 (F).

Morphological analysis of phages Dp-1 and SOCP As documented previously (Kilian, et al., 2008), phage Dp-1 belongs to the Siphoviridae family. It has an icosahedral capsid with an estimated diameter of 69.8 ± 1.2 nm (Fig. 2.1A) and a long non-contractile tail of 169.9 ± 3.6 nm in length and 19.6 ± 2 nm in width. Phage Cp-1, used in this study and stored at the d’Hérelle Center, was re-named SOCP due to genome variations (see below). Phage SOCP belongs to the Podoviridae family and has a hexagonal capsid of 65.8 ± 1.1 nm (top to bottom) and 42.1 ± 1.7 nm in width (Fig. 2.1D). This phage has a short non-contractile tail, 19.3 ± 1 nm in length and 7.5 ± 1.2 nm in width. Observations of phages Dp-1 and SOCP, amplified on both bacterial species, confirmed that the general morphology of these virions was not affected by growth in either hosts.

Microbiological assays One of the great difficulties of working with virulent pneumophages is the ability to visualize plaques consistently. We were able to observe plaques for both phages using BHI+ media (Figs. 2.1B & E). We also noticed that liquid cultures of S. pneumoniae grew

51 better in BHI+ when started from colonies grown on blood agar. Finally, replacing agar by agarose in both top and bottom media led to an improvement in the plaque size and visibility.

The availability of an improved plaque assay allowed us to investigate the host range of phages Dp-1 and SOCP. Interestingly, we observed that they could both replicate on a S. mitis strain (CCRI-15019). Moreover, even larger phage plaques were obtained on S. mitis, compared to S. pneumoniae host cells grown under the same conditions (Figs. 2.1BC & EF). To further investigate the behavior of the two phages on both bacterial species, one- step growth curve assays were performed using S. pneumoniae R6 and S. mitis CCRI- 15019. The latent period of phage Dp-1 was calculated to be 71 ± 4 min when amplified on S. pneumoniae and 59 ± 4 min on S. mitis. The burst sizes were 73 ± 6 plaque-forming units (PFU) per infected cell and 63 ± 6 PFU for S. pneumoniae and S. mitis, respectively. Similarly, the latent period of phage SOCP was estimated to be 78 ± 2 min on S. pneumoniae and 66 ± 5 min on S. mitis, while the burst size was 94 ± 4 PFU on its pneumococcal host and 53 ± 4 PFU on S. mitis. These data indicated a lower burst size for both phages on S. mitis cells but a shorter latent period.

Adsorption to the cell surface was also evaluated for the two phages on both strains. Under the conditions tested, the percentage of adsorption of phage Dp-1 on S. pneumoniae R6 was 95% ± 1.8% and was 79% ±1% on S. mitis. The adsorption of phage SOCP was 94% ± 0.6% on S. pneumoniae R6 and 86 ± 1.3% on S. mitis B6. Thus, both pneumophages could also readily adsorb to the S. mitis cell surface.

The efficacy of plaquing (EOP) of both phages on the two propagating hosts was determined. When phages Dp-1 and SOCP were amplified on their S. pneumoniae hosts they had EOPs of 10-1 and 10-4 on S. mitis, respectively. Similarly, when Dp-1 and SOCP were amplified on S. mitis, their EOPs on S. pneumoniae were 10-1 and 10-3, respectively. These data suggest the presence of host factors that modify the phage behavior.

Genome analysis To determine if replicating these phages on various hosts had an impact at the nucleotide level, we determined the complete genome sequence of both phages after amplification on S. pneumoniae or S. mitis. The double-stranded DNA (dsDNA) genome of phage Dp-1 is made of 56,506 bp. The analysis of the sequence found no nucleotide variation compared to the genomic sequence recently reported for Dp-1 (Sabri, et al., 2011). Moreover, the sequence was identical when Dp-1 was amplified on both S. pneumoniae and S. mitis hosts, indicating that propagating this siphophage on two distinct streptococcal species did not lead to genomic changes.

Similarly, the genome of the podophage was also identical when propagated on either S. pneumoniae or S. mitis. However, analysis of the genomic sequence of the phage Cp-1 used in this study showed variations compared to the GenBank sequence no. NC_001825.1. As indicated above, we thus renamed our Cp-1-like phage SOCP due to these differences. The dsDNA genome of SOCP is 19,347 bp long, while the reported genome of phage Cp-1 is 19,343 bp. Comparative analyses revealed 31 variations in the genome of SOCP as compared to Cp-1 (Table S2.3). These differences were confirmed through primer walking directly on the phage genome.

The genome of phage SOCP has a GC content of 38.8%. It has 27 open reading frames, each preceded by a putative ribosome-binding site (RBS) (Table 2.1). Putative functions could be attributed to only 12 ORFs (44%). Interestingly, we found two additional ORFs in SOCP as compared to Cp-1, namely ORF23 and ORF25 (Fig. 2.2). Of interest were also the products of genes orf5 and orf6, which likely code for DNA polymerase subunits (Mark & Richardson, 1976, Samson & Moineau, 2010), whereas only one (orf5) was found in Cp- 1. Conversely in the case of orf18, one gene was found in SOCP whereas it was split into two genes (orf17 and orf18) in Cp-1. The major capsid protein ORF10 was also affected by mutations, although its size remained the same (Table S2.3). Other notable ORFs containing mutations included the tail protein ORF19, the collar protein ORF12, as well as ORF4, ORF9, ORF12, ORF16, ORF23, ORF25, and ORF27.

Figure 2.2 Genome alignment of phages SOCP and Cp-1.The scale above the phage genome SOCP is in base pairs. Each arrow represents a gene, and the numbering for SOCP refers to Table 2.1. Some putative functions of the deduced proteins are indicated above the arrows (see Table 2.1 for details). Grey arrows indicate that no putative function was attributed to the deduced protein. Arrows with the same color indicate the same general function and have at least 90% identity at the amino acid level. Heterologous regions are shaded gray, and the shaded numbers indicate the number of base pairs between the corresponding gene sequences. Shadows light with colored contour highlight ORFs not found in the genome of phage Cp-1.

Three open reading frames were identified on the negative strand of the SOCP genome, specifically within three other ORFs (major capsid protein, tail protein and one hypothetical protein). These ORFs were not included in the annotation of the phage genome since no BLAST data support these proteins as valid protein products.

Table 1.1. Putative Open Reading Frames deduced from SOCP genome sequences and their predicted functions ORF Start End Strand Length Pi b Mw Putative RBS d Putative function Best hit ORF # of identical aa/ Length E-value Accession (aa) a (kDa) c and start codon with Blast in size of the (aa) number ‘Locus tag’ Cp-1 alignment (GenBank) e (% aa identity) 1 376 642 + 88 4.4 10.4 AAAGGAGAAAGAAAACATG Hypothetical protein Cp-1, p01 1 88/88(100%) 88 3E-57 NP_044813.1 2 657 947 + 96 6.6 11.7 AAAGGAGATAATAAAAATG Hypothetical protein Cp-1, p02 2 96/96(100%) 96 5E-61 NP_044814.1 3 1074 1346 + 90 4.7 10.5 AAAGGAGTAAAAGCACTTG Hypothetical protein Cp-1, p03 3 63/64(98%) 64 3E-36 NP_044815.1 4 1351 2043 + 230 10.1 26.7 AAGGGGTGTAATTAAATG Terminal protein Cp-1, p04 4 229/230(99%) 230 7E-165 NP_044816.1 5 2040 2609 + 189 4.6 22.1 AAAGAAGCGAGGGAAGAAGTG DNA polymerase Cp-1, p05 5 178/179(99%) 568 3E-123 NP_044817.1 6 2681 3745 + 354 6.8 40.8 AATCTTAGATGAAAAGGTG DNA polymerase Cp-1, p05 5 341/354(96%) 568 0 NP_044817.1 7 3702 4148 + 148 9.2 17.6 AAAGGGGGTACGCTGATTTATG Hypothetical protein Cp-1, p06 6 148/148(100%) 148 1E-100 NP_044818.1| 8 4141 4653 + 170 4.8 18.9 AAACGGAGATAAACAAAATG Hypothetical protein Cp-1, p07 7 170/170(100%) 170 5E-118 NP_044819.1 9 4875 5165 + 96 4.2 10.5 AAAGGAGAGGGCTATG Scaffolding protein Cp-1, p08 8 95/96(99%) 96 4E-59 NP_044820.1 10 5409 6506 + 365 5.4 41.7 AAGAGGGAGAAGAATAGAATG Major head protein Cp-1, p09 9 352/365(96%) 365 0 NP_044821.1 11 6563 7576 + 337 5.3 39.5 AAAGGGGACTAAATG Connector protein Cp-1, p11 10 337/337(100%) 337 0 NP_044823.1 12 7563 8210 + 215 5.1 24.7 AAAAGGAGGGGACAATCATTG Collar protein Cp-1, p12 11 192/194(99%) 194 2E-137 NP_044824.1 13 8223 8807 + 194 8.6 22.8 AAAGGTGTATAGATG Hypothetical protein Cp-1, p13 12 194/194(100%) 194 5E-140 NP_044825.1 14 8804 9118 + 104 5.8 11.9 AAAGAGGACATGAAAACCTATG Hypothetical protein Cp-1, p14 13 104/104(100%) 104 7E-67 NP_044826.1 15 9102 9989 + 295 4.9 32.9 AAAAAGAGGTAGAAACAAATG Hypothetical protein Cp-1, p15 14 295/295(100%) 295 0 NP_044827.1 16 10011 10787 + 258 5.0 29.4 AAAGGATTTTAAAACATG Hypothetical protein Cp-1, p16 15 192/207(93%) 288 4E-132 NP_044828.1 17 10787 11548 + 253 6.0 28.4 AGGAGGTATCTAATG Hypothetical protein Cp-1, p18 16 253/253(100%) 253 0 NP_044830.1 18 11515 13077 + 520 5.7 59.0 AAAGTCGGGTCAATG Tail protein Cp-1, p19 / 17 210/224(94%)/ 230 6e-149/ NP_044831.1 / Cp-1, p20 18 236/237(99%) /237 2E-164 NP_044832.1 19 13081 14919 + 612 4.8 67.5 AAAGGGTAAACAATG Tail protein Cp-1, p21 19 582/583(99%) 586 0 NP_044833.1 20 14993 16039 + 348 7.6 40.8 AAATGGTACAATCCGCAGAAAAT Encapsidation protein Cp-1, p23 20 348/348(100%) 360 0 NP_044835.1 G 21 16029 16433 + 134 7.9 15.5 AGGTTATCAATCATG Holin protein Cp-1, p24 21 134/134(100%) 134 1E-89 NP_044836.1 22 16433 17452 + 339 4.6 39.2 AAAGGAGAAAAGAAATAATG Lysozyme Cp-1, p25 22 339/339(100%) 339 0 NP_044837.1 23 17480 17896 - 139 5.62 15.8 AAAACGTAGGGGGTTAATACTAT Hypothetical protein SP058_003 24/65(37%) 234 6E+00 YP_008239483.1 G 95 24 17901 18143 - 80 9.9 9.4 AAATTGAGGTATTAAGAAAATG Hypothetical protein Cp-1, p26 c 80/80(100%) 80 5E-50 NP_044838.1

(orfc) 25 18148 18423 - 91 5.1 10.9 AAGGGACGGTTACTAGATG Hypothetical protein AGR66263 14/44(32%) 410 8E-01 gb|AGR66263.1 26 18424 18693 - 89 7.7 10.8 ACAAATAGGAGGGTAAACATG Hypothetical protein Cp-1, b 89/89(100%) 89 5E-58 NP_044839.1 p27(orfb) 27 18704 18973 - 89 5.0 10.2 AAAGAGGTATAACAAAATG Hypothetical protein Cp-1, p28 a 60/61(98%) 62 7E-35 NP_044840.1 (orfa) a Number of amino acids (aa), b IP, isoelectric point and c MM, molecular mass. d RBS, ribosomal binding site. Bases in bold correspond to nucleotides identical to the RBS consensus; lowercase indicates

Codon usage No tRNAs were found in either of the two pneumophages. Still, the codon usage frequency was investigated for the phage genomes and compared with the codon usage of S. pneumoniae and S. mitis (Table S2.4). The codon usage of pneumophages mostly corresponds to the codons most frequently used by these two bacteria, although the codon usage of the phages was closer to S. pneumoniae, suggesting that both phages are mode adapted to this bacterial species. In a few cases, some codons were over-represented in the phages as compared to the two bacterial hosts, likely to favor phage multiplication (Table S2.4).

Comparative genomics Protein-primed DNA replication was reported for phage Cp-1 (Martin, et al., 1996). Few other phages of the Podoviridae family replicate using this mechanism of DNA replication (Martin, et al., 1996, Kotsonis, et al., 2008, Longas, et al., 2008) and, in general, initiation of replication arises at the 3’ nucleotide of the DNA (Martin, et al., 1996). The genomes of phages SOCP and Cp-1 were aligned with the genomes of five phages infecting other Gram-positive bacteria, namely Bacillus subtilis phage phi29, Lactococcus lactis phage asccphi28, Weissella cibaria phage phiYS6 as well as Bacillus sp. phages GA-1 and Nf (Fig. 2.3). The genome organization of the two pneumophages is somewhat different from the other phages due to alternate orientations of some genes, although a few annotated proteins are related (Fig. 2.3). The genes coding for the DNA polymerase and terminal proteins are on the positive strand in one group (phage Cp-1, SOCP, phiYS61 and asccphi28) and on the opposite strand for another group (phage GA-1, Nf and phi29). Moreover, the genes for structural proteins in the lactococcal phage asccphi28 are in the opposite direction, compared to the other podophages shown in Fig. 2.3. Overall, a low level of identity was found between phages Cp-1/SOCP and these podophages, which is likely due to their distinct ecological niches and host strains.

Figure 2. 3 Comparison of the proteome of pneumophage SOCP/ Cp-1 with other related phages replicating through a protein priming DNA replication system. Phage genome sequences were downloaded from GenBank, aligned in BioEdit and each deduced protein was compared using BioEdit and protein BLAST. Arrows of the same color correspond to ORFs with the same general function.

Discussion

S. mitis is a species closely related to S. pneumoniae that colonizes the human oral cavity. Both species have emerged as multidrug-resistant pathogens due to their ability to acquire foreign DNA by natural competence. The genome of S. mitis has significant similarity to the genome of S. pneumoniae and shares a core of 900 genes (Denapaite, et al., 2010).

Since the publication of the S. mitis B6 genome, studies have been carried out to understand this relationship and a number of studies support the hypothesis of evolution of S. pneumoniae from S. mitis by acquisition of virulence factors and numerous sugar-related transport systems (Raskin, et al., 2006, Denapaite, et al., 2010). Other studies have proposed that a more likely concept is the evolution from a pathogenic bacterium, S. pneumoniae, to a commensal, S. mitis, through loss of virulence genes (Kilian, et al., 2008, Denapaite, et al., 2010). Virulence genes could also have been acquired through horizontal gene transfer between other related species (Zahner, et al., 2011). Many virulence factors are cell surface proteins that play a role in the interaction with host cells (Ikryannikova, et al., 2013). Other pneumococcal cell surface components such as choline-containing teichoic acid, are components of the Dp-1 phage receptors (Lopez, et al., 1982).

Here, we report that two pneumophages can efficiently replicate on a S. mitis strain. These two virulent phages were initially isolated from throat swabs of patients with upper respiratory infections – the natural habitat of S. mitis. The ability of phage Dp-1 to infect S. mitis may be related to the choline-binding proteins found in S. mitis (Lopez, et al., 1982). Homologues of pneumococcal surface choline-binding proteins are present in S. mitis but their role in this bacterium remains unknown (Mitchell, 2011). The host autolysin system, involved in pneumophage virion release (Ronda-Lain, et al., 1977), is also found in both S. pneumoniae and S. mitis (Sheppard, et al., 2004). The adsorption of phages Dp-1 and SOCP was slightly higher on the S. pneumoniae host compared to S. mitis and this may be due to the availability of phage receptors on the cell surface or differences in receptor sequences. It was previously reported that phage Cp-1 adsorbed very poorly to the host cell surface (Sheppard, et al., 2004). Phage SOPC adsorbed very well to its host as well as the S. mitis strain. This could be due to the mutations observed in the genome of SOCP or the experimental conditions used in our study.

The burst size and latent period reported here are rather different from previous studies for both pneumophages (Lopez, et al., 1977, Ronda, et al., 1981). Again, this could be due to the difference in experimental conditions and media used. For phage Dp-1, the host bacterial strain used by Lopez et al. (Lopez, et al., 1977) was S. pneumoniae R36A and in

our study we used the S. pneumoniae R6, a derivative of R36A. Likewise for phage SOCP, its burst size was much higher than reported for Cp-1 [41]. It is not known if this difference is due to the experimental conditions or the genomic variations. Of note, it was previously reported that phage Cp-1 can infect some Streptococcus oralis strains (Ronda, et al., 1989). SOCP can also infect a few S. oralis strains (data not shown).

In addition to the observations that pneumophages can replicate on S. mitis, the other most striking finding was the difference (0.16%) in the genome sequences between SOCP and Cp-1. The nature of such discrepancies remains unclear. Phage SOCP was retrieved from the Félix d’Hérelle Reference Center for Bacterial Viruses and was initially believed to be Cp-1. Either sequencing errors occurred in the original deposited sequence (GenBank no. Z47794) or a very efficient pneumophage was recovered. The latter could be due to phage host-adaptation, giving SOCP the ability to efficiently infect its hosts (Benmayor, et al., 2009). It has been reported that viral adaptation occurs through numerous mutations in the genome at low frequency that increases fitness of the phage (Benmayor, et al., 2009, Hall, et al., 2013). It will thus be interesting to assess whether some of the nucleotide variations detected in SOCP are enabling such increased fitness.

This study on virulent phages provides another example of the relatedness of S. pneumoniae and S. mitis. Both species also carry numerous temperate phages in their genomes that are probably involved in their evolution. Further study is needed to identify most of the hypothetical genes in phage SOCP as well as to increase our understanding of phage-host interactions, with a goal of eventually using virulent streptococcal phages in medical applications.

Acknowledgments

We are grateful to M. Boissinot for the Streptococcus mitis strain CCRI-15019 and to D. Tremblay for electron microscopy.

References

Arai, J., M. Hotomi, S. K. Hollingshead, Y. Ueno, D. E. Briles, and N. Yamanaka. 2011. Streptococcus pneumoniae isolates from middle ear fluid and nasopharynx of children with acute otitis media exhibit phase variation. J Clin Microbiol 49:1646-1649. Arbique, J. C., C. Poyart, P. Trieu-Cuot, G. Quesne, G. Carvalho Mda, A. G. Steigerwalt, R. E. Morey, D. Jackson, R. J. Davidson, and R. R. Facklam. 2004. Accuracy of phenotypic and genotypic testing for identification of Streptococcus pneumoniae and description of Streptococcus pseudopneumoniae sp. nov. J Clin Microbiol 42:4686- 4696. Benmayor, R., D. J. Hodgson, G. G. Perron, and A. Buckling. 2009. Host mixing and disease emergence. Curr Biol 19:764-767. Carrascosa, M., J. L. Perez-Castrillon, I. Sampedro, R. Valle, L. Cillero, and M. A. Mendez. 1994. Lung abscess due to Streptococcus mitis: case report and review. Clin Infect Dis 19:781-783. Denapaite, D., R. Bruckner, M. Nuhn, P. Reichmann, B. Henrich, P. Maurer, Y. Schahle, P. Selbmann, W. Zimmermann, R. Wambutt, and R. Hakenbeck. 2010. The genome of Streptococcus mitis B6--what is a commensal? PLoS One 5:e9426. Djurkovic, S., J. M. Loeffler, and V. A. Fischetti. 2005. Synergistic killing of Streptococcus pneumoniae with the bacteriophage lytic enzyme Cpl-1 and penicillin or gentamicin depends on the level of penicillin resistance. Antimicrob Agents Chemother 49:1225- 1228. Doehn, J. M., K. Fischer, K. Reppe, B. Gutbier, T. Tschernig, A. C. Hocke, V. A. Fischetti, J. Loffler, N. Suttorp, S. Hippenstiel, and M. Witzenrath. 2013. Delivery of the endolysin Cpl-1 by inhalation rescues mice with fatal pneumococcal pneumonia. J Antimicrob Chemother 68:2111-2117. Doern, C. D., and C. A. Burnham. 2010. It's not easy being green: the viridans group streptococci, with a focus on pediatric clinical manifestations. J Clin Microbiol 48:3829-3835. Donkor, E. S. 2013. Understanding the pneumococcus: transmission and evolution. Front Cell Infect Microbiol 3:7. Duplessis, M., and S. Moineau. 2001. Identification of a genetic determinant responsible for host specificity in Streptococcus thermophilus bacteriophages. Mol Microbiol 41:325- 336. Gindreau, E., R. Lopez, and P. Garcia. 2000. MM1, a temperate bacteriophage of the type 23F Spanish/USA multiresistant epidemic clone of Streptococcus pneumoniae: structural analysis of the site-specific integration system. J Virol 74:7803-7813. Gutierrez, A., L. Laureti, S. Crussard, H. Abida, A. Rodriguez-Rojas, J. Blazquez, Z. Baharoglu, D. Mazel, F. Darfeuille, J. Vogel, and I. Matic. 2013. Beta-Lactam antibiotics promote bacterial mutagenesis via an RpoS-mediated reduction in replication fidelity. Nat Commun 4:1610. Hall, J. P., E. Harrison, and M. A. Brockhurst. 2013. Viral host-adaptation: insights from evolution experiments with phages. Curr Opin Virol 3:572-577. Henderson-Begg, S. K., D. M. Livermore, and L. M. Hall. 2006. Effect of subinhibitory concentrations of antibiotics on mutation frequency in Streptococcus pneumoniae. J Antimicrob Chemother 57:849-854.

Ikryannikova, L. N., A. V. Filimonova, M. V. Malakhova, T. Savinova, O. Filimonova, E. N. Ilina, V. A. Dubovickaya, S. V. Sidorenko, and V. M. Govorun. 2013. Discrimination between Streptococcus pneumoniae and Streptococcus mitis based on sorting of their MALDI mass spectra. Clin Microbio Infect 19:1066-1071. Joyce, E. A., S. J. Popper, and S. Falkow. 2009. Streptococcus pneumoniae nasopharyngeal colonization induces type I interferons and interferon-induced gene expression. BMC Genomics 10:404. Kilian, M., K. Poulsen, T. Blomqvist, L. S. Havarstein, M. Bek-Thomsen, H. Tettelin, and U. B. Sorensen. 2008. Evolution of Streptococcus pneumoniae and its close commensal relatives. PLoS One 3:e2683. Kotsonis, S. E., I. B. Powell, C. J. Pillidge, G. K. Limsowtin, A. J. Hillier, and B. E. Davidson. 2008. Characterization and genomic analysis of phage asccphi28, a phage of the family Podoviridae infecting Lactococcus lactis. Appl Environ Microbiol 74:3453- 3460. Kraemer, L., B. Beszteri, S. Gabler-Schwarz, C. Held, F. Leese, C. Mayer, K. Pohlmann, and S. Frickenhaus. 2009. STAMP: extensions to the STADEN sequence analysis package for high throughput interactive microsatellite marker design. BMC Bioinformatics 10:41. Krause, R. M. 1957. Studies on bacteriophages of hemolytic streptococci. I. Factors influencing the interaction of phage and susceptible host cell. J Exp Med 106:365-384. Loeffler, J. M., S. Djurkovic, and V. A. Fischetti. 2003. Phage lytic enzyme Cpl-1 as a novel antimicrobial for pneumococcal bacteremia. Infect Immun 71:6199-6204. Loeffler, J. M., and V. A. Fischetti. 2003. Synergistic lethal effect of a combination of phage lytic enzymes with different activities on penicillin-sensitive and -resistant Streptococcus pneumoniae strains. Antimicrob Agents Chemother 47:375-377. Longas, E., L. Villar, J. M. Lazaro, M. de Vega, and M. Salas. 2008. Phage phi29 and Nf terminal protein-priming domain specifies the internal template nucleotide to initiate DNA replication. Proc Natl Acad Sci U S A 105:18290-18295. Lopez, R., E. Garcia, P. Garcia, C. Ronda, and A. Tomasz. 1982. Choline-containing bacteriophage receptors in Streptococcus pneumoniae. J Bacteriol 151:1581-1590. Lopez, R., C. Ronda, A. Tomasz, and A. Portoles. 1977. Properties of "diplophage": a lipid- containing bacteriophage. J Virol 24:201-210. Lowe, T. M., and S. R. Eddy. 1997. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res 25:955-964. Madhour, A., P. Maurer, and R. Hakenbeck. 2011. Cell surface proteins in S. pneumoniae, S. mitis and S. oralis. Iran J Microbiol 3:58-67. Mark, D. F., and C. C. Richardson. 1976. Escherichia coli thioredoxin: a subunit of bacteriophage T7 DNA polymerase. Proc Natl Acad Sci U S A 73:780-784. Martin, A. C., L. Blanco, P. Garcia, M. Salas, and J. Mendez. 1996. In vitro protein-primed initiation of pneumococcal phage Cp-1 DNA replication occurs at the third 3' nucleotide of the linear template: a stepwise sliding-back mechanism. J Mol Biol 260:369-377. Martin, A. C., R. Lopez, and P. Garcia. 1998. Pneumococcal bacteriophage Cp-1 encodes its own protease essential for phage maturation. J Virol 72:3491-3494. McCullers, J. A., A. Karlstrom, A. R. Iverson, J. M. Loeffler, and V. A. Fischetti. 2007. Novel strategy to prevent otitis media caused by colonizing Streptococcus pneumoniae. PLoS Pathog 3:e28. McDonnell, M., R. Lain, and A. Tomasz. 1975. "Diplophage": a bacteriophage of Diplococcus pneumoniae. Virology 63:577-582.

Mitchell, J. 2011. Streptococcus mitis: walking the line between commensalism and pathogenesis. Mol Oral Microbiol 26:89-98. Moineau, S., E. Durmaz, S. Pandian, and T. R. Klaenhammer. 1993. Differentiation of two abortive mechanisms by using monoclonal antibodies directed toward lactococcal bacteriophage capsid proteins. Appl Environ Microbiol 59:208-212. Nelson, D., L. Loomis, and V. A. Fischetti. 2001. Prevention and elimination of upper respiratory colonization of mice by group A streptococci by using a bacteriophage lytic enzyme. Proc Natl Acad Sci U S A 98:4107-4112. Prudhomme, M., L. Attaiech, G. Sanchez, B. Martin, and J. P. Claverys. 2006. Antibiotic stress induces genetic transformability in the human pathogen Streptococcus pneumoniae. Science 313:89-92. Ramirez, M., E. Severina, and A. Tomasz. 1999. A high incidence of prophage carriage among natural isolates of Streptococcus pneumoniae. J Bacteriol 181:3618-3625. Raskin, D. M., R. Seshadri, S. U. Pukatzki, and J. J. Mekalanos. 2006. Bacterial genomics and pathogen evolution. Cell 124:703-714. Rigvava, S., I. Tchgkonia, D. Jgenti, T. Dvalidze, J. Carpino, and M. Goderdzishvili. 2013. Comparative analysis of the biological and physical properties of Enterococcus faecalis bacteriophage vB_EfaS_GEC-EfS_3 and Streptococcus mitis bacteriophage vB_SmM_GEC-SmitisM_2. Can J Microbiol 59:18-21. Romero, P., N. J. Croucher, N. L. Hiller, F. Z. Hu, G. D. Ehrlich, S. D. Bentley, E. Garcia, and T. J. Mitchell. 2009. Comparative genomic analysis of ten Streptococcus pneumoniae temperate bacteriophages. J Bacteriol 191:4854-4862. Ronda-Lain, C., R. Lopez, A. Tapia, and A. Tomasz. 1977. Role of the pneumococcal autolysin (murein hydrolase) in the release of progeny bacteriophage and in the bacteriophage-induced lysis of the host cells. J Virol 21:366-374. Ronda, C., J. L. Garcia, and R. Lopez. 1989. Infection of Streptococcus oralis NCTC 11427 by pneumococcal phages. FEMS Microbiol Lett 53:187-192. Ronda, C., R. Lopez, and E. Garcia. 1981. Isolation and characterization of a new bacteriophage, Cp-1, infecting Streptococcus pneumoniae. J Virol 40:551-559. Rousseau, G. M., and S. Moineau. 2009. Evolution of Lactococcus lactis Phages within a Cheese Factory. App Enviro Microbio 75:5336-5344. Rukke, H. V., I. K. Hegna, and F. C. Petersen. 2012. Identification of a functional capsule locus in Streptococcus mitis. Mol Oral Microbiol 27:95-108. Sabri, M., R. Hauser, M. Ouellette, J. Liu, M. Dehbi, G. Moeck, E. Garcia, B. Titz, P. Uetz, and S. Moineau. 2011. Genome annotation and intraviral interactome for the Streptococcus pneumoniae virulent phage Dp-1. J Bacteriol 193:551-562. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor, N.Y: CSH Protoc; 3v p. Samson, J. E., and S. Moineau. 2010. Characterization of Lactococcus lactis phage 949 and comparison with other lactococcal phages. Appl Environ Microbiol 76:6843-6852. Serwer, P., S. J. Hayes, J. A. Thomas, and S. C. Hardies. 2007. Propagating the missing bacteriophages: a large bacteriophage in a new class. Virol J 4:21. Sheppard, C. L., T. G. Harrison, R. Morris, A. Hogan, and R. C. George. 2004. Autolysin- targeted LightCycler assay including internal process control for detection of Streptococcus pneumoniae DNA in clinical samples. J Med Microbiol 53:189-195. Siboo, I. R., B. A. Bensing, and P. M. Sullam. 2003. Genomic organization and molecular characterization of SM1, a temperate bacteriophage of Streptococcus mitis. J Bacteriol 185:6968-6975.

Staden, R., K. F. Beal, and J. K. Bonfield. 2000. The Staden package, 1998. Methods Mol Biol 132:115-130. Sunderkotter, C., and K. Becker. 2014. Systemic therapy with antibiotics: overview of important antibiotics in dermatology. Hautarzt 65:113-124. Tiraby, J. G., E. Tiraby, and M. S. Fox. 1975. Pneumococcal bacteriophages. Virology 68:566-569. Witzenrath, M., B. Schmeck, J. M. Doehn, T. Tschernig, J. Zahlten, J. M. Loeffler, M. Zemlin, H. Muller, B. Gutbier, H. Schutte, S. Hippenstiel, V. A. Fischetti, N. Suttorp, and S. Rosseau. 2009. Systemic use of the endolysin Cpl-1 rescues mice with fatal pneumococcal pneumonia. Crit Care Med 37:642-649. Zahner, D., A. R. Gandhi, H. Yi, and D. S. Stephens. 2011. Mitis group streptococci express variable pilus islet 2 pili. PLoS One 6:e25124.

Supporting information

Table S2.1 Primers used in this study to confirm variations within the genome of phage SOCP. Primer pair Primer sequence (5’-3’) PCR size name (bp) p1 F : CGCTGATTTTAAACAATAATGTGAATATTTTG 1442 R : TTCAAGTTTAATCTCATTTCCTAGGTCTAC p2 F : CGTACTCAAGTATTTGGCAATCATG 725 R : GAGATTATGAAAGAATATGATAAATTCATCTTCTCC p3 F : GATTAAGCCAGAATGGATTGACTACA 1054 R : CTCTATATACAGTTTAGAGCGTAAATATTTTG p4 F : CCTTGAAAAGCCTTACAGGTTTATC 1425 R : GAAAATTCTGCTGAGATAACCAGATATTG p5 F : CGATTGCAACCTTTTTAAAATCCAGATATAG 1094 R : GGTTTCTTTTAGTCCTGTGATGTTCA p6 F : CTTTGCTTATCCGTAGATACATGGAG 1280 R : CTATCTGTCCTTGTCCTATCCATTG p7 F : GACGTTCTCTATATCAATGAAGATGCTAC 960 R : CCACTGTCCTATCCCAATACCTATC p8 F : GATAGGACAGTGGACGGGAC 814 R : CTAACTGTCTATCTCCTGTGTTACC p9 F : GCTATGACGTTATAGAACAAAATTATGC 663 R : GCTTCTGCGTCATTCAAAATAGC p10 F : GTCTCCCTAGCTCAAAAAGAAATCA 812 R : CGAGATACCTCTTTTTACTGGTAACG p11 F : GCTAGTAGGATTTTCCTACTAGCTG 1167 R : GTTTCCAGACGATAAACTGGAAAC F, forward; R, reverse.

Table S2.2 Primer sequences of four housekeeping genes. Locus Gene Primer sequence 5’-3’ Reference tag rec A Recombinase F: GCCTTYATCGATGCBGARCA (Zbinden, et al., 2011)

R: GTTTCCGGRTTDCCRAACAT rec P Transketolase F: ACCGCGACCGCTTTATTCTTTC (Whatmore, et al., 2000)

R: ATGCTGACTACGCGGGATTTTTC hex B DNA mismatch repair F: CCATTGACGCGGGCTCTA (Whatmore, et al., 2000)

R: CCTGAATACGTCGGAACATCTTT xpt Xanthine F: GAAATTATTAGAAGARCGCATC (Whatmore, et al., 2000) phosphoribosyltransferase R: TTAGAGATCTGCCTCCWTARAA

F, forward; R, reverse.

Table S2.1 Differences between the genomes of phage SOCP and Cp-1. Phage mutation Phage Cp-1 Amino acid variation SOCP Cp-1 Positiona Putative functiona SOCP CP-1 G C 1870 Terminal protein Ala Arg C G 1871 Terminal protein - T 2579 DNA polymerase Leu Phe A - Between 2701-2102 DNA polymerase Ala His - G 2747 DNA polymerase Gly Ala A G 3116 DNA polymerase Thr His G A 3118 DNA polymerase Gly Asp T C 5036 Scaffolding protein Leu Pro - T 5197 Non-coding region C - Between 5338-5339 Non-coding region A - Between 5959-5960 Major capsid protein Lys Arg - C 6003 Major capsid protein Asp Thr G C 8137 Collar protein Ala Arg C G 8138 Collar protein G - Between 10578-10579 Hypothetical protein Ala Leu A - Between 12206-12207 Tail protein Arg Ser G - Between 13027-13028 Tail protein Gln His G - Between 13027-13028 Tail protein Ala G - Between 13163-13164 Tail protein Gly Arg A T 13669 Tail protein Glu Val C G 14955 Encapsidation protein Ala Glu G - Between 17703-17704 Non-coding region G - Between 17799-17800 Non-coding region - C 18220 Non-coding region - G 18261 Non-coding region T - Between 18266-18267 Non-coding region G - Between 18266-18267 Non-coding region - G 18275 Non-coding region A T 18747 Non-coding region A G 18748 Non-coding region - C 18787 Hypothetical protein Asp Glu a relative to the genome of phage Cp-1. - absence of the nucleotide.

Table S2.2 Codon usage of pneumophages Dp-1 and SOCP for selected amino acids compared to the hosts S. pneumoniae and S. mitis. Phage Bacteria

Amino acid Codon Dp-1 SOCP S. pneumoniae S. mitis Ala GCG 8.4 7.5 8 3.3 GCT 28.5 21.4 30.4 27.4 GCC 8.4 11.4 15.8 7.7 Arg AGG 5.0 3.0 2.0 3.3 AGA 10.6 11.4 7.0 10.9 CGG 1.8 3.8 1.9 0.0 Asn AAC 20.8 38.3 14.1 20.8 Asp GAC 36.8 36.6 17.8 28.4 Cys TGC 3.4 3.2 1.7 0.0 Gln CAA 30.1 24.2 26.7 15.3 Glu GAA 58.3 49.5 51.1 47.0 Gly GGC 10.8 11.7 9.1 23.0 GGG 28.0 13.9 8.5 8.8 Ile ATC 17.7 24.7 25.1 15.3 ATT 41.7 30.9 39.5 33.9 Leu TTA 12.8 21.1 20 32.8 CTG 11.6 8.1 9 3.3 CTC 8.1 4.7 12.4 0.0 Lys AAA 44.0 50.1 43.2 47.0 AAG 28.4 28.1 24.5 30.6 Phe TTC 22.0 14.4 13.7 17.5 Pro CCC 1.6 3.5 2.9 1.1 Ser AGC 9.7 17.4 8.2 5.5 TCA 17.1 17.4 15.9 17.5 TCC 4.2 3.3 5.1 4.4 TCG 6.9 1.3 3.8 1.1 Thr ACA 14.8 22.7 18.5 23.0 ACC 8.4 10.4 12 4.4 Val GTA 15.4 18.5 14.4 23.0 GTC 14.2 8.0 15.1 8.8 GTG 8.1 10.4 12.2 8.8 GTT 27.4 18.0 27.4 25.2 Tyr TAC 24.3 18.2 13.2 25.2 End TAA 2.0 4.2 2.1 3.3 TAG 1.2 0.8 0.8 0.0 The values represent the frequency of codon usage per thousand. The phage preferentially used codons for each amino acid are displayed in bold.

Chapitre 3. Identification of host factors involved in the interaction of Streptococcus pneumoniae with its virulent phages

Résumé

Streptococcus pneumoniae est une bactérie pathogène, responsable d'un large éventail de maladie. L'apparition de souches de pneumocoques résistantes et multirésistantes aux antibiotiques souligne l’importance de trouver de nouvelles alternatives thérapeutiques. La phagothérapie est une alternative prometteuse. Lors de l'infection d'une cellule bactérienne par un phage, de nombreuses interactions se produisent entre les protéines bactériennes et phagiques. Cependant, notre compréhension de ces interactions phage-hôte et les facteurs hôtes impliqués dans ce processus est limitée. Nous avons étudié les interactions entre S. pneumoniae et deux pneumophages virulents SOCP (famille Podoviridae) et Dp-1 (Siphoviridae) en nous basant sur les données récentes d’interactome réalisés in vitro par la technique du double hybride. Plus précisément, nous avons étudié l'implication de 36 gènes identifiés de S. pneumoniae dans la réplication des phages. L’importance de chaque gène de l’hôte dans le processus d’infection phagique a été évaluée en inactivant les gènes dans la souche S. pneumoniae R6 puis en testant l’effet de cette inactivation sur la multiplication des phages Dp-1 et SOCP, individuellement et les deux ensembles. Des essais d'infection par des phages ont révélé qu'au moins six gènes pneumococciques sont absolument nécessaires pour la réplication du phage Dp-1 et un gène dans le cas du SOCP. Des essais de complémentation ont restauré le phénotype de sensibilité aux phages. De plus, nous avons identifié d'autres gènes hôtes qui réduisaient l'efficacité de la réplication des phages. Par ailleurs, nous avons aussi identifié huit nouveaux gènes de S. pneumoniae qui semblent être essentiels pour la croissance du pneumocoque et, ces gènes peuvent représenter de nouvelles cibles médicamenteuses. Cette étude donne un aperçu du réseau complexe impliqué dans les interactions phage-hôte.

Avant-propos

Contributions des auteurs

J’ai réalisé toutes les expériences, analysé les résultats et rédigé l’article au complet. Le professeur Sylvain Moineau a supervisé le projet et co-rédigé le manuscrit.

Publication

S. Ouennane and S. Moineau. Identification of host factors involved in the interaction of Streptococcus pneumoniae with its virulent phages. In preparation for submission.

Abstract

Streptococcus pneumoniae is a human respiratory pathogen responsible for a wide range of diseases. The emergence of antibiotic-resistant pneumococcal strains highlights the need for alternative therapeutic options. One such option is phage therapy. During phage infection of a bacterial cell, many interactions occur between bacterial and phage proteins; however, our understanding of these phage-host interactions and the host factors involved in this process is limited. We investigated the interactions between S. pneumoniae and two pneumococcal virulent phages, SOCP (Podoviridae family) and Dp-1 (Siphoviridae) by exploiting the recently published in vitro interactome obtained using the yeast two-hybrid system. Specifically, we characterized 36 pneumococcal genes identified as potential host factors involved in phage replication by inactivating each of them and testing for resistance to phages SOCP and Dp-1, individually and in combination. Phage infection assays revealed that at least six pneumococcal genes are necessary for phage Dp-1 replication and one gene for phage SOCP. Complementation assays restored the phage-sensitivity phenotype. We also identified other host genes that reduced the efficiency of phage replication. Finally, we identified eight new S. pneumoniae genes that appear to be essential for pneumococcal growth and, as such, they may represent new drug targets. This study offers a glimpse of the complex network involved in phage-host interactions.

Keywords: Streptococcus pneumoniae, virulent phage, phage therapy, host-phage interactions, phage cocktail.

Introduction

Streptococcus pneumoniae (pneumococcus) is the leading cause of community-acquired pneumonia (CAP) worldwide, estimated to cause one million infections each year, in particular among children and the elderly (O'Brien, et al., 2009, Donkor, 2013). Humans are the only recognized natural hosts of S. pneumoniae (Lu, et al., 2008). The pneumococcus can also adhere to the nasopharyngeal epithelium and colonize the mucosal surface of the upper respiratory tract of healthy individuals. Beside asymptomatic carriage, S. pneumoniae is responsible for serious infections, invasive and non-invasive diseases, including bacteremia, meningitis, pneumonia, otitis media and sinusitis (Valentino, et al., 2014). The mechanisms involved in pneumococcal translocation from the nasopharynx to the lung or blood remain poorly understood (Marks, et al., 2013). Despite advances in antibiotic therapy and the availability of vaccinations, these pneumococcal diseases are still serious issues. Over 90 pneumococcal capsule serotypes have been identified (Park, et al., 2007, Calix & Nahm, 2010, Nahm, et al., 2011) and this diversity impedes the development of a universal vaccine. In addition, widespread antibiotic resistance among strains of S. pneumoniae has become a challenge (Domingues, et al., 2012). Taken together, S. pneumoniae infections have become a serious global public health concern and alternative treatment strategies are needed.

Bacteriophage therapy or phage by-products may represent alternative approaches against bacterial infectious agents. Phages and bacteria are the most abundant biological entities on the planet and are in a constant arms race (Hendrix, 2002, Hendrix, 2003, Morris, et al., 2008). For several decades, phages have been used to control specific bacterial infections in Eastern Europe, the former Soviet Union and Georgia (Sulakvelidze, et al., 2001, Abedon, et al., 2011). While phages are potentially attractive therapeutic agents, many questions remain to ensure efficient application. Our understanding of phage-host interactions is still

scant for many bacteria, including the intracellular factors needed for efficient phage replication. It is also unclear how to limit the development of phage resistance (Vieira, et al., 2012). Therefore, the application of phages as therapeutic or biocontrol agents requires more knowledge of the complex interactions between bacteria and phages.

After phage infection, a virulent phage typically hijacks the bacterial host machinery through various interactions involving the participation of host factors to ensure phage replication. However, knowledge of these bacterial factors involved during phage infection has been lacking for most phage-host systems, including in S. pneumoniae.

Recently, a genomic approach was used to study the interactions between S. pneumoniae and two virulent phages (Leprohon, et al., 2015). Specifically, natural S. pneumoniae mutants were selected for resistance to the virulent phages SOCP or Dp-1. Mutations in a GntR-type regulator, in a glycerophosphoryl phosphodiesterase and in a Mur ligase were responsible for resistance to phage SOCP. Resistance to Dp-1 resulted from mutations in a gene coding for a type IV restriction endonuclease (Leprohon, et al., 2015). In another study, a yeast-two hybrid approach was used to screen a collection of 1,704 prey clones derived from S. pneumoniae host with all 28 genes of phage Cp-1 (a derivative of SOCP phage) as well as the 72 genes of phage Dp-1 (Mariano, et al., 2016). The Cp-1 screens found 11 interactions between 7 phage and 10 host proteins, while the Dp-1 screens identified 38 interactions between 19 Dp-1 and 24 proteins of S. pneumoniae. The biological significance of these in vitro interactions remains unknown. Overall, the Y2H analysis revealed 49 unique host-phage interactions with 36 S. pneumoniae genes/proteins with the two pneumococcal phages.

To further our understanding of the S. pneumoniae host factors required to replicate the virulent pneumophages SOCP and Dp-1, we used the host genes detected in the Y2H screen (Mariano, et al., 2016). First, we investigated the importance of these genes for bacterial growth and identified new potential essential genes that may become novel drug targets. Then, we independently inactivated each non-essential gene in S. pneumoniae R6 and tested for resistance to each phage or to a cocktail of both phages. We also investigated

the effects of complementation of these S. pneumoniae genes on phage replication. Finally, we carried out additional bioinformatics analyses to build a network of host factors that participate in or are affected by the phage infection process.

Results

S. pneumoniae genes of interest First, we investigated whether the yeast two-hybrid in vitro data (Mariano, et al., 2016) could be confirmed in an in vivo model of S. pneumoniae. Figure 3.1 and Table 3.1 summarize the 36 pneumococcal genes previously identified in these in vitro interactions. Phages SOCP (Podoviridae) and Dp-1 (Siphoviridae) shared interactions with only two host proteins, the Holliday junction DNA helicase RuvB (Sp_0259) and a DeoR family transcriptional regulator (Sp_2168). The 36 deduced proteins of S. pneumoniae were classified using COG (Clusters of Orthologous Groups of proteins) functional categories (http://www.ncbi.nlm.nih.gov/COG/) and the Comprehensive Microbial Resource (CMR) (http://cmr.jcvi.org/cgi bin/CMR/CmrHomePage.cgi,) (Fig 3.1C). Table 3.1 showed that phage proteins appear to interact with a wide variety of bacterial processes involved in metabolism, signalling, information storage, and processing. Also, some pneumococcal genes encoded hypothetical proteins for which no putative function could be inferred (Table 3.1). Based on previous studies (Lee, et al., 1999, Thanassi, et al., 2002, Song, et al., 2005, van Opijnen, et al., 2009), 13 out of these 36 pneumococcal genes appeared to be essential for the growth of S. pneumoniae (Table 3.1).

Figure 3. 1 Schematic representation of the genes involved in host-phage interaction based on the results of the yeast two-hybrid screens of Mariano et al. (A) and (B) genome organization of phages Dp-1 and SOCP. The open reading frames and directions of transcription of the phages genes involved in host interactions are indicated in color. (C) Classification, based on function, of the pneumococcal genes/proteins reported to interact with pneumophages using COG (Clusters of Orthologous Groups of proteins) functional categories and the Comprehensive Microbial Resource (CMR).

Gene knockout and identification of potential essential genes To evaluate the effect of these genes on bacterial growth and cell behavior, and to identify host factors involved in phage interactions in vivo, we tried to inactivate each of the 36 pneumococcal genes using insertional mutagenesis. For each gene, we cloned an internal gene fragment into the plasmid pFF3, which does not replicate in S. pneumoniae. The constructs were then transformed into S. pneumoniae strain R6 gene to inactivate the genes by homologous recombination (Mortier-Barriere, et al., 1997). We used the strain R6, which is an unencapsulated avirulent strain, because it is sensitive to both phages. Of note, these pneumococcal genes have similar or identical orthologues in S. pneumoniae TIGR4, a capsulated and pathogenic strain.

The gene knockout assay also allowed to evaluate which genes were essential for S. pneumoniae growth. Mutated strains in which gene inactivation still permitted colony formation in the presence of chloramphenicol indicated that the gene was non-essential. When gene disruption inhibited cell growth and did not allow colony formation, we considered it a potential essential gene for the growth of S. pneumoniae, as described elsewhere (Thanassi, et al., 2002). When we did not obtain colonies, we repeated the gene disruption assay two more times. For each experiment, we also included two controls, one to inactivate the non-essential gene LytA (major autolysin), which led to colonies, and another to inactivate the essential gene FtsZ (cell division protein), which led to no colonies.

The constructs were designed so that flanking genes and intergenic regions, including potential promoters, would remain intact to minimize possible polar effects. Southern blots were used to confirm the gene knockouts (data not shown). Table 3.2 shows the results for all disrupted genes. Of 36 disrupted genes, 17 were likely to be essential genes for growth of S. pneumoniae. Of these 17 genes, nine had already been reported to be essential for S. pneumoniae (Lee, et al., 1999, Thanassi, et al., 2002, Song, et al., 2005, van Opijnen, et al., 2009).

Table 3.1 A summary and general function of S. pneumoniae genes and the lytic phages used in this study, based on Y2H screens by Mariano et al. b. Phage SOCP a. Gene symbol Gene description R6 TIGR4 ORF Putative function Host protein interaction spr0177 Sp_0194 Hypothetical protein orf6 Hypothetical protein Sp_1713 spr0761 Sp_0859 Uncharacterized membrane protein orf10 Connector protein Sp_1354 Sp_1881

spr0966 Sp_1088 Hypothetical protein* - orf16 Hypothetical protein Sp_0259

spr1041 Sp_1153 Hypothetical protein Cp orf17 Tail protein Sp_0979

spr1094 Sp_1213 Hypothetical protein SO

spr1356 Sp_1504 Hypothetical protein ge orf21 Holin protein Sp_1208 Poorly

spr1391 Sp_1536 Hypothetical protein Pha orfb Hypothetical protein Sp_0859 Sp_1213

characterized Sp_1980 Sp_2168 spr1576 Sp_1731 Uncharacterized membrane protein spr1934 Sp_2125 Hypothetical protein orfc Hypothetical protein Sp_0979 spr0402 Sp_0446 Acetolactate synthase, small subunit c. Phage Dp-1 spr0602 Sp_0687 ABC transporter, ATP-binding protein ORF Putative function Host protein interaction

spr0882 Sp_0979 Oligopeptidase F * orf4 Queuosine biosynthesis protein QueE Sp_2036 spr1090 Sp_1208 Uridine kinase orf9 Hypothetical protein Sp_0259 Sp_1395 spr1596 Sp_1751 Magnesium transporter Sp_1504 Sp_2168 spr1825 Sp_2012 Glyceraldehyde 3-phosphate dehydrogenase * orf12 RecU Holliday junction-specific endonuclease Sp_2168 spr1836 Sp_2024 PTS cellobiose system transporter subunit IIA orf14 dUTPase Sp_2125 Metabolism spr1847 Sp_2036 PTS ascorbate system transporter subunit IIA orf16 NAD-dependent DNA ligase Sp_0259 spr1963 Sp_2157 Lactaldehyde reductase * orf18 DNA polymerase III gamma/tau subunit Sp_1584 spr1974 Sp_2168 DeoR family transcriptional regulator orf29 Hypothetical protein Sp_2012 spr0238 Sp_0259 Holliday junction DNA helicase RuvB * orf31 Hypothetical protein Sp_0259 Sp_1153 spr1211 Sp_1354 50S ribosomal protein L7/L12 * Sp_2168 spr1395 Sp_1540 Single-stranded DNA binding protein *

1 1 orf32 Hypothetical protein Sp_0194 Sp_0259

- spr1433 Sp_1575 DNA replication protein DnaD* Sp_1540 Sp_1669 spr1439 Sp_1584 Transcriptional repressor CodY * Sp_1915 spr1513 Sp_1669 MutT/nudix family protein orf33 Hypothetical protein Sp_1088

Dp Phage spr1516 Sp_1672 Recombination protein RecR * orf34 Hypothetical protein Sp_0446 Sp_2157 spr1557 Sp_1713 Transcriptional regulator NrdR * orf39 Zinc finger domain protein, putative Sp_0259 Information Information and storage processing spr1569 Sp_1725 LacI family transcriptional regulator orf44 Rho-like domain lipoprotein, putative Sp_0446 Sp_1050 spr1731 Sp_1915 DNA-binding protein Sp_1536 Sp_1575 Sp_1725 Sp_2157 spr1794 Sp_1980 3'-5' exoribonuclease orf47 Hypothetical protein Sp_0687 spr0951 Sp_1050 Antitoxin PezA orf48 Hypothetical protein Sp_1746 Sp_2168

and and spr1252 Sp_1395 PhoU family transcriptional regulator orf51 Hypothetical protein Sp_1672

spr1357 Sp_1505 Autoinducer-2 Exporter Family

orf58 Holin Sp_1505 Sp_1606 spr1459 Sp_1606 Glycosyl transferase, family 2 Sp_1731 Sp_1751 orf60 S-layer protein membrane peptidase Sp_2024 spr1591 Sp_1746 HD domain-containing protein spr1696 Sp_1881 Glutamate racemase * orf72 Signal peptide membrane protein Sp_1606 Cellular Cellular processes signaling *Gene known as potential essential gene (Lee, et al., 1999, Thanassi, et al., 2002, Song, et al., 2005, van Opijnen, et al., 2009). (a) 36 S. pneumoniae genes represented in four functional categories. 75

Table 3.2 Effect of gene inactivation and host-phage interactions of S. pneumoniae

Gene Gene / Protein Function Essential gene LocateP c R6 TIGR4 Literature a In vivo b Subcellular Location spr0238 Sp_0259 holliday junction DNA helicase RuvB Yes No growth Intracellular Cytoplasmic spr0996 Sp_1088 hypothetical protein Yes No growth Intracellular Cytoplasmic spr1211 Sp_1354 ribosomal protein L7/L12 Yes No growth Intracellular Cytoplasmic spr1395 Sp_1540 single-stranded DNA binding protein Yes No growth Intracellular Cytoplasmic spr1433 Sp_1575 DNA replication protein DnaD Yes No growth Intracellular Cytoplasmic spr1439 Sp_1584 transcriptional repressor CodY Yes No growth Intracellular Cytoplasmic spr1516 Sp_1672 recombination protein RecR Yes No growth Intracellular Cytoplasmic spr1557 Sp_1713 transcriptional regulator, NrdR family Yes No growth Intracellular Cytoplasmic spr1696 Sp_1881 glutamate racemase Yes No growth Intracellular Cytoplasmic spr0602 Sp_0687 ABC transporter, ATP-binding protein No growth Intracellular Cytoplasmic spr0951 Sp_1050 antitoxin PezA No growth Intracellular Cytoplasmic spr1041 Sp_1153 hypothetical protein No growth Intracellular Cytoplasmic spr1513 Sp_1669 MutT/nudix family protein No growth Intracellular Cytoplasmic spr1596 Sp_1751 magnesium transporter No growth Multi-transmembrane Membrane spr1794 Sp_1980 3'-5' exoribonuclease No growth Intracellular Cytoplasmic spr1934 Sp_2125 hypothetical protein No growth Intracellular Cytoplasmic spr1974 Sp_2168 DeoR family transcriptional regulator No growth Intracellular Cytoplasmic spr0177 Sp_0194 hypothetical protein Intracellular Cytoplasmic spr0402 Sp_0446 acetolactate synthase, small subunit Multi-transmembrane Membrane 76

spr0761 Sp_0859 uncharacterized membrane protein Multi-transmembrane Membrane

spr0882 Sp_0979 oligopeptidase F Yes Intracellular Cytoplasmic

spr1090 Sp_1208 uridine kinase Intracellular Cytoplasmic

spr1094 Sp_1213 hypothetical protein Intracellular Cytoplasmic

spr1252 Sp_1395 PhoU family transcriptional regulator Intracellular Cytoplasmic

spr1356 Sp_1504 hypothetical protein Intracellular Cytoplasmic

spr1357 Sp_1505 autoinducer-2 Exporter Family Multi-transmembrane Membrane

spr1391 Sp_1536 hypothetical protein Small colonies Intracellular Cytoplasmic

spr1459 Sp_1606 lycosyl transferase, family 2 Multi-transmembrane Membrane

spr1569 Sp_1725 LacI family transcriptional regulator Intracellular Cytoplasmic

spr1576 Sp_1731 uncharacterized probable membrane protein Multi-transmembrane Membrane

spr1591 Sp_1746 HD domain-containing protein Intracellular Cytoplasmic

spr1731 Sp_1915 DNA-binding protein Intracellular Cytoplasmic

spr1825 Sp_2012 glyceraldehyde 3-phosphate dehydrogenase Yes Intracellular Cytoplasmic

spr1836 Sp_2024 PTS cellobiose system transporter subunit IIA Intracellular Cytoplasmic

spr1847 Sp_2036 PTS ascorbate system transporter subunit IIA Intracellular Cytoplasmic

spr1963 Sp_2157 Lactaldehyde reductase Yes Small colonies Intracellular Cytoplasmic a. Identification of the essential host proteins was previously determined (Lee, et al., 1999, Thanassi, et al., 2002, Song, et al., 2005, van Opijnen, et al., 2009). b. Gene knockout by homologous recombination. c. LocateP (http://www.cmbi.ru.nl/locatep-db/cgi-bin/locatepdb.py).

Surprisingly, we found three genes previously reported to be essential for S. pneumoniae to be non-essential here: Sp_0979 (oligopeptidase F), Sp_2012 (glyceraldehyde 3-phosphate dehydrogenase) and Sp_2157 (lactaldehyde reductase) (Figure 3.2). We also identified eight new potential essential genes related to metabolism (Sp_0687, Sp_1751, and Sp_2168), information storage and processing (Sp_1669 and Sp_1980), cellular processes and signaling (Sp_1050) and two poorly characterized genes (Sp_1153 and Sp_2125).

Gene disruption gave rise to several phenotypes including altered behavior and growth. We followed the growth kinetics of each knockout strain, as well as the wild type strain (S. pneumoniae R6), by measuring the optical density of the cultures every 30 minutes for a 24-hour period (data not shown). The growth of the strains deficient in gene Sp_0859 (uncharacterized membrane protein) or Sp_1208 (uridine kinase) was slow compared to the wild-type strain. Bacterial growth was faster when genes Sp_1725 (LacI family transcriptional regulator), Sp_1915 (DNA-binding protein) and Sp_1731 (uncharacterized membrane protein) were inactivated. The growth of Sp_1213 (hypothetical protein) was also faster than wild type but slower than the three above mutants. On blood agar plates, colonies with larger alpha-hemolytic zones (green zones) appeared after overnight culture, of strains deficient in gene Sp_0859 (uncharacterized membrane protein) or Sp_1213 (hypothetical protein). Inactivation Sp_1536 (hypothetical protein) and Sp_2157 (lactaldehyde reductase) in S. pneumoniae R6 led to a smaller colony size phenotype (Table 3.2).

Protein interaction networks in S. pneumoniae Preserving the integrity of cellular processes is crucial for bacterial survival and most are mediated by protein-protein interactions. However, little is known about protein interaction networks inside bacteria. We generated a network of protein-protein interactions in S. pneumoniae TIGR4 using the above 36 host proteins and the STRING (Search Tool for the Retrieval of Interacting Genes/Proteins) database (http://string-db.org/). The STRING database includes known or predicted protein interactions in an organism that integrate all types of interactions to map useful networks of interactions (Szklarczyk, et al., 2015). A screen of the identified proteins of interest yielded 357 putative interactions (Table S3.1).

Among others, we determined that 127 of these potential interactions involved an essential gene, representing 36% of the interaction networks indicating that the inactivation of some genes may have a profound effect on the host protein network, which may explain some of the above in vivo data.

Subcellular localization and conserved domains The study of phage proteins with host factors requires an understanding of host protein functions. However, several S. pneumoniae proteins have no known function. This represents an important challenge in this study. As a first step to puzzle out their functions, we investigated the theoretical proteins’ subcellular locations. We used the LocateP database (http://www.cmbi.ru.nl/locatep-db) to predict subcellular locations of the proteins (Zhou, et al., 2008). This database combines numerous bioinformatics tools by mimicking the cellular processes of protein synthesis and protein secretion to allow accurate prediction of protein subcellular localization (Zhou, et al., 2008). Using LocateP, we determined that most proteins of interest in this study are intracellular, seven out of nine hypothetical proteins are intracellular and two are multi-transmembrane proteins (Table 3.2). Of note, most bacterial proteins are generally intracellular and perform various functions (Zhou, et al., 2008, Amblee & Jeffery, 2015). The majority of intracellular proteins are involved in central pathways of metabolism and some could significantly impact bacterial survival (Amblee & Jeffery, 2015). We identified three hypothetical proteins (Sp_1088, Sp_1153 and Sp_2125) that may be essential proteins for bacterial growth as well as being intracellular proteins involved in important pneumococcal functions.

Using these bioinformatic results, we found that the functions previously predicted for some proteins of S. pneumoniae R6 and TIGR4 may not be clear-cut. For example, gene Sp_1088 was described to code for a DNA repair protein RadC (accession number AE005672.3) but was replaced by a hypothetical protein for S. pneumoniae TIGR4 (NC_003028.3). Similarly, RadC of S. pneumoniae R6 was replaced by another hypothetical protein (NC_003098.1). We then investigated these hypothetical proteins by searching for conserved domains. Hypothetical protein Sp_1504 contains a tetratricopeptide (TPR) repeat domain suggesting protein-protein interaction with possible assembly of

multiprotein complexes. This protein could be involved in essential processes such as in type IV pilus biogenesis involved in virulence-associated functions (Cerveny, et al., 2013). Likewise, Sp_1536 has a conserved domain similar to S-adenosyl-methionine-dependent methyltransferases, suggesting that Sp_1536 may act as a cofactor catalysing the transfer of methyl groups. Gene Sp_2125 has a conserved domain predicted to function as a potential protein involved in the synthesis of metal-sulfur clusters, suggesting that this gene could play a role in biometal metabolism.

Effect of gene knockout on pneumophage infections We assessed the effect of gene inactivation on the replication of the virulent pneumophages SOCP and Dp-1, both independently and in combination. Specifically, we compared the phage infection of wild-type S. pneumoniae strain with the 19 knockout strains deficient in one of the identified host genes, which allows bacterial survival. Using the double-layer agar plate method, we measured the ratio of plaque-forming units per milliliter (PFU/ml) from reference strain S. pneumoniae R6 and compared this to the other strains tested to determine the efficiency of plating (EOP). The results of testing 19 strains against two phages and phage cocktail are summarized in Figure 3.2. Overall, the EOP values varied considerably according to the gene disrupted and the phage tested. An EOP value of 1 means the phage grew well and lysed the test strains with same efficiency as its host, whereas a reduced EOP indicate that tested strain was partially insensitive or resistant to the phage, and totally resistant when the EOP value was equal to 10-8.

Of significant interest, six disrupted genes significantly impacted phage Dp-1 replication (Figure 3.2). Phage replication was completely inhibited (EOP <10-8) in S. pneumoniae strains with these disrupted genes. Two of the genes (Sp_0194, Sp_1536) code for hypothetical proteins, three deduced proteins are involved in cellular processes and signalling (Sp_1505 autoinducer-2 exporter family; Sp_1606 glycosyl transferase family protein, and Sp_1746 HD domain-containing protein) and one (Sp_1915) is involved a DNA-binding protein in transcription and signal transduction. On the other hand, only one gene, Sp_1505 (autoinducer-2 exporter family), also completely inhibited (EOP <10-8)

phage SOCP replication, similar to phage Dp-1. Disrupting the glycosyl transferase family protein (Sp_1606) did produce also a significant reduction in the efficiency of phage SOCP (EOP of 10-5).

Disrupting the gene Sp_1725 (LacI family transcriptional regulator) also negatively affected the replication of both phages, reducing the EOP of Dp-1 by 5 log and the EOP of SOCP by 3 log, while inactivation of Sp_1915 DNA-binding partially reduced the efficiency of phage SOCP by 3 log (Figure 3.2). Remarkably, disruption of gene Sp_0979 coding for an oligopeptidase F increased the efficiency of phage SOCP by one log compared to the reference strain (Figure 3.2).

However, some genes seem to be unimportant for phage replication. Phage SOCP efficiency was not affected on strains S. pneumoniae R6Sp_0859, S. pneumoniae R6Sp_1731 and S. pneumoniae R6Sp_2012 compared to the WT strain. The Sp_0859 and Sp_1731 proteins are hypothetical proteins while Sp_2012 codes for a glyceraldehyde 3-phosphate dehydrogenase involved in carbohydrate metabolism. Similarly, phage Dp-1 propagated normally on S. pneumoniae R6Sp_1213 (hypothetical protein) and S. pneumoniae R6Sp_2157 (lactaldehyde reductase). Moreover, when the other phage was tested on these strains, there was only a 1 or 2 log reduction, indicating that these host genes are not critical for replication of both phages.

Since virulent phages Dp-1 and SOCP belong to two different families, we investigated the effects of a phage cocktail on the inactivated strains. Notably, the phage cocktail produced similar results to the reference strain when propagated on seven tested strains, while the EOP dropped by one or two logs in most cases (Figure 3.2), indicating a synergistic effect of the phage cocktail compared to each monophage. This could also be related to the ability of one or both phages to increase the infection properties of one phage. In contrast, the EOPs were reduced by 5 and 3 logs when the phage cocktail was propagated on S. pneumoniae R6Sp_1915 and S. pneumoniae R6Sp_1606, respectively. Similar to both monophages, S. pneumoniae R6Sp_1505 was completely resistant to the phage cocktail. The phage cocktail was less efficient than each monophage when propogated on S.

pneumoniaeSp_1395. The drop in EOP when using phage cocktail could be due to interference between phages in the absence of this host factor. In general, phage SOCP seems to be more dominant in this phage cocktail.

Figure 3. 2 Efficiency of plating of two pneumococcal virulent phages on various knockouts in S. pneumoniae. All pneumococcal bacterial genes are grouped based on their biological function. The efficiency of plating (EOP) on plates was obtained by dividing the titer of the phage grown on the inactivated strain by the phage titer obtained using the wild type strain S. pneumoniae R6. A star symbol (*) indicates an EOP value of 1, meaning that the phage lysed the tested strains with the same efficiency as the reference strain. EOP values varied considerably according to gene disruption. In total, 19 strains were tested against two phages and one phage cocktail.

Effect of gene complementation on pneumophage infections To confirm the effect of gene knockouts on pneumophage behaviors, we added the wild- type genes into the inactivated strains using the maltose-inducible vector pLS1RGFP. This vector also allowed us to regulate gene expression from the PM promoter by adding maltose to the growth medium to release MalR repression of the PM promoter (Nieto, et al., 2000). Plasmid pLS1RGFP was also sequenced (Figure S3.1) to design specific primers to confirm the clones and transformants.

To show that the vector itself did not affect phage infection, we introduced the pLS1RGFP vector without insert into various strains and incubated them with or without maltose (Figure S3.2). Growing the strains harboring pLS1RGFP (expression vector) in presence of 0.5% maltose had no effect on phage replication. However growing the strains with pLS1RGFP in presence of 5% maltose (over-expression) slightly increased the effectiveness of phage SOCP by one log on six strains (Figure S3.2). S. pneumoniae has many carbohydrate transporters and phosphotransferase systems (PTS) for several sugar- specific uptakes which allow the organism to metabolize different sugars as carbon sources. Growth of this bacterium in the presence of maltose was reported to be involved in upregulation of the maltose gene cluster as well as some operons and genes (Afzal, et al., 2015). The slight increase in SOCP phage efficiency could be due to upregulation of some host factors.

To further confirm the role of the inactivated host genes in phage infection, we cloned of the 19 genes into pLS1RGFP and introduced them into the respective inactivated strain. (Figure 3.3). Our results showed that in most induced strains the phage sensitivity phenotype was restored. For some strains, the EOP remained lower as compared to the wild-type strain when induced with 0.5% maltose (Figure 3.3A). Over-expressing the genes with 5% maltose restored normal phage infection in most of these strains (Figure 3.3B). Surprisingly, overexpression in S. pneumoniaeSp_0979 and S. pneumoniaeSp_1213 led to a reduced EOP mainly for SOCP, while making S. pneumoniaeSp_1606 slightly more phage- sensitive than S. pneumoniae R6 (Figure 3.3B).

Figure 3. 3 Efficiency of plating of two pneumococcal virulent phages on S. pneumoniae strains complemented with wild-type genes. Efficiency of plating of two pneumococcal virulent phages on S. pneumoniae strains complemented with wild-type genes. Gene complementation was performed using the maltose-inducible vector pLS1RGFP. A. Induction using 0.5% maltose. B. Induction using 5% maltose. The efficiency of plaquing (EOP) on plates was obtained by dividing the titer of the phage grown on the inactivated strain by the phage titer obtained using the wild type strain S. pneumoniae R6. A star symbol (*) indicates an EOP value of 1, meaning that the phage lysed the tested strains with the same efficiency as the reference strain. EOP values varied considerably according to gene disruption. In total, 19 strains were tested against two phages and one phage cocktail.

Host factors with a significant impact on phage replication Sp_1505, autoinducer-2 (AI-2), seems to perform a key role in pneumophage replication since its disruption completely inhibited the replication of both SOCP and Dp-1 virulent phages. Autoinducer-2 is synthesized and controlled by LuxS, then exported through membrane-spanning transporters. It is reported to act as a universal signalling molecule in quorum sensing for bacterial interspecies communication (Vidal, et al., 2013). The transcription of quorum-controlled genes by AI-2 is involved in biofilm formation and virulence factor production, while different receptors were found to be under control of AI- 2 intracellular/extracellular concentration to switch on and off (Taga, et al., 2001, Sztajer, et al., 2008, Guo, et al., 2013). Autoinducer-2 was also reported to regulate membrane transport proteins based on increasing external concentration during bacterial growth, leading to the induction of ABC transporters to import AI-2 into the cytoplasm (Taga, et al., 2001, Guo, et al., 2013). It is possible that AI-2 regulates the expression of other host genes important during phage replication and its absence provides a mechanism of defence against phages. AI-2 could also act somehow at the membrane level during, for example, phage DNA injection (Molineux & Panja, 2013) or the release of new virions (Catalao, et al., 2013, Frias, et al., 2013). To accomplish host lysis at the end of phage replication, pneumophages depend on a holin-endolysin system. Holins are synthesized and inserted into the cytoplasmic membrane to form pores that will induce membrane depolarization and allow access of the endolysin to the cell wall. Some phages use holins to mediate the export of phage endolysins to the cell envelope while others remain under control until the correct time, or require the contribution of a host secretion pathway (Sec system), as is the case for pneumophage (Molineux & Panja, 2013). Reduced AI-2 activity was reported to weaken the expression of genes associated with the type III secretion system in Vibrio harveyi and Escherichia coli (Sperandio, et al., 1999, Henke & Bassler, 2004). Thus, inactivation of AI- 2 in S. pneumoniae could modulate negatively the expression of the host Sec system.

Disruption of the glycosyltransferase family 2 (GT) gene in Sp_1606 inhibited infection by phage Dp-1 and provided partial resistance to phage SOCP. Glycosyltranferases catalyse transfer of a glycosyl group from a sugar substrate donor to an acceptor, including other

sugars, lipids, proteins, nucleic acids, antibiotics, or other small molecules (Lairson, et al., 2008). Glycosyltransferases have been previously involved in phage resistance, by inhibiting phage adsorption as a result of serotype conversion encoded by temperate phages (Markine-Goriaynoff, et al., 2004). Several studies have also shown the importance of GT in ensuring propagation of some phages which express their own GT to glycosylate their genome as a protection strategy to avoid digestion by host restriction endonucleases (Wang, et al., 1993, Markine-Goriaynoff, et al., 2004, Lehane, et al., 2005, Lairson, et al., 2008). Other phages can also regulate expression of the bacterial GT to glycosylate its genome (Markine-Goriaynoff, et al., 2004). The results obtained by disrupting the host GT may be related to its involvement in the glycosylation of wall teichoic acids (WTA) needed for phage adsorption. Thus, phage infection could induce increased expression of this enzyme since GT was more efficient when overexpressed, mainly in the case of Dp-1 compared to the WT strain. It has been shown that some Staphylococcus aureus phages, albeit of the Podoviridae family, required a specific host GT, TarS, responsible for glycosylation of wall teichoic acid with β-GlcNAc (Xia, et al., 2010). TarS was found to be overexpressed during the first stage of infection to promote adsorption (Xia, et al., 2010, Li, et al., 2015). Glycosyltransferase are also involved in peptidoglycan biosynthesis (Tseng, et al., 2009, McCann & St Geme, 2014) and consequently could also have an impact on phage DNA injection or lysis. Considering the importance of GT in several biological processes, they may participate in different stages of the phage lytic cycle.

The Sp_1746 protein is predicted to be an HD domain-containing protein. Disrupting this gene significantly affected replication of phage Dp-1. The CD-Search tool assigns this gene to the superfamily of metal-dependent phosphohydrolases which is part of a diverse, uncharacterized group of proteins and domains associated with nucleotidyltransferases and helicases (Yakunin, et al., 2004). The HD protein domain protein catalyzes phosphomonoesterase or phosphodiesterase reactions using a wide range of substrates, such as nucleotides and nucleic acids, and functions primarily in nucleic acid metabolism and signal transduction (Yakunin, et al., 2004). The involvement of this protein in phage infection remains unclear; however, it could be related to cyclic nucleotides. Indeed, the HD superfamily is related to both the cyclic adenosine monophosphate (cAMP) and cyclic

guanosine monophosphate (cGMP) phosphodiesterases, while five distinct metal-dependent phosphohydrolases were found to be involved in cAMP phosphodiesterases (Galperin, et al., 1999, Rao, et al., 2010). Various bacterial cyclic nucleotides, such as cAMP and cGMP, act as second messengers and are involved in signaling systems and control several key processes (Seshasayee, et al., 2010). Other researchers speculate that CRP is one of the key signalling molecules to respond after phage infection as it upregulated over 22 genes in Thermus thermophilus, including those involved in energy regulation, metabolism and even two Cas operons (Agari, et al., 2010).

Discussion

Nowadays, phages are attractive therapeutic agents but many questions remain as they are not fully understood. Phages are natural predators of bacteria that replicate only inside them and their ability to eliminate a specific bacterium depends on efficient phage-host interactions. These interactions include adsorption to host receptors, injection of phage DNA, synthesis of all viral components, virion assembly and release of new phages by bacterial host lysis. The application of phages as potential therapeutic or biocontrol agents requires a better understanding of the complex interactions between bacteria and phages, including host factors required for the phage lytic cycle.

The inactivation of the 36 pneumococcal genes led us to also identify eight new seemingly essential genes for the growth of S. pneumoniae R6. We also confirmed nine previously reported essential genes based on previous studies (Lee, et al., 1999, Thanassi, et al., 2002, Song, et al., 2005, van Opijnen, et al., 2009). We also found three genes (Sp_0979, oligoendopeptidase F; Sp_2012, glyceraldehyde 3-phosphate dehydrogenase; Sp_2157, lactaldehyde reductase) previously reported to be essential for S. pneumoniae to be non- essential in our study. These differences are likely due to the use of different mutagenesis stategies or growth conditions. We also noticed that some genes affected hemolysis (Sp_0859 and Sp_1213), colony size (Sp_1536 and Sp_2157) and bacterial growth rate (Sp_1213, Sp_1725, Sp_1731, Sp_1915). We cannot rule out that some of these effects were due to a polar effect leading to the alteration of downstream genes or due to other protein-protein interactions in S. pneumoniae. In addition, we performed additional bioinformatics analyses to build a network of host factors that participate in or are affected by phage infection. Thus, we identified many putative host protein-protein interactions in S. pneumoniae, including several interaction networks involving essential genes needed for normal pneumococcal growth. Taken altogether, these data improve our understanding of S. pneumoniae growth behaviour and identifies prospective new antimicrobial drug targets by highlighting essential host genes.

The selection of the 36 pneumococcal genes was based on a recent study using a Y2H screen that reported 49 unique interactions between proteins of phages Dp-1 and SOCP and proteins of S. pneumoniae R6 (Mariano, et al., 2016). The main objective of this study was to confirm these interactions in vivo and thereby determine the involvement of these S. pneumoniae host factors in the replication of the two virulent pneumophages. The Y2H screens were performed in yeast, which obviously is a different environment than inside a bacterium. As such, false positive interactions as well as false negative interactions have likely occurred with the Y2H screens but it was still a good starting point to study phage- host interactions.

The Y2H study reported that 36 host proteins interacted with proteins of one of the two phages, as well as two proteins, which were found to interact with both phages. As mentioned above, we could only inactivate 19 out of the 36 host genes and obtained viable mutants. These knockout strains were then tested against each of the two virulent phages and both phages together. We found six genes (Sp_1505, Sp_1606, Sp_1746, Sp_1915) necessary for phage Dp-1 replication, including two (Sp_0194, Sp_1536) coding for hypothetical proteins. Based on the Y2H screen, one of these genes, Sp_1536, was previously reported to interact with a putative phage Rho-like domain (Mariano, et al., 2016). The investigation of conserved domains suggested that this protein might be involved in methyl group transfer. Only one gene (Sp_1505) had a major impact on SOCP replication and it was not detected by the Y2H screen. Interestingly, deleting an oligopeptidase increased SOCP and phage cocktail efficiency. None of the identified genes detected by Y2H and seemingly involved in bacterial metabolism were found to be important for phage replication in vivo. Gene complementation assays coupled with maltose induction restored most of the WT phenotypes, confirming the phage resistance results obtained with the knockout strains.

Recently, a different approach was used to study the interactions between S. pneumoniae and two virulent phages (Leprohon, et al., 2015). Specifically, natural bacteriophage- insensitive mutants (BIMs) of S. pneumoniae mutants were selected following a challenge with either the virulent phage SOCP or Dp-1. Genome and genetic analyses revealed that

the mutations of three genes were responsible for resistance to phage SOCP while the mutation of a single gene was necessary to provide resistance to Dp-1. None of these genes were identified in the Y2H screen. Another challenge encountered during this study was the presence of many genes/proteins of S. pneumoniae that remain only predicted or poorly characterized. These data illustrate the complexity of the phage-host interactions and that multiple approaches will be needed to construct a network of host factors that participate in phage infection. The fact that only one bacterial gene was found to be necessary for the replication of both phages support the strategy of using phage cocktail for antibacterial applications as it will reduce the likelihood of the rapid emergence of phage resistant mutants. Moreover, we observed a synergistic effect when simultaneously testing both phages on the same mutated strain.

At each stage of the phage replication process, it is likely that distinct host factors are involved. We speculated on the importance of some host factors and their possible interactions with phage at specific stages of phage replication. We also found that most identified proteins are intracellular and while others appear to have an impact at the cell membrane or in cell communication. Perhaps some of these host proteins could be considered moonlighting proteins and have an additional function in phage replication. Moonlighting proteins are intracellular proteins that perform several functions in the cell but can also be found on the cell surface performing another function. These proteins are reported to play a key role in colonisation, adhesion and virulence (Amblee & Jeffery, 2015).

Although this study on S. pneumoniae using two virulent phages does not represent the complete range of host factors involved in infection mechanisms used by pneumococcal phages, the results provide novel insights into general host-phage interaction and further understanding about S. pneumoniae. Our results represent a pipeline toward a comprehensive understanding of the molecular mechanism underlying host-phage interactions.

Materials and Methods

Bacterial strains and growth conditions. The strains, plasmids and phages used in this study are shown in Table 3.3. S. pneumoniae R6 was used for all pneumococcal transformation. S. pneumoniae strains were grown in brain heart infusion (BHI), supplemented with 0.5% yeast extract and 5% (vol/vol) defibrinated sheep’s blood, at 37°C in the presence of 5% CO2. For plasmid maintenance, bacterial strains were grown using media supplemented with chloramphenicol (6 µg ml-1) for inactivation assays or erythromycin (1 µg ml-1) for complementation assays. Escherichia coli DH5α strains were grown in Luria Bertani (LB) medium at 37°C, supplemented with chloramphenicol (20 µg ml-1) as needed. Lactococcus lactis MG1363 was grown in M17 medium (Oxoid) at 30°C with added erythromycin (5 µg ml-1), as needed.

Table 3. 3 Bacterial strains, plasmids and phages used in this study Strains, plasmids, Relevant characteristic(s) Reference or source phages Bacterial strains E. coli XL1-Blue recA1 endA1 gyrA96 thi-1 hsdR17 Stratagene supE44 relA1 lac [F´ proAB lacIq Z∆M15 Tn10 (Tetr)].

L. lactis MG1363 Plasmid free, cloning strain (Wegmann, et al., 2007)

S. pneumoniae R6 Nonencapsulated strain, type 2 (Hoskins, et al., 2001)

Plasmids pFF3 3.1 kb; CmR (Lupien, et al., 2013) pNZ123 2.5 kb; CmR (De Vos, 1987) pLS1RGFP 9.4 kb; MalR, EmR (Nieto, et al., 2000)

Phages SOCP Virulent phage, Podoviridae (Martin, et al., 1996, Dp-1 Virulent phage, Siphoviridae Ouennane, et al., 2015) (Sabri, et al., 2011) R Antibiotic resistance; Cm, chloramphenicol; Em, erythromycin; MalR, repression by maltose.

Primers, PCR amplification. DNA templates were prepared as described previously (Wang, et al., 2007). Briefly, S. pneumoniae was grown overnight on trypticase soy agar

(TSA) containing 5% sheep’s blood, at 37°C in the presence of 5% CO2. Single colonies were suspended in filtered BHI broth containing 0.5% yeast extract and incubated at 37°C in the presence of 5% CO2 until the culture reached an optical density (OD) at 600 nm of 0.2 to 0.8. One hundred microliters of each culture were suspended in 0.2 ml of buffer (10 mM Tris-HCl, pH 8.0, 0.45% Triton X-100, and 0.45% Tween 20) in an Eppendorf tube. These mixtures were heated at 100°C for 10 min, cooled on ice and centrifuged for 2 min at 14,000 rpm to pellet bacterial cell debris. A 2-μl aliquot of each supernatant containing the extracted DNA was used for the PCR template. For gene knockouts, PCR was performed using a DNA template and the primers listed in Supplementary Table S3.2. For PCR, internal primers were used for all genes and gene size was between 305 and 1802 bp. Primers were designed to be around 100 bp from each external part. The PCR conditions were: denaturation at 95°C for 5 min followed by 30 cycles of 95°C for 1 min, 52°C for 45s and 72°C for 1 min (actual annealing temperature depended on which primers were used); and one cycle of elongation at 72°C for 1 to 3 min (1 min for each 1 kb of expected product). A 5-µl sample of the PCR product was analyzed by agarose gel electrophoresis. The PCR products were purified using the QIAquick PCR Purification Kit (Qiagen) before ligation to the vector. Gene knockouts of FtsZ (cell division protein) and LytA (major autolysin) were used as controls for bacterial growth and plasmid pNZ123 was used as a control for transformation efficiency in S. pneumoniae.

Plasmid construction and cloning. The plasmid pFF3 was used to inactivate the 36 pneumococcal genes of interest as previously described (Fani, et al., 2011). This plasmid carries a chloramphenicol resistance gene and replicates in E. coli but not in S. pneumoniae. Plasmid pFF3 was digested with AhdI (GACNNN^NNGTC) to generate a single thymidine residue at both 3′ ends of the vector. Polymerase chain reactions were used to amplify specific host regions using Taq DNA polymerase, which added a single deoxyadenosine (A) to each 3' end of the PCR products. Resulting plasmids were transformed into E. coli and then into S. pneumoniae R6. Transformants were selected on chloramphenicol and confirmed by sequencing the insert. The general cloning strategy is presented in Figure 3.4.

For complementation assays, we used the maltose-inducible pLS1RGFP vector (Nieto, et al., 2000, Standish, et al., 2007). To confirm transformants, plasmid-specific and gene- specific primers were used. Vector primers were designed for the XbaI cloning site (5’-

GGATCAATTCTGATTAACTTTATAAGGAGGAAAAAC-3’ and 5’-CAAACGTTTGCGTTACTTATAAGTATACTCC-3’) and the EcoRI site (5’- GTTTTATTGATAAGGAAACGCAAACGTTTTC-3’ and 5’-

GTTATAAAAAAAGGATCAATTTTGAACTCTCTCCC-3’). PCR Products containing the complete pneumococcal gene of interest were obtained using primers listed in Supplementary Table S3.3. For each gene, XbaI sites were added to the 5’ ends of each primer sequence, which were then used to clone the amplified PCR product into XbaI-digested pLS1RGFP vector. When an XbaI site was present within the gene of interest, EcoRI sites were added to the primers and used for cloning into EcoRI-digested pLS1RGFP vector. The amplicons digested and ligated to the digested pLS1RGFP were transformed into L. lactis MG1363 by electroporation using a Gene Pulser II apparatus, then extracted and transformed into S. pneumoniae R6. Some ligated products were also directly transformed into S. pneumoniae R6. Transformants were selected for erythromycin resistance (1 µg/ml) and clones were confirmed by sequencing at the Plateforme de séquençage et de génotypage des génomes of the CHUL/CHUL Center. To induce expression, cells containing the plasmid pLS1RGFP (or derivatives) were grown to mid-log phase in BHI medium, pelleted by centrifugation and resuspended in BHI containing maltose (0.5 and 5%).

Figure 3. 4 Schematic representation of construction of pFF3 plasmid, using TA cloning-like system. The enzyme AhdI recognized two specific restriction sites within the sequence of the pFF3 vector, generating a 33 bp fragment and linearizing the vector with a single 3’ overhanging thymine residue on each blunt. Internal PCR primers were used for all genes (gene lengths of 305 to 1802 bp) and were designed to be approximately 100 bp from each external part. Taq DNA polymerase, which adds an adenine to the 3’ end, was used to amplify the PCR products. Ligase was added to join the PCR product and vector due to the complementary base pairs of the overhangs. The gene knockouts of FtsZ (cell division protein) and LytA (major autolysin) were used as controls for bacterial growth and plasmid pNZ123 was used as a control for the efficiency of transformation in S. pneumoniae.

Preparation of competent cells and transformation. Competent E. coli cells were prepared from 1 ml of overnight culture added to 100 ml of LB medium and grown at 37°C to an OD 600nm of 0.5-0.8. Then, the culture was incubated for 15 min on ice and centrifuged for 5 min at 14,000 rpm. The pellet was re-suspended in 40 ml of transformation buffer 1 (Tfb1) and incubated on ice for 15 min. The mixture was centrifuged again, the pellet re-suspended in 40 ml of transformation buffer 2 (Tfb2) and flash frozen in 250 to 500 µl aliquots in pre-cooled 1.5 ml Eppendorf tubes and stored immediately at -80°C. E. coli transformation was achieved using a thermal treatment.

Electro-competent cells of L. lactis MG1363 were prepared using the glycine method (Holo & Nes, 1989). L. lactis cells were electroporated with 500 ng to 1 µg of plasmid DNA, fresh media was immediately added and the cells were plated on GM17 media containing erythromycin at a concentration of 2 µg ml-1. Extraction and purification of plasmid DNA from E. coli and L. lactis were performed using a Qiagen Plasmid kit according to the manufacturer's instructions. For L. lactis strains, 30 mg ml-1 of lysozyme was added at the beginning with incubation for 30 min at 37°C to facilitate cell lysis. The quality of the extracted plasmids was analyzed on agarose gel electrophoresis (0.8%). Competent cells were prepared from an overnight culture of S. pneumoniae R6 grown in BHI broth containing 0.5% yeast extract and incubated at 37°C in the presence of 5% CO2. An aliquot of the previous culture was transferred into fresh BHI and incubated until it reached an OD600nm of 0.25. Then, cells were frozen in 1 ml of BHI media containing 15% glycerol. S. pneumoniae was transformed using natural transformation and the competence stimulating peptide 1 (CSP-1), as described previously (Fani, et al., 2011). The plasmid and CSP were added to final concentrations of 2 µg ml-1 each. Cultures were then incubated at 30°C for 1 hour followed by incubation at 37°C for 2.5 h. Plates were incubated for 24 h to -1 -1 48 h at 37°C in the presence of 5% CO2, with 6 ug ml of chloramphenicol and/or 1 ug ml erythromycin for selection.

Phage infection. Phage infection of S. pneumoniae strains were performed as previously described (Ouennane, et al., 2015). To obtain phage preparations, phage-infected pneumococcal cultures were incubated until complete cell lysis and the resulting lysate was filtered using a 0.45 µm syringe filter. The efficiency of plating (EOP) on plates was obtained by dividing the titer of the phage grown on the transformed strain by the phage titer obtained using the wild type strain. Two biological and three technical repetitions were done for each phage and strain.

Acknowledgements

We thank Manuel Espinosa for providing pLS1RGFP plasmid and Marc Ouelette for providing plasmid pFF3. We thank Peter Uetz and Alfonso H. Magadan for useful discussion and

technical support. We are grateful to the original authors of the yeast-two hybrid screens used in this analysis. This work was funded by a grant from the Canadian Institute of Health Research to SM. SM holds a Tier 1 Canada Research Chair in Bacteriophages.

References

Abedon, S. T., S. J. Kuhl, B. G. Blasdel, and E. M. Kutter. 2011. Phage treatment of human infections. Bacteriophage 1:66-85. Afzal, M., S. Shafeeq, I. Manzoor, and O. P. Kuipers. 2015. Maltose-dependent transcriptional regulation of the mal regulon by MalR in Streptococcus pneumoniae. PLoS One 10:e0127579. Agari, Y., K. Sakamoto, M. Tamakoshi, T. Oshima, S. Kuramitsu, and A. Shinkai. 2010. Transcription profile of Thermus thermophilus CRISPR systems after phage infection. J Mol Bio 395:270-281. Amblee, V., and C. J. Jeffery. 2015. Physical features of intracellular proteins that moonlight on the cell surface. PLoS One 10:e0130575. Calix, J. J., and M. H. Nahm. 2010. A new pneumococcal serotype, 11E, has a variably inactivated wcjE gene. J Infect Dis 202:29-38. Catalao, M. J., F. Gil, J. Moniz-Pereira, C. Sao-Jose, and M. Pimentel. 2013. Diversity in bacterial lysis systems: bacteriophages show the way. FEMS Microbiol Rev 37:554- 571. Cerveny, L., A. Straskova, V. Dankova, A. Hartlova, M. Ceckova, F. Staud, and J. Stulik. 2013. Tetratricopeptide repeat motifs in the world of bacterial pathogens: role in virulence mechanisms. Infect Immun 81:629-635. De Vos, W. M. 1987. Gene cloning and expression in lactic streptococci. FEMS Microbiol Lett 46:281-295. Domingues, S., K. M. Nielsen, and G. J. da Silva. 2012. Various pathways leading to the acquisition of antibiotic resistance by natural transformation. Mob Gen Elements 2:257-260. Donkor, E. S. 2013. Understanding the pneumococcus: transmission and evolution. Front Cell Infect Microbiol 3:7. Fani, F., P. Leprohon, D. Legare, and M. Ouellette. 2011. Whole genome sequencing of penicillin-resistant Streptococcus pneumoniae reveals mutations in penicillin-binding proteins and in a putative iron permease. Genome Biol 12:R115. Frias, M. J., J. Melo-Cristino, and M. Ramirez. 2013. E Export of the pneumococcal phage SV1 lysin requires choline-containing teichoic acids and is holin-independent. Mol Microbiol 87:430-445. Galperin, M. Y., D. A. Natale, L. Aravind, and E. V. Koonin. 1999. A specialized version of the HD hydrolase domain implicated in signal transduction. J Mol Microbiol Biotechnol 1:303-305. Guo, M., S. Gamby, Y. Zheng, and H. O. Sintim. 2013. Small molecule inhibitors of AI-2 signaling in bacteria: state-of-the-art and future perspectives for anti-quorum sensing agents. Int J Mol Sci 14:17694-17728. Hendrix, R. W. 2002. Bacteriophages: evolution of the majority. Theor Popul Biol 61:471- 480. Hendrix, R. W. 2003. Bacteriophage genomics. Curr Opin Microbiol 6:506-511. Henke, J. M., and B. L. Bassler. 2004. Quorum sensing regulates type III secretion in Vibrio harveyi and Vibrio parahaemolyticus. J Bacteriol 186:3794-3805. Holo, H., and I. F. Nes. 1989. High-frequency transformation, by electroporation, of Lactococcus lactis subsp. cremoris grown with glycine in osmotically stabilized media. Appl Environ Microbiol 55:3119-3123.

Hoskins, J., W. E. Alborn, Jr., J. Arnold, L. C. Blaszczak, S. Burgett, B. S. DeHoff, S. T. Estrem, L. Fritz, D. J. Fu, W. Fuller, C. Geringer, R. Gilmour, J. S. Glass, H. Khoja, A. R. Kraft, R. E. Lagace, D. J. LeBlanc, L. N. Lee, E. J. Lefkowitz, J. Lu, P. Matsushima, S. M. McAhren, M. McHenney, K. McLeaster, C. W. Mundy, T. I. Nicas, F. H. Norris, M. O'Gara, R. B. Peery, G. T. Robertson, P. Rockey, P. M. Sun, M. E. Winkler, Y. Yang, M. Young-Bellido, G. Zhao, C. A. Zook, R. H. Baltz, S. R. Jaskunas, P. R. Rosteck, Jr., P. L. Skatrud, and J. I. Glass. 2001. Genome of the bacterium Streptococcus pneumoniae strain R6. J Bacteriol 183:5709-5717. Lairson, L. L., B. Henrissat, G. J. Davies, and S. G. Withers. 2008. Glycosyltransferases: structures, functions, and mechanisms. Annu Rev of Biochem 77:521-555. Lee, M. S., B. A. Dougherty, A. C. Madeo, and D. A. Morrison. 1999. Construction and analysis of a library for random insertional mutagenesis in Streptococcus pneumoniae: use for recovery of mutants defective in genetic transformation and for identification of essential genes. Appl Environ Microbiol 65:1883-1890. Lehane, A. M., H. Korres, and N. K. Verma. 2005. Bacteriophage-encoded glucosyltransferase GtrII of Shigella flexneri: membrane topology and identification of critical residues. Biochem J 389:137-143. Leprohon, P., H. Gingras, S. Ouennane, S. Moineau, and M. Ouellette. 2015. A genomic approach to understand interactions between Streptococcus pneumoniae and its bacteriophages. BMC Genomics 16:972. Li, X., D. Gerlach, X. Du, J. Larsen, M. Stegger, P. Kuhner, A. Peschel, G. Xia, and V. Winstel. 2015. An accessory wall teichoic acid glycosyltransferase protects Staphylococcus aureus from the lytic activity of Podoviridae. Sci Rep 5:17219. Lu, L., Z. Ma, T. S. Jokiranta, A. R. Whitney, F. R. DeLeo, and J. R. Zhang. 2008. Species-specific interaction of Streptococcus pneumoniae with human complement factor H. J Immunol 181:7138-7146. Lupien, A., D. S. Billal, F. Fani, H. Soualhine, G. G. Zhanel, P. Leprohon, and M. Ouellette. 2013. Genomic characterization of ciprofloxacin resistance in a laboratory- derived mutant and a clinical isolate of Streptococcus pneumoniae. Antimicrob Agents Chemother 57:4911-4919. Mariano, R., S. Wuchty, M. G. Vizoso-Pinto, R. Hauser, and P. Uetz. 2016. The interactome of Streptococcus pneumoniae and its bacteriophages show highly specific patterns of interactions among bacteria and their phages. Sci Rep 6:24597. Markine-Goriaynoff, N., L. Gillet, J. L. Van Etten, H. Korres, N. Verma, and A. Vanderplasschen. 2004. Glycosyltransferases encoded by viruses. J Gen Virol 85:2741-2754. Marks, L. R., B. A. Davidson, P. R. Knight, and A. P. Hakansson. 2013. Interkingdom signaling induces Streptococcus pneumoniae biofilm dispersion and transition from asymptomatic colonization to disease. MBio 4: e00438-13. Martin, A. C., R. Lopez, and P. Garcia. 1996. Analysis of the complete nucleotide sequence and functional organization of the genome of Streptococcus pneumoniae bacteriophage Cp-1. J Virol 70:3678-3687. McCann, J. R., and J. W. St Geme, 3rd. 2014. The HMW1C-like glycosyltransferases--an enzyme family with a sweet tooth for simple sugars. PLoS Pathog 10:e1003977. Molineux, I. J., and D. Panja. 2013. Popping the cork: mechanisms of phage genome ejection. Nat Rev Microbiol 11:194-204. Morris, P., L. J. Marinelli, D. Jacobs-Sera, R. W. Hendrix, and G. F. Hatfull. 2008. Genomic characterization of mycobacteriophage Giles: evidence for phage acquisition of host DNA by illegitimate recombination. J Bacteriol 190:2172-2182.

Mortier-Barriere, I., O. Humbert, B. Martin, M. Prudhomme, and J. P. Claverys. 1997. Control of recombination rate during transformation of Streptococcus pneumoniae: an overview. Microb Drug Resist 3:233-242. Nahm, M. H., M. B. Oliver, L. Siira, T. Kaijalainen, L. M. Lambertsen, and A. Virolainen. 2011. A report of Streptococcus pneumoniae serotype 6D in Europe. J Med Microbiol 60:46-48. Nieto, C., P. Fernandez de Palencia, P. Lopez, and M. Espinosa. 2000. Construction of a tightly regulated plasmid vector for Streptococcus pneumoniae: controlled expression of the green fluorescent protein. Plasmid 43:205-213. O'Brien, K. L., L. J. Wolfson, J. P. Watt, E. Henkle, M. Deloria-Knoll, N. McCall, E. Lee, K. Mulholland, O. S. Levine, and T. Cherian. 2009. Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates. Lancet 374:893-902. Ouennane, S., P. Leprohon, and S. Moineau. 2015. iverse virulent pneumophages infect Streptococcus mitis. PLoS One 10:e0118807. Park, I. H., D. G. Pritchard, R. Cartee, A. Brandao, M. C. Brandileone, and M. H. Nahm. 2007. Discovery of a new capsular serotype (6C) within serogroup 6 of Streptococcus pneumoniae. J Clin Microbiol 45:1225-1233. Rao, F., Y. Qi, E. Murugan, S. Pasunooti, and Q. Ji. 2010. 2',3'-cAMP hydrolysis by metal- dependent phosphodiesterases containing DHH, EAL, and HD domains is non-specific: implications for PDE screening. Biochem Biophys Res Commun 398:500-505. Sabri, M., R. Hauser, M. Ouellette, J. Liu, M. Dehbi, G. Moeck, E. Garcia, B. Titz, P. Uetz, and S. Moineau. 2011. Genome annotation and intraviral interactome for the Streptococcus pneumoniae virulent phage Dp-1. J Bacteriol 193:551-562. Seshasayee, A. S., G. M. Fraser, and N. M. Luscombe. 2010. Comparative genomics of cyclic-di-GMP signalling in bacteria: post-translational regulation and catalytic activity. Nucleic Acids Res 38:5970-5981. Song, J. H., K. S. Ko, J. Y. Lee, J. Y. Baek, W. S. Oh, H. S. Yoon, J. Y. Jeong, and J. Chun. 2005. Identification of essential genes in Streptococcus pneumoniae by allelic replacement mutagenesis. Mol Cells 19:365-374. Sperandio, V., J. L. Mellies, W. Nguyen, S. Shin, and J. B. Kaper. 1999. Quorum sensing controls expression of the type III secretion gene transcription and protein secretion in enterohemorrhagic and enteropathogenic Escherichia coli. Proc Natl Acad Sci U S A 96:15196-15201. Standish, A. J., U. H. Stroeher, and J. C. Paton. 2007. The pneumococcal two-component signal transduction system RR/HK06 regulates CbpA and PspA by two distinct mechanisms. J Bacteriol 189:5591-5600. Sulakvelidze, A., Z. Alavidze, and J. G. Morris, Jr. 2001. Bacteriophage therapy. Antimicrob Agents Chemother 45:649-659. Szklarczyk, D., A. Franceschini, S. Wyder, K. Forslund, D. Heller, J. Huerta-Cepas, M. Simonovic, A. Roth, A. Santos, K. P. Tsafou, M. Kuhn, P. Bork, L. J. Jensen, and C. von Mering. 2015. STRING v10: protein-protein interaction networks, integrated over the tree of life. Nucleic Acids Res 43:D447-452. Sztajer, H., A. Lemme, R. Vilchez, S. Schulz, R. Geffers, C. Y. Yip, C. M. Levesque, D. G. Cvitkovitch, and I. Wagner-Dobler. 2008. Autoinducer-2-regulated genes in Streptococcus mutans UA159 and global metabolic effect of the luxS mutation. J Bacteriology 190:401-415.

100

Taga, M. E., J. L. Semmelhack, and B. L. Bassler. 2001. The LuxS-dependent autoinducer AI-2 controls the expression of an ABC transporter that functions in AI-2 uptake in Salmonella typhimurium. Mol Microbiol 42:777-793. Thanassi, J. A., S. L. Hartman-Neumann, T. J. Dougherty, B. A. Dougherty, and M. J. Pucci. 2002. Identification of 113 conserved essential genes using a high-throughput gene disruption system in Streptococcus pneumoniae. Nucleic Acids Res 30:3152- 3162. Tseng, T. T., B. M. Tyler, and J. C. Setubal. 2009. Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology. BMC Microbiol 9 Suppl 1:S2. Valentino, M. D., A. M. McGuire, J. W. Rosch, P. J. Bispo, C. Burnham, C. M. Sanfilippo, R. A. Carter, M. E. Zegans, B. Beall, A. M. Earl, E. I. Tuomanen, T. W. Morris, W. Haas, and M. S. Gilmore. 2014. Unencapsulated Streptococcus pneumoniae from conjunctivitis encode variant traits and belong to a distinct phylogenetic cluster. Nat Commun 5:5411. van Opijnen, T., K. L. Bodi, and A. Camilli. 2009. Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms. Nat Methods 6:767-772. Vidal, J. E., K. E. Howery, H. P. Ludewick, P. Nava, and K. P. Klugman. 2013. Quorum- sensing systems LuxS/autoinducer 2 and Com regulate Streptococcus pneumoniae biofilms in a bioreactor with living cultures of human respiratory cells. Infect Immun 81:1341-1353. Vieira, A., Y. J. Silva, A. Cunha, N. C. Gomes, H. W. Ackermann, and A. Almeida. 2012. Phage therapy to control multidrug-resistant Pseudomonas aeruginosa skin infections: in vitro and ex vivo experiments. Eur J Clin Microbiol Infect Dis 31:3241-3249. Wang, I. N., Y. Li, Q. Que, M. Bhattacharya, L. C. Lane, W. G. Chaney, and J. L. Van Etten. 1993. Evidence for virus-encoded glycosylation specificity. Proc Natl Acad Sci U S A 90:3840-3844. Wang, Q., M. Wang, F. Kong, G. L. Gilbert, B. Cao, L. Wang, and L. Feng. 2007. Development of a DNA microarray to identify the Streptococcus pneumoniae serotypes contained in the 23-valent pneumococcal polysaccharide vaccine and closely related serotypes. J Microbiol Methods 68:128-136. Wegmann, U., M. O'Connell-Motherway, A. Zomer, G. Buist, C. Shearman, C. Canchaya, M. Ventura, A. Goesmann, M. J. Gasson, O. P. Kuipers, D. van Sinderen, and J. Kok. 2007. Complete genome sequence of the prototype lactic acid bacterium Lactococcus lactis subsp. cremoris MG1363. J Bacteriol 189:3256-3270. Xia, G., L. Maier, P. Sanchez-Carballo, M. Li, M. Otto, O. Holst, and A. Peschel. 2010. Glycosylation of wall teichoic acid in Staphylococcus aureus by TarM. J Biol Chem 285:13405-13415. Yakunin, A. F., M. Proudfoot, E. Kuznetsova, A. Savchenko, G. Brown, C. H. Arrowsmith, and A. M. Edwards. 2004. The HD domain of the Escherichia coli tRNA nucleotidyltransferase has 2',3'-cyclic phosphodiesterase, 2'-nucleotidase, and phosphatase activities. J Biol Chem 279:36819-36827. Zhou, M., J. Boekhorst, C. Francke, and R. J. Siezen. 2008. LocateP: genome-scale subcellular-location predictor for bacterial proteins. BMC Bioinformatics 9:173.

101

Supporting Information

Figure S3. 1 Map of pLS1RGFP vector showing key features of the plasmid: ErmR, erythromycin resistance; GFP, Green Fluorescent Protein; MalA, maltose transport; MalR, maltosaccharide regulator transcriptional; Mob, mobilization protein gene; Pm, promoter M of the malMP operon; Pt, promoter T coupled to the malR gene; Px, promoter induction by maltose; RepA, recombinase functioning in recombinational DNA repair in bacteria; RepB, replication initiator protein; TetL, tetracycline resistance gene; Topo, topoisomerase type I.

102

Figure S3. 2 Comparison of the maltose effect on phage infection . Efficiency of plating of pneumophages on S. pneumoniae strains harboring pLS1RGFP without insert. A. Effect of 0.5% maltose needed for complementation to induce gene expression. B. Effect of 5% maltose used to induce a higher level of gene expression.

103

Table S3. 1 Protein-protein interaction in S. pneumoniae. Interactions determinded using String database and gene essentiality was investigated as descrived elsewhere. Red was used for genes of this study found to interact with others gnes. Green genes that interact more than one time with the pneumococcal proteins. Protein interaction Function Essentiality sp_0192 UPF0297 protein (hypothetical protein?) Yes sp_0196 Putative uncharacterized protein sp_0400 Trigger factor; Involved in protein export

sp_0670 Putative uncharacterized protein sp_0748 UPF0298 protein (hypothetical protein) sp_0865 DNA polymerase III, gamma and tau subunits Y es

Sp_0194 sp_1152 Exonuclease RexA Yes sp_1383 Alanyl-tRNA synthetase Yes sp_2040 jag protein, putative Yes sp_2069 Glutamyl-tRNA synthetase Yes Sp_0260 Putative uncharacterized protein Sp_1790 ATPase, AAA family Sp_1922 UPF0082 protein SP_1922

Sp_2096 Peptidase, M20/M25/M40 family Sp_0179 Holliday junction DNA helicase RuvA Y es SP_1416 S-adenosylmethionine-tRNA ribosyltransferase-isomerase

Sp_0259 SP_0264 Prolyl-tRNA synthetase Y es SP_2058 Queuine tRNA-ribosyltransferase SP_2114 Aspartyl-tRNA synthetase Y es SP_2203 Replicative DNA helicase Yes SP_0445 Acetolactate synthase large subunit SP_0447 Ketol-acid reductoisomerase SP_0450 Threonine dehydratase

Sp_1258 2-isopropylmalate synthase, putative SP_0730 Truncated pyruvate oxidase Y es SP_1392 Alpha-acetolactate decarboxylase

Sp_0446 SP_0251 Formate acetyltransferase, putative SP_0459 Formate acetyltransferase SP_1163 acetoin dehydrogenase, E1 component, beta subunit SP_1164 acetoin dehydrogenase, E1 component, alpha subunit Sp_0111 amino acid ABC transporter, ATP-binding protein, putative Sp_0600 ABC transporter, ATP-binding protein Vexp2 sp_0684 Putative uncharacterized protein sp_0685 Putative uncharacterized protein

sp_0686 Putative uncharacterized protein sp_0912 ABC transporter, ATP-binding protein sp_1341 ABC transporter, ATP-binding protein

Sp_0687 sp_1653 ABC transporter, ATP-binding protein sp_1957 ABC transporter, ATP-binding protein sp_1987 ABC transporter, ATP-binding protein SP_0980 O-methyltransferase SP_0978 Competence protein CoiA Y es SP_0976 SsrA-binding protein SP_1599 tRNA pseudouridine synthase A

SP_2121 Histidyl-tRNA synthetase Y es SP_0981 Foldase protein prsA SP_1577 Adenine phosphoribosyltransferase

Sp_0979 SP_0977 Tellurite resistance protein TehB SP_0237 50S ribosomal protein L17 SP_0236 DNA-directed RNA polymerase subunit alpha Y es

104

SP_1051 Putative uncharacterized protein SP_1052 Hypothetical protein

Sp_1050 SP_1053 Conserved domain protein SP_1049 Putative uncharacterized protein SP_1087 ATP-dependent DNA helicase PcrA SP_0568 Valyl-tRNA synthetase Y es SP_2058 Queuine tRNA-ribosyltransferase

SP_0672 GTP-binding protein HflX SP_1084 Methionine aminopeptidase Y es SP_0457 Undecaprenyl-diphosphatase Yes

Sp_1088 SP_0021 Putative deoxyuridine 5'triphosphate nucleotidohydrolase SP_2218 Rod shape-determining protein MreC Y es SP_1231 phosphopantothenoylcysteine synthase/decarboxylase Yes SP_0843 Deoxyribose-phosphate aldolase SP_1004 Surface protein BVH-3 SP_1687 neuraminidase B SP_1833 Cell wall surface anchor family protein

SP_1340 Putative uncharacterized protein SP_1824 ABC transporter, permease protein SP_1139 Putative uncharacterized protein

Sp_1153 SP_0641 Serine protease SP_1154 Immunoglobulin A1 protease SP_0200 Competence-induced protein Ccs4 SP_0965 Putative endo-beta-N-acetylglucosaminidase SP_0745 Uracil phosphoribosyltransferase SP_0844 Cytidine deaminase SP_1603 Cytidylate kinase Y es

SP_0944 Uridylate kinase Yes SP_0701 Orotidine 5'-phosphate decarboxylase Yes SP_0842 Pyrimidine-nucleoside phosphorylase

Sp_1208 SP_1278 Bifunctional protein pyrR Y es SP_0980 O-methyltransferase SP_1518 Putative uncharacterized protein Y es SP_1517 Transcription elongation factor greA Yes Sp_1213 tRNA pseudouridine synthase B SP_1110 riboflavin kinase/flavin adenine dinucleotide synthase yes SP_1211 Putative uncharacterized protein

SP_1233 Putative uncharacterized protein SP_1754 Putative uncharacterized protein SP_1234 Transcriptional regulator

Sp_1213 SP_1404 UPF0223 protein SP_1403 Inositol monophosphatase family protein SP_1402 NOL1/NOP2/sun family protein SP_0842 Pyrimidine-nucleoside phosphorylase SP_1355 50S ribosomal protein L10 Yes SP_0220 50S ribosomal protein L24 Yes SP_0630 50S ribosomal protein L11 Yes

SP_0212 50S ribosomal protein L2 Yes SP_0219 50S ribosomal protein L14 Yes SP_0221 50S ribosomal protein L5 Yes

Sp_1354 SP_0225 50S ribosomal protein L6 Yes SP_0237 50S ribosomal protein L17 Yes SP_0229 50S ribosomal protein L15 Yes SP_0631 50S ribosomal protein L1

SP_1396 Phosphate import ATP-binding protein pstB 1 SP_1397 Phosphate import ATP-binding protein pstB 2 SP_1400 Phosphate-binding protein pstS 1

Sp_1395

105

Sp_1399 Putative phosphate ABC transporter Sp_1358 Putative phosphate ABC transporter SP_2087 Phosphate import ATP-binding protein pstB 3 SP_2085 Phosphate ABC transporter SP_2086 Transmembrane protein PstA SP_2083 sensor histidine kinase PnpS SP_1226 sensory box sensor histidine kinase Y es Sp_1505 Membrane protein SP_1392 Alpha-acetolactate decarboxylase SP_1168 Mutator mutT protein

Sp_1506 Putative uncharacterized protein Y es SP_1554 CCA-adding enzyme Yes SP_1571 Dihydrofolate reductase Yes

Sp_1504 SP_1371 3-phosphoshikimate 1-carboxyvinyltransferase SP_1113 DNA-binding protein HU Sp_0119 MutT/nudix family protein Sp_0947 UPF0346 protein SP_0947 Sp_1504 TPR domain protein SP_0044 Phosphoribosylaminoimidazole-succinocarboxamide synthase SP_0047 Phosphoribosylformylglycinamidine cyclo-ligase

SP_0048 Phosphoribosylglycinamide formyltransferase Y es Sp_1506 Putative uncharacterized protein Yes SP_2222 CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase Yes

Sp_1505 SP_0516 Heat shock protein GrpE SP_1168 Mutator mutT protein Sp_0486 RNA methyltransferase SP_0591 Cysteinyl-tRNA synthetase Y es Sp_1535 UPF0213 protein SP_0935 Thymidylate kinase Y es SP_0938 Tetrapyrrole methylase family protein

Sp_0975 exoribonuclease, VacB/Rnb family SP_0788 Methionyl-tRNA synthetase Y es SP_0865 DNA polymerase III, gamma and tau subunits Yes

Sp_1536 SP_0936 DNA polymerase III, delta prime subunit SP_1672 Recombination protein recR Y es Sp_1537 Putative general stress protein 13 Sp_1538 Cof family protein/peptidyl-prolyl cis-trans isomerase Sp_0004 GTP-binding protein Yes SP_1541 30S ribosomal protein S6 Yes SP_1539 30S ribosomal protein S18 (rpsR) Yes

SP_2204 50S ribosomal protein L9 (rplI) Sp_2203 Replicative DNA helicase (dnaC) Y es SP_0186 UvrABC system protein A (uvrA) Yes

Sp_1540 SP_1228 A/G-specific adenine glycosylase (mutY) SP_2114 Aspartyl-tRNA synthetase (aspS) Y es SP_1845 Exodeoxyribonuclease (exoA) Yes SP_1542 Asparaginyl-tRNA synthetase (asnS) Yes SP_1576 Homoserine O-succinyltransferase Yes Sp_0673 Putative uncharacterized protein Sp_0937 Initiation-control protein yabA Y es

Sp_1459 Putative uncharacterized protein Yes Sp_0563 Putative uncharacterized protein Sp_1368 Psr protein

Sp_1575 Sp_1289 putative uncharacterized protein Sp_1609 UPF0135 protein Sp_1610 SAM-dependent methyltransferase Y es SP_1449 C3-degrading proteinase

106

Sp_1583 Isochorismatase family protein Sp_1288 UPF0122 protein Y es

Sp_0192 UPF0297 protein Yes Sp_1564 Putative uncharacterized protein SP_2195 Transcriptional regulator CtsR

Sp_1584 Sp_1585 Putative uncharacterized protein Sp_1368 Psr protein SP_0943 Methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase trmFO SP_1263 DNA topoisomerase Yes SP_0588 Polyribonucleotide nucleotidyltransferase SP_1607 UDP-glucose 4-epimerase Yes Sp_1838 glycosyl transferase, putative Yes Sp_1076 Glycosyl transferase, group 1 Yes

SP_1075 CpoA protein Yes Sp_0102 Glycosyl transferase Yes Sp_1837 capsular polysaccharide biosynthesis Yes

Sp_1606 Sp_0486 RNA methyltransferase SP_1169 Uracil-DNA glycosylase SP_0825 Bifunctional protein folD(methylenetetrahydrofolate dehydrogenase) Y es SP_2188 Redox regulated molecular chaperone SP_1670 D-alanine--D-alanine adding enzyme (UDP-N-acetylmuramoylalanyl...) Yes SP_0437 Glutamyl-tRNA(Gln) amidotransferase subunit A Yes SP_0438 Glutamyl-tRNA(Gln) amidotransferase subunit C Yes

Sp_1408 acyl-ACP thioesterase, putative Sp_1407 Hydrolase, haloacid dehalogenase-like family SP_1671 D-alanine-D-alanine ligase (D-alanyl-alanine synthetase A) Y es

Sp_1669 Sp_1668 Putative uncharacterized protein Sp_1406 Putative uncharacterized protein Sp_1462 Putative uncharacterized protein Sp_1409 Putative oxygen-independent coproporphyrinogen III oxidase SP_1673 Penicillin-binding protein 2b Yes Sp_1102 UPF0133 protein SP_0865 DNA polymerase III, gamma and tau subunits Y es

SP_0935 Thymidylate kinase Yes Sp_0938 Tetrapyrrole methylase family protein

SP_1117 DNA ligase Y es

Sp_1672 Sp_0020 Cytidine/deoxycytidylate deaminase family protein SP_0936 DNA polymerase III, delta prime subunit Sp_1536 Putative uncharacterized protein SP_0825 Bifunctional protein fold Y es Sp_1710 Nitroreductase family protein SP_1711 Primosomal protein DnaI Y es Sp_1712 Putative uncharacterized protein Yes

SP_1709 GTP-binding protein engA Yes SP_0178 Riboflavin biosynthesis protein RibD Sp_1024 Serine hydroxymethyltransferase; Interconversion of serine and glycine

Sp_1713 SP_0177 Riboflavin synthase, alpha subunit SP_0175 6,7-dimethyl-8-ribityllumazine synthase SP_0176 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II SP_0433 transcription antitermination protein NusB Yes SP_1724 Sucrose-6-phosphate hydrolase Yes

SP_1721 Fructokinase SP_1722 PTS system IIABC components Sp_1723 Putative uncharacterized protein

Sp_1725

107

Sp_1730 Putative uncharacterized protein Sp_1729 IS1381, transposase OrfB, truncation Sp_1728 Putative uncharacterized protein

SP_1732 Serine/threonine protein kinase Y es SP_1733 Putative uncharacterized protein phpP Yes SP_1734 rRNA methyltransferase RsmB

Sp_1731 SP_1735 Methionyl-tRNA formyltransferase Y es SP_1736 primosome assembly protein PriA Yes SP_0012 Hypoxanthine-guanine phosphoribosyltransferase SP_2061 Putative uncharacterized protein SP_1747 Probable nicotinate-nucleotide adenylyltransferase Sp_1744 Iojap-related protein Sp_1748 Putative uncharacterized protein yes

Sp_1745 Isochorismatase family protein Sp_1079 GTP-binding protein, GTP1/Obg family yes SP_1200 GTP-binding protein lepA

Sp_1746 SP_1107 50S ribosomal protein L27 yes SP_1105 50S ribosomal protein L21 yes SP_0976 SsrA-binding protein SP_0991 5'-methylthioadenosine yes Sp_1749 GTP-binding protein Yes Sp_1750 Putative uncharacterized protein Yes

1 Sp_1752 mechanosensitive ion channel, putative SP_1152 Exonuclease RexA Y es SP_1151 Exonuclease RexB Yes

Sp_175 Sp_1748 Putative uncharacterized protein Yes Sp_2048 Putative uncharacterized protein Sp_1880 Nucleoside-triphosphatase SP_1306 NADP-specific glutamate dehydrogenase SP_1544 Aspartate aminotransferase Y es Sp_1994 aspartate aminotransferase Yes

SP_0502 Glutamine synthetase, type I SP_0688 UDP-N-acetylmuramoylalanine--D-glutamate ligase; Cell wall formation Yes

Sp_1881 SP_2069 Glutamyl-tRNA synthetase Yes SP_0931 Glutamate 5-kinase (gamma-glutamyl kinase) SP_1008 Peptidase T SP_0713 Lysyl-tRNA synthetase Y es Sp_1914 Putative uncharacterized protein Sp_0160 Conserved domain protein Sp_1916 PAP2 family protein

Sp_1917 Putative uncharacterized protein Sp_0141 Transcriptional regulator SP_1499 bacterocin transport accessory protein

Sp_1915 Sp_1548 Putative uncharacterized protein Sp_1918 ABC transporter, ATP-binding protein Sp_1919 ABC transporter, permease protein Sp_0184 Putative uncharacterized protein Sp_1851 Competence-induced protein Ccs50 Yes Sp_1852 Thiamine pyrophosphokinase Sp_1983 Ribulose-phosphate 3-epimerase Y es Sp_1984 Putative ribosome biogenesis GTPase rsgA Yes

Sp_1985 Dimethyladenosine transferase Yes Sp_1698 Alanine racemase Yes Sp_1554 CCA-adding enzyme Yes Sp_1980 Sp_0976 SsrA-binding protein Sp_0935 Thymidylate kinase Y es Sp_1263 DNA topoisomerase Yes

108

Sp_0499 Phosphoglycerate kinas yes Sp_0605 Fructose-bisphosphate aldolase yes Sp_1574 Triosephosphate isomerase yes

Sp_1128 Enolase yes Sp_2030 RecP gene protein (Transketolase) (Tranketolase) (RecP protein) yes Sp_0974 Acylphosphatase

Sp_2012 Sp_0317 4-hydroxy-2-oxoglutarate aldolase Sp_2070 Glucose-6-phosphate isomerase yes Sp_0668 Glucose kinase (Gki) Sp_0843 Deoxyribose-phosphate aldolase Sp_2023 PTS system, IIB component Sp_2022 PTS system, IIC component Sp_0248 PTS system, IIA component

Sp_0308 PTS system, IIA component Sp_2021 Glycosyl hydrolase, family 1 Sp_0249 PTS system, IIB component

Sp_2024 Sp_0474 PTS system, cellobiose-specific IIC component Sp_0310 PTS system, IIC component Sp_0250 PTS system, IIC component Sp_2020 Transcriptional regulator, GntR family Sp_2037 PTS system, IIB componen Sp_2038 ascorbate-specific PTS system enzyme IIC Sp_2129 ascorbate-specific PTS system enzyme IIC

Sp_2035 hexulose-6-phosphate synthase, putative Sp_2031 Putative uncharacterized protein

Sp_2034 hexulose-6-phosphate isomerase, putative

Sp_2036 Sp_2130 PTS system, IIB component, putative Sp_2033 Putative L-ribulose 5-phosphate 4-epimerase AraD Sp_0306 transcriptional regulator, putative Sp_0394 PTS system mannitol-specific EIICB component Y es Sp_0871 conserved hypothetical intein-containing protein Yes Sp_0867 ABC transporter, ATP-binding protein Yes

Sp_0869 Aminotransferase, class-V Yes Sp_0870 NifU family protein Yes Sp_2124 Putative uncharacterized protein

Sp_2125 Sp_0868 Putative uncharacterized protein Y es Sp_0519 Heat shock protein DnaJ Sp_2058 Queuine tRNA-ribosyltransferase Sp_1119 Glyceraldehyde-3-phosphate dehydrogenase, NADP-dependent Sp_2186 Glycerol kinase Sp_2026 Alcohol dehydrogenase, iron-containing

Sp_0445 acetolactate synthase large subunit Sp_0253 Glycerol dehydrogenase Sp_0285 Alcohol dehydrogenase, zinc-containing

Sp_2157 Sp_2158 L-fucose isomerase Sp_1855 Alcohol dehydrogenase, zinc-containing Sp_2055 Alcohol dehydrogenase, zinc-containing Sp_2167 L-fuculose kinase fucK, putative Y es Sp_2167 L-fuculose kinase fucK, putative Yes Sp_2162 PTS system, IIC component Sp_2163 PTS system, IIB component

Sp_2159 Fucolectin-related protein Sp_2166 L-fuculose phosphate aldolase Sp_2161 PTS system, IID component

Sp_2168 Sp_2158 L-fucose isomerase Sp_2164 PTS system, IIA component Sp_2165 Fucose operon FucU protein Y es Sp_2160 Putative uncharacterized protein

109

Table S3.2 Primers used for gene knockout assays PCR product Gene Primer sequence (5’ – 3’) Forward/ Position within size (pb) Reverse the gene Sp_0194 ggtaaaaactatgttcttctagtaccagttaacg forward 118-151 306 pb Sp_0194 gcttggatttcaacttgtccgtcttc reverse 188-163 Sp_0259 gatctttatcgaagccgctaaaatgcg forward 116-143 1000 pb Sp_0259 ctgtctcacgctcttcggcgatattc reverse 880-855 Sp_0446 gcaacagaagatccgaatgtatcgc forward 109-134 477 pb Sp_0446 ctacgtctactactgttgcacggaaaggttg reverse 349-318 Sp_0687 ggacgattggagccatatgacaaagg forward 142-167 642 pb Sp-0687 ggggtctaaggaagcggttggttc reverse 504-481 Sp_0859 ggacatctgcattttggactctattgtc forward 113-140 924 pb Sp_0859 gtcaataaggtcccacaataacctgc reverse 782-757 Sp_0979 catctcttggatagtgcggataacctact forward 134-163 1803 pb Sp_0979 cgacttacctgccttgaggtagtcgatat reverse 1668-1640 Sp_1050 cagtctctaccgaattaatagacatcatttg forward 119-149 477 pb Sp_1050 cactcattaaaatccaaggattagactcatc reverse 346-316 Sp_1088 gtcaagctagcgtttttgaaattgccc forward 119-145 681 pb Sp_1088 cctgaaggatgattgtggaccaag reverse 536-513 Sp_1153 gccgtagcaattgtgtctgtggaaatg forward 119-145 1179 pb Sp_1153 gaagctcacgaaaataggaattgaggatcc reverse 913-884 Sp_1208 gagcatgattcatactacaaggatcag forward 112-139 639 pb Sp_1208 tcgataaactggtggtacattggtttgac reverse 493- 521 Sp_1213 gagcaaaaggccatgaatgagcaacag forward 142-168 1275 pb Sp_1213 gtcaggaatttcttaacctcttccatgcg reverse 1157-1129 Sp_1354 tgaacgaccttgtaaaagctatcg forward 59-82 238pb Sp_1354 gccttctttaacaagtgctggtg reverse 275-297 Sp_1395 atgaccgtgacctggcaaaag forward 112-137 653 Sp_1395 cgtcgtcaacagaacttaag reverse 417-439 Sp_1504 ggcaacttatcttgaagggattgg forward 96-119 1025 pb Sp_1504 tgtcccaattcacgcaagag reverse 1105-1124 Sp_1505 cacctgttttagactttttagcagttgtgatg forward 140-171 1167pb Sp_1505 ctccccagataccaaacatagatc reverse 1045-1022 Sp_1536 gatttccacgttttcctaagaaggggttg forward 122-150 750 pb Sp_1536 cgcctcaatcaaaagcatattggcttcc reverse 642-615 Sp_1540 gagtcaaaatggtgaacgtgaggctg forward 114-139 471 pb Sp_1540 cagttggtgcagagtaagctccac reverse 341-364 Sp_1575 ggcttagaagaaatgtcgccaagc forward 133-156 678 pb Sp_1575 ccagtttctcaaaatcgcctgaatgtac reverse 552-525 Sp_1584 gcaatgcctgcattatcaatagtaaggg forward 122-149 789 pb Sp_1584 cattgacaatcacagagcgagtgattc reverse 670-644 Sp_1606 caagtgatgggaccttggaactcttaaag forward 125-153 963 pb Sp_1606 ccaatggtcaagagttgaatgcctccaag reverse 842-814 Sp_1713 agacgtgagtgcgacgaatg forward 82-103 344 PB Sp_1713 gctctctaactcactgacatcc reverse 405-426

110

Sp_1669 gttgaatcaagcatcagaccttgattccg forward 129-157 612 pb Sp_1669 ggaattgtccatcaagaagcttacatcc reverse 454-472 Sp_1672 gggatgtctgctgatgatgtcaatg forward 100-124 597 pb Sp_1672 gaaagatacatggaagtcgcttcacc reverse 470-445 Sp_1725 gaagccatgcgagaattgggctataaac forward 115-142 966 pb Sp_1725 ggttgcttgatagtagccaattgaggg reverse 848-822 Sp-1731 ggattgtggattgcaatgtccttgc forward 128-152 759 pb Sp_1731 catgaccgcaccagctataatcaaatc reverse 609-582 Sp-1746 gaattagctcagcgctttggtgtag forward 115-139 594 pb Sp-1746 cgatagacttgcaatctcacgcgc reverse 468-445 Sp_1751 ccattgaatacgcactggatagaaacg forward 110-136 909 pb Sp_1751 gccaaaacagctagcaagactgaaatg Reverse 767-741 Sp_1881 gctgagcaaattcgtgaatatacttggc Forward 139-166 797 pb Sp_1881 gtaagactgagatatcccgtacg Reverse 652-630 Sp_1915 gctccgaggttgactttttacaaggg Forward 118-143 450 Sp_1915 gagtaaatctgacggatgtttgcgatcg Reverse 332-305 Sp_1980 caacctcataacattgaggcctttacc Forward 139-165 927pb Sp_1980 gataatctctgcttccataatgcgtgg Reverse 769-795 Sp_2012 gttatgcttgcacacttgttgaaatacgac Forward 115-144 1008pb Sp_2012 cgtcaagaactttagtttgagttgcgtc Reverse 901-874 Sp_2024 ctagctaaggcaggaaatttaaaagaagcg Forward 103-132 327 pb Sp_2024 gtatgagattagagtgaatcttgtgcgcttc Reverse 199-169 Sp_2036 gtggggcaattttgccagagtattacg Forward 107-133 486 pb Sp_2036 gggcaataatttgtggaatggctacac Reverse 364-338 Sp_2125 gaaatcaatctggatgaaacggggctc Forward 124-150 327pb Sp_2125 cagacctgccacgatttcaataggc Reverse 228-204 Sp_2157 gacagataagtacatcgaaggcagt Forward 115-129 1153pb Sp2157 gtcgaaatctttttcttcaatacc Reverse 1047-1023 Sp_2168 caaaagaaagcacggatacgtgaccc Forward 147-172 773 Sp_2168 cagtaagatggtttcatgggctttg Reverse 599-624

111

Table S3. 3 Primers used for complementation assays Gene Gene Primer F/R Primer sequence position Position Size Digestion Digestion TIGR4 R6 name 5' 3' site in site in R6 TIGR4 SP_0259 spr0238 DT304 for gctagcgctagcGAGTCACCCAATCAGGTGGCTT 232128 233126 998 SP_0259 DT305 rev gctagcgctagcGGTTATGAATACAGTGAAAAATAA 0 SP_1208 spr1090 DT306 for gctagcgctagcTGTGATAGAATAGACGACGG 1086075 1085437 -638 SP_1208 DT307 rev gctagcgctagcTTATTTGCTGTTTCGAGCTTC 0 SP_1540 spr1395 DT308 for gctagcgctagcTCACATGATCGTCAAAATTGA 1375311 1374841 -470 SP_1540 DT309 rev gctagcgctagcGTCCATTAGAATGGTAAATCATC 0 SP_1584 spr1439 DT310 for gctagcgctagcCGTTTTTATGTTATAATGATAGCG 1423524 1422736 -788 SP_1584 DT311 rev gctagcgctagcTCATTAGTAATCTCTTTTCTTCAC 0 SP_1713 spr1557 DT312 for gctagcgctagcAATGGTATAATGAAAAGAAAACG 1538731 1538258 -473 SP_1713 DT313 rev gctagcgctagcTTGGCTTCATTTATCTTTCCTT 0 SP_1881 spr1696 DT314 for gctagcgctagcAATCATAATGAACGATCAATCAG 1665693 1664899 -794 SP_1881 DT315 rev gctagcgctagcTGTCATAATTCTACATGCTCC 0 SP_1395 spr1252 DT316 for gctagcgctagcAAGACTATATTACAGGAAAATTTGG 1252240 1251587 -653 SP_1395 DT317 rev gctagcgctagcTTATAGTTCGACAATCTTACCTG 0 SP_2168 spr1974 DT318 for gctagcgctagcCCTCCAATTTGTGCTATAATAT 1964196 1964969 773 XbaI SP_2168 DT319 rev gctagcgctagcTCATTGAATATCAGAAACCC 0 SP_0194 spr0177 DT320 for gctagcgctagcTATAAAGGAGAGGCTATGTCAC 185057 185362 305 SP_0194 DT321 rev gctagcgctagcTCACTCCTCCATAAAGCTGT 0 SP_0446 spr0402 DT322 for gctagcgctagcTGTTACCAATGGTACCGGCT 399026 399526 500 SP_0446 DT323 rev gctagcgctagcTTAATCGCGGGTAAATCCAG 0 SP_0687 spr0602 DT324 for gctagcgctagcCTCGTGTTTCTATGACAATTATG 614626 615267 641 SP_0687 DT325 rev gctagcgctagcTCATCTATGTGATAAATCGGTA 0 SP_0859 spr0761 DT326 for gctagcgctagcTATCAAAAAAGACTAGGGGAGGAG 757384 758307 923 SP_0859 DT327 rev gctagcgctagcCTAAAATGCGAGAAAGTACATT 0 SP_0979 spr0882 DT328 for gctagcgctagcAATATGGTAGAATAGAAAGGATGG 872639 874441 1802 SP_0979 DT329 rev gctagcgctagcTTATGCCAATCCTAATTTTTCA 0 SP_1050 DT330 for gctagcgctagcTGCGTTATGCTTTTTTATGC 934883 935352 469 SP_1050 DT331 rev gctagcgctagcGCATGTTTGAATTCACTATCAG 0 SP_1088 spr0996 DT332 for tctagatctagaAATTTTCCATCCTTCTCACG 981461 982156 695 NheI NheI SP_1088 DT333 rev tctagatctagaTTAGATTAAATCTGTCTTTTCACG 0 SP_1153 spr1041 DT334 for gctagcgctagcGTTTGCTCTTTGATTTTTATTGAG 1028574 1029752 1178 XbaI XbaI SP_1153 DT335 rev gctagcgctagcTACTCATATCACTAATCGTTCTA 0 SP_1213 spr1094 DT336 for tctagatctagaAGGCATGATATAATGGTTACAG 1092176 1090902 -1274 NheI NheI SP_1213 DT337 rev tctagatctagaATAACTTATTTCCTCACTCCC 0 Sp_1354 DT377 for tctagatctagaatggcattgaacattgaaaa 1274614 1274982 -369 Sp_1354 DT378 rev Tctagatctagattatttaagagtaactgaagctccag 0 SP_1504 spr1356 DT340 for gaattcgaattcTGGTATAAGGTAGTCAGTGG 1339622 1338378 -1244 NheIXbaI NheIXbaI SP_1504 DT341 rev gaattcgaattcCTTACAATCTCTCAAACAGTTC 0 SP_1505 spr1357 DT342 for gctagcgctagcGTTTCAAAAATGGTATAATGAGAG 1340763 1339597 -1166 SP_1505 DT343 rev gctagcgctagcCTATTGTTCACTCTTGACTTC 0 SP_1536 spr1391 DT344 for tctagatctagaTTTGTAATGTTAATATAAATTTGCTA 1372460 1371711 -749 NheI NheI SP_1536 DT345 rev tctagatctagaTTATGATCCATAATAAATCTCT 0

112

SP_1575 spr1433 DT346 for gctagcgctagcATGATGCATCTGCATATGGG 1417587 1416910 -677 SP_1575 DT347 rev gctagcgctagcGATTAATCCTTCCAGAGATCCA 0 SP_1606 spr1459 DT348 for gctagcgctagcTCCTATTCCTTACCGCATCG 1440863 1439772 -1091 SP_1606 DT349 rev gctagcgctagcCTCTAGTTTAGCACATTTCCATG 0 SP_1669 spr1513 DT350 for gctagcgctagcACTCTATGAATCTAGCCAAG 1490946 1490335 -611 NheI SP_1669 DT351 rev gctagcgctagcTCTTCTTAGTCAAGATATTGCC 0 SP_1672 spr1516 DT352 for gctagcgctagcTGTATCAAAAATACCATCCAATG 1494205 1493609 -596 SP_1672 DT353 rev gctagcgctagcTACACTTACAACTCTGTCCG 0 SP_1725 spr1569 DT354 for gctagcgctagcATCAAATCTGGAAACCCAAC 1550199 1551164 965 SP_1725 DT355 rev gctagcgctagcGTGTTTAAATACTTTTTCCTGGTA 0 SP_1731 spr1576 DT356 for tctagatctagaGTGATAGAATAGAGGGAGTTG 1555989 1555231 -758 NheI NheI SP_1731 DT357 rev tctagatctagaTTAGTTCATCAATACCAAGGC 0 SP_1746 spr1591 DT358 for gctagcgctagcCAGTGCTAGACTACATCGAG 1570616 1570023 -593 XbaI SP_1746 DT359 rev gctagcgctagcTTAGTTCTCTTTCAAATAGTGC 0 SP_1751 spr1596 DT360 for tctagatctagaAATTTGTGGTACAATAGAGGG 1574370 1573474 -896 NheI NheI SP_1751 DT361 rev tctagatctagaTTCTGGCTCCTTTTCTTAAC 0 SP_1915 spr1731 DT362 for gctagcgctagcCTTGTATTCCTAACTTAGCTTTG 1708821 1708372 -449 XbaI XbaI SP_1915 DT363 rev gctagcgctagcTTTTACCTCATGTTTCTTAGATTT 0 SP_1980 spr1794 DT364 for gctagcgctagcATTAAACCGTCGTACCATAG 1766927 1765923 -1004 SP_1980 DT365 rev gctagcgctagcTATTAATCTAAATCTGGTTTATAGAAG 0 SP_2012 spr1825 DT366 for gctagcgctagcGCAATTCAACTCAAATAGTTG 1801033 1799954 -1079 SP_2012 DT367 rev gctagcgctagcGAATTATTTAGCAATCTTTGCG 0 SP_2024 spr1836 DT368 for gctagcgctagcCGGAATGATGAATGGAGCAAAAG 1810463 1810789 326 SP_2024 DT369 rev gctagcgctagcGATGGGAACGACAGTGTTCC 0 SP_2036 spr1847 DT370 for gctagcgctagcACTGAGAGTTATCGTTTCTG 1823836 1823351 -485 SP_2036 DT371 rev gctagcgctagcCTAACTTTCCAAATCCAATCC 0 SP_2125 spr1934 DT372 for gctagcgctagcAATAGAGGATATTTATCACGTGGAGG 1915450 1915791 341 SP_2125 DT373 rev gctagcgctagcTTAACGAGGTGGTAGTCCAAG 0 SP_2157 spr1963 DT374 for gctagcgctagcATGTTAAATAGATAGCGCGG 1951484 1950333 -1151 SP_2157 DT375 rev gctagcgctagcATTGTCGTCTAATCTCTTGC 0

113

114

Chapitre 4: Discussion et perspectives

S. pneumoniae est l’un des principaux agents pathogènes de l’homme auquel on associe un taux élevé de morbidité et de mortalité. Les infections à S. pneumoniae demeurent un problème de santé publique critique dû à l’émergence de plusieurs souches résistantes et multirésistantes aux antibiotiques. D’ailleurs, cette situation est devenue le cas pour plusieurs autres bactéries pathogènes et représente à l’heure actuelle un problème majeur de santé publique. Aujourd’hui, la réévaluation du pouvoir thérapeutique des phages dans le traitement des infections bactériennes offre une alternative théoriquement attirante. En effet, les phages virulents sont naturellement programmés pour détruire une bactérie (ou un groupe de bactéries spécifiques). Puisque les phages sont des prédateurs naturels des bactéries, ils ont été envisagés très tôt en tant qu'outils thérapeutiques, mais ils ont aussi été très tôt abandonnés. Le déclin de la thérapie avec les phages a coïncidé avec la naissance de l’ère des antibiotiques. Une utilisation efficace des phages à des fins thérapeutiques exigera une bonne compréhension de ces entités biologiques et de leurs interactions avec leurs bactéries, et ce dans un contexte clinique.

Malgré que le génome de S. pneumoniae regorge de prophages, seulement deux phages virulents sont facilement disponibles dans les collections publiques de phages et les essais pour en isoler d’autres ont été peu fructueux. De plus, aucun phage virulent n’est encore isolé pour S. mitis, une espèce phylogénétiquement proche de S. pneumoniae. S. mitis est une bactérie pathogène responsable d’endocardite et plusieurs souches présentent aussi des taux élevés de résistance aux antibiotiques. Ces deux espèces bactériennes ont plusieurs points en commun dont la capacité à coloniser les voies respiratoires supérieures de l’homme, la transition du commensalisme à la virulence et la variation de phase.

Dans le cadre de ce projet de doctorat, j’ai démontré que les pneumophages lytiques Dp-1 et SOCP étaient capables d’infecter des souches de S. mitis. De toute évidence, des récepteurs phagiques sont similaires chez ces deux espèces bactériennes. Même si les récepteurs de pneumophages sont pratiquement inconnus, la plupart des protéines de surface de S. pneumoniae et des homologues de certaines de ces protéines sont présentes

115

chez S. mitis. À noter que le taux d'adsorption des pneumophages est plus élevé pour l'hôte S. pneumoniae. Ceci pourrait être dû à un nombre limité de récepteurs phagiques chez S. mitis, à une exposition réduite de ces récepteurs à la surface de S. mitis ou simplement une affinité plus faible. Une autre observation des plus intéressantes est que les deux pneumophages analysés forment des plages de lyse nettement plus visibles sur un tapis bactérien de S. mitis que sur S. pneumoniae. Par contre, la taille de la progéniture est plus élevée chez l’hôte S. pneumonie alors que le temps de latence est plus court chez S. mitis et ce, pour les deux phages.

Des analyses des génomes des deux phages propagés chez les deux hôtes ont confirmé que le changement de l’hôte bactérien n’induit aucune variation dans les génomes des pneumophages. Cependant, les résultats de séquençage ont montré la présence de plusieurs variations dans le génome de notre phage Cp-1 par rapport à la séquence disponible dans GenBank. L’analyse du génome du phage Cp-1 a mené à sa réannotation et à renommer notre phage SOCP. Il n’est pas impossible que des erreurs de séquençage ont été faites lors de la description originale de ce phage. Le génome a été séquencé pour la première fois en 1996 environ quinze ans après l’isolement du phage et sa séquence a d’ailleurs subi plusieurs rectifications au fil du temps. On ne sait pas ni comment ni quand cette évolution a eu lieu. Les variations dans le génome du phage SOCP pourraient être dues à l'adaptation du phage à son hôte et cette adaptation pourrait améliorer l'infectivité du phage, incluant la capacité d’infecter plusieurs hôtes (Benmayor, et al., 2009). Ces variations ont augmenté la taille de la progéniture à environ 94 UFP dans notre étude par rapport à de 9 à 11 UFP pour le phage Cp-1 dans la publication originale (Ronda, et al., 1981). L’adaptation du phage s’est produite à travers de nombreuses mutations dans le génome. Dans le cas du phage SOCP, la fréquence de mutation était de 0,16%, ce qui est semblable au pourcentage rapporté dans le cas du phage φX174 (Wichman, et al., 2005). Toutefois, ce dernier est un phage à ADN simple brin. Ces différences d’infectivité peuvent être aussi le résultat des conditions utilisées dans les tests et qui sont adaptées pour S. pneumoniae (Ouennane, et al., 2015). Il est à souligner également que nous avons nettement amélioré, suite à plusieurs essais, les conditions d’infection et de croissance des pneumophages.

116

Les principales variations dans le génome de SOCP touchent les gènes codant pour la réplication du phage, les protéines de capside et l'encapsidation, et la protéine de liaison aux récepteurs. Ce type de mutations a déjà été observé chez d’autres phages (Wichman, et al., 2005, Paterson, et al., 2010, Hall, et al., 2013). Cette évolution semble avoir conféré au phage SOCP une nette amélioration à infecter S. pneumoniae et possiblement sa capacité d’infecter efficacement une autre espèce, S. mitis. Le pneumophage Dp-1 (Siphoviridae) est également capable d’infecter une souche de S. mitis. Dp-1 reconnaît des récepteurs qui contiennent des résidus de la choline, un composant de l’acide teichoïque de la paroi bactérienne. De nombreuses protéines de liaison à la choline sont présentes chez S. mitis.

Ainsi, mes travaux ont permis d’infecter des souches de S. mitis avec deux pneumophages et appartenant à deux familles différentes. Il serait aussi intéressant de tester des phages de S. mitis sur des souches de S. pneumoniae. Mais en absence de phages virulents de S. mitis, cette option n’est pas possible pour le moment. D’ailleurs, il semble que les deux espèces bactériennes partagent le même niveau de difficulté pour isoler des nouveaux phages virulents malgré la grande diversité des souches. La difficulté d’isoler des phages virulents mérite une étude plus approfondie pour mieux comprendre les facteurs impliqués. Par exemple, un des problèmes qui influence l’efficacité d’infection des souches cliniques de S. pneumoniae est la présence de la capsule. Plusieurs souches de S. mitis ont aussi un locus génétique fonctionnel codant pour la production de capsules (Rukke, et al., 2012). Il existe des phages qui infectent des souches bactériennes qui produisent des capsules, mais pas chez S. pneumoniae. Qui plus est, le niveau d’expression de la capsule est variable chez S. pneumoniae. En effet, les variations de phase peuvent induire des altérations dans les structures et les composantes associées à la surface, par exemple, le niveau de production de capsules, les protéines de surface et la composition de paroi cellulaire.

Pour l’instant, les deux pneumophages à l’étude ont somme toute un potentiel relativement limité en phagothérapie. Bien qu’ils soient capables d’éliminer à la fois S. pneumoniae et S. mitis, ils ne peuvent infecter des souches capsulées de S. pneumoniae. De plus, avec la grande capacité de ces bactéries à changer leur environnement génétique, leur efficacité in vivo devra être étudiée davantage. De plus les conditions qui peuvent influencer l’efficacité des phages, comme le mode d’administration, les concentrations des préparations

117

phagiques et les facteurs bactériens nécessaires à l’infection phagique seront aussi à déterminer. Ce qui nous amène à notre deuxième objectif qui est l’étude des interactions phage-hôte chez S. pneumoniae.

L’originalité de notre démarche visait à identifier des facteurs de l’hôte qui modulent l’infection par les pneumophages. Plusieurs gènes de S. pneumoniae ont été identifiés à la lumière des résultats d’une étude précédente sur les interactions protéine-protéine par la technique de double hybride (Mariano, et al., 2016). Au total, 36 gènes du pneumocoque ont fait l’objet de notre étude. Tout d’abord, l’importance de ces gènes pour la viabilité du pneumocoque et pour la croissance bactérienne a été évaluée. Les résultats de l’inactivation des gènes d’intérêt ont permis d’identifier huit nouveaux gènes de S. pneumoniae qui semblent essentiels à la croissance de cette bactérie. Trois gènes liés au métabolisme (Sp_0687, Sp_1751 et Sp_2168), deux gènes liés au stockage et au traitement de l'information (Sp_1669 et Sp_1980), un gène intervenant dans les processus cellulaires et la signalisation (Sp_1050) et deux gènes encore mal caractérisés (Sp_1153 et Sp_2125). En outre, certains gènes ont aussi un effet strict sur le phénotype bactérien, comme l'hémolyse, le changement de la taille des colonies et le taux de croissance bactérienne. À noter que ces effets observés pourraient être aussi dus à un effet polaire suite à l'altération de l’expression de certains gènes en aval ou à d’autres interactions intracellulaires.

Des analyses bioinformatiques supplémentaires ont été faites pour construire un réseau de facteurs hôtes qui participent ou qui peuvent affecter l'infection par les phages. Pour ces gènes du pneumocoque, de nombreuses interactions au sein du S. pneumoniae ont été identifiées et ont permis de construire un grand réseau d'interactions. Ce réseau montre la grande diversité et la complexité de ces interactions.

Par la suite, l’implication de ces facteurs de S. pneumoniae dans la réplication des deux pneumophages virulents a été évaluée. De plus, l’efficacité du cocktail des deux phages a aussi été vérifiée. Les tests d'infection des phages en utilisant des souches mutantes (gène inactivé) nous ont permis d'identifier de nombreux gènes pneumococciques nécessaires à l'infection phagique. En effet, j’ai identifié six gènes de pneumocoque essentiels à la réplication du phage Dp-1. Il s’agit de deux gènes codant pour des protéines hypothétiques

118

(Sp_0194, Sp_1536), trois gènes impliqués dans la signalisation et les processus cellulaires (Sp_1505, Sp_1606 et Sp_1746) et un gène participant à la transcription et à la transduction du signal (Sp_1915). Cependant, seulement un gène (Sp_1505) a eu un impact majeur sur la réplication du phage SOCP.

D’autre part, pour confirmer les résultats obtenus suite à l’inactivation des gènes de S. pneumoniae et l’infection par les pneumophages, j’ai procédé à la complémentation de ces gènes dans les souches inactivées. Dans une autre série d’expériences, j’ai aussi utilisé un vecteur permettant la sur-expression de ces gènes. La complémentation a permis de restaurer le phénotype sauvage et d’obtenir des résultats d’infection par les phages (EOP) semblables à la souche sauvage; sauf pour certains gènes (Sp_0194, Sp_1208, Sp_1505, Sp_1606, Sp_1725 et Sp_1915) où la restauration a été obtenue seulement lors de l’augmentation du niveau d’expression des gènes.

Par ailleurs, l'impact de ces modifications génétiques a aussi été déterminé lors d’essais avec un cocktail des deux pneumophages. Les cocktails phagiques sont de plus en plus explorés dans les recherches sur la thérapie par les phages puisqu’il pourraient prévenir ou réduire l'émergence de souches bactériennes résistantes aux phages. L’utilisation d’un cocktail pourrait procurer des effets synergiques tels qu'une meilleure activité antibactérienne par rapport aux monophages. Par opposition, il n’est pas aussi impossible que la présence d’un phage nuise à l’activité d’un second, on parlera alors d’interférence. Le cocktail de phages a été préparé à un titre égal de chaque phage. Dans mes expériences de laboratoire, le cocktail de phage a montré, en général, une meilleure efficacité que le monophage. Cela pourrait être effectivement lié à des effets synergiques et au fait que les deux phages n’utilisent pas les mêmes facteurs de l’hôte. Cependant, une réduction de l’EOP du cocktail de phages a été obtenue lors de la délétion du gène Sp_1395 codant pour un régulateur transcriptionnel de la famille PhoU. Ceci pourrait être le résultat d’une interférence entre les deux phages et qui résulte en la réduction de la taille de la progéniture d’un des deux phages.

119

L'étude des interactions phage-bactérie a permis d'améliorer notre compréhension des exigences des facteurs de l'hôte pour les pneumophages et a montré qu’il est essentiel de confirmer les résultats in vitro de la Y2H. En effet, les tests de la Y2H ont été effectués dans la levure, qui est évidemment un environnement très différent de ce qui se passe dans une bactérie et infectée par un phage par surcroit. Il est clair que l’étude précédente avec la Y2H (Mariano, et al., 2016) a généré des interactions faussement positives et aussi manqué certaines interactions (faux négatifs). D’ailleurs, mes travaux dans un système in vivo, soit l'hôte bactérien, ont aussi permis de détecter plusieurs interactions qui n’avaient pas été identifiées par l’étude de la Y2H. Le fait d’étudier l’interaction de la totalité des gènes avec les deux pneumophages et leur hôte nous a permis de détecter ces interactions non révélées en Y2H.

Même s’il y avait des différences entre les deux approches; le fait de se baser initialement sur les résultats obtenus avec la Y2H a permis de cibler rapidement certains gènes pour notre approche in vivo. Cependant, on est conscient que cette étude n’a pas inclut tous les gènes qui peuvent participer à ces interactions. De même, ni de déterminer en quelle étape du cycle de réplication du phage ces facteurs de l’hôte interviennent. Malgré que la fonction de plusieurs gènes de S. pneumoniae demeure encore mal connue, cette étude aura permis d’ajouter des rôles à quelques gènes. Cette étude a aussi présenté un aperçu du réseau complexe des interactions phage-hôte et a permis d’identifier plusieurs gènes de S. pneumoniae impliqués dans la réplication des pneumophages.

L’étude de bactéries mutantes naturellement résistantes aux phages (BIMs) est habituellement la méthode de choix pour identifier des facteurs de l’hôte impliqués dans la réplication des phages. Ces mutants sont obtenus ou sélectionnés suite à une évolution ciblée sur boîte de Petri en présence de quantités variables de phages. En générant de tels mutants résistants aux phages et en séquençant leur génome, il est possible d’identifier des facteurs de l’hôte important pour l’infection phagique. Dans une étude dans laquelle j’ai récemment participé comme collaboratrice, les analyses d’un BIM résistant au phage SOCP et d’un autre BIM résistant au phage Dp-1 ont permis d’identifier quelques mutations dans le génome de S. pneumoniae (Leprohon, et al., 2015). Au total, onze mutations ont été

120

identifiées dans une souche résistante au phage SOCP et ces mutations étaient retrouvées dans huit gènes. En parallèle, cinq mutations ont été identifiées dans une souche résistante au phage Dp-1 et elles ciblent deux gènes. L’investigation du rôle de chaque mutation dans l’infection phagique a permis d’identifier trois gènes de S. pneumoniae dans la résistance au phage SOCP, soit un gène codant pour un régulateur de type GntR, un autre codant pour une glycerophosphoryl phosphodiestérase et finalement un gène codant pour une ligase (Mur. Un seul gène codant pour une endonucléase de type IV a été confirmé dans la résistance au phage Dp-1 (Leprohon, et al., 2015).

Mes travaux ont également mené à la construction de souches mutantes résistantes aux phages. En effet, la délétion de certains gènes bactériens a mené à une résistance bactérienne contre les phages. Un gène bactérien comme étant important pour les deux phages a été identifié, soit celui codant pour un autoinducer-2, un membre d'une famille de molécules de signalisation. Ce gène semble jouer un rôle clé puisque son inactivation inhibe complètement la réplication des pneumophages SOCP et Dp-1. Ce gène pourrait peut-être contrôler la pression osmotique nécessaire pour l’éjection de l’ADN du phage et son absence empêcher ce processus (Taga, et al., 2001, Guo, et al., 2013). Une deuxième possibilité est l'implication de ce gène dans la libération de la descendance virale lors de la lyse de l’hôte. Certains phages utilisent les holines pour l'exportation des endolysines de phages vers la membrane cellulaire tandis que d'autres phages nécessitent la contribution d'une voie de sécrétion de l'hôte (système Sec), comme c'est le cas pour les pneumophages (Catalao, et al., 2013). L'inactivation de l'AI-2 chez S. pneumoniae pourrait moduler négativement l'expression du système Sec de l’hôte.

Tel que mentionné précédemment, quelques gènes du pneumocoque se sont avérés essentiels à la croissance de la bactérie. Ainsi, l’importance de ces gènes pour les pneumophages n’a pas été étudiée puisque la délétion de ces gènes était létale pour la bactérie. Il aurait été possible d’étudier le niveau d’expression de ces gènes suite à l’infection par les phages et voir si effectivement se sont ces protéines qui interagissent avec les pneumophages. Il serait aussi intéressant de vérifier si ces gènes sont aussi importants pour d’autres phages ou dans le cas d’autres bactéries, soit en se basant sur la

121

ressemblance entre les phages ou en comparant le pourcentage d’identité de ces gènes/protéines chez d’autres bactéries.

Cette étude aurait pu être encore plus intéressante si nous avions pu suivre la production de l’ensemble des protéines de l’hôte à différents temps d’infection et les associer à chaque étape du cycle de la réplication du phage. Nos données aident à définir une meilleure compréhension du pneumocoque et des interactions avec certains de ses phages, mais il reste clairement encore beaucoup de travail. Néanmoins, il s'agit de la première étude à notre connaissance qui compare le résultat de l'interaction hôte-phage via deux systèmes, dans la cellule bactérienne comme modèle in vivo et dans levure par Y2H comme modèle in vitro. Ces deux systèmes modèles représentent une nouvelle façon de faciliter et d'élucider les interactions hôte-phages, entre autres, pour réduire l’étude du nombre des gènes dans la cellule hôte.

Dans ce projet, on a aussi fait face à un autre défi qui est le manque d’information sur la fonction d’un grand nombre de gènes/protéines de S. pneumoniae. En effet, malgré la disponibilité de la séquence du génome bactérien, la plupart des gènes ont des fonctions inconnues ou uniquement prédites. D’ailleurs, les prédictions sur plusieurs gènes/protéines ont grandement fluctuées au cours des cinq dernières années, ce qui a amené de nombreuses mises à jour de notre réseau d’interactions chez S. pneumoniae.

S. pneumoniae est une bactérie qui présente plusieurs caractéristiques pour assurer sa virulence et sa pérennité. Son passage d’un agent commensal à un pathogène est accompagné d’un grand changement dans son réseau d’expression de gènes qui n’est pas encore bien compris. L’usage des phages à des fins thérapeutiques nécessite d’inclure divers scénarios du comportement des bactéries lors de l’infection. Par exemple, la température semble avoir un grand effet sur l’expression des gènes de S. pneumoniae et aussi sur sa virulence (Pandya, et al., 2005). Le nasopharynx, le lieu de départ de l’infection et de la colonisation du pneumocoque, est un environnement avec une température d’environ 33°C. Lorsque la bactérie migre au poumon, le sang et les autres organes ont une température de 37°C mais celle-ci peut être plus élevée en cas d’infection. Même si l’écart

122

de température ne semble pas si grand, l’expression des gènes à ces températures est différente (Pandya, et al., 2005). L’impact de ces fluctuations de température sur l’infection par les phages et les interactions avec les facteurs de l’hôte reste à être investigué. D’autre part, mes travaux ont aussi permis de constater l’importance de métaux pour la croissance de la bactérie mais aussi pour l’infection phagique. S. pneumoniae est doté de nombreux systèmes d'acquisition de métaux qui sont exposés à sa surface. Ces métaux sont nécessaires pour l'infection invasive du pneumocoque. Dans le corps humain, la bactérie nécessite ces métaux pour sa virulence mais on ne sait pas si les concentrations seront suffisantes pour l’infection phagique.

Bien que cette étude de S. pneumoniae et ces deux phages virulents ne représente pas la gamme complète des facteurs de l’hôte impliqués dans les mécanismes d'infection des pneumophages, les résultats fournissent un nouvel aperçu sur les interactions phage- bactérie. Réussir une thérapie avec des phages demeure encore un grand défi. De nouveaux travaux seront nécessaires pour élucider les éléments clés pour garantir son efficacité thérapeutique.

123

Conclusions

La résistance aux antibiotiques est maintenant un problème mondial. Cette résistance met en évidence l'évolution des bactéries sur de nombreuses années et leurs capacités à s’adapter suite à une pression de sélection. Il existe donc maintenant, peut-être plus que jamais, un besoin d’alternatives thérapeutiques pour contrôler certaines infections d’origine bactérienne. Ces alternatives doivent non seulement remplacer l’usage abusif des antibiotiques dans le traitement des infections chez l’homme mais aussi doivent être en mesure de les remplacer dans l’agriculture et la pisciculture. Ces nouvelles options pourraient même être utilisées en synergie avec les antibiotiques. Peut-être faut-il laisser la nature faire son œuvre et tenter ensuite de la domestiquer. Les phages sont les entités biologiques les plus abondantes sur la planète. Puisqu’ils sont spécifiques à un groupe restreint de bactéries, ils n’interviennent que là où sont leurs bactéries hôtes. Auparavant, la thérapie par phage a été appliquée sans aucune connaissance préalable de ces virus bactériens, il suffisait d’isoler le bon phage efficace sur la « bonne » souche bactérienne pour l’utiliser. Cette approche a mené à de nombreux échecs avant de réussir une thérapie ou une préparation à des fins thérapeutiques. Ce manque de connaissances a précipité le déclin de cette thérapie, surtout avec l’arrivée des antibiotiques. Aujourd’hui, l’intérêt pour les phages est revenu et il ne faudrait pas répéter les mêmes erreurs. Cette thèse a permis d’approfondir nos connaissances sur les pneumophages et sur leur souche hôte. Néanmoins, notre compréhension de cette mélodie jouée par ces deux chefs d’orchestre et les éléments qui la définissent reste encore mal comprise. De nombreuses questions demeurent sans réponses ou ne sont pas encore profondément comprises dont les comportements de phages in vivo, ainsi que les paramètres requis pour une application efficace de la thérapie par phage. Les prochaines années seront sans aucun doute très intéressantes puisque de plus en plus d’équipes de recherche et d’entreprises s’intéressent aux applications médicales des phages.

124

Bibliographie

Abedon, S. T., S. J. Kuhl, B. G. Blasdel, and E. M. Kutter. 2011. Phage treatment of human infections. Bacteriophage 1:66-85. Abedon, S. T., C. Thomas-Abedon, A. Thomas, and H. Mazure. 2011. Bacteriophage prehistory: is or is not Hankin, 1896, a phage reference? Bacteriophage 1:174-178. Ackermann, H. W. 2007. 5500 phages examined in the electron microscope. Arch Virol 152:227-243. Ackermann, H. W. 2009. Phage classification and characterization. Methods Mol Bio 501:127-140. Adegbola, R. A., R. DeAntonio, P. C. Hill, A. Roca, E. Usuf, B. Hoet, and B. M. Greenwood. 2014. Carriage of Streptococcus pneumoniae and other respiratory bacterial pathogens in low and lower-middle income countries: a systematic review and meta-analysis. PLoS One 9:e103293. Adriaenssens, E. M., H. W. Ackermann, H. Anany, B. Blasdel, I. F. Connerton, D. Goulding, M. W. Griffiths, S. P. Hooton, E. M. Kutter, A. M. Kropinski, J. H. Lee, M. Maes, D. Pickard, S. Ryu, Z. Sepehrizadeh, S. S. Shahrbabak, A. L. Toribio, and R. Lavigne. 2012. A suggested new bacteriophage genus: "Viunalikevirus". Arch Virol 157:2035-2046. Afzal, M., S. Shafeeq, I. Manzoor, and O. P. Kuipers. 2015. Maltose-dependent transcriptional regulation of the mal regulon by MalR in Streptococcus pneumoniae. PLoS One 10:e0127579. Agari, Y., K. Sakamoto, M. Tamakoshi, T. Oshima, S. Kuramitsu, and A. Shinkai. 2010. Transcription profile of Thermus thermophilus CRISPR systems after phage infection. J Mol Bio 395:270-281. Akira, S., S. Uematsu, and O. Takeuchi. 2006. Pathogen recognition and innate immunity. Cell 124:783-801. Alekshun, M. N., and S. B. Levy. 2006. Commensals upon us. Biochem Pharmacol 71:893-900. Alexandre, Y., G. Le Blay, S. Boisrame-Gastrin, F. Le Gall, G. Hery-Arnaud, S. Gouriou, S. Vallet, and R. Le Berre. 2014. Probiotics: a new way to fight bacterial pulmonary infections? Med Mal Infect 44:9-17. Allan, E., H. A. Hussain, K. R. Crawford, S. Miah, Z. K. Ascott, M. H. Khwaja, and A. H. Hosie. 2007. Genetic variation in comC, the gene encoding competence- stimulating peptide (CSP) in Streptococcus mutans. FEMS Microbiol Lett 268:47- 51. Allen, H. K., J. Donato, H. H. Wang, K. A. Cloud-Hansen, J. Davies, and J. Handelsman. 2010. Call of the wild: antibiotic resistance genes in natural environments. Nat Rev Microbiol 8:251-259. AlonsoDeVelasco, E., A. F. Verheul, J. Verhoef, and H. Snippe. 1995. Streptococcus pneumoniae: virulence factors, pathogenesis, and vaccines. Microbiol Rev 59:591- 603. Amalaradjou, M. A., and A. K. Bhunia. 2012. Modern approaches in probiotics research to control foodborne pathogens. Adv Food Nutr Res 67:185-239.

125

Amblee, V., and C. J. Jeffery. 2015. Physical features of intracellular proteins that moonlight on the cell surface. PLoS One 10:e0130575. Andersson, D. I., and D. Hughes. 2010. Antibiotic resistance and its cost: is it possible to reverse resistance? Nat Rev Microbiol 8:260-271. Arai, J., M. Hotomi, S. K. Hollingshead, Y. Ueno, D. E. Briles, and N. Yamanaka. 2011. Streptococcus pneumoniae isolates from middle ear fluid and nasopharynx of children with acute otitis media exhibit phase variation. J Clin Microbiol 49:1646- 1649. Arbique, J. C., C. Poyart, P. Trieu-Cuot, G. Quesne, G. Carvalho Mda, A. G. Steigerwalt, R. E. Morey, D. Jackson, R. J. Davidson, and R. R. Facklam. 2004. Accuracy of phenotypic and genotypic testing for identification of Streptococcus pneumoniae and description of Streptococcus pseudopneumoniae sp. nov. J Clin Microbiol 42:4686-4696. Avery, O. T., C. M. Macleod, and M. McCarty. 1944. Studies on the chemical nature of the substance inducing transformation of pneumococcal types: induction of transformation by a desoxyribonucleic acid fraction isolated from pneumococcus type III. J Exp Med 79:137-158. Bagnoli, F., M. Moschioni, C. Donati, V. Dimitrovska, I. Ferlenghi, C. Facciotti, A. Muzzi, F. Giusti, C. Emolo, A. Sinisi, M. Hilleringmann, W. Pansegrau, S. Censini, R. Rappuoli, A. Covacci, V. Masignani, and M. A. Barocchi. 2008. A second pilus type in Streptococcus pneumoniae is prevalent in emerging serotypes and mediates adhesion to host cells. J Bacteriol 190:5480-5492. Baker, J. R., S. Dong, and D. G. Pritchard. 2002. The hyaluronan lyase of Streptococcus pyogenes bacteriophage H4489A. Biochem J 365:317-322. Bakhshinejad, B., and M. Sadeghizadeh. 2014. Bacteriophages and their applications in the diagnosis and treatment of hepatitis B virus infection. World J Gastroenterol 20:11671-11683. Bakhshinejad, B., and M. Sadeghizadeh. 2014. Bacteriophages as vehicles for gene delivery into mammalian cells: prospects and problems. Expert Opin Drug Deliv:1- 14. Balogh, B., J. B. Jones, F. B. Iriarte, and M. T. Momol. 2010. Phage therapy for plant disease control. Curr Pharm Biotechnol 11:48-57. Barendt, S. M., L. T. Sham, and M. E. Winkler. 2011. Characterization of mutants deficient in the L,D-carboxypeptidase (DacB) and WalRK (VicRK) regulon, involved in peptidoglycan maturation of Streptococcus pneumoniae serotype 2 strain D39. J Bacteriol 193:2290-2300. Barocchi, M. A., S. Censini, and R. Rappuoli. 2007. Vaccines in the era of genomics: the pneumococcal challenge. Vaccine 25:2963-2973. Barocchi, M. A., J. Ries, X. Zogaj, C. Hemsley, B. Albiger, A. Kanth, S. Dahlberg, J. Fernebro, M. Moschioni, V. Masignani, K. Hultenby, A. R. Taddei, K. Beiter, F. Wartha, A. von Euler, A. Covacci, D. W. Holden, S. Normark, R. Rappuoli, and B. Henriques-Normark. 2006. A pneumococcal pilus influences virulence and host inflammatory responses. Proc Natl Acad Sci U S A 103:2857-2862. Bartual, S. G., D. Straume, G. A. Stamsas, I. G. Munoz, C. Alfonso, M. Martinez- Ripoll, L. S. Havarstein, and J. A. Hermoso. 2014. Structural basis of PcsB- mediated cell separation in Streptococcus pneumoniae. Nat Commun 5:3842.

126

Bashir, S., B. M. Khan, M. Babar, S. Andleeb, M. Hafeez, S. Ali, and M. F. Khan. 2014. Assessment of bioautography and spot screening of tlc of green tea (Camellia) plant extracts as antibacterial and antioxidant agents. Indian J Pharm Sci 76:364-370. Bedi, D., T. Musacchio, O. A. Fagbohun, J. W. Gillespie, P. Deinnocentes, R. C. Bird, L. Bookbinder, V. P. Torchilin, and V. A. Petrenko. 2011. Delivery of siRNA into breast cancer cells via phage fusion protein-targeted liposomes. Nanomedicine 7:315-323. Bedos, J. P., C. Rivier, E. Azoulay-Dupuis, and P. Moine. 1999. Current microbiologic problems. Pulmonary infection by Streptococcus pneumoniae. Current physiopathological aspects. Presse Med 28:442-449. Beilharz, K., L. Novakova, D. Fadda, P. Branny, O. Massidda, and J. W. Veening. 2012. Control of cell division in Streptococcus pneumoniae by the conserved Ser/Thr protein kinase StkP. Proc Natl Acad Sci U S A 109:E905-913. Belanger, A. E., M. J. Clague, J. I. Glass, and D. J. LeBlanc. 2004. Pyruvate oxidase is a determinant of Avery's rough morphology. J Bacteriol 186:8164-8171. Benmayor, R., D. J. Hodgson, G. G. Perron, and A. Buckling. 2009. Host mixing and disease emergence. Curr Biol 19:764-767. Bensing, B. A., I. R. Siboo, and P. M. Sullam. 2001. Proteins PblA and PblB of Streptococcus mitis, which promote binding to human platelets, are encoded within a lysogenic bacteriophage. Infect Immun 69:6186-6192. Berge, M., M. Moscoso, M. Prudhomme, B. Martin, and J. P. Claverys. 2002. Uptake of transforming DNA in Gram-positive bacteria: a view from Streptococcus pneumoniae. Mol Microbiol 45:411-421. Bergman, P., L. Johansson, V. Asp, L. Plant, G. H. Gudmundsson, A. B. Jonsson, and B. Agerberth. 2005. Neisseria gonorrhoeae downregulates expression of the human antimicrobial peptide LL-37. Cell Microbiol 7:1009-1017. Bergmann, S., and S. Hammerschmidt. 2006. Versatility of pneumococcal surface proteins. Microbiology 152:295-303. Bermudez-Brito, M., J. Plaza-Díaz, S. Muñoz-Quezada, C. Gómez-Llorente, and A. Gil. 2012. Probiotic mechanisms of action. Ann Nutr Metab 61:160-174. Berry, A. M., R. A. Lock, and J. C. Paton. 1996. Cloning and characterization of nanB, a second Streptococcus pneumoniae neuraminidase gene, and purification of the NanB enzyme from recombinant Escherichia coli. J Bacteriol 178:4854-4860. Berry, A. M., A. D. Ogunniyi, D. C. Miller, and J. C. Paton. 1999. Comparative virulence of Streptococcus pneumoniae strains with insertion-duplication, point, and deletion mutations in the pneumolysin gene. Infect Immun 67:981-985. Bertozzi Silva, J., and D. Sauvageau. 2014. Bacteriophages as antimicrobial agents against bacterial contaminants in yeast fermentation processes. Biotechnol Biofuels 7:123. Bidnenko, E., S. D. Ehrlich, and M. C. Chopin. 1998. Lactococcus lactis phage operon coding for an endonuclease homologous to RuvC. Mol Microbiol 28:823-834. Biswas, B., S. Adhya, P. Washart, B. Paul, A. N. Trostel, B. Powell, R. Carlton, and C. R. Merril. 2002. Bacteriophage therapy rescues mice bacteremic from a clinical isolate of vancomycin-resistant Enterococcus faecium. Infect Immun 70:204-210.

127

Blower, T. R., T. J. Evans, R. Przybilski, P. C. Fineran, and G. P. Salmond. 2012. Viral evasion of a bacterial suicide system by RNA-based molecular mimicry enables infectious altruism. PLoS Genet 8:e1003023. Blower, T. R., F. L. Short, P. C. Fineran, and G. P. Salmond. 2012. Viral molecular mimicry circumvents abortive infection and suppresses bacterial suicide to make hosts permissive for replication. Bacteriophage 2:234-238. Bogaert, D., R. De Groot, and P. W. Hermans. 2004. Streptococcus pneumoniae colonisation: the key to pneumococcal disease. Lancet Infect Dis 4:144-154. Bondy-Denomy, J., A. Pawluk, K. L. Maxwell, and A. R. Davidson. 2013. Bacteriophage genes that inactivate the CRISPR/Cas bacterial immune system. Nature 493:429-432. Borysowski, J., B. Weber-Dabrowska, and A. Gorski. 2006. Bacteriophage endolysins as a novel class of antibacterial agents. Exp Biol Med 231:366-377. Boudreau, M. A., J. F. Fisher, and S. Mobashery. 2012. Messenger functions of the bacterial cell wall-derived muropeptides. Biochemistry 51:2974-2990. Bowdish, D. M., D. J. Davidson, Y. E. Lau, K. Lee, M. G. Scott, and R. E. Hancock. 2005. Impact of LL-37 on anti-infective immunity. J Leukoc Biol 77:451-459. Braff, M. H., A. Bardan, V. Nizet, and R. L. Gallo. 2005. Cutaneous defense mechanisms by antimicrobial peptides. J Invest Dermatol 125:9-13. Brealey, J. C., P. D. Sly, P. R. Young, and K. J. Chappell. 2015. Viral bacterial co- infection of the respiratory tract during early childhood. FEMS Microbiol Lett 362. Breitbart, M., and F. Rohwer. 2005. Here a virus, there a virus, everywhere the same virus? Trends Microbiol 13:278-284. Brogden, K. A. 2005. Antimicrobial peptides: pore formers or metabolic inhibitors in bacteria? Nat Rev Microbiol 3:238-250. Brouns, S. J., M. M. Jore, M. Lundgren, E. R. Westra, R. J. Slijkhuis, A. P. Snijders, M. J. Dickman, K. S. Makarova, E. V. Koonin, and J. van der Oost. 2008. Small CRISPR RNAs guide antiviral defense in prokaryotes. Science 321:960-964. Brown, A. O., B. Mann, G. Gao, J. S. Hankins, J. Humann, J. Giardina, P. Faverio, M. I. Restrepo, G. V. Halade, E. M. Mortensen, M. L. Lindsey, M. Hanes, K. I. Happel, S. Nelson, G. J. Bagby, J. A. Lorent, P. Cardinal, R. Granados, A. Esteban, C. J. LeSaux, E. I. Tuomanen, and C. J. Orihuela. 2014. Streptococcus pneumoniae translocates into the myocardium and forms unique microlesions that disrupt cardiac function. PLoS Pathog 10:e1004383. Brown, J. S., S. M. Gilliland, and D. W. Holden. 2001. A Streptococcus pneumoniae pathogenicity island encoding an ABC transporter involved in iron uptake and virulence. Mol Microbiol 40:572-585. Brueggemann, A. B., C. L. Harrold, R. Rezaei Javan, A. J. van Tonder, A. J. McDonnell, and B. A. Edwards. 2017. Pneumococcal prophages are diverse, but not without structure or history. Sci Rep 7:42976. Bull, J. J., A. Jacobson, M. R. Badgett, and I. J. Molineux. 1998. Viral escape from antisense RNA. Mol Microbiol 28:835-846. Calix, J. J., and M. H. Nahm. 2010. A new pneumococcal serotype, 11E, has a variably inactivated wcjE gene. J Infect Dis 202:29-38. Campbell, E. A., S. Y. Choi, and H. R. Masure. 1998. A competence regulon in Streptococcus pneumoniae revealed by genomic analysis. Mol Microbiol 27:929- 939.

128

Carmona-Ribeiro, A. M., and L. D. de Melo Carrasco. 2014. Novel formulations for antimicrobial peptides. Int J Mol Sci 15:18040-18083. Carrascosa, M., J. L. Perez-Castrillon, I. Sampedro, R. Valle, L. Cillero, and M. A. Mendez. 1994. Lung abscess due to Streptococcus mitis: case report and review. Clin Infect Dis 19:781-783. Carrolo, M., M. J. Frias, F. R. Pinto, J. Melo-Cristino, and M. Ramirez. 2010. Prophage spontaneous activation promotes DNA release enhancing biofilm formation in Streptococcus pneumoniae. PLoS One 5:e15678. Catalao, M. J., F. Gil, J. Moniz-Pereira, C. Sao-Jose, and M. Pimentel. 2013. Diversity in bacterial lysis systems: bacteriophages show the way. FEMS Microbiol Rev 37:554-571. Cerveny, K. E., A. DePaola, D. H. Duckworth, and P. A. Gulig. 2002. Phage therapy of local and systemic disease caused by Vibrio vulnificus in iron-dextran-treated mice. Infect Immun 70:6251-6262. Cerveny, L., A. Straskova, V. Dankova, A. Hartlova, M. Ceckova, F. Staud, and J. Stulik. 2013. Tetratricopeptide repeat motifs in the world of bacterial pathogens: role in virulence mechanisms. Infect Immun 81:629-635. Chan, B. K., and S. T. Abedon. 2012. Phage therapy pharmacology phage cocktails. Adv Appl Microbiol 78:1-23. Chan, B. K., S. T. Abedon, and C. Loc-Carrillo. 2013. Phage cocktails and the future of phage therapy. Future Microbiol 8:769-783. Chao, Y., L. R. Marks, M. M. Pettigrew, and A. P. Hakansson. 2014. Streptococcus pneumoniae biofilm formation and dispersion during colonization and disease. Front Cell Infect Microbiol 4:194. Chatterjee, S., and E. Rothenberg. 2012. Interaction of bacteriophage l with its E. coli receptor, LamB. Viruses 4:3162-3178. Chen, I., and D. Dubnau. 2004. DNA uptake during bacterial transformation. Nat Rev Microbiol 2:241-249. Claverys, J.-P., and L. S. Havarstein. 2007. Cannibalism and fratricide: mechanisms and raisons d'etre. Nat Rev Microbiol 5:219-229. Clokie, M. R., A. D. Millard, A. V. Letarov, and S. Heaphy. 2011. Phages in nature. Bacteriophage 1:31-45. Cornelissen, A., P. J. Ceyssens, V. N. Krylov, J. P. Noben, G. Volckaert, and R. Lavigne. 2012. Identification of EPS-degrading activity within the tail spikes of the novel Pseudomonas putida phage AF. Virology 434:251-256. Courvalin, P. 2006. Antibiotic resistance: the pros and cons of probiotics. Dig Liver Dis 38 Suppl 2:S261-265. Cowen, L. E. 2008. The evolution of fungal drug resistance: modulating the trajectory from genotype to phenotype. Nat Rev Microbiol 6:187-198. Croucher, N. J., L. Kagedan, C. M. Thompson, J. Parkhill, S. D. Bentley, J. A. Finkelstein, M. Lipsitch, and W. P. Hanage. 2015. Selective and genetic constraints on pneumococcal serotype switching. PLoS Genet 11:e1005095. d'Hérelle, F. 1931. Bacteriophage as a treatment in acute medical and surgical infections. Bull N Y Acad Med 7:329-348. D'Hérelle, F. 2007. On an invisible microbe antagonistic toward dysenteric bacilli: brief note by Mr. F. D'Herelle, presented by Mr. Roux. 1917. Res Microbiol 158:553- 554.

129

Daniel, R. A., and J. Errington. 2003. Control of cell morphogenesis in bacteria: two distinct ways to make a rod-shaped cell. Cell 113:767-776. Davies, J., and D. Davies. 2010. Origins and evolution of antibiotic resistance. Microbiol Mol Biol Rev 74:417-433. De Vos, W. M. 1987. Gene cloning and expression in lactic streptococci. FEMS Microbiol Lett 46:281-295. den Blaauwen, T., M. A. de Pedro, M. Nguyen-Disteche, and J. A. Ayala. 2008. Morphogenesis of rod-shaped sacculi. FEMS Microbiol Rev 32:321-344. Denapaite, D., R. Bruckner, M. Nuhn, P. Reichmann, B. Henrich, P. Maurer, Y. Schahle, P. Selbmann, W. Zimmermann, R. Wambutt, and R. Hakenbeck. 2010. The genome of Streptococcus mitis B6--what is a commensal? PLoS One 5:e9426. Deresinski, S. 2009. Bacteriophage therapy: exploiting smaller fleas. Clin Infect Dis 48:1096-1101. Deutscher, S. L. 2010. Phage display in molecular imaging and diagnosis of cancer. Chem Rev 110:3196-3211. Deveau, H., R. Barrangou, J. E. Garneau, J. Labonte, C. Fremaux, P. Boyaval, D. A. Romero, P. Horvath, and S. Moineau. 2008. Phage response to CRISPR-encoded resistance in Streptococcus thermophilus. J Bacteriol 190:1390-1400. Dintilhac, A., G. Alloing, C. Granadel, and J. P. Claverys. 1997. Competence and virulence of Streptococcus pneumoniae: Adc and PsaA mutants exhibit a requirement for Zn and Mn resulting from inactivation of putative ABC metal permeases. Mol Microbiol 25:727-739. Djurkovic, S., J. M. Loeffler, and V. A. Fischetti. 2005. Synergistic killing of Streptococcus pneumoniae with the bacteriophage lytic enzyme Cpl-1 and penicillin or gentamicin depends on the level of penicillin resistance. Antimicrob Agents Chemother 49:1225-1228. Doehn, J. M., K. Fischer, K. Reppe, B. Gutbier, T. Tschernig, A. C. Hocke, V. A. Fischetti, J. Loffler, N. Suttorp, S. Hippenstiel, and M. Witzenrath. 2013. Delivery of the endolysin Cpl-1 by inhalation rescues mice with fatal pneumococcal pneumonia. J Antimicrob Chemother 68:2111-2117. Doern, C. D., and C. A. Burnham. 2010. It's not easy being green: the viridans group streptococci, with a focus on pediatric clinical manifestations. J Clin Microbiol 48:3829-3835. Domingues, S., A. Chopin, S. D. Ehrlich, and M. C. Chopin. 2004. A phage protein confers resistance to the lactococcal abortive infection mechanism AbiP. J Bacteriol 186:3278-3281. Domingues, S., K. M. Nielsen, and G. J. da Silva. 2012. Various pathways leading to the acquisition of antibiotic resistance by natural transformation. Mob Gen Elements 2:257-260. Donkor, E. S. 2013. Understanding the pneumococcus: transmission and evolution. Front Cell Infect Microbiol 3:7. Dublanchet, A., and S. Bourne. 2007. The epic of phage therapy. Can J Infect Dis Med Microbiol 18:15-18. Dubreuil, J. D. 2013. Antibacterial and antidiarrheal activities of plant products against enterotoxinogenic Escherichia coli. Toxins 5:2009-2041. Duckworth, D. H. 1976. "Who discovered bacteriophage?". Bacteriol Rev 40:793-802.

130

Duplessis, M., and S. Moineau. 2001. Identification of a genetic determinant responsible for host specificity in Streptococcus thermophilus bacteriophages. Mol Microbiol 41:325-336. Dupuis, M. E., M. Villion, A. H. Magadan, and S. Moineau. 2013. CRISPR-Cas and restriction-modification systems are compatible and increase phage resistance. Nat Commun 4:2087. Duran-Reynals, F. 1933. Studies on a certain spreading factor existing in bacteria and its significance for bacterial invasiveness. J Exp Med 58:161-181. Durmaz, E., and T. R. Klaenhammer. 2007. Abortive phage resistance mechanism AbiZ speeds the lysis clock to cause premature lysis of phage-infected Lactococcus lactis. J Bacteriol 189:1417-1425. Durmaz, E., S. M. Madsen, H. Israelsen, and T. R. Klaenhammer. 2002. Lactococcus lactis lytic bacteriophages of the P335 group are inhibited by overexpression of a truncated CI repressor. J Bacteriol 184:6532-6544. Ellis, E. L., and M. Delbruck. 1939. The growth of bacteriophage. J Gen Physiol 22:365- 384. Fadda, D., A. Santona, V. D'Ulisse, P. Ghelardini, M. G. Ennas, M. B. Whalen, and O. Massidda. 2007. Streptococcus pneumoniae DivIVA: localization and interactions in a MinCD-free context. J Bacteriol 189:1288-1298. Falconer, S. B., T. L. Czarny, and E. D. Brown. 2011. Antibiotics as probes of biological complexity. Nat Chem Biol 7:415-423. Fani, F., P. Leprohon, D. Legare, and M. Ouellette. 2011. Whole genome sequencing of penicillin-resistant Streptococcus pneumoniae reveals mutations in penicillin- binding proteins and in a putative iron permease. Genome Biol 12:R115. Feiner, R., T. Argov, L. Rabinovich, N. Sigal, I. Borovok, and A. A. Herskovits. 2015. A new perspective on lysogeny: prophages as active regulatory switches of bacteria. Nat Rev Microbiol 13:641-650. Fenner, F. 1995. ICNV 1966 to ICTV 1994: The contribution of veterinary virology. Vet Microbiol 46:3-13. Fernandez-Cotarelo, M. J., F. Lopez-Medrano, R. San Juan, C. Diaz-Pedroche, M. Lizasoain, F. Chaves, and J. M. Aguado. 2007. Protean manifestations of pleural empyema caused by Streptococcus pneumoniae in adults. Eur J Intern Med 18:141- 145. Fillon, S., K. Soulis, S. Rajasekaran, H. Benedict-Hamilton, J. N. Radin, C. J. Orihuela, K. C. El Kasmi, G. Murti, D. Kaushal, M. W. Gaber, J. R. Weber, P. J. Murray, and E. I. Tuomanen. 2006. Platelet-activating factor receptor and innate immunity: uptake of gram-positive bacterial cell wall into host cells and cell- specific pathophysiology. J Immunol 177:6182-6191. Fischetti, V. A., D. Nelson, and R. Schuch. 2006. Reinventing phage therapy: are the parts greater than the sum? Nat Biotechnol 24:1508-1511. Fiser, A., S. R. Filipe, and A. Tomasz. 2003. Cell wall branches, penicillin resistance and the secrets of the MurM protein. Trends Microbiol 11:547-553. Fleurie, A., C. Lesterlin, S. Manuse, C. Zhao, C. Cluzel, J. P. Lavergne, M. Franz- Wachtel, B. Macek, C. Combet, E. Kuru, M. S. VanNieuwenhze, Y. V. Brun, D. Sherratt, and C. Grangeasse. 2014. MapZ marks the division sites and positions FtsZ rings in Streptococcus pneumoniae. Nature 516:259-262.

131

Fokine, A., and M. G. Rossmann. 2014. Molecular architecture of tailed double-stranded DNA phages. Bacteriophage 4:e28281. Fox, J. L. 2013. Anthrax drug first antibacterial mAb to win approval. Nat Biotechnol 31:8. Frias, M. J., J. Melo-Cristino, and M. Ramirez. 2013. Export of the pneumococcal phage SV1 lysin requires choline-containing teichoic acids and is holin-independent. Mol Microbiol 87:430-445. Fujimori, S., K. Gudis, K. Mitsui, T. Seo, M. Yonezawa, S. Tanaka, A. Tatsuguchi, and C. Sakamoto. 2009. A randomized controlled trial on the efficacy of synbiotic versus probiotic or prebiotic treatment to improve the quality of life in patients with ulcerative colitis. Nutrition 25:520-525. Galperin, M. Y., D. A. Natale, L. Aravind, and E. V. Koonin. 1999. A specialized version of the HD hydrolase domain implicated in signal transduction. J Mol Microbiol Biotechnol 1:303-305. Ganju, L., D. Karan, S. Chanda, K. K. Srivastava, R. C. Sawhney, and W. Selvamurthy. 2003. Immunomodulatory effects of agents of plant origin. Biomed Pharmacother 57:296-300. Garneau, J. E., and S. Moineau. 2001. CRISPR/Cas system and resistance to bacteriophage infection. In: eLS. John Wiley & Sons, Ltd. Geno, K. A., G. L. Gilbert, J. Y. Song, I. C. Skovsted, K. P. Klugman, C. Jones, H. B. Konradsen, and M. H. Nahm. 2015. Pneumococcal capsules and their types: past, present, and future. Clin Microbiol Rev 28:871-899. Gilmore, M. S., and W. Haas. 2005. The selective advantage of microbial fratricide. Proc Natl Acad Sci U S A 102:8401-8402. Gindreau, E., R. Lopez, and P. Garcia. 2000. MM1, a temperate bacteriophage of the type 23F Spanish/USA multiresistant epidemic clone of Streptococcus pneumoniae: structural analysis of the site-specific integration system. J Virol 74:7803-7813. Goeders, N., and L. Van Melderen. 2014. Toxin-antitoxin systems as multilevel interaction systems. Toxins 6:304-324. Goerke, C., C. Wirtz, U. Fluckiger, and C. Wolz. 2006. Extensive phage dynamics in Staphylococcus aureus contributes to adaptation to the human host during infection. Mol Microbiol 61:1673-1685. Goffin, C., and J. M. Ghuysen. 1998. Multimodular penicillin-binding proteins: an enigmatic family of orthologs and paralogs. Microbiol Mol Biol Rev 62:1079-1093. Gomez-Estaca, J., A. Lopez de Lacey, M. E. Lopez-Caballero, M. C. Gomez-Guillen, and P. Montero. 2010. Biodegradable gelatin-chitosan films incorporated with essential oils as antimicrobial agents for fish preservation. Food Microbiol 27:889- 896. Grimoud, J., H. Durand, C. Courtin, P. Monsan, F. Ouarne, V. Theodorou, and C. Roques. 2010. In vitro screening of probiotic lactic acid bacteria and prebiotic glucooligosaccharides to select effective synbiotics. Anaerobe 16:493-500. Gu, J., X. Liu, Y. Li, W. Han, L. Lei, Y. Yang, H. Zhao, Y. Gao, J. Song, R. Lu, C. Sun, and X. Feng. 2012. A method for generation phage cocktail with great therapeutic potential. PLoS One 7:e31698. Gualdi, L., J. K. Hayre, A. Gerlini, A. Bidossi, L. Colomba, C. Trappetti, G. Pozzi, J. D. Docquier, P. Andrew, S. Ricci, and M. R. Oggioni. 2012. Regulation of neuraminidase expression in Streptococcus pneumoniae. BMC Microbiol 12:200.

132

Guiral, S., T. J. Mitchell, B. Martin, and J. P. Claverys. 2005. Competence-programmed predation of noncompetent cells in the human pathogen Streptococcus pneumoniae: genetic requirements. Proc Natl Acad Sci U S A 102:8710-8715. Guo, M., S. Gamby, Y. Zheng, and H. O. Sintim. 2013. Small molecule inhibitors of AI- 2 signaling in bacteria: state-of-the-art and future perspectives for anti-quorum sensing agents. Int J Mol Sci 14:17694-17728. Guo, Y., C. Quiroga, Q. Chen, M. J. McAnulty, M. J. Benedik, T. K. Wood, and X. Wang. 2014. RalR (a DNase) and RalA (a small RNA) form a type I toxin-antitoxin system in Escherichia coli. Nucleic Acids Res 42:6448-6462. Gutierrez, A., L. Laureti, S. Crussard, H. Abida, A. Rodriguez-Rojas, J. Blazquez, Z. Baharoglu, D. Mazel, F. Darfeuille, J. Vogel, and I. Matic. 2013. Beta-Lactam antibiotics promote bacterial mutagenesis via an RpoS-mediated reduction in replication fidelity. Nat Commun 4:1610. Haaber, J., J. E. Samson, S. J. Labrie, V. Campanacci, C. Cambillau, S. Moineau, and K. Hammer. 2010. Lactococcal abortive infection protein AbiV interacts directly with the phage protein SaV and prevents translation of phage proteins. Appl Environ Microbiol 76:7085-7092. Haba, E., S. Bouhdid, N. Torrego-Solana, A. M. Marqués, M. J. Espuny, M. J. García- Celma, and A. Manresa. 2014. Rhamnolipids as emulsifying agents for essential oil formulations: antimicrobial effect against Candida albicans and methicillin- resistant Staphylococcus aureus. Int J Pharm 476:134-141. Hall, J. P., E. Harrison, and M. A. Brockhurst. 2013. Viral host-adaptation: insights from evolution experiments with phages. Curr Opin Virol 3:572-577. Hammerschmidt, S. 2006. Adherence molecules of pathogenic pneumococci. Curr Opin Microbiol 9:12-20. Hancock, R. E., A. Nijnik, and D. J. Philpott. 2012. Modulating immunity as a therapy for bacterial infections. Nat Rev Microbiol 10:243-254. Hancock, R. E., and H. G. Sahl. 2006. Antimicrobial and host-defense peptides as new anti-infective therapeutic strategies. Nat Biotechnol 24:1551-1557. Hauser, R., M. Sabri, S. Moineau, and P. Uetz. 2011. The proteome and interactome of Streptococcus pneumoniae phage Cp-1. J Bacteriol 193:3135-3138. Hava, D. L., and A. Camilli. 2002. Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors. Mol Microbiol 45:1389-1406. Havarstein, L. S., B. Martin, O. Johnsborg, C. Granadel, and J. P. Claverys. 2006. New insights into the pneumococcal fratricide: relationship to clumping and identification of a novel immunity factor. Mol Microbiol 59:1297-1307. Hemarajata, P., and J. Versalovic. 2013. Effects of probiotics on gut microbiota: mechanisms of intestinal immunomodulation and neuromodulation. Therap Adv Gastroenterol 6:39-51. Henderson-Begg, S. K., D. M. Livermore, and L. M. Hall. 2006. Effect of subinhibitory concentrations of antibiotics on mutation frequency in Streptococcus pneumoniae. J Antimicrob Chemother 57:849-854. Hendrix, R. W. 2002. Bacteriophages: evolution of the majority. Theor Popul Biol 61:471- 480. Hendrix, R. W. 2003. Bacteriophage genomics. Curr Opin Microbiol 6:506-511. Henke, J. M., and B. L. Bassler. 2004. Quorum sensing regulates type III secretion in Vibrio harveyi and Vibrio parahaemolyticus. J Bacteriol 186:3794-3805.

133

Henriques-Normark, B., and E. I. Tuomanen. 2013. The pneumococcus: epidemiology, microbiology, and pathogenesis. Cold Spring Harb Perspect Med 3:7 a010215. Henry, M., and L. Debarbieux. 2012. Tools from viruses: bacteriophage successes and beyond. Virology 434:151-161. Higgins, M. L., and G. D. Shockman. 1970. Model for cell wall growth of Streptococcus faecalis. J Bacteriol 101:643-648. Holo, H., and I. F. Nes. 1989. High-frequency transformation, by electroporation, of Lactococcus lactis subsp. cremoris grown with glycine in osmotically stabilized media. Appl Environ Microbiol 55:3119-3123. Hoskins, J., W. E. Alborn, Jr., J. Arnold, L. C. Blaszczak, S. Burgett, B. S. DeHoff, S. T. Estrem, L. Fritz, D. J. Fu, W. Fuller, C. Geringer, R. Gilmour, J. S. Glass, H. Khoja, A. R. Kraft, R. E. Lagace, D. J. LeBlanc, L. N. Lee, E. J. Lefkowitz, J. Lu, P. Matsushima, S. M. McAhren, M. McHenney, K. McLeaster, C. W. Mundy, T. I. Nicas, F. H. Norris, M. O'Gara, R. B. Peery, G. T. Robertson, P. Rockey, P. M. Sun, M. E. Winkler, Y. Yang, M. Young-Bellido, G. Zhao, C. A. Zook, R. H. Baltz, S. R. Jaskunas, P. R. Rosteck, Jr., P. L. Skatrud, and J. I. Glass. 2001. Genome of the bacterium Streptococcus pneumoniae strain R6. J Bacteriol 183:5709-5717. Ikryannikova, L. N., A. V. Filimonova, M. V. Malakhova, T. Savinova, O. Filimonova, E. N. Ilina, V. A. Dubovickaya, S. V. Sidorenko, and V. M. Govorun. 2013. Discrimination between Streptococcus pneumoniae and Streptococcus mitis based on sorting of their MALDI mass spectra. Clin Microbiol Infect 19:1066-1071. Iovino, F., M. C. Brouwer, D. van de Beek, G. Molema, and J. J. Bijlsma. 2013. Signalling or binding: the role of the platelet-activating factor receptor in invasive pneumococcal disease. Cell Microbiol 15:870-881. Iovino, F., D. L. Hammarlof, G. Garriss, S. Brovall, P. Nannapaneni, and B. Henriques-Normark. 2016. Pneumococcal meningitis is promoted by single cocci expressing pilus adhesin RrgA. J Clin Invest 126:2821-2826. Jenssen, H., P. Hamill, and R. E. Hancock. 2006. Peptide antimicrobial agents. Clin Microbiol Rev 19:491-511. Jiang, X. R., A. Song, S. Bergelson, T. Arroll, B. Parekh, K. May, S. Chung, R. Strouse, A. Mire-Sluis, and M. Schenerman. 2011. Advances in the assessment and control of the effector functions of therapeutic antibodies. Nat Rev Drug Discov 10:101-111. Jikia, D., N. Chkhaidze, E. Imedashvili, I. Mgaloblishvili, G. Tsitlanadze, R. Katsarava, J. Glenn Morris, Jr., and A. Sulakvelidze. 2005. The use of a novel biodegradable preparation capable of the sustained release of bacteriophages and ciprofloxacin, in the complex treatment of multidrug-resistant Staphylococcus aureus-infected local radiation injuries caused by exposure to Sr90. Clin Exp Dermatol 30:23-26. Johnsborg, O., and L. S. Havarstein. 2009. Regulation of natural genetic transformation and acquisition of transforming DNA in Streptococcus pneumoniae. FEMS Microbiol Rev 33:627-642. Johnston, C., B. Martin, G. Fichant, P. Polard, and J. P. Claverys. 2014. Bacterial transformation: distribution, shared mechanisms and divergent control. Nat Rev Microbiol 12:181-196.

134

Johnston, N. J., J. C. De Azavedo, J. D. Kellner, and D. E. Low. 1998. Prevalence and characterization of the mechanisms of macrolide, lincosamide, and streptogramin resistance in isolates of Streptococcus pneumoniae. Antimicrob Agents Chemother 42:2425-2426. Joyce, E. A., S. J. Popper, and S. Falkow. 2009. Streptococcus pneumoniae nasopharyngeal colonization induces type I interferons and interferon-induced gene expression. BMC Genomics 10:404. Jung, E., N. K. Lee, S. K. Kang, S. H. Choi, D. Kim, K. Park, K. Choi, Y. J. Choi, and D. H. Jung. 2012. Identification of tissue-specific targeting peptide. J Comput Aided Mol Des 26:1267-1275. Kadioglu, A., J. N. Weiser, J. C. Paton, and P. W. Andrew. 2008. The role of Streptococcus pneumoniae virulence factors in host respiratory colonization and disease. Nat Rev Microbiol 6:288-301. Kaufmann, S. H., and U. E. Schaible. 2005. Antigen presentation and recognition in bacterial infections. Curr Opin Immunol 17:79-87. Kawai, T., and S. Akira. 2010. The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nat Immunol 11:373-384. Kilian, M., K. Poulsen, T. Blomqvist, L. S. Havarstein, M. Bek-Thomsen, H. Tettelin, and U. B. Sorensen. 2008. Evolution of Streptococcus pneumoniae and its close commensal relatives. PLoS One 3:e2683. Klumpp, J., R. Lavigne, M. J. Loessner, and H. W. Ackermann. 2010. The SPO1- related bacteriophages. Arch Virol 155:1547-1561. Kotsonis, S. E., I. B. Powell, C. J. Pillidge, G. K. Limsowtin, A. J. Hillier, and B. E. Davidson. 2008. Characterization and genomic analysis of phage asccphi28, a phage of the family Podoviridae infecting Lactococcus lactis. Appl Environ Microbiol 74:3453-3460. Kotsovilis, S., and E. Andreakos. 2014. Therapeutic human monoclonal antibodies in inflammatory diseases. Methods Mol Biol 1060:37-59. Kotzampassi, K., and E. J. Giamarellos-Bourboulis. 2012. Probiotics for infectious diseases: more drugs, less dietary supplementation. Int J Antimicrob Agents 40:288-296. Kraemer, L., B. Beszteri, S. Gabler-Schwarz, C. Held, F. Leese, C. Mayer, K. Pohlmann, and S. Frickenhaus. 2009. STAMP: extensions to the STADEN sequence analysis package for high throughput interactive microsatellite marker design. BMC Bioinformatics 10:41. Krause, R. M. 1957. Studies on bacteriophages of hemolytic streptococci. I. Factors influencing the interaction of phage and susceptible host cell. J Exp Med 106:365- 384. Kruger, D. H., and T. A. Bickle. 1983. Bacteriophage survival: multiple mechanisms for avoiding the deoxyribonucleic acid restriction systems of their hosts. Microbiol Rev 47:345-360. Kummerer, K., and A. Henninger. 2003. Promoting resistance by the emission of antibiotics from hospitals and households into effluent. Clin Microbiol Infect 9:1203-1214. Kummerfeldt, C. E. 2014. Raxibacumab: potential role in the treatment of inhalational anthrax. Infect Drug Resist 7:101-109.

135

Kurekci, C., J. Padmanabha, S. L. Bishop-Hurley, E. Hassan, R. A. Al Jassim, and C. S. McSweeney. 2013. Antimicrobial activity of essential oils and five terpenoid compounds against Campylobacter jejuni in pure and mixed culture experiments. Int J Food Microbiol 166:450-457. Labrie, S. J., J. E. Samson, and S. Moineau. 2010. Bacteriophage resistance mechanisms. Nat Rev Microbiol 8:317-327. Lairson, L. L., B. Henrissat, G. J. Davies, and S. G. Withers. 2008. Glycosyltransferases: structures, functions, and mechanisms. Annu Rev of Biochem 77:521-555. Langeveld, W. T., E. J. Veldhuizen, and S. A. Burt. 2014. Synergy between essential oil components and antibiotics: a review. Crit Rev Microbiol 40:76-94. Larimer, B. M., and S. L. Deutscher. 2014. Development of a peptide by phage display for SPECT imaging of resistance-susceptible breast cancer. Am J Nucl Med Mol Imaging 4:435-447. LaRocca, T. J., D. J. Holthausen, C. Hsieh, C. Renken, C. A. Mannella, and J. L. Benach. 2009. The bactericidal effect of a complement-independent antibody is osmolytic and specific to Borrelia. Proc Natl Acad Sci U S A 106:10752-10757. Laurenceau, R., G. Pehau-Arnaudet, S. Baconnais, J. Gault, C. Malosse, A. Dujeancourt, N. Campo, J. Chamot-Rooke, E. Le Cam, J. P. Claverys, and R. Fronzes. 2013. A type IV pilus mediates DNA binding during natural transformation in Streptococcus pneumoniae. PLoS Pathog 9:e1003473. Lee, M. S., B. A. Dougherty, A. C. Madeo, and D. A. Morrison. 1999. Construction and analysis of a library for random insertional mutagenesis in Streptococcus pneumoniae: use for recovery of mutants defective in genetic transformation and for identification of essential genes. Appl Environ Microbiol 65:1883-1890. Lehane, A. M., H. Korres, and N. K. Verma. 2005. Bacteriophage-encoded glucosyltransferase GtrII of Shigella flexneri: membrane topology and identification of critical residues. Biochem J 389:137-143. Leprohon, P., H. Gingras, S. Ouennane, S. Moineau, and M. Ouellette. 2015. A genomic approach to understand interactions between Streptococcus pneumoniae and its bacteriophages. BMC Genomics 16:972. Li, X., D. Gerlach, X. Du, J. Larsen, M. Stegger, P. Kuhner, A. Peschel, G. Xia, and V. Winstel. 2015. An accessory wall teichoic acid glycosyltransferase protects Staphylococcus aureus from the lytic activity of Podoviridae. Sci Rep 5:17219. Lim, B. N., G. J. Tye, Y. S. Choong, E. B. Ong, A. Ismail, and T. S. Lim. 2014. Principles and application of antibody libraries for infectious diseases. Biotechnol Lett 36:2381-2392. Liu, B., and M. Pop. 2009. ARDB--antibiotic resistance genes database. Nucleic Acids Res 37:D443-447. Liu, W., S. L. Dong, F. Xu, X. Q. Wang, T. R. Withers, H. D. Yu, and X. Wang. 2013. Effect of intracellular expression of antimicrobial peptide LL-37 on growth of Escherichia coli strain TOP10 under aerobic and anaerobic conditions. Antimicrob Agents Chemother 57:4707-4716. Loeffler, J. M., S. Djurkovic, and V. A. Fischetti. 2003. Phage lytic enzyme Cpl-1 as a novel antimicrobial for pneumococcal bacteremia. Infect Immun 71:6199-6204.

136

Loeffler, J. M., and V. A. Fischetti. 2003. Synergistic lethal effect of a combination of phage lytic enzymes with different activities on penicillin-sensitive and -resistant Streptococcus pneumoniae strains. Antimicrob Agents Chemother 47:375-377. Loeffler, J. M., and V. A. Fischetti. 2006. Lysogeny of Streptococcus pneumoniae with MM1 phage: improved adherence and other phenotypic changes. Infect Immun 74:4486-4495. Longas, E., L. Villar, J. M. Lazaro, M. de Vega, and M. Salas. 2008. Phage phi29 and Nf terminal protein-priming domain specifies the internal template nucleotide to initiate DNA replication. Proc Natl Acad Sci U S A 105:18290-18295. Lopez, R., E. Garcia, P. Garcia, C. Ronda, and A. Tomasz. 1982. Choline-containing bacteriophage receptors in Streptococcus pneumoniae. J Bacteriol 151:1581-1590. Lopez, R., C. Ronda, A. Tomasz, and A. Portoles. 1977. Properties of "diplophage": a lipid-containing bacteriophage. J Virol 24:201-210. Lorian, V., and B. Popoola. 1972. Pneumococci producing beta hemolysis on agar. Appl Microbiol 24:44-47. Lowe, T. M., and S. R. Eddy. 1997. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res 25:955-964. Lu, L., Z. Ma, T. S. Jokiranta, A. R. Whitney, F. R. DeLeo, and J. R. Zhang. 2008. Species-specific interaction of Streptococcus pneumoniae with human complement factor H. J Immunol 181:7138-7146. Lu, M. J., and U. Henning. 1994. Superinfection exclusion by T-even-type coliphages. Trends Microbiol 2:137-139. Lu, M. J., Y. D. Stierhof, and U. Henning. 1993. Location and unusual membrane topology of the immunity protein of the Escherichia coli phage T4. J Virol 67:4905-4913. Lu, T. K., and M. S. Koeris. 2011. The next generation of bacteriophage therapy. Curr Opin Microbiol 14:524-531. Lupien, A., D. S. Billal, F. Fani, H. Soualhine, G. G. Zhanel, P. Leprohon, and M. Ouellette. 2013. Genomic characterization of ciprofloxacin resistance in a laboratory-derived mutant and a clinical isolate of Streptococcus pneumoniae. Antimicrob Agents Chemother 57:4911-4919. Luria, S. E., and T. F. Anderson. 1942. The identification and characterization of bacteriophages with the electron microscope. Proc Natl Acad Sci U S A 28:127-130 121. Ly-Chatain, M. H. 2014. The factors affecting effectiveness of treatment in phages therapy. Front Microbiol 5:51. Madhour, A., P. Maurer, and R. Hakenbeck. 2011. Cell surface proteins in S. pneumoniae, S. mitis and S. oralis. Iran J Microbiol 3:58-67. Mahima, A. Rahal, R. Deb, S. K. Latheef, H. Abdul Samad, R. Tiwari, A. K. Verma, A. Kumar, and K. Dhama. 2012. Immunomodulatory and therapeutic potentials of herbal, traditional/indigenous and ethnoveterinary medicines. Pak J Biol Sci 15:754-774. Mahony, J., S. McGrath, G. F. Fitzgerald, and D. van Sinderen. 2008. Identification and characterization of lactococcal-prophage-carried superinfection exclusion genes. Appl Environ Microbiol 74:6206-6215. Mansour, S. C., O. M. Pena, and R. E. Hancock. 2014. Host defense peptides: front-line immunomodulators. Trends Immunol 35:443-450.

137

Marasco, W. A., and J. Sui. 2007. The growth and potential of human antiviral monoclonal antibody therapeutics. Nat Biotechnol 25:1421-1434. Mariano, R., S. Wuchty, M. G. Vizoso-Pinto, R. Hauser, and P. Uetz. 2016. The interactome of Streptococcus pneumoniae and its bacteriophages show highly specific patterns of interactions among bacteria and their phages. Sci Rep 6:24597. Mark, D. F., and C. C. Richardson. 1976. Escherichia coli thioredoxin: a subunit of bacteriophage T7 DNA polymerase. Proc Natl Acad Sci U S A 73:780-784. Markine-Goriaynoff, N., L. Gillet, J. L. Van Etten, H. Korres, N. Verma, and A. Vanderplasschen. 2004. Glycosyltransferases encoded by viruses. J Gen Virol 85:2741-2754. Marks, L. R., B. A. Davidson, P. R. Knight, and A. P. Hakansson. 2013. Interkingdom signaling induces Streptococcus pneumoniae biofilm dispersion and transition from asymptomatic colonization to disease. MBio 4: e00438-13. Marriott, H. M., T. J. Mitchell, and D. H. Dockrell. 2008. Pneumolysin: a double-edged sword during the host-pathogen interaction. Curr Mol Med 8:497-509. Martin, A. C., L. Blanco, P. Garcia, M. Salas, and J. Mendez. 1996. In vitro protein- primed initiation of pneumococcal phage Cp-1 DNA replication occurs at the third 3' nucleotide of the linear template: a stepwise sliding-back mechanism. J Mol Biol 260:369-377. Martin, A. C., R. Lopez, and P. Garcia. 1996. Analysis of the complete nucleotide sequence and functional organization of the genome of Streptococcus pneumoniae bacteriophage Cp-1. J Virol 70:3678-3687. Martin, A. C., R. Lopez, and P. Garcia. 1998. Pneumococcal bacteriophage Cp-1 encodes its own protease essential for phage maturation. J Virol 72:3491-3494. Massidda, O., D. Anderluzzi, L. Friedli, and G. Feger. 1998. Unconventional organization of the division and cell wall gene cluster of Streptococcus pneumoniae. Microbiology 144:3069-3078. Massidda, O., L. Novakova, and W. Vollmer. 2013. From models to pathogens: how much have we learned about Streptococcus pneumoniae cell division? Environ Microbiol 15:3133-3157. Matsuzaki, S., M. Rashel, J. Uchiyama, S. Sakurai, T. Ujihara, M. Kuroda, M. Ikeuchi, T. Tani, M. Fujieda, H. Wakiguchi, and S. Imai. 2005. Bacteriophage therapy: a revitalized therapy against bacterial infectious diseases. J Infect Chemother 11:211-219. McCann, J. R., and J. W. St Geme, 3rd. 2014. The HMW1C-like glycosyltransferases-- an enzyme family with a sweet tooth for simple sugars. PLoS Pathog 10:e1003977. McCullers, J. A., A. Karlstrom, A. R. Iverson, J. M. Loeffler, and V. A. Fischetti. 2007. Novel strategy to prevent otitis media caused by colonizing Streptococcus pneumoniae. PLoS Pathog 3:e28. McDonnell, M., R. Lain, and A. Tomasz. 1975. "Diplophage": a bacteriophage of Diplococcus pneumoniae. Virology 63:577-582. Mejean, V., and J. P. Claverys. 1993. DNA processing during entry in transformation of Streptococcus pneumoniae. J Biol Chem 268:5594-5599. Mitchell, A. M., and T. J. Mitchell. 2010. Streptococcus pneumoniae: virulence factors and variation. Clin Microbiol Infect 16:411-418. Mitchell, J. 2011. Streptococcus mitis: walking the line between commensalism and pathogenesis. Mol Oral Microbiol 26:89-98.

138

Mitchell, J., I. R. Siboo, D. Takamatsu, H. F. Chambers, and P. M. Sullam. 2007. Mechanism of cell surface expression of the Streptococcus mitis platelet binding proteins PblA and PblB. Mol Microbiol 64:844-857. Mitchell, T. J. 2000. Virulence factors and the pathogenesis of disease caused by Streptococcus pneumoniae. Res Microbiol 151:413-419. Mitchell, T. J. 2003. The pathogenesis of streptococcal infections: from tooth decay to meningitis. Nat Rev Microbiol 1:219-230. Moineau, S., E. Durmaz, S. Pandian, and T. R. Klaenhammer. 1993. Differentiation of two abortive mechanisms by using monoclonal antibodies directed toward lactococcal bacteriophage capsid proteins. Appl Environ Microbiol 59:208-212. Molineux, I. J., and D. Panja. 2013. Popping the cork: mechanisms of phage genome ejection. Nat Rev Microbiol 11:194-204. Monahan, L. G., I. V. Hajduk, S. P. Blaber, I. G. Charles, and E. J. Harry. 2014. Coordinating bacterial cell division with nutrient availability: a role for glycolysis. MBio 5:e00935-00914. Monk, A. B., C. D. Rees, P. Barrow, S. Hagens, and D. R. Harper. 2010. Bacteriophage applications: where are we now? Lett Appl Microbiol 51:363-369. Mook-Kanamori, B. B., M. Geldhoff, T. van der Poll, and D. van de Beek. 2011. Pathogenesis and pathophysiology of pneumococcal meningitis. Clin Microbiol Rev 24:557-591. Morales, M., P. Garcia, A. G. de la Campa, J. Linares, C. Ardanuy, and E. Garcia. 2010. Evidence of localized prophage-host recombination in the lytA gene, encoding the major pneumococcal autolysin. J Bacteriol 192:2624-2632. Morlot, C., M. Noirclerc-Savoye, A. Zapun, O. Dideberg, and T. Vernet. 2004. The D,D-carboxypeptidase PBP3 organizes the division process of Streptococcus pneumoniae. Mol Microbiol 51:1641-1648. Morris, P., L. J. Marinelli, D. Jacobs-Sera, R. W. Hendrix, and G. F. Hatfull. 2008. Genomic characterization of mycobacteriophage Giles: evidence for phage acquisition of host DNA by illegitimate recombination. J Bacteriol 190:2172-2182. Mortier-Barriere, I., O. Humbert, B. Martin, M. Prudhomme, and J. P. Claverys. 1997. Control of recombination rate during transformation of Streptococcus pneumoniae: an overview. Microb Drug Resist 3:233-242. Muschiol, S., M. Balaban, S. Normark, and B. Henriques-Normark. 2015. Uptake of extracellular DNA: competence induced pili in natural transformation of Streptococcus pneumoniae. Bioessays 37:426-435. Mushtaq, N., M. Ezzati, L. Hall, I. Dickson, M. Kirwan, K. M. Png, I. S. Mudway, and J. Grigg. 2011. Adhesion of Streptococcus pneumoniae to human airway epithelial cells exposed to urban particulate matter. J Allergy Clin Immunol 127:1236-1242 e1232. Nahm, M. H., M. B. Oliver, L. Siira, T. Kaijalainen, L. M. Lambertsen, and A. Virolainen. 2011. A report of Streptococcus pneumoniae serotype 6D in Europe. J Med Microbiol 60:46-48. Nakai, T., and S. C. Park. 2002. Bacteriophage therapy of infectious diseases in aquaculture. Res Microbiol 153:13-18. Nelson, D., L. Loomis, and V. A. Fischetti. 2001. Prevention and elimination of upper respiratory colonization of mice by group A streptococci by using a bacteriophage lytic enzyme. Proc Natl Acad Sci U S A 98:4107-4112.

139

Ng, W. L., K. M. Kazmierczak, and M. E. Winkler. 2004. Defective cell wall synthesis in Streptococcus pneumoniae R6 depleted for the essential PcsB putative murein hydrolase or the VicR (YycF) response regulator. Mol Microbiol 53:1161-1175. Nieto, C., P. Fernandez de Palencia, P. Lopez, and M. Espinosa. 2000. Construction of a tightly regulated plasmid vector for Streptococcus pneumoniae: controlled expression of the green fluorescent protein. Plasmid 43:205-213. Nuding, S., T. Frasch, M. Schaller, E. F. Stange, and L. T. Zabel. 2014. Synergistic effects of antimicrobial peptides and antibiotics against Clostridium difficile. Antimicrob Agents Chemother 58:5719-5725. O'Brien, K. L., L. J. Wolfson, J. P. Watt, E. Henkle, M. Deloria-Knoll, N. McCall, E. Lee, K. Mulholland, O. S. Levine, and T. Cherian. 2009. Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates. Lancet 374:893-902. Ohsaki, Y., M. Tachibana, T. Awaya, M. Kuroki, and Y. Itoh. 2008. Recovery of susceptibility to penicillin G in clinical isolates of Streptococcus pneumoniae despite increased accumulation of pbp gene alterations. Int J Antimicrob Agents 32:427-431. Okorochenkov, S. A., G. A. Zheltukhina, and V. E. Nebol'sin. 2012. Antimicrobial peptides: mode of action and perspectives of practical application. Biomed Khim 58:131-143. Oleksiewicz, M. B., G. Nagy, and E. Nagy. 2012. Anti-bacterial monoclonal antibodies: back to the future? Arch Biochem Biophys 526:124-131. Otsuka, Y., and T. Yonesaki. 2012. Dmd of bacteriophage T4 functions as an antitoxin against Escherichia coli LsoA and RnlA toxins. Mol Microbiol 83:669-681. Oudhuis, G. J., D. C. Bergmans, and A. Verbon. 2011. Probiotics for prevention of nosocomial infections: efficacy and adverse effects. Curr Opin Crit Care 17:487- 492. Ouennane, S., P. Leprohon, and S. Moineau. 2015. Diverse virulent pneumophages infect Streptococcus mitis. PLoS One 10:e0118807. Pagliero, E., O. Dideberg, T. Vernet, and A. M. Di Guilmi. 2005. The PECACE domain: a new family of enzymes with potential peptidoglycan cleavage activity in Gram- positive bacteria. BMC Genomics 6:19. Pandya, U., C. A. Allen, D. A. Watson, and D. W. Niesel. 2005. Global profiling of Streptococcus pneumoniae gene expression at different growth temperatures. Gene 360:45-54. Parisien, A., B. Allain, J. Zhang, R. Mandeville, and C. Q. Lan. 2008. Novel alternatives to antibiotics: bacteriophages, bacterial cell wall hydrolases, and antimicrobial peptides. J Appl Microbiol 104:1-13. Park, I. H., D. G. Pritchard, R. Cartee, A. Brandao, M. C. Brandileone, and M. H. Nahm. 2007. Discovery of a new capsular serotype (6C) within serogroup 6 of Streptococcus pneumoniae. J Clin Microbiol 45:1225-1233. Patel, A., N. Shah, and J. B. Prajapati. 2014. Clinical application of probiotics in the treatment of Helicobacter pylori infection--a brief review. J Microbiol Immunol Infect 47:429-437. Paterson, G. K., and T. J. Mitchell. 2006. The role of Streptococcus pneumoniae sortase A in colonisation and pathogenesis. Microbes Infect 8:145-153.

140

Paterson, S., T. Vogwill, A. Buckling, R. Benmayor, A. J. Spiers, N. R. Thomson, M. Quail, F. Smith, D. Walker, B. Libberton, A. Fenton, N. Hall, and M. A. Brockhurst. 2010. Antagonistic coevolution accelerates molecular evolution. Nature 464:275-278. Peitzman, S. J. 1969. Felix d'Herelle and bacteriophage therapy. Trans Stud Coll Physicians Phila 37:115-123. Perry, J. A., M. B. Jones, S. N. Peterson, D. G. Cvitkovitch, and C. M. Levesque. 2009. Peptide alarmone signalling triggers an auto-active bacteriocin necessary for genetic competence. Mol Microbiol 72:905-917. Petrenko, V. A., and P. K. Jayanna. 2014. Phage protein-targeted cancer nanomedicines. FEBS Lett 588:341-349. Pinho, M. G., M. Kjos, and J. W. Veening. 2013. How to get (a)round: mechanisms controlling growth and division of coccoid bacteria. Nat Rev Microbiol 11:601-614. Piotrowski, A., P. Luo, and D. A. Morrison. 2009. Competence for genetic transformation in Streptococcus pneumoniae: termination of activity of the alternative sigma factor ComX is independent of proteolysis of ComX and ComW. J Bacteriol 191:3359-3366. Plotkowski, M. C., E. Puchelle, G. Beck, J. Jacquot, and C. Hannoun. 1986. Adherence of type I Streptococcus pneumoniae to tracheal epithelium of mice infected with influenza A/PR8 virus. Am Rev Respir Dis 134:1040-1044. Plummer, S. F., I. Garaiova, T. Sarvotham, S. L. Cottrell, S. Le Scouiller, M. A. Weaver, J. Tang, P. Dee, and J. Hunter. 2005. Effects of probiotics on the composition of the intestinal microbiota following antibiotic therapy. Int J Antimicrob Agents 26:69-74. Prudhomme, M., L. Attaiech, G. Sanchez, B. Martin, and J. P. Claverys. 2006. Antibiotic stress induces genetic transformability in the human pathogen Streptococcus pneumoniae. Science 313:89-92. Rakhuba, D. V., E. I. Kolomiets, E. S. Dey, and G. I. Novik. 2010. Bacteriophage receptors, mechanisms of phage adsorption and penetration into host cell. Pol J Microbiol 59:145-155. Ram, G., J. Chen, K. Kumar, H. F. Ross, C. Ubeda, P. K. Damle, K. D. Lane, J. R. Penades, G. E. Christie, and R. P. Novick. 2012. Staphylococcal pathogenicity island interference with helper phage reproduction is a paradigm of molecular parasitism. Proc Natl Acad Sci U S A 109:16300-16305. Ramirez, M., E. Severina, and A. Tomasz. 1999. A high incidence of prophage carriage among natural isolates of Streptococcus pneumoniae. J Bacteriol 181:3618-3625. Ranjan, S., G. Bakthavathsalam, V. V. Raghavan, and R. K. Sindhu. 2014. Growth of Streptococcus pneumoniae on Macconkey agar: possibility of impossible? J Clin Diagn Res 8:DL01. Rao, F., Y. Qi, E. Murugan, S. Pasunooti, and Q. Ji. 2010. 2',3'-cAMP hydrolysis by metal-dependent phosphodiesterases containing DHH, EAL, and HD domains is non-specific: implications for PDE screening. Biochem Biophys Res Commun 398:500-505. Raskin, D. M., R. Seshadri, S. U. Pukatzki, and J. J. Mekalanos. 2006. Bacterial genomics and pathogen evolution. Cell 124:703-714. Ravin, V., L. Raisanen, and T. Alatossava. 2002. A conserved C-terminal region in Gp71 of the small isometric-head phage LL-H and ORF474 of the prolate-head phage

141

JCL1032 is implicated in specificity of adsorption of phage to its host, Lactobacillus delbrueckii. J Bacteriol 184:2455-2459. Rayes, N., D. Seehofer, T. Theruvath, M. Mogl, J. M. Langrehr, N. C. Nussler, S. Bengmark, and P. Neuhaus. 2007. Effect of enteral nutrition and synbiotics on bacterial infection rates after pylorus-preserving pancreatoduodenectomy: a randomized, double-blind trial. Ann Surg 246:36-41. Reinert, R. R. 2009. The antimicrobial resistance profile of Streptococcus pneumoniae. Clin Microbiol Infect 3:7-11. Rhoads, D. D., R. D. Wolcott, M. A. Kuskowski, B. M. Wolcott, L. S. Ward, and A. Sulakvelidze. 2009. Bacteriophage therapy of venous leg ulcers in humans: results of a phase I safety trial. J Wound Care 18:237-238. Richards, V. P., S. R. Palmer, P. D. Pavinski Bitar, X. Qin, G. M. Weinstock, S. K. Highlander, C. D. Town, R. A. Burne, and M. J. Stanhope. 2014. Phylogenomics and the dynamic genome evolution of the genus Streptococcus. Genome Biol Evol 6:741-753. Rigvava, S., I. Tchgkonia, D. Jgenti, T. Dvalidze, J. Carpino, and M. Goderdzishvili. 2013. Comparative analysis of the biological and physical properties of Enterococcus faecalis bacteriophage vB_EfaS_GEC-EfS_3 and Streptococcus mitis bacteriophage vB_SmM_GEC-SmitisM_2. Can J Microbiol 59:18-21. Ring, A., J. N. Weiser, and E. I. Tuomanen. 1998. Pneumococcal trafficking across the blood-brain barrier. Molecular analysis of a novel bidirectional pathway. J Clin Invest 102:347-360. Robbins, J. B., and R. Schneerson. 1983. Planning for a second (23 valent) generation pneumococcal vaccine with special reference to new developments in our understanding of the structure and biology of polysaccharides. Bull Eur Physiopath Respir 19:215-226. Romero, P., N. J. Croucher, N. L. Hiller, F. Z. Hu, G. D. Ehrlich, S. D. Bentley, E. Garcia, and T. J. Mitchell. 2009. Comparative genomic analysis of ten Streptococcus pneumoniae temperate bacteriophages. J Bacteriol 191:4854-4862. Ronda-Lain, C., R. Lopez, A. Tapia, and A. Tomasz. 1977. Role of the pneumococcal autolysin (murein hydrolase) in the release of progeny bacteriophage and in the bacteriophage-induced lysis of the host cells. J Virol 21:366-374. Ronda, C., J. L. Garcia, and R. Lopez. 1989. Infection of Streptococcus oralis NCTC 11427 by pneumococcal phages. FEMS Microbiol Lett 53:187-192. Ronda, C., R. Lopez, and E. Garcia. 1981. Isolation and characterization of a new bacteriophage, Cp-1, infecting Streptococcus pneumoniae. J Virol 40:551-559. Rousseau, G. M., and S. Moineau. 2009. Evolution of Lactococcus lactis phages within a cheese factory. App Environ Microbiol 75:5336-5344. Rukke, H. V., I. K. Hegna, and F. C. Petersen. 2012. Identification of a functional capsule locus in Streptococcus mitis. Mol Oral Microbiol 27:95-108. Sabri, M., R. Hauser, M. Ouellette, J. Liu, M. Dehbi, G. Moeck, E. Garcia, B. Titz, P. Uetz, and S. Moineau. 2011. Genome annotation and intraviral interactome for the Streptococcus pneumoniae virulent phage Dp-1. J Bacteriol 193:551-562. Salmond, G. P., and P. C. Fineran. 2015. A century of the phage: past, present and future. Nat Rev Microbiol 13:777-786. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor, N.Y: CSH Protoc; 3v p.

142

Samson, J. E., A. H. Magadan, M. Sabri, and S. Moineau. 2013. Revenge of the phages: defeating bacterial defences. Nat Rev Microbiol 11:675-687. Samson, J. E., and S. Moineau. 2010. Characterization of Lactococcus lactis phage 949 and comparison with other lactococcal phages. Appl Environ Microbiol 76:6843- 6852. Schechner, V., E. Temkin, S. Harbarth, Y. Carmeli, and M. J. Schwaber. 2013. Epidemiological interpretation of studies examining the effect of antibiotic usage on resistance. Clin Microbiol Rev 26:289-307. Scheffler, R. J., S. Colmer, H. Tynan, A. L. Demain, and V. P. Gullo. 2013. Antimicrobials, drug discovery, and genome mining. Appl Microbiol Biotechnol 97:969-978. Scholtens, P. A., D. A. Goossens, and A. Staiano. 2014. Stool characteristics of infants receiving short-chain galacto-oligosaccharides and long-chain fructo- oligosaccharides: a review. World J Gastroenterol 20:13446-13452. Schroeder, M. R., and D. S. Stephens. 2016. Macrolide Resistance in Streptococcus pneumoniae. Front Cell Infect Microbiol 6:98. Schulz zur Wiesch, P., J. Engelstadter, and S. Bonhoeffer. 2010. Compensation of fitness costs and reversibility of antibiotic resistance mutations. Antimicrob Agents Chemother 54:2085-2095. Scott, A. M., J. P. Allison, and J. D. Wolchok. 2012. Monoclonal antibodies in cancer therapy. Cancer Immun 12:14. Serwer, P., S. J. Hayes, J. A. Thomas, and S. C. Hardies. 2007. Propagating the missing bacteriophages: a large bacteriophage in a new class. Virol J 4:21. Seshasayee, A. S., G. M. Fraser, and N. M. Luscombe. 2010. Comparative genomics of cyclic-di-GMP signalling in bacteria: post-translational regulation and catalytic activity. Nucleic Acids Res 38:5970-5981. Sheppard, C. L., T. G. Harrison, R. Morris, A. Hogan, and R. C. George. 2004. Autolysin-targeted LightCycler assay including internal process control for detection of Streptococcus pneumoniae DNA in clinical samples. J Med Microbiol 53:189-195. Shimizu, K., H. Ogura, T. Asahara, K. Nomoto, M. Morotomi, O. Tasaki, A. Matsushima, Y. Kuwagata, T. Shimazu, and H. Sugimoto. 2013. Probiotic/synbiotic therapy for treating critically ill patients from a gut microbiota perspective. Dig Dis Sci 58:23-32. Siboo, I. R., B. A. Bensing, and P. M. Sullam. 2003. Genomic organization and molecular characterization of SM1, a temperate bacteriophage of Streptococcus mitis. J Bacteriol 185:6968-6975. Sillankorva, S. M., H. Oliveira, and J. Azeredo. 2012. Bacteriophages and their role in food safety. Int J Microbiol 2012:863945. Singer, R. S., M. P. Ward, and G. Maldonado. 2006. Can landscape ecology untangle the complexity of antibiotic resistance? Nat Rev Microbiol 4:943-952. Skurnik, M., M. Pajunen, and S. Kiljunen. 2007. Biotechnological challenges of phage therapy. Biotechnol Lett 29:995-1003. Slavcev, R. A., and S. Hayes. 2003. Stationary phase-like properties of the bacteriophage lambda Rex exclusion phenotype. Mol Genet Genomics 269:40-48. Smeianov, V., K. Scott, and G. Reid. 2000. Activity of cecropin P1 and FA-LL-37 against urogenital microflora. Microbes Infect 2:773-777.

143

Smith, C. M., S. Sandrini, S. Datta, P. Freestone, S. Shafeeq, P. Radhakrishnan, G. Williams, S. M. Glenn, O. P. Kuipers, R. A. Hirst, A. J. Easton, P. W. Andrew, and C. O'Callaghan. 2014. Respiratory syncytial virus increases the virulence of Streptococcus pneumoniae by binding to penicillin binding protein 1a. A new paradigm in respiratory infection. Am J Respir Crit Care Med 190:196-207. Snyder, L. 1995. Phage-exclusion enzymes: a bonanza of biochemical and cell biology reagents? Mol Microbiol 15:415-420. Song, J. H., K. S. Ko, J. Y. Lee, J. Y. Baek, W. S. Oh, H. S. Yoon, J. Y. Jeong, and J. Chun. 2005. Identification of essential genes in Streptococcus pneumoniae by allelic replacement mutagenesis. Mol Cells 19:365-374. Sorek, R., V. Kunin, and P. Hugenholtz. 2008. CRISPR--a widespread system that provides acquired resistance against phages in bacteria and archaea. Nat Rev Microbiol 6:181-186. Soualhine, H., V. Brochu, F. Menard, B. Papadopoulou, K. Weiss, M. G. Bergeron, D. Legare, J. Drummelsmith, and M. Ouellette. 2005. A proteomic analysis of penicillin resistance in Streptococcus pneumoniae reveals a novel role for PstS, a subunit of the phosphate ABC transporter. Mol Microbiol 58:1430-1440. Sperandio, V., J. L. Mellies, W. Nguyen, S. Shin, and J. B. Kaper. 1999. Quorum sensing controls expression of the type III secretion gene transcription and protein secretion in enterohemorrhagic and enteropathogenic Escherichia coli. Proc Natl Acad Sci U S A 96:15196-15201. Staden, R., K. F. Beal, and J. K. Bonfield. 2000. The Staden package, 1998. Methods Mol Biol 132:115-130. Standish, A. J., U. H. Stroeher, and J. C. Paton. 2007. The pneumococcal two- component signal transduction system RR/HK06 regulates CbpA and PspA by two distinct mechanisms. J Bacteriol 189:5591-5600. Stern, A., and R. Sorek. 2011. The phage-host arms race: shaping the evolution of microbes. Bioessays 33:43-51. Strauch, E., H. Kaspar, C. Schaudinn, C. Damasko, A. Konietzny, P. Dersch, M. Skurnik, and B. Appel. 2003. Analysis of enterocoliticin, a phage tail-like bacteriocin. Adv Exp Med Biol 529:249-251. Sturino, J. M., and T. R. Klaenhammer. 2006. Engineered bacteriophage-defence systems in bioprocessing. Nat Rev Microbiol 4:395-404. Sulakvelidze, A., Z. Alavidze, and J. G. Morris, Jr. 2001. Bacteriophage therapy. Antimicrob Agents Chemother 45:649-659. Sun, Y. H., S. Bakshi, R. Chalmers, and C. M. Tang. 2000. Functional genomics of Neisseria meningitidis pathogenesis. Nat Med 6:1269-1273. Sundararajan, K., A. Miguel, S. M. Desmarais, E. L. Meier, K. Casey Huang, and E. D. Goley. 2015. The bacterial tubulin FtsZ requires its intrinsically disordered linker to direct robust cell wall construction. Nat Commun 6:7281. Sunderkotter, C., and K. Becker. 2014. Systemic therapy with antibiotics: overview of important antibiotics in dermatology. Hautarzt 65:113-124. Syrjänen, R. K., T. M. Kilpi, T. H. Kaijalainen, E. E. Herva, and A. K. Takala. 2001. Nasopharyngeal carriage of Streptococcus pneumoniae in finnish children younger than 2 years old. J Infect Dis 184:451-459. Szklarczyk, D., A. Franceschini, S. Wyder, K. Forslund, D. Heller, J. Huerta-Cepas, M. Simonovic, A. Roth, A. Santos, K. P. Tsafou, M. Kuhn, P. Bork, L. J.

144

Jensen, and C. von Mering. 2015. STRING v10: protein-protein interaction networks, integrated over the tree of life. Nucleic Acids Res 43:D447-452. Sztajer, H., A. Lemme, R. Vilchez, S. Schulz, R. Geffers, C. Y. Yip, C. M. Levesque, D. G. Cvitkovitch, and I. Wagner-Dobler. 2008. Autoinducer-2-regulated genes in Streptococcus mutans UA159 and global metabolic effect of the luxS mutation. J Bacteriology 190:401-415. Taga, M. E., J. L. Semmelhack, and B. L. Bassler. 2001. The LuxS-dependent autoinducer AI-2 controls the expression of an ABC transporter that functions in AI-2 uptake in Salmonella typhimurium. Mol Microbiol 42:777-793. Talbot, T. R., T. V. Hartert, E. Mitchel, N. B. Halasa, P. G. Arbogast, K. A. Poehling, W. Schaffner, A. S. Craig, and M. R. Griffin. 2005. Asthma as a risk factor for invasive pneumococcal disease. N Engl J Med 352:2082-2090. Tettelin, H., K. E. Nelson, I. T. Paulsen, J. A. Eisen, T. D. Read, S. Peterson, J. Heidelberg, R. T. DeBoy, D. H. Haft, R. J. Dodson, A. S. Durkin, M. Gwinn, J. F. Kolonay, W. C. Nelson, J. D. Peterson, L. A. Umayam, O. White, S. L. Salzberg, M. R. Lewis, D. Radune, E. Holtzapple, H. Khouri, A. M. Wolf, T. R. Utterback, C. L. Hansen, L. A. McDonald, T. V. Feldblyum, S. Angiuoli, T. Dickinson, E. K. Hickey, I. E. Holt, B. J. Loftus, F. Yang, H. O. Smith, J. C. Venter, B. A. Dougherty, D. A. Morrison, S. K. Hollingshead, and C. M. Fraser. 2001. Complete genome sequence of a virulent isolate of Streptococcus pneumoniae. Science 293:498-506. Thanassi, J. A., S. L. Hartman-Neumann, T. J. Dougherty, B. A. Dougherty, and M. J. Pucci. 2002. Identification of 113 conserved essential genes using a high- throughput gene disruption system in Streptococcus pneumoniae. Nucleic Acids Res 30:3152-3162. Tiraby, J. G., E. Tiraby, and M. S. Fox. 1975. Pneumococcal bacteriophages. Virology 68:566-569. Tiwari, R., K. Dhama, A. Kumar, A. Rahal, and S. Kapoor. 2014. Bacteriophage therapy for safeguarding animal and human health: a review. Pak J Biol Sci 17:301- 315. Tock, M. R., and D. T. Dryden. 2005. The biology of restriction and anti-restriction. Curr Opin Microbiol 8:466-472. Tohidkia, M. R., J. Barar, F. Asadi, and Y. Omidi. 2012. Molecular considerations for development of phage antibody libraries. J Drug Target 20:195-208. Tomasz, A., J. D. Jamieson, and E. Ottolenghi. 1964. The Fine Structure of Diplococcus Pneumoniae. J Cell Biol 22:453-467. Trepel, M., C. A. Stoneham, H. Eleftherohorinou, N. D. Mazarakis, R. Pasqualini, W. Arap, and A. Hajitou. 2009. A heterotypic bystander effect for tumor cell killing after adeno-associated virus/phage-mediated, vascular-targeted suicide gene transfer. Mol Cancer Ther 8:2383-2391. Tseng, T. T., B. M. Tyler, and J. C. Setubal. 2009. Protein secretion systems in bacterial- host associations, and their description in the Gene Ontology. BMC Microbiol 9 Suppl 1:S2. Tunjungputri, R. N., F. M. Mobegi, A. J. Cremers, C. E. van der Gaast-de Jongh, G. Ferwerda, J. F. Meis, N. Roeleveld, S. D. Bentley, A. S. Pastura, S. A. van Hijum, A. J. van der Ven, Q. de Mast, A. Zomer, and M. I. de Jonge. 2017.

145

Phage-derived protein induces increased platelet activation and is associated with mortality in patients with invasive pneumococcal disease. MBio 8:e01984-16.

Twort, F. W. 1915. An investigation on the nature of ultra-microscopic viruses. Lancet 186:1241-1243. Typas, A., M. Banzhaf, C. A. Gross, and W. Vollmer. 2012. From the regulation of peptidoglycan synthesis to bacterial growth and morphology. Nat Rev Microbiol 10:123-136. Uchiyama, S., A. F. Carlin, A. Khosravi, S. Weiman, A. Banerjee, D. Quach, G. Hightower, T. J. Mitchell, K. S. Doran, and V. Nizet. 2009. The surface- anchored NanA protein promotes pneumococcal brain endothelial cell invasion. J Exp Med 206:1845-1852. Ulevitch, R. J. 2004. Therapeutics targeting the innate immune system. Nat Rev Immunol 4:512-520. Valentino, M. D., A. M. McGuire, J. W. Rosch, P. J. Bispo, C. Burnham, C. M. Sanfilippo, R. A. Carter, M. E. Zegans, B. Beall, A. M. Earl, E. I. Tuomanen, T. W. Morris, W. Haas, and M. S. Gilmore. 2014. Unencapsulated Streptococcus pneumoniae from conjunctivitis encode variant traits and belong to a distinct phylogenetic cluster. Nat Commun 5:5411. van der Poll, T., and S. M. Opal. 2009. Pathogenesis, treatment, and prevention of pneumococcal pneumonia. Lancet 374:1543-1556. van Heijenoort, J. 2001. Formation of the glycan chains in the synthesis of bacterial peptidoglycan. Glycobiology 11:25R-36R. van Opijnen, T., K. L. Bodi, and A. Camilli. 2009. Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms. Nat Methods 6:767-772. Veldhuizen, E. J., V. A. Schneider, H. Agustiandari, A. van Dijk, J. L. Tjeerdsma-van Bokhoven, F. J. Bikker, and H. P. Haagsman. 2014. Antimicrobial and immunomodulatory activities of PR-39 derived peptides. PLoS One 9:e95939. Vidal, J. E., K. E. Howery, H. P. Ludewick, P. Nava, and K. P. Klugman. 2013. Quorum-sensing systems LuxS/autoinducer 2 and Com regulate Streptococcus pneumoniae biofilms in a bioreactor with living cultures of human respiratory cells. Infect Immun 81:1341-1353. Vieira, A., Y. J. Silva, A. Cunha, N. C. Gomes, H. W. Ackermann, and A. Almeida. 2012. Phage therapy to control multidrug-resistant Pseudomonas aeruginosa skin infections: in vitro and ex vivo experiments. Eur J Clin Microbiol Infect Dis 31:3241-3249. Villion, M., and S. Moineau. 2013. Virology: phages hijack a host's defence. Nature 494:433-434. Vunnam, S., P. Juvvadi, and R. B. Merrifield. 1997. Synthesis and antibacterial action of cecropin and proline-arginine-rich peptides from pig intestine. J Pept Res 49:59-66. Walker, C. L., I. Rudan, L. Liu, H. Nair, E. Theodoratou, Z. A. Bhutta, K. L. O'Brien, H. Campbell, and R. E. Black. 2013. Global burden of childhood pneumonia and diarrhoea. Lancet 381:1405-1416. Walkinshaw, M. D., P. Taylor, S. S. Sturrock, C. Atanasiu, T. Berge, R. M. Henderson, J. M. Edwardson, and D. T. Dryden. 2002. Structure of Ocr from bacteriophage T7, a protein that mimics B-form DNA. Mol Cell 9:187-194.

146

Wang, I. N., Y. Li, Q. Que, M. Bhattacharya, L. C. Lane, W. G. Chaney, and J. L. Van Etten. 1993. Evidence for virus-encoded glycosylation specificity. Proc Natl Acad Sci U S A 90:3840-3844. Wang, Q., M. Wang, F. Kong, G. L. Gilbert, B. Cao, L. Wang, and L. Feng. 2007. Development of a DNA microarray to identify the Streptococcus pneumoniae serotypes contained in the 23-valent pneumococcal polysaccharide vaccine and closely related serotypes. J Microbiol Methods 68:128-136. Wang, T., W. C. Hartner, J. W. Gillespie, K. P. Praveen, S. Yang, L. A. Mei, V. A. Petrenko, and V. P. Torchilin. 2014. Enhanced tumor delivery and antitumor activity in vivo of liposomal doxorubicin modified with MCF-7-specific phage fusion protein. Nanomedicine 10:421-430. Warrener, P., R. Varkey, J. C. Bonnell, A. DiGiandomenico, M. Camara, K. Cook, L. Peng, J. Zha, P. Chowdury, B. Sellman, and C. K. Stover. 2014. A novel anti- PcrV antibody providing enhanced protection against Pseudomonas aeruginosa in multiple animal infection models. Antimicrob Agents Chemother 58:4384-4391. Watson, D. A., D. M. Musher, J. W. Jacobson, and J. Verhoef. 1993. A brief history of the pneumococcus in biomedical research: a panoply of scientific discovery. Clin Infect Dis 17:913-924. Wegmann, U., M. O'Connell-Motherway, A. Zomer, G. Buist, C. Shearman, C. Canchaya, M. Ventura, A. Goesmann, M. J. Gasson, O. P. Kuipers, D. van Sinderen, and J. Kok. 2007. Complete genome sequence of the prototype lactic acid bacterium Lactococcus lactis subsp. cremoris MG1363. J Bacteriol 189:3256- 3270. Weiser, J. N., D. Bae, C. Fasching, R. W. Scamurra, A. J. Ratner, and E. N. Janoff. 2003. Antibody-enhanced pneumococcal adherence requires IgA1 protease. Proc Natl Acad Sci U S A 100:4215-4220. Wen, Z., Y. Liu, F. Qu, and J. R. Zhang. 2016. Allelic variation of the capsule promoter diversifies encapsulation and virulence in Streptococcus pneumoniae. Sci Rep 6:30176. Westwater, C., L. M. Kasman, D. A. Schofield, P. A. Werner, J. W. Dolan, M. G. Schmidt, and J. S. Norris. 2003. Use of genetically engineered phage to deliver antimicrobial agents to bacteria: an alternative therapy for treatment of bacterial infections. Antimicrob Agents Chemother 47:1301-1307. Whatmore, A. M., A. Efstratiou, A. P. Pickerill, K. Broughton, G. Woodard, D. Sturgeon, R. George, and C. G. Dowson. 2000. Genetic relationships between clinical isolates of Streptococcus pneumoniae, Streptococcus oralis, and Streptococcus mitis: characterization of "Atypical" pneumococci and organisms allied to S. mitis harboring S. pneumoniae virulence factor-encoding genes. Infect Immun 68:1374-1382. Wichman, H. A., J. Millstein, and J. J. Bull. 2005. Adaptive molecular evolution for 13,000 phage generations: a possible arms race. Genetics 170:19-31. Witzenrath, M., B. Schmeck, J. M. Doehn, T. Tschernig, J. Zahlten, J. M. Loeffler, M. Zemlin, H. Muller, B. Gutbier, H. Schutte, S. Hippenstiel, V. A. Fischetti, N. Suttorp, and S. Rosseau. 2009. Systemic use of the endolysin Cpl-1 rescues mice with fatal pneumococcal pneumonia. Crit Care Med 37:642-649. Wright, A., C. H. Hawkins, E. E. Anggard, and D. R. Harper. 2009. A controlled clinical trial of a therapeutic bacteriophage preparation in chronic otitis due to

147

antibiotic-resistant Pseudomonas aeruginosa; a preliminary report of efficacy. Clin Otolaryngol 34:349-357. Wright, G. D. 2007. The antibiotic resistome: the nexus of chemical and genetic diversity. Nat Rev Microbiol 5:175-186. Wyres, K. L., A. van Tonder, L. M. Lambertsen, R. Hakenbeck, J. Parkhill, S. D. Bentley, and A. B. Brueggemann. 2013. Evidence of antimicrobial resistance- conferring genetic elements among pneumococci isolated prior to 1974. BMC Genomics 14:500. Xia, G., L. Maier, P. Sanchez-Carballo, M. Li, M. Otto, O. Holst, and A. Peschel. 2010. Glycosylation of wall teichoic acid in Staphylococcus aureus by TarM. J Biol Chem 285:13405-13415. Yakunin, A. F., M. Proudfoot, E. Kuznetsova, A. Savchenko, G. Brown, C. H. Arrowsmith, and A. M. Edwards. 2004. The HD domain of the Escherichia coli tRNA nucleotidyltransferase has 2',3'-cyclic phosphodiesterase, 2'-nucleotidase, and phosphatase activities. J Biol Chem 279:36819-36827. Yao, S., Y. Zhu, and L. Chen. 2013. Advances in targeting cell surface signalling molecules for immune modulation. Nat Rev Drug Discov 12:130-146. Yaung, S. J., K. M. Esvelt, and G. M. Church. 2014. CRISPR/Cas9-mediated phage resistance is not impeded by the DNA modifications of phage T4. PLoS One 9:e98811. Zahner, D., A. R. Gandhi, H. Yi, and D. S. Stephens. 2011. Mitis group streptococci express variable pilus islet 2 pili. PLoS One 6:e25124. Zapun, A., T. Vernet, and M. G. Pinho. 2008. The different shapes of cocci. FEMS Microbiol Rev 32:345-360. Zbinden, A., N. Kohler, and G. V. Bloemberg. 2011. recA-based PCR assay for accurate differentiation of Streptococcus pneumoniae from other viridans streptococci. J Clin Microbiol 49:523-527. Zhou, M., J. Boekhorst, C. Francke, and R. J. Siezen. 2008. LocateP: genome-scale subcellular-location predictor for bacterial proteins. BMC Bioinformatics 9:173. Zuany-Amorim, C., J. Hastewell, and C. Walker. 2002. Toll-like receptors as potential therapeutic targets for multiple diseases. Nat Rev Drug Discov 1:797-807.

148

Annexe

Gagner la guerre contre les bactéries résistantes aux antibiotiques

Résumé de la publication

L’émergence de bactéries résistantes et multirésistantes aux antibiotiques est liée à leur capacité d’acquérir des gènes de résistance par divers moyens ainsi que par la presssion de sélection provenant d’une sur-utilisation de ces antibiotiques. En conséquence, la résistance aux antibiotiques est maintenant un problème de santé publique mondial. À l'heure actuelle, de nombreuses recherches se concentrent sur des alternatives aux antibiotiques. Dans cette revue, nous soulignons les progrès récents dans la thérapie antibactérienne liés au développement des agents antibactériens et aux applications potentielles de ces alternatives thérapeutiques.

Avant-propos

Contributions des auteurs

J’ai réalisé les recherches bibliographiques et j’ai rédigé l’article en collaboration avec le professeur Sylvain Moineau.

Publication

Siham Ouennane1,2, and Sylvain Moineau1,2. Trying to win the war against antibiotic- resistant bacteria. In preparation for submission.

149

Abstract

Bacteria can acquire antibiotic resistance genes through different means, leading to the emergence of multi-drug-resistant bacteria and making antibiotic treatment of pathogenic bacteria less effective. As a consequence, antibiotic-resistant bacteria are a major global healthcare challenge. Considerable research efforts now focus on other remedies to provide new alternatives against these resistant bacteria. In this review, we highlight recent advancements related to the potential applications of these antibacterial alternatives.

Introduction

The discovery of antibiotics revolutionized the history of medicine and our ability to fight bacterial infections. More than 80 years after the discovery of antibiotics, we can certainly conclude that they have increased life expectancy. Penicillin was the first natural antibiotic and it signalled the beginning of the golden age of antibiotics (Scheffler, et al., 2013). This also paved the way to the identification and characterization of other novel and non-toxic antibiotics, extensive production of these compounds, and the development of synthetic antibacterials. Antibiotics were also used as chemical probes to advance our understanding of bacterial physiology, biochemistry and genetics (Falconer, et al., 2011). Numerous antibiotics were successfully employed to cure pathogenic bacterial infections, targeting different bacterial functions such as cell wall biosynthesis, nucleic acid synthesis, protein biosynthesis and various metabolic pathways.

Regrettably, overconfidence about the ability of antibiotics to eradicate bacterial diseases and the worldwide use and/or misuse of these antibacterial agents led to the emergence of resistance among human bacterial pathogens. However, resistant microorganisms were isolated even before the first clinical use of antibiotics (Wright, 2007). In fact, to survive in nature, microorganisms have the ability to coexist with others and to overcome variable environmental and chemical challenges (Wright, 2007, Cowen, 2008). Certainly, resistance to antimicrobial agents is not a novel phenomenon but the rapid development and dissemination of antimicrobial resistance, especially among bacterial pathogens is directly related to abuse and misuse of antimicrobial agents (Schulz zur Wiesch, et al., 2010). A

150

myriad of resistance mechanisms employed by bacteria are known but some are still not yet fully understood (Davies & Davies, 2010).

Antibiotic resistance, as an adaptive way to survive and persist in the environment (Andersson & Hughes, 2010), can generally be acquired by two mechanisms: acquisition of resistance genes and spontaneous mutation (Liu & Pop, 2009). Most antibiotic resistance genes are believed to be spread by horizontal gene transfer through mobile genetic elements such as plasmids, integrons and transposons (Fig. A.1). Natural competence, bacterial transduction and conjugation could also play significant roles. This resistance can be disseminated between members of the same bacterial species or between genera and species (Schechner, et al., 2013). On the other hand, acquiring resistance by spontaneous mutation can affect fitness by decreasing the bacterial growth rate (Andersson & Hughes, 2010, Schulz zur Wiesch, et al., 2010). But bacteria can also acquire other mutations to compensate for these fitness mutations. These compensatory mutations improve bacterial fitness without disturbing antibiotic tolerance (Schulz zur Wiesch, et al., 2010).

151

Figure A. 1 Summary of antibiotic target site and resistance mechanisms in Gram- positive and Gram-negative bacteria. A. Antibiotic mechanisms of action. B. Resistance mechanisms used by bacteria

The emergence of antibiotic-resistant strains can be attributed to several factors, including the use of antibiotics in agriculture, even in the absence of infection, and also in fish farms to cure disease and promote growth (Allen, et al., 2010). Moreover, antibiotics are released via patient excreta into municipal sewage systems, mainly in the effluents of hospitals but also from pharmaceutical plants and in agriculture runoff (Kummerer & Henninger, 2003, Singer, et al., 2006). As a consequence, antibiotics persist in aquatic and soil environments, often in sub-inhibitory concentrations, promoting the selection and spread of resistance (Allen, et al., 2010). Several bacterial pathogens have evolved into “superbugs” which reduce therapeutic options and extend periods of hospital care for those infected (Davies & Davies, 2010). Superbugs are classified into two major types: 1) commensal origin where bacteria acquired antibiotic resistance genes and increased virulence; and 2) environmental origin which are opportunistic pathogens (Alekshun & Levy, 2006, Wright, 2007).

152

Research to discover new antibiotics is facing a number of issues, ranging from the high cost to technical barriers to uncover truly novel antibacterial agents.

The above concerns are worldwide in scope and have important economic consequences. As such, a number of alternatives to antibiotics have been proposed, some of which will be reviewed here.

1. Bacteriophage therapy

Bacteriophages (or phages) are viruses that infect and eventually lyse only bacterial cells (Ly-Chatain, 2014). Phages are ubiquitous, representing the most abundant biological entities on the planet. An estimated 1031 to 1032 phages exist in the biosphere and phage predation is predicted to destroy approximately half of the Earth’s bacterial population every 48 hours (Deresinski, 2009). The discovery of bacteriophages is credited independently to Frederick Twort (in 1915) and Félix d’Hérelle (in 1917) before the medical application of antibiotics (Parisien, et al., 2008). D’Hérelle was the first to propose the idea of using phages to treat bacterial infectious diseases in animals and humans, which was the shining start in the development of phage therapy (Abedon, et al., 2011). The discovery and efficacy of antibiotics ended most phage-based treatments of human infections in the West and phages were abandoned as significant therapeutic agents. However, in Eastern Europe, research into and application of phage therapy was and is still used to treat several bacterial infectious diseases (Clokie, et al., 2011). The emergence of resistance to antibiotics has motivated the West to re-evaluate phage therapy. Phage therapy uses whole-phage products, namely virulent phages that do not harbour genes coding for virulence factors (Fig A.2). Phages provide several advantages as they are effective against multidrug-resistant bacterial pathogens and they do not disturb the normal microbial flora because of high host specificity (Skurnik, et al., 2007, Chan, et al., 2013). They also replicate at the site of infection and do not affect eukaryotic cells (Matsuzaki, et al., 2005, Skurnik, et al., 2007). Finally, the cost of isolating new phages is relatively low. Numerous studies show the success of phages against many pathogenic bacteria for humans and

153

animals, such as the case of a vancomycin-resistant Enterococcus faecium strain in mice (Biswas, et al., 2002), and for localized and systemic infections caused by Vibrio vulnificus (Cerveny, et al., 2002).

Figure A. 2 Main strategies of applying bacteriophages in phage

Phage therapy also has some challenges that include poor stability of phage preparations and the efficient removal of bacterial residues as endotoxins and pyrogens (Lu & Koeris, 2011). Moreover, phage resistance may also become a problem. Bacteria have developed numerous resistance mechanisms to interfere with phage replication that are directed at different steps of the lytic cycle (Table A.1). To avoid the mistakes that led to antibiotic resistance, it is vital to study phage resistance mechanisms and their dissemination before introducing phage therapy.

154

Table A. 1 Summary of the bacterial anti-phage mechanisms and strategies used by phage to avoid host resistance. Stage of Bacterial phage resistance Survival Phage escape resistance Ref lytic effect cycle

Modification or loss of phage host receptor Recognition of new receptors (Labrie, et al., 2010) Mutation in the genes encoding receptor Acquisition of mutations in genes (Samson, et al., 2013)

Bacterial capsule production coding for RBP (receptor-binding (Chatterjee & Production of protein (ex. protein A) proteins) or tail fiber Rothenberg, 2012) Protein masking receptor to avoid phage (Ravin, et al., 2002)

rption

overinfection exclusion

Adso Production of extracellular matrix Burrowing for receptors: Phage Cleavage of EPS by phage (Cornelissen, et al., Hydrolases or lyases 2012) Recognition of polysaccharides (Baker, et al., 2002) (K and O antigens)

Superinfection immunity and exclusion Conformational change at the injection Phage encoded regulatory control region (Labrie, et al., 2010) site as genetic switch (e.g., Some virulent (Lu, et al., 1993)

death Inhibition of phage DNA transfer into the phages of P335) (Lu & Henning, 1994) host cell by Sie systems. (Mahony, et al., 2008)

Prevention of peptidoglycan Phage (Durmaz, et al., 2002) degradation by phage lysozyme Phage DNA ejection Phage DNA Prophage-encoded repressor protein

Restriction / modification system DNA base modification to evade (Dupuis, et al., 2013) Cleavage of phage DNA restriction (Tock & Dryden, Protection of host DNA from restriction Camouflage of restriction site by phage 2005) by the methylase activity protein DNA mimic protein (Stern & Sorek, 2011) Self-methylation and activation of host (Walkinshaw, et al., methylase 2002) Addition of hydroxymethyl (Yaung, et al., 2014) transferase to all cytosine residues with/without glycosylation (Kruger & Bickle, Acquisition of methyltransferase 1983) Inhibition by phage protein (Samson, et al., 2013) Overcome classical restriction gene product (Domingues, et al., Active viral block of restriction 2004)

enzyme

CRISPR-Cas systems Intregation of fragment of phage DNA Acquisition of single-nucleotide (Deveau, et al., 2008)

into CRISPR loci (proto-spacer) mutation: (Schechner, et al., Production of crRNA units to interfere Protospacer adjacent motif (PAM) 2013) with foreign DNA by complementarity Protospacer sequence (Sorek, et al., 2008) Phosphorylation of Cas protein (Brouns, et al., 2008)

Genome replication Genome

Phage genome deletion sequence of: (Deveau, et al., 2008) PAM motif (Samson, et al., 2013) Protospacer region (Bondy-Denomy, et Synthesis of small phage protein with al., 2013) anti-CRISPR activity

Phage release phage and no suicide Cell

Abortive infection: Interference with DNA replication: Synthesis of host protein that: -decreases bacterial fitness By-pass by phage mutations (Blower, et al., 2012) -inhibits bacterial growth Exchange of a DNA fragment with a (Haaber, et al., 2010) -decreases ATP needed for virion resident prophage (Slavcev & Hayes, multiplication Homologous recombination events 2003) Inhibition of phage protein expression Synthesis of phage molecule to interfere (Snyder, 1995) Synthesis of a complementary DNA with bacterial antitoxin (Otsuka & Yonesaki, Depolarization of membrane to avoid death Phage - encoded pseudo-antotoxin RNA 2012)

155

infection: Rex exclusion to neutralize the bacterial toxin (Bidnenko, et al., Toxin-antotoxin systems Phage antitoxin against multiple toxins 1998) Activation by phage infection Neutralization of toxin by production of (Labrie, et al., 2010) stable antitoxin (Blower, et al., 2012) Phage mimics the small RNA antitoxin (Guo, et al., 2014)

(Sturino &

Abortive infection: Inhibition of RNA transcription Klaenhammer, 2006) Inhibition of phage gene translation Acquisition of discrete mutations and all (Bull, et al., 1998) Reduce efficiency of plaquing above (Goeders & Van Origin-derived PER Melderen, 2014) Inhibit production of phage major capsid

protein

death

CRISPR-Cas systems Phage encoded own functional CRISPR- (Villion & Moineau, Integration of fragment of phage DNA cas systems 2013)

Transcription and and translation Transcription Interference with phage nucleic acid Phage-encoded antiphage systems (Ram, et al., 2012) Acquisition of point mutations or (Garneau & Moineau, Reduce phage replication / Phage and cell and / Phage replication phage Reduce deletions 2001)

Abortive infection: (Sturino & Phage-triggered suicide Phage mutations and all above. Klaenhammer, 2006)

Interference with phage DNA packaging

Subunit poisoning

Assembly

Cell suicide and no and no suicide Cell release phage

Abortive infection: (Stern & Sorek, 2011)

Block phage from infecting neighboring Phage mutations and all above. (Durmaz &

cells Klaenhammer, 2007) Premature lysis of infected cell

death

Cell lysis Cell Host-factor elimination

Elimination of host factors essential for Phage phage replication

The possibility of phage resistance has led researchers to explore the use of phage cocktails. Phage cocktails are mixtures of phages, thereby producing more pharmacologically suitable preparations to broaden the spectrum of activity of therapeutic phages (Chan & Abedon, 2012, Chan, et al., 2013). Phage cocktails may not only solve the problem of narrow host range but also avoid problems related to phage resistance. Recently, numerous studies have reported the effectiveness phage cocktails to control, detect and treat pathogenic bacteria in both humans and animals (Chan, et al., 2013, Tiwari, et al., 2014). For example, a phage cocktail containing eight phages belonging to Podoviridae and Myoviridae was used in a phase I trial to treat patients with venous leg ulcers, targeting a single bacterium in the wounds (Rhoads, et al., 2009). A phage cocktail containing three phages was tested in mice

156

infected by Klebsiella pneumoniae, which recovered pneumoniae bacteremia and quickly eliminated the bacteria (Gu, et al., 2012). Others have reported double-blind phase I/II clinical trials for treatment of chemo-resistant Pseudomonas aeruginosa-associated chronic otitis and showed effectiveness and safety of the phage cocktail (Wright, et al., 2009). Others have developed a strategy to fight bacterial infections based on using genetically engineered phages as a delivery system for bactericidal proteins to target specific bacteria (Westwater, et al., 2003).

Using combined therapy to treat human bacterial infections represents another strategy to fight resistant bacteria, and could be implemented using phage or phage cocktails with antibiotics to eradicate bacteria or by using specific phages targeting specific bacteria for antibiotic delivery. In three patients in Georgia, phages combined with antibiotics were tested in wound containing multidrug-resistant Staphylococcus aureus. Clinical improvement in wounds was observed within 7 days, purulent drainage stopped and bacteria were eliminated (Jikia, et al., 2005).

Recent interest has been rekindled in the development of clinical uses and commercialization of phages, and pharmaceutical companies have become more involved in phage therapy. The Eliava Institute was the first center in the world focused on bacteriophages, including research, industrial department and manufacturing units. Later, other companies got involved such as Eli Lilly and medical institutes have emerged including the Hirszfeld Institute (Sulakvelidze, et al., 2001, Deresinski, 2009).

Other phage applications in human diseases The phage display technology represents a powerful tool and innovative application for pharmacology, immunology, cell biology, vaccine development, and isolation of specific biomarkers for many diseases (Tohidkia, et al., 2012, Bakhshinejad & Sadeghizadeh, 2014). Recently, it was developed to diagnose and treat hepatitis B with the hope of producing the anti-HBV (hepatitis B virus) vaccines (Bakhshinejad & Sadeghizadeh, 2014). Furthermore, phages can efficiently deliver drugs and genes to mammalian cells for clinical purposes as an innovative display phage screening strategy (Bakhshinejad & Sadeghizadeh,

157

2014). Many studies reported the application of a phage display library in the diagnosis (Deutscher, 2010, Lim, et al., 2014) and potential treatment of a wide range of cancers through in vitro and in vivo targeted delivery of therapeutic genes (Bakhshinejad & Sadeghizadeh, 2014) to suppress tumor growth and kill tumor cells (Trepel, et al., 2009). In nanomedicines, phage protein-mediated delivery of anticancer drugs (Petrenko & Jayanna, 2014, Wang, et al., 2014) has shown promising results compared to common chemotherapy. Phage display makes probing tumor cells in the human body possible, which has led to the identification of peptides targeting a specific cancer (Larimer & Deutscher, 2014), and even peptides for human vasculature (Jung, et al., 2012, Larimer & Deutscher, 2014). Another approach is in this area of phage fusion proteins targeting breast cancer cells to deliver siRNA (Bedi, et al., 2011).

Phage applications in industries Phages have also been investigated in agriculture and aquaculture. The Food and Drug Administration (FDA) has recognized phages as safe for use in food additives as antimicrobial biocontrol agents (Tiwari, et al., 2014). A phage preparation was proposed to be added to animal feed to control Salmonella infection (Sillankorva, et al., 2012). Control and protection of plants against bacterial infections is possible using phages (Balogh, et al., 2010). Successful application of phages was obtained in cases of bacterial infections of apple blossom, tomato, pepper spot and other crops (Monk, et al., 2010). Phage products have been approved to reduce the risk of foodborne listeriosis (Monk, et al., 2010). They have been proposed to combat bacterial contamination in yeast industrial processes (Bertozzi Silva & Sauvageau, 2014). Phages were used as biocontrol agents and lytic phages were used to detect the presence of pathogenic bacteria such as Mycobacterium tuberculosis (Henry & Debarbieux, 2012). Phages were tested against many pathogenic bacteria in aquaculture to prevent and treat infectious diseases, and were found to be efficient (Nakai & Park, 2002).

158

Phage components as antibacterial agents Most characterized phages that possess a tail produce lytic enzymes, known as endolysins that are needed to lyse the cell at the end of the lytic cycle to release new virions (Matsuzaki, et al., 2005). Phage endolysins belong to the cell wall hydrolase class and they degrade peptidoglycan bonds, the major component of the bacterial cell wall, even from outside of the cell (Matsuzaki, et al., 2005, Fischetti, et al., 2006, Parisien, et al., 2008). Many in vivo and in vitro studies have shown that phage lytic enzymes have the capacity to rapidly kill bacteria even at low dose (Strauch, et al., 2003, Fischetti, et al., 2006). Lytic enzymes seem to be very promising and can be used as potential antibacterial agents with a different mode of action compared to antibiotics targeting cell wall membranes, such as penicillin. Lytic enzymes are also active against antibiotic-resistant bacteria and, in this case, the probability of developing resistance against lytic enzymes appears to be very low (Matsuzaki, et al., 2005, Borysowski, et al., 2006).

2. Immune modulation therapy

The human immune system is designed to fight a wide array of potential pathogens. This system is our own natural defense, which is divided into two types of immunity to protect our body from numerous microbes: innate and adaptive immunity. These two mechanisms play an essential role in the maintenance of health, and in the prevention of and recovery from disease, but each mechanism has different functions and roles. The immune system regularly interacts with a massive number of microorganisms including commensals, gut microbiota, and other microorganisms from the environment, including pathogens (Mansour, et al., 2014). Although this great system can tolerate and stay passive in contact with commensal microbial species, contact with a harmful microbe activates a response to prevent infection and remove this microbe. Hence, the idea to use immune modulation therapy to combat a myriad of human diseases, including bacterial infections. Immune modulation is a rational approach exploiting natural host mechanisms to initiate or enhance protective antimicrobial immunity (Hancock, et al., 2012). Microbes express specific

159

virulence factors that repress immune system responses and increase pathogenicity (Hancock, et al., 2012). Therefore, depending on the situation, the immune system can modulate the response through hyperactivation (immunostimulation) or hypoactivation (immunosuppression) (Mahima, et al., 2012, Yao, et al., 2013). Immunomodulation is reconstitution therapy to retrieve control of the human body.

Immunomodulatory agents were shown to be useful as a therapeutic strategy (reconstitution therapy) to compensate a defect in the immune system. These agents limited autoimmune and inflammation responses and stimulated antitumor immunity (Ulevitch, 2004, Hancock, et al., 2012). Vaccination is one of the great successes of immune modulation therapy to prevent infectious diseases. Monoclonal antibodies (mAb) are could be used as immunomodulation tools, they were approved for clinical application many decades ago for treatment of various diseases (Jiang, et al., 2011). Much work was done to develop human therapeutic antibodies to become less immunogenic and more efficient with a longer half- life in vivo (Jiang, et al., 2011). Today, many monoclonal antibodies (mAb) have been approved for treatment of inflammatory diseases (Kotsovilis & Andreakos, 2014), cancer (Scott, et al., 2012) and viral infections (Marasco & Sui, 2007).

The application of mAb as a therapy for bacterial infectious diseases is promising but still not commonly used. Yet, recent attention has been given to the development of efficient mAb against bacterial infectious diseases for clinical use and they are gaining momentum to remove resistant bacteria and/or bacterial toxins. mAbs targeting anthrax were the first to be approved (due to bioterrorist threats) for use in patients with inhalational anthrax. This mAb acts by binding to a key antigen of Bacillus anthracis (Fox, 2013). Neutralizing antitoxin mAbs have significant potential as they can inhibit the function of bacterial exotoxins (Oleksiewicz, et al., 2012). Many efforts have also been made to develop mAbs to obstruct the binding of toxins to their receptors, allowing efficient clearance. Several mAbs targeting the protective antigen component of the lethal B. anthracis toxin are currently under investigation (Oleksiewicz, et al., 2012) while Raxibacumab has already been approved for treatment and prophylaxis in the case of inhalational anthrax (Kummerfeldt, 2014). Similarly, anti-PcrV antibody provides significant protection against the P.

160

aeruginosa type III secretion system (T3SS), which injects bacterial toxins directly into the cytoplasm of host cells. Anti-PcrV antibody demonstrated excellent efficacy in multiple animal models against multi-drug resistant P. aeruginosa (Warrener, et al., 2014).

Most mAbs target one specific epitope that block a toxin while mAb cocktails increase efficiency by overlapping more epitopes (Oleksiewicz, et al., 2012). Interestingly, many mAb cocktails designed as efficient toxin neutralizers are in clinical trials and seem promising, such as a mixture of three monoclonal antibodies against Clostridium botulinum toxin. A cocktail of two mAbs toward Shiga toxin-producing E. coli are in clinical research trials (Oleksiewicz, et al., 2012). In addition, an approach to use mAbs targeting components of the outer membrane against bacterial lipopolysaccharide and lipoteichoic acid is in clinical development (Oleksiewicz, et al., 2012). Monoclonal antibodies targeting bacterial surface components seems to be an encouraging option since the mAbs bind directly to surface proteins and act in several different ways, including via bacterial lysis (LaRocca, et al., 2009, Oleksiewicz, et al., 2012). Similar to phage therapy, interest in study and development of mAbs has increased and many biotechnology companies are engaged in this promising area.

Immunomodulation therapy targeting innate immune receptors is another potential therapeutic alternative. The innate immune system recognises molecular signatures from microbial cells by way of pattern recognition receptors (PRRs), which directly trigger immune cells (Kawai & Akira, 2010, Hancock, et al., 2012). The idea of targeting PRRs is related to their high conservation among different species, which means few variations among pathogen-associated molecular patterns (PAMs) leading to control and regulation of the immune system (Akira, et al., 2006). There has been considerable expansion in our knowledge of Toll-like receptors (TLRs) and NOD-like receptors (NLRs), key families of PRR receptors regarded as potential therapeutic regulators. They stimulate the immune system in the same way as microorganisms and play an important role by controlling bacterial infection (Hancock, et al., 2012).

161

TLRs and NLRs, have the ability to rapidly detect and recognize structural components belonging to Gram-positive and Gram-negative bacteria (Akira, et al., 2006). Toll-like receptor family members include 10 transmembrane proteins, each one recognizes and has a specific response to specific PAMs such as nucleic acids, lipoteichoic acid, lipopolysaccharide, porins and flagellin (Akira, et al., 2006, Hancock, et al., 2012). Likewise, NLRs sense and distinguish muropeptides (Chan, et al., 2013), soluble peptidoglycan structures and other bacterial components, which play a role as messengers of the presence of antibiotic pointing cell-wall biosynthesis (Boudreau, et al., 2012).

Bacteria can evade the host immune defense system using numerous strategies, including rapid growth, which does not give enough time to the host to provide good responses, creating a need for vaccination against these infections. Bacteria can also evade the host immune defense system through persistence, which makes the immune system weaker (Kaufmann & Schaible, 2005). Therefore, immunomodulation therapy through TLRs and NLRs could be used as agonist, antagonist or bacterial vaccines to boost host bacterial elimination (Chan, et al., 2013). Trials are underway for various applications, such as the case of a respiratory tract infection caused by bacteria where TLR agonists as bacterial vaccines have the potential to eliminate existing bacteria and protect against future bacterial infections (Zuany-Amorim, et al., 2002, Hancock, et al., 2012).

Taken altogether, immunomodulation has two targets: the cell surface receptors and the intracellular pathways (Ulevitch, 2004). This represents promising new approaches for selective therapy by targeting proteins or signalling pathways to modulate the innate immune system in order to treat bacterial infections with limited side effects. Immunomodulation therapy provides advantages compared to common therapy. First, no antimicrobial resistance can be developed against this therapy, especially in the absence of selection pressure against the microbes. Second, this therapy targets the host and not the invasive microorganisms, making the human body stronger through modulation of immunity.

162

3. Antimicrobial peptides

Antimicrobial peptides (AMPs) are part of our natural innate immune system. In fact, they are present in almost every life form, from bacteria to human, and active against a wide range of pathogenic agents able to kill a broad spectrum of microorganisms (Hancock, et al., 2012, Okorochenkov, et al., 2012). AMPs are short, positively charged, amphiphilic peptides, 10 to 50 amino acids long (Hancock & Sahl, 2006).

The mode of action of AMPs requires direct interaction with the bacterial surface. The positive charge of these peptides and the negative charge of the bacterial cell wall (due to phosphate groups in LPS of Gram-negative bacteria and lipoteichoic acids of Gram- positive bacteria) promote attachment, then AMPs promote pore formation leading to bacterial lysis and killing (Jenssen, et al., 2006, Okorochenkov, et al., 2012). In Gram- positive bacteria, AMPs often target Lipid II, a membrane-anchored cell-wall precursor that plays an essential role in cell-wall synthesis, and lead to disruption of cell wall biosynthesis and pore formation (Hancock & Sahl, 2006). Similarly, in Gram-negative bacteria, after attachment of AMPs to the outer membrane, these peptides are directed into membrane- associated structures where they increase the permeability by channel formation and membrane disorganization, leading to the entry of other peptides arriving at the cytoplasmic membrane (Jenssen, et al., 2006). Pore formation is not the exclusive mode of action of antimicrobial peptides, there are other mechanisms targeting a variety of essential cellular processes including inhibition of spectum formation, cell-wall biosynthesis, inhibition of enzymatic activity and inhibition of nucleic acids and protein synthesis, binding to DNA and activation of autolysis (Brogden, 2005, Deutscher, 2010). Many factors also affect AMPs activity and specificity. The susceptibility of a bacterium to any given AMP is related to the peptide size, sequence, structure and conformation, hydrophobicity, cationic and amphiphilic nature (Brogden, 2005).

AMPs are considered to be a very promising alternative to antibiotics (Okorochenkov, et al., 2012). Much work has been done in the last three decades to identify and study AMPs

163

(Jenssen, et al., 2006). In addition to their antimicrobial properties some have also immunomodulation activity, making them a promising tool against antibiotic resistant bacteria (Hancock & Sahl, 2006). Several AMPs are in clinical trials and others are in discovery, development and preclinical studies (Jenssen, et al., 2006, Okorochenkov, et al., 2012).

LL-37, a human antimicrobial peptide with 37 amino acids having immunomodulatory properties, has a broad spectrum activity against many Gram-positive and Gram-negative bacteria, such as Escherichia coli, Staphylocococcus aureus, Salmonella typhimurium and P. aeruginosa, Neisseria gonorrhoeae, Klebsiella pneumoniae and group A Streptococcus (Smeianov, et al., 2000, Bergman, et al., 2005, Bowdish, et al., 2005, Liu, et al., 2013). The pig-derived antimicrobial peptide PR-39 provided favorable results against several Gram-positive bacteria such as Bacillus globigii and Enterococcus faecalis and toward Gram-negative bacteria with as broad an antibacterial spectrum as Pseudomonas (Vunnam, et al., 1997, Veldhuizen, et al., 2014). Antimicrobial peptides produced by fungi can also have antibacterial activities against many Gram-positive bacteria including Streptococcus (Hancock & Sahl, 2006). It is also well-documented that AMPs provide cutaneous defense mechanisms, even against Staphylococcus aureus (Braff, et al., 2005).

Antimicrobial peptides could be used also as food preservatives. For example, nisin, an antimicrobial peptide with 34 amino acids produced by Lactococcus lactis, is active against foodborne pathogens, including resistant bacteria such as methicillin-resistant S. aureus (Jenssen, et al., 2006). Encapsulation of AMPs can enhance their stability in foods to assure higher efficiency (Carmona-Ribeiro & de Melo Carrasco, 2014). Researchers have detected AMP-resistance in bacteria but to a lower frequency. Resistance mechanisms include reducing negative surface charge by alteration of membrane protein or by production of proteolytic enzymes to degrade AMPs (Brogden, 2005). Even with a few reported cases of resistance, the use of AMPs for therapeutic purposes as an antibacterial alternative is still promising. To ensure the effectiveness of AMPs other parameters should be taken into consideration, such as the in vivo concentration of these peptides, synergic effects with other molecules or inactivation by proteases (Braff, et al., 2005, Brogden,

164

2005). Of interest is the development of synthetic AMPs or their optimization by chemical modification to increase their efficiency, to reduce toxicity, and to increase bioavailability (Jenssen, et al., 2006, Okorochenkov, et al., 2012). Combined therapy using AMPs and antibiotics is also attracting. Two AMPs, LL-37 and HBD3 were combined with antibiotics and showed to act synergistically against Clostridium difficile (Nuding, et al., 2014).

Antimicrobial peptides have shown high efficiency against a wide range of bacteria but more work is still needed to produce less toxic, more stable AMPs at a lower cost.

4. Probiotics and prebiotics

The intestinal microbiota is a collection of commensal microorganisms, including bacteria, fungi and protozoa that play an essential role in human health. They also have key roles in metabolism and food absorption as well as to provide protection from pathogenic agents (Plummer, et al., 2005, Grimoud, et al., 2010). Probiotics and prebiotics are employed in food products to reduce pathogenic bacteria and as a strategy to restore and protect the intestinal microbiota (Grimoud, et al., 2010).

Probiotics are living bacteria widely administered to humans in reasonable quantities to prevent side effects following antibiotic therapy, which disturbs the ecological balance of the gut microbiota. Probiotics stimulate the growth of some members of the gut microbiota and modulate mucosal and systemic immunity (Courvalin, 2006, Kotzampassi & Giamarellos-Bourboulis, 2012). Determining the direct effect of probiotics on the intestinal microbiota is difficult due to the relationships between members of the microbiota (Plummer, et al., 2005). Probiotics use natural competition mechanisms, including competition for food, adherence to the mucosa and epithelium, inhibition of bacterial translocation, production of inhibitor compounds such as bacteriocins, and as immunomodulators to improve the human immune system and maintain the integrity of the intestinal barrier (Hemarajata & Versalovic, 2013). Probiotics have been shown to provide relief in the case of gastroenteritis by reducing the duration of symptoms (Kotzampassi &

165

Giamarellos-Bourboulis, 2012). The main bacteria used as probiotics belong to the lactic acid bacteria group (mostly Lactobacillus sp.) as well as from Bifidobacterium, which are part of the normal gut microbiota (Kotzampassi & Giamarellos-Bourboulis, 2012). It has been reported that hosts distinguish probiotics through their pattern recognition receptors, increasing or supressing activation of downstream pathways of the host immune system (Bermudez-Brito, et al., 2012). Many studies have highlighted the use of probiotics to prevent or treat bacterial pathogenic infections, as an alternative or complementary to antibiotics (Oudhuis, et al., 2011, Amalaradjou & Bhunia, 2012, Kotzampassi & Giamarellos-Bourboulis, 2012). They can be used for prophylactic treatment against bacterial respiratory infections, including nosocomial or community acquired pneumonia (Alexandre, et al., 2014). Probiotics are also used in the treatment of gastrointestinal infections by reducing infections by Helicobacter pylori, the causative agent of ulcers, and are reported to decrease bacterial charge and gastritis (Patel, et al., 2014) and to prevent nosocomial infection (Oudhuis, et al., 2011). A clinical trial using combined probiotics seems to reduce the incidence of postoperative bacterial among patients undergoing pancreas resection or liver transplant (Rayes, et al., 2007). Likewise, probiotics could be used to control foodborne pathogens. Probiotics were demonstrated to reduce various pathogens, such as Salmonella Enteritidis, the causative agent of foodborne gastroenteritis, in chicks, and to protect mice from death caused by L. monocytogenes (Amalaradjou & Bhunia, 2012).

Prebiotics are selectively fermented ingredients and non-digestible food ingredients that modulate the proliferation of the active gut microbiota (Grimoud, et al., 2010). Research into the addition of prebiotics increased due to their perceived benefits for human health. Today, it is recommended to add prebiotics to infant milk to mimic similar functionalities as human milk by mixing short chain galacto-oligosaccharides and long-chain fructo- oligosaccharides at a ratio of 9:1 (Scholtens, et al., 2014). A food product containing prebiotics and probiotics is called a synbiotic (Grimoud, et al., 2010). The use of synbiotics versus prebiotics and probiotics alone in patients with ulcerative colitis seems to be more efficient due to the effect of prebiotics in improving the probiotic colonization or metabolism and in regulating the gut microbiota (Fujimori, et al., 2009, Grimoud, et al.,

166

2010). Synbiotic treatment was also demonstrated to reduce septic complication (Shimizu, et al., 2013).

Currently, prebiotics, probiotics and synbiotics are promising products to assure maintenance and restauration of intestinal microbiota. An important consideration for a probiotic product is the selection of bacteria. It should have no or low resistance to antibiotics as well as be refractory to the acquisition of antibiotic resistance genes to avoid dissemination.

5. Other antimicrobial agents

Medicinal Plants A large number of Earth’s medicinal plants can be thought of as nature’s gifts and they have been part of traditional medicine practices for thousands of years. Knowledge of these plants and their uses in the treatment of various diseases or symptoms were preserved for generations (Dubreuil, 2013). Among others, medicinal plants and plant extracts have been studied for their immunomodulation properties of the host (Ganju, et al., 2003). Current work focuses on determining the active components in medicinal plants and studying their properties with a focus on using them as complementary and/or alternative therapies to treat diseases, including as antimicrobial agents (Dubreuil, 2013). It has been reported that many medicinal plants have antibacterial activity, for example, against enterotoxigenic E. coli and Vibrio cholorae (Ganju, et al., 2003, Dubreuil, 2013). Some varieties and extracts of Camellia plants were shown to have the ability to eliminate S. aureus, S. pyogenes, S. epidermidis, P. aeruginosa, K. pneumonia, E. coli, and Serratia marcescens (Bashir, et al., 2014). The use of medicinal plants as antimicrobial agents is promising and could be an efficient alternative or combined therapy with antibiotics. To increase safety and efficacy, more studies are needed to understand the interactions between different active components in the same plant or from different plants, and also to understand the interactions with antibiotics and components of the human body.

167

Essential oils Essential oils are oily aromatic liquids that protect plants from diseases and are considered to be mixtures of volatile organic molecules that can be extracted from plants by different methods (Haba, et al., 2014). After the emergence of antimicrobial resistance, many studies have focused on essential oils, highlighting their antimicrobial properties. Antimicrobial activity was not always found stable and reproducible due to seasonal composition changes and the percentage of active components, geographic site and the function of a part from the same plant (Gomez-Estaca, et al., 2010). Because of their complex composition, essential oils have many modes of action, such as disturbing the bacterial membrane, inhibiting enzymes, disrupting metabolic pathways and increasing membrane permeability (Langeveld, et al., 2014). Many studies reported the effects of essentials oils against pathogenic bacteria but the tea tree Melaleuca alternifolia and the flowering plant Backhousia citriodora are particularly interesting as their extracted essential oils are effective against a wide range of bacteria (Kurekci, et al., 2013). Likewise, essential oils were reported to have antimicrobial activity against Candida albicans and methicillin- resistant S. aureus (Haba, et al., 2014). Essential oils are particularly interesting and efficient for food and fish preservation (Gomez-Estaca, et al., 2010). The absence of bacterial resistance to these products holds promise for their use in the treatment of infections and perhaps for their use in combined therapy with antibiotics.

Conclusions

Antibiotic resistance remains an alarming problem worldwide due to the extensive use and misuse of antibiotics. The urgent need for alternative antimicrobial agents and treatments is crucial for controlling pathogens in medicine and agriculture. The availability of many promising alternatives is encouraging but also highlights the needs for more studies to fully comprehend their mode of action alone or in combination with our current arsenal of antimicrobial agents. Moreover, additional studies are required to assess their microbiological and clinical impacts on animal and humans.

168

References

Abedon, S. T., S. J. Kuhl, B. G. Blasdel, and E. M. Kutter. 2011. Phage treatment of human infections. Bacteriophage 1:66-85. Akira, S., S. Uematsu, and O. Takeuchi. 2006. Pathogen recognition and innate immunity. Cell 124:783-801. Alekshun, M. N., and S. B. Levy. 2006. Commensals upon us. Biochem Pharmacol 71:893- 900. Alexandre, Y., G. Le Blay, S. Boisrame-Gastrin, F. Le Gall, G. Hery-Arnaud, S. Gouriou, S. Vallet, and R. Le Berre. 2014. Probiotics: a new way to fight bacterial pulmonary infections? Med Mal Infect 44:9-17. Allen, H. K., J. Donato, H. H. Wang, K. A. Cloud-Hansen, J. Davies, and J. Handelsman. 2010. Call of the wild: antibiotic resistance genes in natural environments. Nat Rev Microbiol 8:251-259. Amalaradjou, M. A., and A. K. Bhunia. 2012. Modern approaches in probiotics research to control foodborne pathogens. Adv Food Nutr Res 67:185-239. Andersson, D. I., and D. Hughes. 2010. Antibiotic resistance and its cost: is it possible to reverse resistance? Nat Rev Microbiol 8:260-271. Baker, J. R., S. Dong, and D. G. Pritchard. 2002. The hyaluronan lyase of Streptococcus pyogenes bacteriophage H4489A. Biochem J 365:317-322. Bakhshinejad, B., and M. Sadeghizadeh. 2014. Bacteriophages and their applications in the diagnosis and treatment of hepatitis B virus infection. World J Gastroenterol 20:11671- 11683. Bakhshinejad, B., and M. Sadeghizadeh. 2014. Bacteriophages as vehicles for gene delivery into mammalian cells: prospects and problems. Expert Opin Drug Deliv:1-14. Balogh, B., J. B. Jones, F. B. Iriarte, and M. T. Momol. 2010. Phage therapy for plant disease control. Curr Pharm Biotechnol 11:48-57. Bashir, S., B. M. Khan, M. Babar, S. Andleeb, M. Hafeez, S. Ali, and M. F. Khan. 2014. Assessment of bioautography and spot screening of tlc of green tea (Camellia) plant extracts as antibacterial and antioxidant agents. Indian J Pharm Sci 76:364-370. Bedi, D., T. Musacchio, O. A. Fagbohun, J. W. Gillespie, P. Deinnocentes, R. C. Bird, L. Bookbinder, V. P. Torchilin, and V. A. Petrenko. 2011. Delivery of siRNA into breast cancer cells via phage fusion protein-targeted liposomes. Nanomedicine 7:315- 323. Bergman, P., L. Johansson, V. Asp, L. Plant, G. H. Gudmundsson, A. B. Jonsson, and B. Agerberth. 2005. Neisseria gonorrhoeae downregulates expression of the human antimicrobial peptide LL-37. Cell Microbiol 7:1009-1017. Bermudez-Brito, M., J. Plaza-Díaz, S. Muñoz-Quezada, C. Gómez-Llorente, and A. Gil. 2012. Probiotic mechanisms of action. Ann Nutr Metab 61:160-174 Bertozzi Silva, J., and D. Sauvageau. 2014. Bacteriophages as antimicrobial agents against bacterial contaminants in yeast fermentation processes. Biotechnol Biofuels 7:123. Bidnenko, E., S. D. Ehrlich, and M. C. Chopin. 1998. Lactococcus lactis phage operon coding for an endonuclease homologous to RuvC. Mol Microbiol 28:823-834. Biswas, B., S. Adhya, P. Washart, B. Paul, A. N. Trostel, B. Powell, R. Carlton, and C. R. Merril. 2002. Bacteriophage therapy rescues mice bacteremic from a clinical isolate of vancomycin-resistant Enterococcus faecium. Infect Immun 70:204-210.

169

Blower, T. R., T. J. Evans, R. Przybilski, P. C. Fineran, and G. P. Salmond. 2012. Viral evasion of a bacterial suicide system by RNA-based molecular mimicry enables infectious altruism. PLoS Genet 8:e1003023. Blower, T. R., F. L. Short, P. C. Fineran, and G. P. Salmond. 2012. Viral molecular mimicry circumvents abortive infection and suppresses bacterial suicide to make hosts permissive for replication. Bacteriophage 2:234-238. Bondy-Denomy, J., A. Pawluk, K. L. Maxwell, and A. R. Davidson. 2013. Bacteriophage genes that inactivate the CRISPR/Cas bacterial immune system. Nature 493:429-432. Borysowski, J., B. Weber-Dabrowska, and A. Gorski. 2006. Bacteriophage endolysins as a novel class of antibacterial agents. Exp Biol Med 231:366-377. Boudreau, M. A., J. F. Fisher, and S. Mobashery. 2012. Messenger functions of the bacterial cell wall-derived muropeptides. Biochemistry 51:2974-2990. Bowdish, D. M., D. J. Davidson, Y. E. Lau, K. Lee, M. G. Scott, and R. E. Hancock. 2005. Impact of LL-37 on anti-infective immunity. J Leukoc Biol 77:451-459. Braff, M. H., A. Bardan, V. Nizet, and R. L. Gallo. 2005. Cutaneous defense mechanisms by antimicrobial peptides. J Invest Dermatol 125:9-13. Brogden, K. A. 2005. Antimicrobial peptides: pore formers or metabolic inhibitors in bacteria? Nat Rev Microbiol 3:238-250. Brouns, S. J., M. M. Jore, M. Lundgren, E. R. Westra, R. J. Slijkhuis, A. P. Snijders, M. J. Dickman, K. S. Makarova, E. V. Koonin, and J. van der Oost. 2008. Small CRISPR RNAs guide antiviral defense in prokaryotes. Science 321:960-964. Bull, J. J., A. Jacobson, M. R. Badgett, and I. J. Molineux. 1998. Viral escape from antisense RNA. Mol Microbiol 28:835-846. Carmona-Ribeiro, A. M., and L. D. de Melo Carrasco. 2014. Novel formulations for antimicrobial peptides. Int J Mol Sci 15:18040-18083. Cerveny, K. E., A. DePaola, D. H. Duckworth, and P. A. Gulig. 2002. Phage therapy of local and systemic disease caused by Vibrio vulnificus in iron-dextran-treated mice. Infect Immun 70:6251-6262. Chan, B. K., and S. T. Abedon. 2012. Phage therapy pharmacology phage cocktails. Adv Appl Microbiol 78:1-23. Chan, B. K., S. T. Abedon, and C. Loc-Carrillo. 2013. Phage cocktails and the future of phage therapy. Future Microbiol 8:769-783. Chatterjee, S., and E. Rothenberg. 2012. Interaction of bacteriophage l with its E. coli receptor, LamB. Viruses 4:3162-3178. Clokie, M. R., A. D. Millard, A. V. Letarov, and S. Heaphy. 2011. Phages in nature. Bacteriophage 1:31-45. Cornelissen, A., P. J. Ceyssens, V. N. Krylov, J. P. Noben, G. Volckaert, and R. Lavigne. 2012. Identification of EPS-degrading activity within the tail spikes of the novel Pseudomonas putida phage AF. Virology 434:251-256. Courvalin, P. 2006. Antibiotic resistance: the pros and cons of probiotics. Dig Liver Dis 38 Suppl 2:S261-265. Cowen, L. E. 2008. The evolution of fungal drug resistance: modulating the trajectory from genotype to phenotype. Nat Rev Microbiol 6:187-198. Davies, J., and D. Davies. 2010. Origins and evolution of antibiotic resistance. Microbiol Mol Biol Rev 74:417-433. Deresinski, S. 2009. Bacteriophage therapy: exploiting smaller fleas. Clin Infect Dis 48:1096- 1101. Deutscher, S. L. 2010. Phage display in molecular imaging and diagnosis of cancer. Chem Rev 110:3196-3211.

170

Deveau, H., R. Barrangou, J. E. Garneau, J. Labonte, C. Fremaux, P. Boyaval, D. A. Romero, P. Horvath, and S. Moineau. 2008. Phage response to CRISPR-encoded resistance in Streptococcus thermophilus. J Bacteriol 190:1390-1400. Domingues, S., A. Chopin, S. D. Ehrlich, and M. C. Chopin. 2004. A phage protein confers resistance to the lactococcal abortive infection mechanism AbiP. J Bacteriol 186:3278- 3281. Dubreuil, J. D. 2013. Antibacterial and antidiarrheal activities of plant products against enterotoxinogenic Escherichia coli. Toxins 5:2009-2041. Dupuis, M. E., M. Villion, A. H. Magadan, and S. Moineau. 2013. CRISPR-Cas and restriction-modification systems are compatible and increase phage resistance. Nat Commun 4:2087. Durmaz, E., and T. R. Klaenhammer. 2007. Abortive phage resistance mechanism AbiZ speeds the lysis clock to cause premature lysis of phage-infected Lactococcus lactis. J Bacteriol 189:1417-1425. Durmaz, E., S. M. Madsen, H. Israelsen, and T. R. Klaenhammer. 2002. Lactococcus lactis lytic bacteriophages of the P335 group are inhibited by overexpression of a truncated CI repressor. J Bacteriol 184:6532-6544. Falconer, S. B., T. L. Czarny, and E. D. Brown. 2011. Antibiotics as probes of biological complexity. Nat Chem Biol 7:415-423. Fischetti, V. A., D. Nelson, and R. Schuch. 2006. Reinventing phage therapy: are the parts greater than the sum? Nat Biotechnol 24:1508-1511. Fox, J. L. 2013. Anthrax drug first antibacterial mAb to win approval. Nat Biotechnol 31:8. Fujimori, S., K. Gudis, K. Mitsui, T. Seo, M. Yonezawa, S. Tanaka, A. Tatsuguchi, and C. Sakamoto. 2009. A randomized controlled trial on the efficacy of synbiotic versus probiotic or prebiotic treatment to improve the quality of life in patients with ulcerative colitis. Nutrition 25:520-525. Ganju, L., D. Karan, S. Chanda, K. K. Srivastava, R. C. Sawhney, and W. Selvamurthy. 2003. Immunomodulatory effects of agents of plant origin. Biomed Pharmacother 57:296-300. Garneau, J. E., and S. Moineau. 2001. CRISPR/Cas system and resistance to bacteriophage infection. In: eLS. John Wiley & Sons, Ltd. Goeders, N., and L. Van Melderen. 2014. Biodegradable gelatin-chitosan films incorporated with essential oils as antimicrobial agents for fish preservation. Food Microbiol 27:889- 896. Gomez-Estaca, J., A. Lopez de Lacey, M. E. Lopez-Caballero, M. C. Gomez-Guillen, and P. Montero. 2010. Biodegradable gelatin-chitosan films incorporated with essential oils as antimicrobial agents for fish preservation. Food Microbiol 27:889-896. Grimoud, J., H. Durand, C. Courtin, P. Monsan, F. Ouarne, V. Theodorou, and C. Roques. 2010. In vitro screening of probiotic lactic acid bacteria and prebiotic glucooligosaccharides to select effective synbiotics. Anaerobe 16:493-500. Gu, J., X. Liu, Y. Li, W. Han, L. Lei, Y. Yang, H. Zhao, Y. Gao, J. Song, R. Lu, C. Sun, and X. Feng. 2012. A method for generation phage cocktail with great therapeutic potential. PLoS One 7:e31698. Guo, Y., C. Quiroga, Q. Chen, M. J. McAnulty, M. J. Benedik, T. K. Wood, and X. Wang. 2014. RalR (a DNase) and RalA (a small RNA) form a type I toxin-antitoxin system in Escherichia coli. Nucleic Acids Res 42:6448-6462. Haaber, J., J. E. Samson, S. J. Labrie, V. Campanacci, C. Cambillau, S. Moineau, and K. Hammer. 2010. Lactococcal abortive infection protein AbiV interacts directly with the

171

phage protein SaV and prevents translation of phage proteins. Appl Environ Microbiol 76:7085-7092. Haba, E., S. Bouhdid, N. Torrego-Solana, A. M. Marqués, M. J. Espuny, M. J. García- Celma, and A. Manresa. 2014. Rhamnolipids as emulsifying agents for essential oil formulations: antimicrobial effect against Candida albicans and methicillin-resistant Staphylococcus aureus. Int J Pharm 476:134-141. Hancock, R. E., A. Nijnik, and D. J. Philpott. 2012. Modulating immunity as a therapy for bacterial infections. Nat Rev Microbiol 10:243-254. Hancock, R. E., and H. G. Sahl. 2006. Antimicrobial and host-defense peptides as new anti- infective therapeutic strategies. Nat Biotechnol 24:1551-1557. Hemarajata, P., and J. Versalovic. 2013. Effects of probiotics on gut microbiota: mechanisms of intestinal immunomodulation and neuromodulation. Therap Adv Gastroenterol 6:39- 51. Henry, M., and L. Debarbieux. 2012. Tools from viruses: bacteriophage successes and beyond. Virology 434:151-161. Jenssen, H., P. Hamill, and R. E. Hancock. 2006. Peptide antimicrobial agents. Clin Microbiol Rev 19:491-511. Jiang, X. R., A. Song, S. Bergelson, T. Arroll, B. Parekh, K. May, S. Chung, R. Strouse, A. Mire-Sluis, and M. Schenerman. 2011. Advances in the assessment and control of the effector functions of therapeutic antibodies. Nat Rev Drug Discov 10:101-111. Jikia, D., N. Chkhaidze, E. Imedashvili, I. Mgaloblishvili, G. Tsitlanadze, R. Katsarava, J. Glenn Morris, Jr., and A. Sulakvelidze. 2005. The use of a novel biodegradable preparation capable of the sustained release of bacteriophages and ciprofloxacin, in the complex treatment of multidrug-resistant Staphylococcus aureus-infected local radiation injuries caused by exposure to Sr90. Clin Exp Dermatol 30:23-26. Jung, E., N. K. Lee, S. K. Kang, S. H. Choi, D. Kim, K. Park, K. Choi, Y. J. Choi, and D. H. Jung. 2012. Identification of tissue-specific targeting peptide. J Comput Aided Mol Des 26:1267-1275. Kaufmann, S. H., and U. E. Schaible. 2005. Antigen presentation and recognition in bacterial infections. Curr Opin Immunol 17:79-87. Kawai, T., and S. Akira. 2010. The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nat Immunol 11:373-384. Kotsovilis, S., and E. Andreakos. 2014. Therapeutic human monoclonal antibodies in inflammatory diseases. Methods Mol Biol 1060:37-59. Kotzampassi, K., and E. J. Giamarellos-Bourboulis. 2012. Probiotics for infectious diseases: more drugs, less dietary supplementation. Int J Antimicrob Agents 40:288-296. Kruger, D. H., and T. A. Bickle. 1983. Bacteriophage survival: multiple mechanisms for avoiding the deoxyribonucleic acid restriction systems of their hosts. Microbiol Rev 47:345-360. Kummerer, K., and A. Henninger. 2003. Promoting resistance by the emission of antibiotics from hospitals and households into effluent. Clin Microbiol Infect 9:1203-1214. Kummerfeldt, C. E. 2014. Raxibacumab: potential role in the treatment of inhalational anthrax. Infect Drug Resist 7:101-109. Kurekci, C., J. Padmanabha, S. L. Bishop-Hurley, E. Hassan, R. A. Al Jassim, and C. S. McSweeney. 2013. Antimicrobial activity of essential oils and five terpenoid compounds against Campylobacter jejuni in pure and mixed culture experiments. Int J Food Microbiol 166:450-457. Labrie, S. J., J. E. Samson, and S. Moineau. 2010. Bacteriophage resistance mechanisms. Nat Rev Microbiol 8:317-327.

172

Langeveld, W. T., E. J. Veldhuizen, and S. A. Burt. 2014. Synergy between essential oil components and antibiotics: a review. Crit Rev Microbiol 40:76-94. Larimer, B. M., and S. L. Deutscher. 2014. Development of a peptide by phage display for SPECT imaging of resistance-susceptible breast cancer. Am J Nucl Med Mol Imaging 4:435-447. LaRocca, T. J., D. J. Holthausen, C. Hsieh, C. Renken, C. A. Mannella, and J. L. Benach. 2009. The bactericidal effect of a complement-independent antibody is osmolytic and specific to Borrelia. Proc Natl Acad Sci U S A 106:10752-10757. Lim, B. N., G. J. Tye, Y. S. Choong, E. B. Ong, A. Ismail, and T. S. Lim. 2014. Principles and application of antibody libraries for infectious diseases. Biotechnol Lett 36:2381- 2392. Liu, B., and M. Pop. 2009. ARDB--antibiotic resistance genes database. Nucleic Acids Res 37:D443-447. Liu, W., S. L. Dong, F. Xu, X. Q. Wang, T. R. Withers, H. D. Yu, and X. Wang. 2013. Effect of intracellular expression of antimicrobial peptide LL-37 on growth of Escherichia coli strain TOP10 under aerobic and anaerobic conditions. Antimicrob Agents Chemother 57:4707-4716. Lu, M. J., and U. Henning. 1994. Superinfection exclusion by T-even-type coliphages. Trends Microbiol 2:137-139. Lu, M. J., Y. D. Stierhof, and U. Henning. 1993. Location and unusual membrane topology of the immunity protein of the Escherichia coli phage T4. J Virol 67:4905-4913. Lu, T. K., and M. S. Koeris. 2011. The next generation of bacteriophage therapy. Curr Opin Microbiol 14:524-531. Ly-Chatain, M. H. 2014. The factors affecting effectiveness of treatment in phages therapy. Front Microbiol 5:51. Mahima, A. Rahal, R. Deb, S. K. Latheef, H. Abdul Samad, R. Tiwari, A. K. Verma, A. Kumar, and K. Dhama. 2012. Immunomodulatory and therapeutic potentials of herbal, traditional/indigenous and ethnoveterinary medicines. Pak J Biol Sci 15:754- 774. Mahony, J., S. McGrath, G. F. Fitzgerald, and D. van Sinderen. 2008. Identification and characterization of lactococcal-prophage-carried superinfection exclusion genes. Appl Environ Microbiol 74:6206-6215. Mansour, S. C., O. M. Pena, and R. E. Hancock. 2014. Host defense peptides: front-line immunomodulators. Trends Immunol 35:443-450. Marasco, W. A., and J. Sui. 2007. The growth and potential of human antiviral monoclonal antibody therapeutics. Nat Biotechnol 25:1421-1434. Matsuzaki, S., M. Rashel, J. Uchiyama, S. Sakurai, T. Ujihara, M. Kuroda, M. Ikeuchi, T. Tani, M. Fujieda, H. Wakiguchi, and S. Imai. 2005. Bacteriophage therapy: a revitalized therapy against bacterial infectious diseases. J Infect Chemother 11:211-219. Monk, A. B., C. D. Rees, P. Barrow, S. Hagens, and D. R. Harper. 2010. Bacteriophage applications: where are we now? Lett Appl Microbiol 51:363-369. Nakai, T., and S. C. Park. 2002. Bacteriophage therapy of infectious diseases in aquaculture. Res Microbiol 153:13-18. Nuding, S., T. Frasch, M. Schaller, E. F. Stange, and L. T. Zabel. 2014. Synergistic effects of antimicrobial peptides and antibiotics against Clostridium difficile. Antimicrob Agents Chemother 58:5719-5725. Okorochenkov, S. A., G. A. Zheltukhina, and V. E. Nebol'sin. 2012. Antimicrobial peptides: mode of action and perspectives of practical application. Biomed Khim 58:131-143.

173

Oleksiewicz, M. B., G. Nagy, and E. Nagy. 2012. Anti-bacterial monoclonal antibodies: back to the future? Arch Biochem Biophys 526:124-131. Otsuka, Y., and T. Yonesaki. 2012. Dmd of bacteriophage T4 functions as an antitoxin against Escherichia coli LsoA and RnlA toxins. Mol Microbiol 83:669-681. Oudhuis, G. J., D. C. Bergmans, and A. Verbon. 2011. Probiotics for prevention of nosocomial infections: efficacy and adverse effects. Curr Opin Crit Care 17:487-492. Parisien, A., B. Allain, J. Zhang, R. Mandeville, and C. Q. Lan. 2008. Novel alternatives to antibiotics: bacteriophages, bacterial cell wall hydrolases, and antimicrobial peptides. J Appl Microbiol 104:1-13. Patel, A., N. Shah, and J. B. Prajapati. 2014. Clinical application of probiotics in the treatment of Helicobacter pylori infection--a brief review. J Microbiol Immunol Infect 47:429-437. Petrenko, V. A., and P. K. Jayanna. 2014. Phage protein-targeted cancer nanomedicines. FEBS Lett 588:341-349. Plummer, S. F., I. Garaiova, T. Sarvotham, S. L. Cottrell, S. Le Scouiller, M. A. Weaver, J. Tang, P. Dee, and J. Hunter. 2005. Effects of probiotics on the composition of the intestinal microbiota following antibiotic therapy. Int J Antimicrob Agents 26:69-74. Ram, G., J. Chen, K. Kumar, H. F. Ross, C. Ubeda, P. K. Damle, K. D. Lane, J. R. Penades, G. E. Christie, and R. P. Novick. 2012. Staphylococcal pathogenicity island interference with helper phage reproduction is a paradigm of molecular parasitism. Proc Natl Acad Sci U S A 109:16300-16305. Ravin, V., L. Raisanen, and T. Alatossava. 2002. A conserved C-terminal region in Gp71 of the small isometric-head phage LL-H and ORF474 of the prolate-head phage JCL1032 is implicated in specificity of adsorption of phage to its host, Lactobacillus delbrueckii. J Bacteriol 184:2455-2459. Rayes, N., D. Seehofer, T. Theruvath, M. Mogl, J. M. Langrehr, N. C. Nussler, S. Bengmark, and P. Neuhaus. 2007. Effect of enteral nutrition and synbiotics on bacterial infection rates after pylorus-preserving pancreatoduodenectomy: a randomized, double-blind trial. Ann Surg 246:36-41. Rhoads, D. D., R. D. Wolcott, M. A. Kuskowski, B. M. Wolcott, L. S. Ward, and A. Sulakvelidze. 2009. Bacteriophage therapy of venous leg ulcers in humans: results of a phase I safety trial. J Wound Care 18:237-238. Samson, J. E., A. H. Magadan, M. Sabri, and S. Moineau. 2013. Revenge of the phages: defeating bacterial defences. Nat Rev Microbiol 11:675-687. Schechner, V., E. Temkin, S. Harbarth, Y. Carmeli, and M. J. Schwaber. 2013. Epidemiological interpretation of studies examining the effect of antibiotic usage on resistance. Clin Microbiol Rev 26:289-307. Scheffler, R. J., S. Colmer, H. Tynan, A. L. Demain, and V. P. Gullo. 2013. Antimicrobials, drug discovery, and genome mining. Appl Microbiol Biotechnol 97:969-978. Scholtens, P. A., D. A. Goossens, and A. Staiano. 2014. Stool characteristics of infants receiving short-chain galacto-oligosaccharides and long-chain fructo-oligosaccharides: a review. World J Gastroenterol 20:13446-13452. Schulz zur Wiesch, P., J. Engelstadter, and S. Bonhoeffer. 2010. Compensation of fitness costs and reversibility of antibiotic resistance mutations. Antimicrob Agents Chemother 54:2085-2095. Scott, A. M., J. P. Allison, and J. D. Wolchok. 2012. Monoclonal antibodies in cancer therapy. Cancer Immun 12:14.

174

Shimizu, K., H. Ogura, T. Asahara, K. Nomoto, M. Morotomi, O. Tasaki, A. Matsushima, Y. Kuwagata, T. Shimazu, and H. Sugimoto. 2013. Probiotic/synbiotic therapy for treating critically ill patients from a gut microbiota perspective. Dig Dis Sci 58:23-32. Sillankorva, S. M., H. Oliveira, and J. Azeredo. 2012. Bacteriophages and their role in food safety. Int J Microbiol 2012:863945. Singer, R. S., M. P. Ward, and G. Maldonado. 2006. Can landscape ecology untangle the complexity of antibiotic resistance? Nat Rev Microbiol 4:943-952. Skurnik, M., M. Pajunen, and S. Kiljunen. 2007. Biotechnological challenges of phage therapy. Biotechnol Lett 29:995-1003. Slavcev, R. A., and S. Hayes. 2003. Stationary phase-like properties of the bacteriophage lambda Rex exclusion phenotype. Mol Genet Genomics 269:40-48. Smeianov, V., K. Scott, and G. Reid. 2000. Activity of cecropin P1 and FA-LL-37 against urogenital microflora. Microbes Infect 2:773-777. Snyder, L. 1995 Phage-exclusion enzymes: a bonanza of biochemical and cell biology reagents? Mol Microbiol 15:415-420. Sorek, R., V. Kunin, and P. Hugenholtz. 2008. CRISPR--a widespread system that provides acquired resistance against phages in bacteria and archaea. Nat Rev Microbiol 6:181- 186. Stern, A., and R. Sorek. 2011. The phage-host arms race: shaping the evolution of microbes. Bioessays 33:43-51. Strauch, E., H. Kaspar, C. Schaudinn, C. Damasko, A. Konietzny, P. Dersch, M. Skurnik, and B. Appel. 2003. Analysis of enterocoliticin, a phage tail-like bacteriocin. Adv Exp Med Biol 529:249-251. Sturino, J. M., and T. R. Klaenhammer. 2006. Engineered bacteriophage-defence systems in bioprocessing. Nat Rev Microbiol 4:395-404. Sulakvelidze, A., Z. Alavidze, and J. G. Morris, Jr. 2001. Bacteriophage therapy. Antimicrob Agents Chemother 45:649-659. Tiwari, R., K. Dhama, A. Kumar, A. Rahal, and S. Kapoor. 2014. Bacteriophage therapy for safeguarding animal and human health: a review. Pak J Biol Sci 17:301-315. Tock, M. R., and D. T. Dryden. 2005. The biology of restriction and anti-restriction. Curr Opin Microbiol 8:466-472. Tohidkia, M. R., J. Barar, F. Asadi, and Y. Omidi. 2012. Molecular considerations for development of phage antibody libraries. J Drug Target 20:195-208. Trepel, M., C. A. Stoneham, H. Eleftherohorinou, N. D. Mazarakis, R. Pasqualini, W. Arap, and A. Hajitou. 2009. A heterotypic bystander effect for tumor cell killing after adeno-associated virus/phage-mediated, vascular-targeted suicide gene transfer. Mol Cancer Ther 8:2383-2391. Ulevitch, R. J. 2004. Therapeutics targeting the innate immune system. Nat Rev Immunol 4:512-520. Veldhuizen, E. J., V. A. Schneider, H. Agustiandari, A. van Dijk, J. L. Tjeerdsma-van Bokhoven, F. J. Bikker, and H. P. Haagsman. 2014. Antimicrobial and immunomodulatory activities of PR-39 derived peptides. PLoS One 9:e95939. Villion, M., and S. Moineau. 2013. Virology: phages hijack a host's defence. Nature 494:433- 434. Vunnam, S., P. Juvvadi, and R. B. Merrifield. 1997. Synthesis and antibacterial action of cecropin and proline-arginine-rich peptides from pig intestine. J Pept Res 49:59-66. Walkinshaw, M. D., P. Taylor, S. S. Sturrock, C. Atanasiu, T. Berge, R. M. Henderson, J. M. Edwardson, and D. T. Dryden. 2002. Structure of Ocr from bacteriophage T7, a protein that mimics B-form DNA. Mol Cell 9:187-194.

175

Wang, T., W. C. Hartner, J. W. Gillespie, K. P. Praveen, S. Yang, L. A. Mei, V. A. Petrenko, and V. P. Torchilin. 2014. Enhanced tumor delivery and antitumor activity in vivo of liposomal doxorubicin modified with MCF-7-specific phage fusion protein. Nanomedicine 10:421-430. Warrener, P., R. Varkey, J. C. Bonnell, A. DiGiandomenico, M. Camara, K. Cook, L. Peng, J. Zha, P. Chowdury, B. Sellman, and C. K. Stover. 2014. A novel anti-PcrV antibody providing enhanced protection against Pseudomonas aeruginosa in multiple animal infection models. Antimicrob Agents Chemother 58:4384-4391. Westwater, C., L. M. Kasman, D. A. Schofield, P. A. Werner, J. W. Dolan, M. G. Schmidt, and J. S. Norris. 2003. Use of genetically engineered phage to deliver antimicrobial agents to bacteria: an alternative therapy for treatment of bacterial infections. Antimicrob Agents Chemother 47:1301-1307. Wright, A., C. H. Hawkins, E. E. Anggard, and D. R. Harper. 2009. A controlled clinical trial of a therapeutic bacteriophage preparation in chronic otitis due to antibiotic- resistant Pseudomonas aeruginosa; a preliminary report of efficacy. Clin Otolaryngol 34:349-357. Wright, G. D. 2007. The antibiotic resistome: the nexus of chemical and genetic diversity. Nat Rev Microbiol 5:175-186. Yao, S., Y. Zhu, and L. Chen. 2013. Advances in targeting cell surface signalling molecules for immune modulation. Nat Rev Drug Discov 12:130-146. Yaung, S. J., K. M. Esvelt, and G. M. Church. 2014. CRISPR/Cas9-mediated phage resistance is not impeded by the DNA modifications of phage T4. PLoS One 9:e98811. Zuany-Amorim, C., J. Hastewell, and C. Walker. 2002. Toll-like receptors as potential therapeutic targets for multiple diseases. Nat Rev Drug Discov 1:797-807.

176