Molecular Interactions Between Maize Fine Streak Virus and Insect Vector

Home , Aedes hensilli, Graminella, Graminella nigrifrons, Streak (moth)

Molecular interactions between Maize fine streak virus and insect vector,

Graminella nigrifrons

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

Yuting Chen, M.S.

Graduate Program in Entomology

The Ohio State University

2013

Dissertation Committee:

Dr. Andrew P. Michel, Advisor

Dr. David L. Denlinger

Dr. Omprakash Mittapalli

Dr. Margaret G. Redinbaugh

Copyrighted by

Yuting Chen

2013

Abstract

Phytophagous hemipteran insects are suitable vectors for plant viruses, such as plant-infecting rhabdoviruses, which have caused severe yield loss. These single-stranded negative RNA viruses are specifically transmitted by hemipteran insects in a circulative propagative manner. My research investigated the vector-virus interactions using the black-faced leafhopper Graminella nigrifrons and an emerging plant-infecting rhabdovirus, Maize fine streak virus (MFSV) from molecular, genetic and ecological perspectives.

G. nigrifrons is the only identified vector for MFSV, and vector competence varies within laboratory populations. G. nigrifrons can be experimentally separated into three types based on their ability to transmit MFSV: transmitters, which can transmit MFSV to new host plants; acquirers, which are positive MFSV, but do not transmit the virus; and non-acquirers, which are neither positive for nor able to transmit the virus. My research focused on how antiviral immunity responds to MFSV challenge among different types of G. nigrifrons, which was proposed to associate with vector competence.

The transcriptome of G. nigrifrons was first characterized, and a significant similarity of immune response transcripts was discovered with other well-characterized insects. Expression of ten transcripts that putatively functioned in insect RNAi and humoral pathways was evaluated among three types of G. nigrifrons using RT-qPCR: Ars-2, Dcr-2, Ago-2, four PGRPs (SB1, SD, LB and LC), Toll,

ii spaetzle and defensin. Overall down regulation was seen in MFSV challenged leafhoppers. In particular, Ars-2, Dcr-2 and Ago-2 were significantly suppressed in acquirers and non-acquirers compared to transmitters or control (MFSV unchallenged) leafhoppers. Expression of three PGRPs (SB1, SD, and LC) and Toll were similar in all MFSV challenged leafhoppers but was significantly suppressed compared to control. Genetic variation of RT-qPCR evaluated transcirpts was analyzed among three types of G. nigrifrons. A non-synonymous SNP in the

MFSV-N gene was identified only in transmitters. However, there was no correlation between differentially expressed immune transcripts and the presence of putative synonymous/non-synonymous SNPs.

RNAi was successfully developed to investigate the functions of PGRP-LC and

Dcr-2 related to virus acquisition and transmission. Expression of PGRP-LC and

Dcr-2 was reduced to 30% and 20% of levels in control leafhoppers respectively, after

14 and 22 dpi of dsRNAs. The reduction in expression was equally effective for both nymphs and adults. There was no effect on MFSV transmission or acquisition between non-injected or dsRNAs for GFP and PGRP-LC or Dcr-2 injected leafhoppers, however, acquisition was slightly higher in Dcr-2 silenced leafhoppers.

Silencing PGRP-LC resulted in 90% mortality before MFSV could be transmitted. A significantly higher number of ‘abnormally molted’ leafhoppers were observed after silencing PGRP-LC.

Higher temperature and light intensity tended to increase MFSV transmission during 1-week inoculation access period. There was no difference of transmission between insect genders under different environmental treatments.

To conclude, my research revealed complex vector-virus-plant interactions at the molecular, genetic and environmental levels. Successful use of RNAi to decrease G.

iii nigrifrons transcript levels may provide possible targets of RNAi-based pest management.

Acknowledgments

I especially would like to thank my advisor, Andy Michel, for his endless support and help with my study and research. Any growth, improvement or award from my research and even my English, could not have been achieved without his patient and kind guidance. I appreciate his allowing me do the research that I am really interested in. He is a truly wonderful advisor, and I count myself lucky to have been his student!

I would like to thank my advisory committee members, David Denlinger,

Omprakash Mittapalli and Margaret (Peg) Redinbaugh for their advice and support to this project. I really enjoyed our discussion about this project during every meeting.

I appreciate the helpful and professional advice from Luis Canas regarding my statistical analysis. I appreciate Dan Herms and Larry Phelan for teaching the classes

“Nature and Practice of Science” and “Journal Club”, from which I learned some of the most important things in my academic career. I appreciate Peter Piermarini and

Nuris Acosta for helping me develop the RNAi technique using micro-injection. I also appreciate the helpful bioinformatics expertise of Bryan Cassone, Asela Wijeratne,

Saranga Wijeratne and Xiaodong Bai. I also wish to thank Feng Qu and Lucy Stewart for their constructive advice during our group meeting.

I am very grateful to Jane Todd for teaching me, from the very beginning, how to rear and maintain the G. nigrifrons colony in the laboratory and transfer MFSV using

G. nigrifrons. Without these basic techniques, my project could not have succeeded. I enjoyed our discussion about research, and I also appreciate that she shared her

v limited space in the growth chamber with me. I appreciate Kristen Willie for providing me MFSV antiserum and other reagents for my virus experiment. I also wish to thank Lee Wilson, Bob James and Judy Smith for arranging the greenhouse and growth chamber space for me in Selby and Thorne Hall. I thank Brenda Franks,

Lori Jones and Shirley Holmes for their administrative support. I also thank my colleagues in both Andy and Peg’s lab for their technical help and friendship.

Finally, I deeply appreciate the OSU Entomology Department for providing me this opportunity to study here. This department is such a wonderful family, which has made me feel at home in the US. The endless support received from other students and faculty helped make a significant improvement in not only my English, but also my study and research, and their friendship helped me get through every difficulty. I consider myself extremely fortunate to have been a part of this department.

This project was partially funded by The OARDC Research Enhancement

Competitive Grants Program.

Vita

2001 − 2005……………………………… .. B.S. Plant Protection, China Agricultural

University

2005 − 2008………………………………...M.S. Plant Pathology, China Agricultural

University

2009 to present ...... Entomology, The Ohio State University

Publications

Chen, Y., Cassone, B.J., Bai, X., Redinbaugh, M.G., Michel, A.P., 2012.

Transcriptome of the plant virus vector Graminella nigrifrons, and the molecular

interactions of Maize fine streak rhabdovirus transmission. Plos One 7, e40613

Cheng, Y.-Q., Liu, Z.-M., Xu, J., Zhou, T., Wang, M., Chen, Y.-T., Li, H.-F., Fan,

Z.-F., 2008. HC-Pro protein of sugar cane mosaic virus interacts specifically with

maize ferredoxin-5 in vitro and in planta. Journal of General Virology 89, 2046-2054.

Fields of Study

Major Field: Entomology

vii

Table of Contents

Abstract ...... ii

Acknowledgments...... v

Vita ...... vii

Table of Contents ...... viii

List of Figures ...... x

List of Tables ...... xi

Chapters:

1. Introduction ...... 1 Biology of G. nigrifrons ...... 2 Biology of plant-infecting rhabdoviruses ...... 4 Interaction between plant-infecting rhabdoviruses and insect vector ...... 6 Interaction between MFSV and Graminella nigrifrons ...... 8 References ...... 10

2. Transcriptome of the plant virus vector Graminella nigrifrons, and the molecular interactions of Maize fine streak virus transmission ...... 18 Abstract ...... 18 Introduction ...... 19 Methods and Materials ...... 23 Results and Discussion ...... 28 References ...... 35

3. Differential expression of immune response transcripts in Graminella nigrifrons against Maize fine streak virus challenge ...... 46 Abstract ...... 46 Introduction ...... 47 Methods and Materials ...... 50 Results ...... 54

viii Discussion ...... 56 References ...... 61

4. RNAi mediated silencing of immune transcripts in Graminella nigrifrons ...... 70 Abstract ...... 70 Introduction ...... 71 Methods and Materials ...... 74 Results ...... 77 Discussion ...... 79 References ...... 84

5. Effects of temperature and light intensity on Maize fine streak virus transmission by Graminella nigrifrons ...... 96 Abstract ...... 96 Introduction ...... 96 Methods and Materials ...... 99 Results ...... 102 Discussion ...... 103 References ...... 109

6. Summary and future work ...... 124

References ...... 129

List of Figures

Figure 2.1: Gene ontology (GO) terms for G. nigrifrons EST (contigs and singletons)...... 41

Figure 2.2: Comparison of reference genes for G. nigrifrons using geNorm...... 42

Figure 2.3: Expression profiles of transcripts involved in G. nigrifrons immune response detected by RT-qPCR...... 43

Figure 3.1: Expression of immune response transcripts among three types of G. nigrifrons evaluated by RT-qPCR...... 65

Figure 4.1: Effect of RNAi on target transcript expression...... 88

Figure 4.2: Mortality (%) of leafhoppers after dsRNAs injection maintained on MFSV-symptomatic maize...... 89

Figure 4.3: Mortality (%) of leafhoppers after dsRNAs injection maintained on healthy maize...... 90

Figure 4.4: Abnormal eclosion of leafhoppers injected with different dsRNAs or no injection and maintained on either MFSV-symptomatic or healthy maize...... 91

Figure 4.5: Effects of RNAi on MFSV acquisition...... 92

Figure 5.1: Mortality (%) of G. nigrifrons and test plants after 4-week PADP under different temperature-light intensity treatments...... 121

Figure 5.2: MFSV transmission detected after 4-week PADP under different temperature-light intensity treatments...... 122

Figure 5.3: Relative expression of MFSV N and 3 in G. nigrifrons transmitters under different environmental treatments evaluated by RT-qPCR...... 123

List of Tables

Table 2.1: Primer sequences, efficiencies and correlation of potential RT-qPCR reference genes for G. nigrifrons...... 44

Table 2.2: Primer sequences and efficiencies of candidate genes evaluated for differential expression among MFSV transmitters and control G. nigrifrons (RT-qPCR)...... 45

Table 3.1: Primer sequences and efficiencies of candidate transcripts of G. nigrifrons evaluated by RT-qPCR...... 66

Table 3.2: Primer sequences, annealing temperatures and extension times for amplifying 14 transcripts...... 67

Table 3.3 Reads mapping of 15 G. nigrifrons individuals sequenced using Ion Torrent...... 68

Table 3.4: SNPs detection from 15 individuals among three types of G. nigrifrons. .. 69

Table 4.1: Primer sequences, annealing temperatures and extension times for amplifying transcript PGRP-LC, Dcr-2 and GFP (control)...... 93

Table 4.2: Primer sequences and efficiencies of transcripts Dcr-2 and PGRP-LC evaluated by RT-qPCR for RNAi verification...... 94

Table 4.3: Multivariate repeated measure analysis of mortality of leafhoppers...... 95

CHAPTER 1

Introduction

Phytophagous hemipteran insects such as white flies, planthoppers, aphids and leafhoppers are notorious as agricultural pests on economically important crops. Due to their unique piercing-sucking mouthparts, hemipteran insects specifically feed on phloem or xylem of host plants, which affects the growth and development of host plants. More importantly, these pests also transmit devastating diseases among their host plants, especially viral diseases that cause severe yield loss (Bos, 1982;

Brewbaker, 1975).

Arthropod-borne viruses (arboviruses) are those viruses transmitted by arthropod vectors, particularly insects. While vector-borne zoonotic arboviruses such as West Nile virus and Dengue virus are well studied (Ahmed et al., 2009), less research has focused on plant-infecting arboviruses. In fact, many serious plant diseases are caused by plant-infecting arboviruses, which are specifically transmitted by hemipteran insects within Aphididae, Delphacidae and Cicadellidae (Ammar and

Nault, 2002; Nault, 1997). For example, planthopper Peregrinus maidis (Hemipetera:

Delphacidae) transmitted Maize mosaic virus (MMV), which is a plant-infecting rhabdovirus (Rhabdoviridae, Nucleorhabdovirus) that infects different susceptible maize. First discovered in 1914, this virus has caused severe corn disease, which has resulted in up to 100% yield loss (Brewbaker, 1975; Falk and Tsai, 1985; Jackson et al., 2005; Kunkel, 1921; Redinbaugh and Hogenhout, 2005). Understanding the interactions among the disease triangle (host plant-viral pathogen-vector), as well as

1 the effects of environmental factors on plant disease spread are essential to control viral diseases, especially emerging viral diseases.

The black-faced leafhopper, Graminella nigrifrons (Forbes) (Hemiptera:

Cicadellidae), is an important insect vector for Maize chlorotic dwarf virus (MCDV)

(Choudhury and Rosenkranz, 1983; Gordon and Nault, 1977; Nault et al., 1980). In

1999, Georgia, USA, an emerging plant-infecting nucleorhabdovirus was discovered and named Maize fine streak virus (MFSV). This virus was horizontally transmitted by G. nigrifrons in a persistent propagative manner, which indicates that replication of

MFSV occurs within G. nigrifrons, and that transmitters are able to transmit MFSV to other host plants during the remaining of their life span (Ammar et al., 2009). This study focused on the interactions between the G. nigrifrons and MFSV as well as the molecular mechanisms of vector competence. The results provided important information to the study of virus-vector-plant interactions, and advanced our understanding of the insect immune response against virus infection and the potential for insect and viral disease management.

Biology of G. nigrifrons

G. nigrifrons is one of the most common and abundant leafhoppers widely distributed in 35 states of the US, Canada and Caribbean (Stoner and Gustin, 1967).

This leafhopper is slender and elongate, 2.5-4.0 mm long, characterized by unmarked to heavily marked black face (Kramer, 1967). Under the laboratory conditions (24°C,

14-hour photoperiod), the average egg stage of G. nigrifrons is 10 days. Most of newly hatched G. nigrifrons nymphs develop to adults in an average of 22-days with

5 nymphal instars. Female adults live about 30 days, the average number of eggs oviposited by each female is 16, and most of eggs are oviposited in the mesophyll of

2 leaves within the first 2 weeks after mating (Larsen et al., 1990; Sedlacek et al., 1990;

Stoner and Gustin, 1967). The development rate of males is 1.2 days faster than females, and temperature is a key factor affecting development rate of both males and females. With increased temperature, the development rate accelerates, shortening the development time of egg to adult. However, heavier and larger adults are more common at lower temperatures (Larsen et al., 1990).

G. nigrifrons can feed on a broad array of host plants, such as annual oats, rice, perennial rye grass and johnsongrass (Boyd and Pitre, 1969). The mean development time of G. nigrifrons was not significantly affected by different host plants at the same laboratory conditions. However, at different temperatures, G. nigrifrons showed a preference of plants for development and overwintering (Larsen et al., 1990;

Sedlacek et al., 1990). For example, johnsongrass or other perennial plants are preferred developmental hosts in the early spring, then G. nigrifrons move to annual hosts such as oats and maize in midsummer (Larsen et al., 1990), with oats as a preferred overwintering host plant (Boyd and Pitre, 1968).

A field study indicated at least three generations of G. nigrifrons occurred in the northern part of Mississippi, and the first generation was the most destructive to young maize seedlings (Boyd and Pitre, 1968; Sedlacek and Freytag, 1986). Diapause was not observed in any life stage of G. nigrifrons (Boyd and Pitre, 1968). Both G. nigrifrons adults and eggs survived winter temperatures on host plants such as grasses and grain crops in northern Mississippi (Boyd and Pitre, 1968). Adults could not overwinter in central Kentucky (Sedlacek et al., 1990), but eggs were suggested as overwintering stage in northern Ohio (Larsen et al., 1990). Sedlacek et al, (1990) hypothesized that adults caught in the field in central Kentucky from early May through early June immigrated from southern areas (Sedlacek et al., 1990). The

3 majority of G. nigrifrons adults were caught in the late July and early August using sticky and aerial suction traps in Ohio field, and these leafhoppers were also suggested to be migrants (Teraguchi, 1986).

Biology of plant-infecting rhabdoviruses

Rhabdoviridae is one of the four families in the order of Mononegavirales.

Members within this order are linear, non-segmented, negative single-stranded (–ss)

RNA viruses. There are 9 identified genera in the family Rhabdoviridae (ICTV,

2012), and only two genera infect plants: Cytorhabdovirus and Nucleorhabdovirus

(Jackson et al., 2005; Redinbaugh and Hogenhout, 2005).

Plant-infecting rhabdoviruses have bacilliform morphology, and the virus particle contains three layers. The –ssRNA is encapsidated by nucleocapsid protein and associates with viral phosphoprotein and polymerase to form the inner core. This core is surrounded by a host-derived lipid bilayer membrane. The matrix proteins are embedded in this lipid layer, and the glycoproteins protrude from this layer to form a spike-like surface on the outer layer (Jackson et al., 2005; Redinbaugh and

Hogenhout, 2005).

Vertebrate-infecting rhabdoviruses such as Vesicular stomatitis virus (VSV) contain 5 consensus open reading frames (ORFs) following the order of

3’-N-P-M-G-L-5’, which encode 5 proteins: nucleocapsid (N) protein, phosphoprotein

(P) protein, matrix (M) protein, glycoprotein (G) and polymerase (L) protein (Ammar et al., 2009; Goodin and Jackson, 2002; Redinbaugh et al., 2002). Plant-infecting rhabdoviruses usually contain additional (one to four) ORFs that are located between

P and M and/or G and L, and the sequence similarity among these additional ORFs are very low (Redinbaugh and Hogenhout, 2005). In vertebrate-infecting

4 rhabdoviruses, genes are expressed sequentially, and the transcription decreases following the order 3’ to 5’ in the genome. For example, the N gene of VSV expresses first and most, followed by P, M and G, and the L gene expressed last and least

(Abraham and Banerjee, 1976; Conzelmann, 1998). In plant-infecting rhabdoviruses the expression level of each ORF, including additional ORFs in either plants or insect host are less studied.

The N protein functions to encapsidate the viral genomic RNA to form the nuclear viroplasms (Deng et al., 2007). Sonchus yellow net virus (SYNV) N protein is localized to the nucleus, which is mediated by the C terminus nuclear localization signal (NLS) (Goodin et al., 2001). SYNV P protein has an N terminal karyophillic region, which directs the localization to the nucleus independently from N protein

(Goodin et al., 2001). P interacts with N and L proteins to form the viral replication complex in the plant nucleus (Wagner and Jackson, 1997), and this protein was suggested to be involved in viral RNA elongation and facilitate the movement of L protein on the template RNA during the VSV replication (De and Banerjee, 1985).

Phosphoprotein of VSV is required for specific binding of N to viral genomic RNA

(Masters and Banerjee, 1988). M proteins are basic and hydrophilic. They interact with G proteins as well as lipid membranes. M proteins are also involved in forming the nucleocapsid coiling structure (Barge et al., 1993). G protein is one of the important structural proteins forming the viral particles, particularly the spikes on the virion surface. Therefore, for virus-host interactions, G protein is hypothesized to mediate the recognition between viruses and receptors on the surface of host cells that is required for viruses to enter the cells by endocytosis or fusion with membrane vesicle (Ammar et al., 2009; Hogenhout et al., 2003; Langevin et al., 2002). L has the polymerase and RNA binding domains, and this protein is required for rhabdovirus

5 replication. L presents in virions in low abundance: each VSV virion contains about

1866 and 466 molecules of M and P proteins, but only 50 molecules of L proteins

(Thomas et al., 1985). Based on the conserved motifs of L protein, phylogenetic relationships among rhabdoviruses have been analyzed using L gene (Bourhy et al.,

2005). The plant-infecting rhabdoviruses were clustered together, and

Cytorhabdovirus and Nucleorhabdovirus were separated into two clades (Jackson et al., 2005). The additional proteins encoded by plant-infecting rhabdoviruses are hypothesized to involve in cell-to-cell movement in plants, such as the MMV P3 and

MFSV P4, which have conserved structures that are similar to 30K superfamily of plant virus movement proteins (Jackson et al., 2005; Redinbaugh and Hogenhout,

2005). However, more direct evidence is needed to support this hypothesis.

Interaction between plant-infecting rhabdoviruses and insect vector

Viruses within Rhabdoviridae infect a wide range of hosts including vertebrates, invertebrates, and more than 90 rhabdoviruses infect plants. More importantly, some of these plant-infecting rhabdoviruses cause severe diseases and yield loss to the economically important crops worldwide (Ammar et al., 2009). Although vascular puncture inoculation (VPI) has been successfully used for mechanical transmission of plant-infecting rhabdoviruses such as MFSV in the laboratory conditions (Redinbaugh et al., 2001; Redinbaugh et al., 2002), in natural environments, most of plant-infecting rhabdoviruses are specifically transmitted by one or few closely related hemipteran insects species within Aphididae (aphids), Cicadellidae (leafhoppers) and

Delphacidae (planthoppers). Most of plant-infecting rhabdoviruses are horizontally transmitted among host plants by their insect vectors in a persistent propagative manner, which indicates the occurrence of virus entry and replication within insect

6 vector before transmission (Ammar et al., 2009; Hogenhout et al., 2003). However, only a few aphid-borne plant-infecting rhabdoviruses are vertically transmitted from the female insects to their progenies, such as Hyperomyzus lactucae transmitted

Sowthistle yellow vein virus (SYVV) and Lettuce necrotic yellows virus (LNYV)

(Tsai et al., 2005).

Vector competence varies within insect species as some individuals or biotypes might be capable of transmission or more efficiently transmit plant-infecting rhabdoviruses (Ammar and Nault, 2002; Cisneros Delgadillo, 2013; Todd et al.,

2010). Therefore, physical barriers and insect innate immune response have been suggested as key factors affecting vector specificity and competence (Ammar et al.,

2009). After plant-infecting rhabdoviruses are ingested by their insect vectors through feeding, the viruses must pass through at least two physical barriers to be successfully transmitted to another host plant, the midgut and salivary glands. Once plant-infecting rhabdoviruses pass through the midgut barrier, they disseminate to other tissues or organs through neurotropic and/or hemolymph route. It has been hypothesized that the viral G protein plays an essential role in interacting with receptors on the surface of host cells, which mediates the virus entry into host cells and escape from each barrier through endocytosis. The absence of functional receptors due to genetic variation might result in the lack of transmission (Ammar et al., 2009; Hogenhout et al., 2003).

Besides the physical barriers, insect antiviral response is another proposed defense mechanism limiting virus replication and dissemination (Ammar et al., 2009;

Hogenhout et al., 2003). Although it is not clear what the pathogen associated molecular patterns (PAMPs) produced by rhabdoviruses are that could be recognized by host immune response, G protein of infectious Hematopoietic necrosis virus

(IHNV, a rhabdovirus that infects trout) induced protective immunity (Coll, 1995;

7 Gilmore et al., 1988). Unlike mammals, insects do not have an adaptive immune system, therefore, innate immune response is an important mechanism defending insects against microbial challenge. Humoral responses (Toll and immune deficiency pathways) have been shown to be involved in arboviruses defense, and differential expression of peptidoglycan recognition proteins (PGRPs) and anti-microbial peptides (AMPs) was seen in Sigma virus (a member of the Rhabdoviridae) challenged Drosophila melanogaster (Tsai et al., 2008; Zambon et al., 2005).

However, the molecular interactions between plant-infecting rhabdoviruses and the innate immunity of their insect vectors have not been well documented.

Interaction between MFSV and Graminella nigrifrons

Maize fine streak virus is a new species in the genus Nucleorhabdovirus

(Rhabdoviridae). MFSV has typical bullet-shaped rhabdovirus morphology with an enveloped capsid and helical structure. MFSV encodes five consensus proteins, N, P,

M, G and L, and two additional proteins that are between P and M. Infected maize show symptoms of dwarfing and fine chlorotic steaks along intermediate and small veins (Redinbaugh et al., 2002). MFSV could be mechanically transmitted by VPI or horizontally transmitted by the black-faced leafhopper G. nigrifrons in a persistent propagative manner (Redinbaugh et al., 2002; Todd et al., 2010).

Vector competence varies within the same G. nigrifrons populations. Individual insects can be experimentally categorized into three types according to their acquisition or transmission abilities. MFSV replication occurs within G. nigrifrons transmitters and acquirers, but only transmitters are capable of transmitting MFSV among host plants. Virus replication is not detected within non-acquirers. A minimum

4-week post-first access to disease period (PADP, the interval from the beginning of

8 virus acquisition to the end of the virus inoculation) is necessary for MFSV transmission, and longer acquisition access periods (AAP), such as a 3-week AAP, tends to increase the virus titer and transmission rate (Creamer et al., 1997; Todd et al., 2010). The identified acquisition and transmission rates of MFSV by G. nigrifrons was about 16% and 4% respectively after a 4-week PADP under the laboratory condition (Todd et al., 2010). MFSV is not detected within G. nigrifrons at 1-week

PADP. But by a 2-week PADP, MFSV is detected in midgut and filter chamber cells, as well as neural tissues, visceral muscles and hemocytes. MFSV continuously is disseminated to other tissues such as muscles, tracheal cells and hindgut by the 3rd or

4th week PADP. At 4-week PADP, accumulation of MFSV is observed in both nuclear and cytoplasm of the G. nigrifrons salivary glands. Therefore, MFSV might overcome the midgut barrier and spread to other tissues and finally reach the salivary glands through both neurotropic and hemolymph routes (Todd et al., 2010). Then

MFSV crosses the salivary gland barrier of G. nigrifrons transmitters, which allows the virus to be transmitted to the new host plant during the feeding and injection of saliva.

Although G. nigrifrons is the only identified insect vector for MFSV, there was no molecular especially transcriptome information available for this important vector.

Therefore, my second chapter characterized the G. nigrifrons transcriptome, and the results were published (Chen et al., 2012). Then, in the third chapter, based on the molecular resources obtained from transcriptome database, I was interested in understanding the molecular interactions between MFSV and different types of G. nigrifrons. In particular, we focused on how G. nigrifrons antiviral immunity responded to MFSV challenge among different types of leafhoppers at transcriptional level. In order to associate the differentially expressed immune transcripts with

9 genetic variation, the polymorphism of these transcripts among different types of leafhoppers was also determined in the third chapter. In the fourth chapter, the functions of two G. nigrifrons immune transcripts in MFSV transmission and acquisition were studied using a newly developed RNA interference (RNAi) assay.

The fifth chapter investigated the effects of environmental factors (temperature and light intensity) on MFSV transmission. The results of my entire dissertation research indicated complex molecular interactions among G. nigrifrons, MFSV and the environment, which helped to decipher the role of insect antiviral immunity in plant virus transmission and vector competence.

References

Abraham, G., and Banerjee, A. K. (1976). Sequential transcription of the genes of vesicular stomatitis virus. Proc Natl Acad Sci U S A 73, 1504-8.

Agrawal, N., Dasaradhi, P. V., Mohmmed, A., Malhotra, P., Bhatnagar, R. K., and Mukherjee, S. K. (2003). RNA interference: biology, mechanism, and applications. Microbiol Mol Biol Rev 67, 657-85.

Ahmed, J., Bouloy, M., Ergonul, O., Fooks, A., Paweska, J., Chevalier, V., Drosten, C., Moormann, R., Tordo, N., Vatansever, Z., Calistri, P., Estrada-Pena, A., Mirazimi, A., Unger, H., Yin, H., and Seitzer, U. (2009). International network for capacity building for the control of emerging viral vector-borne zoonotic diseases: ARBO-ZOONET. Euro Surveill 14.

Ammar, E.-D., Tsai, C. W., Whitfield, A. E., Redinbaugh, M. G., and Hogenhout, S. A. (2009). Cellular and Molecular Aspects of Rhabdovirus Interactions with Insect and Host plants. Annual Review of Entomology 54, 447-468.

Ammar, E. (1994). Propagative Transmission of Plant and Animal Viruses by Insects: Factors Affecting Vector Specificity and Competence. In "Advances in Disease Vector Research" (K. Harris, ed.), Vol. 10, pp. 289-331. Springer New York.

10 Ammar, E. D., and Nault, L. R. (2002). Virus transmission by leafhoppers, planthoppers and treehoppers (Auchenorrhyncha, Homoptera). Advances in Botanical Research, Vol 36 36, 141-167.

Anderson, P. K., Cunningham, A. A., Patel, N. G., Morales, F. J., Epstein, P. R., and Daszak, P. (2004). Emerging infectious diseases of plants: pathogen pollution, climate change and agrotechnology drivers. Trends Ecol Evol 19, 535-44.

Bai, X., Zhang, W., Orantes, L., Jun, T. H., Mittapalli, O., Mian, M. A., and Michel, A. P. (2010). Combining next-generation sequencing strategies for rapid molecular resource development from an invasive aphid species, Aphis glycines. Plos One 5, e11370.

Barge, A., Gaudin, Y., Coulon, P., and Ruigrok, R. W. (1993). Vesicular stomatitis virus M protein may be inside the ribonucleocapsid coil. J Virol 67, 7246-53.

Baton, L. A., Garver, L. S., Xi, Z. Y., and Dimopoulos, G. (2008). Functional genomics studies on the innate immunity of disease vectors. Insect Science 15, 15-27.

Bos, L. (1982). Crop losses caused by viruses. Crop Protection 1, 263-282.

Bourhy, H., Cowley, J. A., Larrous, F., Holmes, E. C., and Walker, P. J. (2005). Phylogenetic relationships among rhabdoviruses inferred using the L polymerase gene. J Gen Virol 86, 2849-58.

Boyd, F. J., and Pitre, H. N. (1968). Studies on the Field Biology of Graminella nigrifrons, a Vector of Corn Stunt Virus in Mississippi. Annals of the Entomological Society of America 61, 1423-1427.

Boyd, F. J., and Pitre, H. N. (1969). Greenhouse studies of host plant suitability to Gaminella nigrifrons, a vector of Corn stunt virus. Journal of Economic Entomology 62, 126-130.

Brewbaker, J. L. e. (1975). Corn and sorghum diseases and insect pests in Hawaii. Hawaii Agric. Exp. Sta. Misc. Public. 122, :22pp.

Carpenter, J., Hutter, S., Baines, J. F., Roller, J., Saminadin-Peter, S. S., Parsch, J., and Jiggins, F. M. (2009). The Transcriptional Response of Drosophila melanogaster to Infection with the Sigma Virus (Rhabdoviridae). Plos One 4.

Carpenter, J. A., Obbard, D. J., Maside, X., and Jiggins, F. M. (2007). The recent spread of a vertically transmitted virus through populations of Drosophila melanogaster. Molecular Ecology 16, 3947-3954.

Chen, Y., Cassone, B. J., Bai, X., Redinbaugh, M. G., and Michel, A. P. (2012). Transcriptome of the plant virus vector Graminella nigrifrons, and the molecular interactions of maize fine streak rhabdovirus transmission. Plos One 7, e40613.

11 Choudhury, M. M., and Rosenkranz, E. (1983). Vector relationship of Graminella nigrifrons to Maize chlorotic dwarf virus. Phytopathology 73, 685-690.

Christophides, G. K., Zdobnov, E., Barillas-Mury, C., Birney, E., Blandin, S., Blass, C., Brey, P. T., Collins, F. H., Danielli, A., Dimopoulos, G., Hetru, C., Hoa, N. T., Hoffmann, J. A., Kanzok, S. M., Letunic, I., Levashina, E. A., Loukeris, T. G., Lycett, G., Meister, S., Michel, K., Moita, L. F., Muller, H. M., Osta, M. A., Paskewitz, S. M., Reichhart, J. M., Rzhetsky, A., Troxler, L., Vernick, K. D., Vlachou, D., Volz, J., von Mering, C., Xu, J., Zheng, L., Bork, P., and Kafatos, F. C. (2002). Immunity-related genes and gene families in Anopheles gambiae. Science 298, 159-65.

Coll, J. M. (1995). The glycoprotein G of rhabdoviruses. Archives of Virology 140, 827-51.

Conzelmann, K. K. (1998). Nonsegmented negative-strand RNA viruses: genetics and manipulation of viral genomes. Annu Rev Genet 32, 123-62.

Creamer, R., He, X., and Styer, W. E. (1997). Transmission of sorghum stunt mosaic rhabdovirus by the leafhopper vector, Graminella sonora (Homoptera: Cicadellidae). Plant Disease 81, 63-65.

De, B. P., and Banerjee, A. K. (1985). Requirements and functions of vesicular stomatitis virus L and NS proteins in the transcription process in vitro. Biochem Biophys Res Commun 126, 40-9.

Deng, M., Bragg, J. N., Ruzin, S., Schichnes, D., King, D., Goodin, M. M., and Jackson, A. O. (2007). Role of the sonchus yellow net virus N protein in formation of nuclear viroplasms. J Virol 81, 5362-74.

Dong, Y., Aguilar, R., Xi, Z., Warr, E., Mongin, E., and Dimopoulos, G. (2006). Anopheles gambiae immune responses to human and rodent Plasmodium parasite species. PLoS Pathog 2, e52.

Douglas, A. E., Bouvaine, S., and Russell, R. R. (2011). How the insect immune system interacts with an obligate symbiotic bacterium. Proc Biol Sci 278, 333-8.

Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T. (2001). Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411, 494-8.

Falk, B. W., and Tsai, J. H. (1985). Serological detection and evidence for multiplication of maize mosaic virus in the planthopper, Peregrenus maidis. Phytopathology 75, 852-855.

Fragkoudis, R., Chi, Y., Siu, R. W., Barry, G., Attarzadeh-Yazdi, G., Merits, A., Nash, A. A., Fazakerley, J. K., and Kohl, A. (2008). Semliki Forest virus strongly reduces mosquito host defence signaling. Insect Mol Biol 17, 647-56.

12 Gilmore, R. D., Engelking, H. M., Manning, D. S., and Leong, J. C. (1988). Expression in Escherichia Coli of an Epitope of the Glycoprotein of Infectious Hematopoietic Necrosis Virus Protects Against Viral Challenge. Nat Biotech 6, 295-300.

Goodin, M. M., Austin, J., Tobias, R., Fujita, M., Morales, C., and Jackson, A. O. (2001). Interactions and nuclear import of the N and P proteins of sonchus yellow net virus, a plant nucleorhabdovirus. J Virol 75, 9393-406.

Goodin, M. M., and Jackson, A. O. (2002). Nucleorhabdovirus. Springer Index of Viruses, 1074-1077.

Gordon, D. T., and Nault, L. R. (1977). Involvement of maize chlorotic dwarf virus and other agents in stunting diseases of Zea mays in the United States. Phytopathology 67, 27-36.

Gotz, S., Garcia-Gomez, J. M., Terol, J., Williams, T. D., Nagaraj, S. H., Nueda, M. J., Robles, M., Talon, M., Dopazo, J., and Conesa, A. (2008). High-throughput functional annotation and data mining with the Blast2GO suite. Nucleic Acids Res 36, 3420-35.

Green, P. (2009). phrap. http://phrap.org.

Hannon, G. J. (2002). RNA interference. Nature 418, 244-51.

Hao, Z., Kasumba, I., Lehane, M. J., Gibson, W. C., Kwon, J., and Aksoy, S. (2001). Tsetse immune responses and trypanosome transmission: implications for the development of tsetse-based strategies to reduce trypanosomiasis. Proc Natl Acad Sci U S A 98, 12648-53.

Hoffmann, J. A. (2003). The immune response of Drosophila. Nature 426, 33-8.

Hoffmann, J. A., and Hetru, C. (1992). Insect defensins: inducible antibacterial peptides. Immunol Today 13, 411-5.

Hogenhout, S. A., Ammar, E. D., Whitfield, A. E., and Redinbaugh, M. G. (2008). Insect vector interactions with persistently transmitted viruses. Annual Review of Phytopathology 46, 327-359.

Hogenhout, S. A., Redinbaugh, M. G., and Ammar, E. D. (2003). Plant and animal rhabdovirus host range: a bug's view. Trends in microbiology 11, 264-271.

Jackson, A. O., Dietzgen, R. G., Goodin, M. M., Bragg, J. N., and Deng, M. (2005). Biology of plant rhabdoviruses. Annual Review of Phytopathology 43, 623-660.

Jaubert-Possamai, S., Rispe, C., Tanguy, S., Gordon, K., Walsh, T., Edwards, O., and Tagu, D. (2010). Expansion of the miRNA Pathway in the Hemipteran Insect Acyrthosiphon pisum. Molecular Biology and Evolution 27, 979-987.

13 Kim, C. H., Park, J. W., Ha, N. C., Kang, H. J., and Lee, B. L. (2008). Innate immune response in insects: recognition of bacterial peptidoglycan and amplification of its recognition signal. BMB Rep 41, 93-101.

Kramer, J. P. (1967). A taxonomic study of Graminella nigrifrons, a vector of corn stunt disease, and its congeners in the United States (Homoptera: Cicadellidae: Deltocephalinae). Annals of the Entomological Society of America 60, 604-616.

Kunkel, L. O. (1921). A possible causative agent for the mosaic disease of corn. Hawaii. Sugar Plant. Assoc. Exp. Stn. Bull. Bot. Ser. 3, 44-58.

Kurtz, S. (2011). The Vmatch large scale sequence analysis software. http://www.vmatch.de/.

Lambert, J., Keppi, E., Dimarcq, J. L., Wicker, C., Reichhart, J. M., Dunbar, B., Lepage, P., Van Dorsselaer, A., Hoffmann, J., Fothergill, J., and et al. (1989). Insect immunity: isolation from immune blood of the dipteran Phormia terranovae of two insect antibacterial peptides with sequence homology to rabbit lung macrophage bactericidal peptides. Proc Natl Acad Sci U S A 86, 262-6.

Langevin, C., Jaaro, H., Bressanelli, S., Fainzilber, M., and Tuffereau, C. (2002). Rabies Virus Glycoprotein (RVG) Is a Trimeric Ligand for the N-terminal Cysteine-rich Domain of the Mammalian p75 Neurotrophin Receptor. Journal of Biological Chemistry 277, 37655-37662.

Larsen, K. J., Madden, L. V., and Nault, L. R. (1990). Effect of Temperature and Host Plant on the Development of the Blackfaced Leafhopper. Entomologia Experimentalis Et Applicata 55, 285-294.

Lentz, T. L., Burrage, T. G., Smith, A. L., Crick, J., and Tignor, G. H. (1982). Is the Acetylcholine-Receptor a Rabies Virus Receptor. Science 215, 182-184.

Mamidala, P., Rajarapu, S. P., Jones, S. C., and Mittapalli, O. (2011). Identification and validation of reference genes for quantitative real-time polymerase chain reaction in Cimex lectularius. J Med Entomol 48, 947-51.

Masters, P. S., and Banerjee, A. K. (1988). Complex formation with vesicular stomatitis virus phosphoprotein NS prevents binding of nucleocapsid protein N to nonspecific RNA. J Virol 62, 2658-64.

Medzhitov, R., and Janeway, C. A., Jr. (1997). Innate immunity: the virtues of a nonclonal system of recognition. Cell 91, 295-8.

Nault, L. R. (1980). Maize Bushy Stunt and Corn Stunt - a Comparison of Disease Symptoms, Pathogen Host Ranges, and Vectors. Phytopathology 70, 659-662.

Nault, L. R. (1997). Arthropod transmission of plant viruses: a new synthesis Annals of the Entomological Society of America 90, 521-541.

14 Nault, L. R., Gingery, R. E., and Gordon, D. T. (1980). Leafhopper Transmission and Host Range of Maize Rayado Fino Virus. Phytopathology 70, 709-712.

Noda, H., Kawai, S., Koizumi, Y., Matsui, K., Zhang, Q., Furukawa, S., Shimomura, M., and Mita, K. (2008). Annotated ESTs from various tissues of the brown planthopper Nilaparvata lugens: a genomic resource for studying agricultural pests. Bmc Genomics 9, 117.

Pfaffl, M. W. (2001). A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Research 29, e45.

Redinbaugh, M. G., and Hogenhout, S. A. (2005). Plant rhabdoviruses. Curr Top Microbiol Immunol 292, 143-63.

Redinbaugh, M. G., Louie, R., Ngwira, P., Edema, R., Gordon, D. T., and Bisaro, D. M. (2001). Transmission of viral RNA and DNA to maize kernels by vascular puncture inoculation. J Virol Methods 98, 135-43.

Redinbaugh, M. G., Seifers, D. L., Meulia, T., Abt, J. J., Anderson, R. J., Styer, W. E., Ackerman, J., Salomon, R., Houghton, W., Creamer, R., Gordon, D. T., and Hogenhout, S. A. (2002). Maize fine streak virus, a New Leafhopper-Transmitted Rhabdovirus. Phytopathology 92, 1167-1174.

Rosinski-Chupin, I., Briolay, J., Brouilly, P., Perrot, S., Gomez, S. M., Chertemps, T., Roth, C. W., Keime, C., Gandrillon, O., Couble, P., and Brey, P. T. (2007). SAGE analysis of mosquito salivary gland transcriptomes during Plasmodium invasion. Cell Microbiol 9, 708-24.

Rudenko, N., Golovchenko, M., Edwards, M. J., and Grubhoffer, L. (2005). Differential expression of Ixodes ricinus tick genes induced by blood feeding or Borrelia burgdorferi infection. J Med Entomol 42, 36-41.

Sackton, T. B., Lazzaro, B. P., Schlenke, T. A., Evans, J. D., Hultmark, D., and Clark, A. G. (2007). Dynamic evolution of the innate immune system in Drosophila. Nat Genet 39, 1461-8.

Sanders, H. R., Foy, B. D., Evans, A. M., Ross, L. S., Beaty, B. J., Olson, K. E., and Gill, S. S. (2005). Sindbis virus induces transport processes and alters expression of innate immunity pathway genes in the midgut of the disease vector, Aedes aegypti. Insect Biochem Mol Biol 35, 1293-307.

Scharlaken, B., de Graaf, D. C., Goossens, K., Brunain, M., Peelman, L. J., and Jacobs, F. J. (2008). Reference gene selection for insect expression studies using quantitative real-time PCR: The head of the honeybee, Apis mellifera, after a bacterial challenge. Journal of Insect Science 8, 33.

Schmittgen, T. D., and Livak, K. J. (2008). Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3, 1101-8.

15 Sedlacek, J. D., and Freytag, P. H. (1986). Aspects of the Field Biology of the Blackfaced Leafhopper (Homoptera: Cicadellidae) in Corn and Pastures in Kentucky. Journal of Economic Entomology 79, 605-613.

Sedlacek, J. D., Yeargan, K. V., and Freytag, P. H. (1990). Effect of Temperature on the Development of the Blackfaced Leafhopper (Homoptera: Cicadellidae). Environmental Entomology 19, 209-214.

Seifert, U., Maranon, C., Shmueli, A., Desoutter, J. F., Wesoloski, L., Janek, K., Henklein, P., Diescher, S., Andrieu, M., de la Salle, H., Weinschenk, T., Schild, H., Laderach, D., Galy, A., Haas, G., Kloetzel, P. M., Reiss, Y., and Hosmalin, A. (2003). An essential role for tripeptidyl peptidase in the generation of an MHC class I epitope. Nat Immunol 4, 375-379.

Shelly, S., Lukinova, N., Bambina, S., Berman, A., and Cherry, S. (2009). Autophagy is an essential component of Drosophila immunity against vesicular stomatitis virus. Immunity 30, 588-598.

Sim, C., Hong, Y. S., Vanlandingham, D. L., Harker, B. W., Christophides, G. K., Kafatos, F. C., Higgs, S., and Collins, F. H. (2005). Modulation of Anopheles gambiae gene expression in response to o'nyong-nyong virus infection. Insect Mol Biol 14, 475-81.

Stewart, L. R. (2011). Waikaviruses: studied but not understood. APS Net Plant Pathology Online.

Stoner, W. N., and Gustin, R. D. (1967). Biology of Graminella Nigrifrons (Homoptera - Cicadellidae) a Vector of Corn (Maize) Stunt Virus. Annals of the Entomological Society of America 60, 496-505.

Teraguchi, S. E. (1986). Migration patterns of leafhoppers (Homoptera: Cicadellidae) in an Ohio old field. Environmental Entomology 15, 1199-1211.

Thomas, D., Newcomb, W. W., Brown, J. C., Wall, J. S., Hainfeld, J. F., Trus, B. L., and Steven, A. C. (1985). Mass and molecular composition of vesicular stomatitis virus: a scanning transmission electron microscopy analysis. J Virol 54, 598-607.

Todd, J. C., Ammar el, D., Redinbaugh, M. G., Hoy, C., and Hogenhout, S. A. (2010). Host plant range and leafhopper transmission of maize fine streak virus. Phytopathology 100, 1138-45.

Tomkinson, B., and Lindas, A. C. (2005). Tripeptidyl-peptidase II: A multi-purpose peptidase. International Journal of Biochemistry & Cell Biology 37, 1933-1937.

16 Tsai, C. W., Redinbaugh, M. G., Willie, K. J., Reed, S., Goodin, M., and Hogenhout, S. A. (2005). Complete genome sequence and in planta subcellular localization of maize fine streak virus proteins. J Virol 79, 5304-14.

Ursic-Bedoya, R. J., and Lowenberger, C. A. (2007). Rhodnius prolixus: Identification of immune-related genes up-regulated in response to pathogens and parasites using suppressive subtractive hybridization. Dev Comp Immunol 31, 109-120.

Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., and Speleman, F. (2002). Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biology 3, RESEARCH0034.

Vilmos, P., and Kurucz, E. (1998). Insect immunity: evolutionary roots of the mammalian innate immune system. Immunol Lett 62, 59-66.

Wagner, J. D., and Jackson, A. O. (1997). Characterization of the components and activity of Sonchus yellow net rhabdovirus polymerase. J Virol 71, 2371-82.

Werner, T., Liu, G., Kang, D., Ekengren, S., Steiner, H., and Hultmark, D. (2000). A family of peptidoglycan recognition proteins in the fruit fly Drosophila melanogaster. Proc Natl Acad Sci U S A 97, 13772-7.

Whitfield, A. E., Rotenberg, D., Aritua, V., and Hogenhout, S. A. (2011). Analysis of expressed sequence tags from Maize mosaic rhabdovirus-infected gut tissues of Peregrinus maidis reveals the presence of key components of insect innate immunity. Insect Mol Biol 20, 225-42.

Zambon, R. A., Nandakumar, M., Vakharia, V. N., and Wu, L. P. (2005). The Toll pathway is important for an antiviral response in Drosophila. Proceedings of the National Academy of Sciences of the United States of America 102, 7257-7262.

Zamore, P. D., Tuschl, T., Sharp, P. A., and Bartel, D. P. (2000). RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 101, 25-33.

Zerbino, D. R., and Birney, E. (2008). Velvet: algorithms for de novo short read assembly using de Bruijn graphs. Genome Res 18, 821-9.

Zhang, F., Guo, H., Zheng, H., Zhou, T., Zhou, Y., Wang, S., Fang, R., Qian, W., and Chen, X. (2010). Massively parallel pyrosequencing-based transcriptome analyses of small brown planthopper (Laodelphax striatellus), a vector insect transmitting rice stripe virus (RSV). Bmc Genomics 11, 303.

Zou, Z., Najar, F., Wang, Y., Roe, B., and Jiang, H. (2008). Pyrosequence analysis of expressed sequence tags for Manduca sexta hemolymph proteins involved in immune responses. Insect Biochem Mol Biol 38, 677-82.

CHAPTER 2

Transcriptome of the plant virus vector Graminella nigrifrons, and the molecular

interactions of Maize fine streak virus transmission

This chapter has been published (Chen et al., 2012). Table S2.1, S2.2, S2.3, S2.4 and S2.5 in this chapter refer to table S2, S3, 1, S4, 2 in the published paper online; figure S2.1 in this chapter refers to figure 1 in the published paper online.

Abstract

Leafhoppers (Hemiptera:Cicadellidae) are plant-phloem feeders that are known for their ability to vector plant pathogens. The black-faced leafhopper (Graminella nigrifrons) has been identified as the only known vector for the Maize fine streak virus (MFSV), an emerging plant pathogen in the Rhabdoviridae. Within G. nigrifrons populations, individuals can be experimentally separated into three classes based on their capacity for viral transmission: transmitters, acquirers and non-acquirers. Understanding the molecular interactions between vector and virus can reveal important insights in virus immune defense and vector transmission. RNA sequencing (RNA-Seq) was performed to characterize the transcriptome of G. nigrifrons. A total of 38,240 ESTs of a minimum 100 bp were generated from two separate cDNA libraries consisting of virus transmitters and acquirers. More than 60% of known D. melanogaster, A. gambiae, T. castaneum immune response genes mapped to our G. nigrifrons EST database. Real time quantitative PCR (RT-qPCR)

18 showed significant down-regulation of three genes for peptidoglycan recognition proteins (PGRP - SB1, SD, and LC) in G. nigrifrons transmitters versus control leafhoppers. Our study is the first to characterize the transcriptome of a leafhopper vector species. Significant sequence similarity in immune defense genes existed between G. nigrifrons and other well characterized insects. The down-regulation of

PGRPs in MFSV transmitters suggested a possible role in rhabdovirus transmission.

The results provide a framework for future studies aimed at elucidating the molecular mechanisms of plant virus vector competence.

Introduction

Hemipteran insects such as aphids, whiteflies, planthoppers and leafhoppers are arguably the most important vectors of plant-infecting viruses. These insects have specialized mouthparts suitable for tissue specific feeding (often the phloem), and wide host ranges that provide ample opportunity for virus transmission (Ammar and

Nault, 2002; Nault, 1997). Most insect vectors of plant viruses have significant associations with humans and agroecosystems. Recent rapid changes in these environments have increased crop exposure to viruses and vectors or altered evolutionary, ecological or genetic interactions leading to enhanced transmission

(Anderson et al., 2004). A lack of understanding these factors, including the molecular mechanisms of virus transmission by vectors, reduces our ability to assess and manage risks posed by plant virus vectors, particularly for emerging diseases whose full impacts are not yet realized.

Graminella nigrifrons is one of the most common and abundant leafhoppers in the eastern half of the U.S., presently found in 35 states from southern Maine to

Florida (Stoner and Gustin, 1967). It has a wide host plant range, including oats

19 (Avena sativa L.), maize (Zea mays L.), perennial rye grass (Lolium perenne L.) and johnsongrass (Sorghum halepense L.) (Larsen et al., 1990). G. nigrifrons is a natural and experimental vector of several pathogens (e.g. maize bushy stunt phytoplasma and corn stunt spiroplasma) as well as several types of viruses, including rhabdoviruses (Boyd and Pitre, 1969; Nault, 1980a; Nault et al., 1980; Redinbaugh et al., 2002; Stewart, 2011).

G. nigrifrons has recently been identified as a vector of the emerging

Rhabdovirus Maize fine streak virus (MFSV) (Redinbaugh et al., 2002; Todd et al.,

2010), which is a newly described member of Nucleorhabdovirus, first detected in

Georgia, US in 1999 (Redinbaugh et al., 2002). In maize, this emerging virus causes symptoms of dwarfing and fine chlorotic steaks along intermediate and small veins.

Consistent with most rhabdoviruses, MFSV has high vector species specificity as G. nigrifrons is the only reported insect vector (Redinbaugh et al., 2002; Todd et al.,

2010; Tsai et al., 2005). G. nigrifrons transmits MFSV in a persistent propagative manner, but, vector competence for MFSV is not consistent within G. nigrifrons populations. Individual insects can be categorized into three groups according to their acquisition or transmission capabilities after exposure to MFSV infected plants.

‘Transmitters’ acquire and transmit virus (i.e., they are vectors); ‘acquirers’ acquire, but cannot transmit virus; and non-acquirers do not acquire virus after feeding on infected plants (Redinbaugh et al., 2002; Todd et al., 2010). Mechanisms of these differences are unknown, but it is hypothesized that barriers to virus replication and movement within the insect might be the key factors limiting vector competence among G. nigrifrons individuals (Ammar et al., 2009; Redinbaugh and Hogenhout,

2005). While biological parameters associated with MFSV and other pathogen transmission by G. nigrirons are defined, the absence of molecular resources for this

20 vector prevents further investigations into insect vector competence, the molecular basis of rhabodvirus transmission, and comparative vector genomics. While a few molecular investigations exist for planthoppers (Noda et al., 2008; Zhang et al., 2010), data for leafhoppers is virtually non-existent.

Rhabdoviruses can infect both plants and animals (including mammals) and consist of a nucleocapsid containing a negative single-stranded RNA genome encapsidated into a lipid bilayer membrane. There are seven recognized

Rhabdoviridae genera, but only viruses within the Nucleorhabdovirus and

Cytorhabdovirus infect plants (Hogenhout et al., 2008; Jackson et al., 2005). In contrast to most plant viruses, the rhabdoviruses also infect their insect vectors, they must, therefore, replicate within the insect and cross several molecular and physical barriers prior to being transmitted to additional host plant (Ammar et al., 2009). These barriers may include digestive enzymes, peritrophic lining, improper epithelial cell receptors for virus attachment, programmed cell death, virus induced RNA interference (RNAi) or an active insect immune response (Ammar et al., 2009; Tsai et al., 2008). A midgut barrier to virus infection of poor vectors has been defined for some rhabdoviruses, but other barriers are not as well understood (Ammar et al.,

2009; Jackson et al., 2005).

In other systems, the impact of several insect responses on vector competence has begun to be defined, including insect innate immunity, a highly conserved, essential defense against microbial infection, such as bacteria, fungi, nematodes and viruses (Medzhitov and Janeway, 1997). Non-self molecules are recognized and subsequently trigger cell-mediated phagocytosis, encapsulation and/or humoral responses. The humoral response is activated by the binding of peptidoglycan recognition proteins (PGRPs) to pathogen associated molecular patterns (PAMPs),

21 which then regulate antimicrobial peptide (AMPs) production through Toll or immune deficiency (IMD) signaling cascades (Kim et al., 2008). Two classes of PGRPs are described: the short PGRPs (PGRP-S) are small extracellular proteins without transmembrane domains present in the hemolymph and cuticle; and, long PGRPs

(PGRP-L) are larger proteins that encode transmembrane domains (Werner et al.,

2000). The responses of insect PGRPs to bacterial and fungal infection have been well described, and several recent studies revealed the involvement of the Toll pathway and PGRPs in D. melanogaster defense against viral infection (Tsai et al., 2008;

Zambon et al., 2005). The number and the type of PGRPs vary among insects. For example, D. melanogaster has 12 PGRP genes (Werner et al., 2000) and Anopheles gambiae has 7 (Christophides et al., 2002),but the Hemipteran pea aphid

Acyrthosiphon pisum lacks PGRPs due to the co-evolution with its endosymbionts

(Douglas et al., 2011). The role of PGRPs in leafhoppers and planthoppers, the primary vectors of plant viruses, is not well understood.

RNA interference (RNAi) is another key pathway protecting eukaryotic organisms from virus infection (Agrawal et al., 2003; Hannon, 2002). Genes, proteins and pathways important for RNAi have been characterized in D. melanogaster, but genes involved in these pathways have just begun to be described in insect vectors of plant viruses including Peregrinus maidis (Whitfield et al., 2011), and A. pisum

(Jaubert-Possamai et al., 2010). No information about RNAi pathway genes is available for leafhoppers.

To expand leafhopper molecular resources, we constructed cDNA libraries using RNA from G. nigrifrons transmitters and acquirers, and sequenced the transcripts using RNA-seq. The resulting EST database provides the first transcriptome information on a leafhopper, and contains genes potentially involved in

22 anti-pathogen defense. In addition, we used RT-qPCR to examine the expression of seven genes putatively involved in insect immune response for leafhoppers known to transmit MFSV and leafhoppers not previously exposed to MFSV.

Methods and Materials

Insect rearing and virus maintenance

G. nigrifrons was maintained on maize (Zea mays L.) hybrid Early Sunglow in growth chambers, and MFSV was maintained by serial transfer to maize at OARDC as previously described (Todd et al., 2010). For virus maintenance, 300 G. nigrifrons individuals were reared on MFSV infected maize for three weeks then transferred to healthy maize seedlings. Inoculated plants with MFSV symptoms were subsequently used as source plants.

Differentiating non-acquirers, acquirers, and transmitters

Two hundred G. nigrifrons adults (100 males and 100 females) were collected, placed in a single cage, and allowed to mate and oviposit on MFSV infected maize seedlings for two days. After 14 days, the (F1) nymphs were observed, and this was denoted as day 0. The F1 nymphs were reared on MFSV infected maize seedlings for

21 days, then F1 adults were individually transferred to 4-day old healthy maize plants within a tube. After one week, F1 leafhoppers were collected, labeled according to the maize test plant, and stored at -80℃. Plants were moved to a growth chamber for three weeks for MFSV symptom development (Todd et al., 2010). An insect was designated as a transmitter if MFSV symptoms developed on the test plant it fed on.

For non-transmitter insects, RT-PCR was performed on individuals using the Access

23 RT-PCR System (Promega, Madison, WI) following the manufacturer’s protocol.

Primer pairs 361F (5′- GTGCAGAATTGCCCTATCC -3′)/917R (5′-

TCGAGGCAATTCCTGTATC -3′) and 5335F (5′-

CTCCCATTATCATAGATAAAG -3′)/6360R (5′- TATATGCAATTCTGATTCCTC

-3′) were used to amplify a 1120 bp and 1030 bp fragments of the viral N and G genes, respectively, based on MFSV genome sequence (Tsai et al., 2005). Reverse transcription was performed at 45oC for 45 min and followed by 2 min at 94oC. PCR included 40 cycles of 94oC for 30 s, annealing at 54oC (N gene) or 52oC (G gene) for

30 s, and extension at 68 oC for 120 s. An insect was designated as an ‘acquirer’ if

RT-PCR indicated the presence of MFSV, but no transmission of the virus to the test plant. ‘Non-acquirers’ were those insects for which MFSV was not detected by

RT-PCR, and no symptoms developed on test plants.

RNA isolation and cDNA library construction

Total RNA from individual G. nigrifrons transmitters and acquirers was isolated with Trizol (Invitrogen, Grand Island, NY) following the manufacturer’s protocol.

The concentration and the quality of RNA were analyzed using a Nanodrop 2000c spectrophotometer and Agilent 2100 Bioanalyzer. RNA (10 µg) was pooled from eight individuals from each class and used to construct two cDNA libraries following the mRNA sequencing sample preparation guide (Illumina, San Diego, CA).

Paired-end DNA sequencing was done in two lanes (one per library) on an Illumina

GA-II following manufacturer’s protocol.

24 Sequence assembly and annotation

The 76-bp paired-end Illumina reads from the acquirer (32,548,016 reads) and transmitter (30,541,892 reads) libraries were combined for de novo assembly.

Low-quality (≥80% of the read with the Phred score of less than 20) and low complexity (>80% of the read with single-nucleotide, di-nucleotide, or tri-nucleotide repeats) were removed. The processed reads were then assembled using a combination of the Velvet (ver. 1.2.01) (Zerbino and Birney, 2008) and Oases (ver.

0.2.06; http://www.ebi.ac.uk/~zerbino/oases/) programs with the k-mer lengths of 41,

43, 45, 47, 49, 51, 53, and 55. The resulting assembled sequences and singletons were combined, processed to remove duplicates using a custom Perl Script (Bai et al.,

2010), and further assembled after examining the overlapped regions identified by

Vmatch (ver. z.z) (Kurtz, 2011). Contigs were then further assembled using Phrap program (version: 0.020425.c) (Green, 2009) to obtain the final transcriptome of sequences >100 bp. Sequences have been submitted to the short read archive at NCBI

GenBank under accession number SRP013390.3.

Functional annotation of the G. nigrifrons transcriptome was performed by searching for analogous sequences in the Swiss-Prot database

(http://www.ebi.ac.uk/uniprot) using an E-value cut-off of 10-4. Hierarchical functional categorization on gene ontologies (GO terms) was done using BLAST2GO

(http://www.blast2go.de) (Gotz et al., 2008). BLAST2GO was also used to identify genes represented in Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways

(http://www.kegg.com/kegg/kegg1a.html).

25 Comparison of G. nigrifrons and other invertebrate transcriptomes and immune response genes

Each of the 32,480 G. nigrifrons ESTs was subjected to pair-wise comparison to

EST databases of eight invertebrate species using desktop downloaded tBLASTx software and a 10-10 E-value threshold. Seven invertebrate databases were constructed by retrieving cDNA sequences of characterized genomes from NCBI

(ftp://ftp.ncbi.nih.gov) or Ensembl (ftp://ftp.ensembl.org/): Acyrthosiphon pisum (pea aphid, order Hemiptera, 37,994 sequences), Apis mellifera (honey bee, order

Hymenoptera, 18,542 sequences), Nasonia vitripennis (parasitic wasp, order

Hymenoptera, 27,287 sequences), Tribolium castaneum (red flour beetle, order

Coleoptera, 14,366 sequences), Anopheles gambiae (malaria mosquito, order Diptera,

14,974 sequences), Drosophila. melanogaster (fruit fly, order Diptera, 19,233 sequences), and Caenorhabditis elegans (soil nematode, order Rhabditida, 32,201 sequences). A NCBI transcriptome database was also constructed for P. maidis

(maize planthopper, order Hemiptera), which contained 10,636 sequences derived from the gut (Whitfield et al., 2011). Immunity gene homologs from G. nigrifrons

EST database were identified by similarity to annotated immunity genes from an insect immunity gene databases constructed by Whitfield et al.(Whitfield et al., 2011) that contained over 300 immunity genes derived from D. melanogaster (356 genes)

(Sackton et al., 2007), A. gambiae (302 genes) (Christophides et al., 2002), and T. castaneum (245 genes) (Zou et al., 2008) using tBLASTx with an E-value cut-off of

10-10.

26 Validation of reference genes for gene expression studies

Six candidate housekeeping genes were selected (Table 2.1): alpha tubulin (α

-TUB) (GnigEST017131), elongation factor 1-alpha (EF-1α) (GnigEST008963), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (GnigEST000002), succinate dehydrogenase (SDHA) (GnigEST008732), ribosomal protein L3 (RPL3)

(GnigEST000330), ribosomal protein S13 (RPS13) (GnigEST004586). Six treatments were used including MFSV-transmitters, non-acquirers and leafhoppers raised on healthy plants, separated in groups of males and females. Total RNA was extracted from individual G. nigrifrons adults using Trizol (Invitrogen). DNA was removed from the RNA samples with the TURBO DNA-free kit (Ambion, Grand Island, NY).

The concentration and quality of the RNA were verified as outlined above. Total

RNA (1μg) from individual insects was used for cDNA synthesis with the SuperScript

III First-Strand Synthesis System (Invitrogen, Grand Island, NY). The cDNA was used as template for RT-qPCR using the iQ SYBR Green Mix (Bio-Rad, Hercules,

CA), following the manufacturer’s recommendations and primers designed using

Beacon Designer 7.0 (BioRad, Hercules, CA). PCR was performed with 5µl of SYBR

Green Mix, 2 µl of cDNA template (20ng/µl) and 5 pmole of each primer. Target genes were amplified at 95°C for 3 min followed by 40 cycles of 95°C for 10 s and

60°C for 30 s. Nuclease-free water was used for negative control reactions. PCR efficiency (E) was calculated by the equation E = 10[-1/slope] (Pfaffl, 2001). A standard curve was constructed using serial dilutions of pooled individual cDNAs and used to determine the relative expression values for these six reference genes (User Bulletin

#2: ABI Prism 7700 Sequence Detection System vide supra)

(http://www3.appliedbiosystems.com/). The software geNorm was used to determine the most stable reference gene among the six tested (Vandesompele et al., 2002).

27 Expression of seven genes with known function in insect innate immunity was evaluated in transmitters and leafhoppers raised on healthy plants (i.e. never exposed to MFSV infected plants, used as control) using RT-qPCR: acetylcholine receptor subunit alpha-L1 (AChR) (GnigEST002867), autophagy protein 5 (ATG 5)

(GnigEST012478), defensin (GnigEST011432), peptidoglycan recognition protein

SB1 (PGRP-SB1) (GnigEST015027), PGRP-SD (GnigEST009213), PGRP-LC

(GnigEST006324), tripeptidyl peptidase II (TPP II) (GnigEST021246). RNA isolation and RT-qPCR protocols were carried out as outlined above with primers listed in Table 2.2. The expression profiles of the seven genes were normalized to the internal control RPS13. Nuclease-free water was used as the negative control reactions. For each treatment, three biological replicates composed of RNA isolated from 10 adult leafhoppers were analyzed. The relative accumulation of transcripts in

MFSV transmitters and control leafhoppers were determined using the comparative

-ΔCt CT method (Schmittgen and Livak, 2008). A T-test was used to compare mean 2 values.

Results and Discussion

Sequence assembly and annotation

A total of 38,240 good quality ESTs of a minimum 100 bp were generated for the G. nigrifrons transcriptome. Approximately 34% of these transcripts (n = 13,036) mapped to the Swiss-Prot database (E < 10-4) based on deduced amino acid similarity.

Of these, 177 homologs were of prokaryotic origin and therefore removed from further analysis. On a more conserved level (E-value < 10-180), 1,070 G. nigrifrons

ESTs have high similarity with genes in the Swiss-Prot database (listed in Table

S2.1). Approximately one-third of these highly conserved genes (n = 355) had highest

28 similarity to a D. melanogaster gene. To guide biological interpretation, we used

BLAST2GO to examine the associations between gene (GO) and enzyme (EC) ontologies assigned to the G. nigrifrons ESTs. We identified 4,488 ESTs (12%) that mapped to GO or EC terms (Figure 2.1). Of these, 2,634 G. nigrifrons ESTs were classified as having function in cellular processes, 2,592 as having binding function, and 2604 as cell parts. KEGG-based pathway analysis using BLAST2GO from ortholog cellular pathways indicated that 882 ESTs could be putatively assigned to one or more of 126 KEGG pathways (Table S2.2). Thus, our initial functional analysis of the G. nigrifrons transcriptome indicates significant similarities with those of previously sequenced organisms, particularly D. melanogaster. However, fewer than half of the G. nigrifrons ESTs had significant similarity to genes in

SWISS-PROT database, and less than 10% could be classified by GO term or KEGG pathway.

Comparison of G. nigrifrons and other invertebrate ESTs

Pair-wise comparison of the G. nigrifrons ESTs with cDNA databases for seven well-characterized invertebrate genomes and one insect dbEST collection indicated that ca. 37% (n = 14,259) of the G. nigrifrons ESTs had a significant match to at least one of the insect databases (E < 10-10). When significant G. nigrifrons matches to the same predicted or known ortholog protein sequence in different species were collapsed into a single observation, there were 9,635 transcripts with at least one hit to an invertebrate database (~25% of the total ESTs). Partitioning of the significant matches among the eight invertebrate databases indicated D. melanogaster (n =

7,303) and T. castaneum (n = 7,028) had the greatest number of matches, whereas the most distantly related species, C. elegans, had the fewest (n = 4,777). The number of

29 matches ranged between 6,309 and 6,907 for the remaining five invertebrate comparisons. Differences in the number of matches may be due to genomic evolution, or may more likely reflect different stages of transcriptomic characterization and curation.

For the putative or known ortholog transcripts, the number of G. nigrifrons

ESTs that match a sequence in only one of the eight comparison invertebrate species was determined. The number of significant ortholog matches as well as the number of transcripts exclusive to one invertebrate for all eight pair-wise comparisons are shown in figure S2.1. Roughly half of the unique matches exclusive to one invertebrate (161 of 332) were attributed to N. vitripennis or the hemipteran A. pisum. The relatively low percentage (3%) of unique matches to the most closely related species in the comparisons, the corn planthopper P. maidis, is likely due to the small number of P. maidis ESTs (10,636) compared to the transcriptomes of the other seven query species.

Immune response ESTs in G. nigrifrons

The transcriptional responses of pathogen infection in insect human disease vectors are well described (Dong et al., 2006; Hao et al., 2001; Rosinski-Chupin et al.,

2007; Rudenko et al., 2005; Sanders et al., 2005; Sim et al., 2005; Ursic-Bedoya and

Lowenberger, 2007). These studies suggest that innate immunity genes can have different functions in different genetic backgrounds, between closely related insect vector species, and even between different populations of the same species (Baton et al., 2008). However, little is known about the transcriptome response in insect plant disease vectors due to pathogen invasion. To identify ESTs that play a putative role in the leafhopper immune response, we compared our dataset against >300 A. gambiae,

30 D. melanogaster, and T. castaneum transcripts with known function in the insect immune response (including several transcript variants of some genes). The 25 G. nigrifrons ESTs with highest similarity to known immunity genes of A. gambiae, D. melanogaster, and T. castaneum are shown in Table S2.3.

A total of 194 G. nigrifrons ESTs were predicted to be functional in the immune response (Table S2.4) such as Toll and immune deficiency (IMD) pathways, Jun

N-terminal kinase (JNK), and Janus Kinase/signal transducer of activator of transcription (JAK/STAT). In addition, 10 ESTs with the E ≤ 10-13, putatively function as pattern recognition proteins (PRPs) including different gram-negative bacteria binding proteins (GNBPs), C-type lectin and scavenger receptors. Of particular interest of PRPs are PGRPs, which are the proteins responsible for sensing and binding of non-self molecules and which activate downstream immune responses.

Since the Toll pathway was reported to play an important role in Drosophila X virus

(DXV) defense (Zambon et al., 2005), ESTs encoding putative key proteins involved in this pathway such as Spaetzle, protein Toll as well as its partners, Pelle and

MyD88, Cactus, and Dorsal-related immunity factor (Dif) were identified. Other essential proteins function in IMD pathway such as DREDD and Relish, their corresponding ESTs were also present in G. nigrifrons. Although there are eight types of AMPs identified in D. melanogaster, there was only one putative AMP gene, defensin, identified in G. nigrifrons ESTs. The relatively large percentage of highly similar transcripts is expected, given the high degree of conservation of immune signaling pathways across diverse insect and mammalian taxa (Hoffmann, 2003;

Vilmos and Kurucz, 1998).

31 G. nigrifrons ESTs with similarity to RNAi pathway genes

RNAi is a highly conserved gene silencing process triggered by double-stranded

RNAs and guided by small interfering RNA (siRNA) that involves post-transcriptional gene silencing (PTGS), which is essential for virus defense and development in insects (Elbashir et al., 2001; Zamore et al., 2000). Thirty-two

Drosophila genes have been implicated in RNAi/PTGS. G. nigrifrons ESTs homologous to RNAi/PTGS transcripts were identified using tBLASTx with an

(E-value < 10-10) against nucleotide sequences of D. melanogaster RNAi/PTGS genes. Forty-three G. nigrifrons ESTs matched to at least one D. melanogaster

RNAi/PTGS transcript variant, and included 69% of D. melanogaster RNAi/PTGS genes (Table S2.5). Significant matches for some of the D. melanogaster RNAi/PTGS genes (e.g. FBgn0262447, FBgn0262432, FBgn0262391) were not identified, likely due to their small size (<100 bp).

Validation and expression profiles of G. nigrifrons candidate genes

Since reference genes for assaying G. nigrifrons gene expression have not been described, we examined expression of six genes previously selected for reference gene validation in other insects using RT-qPCR (Scharlaken et al., 2008). Primer pairs for all six genes had a R2 > 0.99 and primer efficiency (E values) between 1.8 and 2.2

(Table 2.1). Stability analysis revealed RPS13 and α –TUB were the most stably expressed genes (Figure 2.2), and RPS13 was chosen based on comparisons with other insects (Mamidala et al., 2011).

Gene expression patterns for seven selected genes implicated in insect innate immunity were tested using RT-qPCR, including three PGRPs (two representing short class and one representing long class), as well as AChR, ATG 5, TPP-II and defensin

32 (the only AMP EST in our database) (Carpenter et al., 2009; Tsai et al., 2008;

Whitfield et al., 2011). RNAs were isolated from G. nigrifrons individuals that were either experimentally determined to be MFSV transmitters or control leafhoppers.

RNA used for RT-qPCR had an A260/A280 between 1.8 and 2, and the PCR efficiencies for the candidate gene primers were between 1.8 and 2.2 (Table 2.2). The fold difference in expression for transmitters versus control leafhoppers ranged from

-4.0 to 1.4 (Figure 2.3). No significant differences in ATG5, AChR, TPP-II or defensin expression were detected. However, expression of the PGRP genes was significantly lower in transmitters compared to control leafhoppers.

Previous studies suggested roles for ATG5, AChR, TPP-II or defensin in the innate immune response. A role for autophagy in controlling vesicular stomatitis virus

(VSV) replication was indicated in D. melanogaster (Shelly et al., 2009). TPP-II, a multi-function peptidase, was reported to be involved in protein turnover and immune response through processing antigen epitopes (Seifert et al., 2003; Tomkinson and

Lindas, 2005). AChR was suggested as a receptor for rabies virus (Rhabdoviridae)

(Lentz et al., 1982). Defensin is induced during bacterial infection after activation of the Toll pathway by the recognition and binding of PAMPs to PGRP-SA or SD

(Hoffmann, 2003; Hoffmann and Hetru, 1992; Lambert et al., 1989). However no significant expression difference between transmitters and control leafhoppers was detected for any of these four genes. A similar lack of an effect of MMV infection was found in P. maidis for ATG3 and TPP-II (Whitfield et al., 2011), and for defensin in Sigma virus (SIGMAV)-infected and non-infected Drosophila (Tsai et al., 2008).

Therefore, although these genes have roles in innate insect immunity, their expression does not seem to respond to long-term rhabdovirus infection in planthoppers or leafhoppers.

33 Recent studies have indicated a role of PGRPs in insect virus defense (Tsai et al., 2008), and our data shows a potential interaction between putative G. nigrifrons

PGRPs and rhabdovirus infection. All three putative-PGRPs tested (PGRP-SB1,

PGRP-SD and PGRP-LC) showed significantly lower expression in MFSV transmitters compared to control leafhoppers, and the fold changes ranged from -2.9 to -4.0 (Figure 2.3). Pathogens, such as bacteria and fungi, are recognized by PGRPs, which subsequently trigger downstream AMPs production through Toll or IMD immune pathway (Werner et al., 2000). In Drosophila, infection with the rhabdovirus

SIGMAV also alters expression of PGRP-SB1 and PGRP-SD; however in this case, increased transcript levels were found with these genes in infected Drosopila compared to un-infected (Tsai et al., 2008; Zambon et al., 2005). Several non-mutually exclusive factors may explain the different expression profiles of these three putative PGRPs in the G. nigrifrons/MFSV and D. melanogaste/SIGMAV systems. SIGMAV are known insect pathogens, whereas the pathogenicity of MFSV in G. nigrifrons has not been determined. For example, SIGMAV, which is also a member of Rhabdoviridae, is a natural viral insect pathogen widespread in D. melanogaster populations, and is vertically transmitted (Carpenter et al., 2007).

Alternatively, MFSV is transmitted only through feeding on infected host plants; vertical transmission has not been observed in G. nigrifrons (Redinbaugh et al., 2002;

Todd et al., 2010). The difference in virus acquisition and pathogenicity may elicit different immune responses.

Additionally, we hypothesize that MFSV might actively manipulate vector immune response in terms of reduced expression of these three PGRPs in order to successfully replicate within G. nigrifrons transmitters and acquirers. Virus manipulation has been observed with the Togavirus Semliki Forest Virus (SFV)

34 within infected cell lines of the mosquito Aedes albopictus; in this case activation of immune defense pathways was suppressed (Fragkoudis et al., 2008). Manipulation may be through direct interactions with the insect vector, or by altering physiological processes of the host plants such that an elevated plant defense response impacts insect defenses which consequently favors virus replication. Although this hypothesis is untested, further work aimed at describing the expression profiles of other PGRPs among all three G. nigrifrons classes (transmitters, acquirers, non-acquirers) will help understand the interactions between PGRPs and MFSV proteins that lead to virus transmission.

Our study represents the first transcriptome characterization of a leafhopper species, which includes 38,240 transcripts. Significant sequence similarity existed in immune defense genes existed between G. nigrifrons and other well-characterized insects. Additionally, we have identified several putative components of the RNAi pathway, which will enable future development of functional evaluation of the role of this important pathway in transmission of MFSV. The down-regulation of PGRPs in

MFSV transmitters suggests a possible interaction with rhabdovirus transmission by vectors, although additional research is required to define the mechanism. The results presented expand molecular characterization of plant virus vectors and will help further understand the mechanisms of plant virus vector competence.

References

Agrawal, N., Dasaradhi, P. V., Mohmmed, A., Malhotra, P., Bhatnagar, R. K., and Mukherjee, S. K. (2003). RNA interference: biology, mechanism, and applications. Microbiol Mol Biol Rev 67, 657-85.

35 Ammar, E.-D., Tsai, C. W., Whitfield, A. E., Redinbaugh, M. G., and Hogenhout, S. A. (2009). Cellular and Molecular Aspects of Rhabdovirus Interactions with Insect and Host plants. Annual Review of Entomology 54, 447-468.

Ammar, E. D., and Nault, L. R. (2002). Virus transmission by leafhoppers, planthoppers and treehoppers (Auchenorrhyncha, Homoptera). Advances in Botanical Research, Vol 36 36, 141-167.

Baton, L. A., Garver, L. S., Xi, Z. Y., and Dimopoulos, G. (2008). Functional genomics studies on the innate immunity of disease vectors. Insect Science 15, 15-27.

Boyd, F. J., and Pitre, H. N. (1969). Greenhouse studies of host plant suitability to Gaminella nigrifrons, a vector of Corn stunt virus. Journal of Economic Entomology 62, 126-130.

Dong, Y., Aguilar, R., Xi, Z., Warr, E., Mongin, E., and Dimopoulos, G. (2006). Anopheles gambiae immune responses to human and rodent Plasmodium parasite species. PLoS Pathog 2, e52.

36 Douglas, A. E., Bouvaine, S., and Russell, R. R. (2011). How the insect immune system interacts with an obligate symbiotic bacterium. Proc Biol Sci 278, 333-8.

Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T. (2001). Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411, 494-8.

Green, P. (2009). phrap. http://phrap.org.

Hannon, G. J. (2002). RNA interference. Nature 418, 244-51.

Hoffmann, J. A. (2003). The immune response of Drosophila. Nature 426, 33-8.

Hoffmann, J. A., and Hetru, C. (1992). Insect defensins: inducible antibacterial peptides. Immunol Today 13, 411-5.

Hogenhout, S. A., Ammar, E. D., Whitfield, A. E., and Redinbaugh, M. G. (2008). Insect vector interactions with persistently transmitted viruses. Annual Review of Phytopathology 46, 327-359.

Jackson, A. O., Dietzgen, R. G., Goodin, M. M., Bragg, J. N., and Deng, M. (2005). Biology of plant rhabdoviruses. Annual Review of Phytopathology 43, 623-660.

Kim, C. H., Park, J. W., Ha, N. C., Kang, H. J., and Lee, B. L. (2008). Innate immune response in insects: recognition of bacterial peptidoglycan and amplification of its recognition signal. BMB Rep 41, 93-101.

Kurtz, S. (2011). The Vmatch large scale sequence analysis software. http://www.vmatch.de/.

37 Lambert, J., Keppi, E., Dimarcq, J. L., Wicker, C., Reichhart, J. M., Dunbar, B., Lepage, P., Van Dorsselaer, A., Hoffmann, J., Fothergill, J., and et al. (1989). Insect immunity: isolation from immune blood of the dipteran Phormia terranovae of two insect antibacterial peptides with sequence homology to rabbit lung macrophage bactericidal peptides. Proc Natl Acad Sci U S A 86, 262-6.

Larsen, K. J., Madden, L. V., and Nault, L. R. (1990). Effect of Temperature and Host Plant on the Development of the Blackfaced Leafhopper. Entomologia Experimentalis Et Applicata 55, 285-294.

Lentz, T. L., Burrage, T. G., Smith, A. L., Crick, J., and Tignor, G. H. (1982). Is the Acetylcholine-Receptor a Rabies Virus Receptor. Science 215, 182-184.

Medzhitov, R., and Janeway, C. A., Jr. (1997). Innate immunity: the virtues of a nonclonal system of recognition. Cell 91, 295-8.

Nault, L. R. (1980). Maize Bushy Stunt and Corn Stunt - a Comparison of Disease Symptoms, Pathogen Host Ranges, and Vectors. Phytopathology 70, 659-662.

Nault, L. R. (1997). Arthropod transmission of plant viruses: a new synthesis Annals of the Entomological Society of America 90, 521-541.

Nault, L. R., Gingery, R. E., and Gordon, D. T. (1980). Leafhopper Transmission and Host Range of Maize Rayado Fino Virus. Phytopathology 70, 709-712.

Pfaffl, M. W. (2001). A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Research 29, e45.

Redinbaugh, M. G., and Hogenhout, S. A. (2005). Plant rhabdoviruses. Curr Top Microbiol Immunol 292, 143-63.

38 Rudenko, N., Golovchenko, M., Edwards, M. J., and Grubhoffer, L. (2005). Differential expression of Ixodes ricinus tick genes induced by blood feeding or Borrelia burgdorferi infection. J Med Entomol 42, 36-41.

Sackton, T. B., Lazzaro, B. P., Schlenke, T. A., Evans, J. D., Hultmark, D., and Clark, A. G. (2007). Dynamic evolution of the innate immune system in Drosophila. Nat Genet 39, 1461-8.

Schmittgen, T. D., and Livak, K. J. (2008). Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3, 1101-8.

Shelly, S., Lukinova, N., Bambina, S., Berman, A., and Cherry, S. (2009). Autophagy is an essential component of Drosophila immunity against vesicular stomatitis virus. Immunity 30, 588-598.

Stewart, L. R. (2011). Waikaviruses: studied but not understood. APS Net Plant Pathology Online.

Stoner, W. N., and Gustin, R. D. (1967). Biology of Graminella Nigrifrons (Homoptera - Cicadellidae) a Vector of Corn (Maize) Stunt Virus. Annals of the Entomological Society of America 60, 496-505.

Todd, J. C., Ammar el, D., Redinbaugh, M. G., Hoy, C., and Hogenhout, S. A. (2010). Host plant range and leafhopper transmission of maize fine streak virus. Phytopathology 100, 1138-45.

Tomkinson, B., and Lindas, A. C. (2005). Tripeptidyl-peptidase II: A multi-purpose peptidase. International Journal of Biochemistry & Cell Biology 37, 1933-1937.

39 Tsai, C. W., McGraw, E. A., Ammar, E. D., Dietzgen, R. G., and Hogenhout, S. A. (2008). Drosophila melanogaster mounts a unique immune response to the Rhabdovirus sigma virus. Appl Environ Microbiol 74, 3251-6.

Tsai, C. W., Redinbaugh, M. G., Willie, K. J., Reed, S., Goodin, M., and Hogenhout, S. A. (2005). Complete genome sequence and in planta subcellular localization of maize fine streak virus proteins. J Virol 79, 5304-14.

Vilmos, P., and Kurucz, E. (1998). Insect immunity: evolutionary roots of the mammalian innate immune system. Immunol Lett 62, 59-66.

Zamore, P. D., Tuschl, T., Sharp, P. A., and Bartel, D. P. (2000). RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 101, 25-33.

Zerbino, D. R., and Birney, E. (2008). Velvet: algorithms for de novo short read assembly using de Bruijn graphs. Genome Res 18, 821-9.

Figure 2.1: Gene ontology (GO) terms for G. nigrifrons EST (contigs and singletons). The pie charts were generated based on A. Biological process; B. Molecular function; C. Cellular component.

Figure 2.2: Comparison of reference genes for G. nigrifrons using geNorm. Genes with lower average expression stability M are more stable among all treatments. α-TUB, alpha tubulin; EF-1α, elongation factor 1-alpha; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; SDHA, succinate dehydrogenase; RPL3, ribosomal protein L3; RPS13, ribosomal protein S13.

Figure 2.3: Expression profiles of transcripts involved in G. nigrifrons immune response detected by RT-qPCR. Each bar represents the fold change of G. nigrifrons transmitters versus control leafhoppers. The relative expression level of each transcript was nomalized to ribosomal protein S13 (RPS13), and then calibrated to control leafhoppers. Relative expression was calculated based on a mean of three biological replicates concluding 30 individuals. *P < 0.05; **P < 0.01.

Table 2.1: Primer sequences, efficiencies and correlation of potential RT-qPCR reference genes for G. nigrifrons. aα-TUB, alpha tubulin, EF-1α, elongation factor 1-alpha, GAPDH, glyceraldehyde-3-phosphate dehydrogenase, SDHA, succinate dehydrogenase, RPL3, ribosomal protein L3, RPS13, ribosomal protein S13. bE, PCR efficiency was calculated by the equation E = 10[-1/slope]. cR2, correlation co-efficient was calculated from standard curve.

able 2.2: Primer sequences and efficiencies of candidate genes evaluated for differential expression among MFSV transmitters and control G. nigrifrons (RT-qPCR).aAChR, acetylcholine receptor subunit alpha-L1; ATG 5, autophagy protein 5; PGRP, peptidoglycan recognition protein; TPP II, tripeptidyl peptidase II. bEfficiency was calculated by the equation E = 10[-1/slope].

CHAPTER 3

Differential expression of immune response transcripts in Graminella nigrifrons

against Maize fine streak virus challenge

Abstract

The black-faced leafhopper (Graminella nigrifrons) is the only known vector for

Maize fine streak virus (MFSV), an emerging plant pathogen within the

Rhabdoviridae. Within a laboratory G. nigrifrons population, individuals can be experimentally separated into three types based on their capacity for viral transmission: transmitters, acquirers and non-acquirers. In this study, we compared the expression profiles and genetic variation for ten transcripts putatively functioning in insect immune response among the three types using real time quantitative PCR

(RT-qPCR) after MFSV challenge. The overall suppression of these transcripts was detected in MFSV challenged leafhoppers compared to the control (MFSV unchallenged) leafhoppers. Significant down-regulation of Ars-2, Dcr-2 and Ago-2 was observed in acquirers and non-acquirers, whereas transmitters had either similar or higher expression than control leafhoppers. Three out of four transcripts for peptidoglycan recognition proteins (PGRP - SB1, SD, and LC) and transcript Toll were expressed similarly in all MFSV challenged G. nigrifrons (i.e. no differences among three types) but were significantly suppressed compared to control. However,

PGRP-LB showed similar expression in all leafhoppers (challenged and unchallenged). Genetic variation was also detected among three types, including a non-synonymous SNP in the MFSV-N gene, identified only in transmitters. We

46 hypothesized that the humoral and RNAi defenses are differentially regulated among three types of G. nigrifrons, but that vector competence results from complex interactions among vector, virus and environment.

Introduction

Arthropods, and more specifically insects, are well known as vectors for both animal and plant diseases. Most arthropod-borne virus (arbovirus) research has focused on vector-borne zoonotic pathogens (Ahmed et al., 2009), and molecular interactions with plant pathogen vectors have received less attention in comparison. In fact, many severe plant diseases are caused by viruses that are exclusively transmitted by hemipteran insects within the Aphididae, Delphacidae and Cicadellidae (Ammar and Nault, 2002; Nault, 1997). For example, the planthopper Peregrinus maidis

(Hemipetera: Delphacidae), an efficient vector for the plant-infecting rhabdovirus

Maize mosaic virus (MMV), has caused severe corn disease since 1914 (Falk and

Tsai, 1985; Kunkel 1921), and has resulted in up to 100% yield loss (Jackson et al.

2005; Redinbaugh & Hogenhout 2005; Brewbaker 1981). Understanding the factors affecting virus spread and the interactions among disease triangle (host plant-viral pathogen-vector) is the key to control viral diseases.

The black-faced leafhopper Graminella nigrifrons (Hemiptera: Cicadellidae) is the only known insect vector capable of transmitting the emerging nucleorhabdovirus

Maize fine streak virus (MFSV) in a persistent propagative manner (Redinbaugh et al., 2002; Todd et al., 2010). Rhabdoviruses have a wide host range and cause severe diseases and serious economic loss (Hogenhout et al., 2003; Jackson et al., 2005;

Kuzmin et al., 2009). These negative single-stranded RNA viruses are encapsulated into a lipid bilayer membrane and mainly vectored by arthropods through horizontal

47 transmission. Among the nine recognized Rhabdoviridae genera, only

Nucleorhabdovirus and Cytorhabdovirus infect plants, and most of the plant-infecting rhabdoviruses are specifically transmitted by one or a few closely related insect species including aphids, planthoppers and leafhoppers (Ammar et al., 2009; Goodin and Jackson, 2002; Hogenhout et al., 2003; Jackson et al., 2005). MFSV was first detected in Georgia, USA, in 1999 (Redinbaugh et al., 2002). Similar to other plant-infecting rhabdoviruses, MFSV has a broad range of host plants including maize and other economic important monocots such as barley, oats and wheat. A 4-week post-first access to disease period (PADP, the interval from the beginning of the acquisition access period to the end of the inoculation access period) is necessary for

MFSV transmission, and longer acquisition access periods (AAP) tend to increase the virus titer and transmission rate (Todd et al., 2010).

Although transmission is specific to G. nigrifrons, vector competence varies within laboratory populations. Individuals can be experimentally categorized into three types after 4-week PADP. Transmitters are able to transmit MFSV to healthy host plants after virus replication, acquirers are not able to transmit MFSV but virus replication occurs, and neither transmission nor replication occurs in non-acquirers

(Redinbaugh et al., 2002; Todd et al., 2010). Physical barriers such as the midgut and salivary glands are proposed to be important for preventing rhabdoviruses infection

(Ammar et al., 2009; Hogenhout et al., 2003). Reaching and infecting the salivary glands of G. nigrifrons is the key step for MFSV transmission. Although genetic differences among receptors on barriers are likely to be determinants for vector competence, insect immune responses, including RNAi and humoral pathways are also important for virus resistance (Ammar et al., 2009).

48 Unlike vertebrates, insects lack an adaptive immune response for viral defense.

RNA interference (RNAi) has been previously described as an important antiviral defense in insects such as Drosophila melanogaster and Aedes aegypti (Blair, 2011; van Mierlo et al., 2011; Wu et al., 2010). Viral double stranded RNAs (dsRNAs) produced during virus replication are recognized by host cells, which triggers the cleavage of long dsRNAs into 21 to 24 nucleotide small interfering RNAs (siRNAs) by protein Dicer, which is a double-stranded RNA-specific endoribonuclease belonging to RNase III family. Then the siRNAs are incorporated into the RNA induced silencing complex (RISC), which includes the protein Argonaute (Ago). The

RISC guides the sequence-specific degradation of the target viral mRNA (Ding and

Voinnet, 2007). In Drosophila, siRNAs are processed by Dicer-2 (Dcr2) and recruited by Ago2 (Ding and Voinnet, 2007), whereas the proteins Loquacious isoform PD

(Loqs-PD) and Arsenic resistance protein 2 (Ars-2) are required for the cleavage function of Dcr-2 (Sabin et al., 2009; van Mierlo et al., 2011). It is not well documented if or how this pathway protects G. nigrifrons from MFSV infection, therefore, understanding how these RNAi transcripts respond to MFSV will provide clues to its potential role for viral defense.

Besides the RNAi pathway, insect humoral responses including Toll and immune deficiency (IMD) pathways are also involved in viral defense (Costa et al.,

2009; Xi et al., 2008; Zambon et al., 2005). Both pathways regulate the production of antimicrobial peptides (AMPs) through activation of the NF-κB signaling cascade.

These pathways are initiated by the recognition and binding of non-self molecules to pattern recognition receptors (PRRs) such as peptidoglycan recognition proteins

(PGRPs). The receiving of defense signals by immune cells triggers phosphorylation and degradation of the protein Cactus (Toll pathway) and Relish (IMD pathway),

49 which are inhibitors of NF-κB transcription factors. Once these NF-κB transcription factors are released and bound to AMP genes, transcription is activated and AMPs are then rapidly produced (Hoffmann, 2003). The Toll and IMD pathways are well documented for resisting fungi and bacterial infection by recognizing and binding pathogen associated molecular patterns (PAMPs) to specific PGRPs (Charroux et al.,

2009; Dziarski and Gupta, 2006; Hoffmann, 2003). However, the antiviral function of humoral response was only studied in D. melanogaster and A. aegypti, and the role of

Toll or IMD pathway in plant-infecting rhabdovirus response is unclear.

To elucidate how G. nigrifrons immunity responds to MFSV, we compared the expression of candidate immune transcripts involved in RNAi and humoral pathways.

Expression was compared among the three types of G. nigrifrons as well as unchallenged leafhoppers using RT-qPCR. In addition, we sequenced these transcripts

(as well as the MFSV N gene) to determine if polymorphism among three types was linked to differences in gene expression. Our data revealed a complex molecular interaction among vector, virus, and possibly the host plant, and advanced our understanding the role of insect immune response in plant pathogen transmission and vector competence.

Methods and Materials

Insects and virus maintenance

A laboratory population of G. nigrifrons was maintained on susceptible maize

(Zea mays L. hybrid Early Sunglow) at OARDC. Insects were reared in a growth chamber with 70% humidity at 25°C for 16h of light and 22°C for 8h of dark period.

MFSV was also maintained on Early Sunglow maize, using serial transfers with the

G. nigrifrons laboratory population (Chen et al., 2012; Todd et al., 2010).

50 Identification of the three types of G. nigrifrons

G. nigrifrons were identified as transmitters, acquirers and non-acquirer using the protocol in Chen et al. (2012). Briefly, susceptible Early Sunglow maize seedlings were used as test plants to separate G. nigrifrons transmitters from acquirers and non-acquirers based on MFSV symptoms. Each 4-day old healthy maize seedling (not challenged with MFSV) was caged with a G. nigrifrons individual that had been feeding on MFSV infected maize for 21 days. After one week inoculation, G. nigrifrons was collected, and the test plants were moved to a separate growth chamber for MFSV symptom development. Leafhoppers were classified as transmitters if the

MFSV symptoms of chlorotic streaks were visible on the test plants. Leaf tissue from asymptomatic test plants was tested for the presence of MFSV by protein-A sandwich

(PAS)-ELISA (Todd et al., 2010). Healthy and symptomatic MFSV-infected maize were used as negative and positive controls respectively. MFSV antiserum was diluted to 1: 800, and the A405 value was detected from 0 to 20 min at 5 min intervals after the addition of substrate. Plants were considered uninfected infected if the increase in absorbance at 405 nm was less than the mean plus six standard deviations of the increase for the negative controls (Edwards and Cooper, 1985; Todd et al.,

2010). Additionally, a reverse transcription PCR (RT-PCR) assay was used to distinguish between G. nigrifrons acquirers and non-acquirers and to confirm the virus presence in transmitters. Total RNA was extracted from G. nigrifrons individuals using Trizol, and a 1120 bp fragment of the MFSV N gene was amplified using 300ng of isolated RNA (Chen et al., 2012; Todd et al., 2010). PCR products were electrophoresed on 1% agarose gel. Acquirers were those leafhoppers that showed positive RT-PCR bands for the MFSV N gene in insects but negative for

MFSV with the PAS-ELISA and no visible symptoms for test plants. Non-acquirers

51 were identified as leafhoppers with negative results for both molecular diagnostics

(RT-PCR and PAS-ELISA) and the presence of MFSV on the test maize.

Expression of immune response transcripts among three types of G. nigrifrons

Expression of the 10 transcripts, peptidoglycan recognition protein SB1

(PGRP-SB1) (GnigEST015027), PGRP-SD (GnigEST009213), PGRP-LB

(GnigEST000947), PGRP-LC (GnigEST006324), Toll (GnigEST018495), spaetzle

(GnigEST007408), defensin (GnigEST011432), Ars-2 (GnigEST001871), Dcr-2

(GnigEST006630) and Argonaute (GnigEST009734) was evaluated using RT-qPCR.

Total RNA from ten leafhoppers (five males and five females) from each type was pooled as one biological replicate, using the same amount of RNA per individual

(150ng). The TURBO DNA-free kit (Ambion, Grand Island, NY) was used to remove

DNA contamination from RNA samples. Treated RNA (1μg) was used for cDNA synthesis with the SuperScript III First-Strand Synthesis System (Invitrogen, Grand

Island, NY). Expression profiles of target transcripts were examined by real time quantitative PCR (RT-qPCR), which was performed using 40ng of reversed transcribed cDNA template, 5 pmole of each primer and 5µl iQ SYBR Green Mix

(Bio-Rad, Hercules, CA) in a 10µl reaction. Primers were designed by Beacon

Designer 7.0 (Bio-Rad, Hercules, CA), with sequence information shown in

Supplementary Table 1. The target transcripts were amplified at 95°C for 3 min followed by 40 cycles of 95°C for 10 s and 60°C for 30 s. Nuclease-free water was used as a negative control. For each G. nigrifrons type, three biological replicates were evaluated and the leafhoppers maintained on healthy maize were used as calibrator (control). Expression of candidate immune transcripts from each leafhopper type was first normalized to Ribosomal protein S13 (RPS13) (GnigEST004586),

52 which was used as reference gene (Chen et al., 2012) and then calibrated to the control (unchallenged leafhoppers). The relative expression value of each transcript

-ΔΔCt was determined using the comparative Ct method (2 values), and ANOVA was used to compare mean 2-ΔCt values (Schmittgen and Livak, 2008).

Genetic variation within transcripts in G. nigrifrons and MFSV

Except for the transcripts PGRP-LC and Ago-2, the remaining eight G. nigrifrons immune response transcripts that were examined by RT-qPCR were amplified and sequenced. From the transmitters and acquirers, we also included the

MFSV N gene as a control to confirm the virus presence and potentially identify any polymorphism in virus sequence. cDNA of five leafhoppers from each G. nigrifrons type was individually reverse transcribed from DNase treated total RNA as described above. PCR was performed with 40ng of cDNA, 5pmol for each primer and Terra

PCR Direct Polymerase Mix (Clontech, Mountain View, CA). Primer sequences and cycling conditions, which varied depending on locus, are provided in Supplementary

Table 2. Amplification to the expected size was evaluated on a 1% agarose gel and then purified using the QIAquick PCR Purification Kit (Qiagen, Germantown, MD).

Purified PCR products were pooled per individual and then sequenced using an Ion

Torrent at the Ohio University genomics facility following manufacturer’s instruction.

Sequencing libraries for each individual were individually barcoded, and a total of 15 individuals were sequenced on a single 314 chip (five per type). Quality processing including adapter and poly A trimming was performed post-sequencing and the resulting reads were mapped to reference sequences using CLC Genomics

Workbench. The reference sequences were obtained from G. nigrifrons transcriptome database (Chen et al., 2012) and GenBank (Accession number, NC_005974.1; gene

53 ID, 2886022). Mapping parameters were set as mismatch cost: 1; insertion cost: 1; deletion cost: 1; length fraction: 0.4 and similarity fraction: 0.8. After mapping, single nucleotide polymorphisms (SNPs) were detected using the parameters: minimum coverage: 20; minimum variant frequency (%): 35 and maximum expected alleles: 2.

The open reading frame (ORF) of each transcript was predicted using blastx against non-redundant protein sequences database. The obtained SNPs were compared to the reference sequences to detect putative non-synonymous SNPs using the predicted

ORF.

Results

Expression of immune response transcripts among three types of G. nigrifrons

Previous evidence in other arthropod vectors suggested that genes involved in the RNAi, Toll or IMD pathway would be involved in response to virus infection

(Fragkoudis et al., 2009; Xi et al., 2008); however, data is limited on hemipteran vectors of rhabdoviruses. RT-qPCR was performed to examine the expression of 10 transcripts that putatively function in insect response to virus infection. Differential expression was observed among three types based on candidate transcripts and immune pathways (Figure 1). For example, we observed substantial differences in expression for the transcripts Ars-2, Dcr-2 and Ago-2, which are known as key elements that function in the RNAi pathway. Acquirers and non-acquirers showed significant suppression whereas transmitters had the same level of expression as control leafhoppers for Ars-2, Dcr-2, and a significantly higher level for Ago-2 (Fig.

1A). PGRPs, which are involved in the initiation of humoral pathways, showed a significant suppression (specifically PGRP-SB1, SD, LC) in all MFSV challenged leafhoppers (transmitters, acquirers and non-acquirers), but no difference was seen for

54 PGRP-LB (Fig. 1B). The expression of Toll was significantly reduced in all three types after MFSV challenge; spaetzle was also suppressed, and it was significantly lower in acquirers and non-acquirers. However, no difference was observed in the expression of defensin among G. nigrifrons three types or to the control (Fig. 1C).

Genetic variation of transcripts in G. nigrifrons and MFSV

A total of 15 individuals from G. nigrifrons transmitters, acquirers and non-acquirers (five individuals from each type) were used to analyze genetic variation within these immune transcripts. Table 1 reveals the mapping results of 15 G. nigrifrons individuals to the reference sequences. Substantial coverage was obtained per individual and per transcript, with a range from 19X to 244X. Most reads were mapped to the reference sequence; the averages of unmapped reads for each type were

23.49%, 24.06% and 29.10% respectively, and were not significantly different (P >

0.5).

Table 2 displays the number of SNPs detected from each transcript across all three types. We observed at least two SNPs for every transcript; however, the distribution of SNPs differed among transcripts and three types of G. nigrifrons. For example, transcript defensin contained the most variation (14 SNPs), but more than half (eight) of SNPs were shared among all three G. nigrifrons types and none of them was specific to transmitters. Interestingly, although there were fewer SNPs (12) found for transcript PGRP-LB, all of them were specific to transmitters. SNPs of MFSV N transcript were only detected from G. nigrifrons transmitters and acquirers.

Since SNPs were found within the coding region of every transcript, we also analyzed the number of putative non-synonymous SNPs (nsSNPs) (Table 2). Most

SNPs resulted in a synonymous change (47 of sSNPs/64 total SNPs), and no nsSNPs

55 were found in transcripts PGRP-SD and Ars-2. PGRP-LB was the only transcript that had putative nsSNPs specific to transmitters, but these had low frequency (i.e. the 4 nsSNPs were only found within one individual). The basic chemical properties of most nsSNPs did not change. For example, within PGRP-LB, both isoleucine and valine are aliphatic hydrophobic amino acids, and both asparagine and aspartic acid are capable to form hydrogen bond. Similarly for nsNSPs within Dcr-2, which has most nsSNPs, lysine, arginine, asparagines, aspartic aicd and glutamic acid are all polar amino acids. Two nsSNPs in PGRP-LB changed the polarity of the original amino acids, but none of observed nsSNPs is at the functional sites (active or binding site) of this transcript.

Discussion

MFSV is an emerging plant-infecting rhabdovirus which is specifically transmitted by the black-faced leafhopper G. nigrifrons. Within this insect species, vector competence varies among individuals, providing an opportunity to investigate the differential physiological and molecular regulations among three types of G. nigrifrons as well as the interactions between virus and insect. Therefore, we analyzed how G. nigrifrons antiviral immunity responds to MFSV challenge and whether or not differences among three types exist that may explain the variation in vector competence. We focused our study on comparing the expression and genetic variation of ten transcripts that putatively function in G. nigrifrons antiviral pathways among three types of G. nigrifrons.

56 Differentially expressed immunne transcripts and their potential role in MFSV transmission

Insect innate immunity is an essential mechanism responding to invasion or infection by exogenous organisms. In particular, antiviral immunity was reported as a primary mechanism protecting insects from viral infection (Ding and Voinnet, 2007;

Hoffmann, 2003). RNAi is a well-known antiviral pathway controlling arbovirus infection in both D. melanogaster and A. aegypti (Blair, 2011; van Mierlo et al., 2011;

Wu et al., 2010). Similarly, the PGRP mediated Toll pathway has been reported as another key factor controlling infection of Drosophila X virus (DXV) (Zambon et al.,

2005) as well as Dengue virus (Xi et al., 2008). It seems that antiviral immunity is a multi-genetic function instead of operating by a single factor or pathway, which is supported by our differentially expressed immune transcripts results.

G. nigrifrons is an ideal system to study the molecular basis of transmission because of the natural variation in vector competence. Our data showed an overall suppression of transcripts putatively functioning in both RNAi and Toll pathways in

MFSV challenged G. nigrifrons compared to unchallenged leafhoppers. Similarly, a large number of down-regulated immune response genes were also seen in mosquito

A.aegypti cells after Dengue virus infection (Jiang et al., 2003). Although Drosophila immune defense has been reported to be activated after DXV or Sigma virus

(SIGMAV, Rhabdoviridae) infection (Tsai et al., 2008; Zambon et al., 2005),

Carpenter et al., (2009) reported unchanged transcriptional regulation of transcripts in

Drosophila Toll, IMD or Jak-STAT pathways after SIGMAV infection. The difference in immune genes expression might be due to different viral infection stages. Virus-host interactions could be changed upon infection stages, therefore, G. nigrifrons might mount immune response once MFSV was detected. However, in our

57 study, we compared the transcriptional expression of immune response transcripts at one time-point (after 4-week PADP), which possibly provided MFSV enough time to suppress G. nigrifrons immune defense. The observed decrease in gene expression may be a mechanism to more quickly return to an equilibrium or baseline state

(similar to uninfected leafhoppers). This hypothesis could be confirmed by analyzing the level and activity of proteins that are encoded by these immune transcripts.

We also observed a difference in expression between these two pathways specific only to transmitters. Transcripts Ars-2, Dcr-2 and Ago-2 were not suppressed in transmitters compared to acquirers and non-acquirers, but four PGRPs and Toll was expressed similarly in all MFSV challenged G. nigrifrons. In contrast to most suppressed transcripts, there was no change in PGRP-LB expression among all MFSV challenged G. nigrifrons and control leafhoppers (Figure 1). Even though it is unclear which PGRPs are particularly involved in G. nigrifrons Toll pathway, the different regulation of Toll and 3 transcripts in RNAi pathway might indicate a role for different defense mechanisms (humoral and RNAi pathways) upon MFSV challenge and infection.

While our data showed significant difference in transcriptional expression, vector competence could also be indirectly affected by many factors such as the environment, host plant and nymphal nutrition (Gingery et al., 2004; Takahashi,

1976). Since control and treated leafhoppers were maintained at the same environmental conditions, host plant and nymphal nutrition might have more important effects on G. nigrifrons antiviral immunity regulation. First, MFSV infection could change physiological processes in the host plant, which subsequently affects feeding of G. nigrifrons (Cory and Hoover, 2006). Second, G. nigrifrons nymphs might lack adequate nutrients to mount an effective immune response when

58 they continuously feed on MFSV infected maize, since the streaking symptomology of MFSV infection likely impacts photosynthesis rates and nutrient production. Third, although leafhopper-borne viruses are not known to influence the longevity or fecundity of their insect hosts, MFSV might suppress immune response by attacking

G. nigrifrons fat body cells, where most of immune proteins and peptides are produced (Littau and Maramorosch, 1956; Maramorosch, 1958). In our study, G. nigrifrons individuals were maintained on symptomatic MFSV maize since emergence, therefore we hypothesize that the significantly suppressed immune responses in MFSV challenged individuals may have been due to a combination of host plant immune response, lack of nutrition and MFSV infection. Our future work will study the effect of nutritive qualities of host plants on insect antiviral immunity to further understand the Graminella-MFSV-maize interaction.

Ample genetic variation does not lead to differences in expression

Non-synonymous SNPs within coding regions alter amino acid sequences, which could lead to possible structural changes and improper protein function and physiological metabolism. We analyzed the level of genetic variation within coding region of transcripts putatively functioning in G. nigrifrons immune response, which might have explained the observed expression differences.

We observed different numbers of SNPs for each transcript, including both synonymous and non-synonymous SNPs. However, we did not see any correlation between the expression levels of each transcript and the presence of synonymous/non-synonymous SNPs. For example, we observed the differently expressed Ars-2 and Dcr-2 in transmitters vs acquirers and non-acquirers, but there was no difference in the distribution of SNPs among three types of G. nigrifrons. In

59 stark contrast, twelve transmitter-specific SNPs were detected from transcript

PGRP-LB, and four of them are non-synonymous; however, we did not observe any significant expression difference among 3 types of G. nigrifrons for this transcript.

Although transcript Dcr-2 had the most nsSNPs, four out of five nsSNPs did not change the polarity of the original amino acids. Only one nsSNP (phenylalanine to cysteine) might influence the interaction with other amino acids, since cysteine usually covalently bonds to other cysteine residues to form disulfide bonds. However, none of observed nsSNPs were located at the predicted active or binding sites of protein Dcr-2, which suggested the structure and function of Dcr-2 should not be significantly different among three types. Interestingly, we also saw a transmitter specific non-synonymous SNP from MFSV-N gene, although the chemical properties of these two amino acids are similar (Lysine changed to Arginine). Since the high specificity of this virus to a single vector might be due to the interaction between

MFSV and G. nigrifrons (Hogenhout et al., 2008), we hypothesize that this relationship might be different in transmitters from acquirers and non-acquirers.

Although more evidence is required to support this hypothesis, it is possible that vector competence is not only due to genetic variation in insect vector transcripts but also the virus (Gray and Banerjee, 1999). MFSV virions might evolve to bind to certain receptors on the G. nigrifrons salivary gland membrane to invade and be transmitted to other host plants. Since we only partially amplified each transcript using cDNA, SNPs at the 5’ and 3’ UTRs, introns and the rest of exons are missed.

Therefore, our current SNP results might not fully represent the relationship between genetic variants and vector competence. Our future work will use more individuals from each type to discover more variation from wider region of viral and G. nigrifrons immune transcripts.

60 In this study, we observed the differential expression of immune transcripts between MFSV challenged G. nigrifrons and control leafhoppers, among different types and among humoral and RNAi pathways. We hypothesize that the humoral response could be the overall defense mechanism to all exogenous organisms including virus, and the RNAi pathway might specifically target to the MFSV challenge. Our future work will decipher which specific tissue these immune response transcripts expressed in G. nigrifrons, and how these two immune pathways interact to respond to MFSV challenge, which helps to understand the complexity of vector-virus-host interactions.

References

Ammar, E. D., and Nault, L. R. (2002). Virus transmission by leafhoppers, planthoppers and treehoppers (Auchenorrhyncha, Homoptera). Advances in Botanical Research, Vol 36 36, 141-167.

Blair, C. D. (2011). Mosquito RNAi is the major innate immune pathway controlling arbovirus infection and transmission. Future Microbiol 6, 265-77.

Charroux, B., Rival, T., Narbonne-Reveau, K., and Royet, J. (2009). Bacterial detection by Drosophila peptidoglycan recognition proteins. Microbes Infect 11, 631-6.

61 Connor, J. H., McKenzie, M. O., Parks, G. D., and Lyles, D. S. (2007). Antiviral activity and RNA polymerase degradation following Hsp90 inhibition in a range of negative strand viruses. Virology 362, 109-19.

Cory, J. S., and Hoover, K. (2006). Plant-mediated effects in insect-pathogen interactions. Trends Ecol Evol 21, 278-86.

Costa, A., Jan, E., Sarnow, P., and Schneider, D. (2009). The Imd Pathway Is Involved in Antiviral Immune Responses in Drosophila. Plos One 4, e7436.

Ding, S. W., and Voinnet, O. (2007). Antiviral immunity directed by small RNAs. Cell 130, 413-26.

Dow, J. A., Davies, S. A., Guo, Y., Graham, S., Finbow, M. E., and Kaiser, K. (1997). Molecular genetic analysis of V-ATPase function in Drosophila melanogaster. J Exp Biol 200, 237-45.

Dziarski, R., and Gupta, D. (2006). The peptidoglycan recognition proteins (PGRPs). Genome Biology 7, 232.

Edwards, M. L., and Cooper, J. I. (1985). Plant virus detection using a new form of indirect ELISA. Journal of Virological Methods 11, 309-319.

Fragkoudis, R., Attarzadeh-Yazdi, G., Nash, A. A., Fazakerley, J. K., and Kohl, A. (2009). Advances in dissecting mosquito innate immune responses to arbovirus infection. J Gen Virol 90, 2061-72.

Gingery, R. E., Anderson, R. J., and Redinbaugh, M. G. (2004). Effect of environmental conditions and leafhopper gender on Maize chlorotic dwarf virus transmission by Graminella nigrifrons (Homoptera: Cicadellidae). J Econ Entomol 97, 768-73.

Goodin, M. M., and Jackson, A. O. (2002). Nucleorhabdovirus. Springer Index of Viruses, 1074-1077.

Gray, S. M., and Banerjee, N. (1999). Mechanisms of arthropod transmission of plant and animal viruses. Microbiology & Molecular Biology Reviews 63, 128-148.

Hoffmann, J. A. (2003). The immune response of Drosophila. Nature 426, 33-8.

Hogenhout, S. A., Ammar, E. D., Whitfield, A. E., and Redinbaugh, M. G. (2008). Insect vector interactions with persistently transmitted viruses. Annual Review of Phytopathology 46, 327-359.

Hogenhout, S. A., Redinbaugh, M. G., and Ammar, E. D. (2003). Plant and animal rhabdovirus host range: a bug's view. Trends in microbiology 11, 264-271.

Jackson, A. O., Dietzgen, R. G., Goodin, M. M., Bragg, J. N., and Deng, M. (2005). Biology of plant rhabdoviruses. Annual Review of Phytopathology 43, 623-660.

62 Kuzmin, I. V., Novella, I. S., Dietzgen, R. G., Padhi, A., and Rupprecht, C. E. (2009). The rhabdoviruses: biodiversity, phylogenetics, and evolution. Infection Genetics and Evolution 9, 541-53.

Littau, V. C., and Maramorosch, K. (1956). Cytological effects of aster-yellows virus on its insect vector. Virology 2, 128-30.

Maramorosch, K. (1958). SECTION OF BIOLOGY: VIRUSES THAT INFECT AND MULTIPLY IN BOTH PLANTS AND INSECTS*. Transactions of the New York Academy of Sciences 20, 383-393.

Nault, L. R. (1997). Arthropod transmission of plant viruses: a new synthesis Annals of the Entomological Society of America 90, 521-541.

Sabin, L. R., Zhou, R., Gruber, J. J., Lukinova, N., Bambina, S., Berman, A., Lau, C.-K., Thompson, C. B., and Cherry, S. (2009). Ars2 Regulates Both miRNA- and siRNA- Dependent Silencing and Suppresses RNA Virus Infection in Drosophila. Cell 138, 340-351.

Schmittgen, T. D., and Livak, K. J. (2008). Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3, 1101-8.

Sim, S., and Dimopoulos, G. (2010). Dengue virus inhibits immune responses in Aedes aegypti cells. Plos One 5, e10678.

Takahashi, M. (1976). The effects of environmental and physiological conditions of Culex tritaeniorhynchus on the pattern of transmission of Japanese encephalitis virus. J Med Entomol 13, 275-84.

Todd, J. C., Ammar el, D., Redinbaugh, M. G., Hoy, C., and Hogenhout, S. A. (2010). Host plant range and leafhopper transmission of maize fine streak virus. Phytopathology 100, 1138-45.

Tsai, C. W., McGraw, E. A., Ammar, E. D., Dietzgen, R. G., and Hogenhout, S. A. (2008). Drosophila melanogaster mounts a unique immune response to the Rhabdovirus sigma virus. Appl Environ Microbiol 74, 3251-6. van Mierlo, J. T., van Cleef, K. W., and van Rij, R. P. (2011). Defense and counterdefense in the RNAi-based antiviral immune system in insects. Methods Mol Biol 721, 3-22.

Wu, Q., Luo, Y., Lu, R., Lau, N., Lai, E. C., Li, W. X., and Ding, S. W. (2010). Virus discovery by deep sequencing and assembly of virus-derived small silencing RNAs. Proc Natl Acad Sci U S A 107, 1606-11.

63 Xi, Z., Ramirez, J. L., and Dimopoulos, G. (2008). The Aedes aegypti toll pathway controls dengue virus infection. PLoS Pathog 4, e1000098.

Figure 3.1: Expression of immune response transcripts among three types of G. nigrifrons evaluated by RT-qPCR. Relative expression calculated using ΔCt values, with normalization to internal control RPS13. *P < 0.05; NS, no significant difference.

Table 3.1: Primer sequences and efficiencies of candidate transcripts of G. nigrifrons evaluated by RT-qPCR. aAgo-2, Argonaute 2; Ars-2, Arsenic resistance protein 2; PGRP, peptidoglycan recognition protein. bEfficiency was calculated by the equation E = 10[-1/slope].

Table 3.2: Primer sequences, annealing temperatures and extension times for amplifying 14 transcripts. Transcript putatively functions as Dicer-2 was amplified using four pairs of primer due to the length of this transcript. F1 to F4 represent these four fragments, each fragment has approximate 100 base pair (bp) overlap with its adjacent fragment. The open reading frame of this transcript was 4839 bp.

Table 3.3 Reads mapping of 15 G. nigrifrons individuals sequenced using Ion Torrent. Bar coding, Ion Torrent adapter sequences and poly A sequence were trimmed off before mapping. Sequence of 13 G. nigrifrons transcripts from EST database and MFSV N gene were used as reference sequences. Mapping parameters: mismatch cost: 1; insertion cost: 1; deletion cost: 1; length fraction: 0.4 and similarity fraction: 0.8.

Table 3.4: SNPs detection from 15 individuals among three types of G. nigrifrons. Reads mapping, SNPs position and allele variants were analyzed by CLC Genomics Workbench. SNPs position and allele variants were called after trimming off bar coding, Ion Torrent adapter sequences and poly A sequence from raw sequencing data. SNPs of MFSV N transcript were only detected from G. nigrifrons transmitters and acquirers. The letters T, A and N represent transmitters, acquirers and non-acquirers respectively.

CHAPTER 4

RNAi mediated silencing of immune transcripts in Graminella nigrifron

Abstract

RNA interference (RNAi) has been widely used for studying the interactions between viruses and hosts as well as understanding the functions of candidate genes. The objective of this study was to develop an RNAi method to study the functions of two immune response transcripts, PGRP-LC and Dcr-2 in the black-faced leafhopper

Graminella nigrifrons, related to virus acquisition and transmission. G. nigrifrons is the only known vector for Maize fine streak virus (MFSV), an emerging plant-infecting nucleorhabdovirus. The expression of PGRP-LC and Dcr-2 were reduced to 30% and 20% of levels in control leafhoppers respectively, after injection of dsRNAs. The reduction in expression was equally effective for both nymphs and adults, lasting from 2 to 14 days post injection (dpi) for PGRP-LC and from 2 to 22 dpi for Dcr-2. There was no effect on MFSV transmission or acquisition between control and dsRNAs for PGRP-LC or Dcr-2 injected leafhoppers. However, acquisition was significantly higher in Dcr-2 silenced leafhopper than in PGRP-LC silenced leafhoppers. Significantly higher mortality (greater than 90%) occurred in leafhoppers injected with dsRNA for PGRP-LC by 27 dpi feeding on healthy and

MFSV symptomatic maize. More interestingly, injection of dsRNA for PGRP-LC resulted in an increase in ‘abnormally molted’ leafhoppers. The effects of knocking down PGRP-LC on abnormal eclosion and mortality suggest a connection between insect molting and immune defense. The successful use of RNAi to silence G.

70 nigrifrons transcripts will facilitate the study of gene function in the leafhopper, and may provide approaches for developing targets of RNAi-based pest control.

Introduction

The black-faced leafhopper Graminella nigrifrons (Forbes) (Hemiptera:

Cicadellidae) is an important hemipteran pest with a wide distribution ranging from

Central America to Canada (Stoner and Gustin, 1967). G. nigrifrons causes damage and yield loss to economic cereals such as maize, barley and wheat. The damage is due not only to direct feeding, but also to viral diseases that are transmitted by the leafhopper. G. nigrifrons is a vector for Maize chlorotic dwarf virus (MCDV), which is an economically important disease of maize (Choudhury and Rosenkranz, 1983;

Gordon and Nault, 1977). Recently, G. nigrifrons is also the only vector identifiedfor the emerging plant-infecting nucleorhabdovirus, Maize fine streak virus (MFSV)

(Redinbaugh et al., 2002; Todd et al., 2010).

MFSV is transmitted by G. nigrifrons in a persistent propagative manner.

MFSV replicates within G. nigrifrons after it is acquired through feeding, and the inoculative insects are able to transmit the virus to other host plants for the remainder of their life span (Ammar et al., 2009). A 4-week post-first access to disease period

(PADP, the interval from the beginning of virus acquisition to the end of the virus inoculation period) is necessary for MFSV transmission, and longer acquisition access periods (AAP) tend to increase the virus titer and transmission (Creamer et al., 1997;

Todd et al., 2010). Vector competence varies within laboratory populations, and G. nigrifrons individuals can be experimentally separated into 3 types: transmitters, which can transmit MFSV to new host plants after a 4-week PADP; acquirers, which are positive for MFSV by ELISA or RT-PCR, but do not transmit the virus; and,

71 non-acquirers, which are neither positive nor able to transmit the virus (Redinbaugh et al., 2002; Todd et al., 2010). Physical barriers, such as midgut and salivary glands are hypothesized to limit rhabdoviruses replication and dissemination within insect vectors (Ammar et al., 2009; Hogenhout et al., 2003). MFSV could be detected from neural tissues, visceral muscles and hemocytes by a 2-week AAP, which suggests

MFSV overcomes the midgut barrier by two weeks after acquisition. Then, MFSV reaches and overcomes the salivary glands by the 3rd or 4th week PADP, from which

MFSV could be transmitted to a new host plant during insect feeding (Ammar et al.,

2009; Todd et al., 2010). Genetic variation of receptors on these physical barriers are also hypothesized to determine the capability of virus transmission. Additionally, G. nigrifrons immune response possibly play an essential role in responding to MFSV challenge (Ammar et al., 2009).

The insect innate immune system is a key defense mechanism protecting insects from exogenous infectious organisms such as bacteria and fungi (Govind, 2008;

Hoffmann, 2003). It is also proposed to function in virus resistance (Ammar et al.,

2009; Avadhanula et al., 2009; Tsai et al., 2008; Xi et al., 2008). Humoral pathways, such as the Toll and immune deficiency (IMD) pathways are mediated by pattern recognition receptors (PRRs), and regulate the production of antimicrobial peptides

(AMPs) that attack the pathogens. Peptidoglycan recognition proteins (PGRPs) are important PRRs that recognize pathogen-associated molecular patterns (PAMPs) produced by bacteria and fungi. The binding of non-self molecules, such as PAMPs, to PGRPs initiates humoral responses, and triggers the phosphorylation and degradation of the proteins Cactus and Relish. In turn, Cactus and Relish inhibit

NF-κB transcription factors of the Toll and IMD pathways. The released transcription factors bind to AMP genes, causing rapid production of AMPs (Hoffmann, 2003).

72 In addition to humoral responses, RNA interference (RNAi) has been implicated in the insect antiviral response (Gouinguene and Turlings, 2002; Lowry et al., 1998).

The siRNA-mediated RNAi mechanism involves the sequence-specific degradation of the target viral RNA (Ding and Voinnet, 2007). In host cells, RNAi is triggered by dsRNAs produced during virus replication. Subsequently, Dicer (DCR), an RNase III family double-stranded RNA-specific endoribonuclease cleaves the long dsRNAs into

21 to 24 nucleotide small interfering RNAs (siRNAs). An effective RNA-induced silencing complex (RISC) forms when the 21-nt siRNA is incorporated into

Argonaute (Ago, the central and catalytic protein in the RISC), which guides the degradation of the target viral mRNA. There are two DCRs in Drosophila, and

Dicer-2 (Dcr2) primarily processes the siRNAs, which are subsequently recruited by

Ago2 (Ding and Voinnet, 2007; van Mierlo et al., 2011).

Since RNAi targets any mRNA with complementary sequence to siRNAs processed by DCRs, this mechanism is widely used to study gene functions (Belles,

2010). RNAi methods are being rapidly developed for insects systems especially in hemipterans such as triatomine bugs, whiteflies, planthoppers and aphids using oral feeding or micro-injection of dsRNAs (Araujo et al., 2006; Chen et al., 2010;

Jaubert-Possamai et al., 2007; Upadhyay et al., 2011; Yao et al., 2013). RNAi has also been proposed as a useful tool for pest control, knocking down vital genes that result in high insect mortality (Price and Gatehouse, 2008; Seifers et al., 2006).

Previously, we demonstrated differential expression of G. nigrifrons immune transcripts between MFSV challenged G. nigrifrons and control G. nigrifrons. These differences were identified in vector and non-vector leafhoppers, and for transcripts in both the humoral and RNAi pathways. In this study, we developed an experimental system for knocking down expression of specific transcripts in G. nigrifrons using

73 RNAi, and used this system to examine the roles of two transcripts, PGRP-LC and

Dcr-2, in response of leafhoppers to feeding on MFSV infected plants. We hypothesized that, if these two transcirpts play a role in the immune response to

MFSV, then silencing would lead to higher rates of virus acquisition and transmission by leafhoppers.

Methods and Materials

Insect and plant maintenance

A G. nigrifrons laboratory population was maintained on maize (Zea mays L.

‘Early Sunglow’) in a growth chamber with 16 h light (25°C) and 8 h dark (22°C) periods. MFSV was maintained on maize by serial transfers with G. nigrifrons (Chen et al., 2012; Todd et al., 2010).

RNA isolation and cDNA synthesis

Total RNA was isolated from individual G. nigrifrons using Trizol (Invitrogen,

Grand Island, NY) following the manufacturer’s protocol. DNA contamination was removed from the isolated RNA using DNase (TURBO DNA-free kit, Ambion,

Grand Island, NY). Then cDNA was synthesized with the treated RNA (1μg) using the SuperScript III First-Strand Synthesis System (Invitrogen, Grand Island, NY). dsRNA synthesis

RNA was transcribed using two DNA templates. For each target, two sets of primers were designed that the two products had a T7 polymerase promoter sequence at opposite 5’ ends, and used to amplify target fragments using G. nigrifrons cDNA or a GFP-containing plasmid as template (Qu et al., 2003). Primer sequences, annealing temperatures and extension times are in Table 4.1. Amplicons were purified using the

74 QIAprep Spin Miniprep Kit (Qiagen, Germantown, MD). Purified PCR products (1.5

μg for each product) were used for dsRNA synthesis with the MEGAscript RNAi Kit

(Invitrogen, Grand Island, NY) following the manufacturer’s protocol. The purified dsRNA (eluted with nuclease-free water) was evaluated on 1% agarose gels and the concentration and quality were evaluated using a Nanodrop 2000c spectrophotometer.

Each dsRNA was normalized to 3μg/μL for injection.

dsRNA injection and silencing verification

Male and female G. nigrifrons 5th instar nymphs were separated and anesthetized on ice. Each nymph was injected with total 207 nL fluid (69 nL × 3 injections) containing 621ng dsRNA using a nanoliter injector (Nanoject II,

Drummond Scientific Company, Broomall, PA). Because the Dcr-2 open reading frame is 4839bp long, three different dsRNAs were used to target to this transcript, and equal volumes (23 nL/ injection) of each dsRNAs was used for injection. Single dsRNAs were used to target the PGRP-LC and GFP (Table 4.1). Injected nymphs were maintained on healthy maize seedlings for 24 hours to check the mortality caused by injection. Surviving nymphs were collected at different time points: 2, 4, 10 and 14 days post injection (dpi) to verify silencing of the targeted transcripts. Nymphs injected with dsRNA for Dcr-2 and GFP were also collected at 22 dpi.

RT-qPCR was used to verify silencing. Primers (Table 4.2) were designed using

Beacon Designer 7.0 (Bio-Rad, Hercules, CA), such that the regions encoding dsRNA targets and RT-qPCR amplicons did not overlap. RT-qPCR was carried out at 95°C for 3 min followed by 40 cycles of 95°C for 10 s and 60°C for 30 s. Nuclease-free water was used as a negative control. Three biological replicates were evaluated for each time point. Expression of PGRP-LC and Dcr-2 was determined using the

75 -ΔΔCt comparative Ct method (2 values), the Ct value was first normalized to reference gene Ribosomal protein S13 (PRS13) and then calibrated to the control, and t-test was used to compare mean 2-ΔCt values (Chen et al., 2012).

Mortality, acquisition and transmission assay

Leafhoppers injected with dsRNA were maintained on healthy maize for 24 hours. For each target, half of the surviving nymphs were then transferred to

MFSV-symptomatic maize and the other half were maintained on healthy maize, with male and female nymphs being maintained on separate cages. Control, non-injected leafhoppers were maintained on healthy maize for 24 hours, then transferred onto

MFSV-symptomatic or healthy maize similarly to injected insects. After 21 days, leafhoppers maintained on MFSV-symptomatic maize were individually transferred to

4-day old healthy maize seedlings for a 5-day inoculation access period (IAP). The leafhoppers were then collected and the maize seedlings were maintained in a growth chamber for 3 weeks for symptom development. Transmission was evaluated based on development of MFSV symptoms in seedlings (Redinbaugh et al., 2002; Todd et al., 2010).

Mortality was recorded daily from 1 to 21 days, followed by a final check at 26 days after leafhoppers were transferred onto MFSV. Multivariate repeated measures analysis was used to compare changes in insect mortality among different treatments over time using SAS Release 9.2 (SAS Institute Inc., 2008), with P ≤ 0.05 indicating significant difference among treatments.

Virus acquisition was detected with a protein-A sandwich (PAS)-ELISA as previously described (Todd et al., 2010). MFSV-symptomatic maize leave tissue and healthy G. nigrifrons individuals served as the positive and negative controls

76 respectively. Leafhoppers were considered infected if the increase in absorbance at

405 nm was more than the mean plus six standard deviations of the increase for the negative controls (Edwards and Cooper, 1985; Todd et al., 2010). The difference in acquisition rate among three dsRNA treated and non-treated leafhoppers was analyzed by ANOVA.

Results

Silencing of PGRP-LC and Dcr-2

G. nigrifrons (three biological replicates, three males and three females per replicate) were collected beginning at two dpi to determine the levels of transcripts targeted for RNAi using RT-qPCR (Figure 4.1). Due to the high mortality in G. nigrifrons injected with dsRNAs targeting PGRP-LC, the silencing of this transcript was assessed up to 14 dpi. Expression of Dcr-2 was evaluated for up to 22 dpi.

Expression of both transcripts was significantly suppressed after 5th instar nymphs were injected with target dsRNAs compared to leafhoppers injected with dsRNA derived from GFP (Figure 4.1). PGRP-LC transcript levels were reduced by 60% at 2 dpi, and the suppression was stable through 14 dpi, by which the nymphs emerged to adults, and the transcript levels were 90% lower than in control insects injected with dsRNA for GFP. Similarly, expression of Dcr-2 was significantly reduced at each time point through 22 dpi, when expression was about 25% of that in control leafhoppers (Figure 4.1).

Effect of RNAi on leafhopper mortality

The numbers of dead leafhoppers was determined daily in cohorts injected with each dsRNA and compared with numbers for non-injected leafhoppers. Initially,

77 mortality was determined separately for males and females, but no significant differences were observed between the two sexes for any of the treatments (data not shown), so the data was pooled. Significant higher mortality was observed between 7 and 26 days after transferring leafhoppers that were injected with dsRNA for

PGRP-LC than dsRNAs for GFP or Dcr-2 or non-injected leafhoppers (Figure 4.2 and 4.3, Table 4.3). The increased mortality was independent of whether leafhoppers were transferred to MFSV-symptomatic or healthy maize at 7 days after transferring

(P < 0.05). Additionally, 42% and 24% of 5th instar nymphs molted abnormally after injection with PGRP-LC dsRNA and transfer to MFSV-symptomatic or healthy maize respectively (Figure 4.4). The incidence of abnormal molting was significantly higher for leafhoppers injected with PGRP-LC dsRNA than it was for GFP, Dcr-2 dsRNA or control leafhoppers (MFSV challenged, F = 7.85; df = 3; P < 0.01; healthy maize, F =

7.16; df = 3; P = 0.12).

Effect of RNAi on MFSV acquisition and transmission

We previously detected differential expression of Dcr-2 and PGPR-LC among three types of G. nigrifrons as well as between MFSV challenged and control leafhoppers. Therefore, the importance of these two transcripts in MFSV transmission and acquisition was tested using RNAi. Relative to non-injected control leafhoppers, no difference was seen in the proportion of transmitters or acquirers after injection of dsRNAs for PGRP-LC, Dcr-2 and GFP (Figure 4.5). But interestingly, we were able to detect MFSV from dead leafhoppers that were collected daily, and the earliest day that the virus could be detected from dead leafhoppers was 16 days after MFSV challenge. These data might suggest that PGRP-LC and Dcr-2 do not play a major role in MFSV infection of G. nigrifrons. However, the experiments were limited by the numbers of insects that could be tested and the very low proportions of

78 transmitters and acquirers in the laboratory leafhopper population. For example, at 26 days PADP, a total of three, three, one and one transmitters were identified from non-injected control, GFP dsRNA, Dcr-2 dsRNA and PGRP-LC dsRNA injected leafhoppers among all three replicates respectively.

Discussion

RNAi has been widely used to study gene function in model insects such as

Drsophila, Tribolium and Aedes (Bucher et al., 2002; Clemens et al., 2000; Coy et al.,

2012), and the technique is well developed for insects within different Orders, such as grasshoppers (Orthoptera) (Dong and Friedrich, 2005), honeybees (Hymenoptera)

(Amdam et al., 2003) and diamondback moths (Lepidoptera) (Bautista et al., 2009).

Recently, several studies focused on developing RNAi to study gene function and identify control measures for hemipteran pests, such as aphids, planthoppers, whitflies and glassy winged sharpshooters (Araujo et al., 2006; Chen et al., 2010;

Jaubert-Possamai et al., 2007; Rosa et al., 2012; Upadhyay et al., 2011; Yao et al.,

2013). However, to our knowledge, this is the first report using RNAi to knock down gene expression in a leafhopper. Using this technique, we began to study the effects of

Dcr-2 and PGRP-LC expression on leafhopper mortality and MFSV acquisition and transmission.

RNAi is effective in G. nigrifrons

Two major dsRNA delivery mechanisms have been widely used and compared in insect RNAi research: oral feeding and micro-injection (Price and Gatehouse,

2008). In this study, we used micro-injection to knock down expression of two transcripts with roles in the insect innate immune response, PGRP-LC and Dcr-2.

79 Micro-injection allows control of the amount of dsRNA introduced into the insect that could lead to more efficient and consistent results (Price and Gatehouse, 2008; Yao et al., 2013). Fifth instar nymphs of G. nigrifrons were injected with different dsRNAs and were collected at different time points to determine the efficacy and impact of

RNAi. Due to the limited body capacity of G. nigrifrons nymphs, we used a high concentration of each dsRNA (3μg/μL). Because acquisition and transmission of

MFSV by G. nigrifrons requires a 3 to 4-week PADP, it was critical that silencing of transcripts by RNAi be sustained over a relatively long period. Successful suppression of target genes was also seen in other hemipteran RNAi studies, such as silencing

V-ATPase in Peregrinus maidis, an important insect vector for another plant-infecting nucleorhabdovirus, Maize mosaic virus (MMV) (Yao et al., 2013). However, the silencing effect was only evaluated by 12 dpi. Here, decreased expression of

PGRP-LC and Dcr-2 could be detected at 14 and 22 dpi. We could not collect enough dsRNA for PGRP-LC injected leafhoppers at 22 dpi due to the high mortality after knocking down this transcript, although the reduction of PGRP-LC was still stable

(Figure 4.1). Thus, this RNAi technique could be useful for investigating the roles of leafhopper transcripts in transmission of persistently transmitted viruses, such as

MFSV. Notably, suppression of transcripts after dsRNA injected into 5th instar nymphs, and this RNAi effect passed to the adults.

The effect of suppressing PGRP-LC expression on leafhopper mortality

Mortality is one of the common and obvious phenotypes observed after knocking down the vital insect genes (Price and Gatehouse, 2008). About 35% injected leafhoppers died within 4 weeks, and injection of dsRNA targeting PGRP-LC resulted in over 90% mortality during this period (Figure 4.2 and 4.3, Table 4.3).

80 Since MFSV transmission by G. nigrifrons requires a 4-week PADP, systemic silencing of PGRP-LC could be an efficient method for controlling G. nigrifrons populations on crops as well as limiting MFSV spread in the field. In addition, high mortality caused by silencing PGRP-LC was seen with or without MFSV challenge from 8 dpi (7 days after MFSV challenge). This result suggested that acquiring MFSV might not be the only factor leading to this high mortality. PGRP-LC could be a vital factor involved in other important but unknown physiological pathways in G. nigrifrons besides immune response.

Roles of PGRP-LC and Dcr-2 in MFSV acquisition and transmission

We did not detect significant differences in the acquisition and transmission of

MFSV among treatments in these experiments, likely due to a substantial variation among biological replicates. However, it is possible that this is the result of the fairly high mortality for injected insects that resulted in small numbers of insects that could be tested for virus acquisition and transmission. MFSV is not efficiently transmitted by G. nigrifrons. It has been tested that under the laboratory condition, the transmission and acquisition rates were about only 4% and 16% respectively after a

4-week PADP (Todd et al., 2010). Therefore, testing a small number of leafhoppers could have resulted in a substantial variation among biological replicates for both acquisition and transmission.

Dcr-2 knocked down leafhoppers have slightly higher acquisition than controls, which suggests that Dcr-2 might be partially involved in limiting MFSV replication.

There are only two identified DCRs in D. melanogaster and Aedes aegypti (Dcr-1 and

Dcr-2), and they are involved in miRNA and siRNA processing respectively

(Bernhardt et al., 2012; Kuno et al., 1998). However, two copies of miRNA specific

81 Dcr-1 genes were discovered in the pea aphid, Acyrthosiphon pisum

(Jaubert-Possamai et al., 2010). The number of DCRs in G. nigrifrons has not been confirmed, and whether or not the functions of DCRs are redundant in G. nigrifrons is still unknown. Knocking down both DCRs in G. nigrifrons simultaneously might address this question.

Abnormal eclosion associated with silencing PGRP-LC

Significantly high mortality was observed in the PGRP-LC silenced leafhoppers over a period of 26 days, and mortality was associated with a pattern of abnormal eclosion of adults (Figure 4.4). 42% and 24% of PGRP-LC knocked down leafhoppers that were maintained on MFSV-symptomatic and healthy maize could not completely shed their exoskeleton, which appeared inhibit movement and flying capability. The abnormally eclosed adults were likely prevented from feeding, which led to starvation. Indeed, some of these leafhoppers were unable to extract their mouthparts from the old exoskeleton. Recently, the PGRP-LC mediated IMD pathway was found to be triggered by the molting hormone, 20-hydroxyecdysone (20E) in

Drosophila. The expression of PGRP-LC was dramatically increased by 20E treatment, which resulted in the induction a subset of AMP genes (Gubler, 1998a). It is well known that 20E is required for insect molting and the cuticle proteins genes are positively regulated by the exposure to a pulse of 20E (Meltzer et al., 1998).

However, the negative impact was that the imaginal disc of Drosophila could not form an exocuticle if it was continuously exposed to 20E (Meltzer et al., 1998; Savage et al., 1998). G. nigrifrons is continuously challenged by many exogenous organisms from the environment, not only MFSV which was treated purposely but also other fungi or bacteria or even endosymbionts when they were maintained on healthy maize.

82 IMD is a key pathway defending many of these pathogens. However, after knocking down PGRP-LC, IMD pathway might be suppressed. In order to express an effective level of PGRP-LC and keep IMD pathway function properly, G. nigrifrons might continuously produce more 20E to compensate the loss, which could affect chitin biosynthesis and lead to this abnormal eclosion. The abnormal eclosion and misshaped wings has been observed in some dsRNA injected insects, such as dsRNAs targeting to EcRcom and VTPase in Spodoptera exigua and Peregrinus maidis respectively (Gubler, 1998b; Yao et al., 2013). However, our study is the first report of high mortality and abnormal eclosion by knocking down an insect immune response transcript. Our future research will focus on the mechanism behind this phenomenon, and find out how insect molting connects to immunity.

Using RNAi to study the functions of immune response transcripts of G. nigrifrons in MFSV transmission and acquisition has been successfully developed.

The surprisingly high mortality caused by knocking down PGRP-LC before MFSV could be transmitted suggested an efficient method to control G. nigrifrons as an agricultural pest as well as limit MFSV spread in the field. However, insect immunity is not the only factor affecting transmission and acquisition, genetic variation (insect receptors for virus entry), environmental factors (temperature, light intensity, day length), nymphal nutrients and host plants also affect the transmission and acquisition.

Future work will focus on the totality of this interaction among host plants, virus, vector and environment.

83 References

Amdam, G. V., Simoes, Z. L., Guidugli, K. R., Norberg, K., and Omholt, S. W. (2003). Disruption of vitellogenin gene function in adult honeybees by intra-abdominal injection of double-stranded RNA. BMC Biotechnol 3, 1.

Araujo, R. N., Santos, A., Pinto, F. S., Gontijo, N. F., Lehane, M. J., and Pereira, M. H. (2006). RNA interference of the salivary gland nitrophorin 2 in the triatomine bug Rhodnius prolixus (Hemiptera: Reduviidae) by dsRNA ingestion or injection. Insect Biochem Mol Biol 36, 683-93.

Avadhanula, V., Weasner, B. P., Hardy, G. G., Kumar, J. P., and Hardy, R. W. (2009). A novel system for the launch of alphavirus RNA synthesis reveals a role for the Imd pathway in arthropod antiviral response. PLoS Pathog 5, e1000582.

Bautista, M. A., Miyata, T., Miura, K., and Tanaka, T. (2009). RNA interference-mediated knockdown of a cytochrome P450, CYP6BG1, from the diamondback moth, Plutella xylostella, reduces larval resistance to permethrin. Insect Biochem Mol Biol 39, 38-46.

Belles, X. (2010). Beyond Drosophila: RNAi in vivo and functional genomics in insects. Annu Rev Entomol 55, 111-28.

Bernhardt, S. A., Simmons, M. P., Olson, K. E., Beaty, B. J., Blair, C. D., and Black, W. C. (2012). Rapid intraspecific evolution of miRNA and siRNA genes in the mosquito Aedes aegypti. Plos One 7, e44198.

Bucher, G., Scholten, J., and Klingler, M. (2002). Parental RNAi in Tribolium (Coleoptera). Curr Biol 12, R85-6.

Chen, J., Zhang, D., Yao, Q., Zhang, J., Dong, X., Tian, H., and Zhang, W. (2010). Feeding-based RNA interference of a trehalose phosphate synthase gene in the brown planthopper, Nilaparvata lugens. Insect Mol Biol 19, 777-86.

Choudhury, M. M., and Rosenkranz, E. (1983). Vector relationship of Graminella nigrifrons to Maize chlorotic dwarf virus. Phytopathology 73, 685-690.

Clemens, J. C., Worby, C. A., Simonson-Leff, N., Muda, M., Maehama, T., Hemmings, B. A., and Dixon, J. E. (2000). Use of double-stranded RNA

84 interference in Drosophila cell lines to dissect signal transduction pathways. Proc Natl Acad Sci U S A 97, 6499-503.

Coy, M. R., Sanscrainte, N. D., Chalaire, K. C., Inberg, A., Maayan, I., Glick, E., Paldi, N., and Becnel, J. J. (2012). Gene silencing in adult Aedes aegypti mosquitoes through oral delivery of double-stranded RNA. Journal of Applied Entomology 136, 741-748.

Creamer, R., He, X., and Styer, W. E. (1997). Transmission of sorghum stunt mosaic rhabdovirus by the leafhopper vector, Graminella sonora (Homoptera: Cicadellidae). Plant Disease 81, 63-65.

Ding, S. W., and Voinnet, O. (2007). Antiviral immunity directed by small RNAs. Cell 130, 413-26.

Dong, Y., and Friedrich, M. (2005). Nymphal RNAi: systemic RNAi mediated gene knockdown in juvenile grasshopper. BMC Biotechnol 5, 25.

Edwards, M. L., and Cooper, J. I. (1985). Plant virus detection using a new form of indirect ELISA. Journal of Virological Methods 11, 309-319.

Gordon, D. T., and Nault, L. R. (1977). Involvement of maize chlorotic dwarf virus and other agents in stunting diseases of Zea mays in the United States. Phytopathology 67, 27-36.

Gouinguene, S. P., and Turlings, T. C. (2002). The effects of abiotic factors on induced volatile emissions in corn plants. Plant Physiol 129, 1296-307.

Govind, S. (2008). Innate immunity in Drosophila: Pathogens and pathways. Insect Sci 15, 29-43.

Gubler, D. J. (1998a). The global pandemic of dengue/dengue haemorrhagic fever: current status and prospects for the future. Ann Acad Med Singapore 27, 227-34.

Gubler, D. J. (1998b). Resurgent vector-borne diseases as a global health problem. Emerg Infect Dis 4, 442-50.

Hoffmann, J. A. (2003). The immune response of Drosophila. Nature 426, 33-8.

Hogenhout, S. A., Redinbaugh, M. G., and Ammar, E. D. (2003). Plant and animal rhabdovirus host range: a bug's view. Trends in microbiology 11, 264-271.

Jaubert-Possamai, S., Le Trionnaire, G., Bonhomme, J., Christophides, G. K., Rispe, C., and Tagu, D. (2007). Gene knockdown by RNAi in the pea aphid Acyrthosiphon pisum. BMC Biotechnol 7, 63.

85 Kuno, G., Cropp, C. B., Wong-Lee, J., and Gubler, D. J. (1998). Evaluation of an IgM immunoblot kit for dengue diagnosis. Am J Trop Med Hyg 59, 757-62.

Lowry, P. W., Truong, D. H., Hinh, L. D., Ladinsky, J. L., Karabatsos, N., Cropp, C. B., Martin, D., and Gubler, D. J. (1998). Japanese encephalitis among hospitalized pediatric and adult patients with acute encephalitis syndrome in Hanoi, Vietnam 1995. Am J Trop Med Hyg 58, 324-9.

Meltzer, M. I., Rigau-Perez, J. G., Clark, G. G., Reiter, P., and Gubler, D. J. (1998). Using disability-adjusted life years to assess the economic impact of dengue in Puerto Rico: 1984-1994. Am J Trop Med Hyg 59, 265-71.

Rosa, C., Kamita, S. G., and Falk, B. W. (2012). RNA interference is induced in the glassy winged sharpshooter Homalodisca vitripennis by actin dsRNA. Pest Manag Sci 68, 995-1002.

Price, D. R., and Gatehouse, J. A. (2008). RNAi-mediated crop protection against insects. Trends Biotechnol 26, 393-400.

Qu, F., Ren, T., and Morris, T. J. (2003). The coat protein of turnip crinkle virus suppresses posttranscriptional gene silencing at an early initiation step. J Virol 77, 511-22.

Savage, H. M., Fritz, C. L., Rutstein, D., Yolwa, A., Vorndam, V., and Gubler, D. J. (1998). Epidemic of dengue-4 virus in Yap State, Federated States of Micronesia, and implication of Aedes hensilli as an epidemic vector. Am J Trop Med Hyg 58, 519-24.

Seifers, D. L., Martin, T. J., Harvey, T. L., Haber, S., and Haley, S. D. (2006). Temperature Sensitivity and Efficacy of Wheat streak mosaic virus Resistance Derived from CO960293 Wheat. Plant Disease 90, 623-628.

Stoner, W. N., and Gustin, R. D. (1967). Biology of Graminella Nigrifrons (Homoptera - Cicadellidae) a Vector of Corn (Maize) Stunt Virus. Annals of the Entomological Society of America 60, 496-505.

Todd, J. C., Ammar el, D., Redinbaugh, M. G., Hoy, C., and Hogenhout, S. A. (2010). Host plant range and leafhopper transmission of maize fine streak virus. Phytopathology 100, 1138-45.

86 Upadhyay, S. K., Chandrashekar, K., Thakur, N., Verma, P. C., Borgio, J. F., Singh, P. K., and Tuli, R. (2011). RNA interference for the control of whiteflies (Bemisia tabaci) by oral route. J Biosci 36, 153-161. van Mierlo, J. T., van Cleef, K. W., and van Rij, R. P. (2011). Defense and counterdefense in the RNAi-based antiviral immune system in insects. Methods Mol Biol 721, 3-22.

Xi, Z., Ramirez, J. L., and Dimopoulos, G. (2008). The Aedes aegypti toll pathway controls dengue virus infection. PLoS Pathog 4, e1000098.

Yao, J., Rotenberg, D., Afsharifar, A., Barandoc-Alviar, K., and Whitfield, A. E. (2013). Development of RNAi Methods for Peregrinus maidi, the Corn Planthopper. Plos One 8, e70243.

Figure 4.1: Effect of RNAi on target transcript expression. The relative expression of Graminella nigrifrons PGRP-LC and Dcr-2 transcripts were quantified using RT-qPCR. Ct values were normalized to ribosomal protein S13 (RPS13), and dsRNA for GFP injected leafhoppers were used as control. Six leafhoppers were collected as one biological replicate; three biological replicates were collected at each time point for each transcript.

Figure 4.2: Mortality (%) of leafhoppers after dsRNAs injection maintained on MFSV-symptomatic maize. Multivariate repeated measurement was used to compare changes in insect mortality among different injection treatments over time using SAS Release 9.2 (SAS Institute Inc., 2008). A probability value ≤ 0.05 indicates a significant difference for the entire analysis. One asterisk indicates a P < 0.05, double asterisks indicate a P < 0.01.

Figure 4.3: Mortality (%) of leafhoppers after dsRNAs injection maintained on healthy maize. Multivariate repeated measurement was used to compare changes in insect mortality among different injection treatments over time using SAS Release 9.2 (SAS Institute Inc., 2008). A probability value ≤ 0.05 indicates a significant difference for the entire analysis. One asterisk indicates a P < 0.05, double asterisks indicate a P < 0.01.

Figure 4.4: Abnormal eclosion of leafhoppers injected with different dsRNAs or no injection and maintained on either MFSV-symptomatic or healthy maize. A: Each bar shows the mean of abnormal eclosion of three experimental replicates. ANOVA was used to analyze the difference of abnormal eclosion among different injection treatments. B and C represent the abnormally molted leafhoppers injected with dsRNA for PGRP-LC. Red arrow showed the mouthpart of abnormally molted leafhopper, orange dotted arrows point the old exoskeleton.

Figure 4.5: Effects of RNAi on MFSV acquisition. Acquisition of MFSV was assessed in leafhoppers after a 26-day PADP (3-week acquisition access period plus 5-day inoculation access period) using PAS-ELISA. The percentage of leafhoppers positive for MFSV was calculated for each treatment for insects transferred to MFSV-symptomatic maize. Data presented are the mean ± standard error for three experimental replicates. ANOVA was used to analyze the difference of acquisition among different injection treatments. Bars having the same letter above them indicated no difference in the mean based on ANOVA.

Table 4.1: Primer sequences, annealing temperatures and extension times for amplifying transcript PGRP-LC, Dcr-2 and GFP (control). Transcript Dcr-2 was targeted by three dsRNAs, which were amplified using three pairs of primers. F1 to F3 represent fragments one to three.

Table 4.2: Primer sequences and efficiencies of transcripts Dcr-2 and PGRP-LC evaluated by RT-qPCR for RNAi verification.aDcr-2, Dicer 2; PGRP-LC, peptidoglycan recognition protein LC. bEfficiency was calculated by the equation E = 10[-1/slope].

Table 4.3: Multivariate repeated measure analysis of mortality of leafhoppers. Mortality was detected for a 26-day period among different injection treatments and maintained on MFSV-symptomatic or healthy maize using SAS Release 9.2 (SAS Institute Inc., 2008). A probability value ≤ 0.05 indicates a significant difference for the entire analysis.

CHAPTER 5

Effects of temperature and light intensity on Maize fine streak virus transmission

by Graminella nigrifrons

Abstract

The black-faced leafhopper Graminella nigrifrons is the only identified insect vector for Maize fine streak virus (MFSV), an emerging plant-infecting nucleorhabdovirus.

MFSV is transmitted in a persistent propagative manner by G. nigrifrons, and the vector competence varies within populations. In this study, effects of environmental factors, namely temperature and light intensity on MFSV transmission during the

1-week inoculation access period (IAP) were evaluated using four temperature-light intensity combination treatments. We observed significantly higher mortality of leafhoppers and test plants under high temperature (30°C) and low light intensity.

Statistically, no difference in transmission was seen among treatments, however, transmission tended to increase under the higher temperature and light intensity.

Similarly, expression of MFSV N or 3 genes in transmitters from different treatments did not show significant difference, but expression of 3 was significantly higher than

N. Our results suggested that neither temperature nor light intensity is the single factor impacting transmission.

Introduction

Hemipteran insects such as aphids and planthoppers are important agricultural pests because of the direct feeding damage they cause and as vectors of plant

96 pathogens. These phloem feeders are essential vectors for the horizontal transmission of a large number of plant viruses, which results in the serious yield loss of economic crops. For example, the plant-infecting rhabdoviruses have impacted a broad range of monocot crops such as barley, wheat and maize (Brewbaker, 1975; Jackson et al.,

2005; Redinbaugh and Hogenhout, 2005). The Maize mosaic virus (MMV), specifically transmitted by the planthopper Peregrinus maidis, has resulted in up to

100% yield loss since its first report in 1914 (Falk and Tsai, 1985; Kunkel, 1921). To date, there are very few options for controlling the impacts of plant diseases.

The plant-infecting rhabdoviruses are negative single-stranded RNA viruses that are encapsulated into a lipid bilayer membrane. These viruses are mainly vectored by one or a few closely related insect families including Aphididae (aphids), Delphacidae

(planthoppers) and Cicadelidae (leafhoppers) (Ammar et al., 2009; Goodin and

Jackson, 2002; Hogenhout et al., 2003; Jackson et al., 2005). Planthoppers and leafhoppers transmit plant-infecting rhabdoviruses in a persistent propagative manner, which suggests the viruses are capable of replication within insect vector, and the competent vectors are capable of transmitting the viruses during the remaining of their life span (Ammar et al., 2009). However, the latent period (the time from virus ingestion to the competent insects are able to inoculate a host) varies from a few days to a few weeks for persistent propagatively transmitted viruses (Gray and Banerjee,

1999). Even greater differences exist among non-persistent, semi-persistent and persistent transmitted viruses. Given this level of variation, there may be a large effect of environmental factors on transmission within and among virus types.

The black-faced leafhopper, Graminella nigrifrons (Hemiptera: Cicadellidae), has been identified as an important vector for corn stunt disease, and Maize chlorotic dwarf virus (MCDV) (Nault et al., 1980; Nault et al., 1973). Recently, this insect was

97 identified as the only vector transmitting an emerging plant-infecting rhabdovirus,

Maize fine streak virus (MFSV), in a persistent propagative manner (Redinbaugh et al., 2002; Todd et al., 2010). The vector competence for MFSV varies within populations. G. nigrifrons individuals could be experimentally separated into three types based on their ability to transmit MFSV. Transmitters are able to transmit

MFSV after virus replication, acquirers are not able to transmit MFSV but virus replication occurs, and neither transmission nor replication occurs in non-acquirers

(Redinbaugh et al., 2002; Todd et al., 2010). A 4-week, post-first access to disease period (PADP, the interval from the beginning of the acquisition access period to the end of the inoculation access period) is required for MFSV transmission (Todd et al.,

2010). Longer acquisition access period (AAP) and inoculation access period (IAP) increase the transmission (Creamer et al., 1997; Todd et al., 2010). Physical barriers such as the midgut and salivary glands have been proposed to be critical for vector competence. In particular, genetic variation within receptors that plant-infecting rhabdoviruses could use for entry across the different barriers could be determinants for transmission (Ammar et al., 2009; Hogenhout et al., 2003).

Vector competence may also be impacted by extrinsic environmental factors, such as the temperature and light intensity (Ammar and Nault, 2002; Gingery et al.,

2004; Slykhuis and Sherwood, 1964). The effects of environmental factors on virus transmission have been previously evaluated, such as G. nigrifrons transmitted

MCDV (Sequiviridae, Waikavirus) and the leafhopper Endria inimical (Say) transmitted cytorhabdovirus Wheat striate mosaic virus (WSMV, Rhabdoviridae,

Cytorhabdovirus). Higher temperature or light intensity as well as longer day length significantly increased the MCDV transmission by G. nigrifrons (Gingery et al.,

98 2004). Similarly, higher temperature decreased the latent period of WSMV transmitted by E. inimical (Slykhuis and Sherwood, 1964).

The goal of this study is to evaluate the effects of environmental factors, especially the temperature and light intensity on MFSV transmission during 1-week

IAP. I hypothesize that with the increased temperature and light intensity, MFSV transmission rises. It has been well studied that temperature is an essential factor regulating insect development, and higher temperature increases the development rate of G. nigrifrons eggs and nymphs (Larsen et al., 1990; Sedlacek et al., 1990). Some propagative viruses were observed to be more efficiently transmitted by younger insects, since it might be easier for viruses to overcome under developed midgut barrier in younger insects. It is difficult to normalize this indirect temperature effect on MFSV transmission if different environmental conditions were used during 3-week

AAP, when G. nigrifrons was at nymphal stages. Therefore, we determined the effects of temperature and light intensity on MFSV transmission during the 1-week IAP, when the G. nigrifrons already emerged to adults.

Methods and Materials

Insect and plant maintenance

The laboratory population of G. nigrifrons and MFSV were maintained on susceptible maize (Zea mays L. hybrid Early Sunglow) in the growth chamber with

250 μE/m2 (miroeinstiens/m2) and 70% humidity at 25°C for 16h of light and 22°C for 8h of dark period. MFSV was serially transferred with the laboratory G. nigrifrons population. MFSV-infected symptomatic maize was used as source plants.

99 Exposure to different environments

G. nigrifrons adults (100 males and 100 females) from the laboratory colony were allowed to oviposit on MFSV-infected symptomatic maize for two days. At 14 days after oviposition, the majority of hatched nymphs (F1) were observed. From this day, the F1 leafhoppers were given a 4-week PADP, which including a 3-week AAP and 1-week IAP. Briefly, G. nigrifrons nymphs were maintained on MFSV-infected symptomatic maize, and by the end of the three weeks AAP, nymphs emerged to adults. All the F1 leafhoppers were maintained at the same conditions as the laboratory population for the 3-week AAP. Then, the same number of male and female G. nigrifrons adults was individually transferred to a 4-day old healthy maize plant for virus inoculation. After one week IAP, F1 leafhoppers were collected, labeled according to the maize test plant. The effects of temperature and light intensity on transmission were evaluated during the 1-week IAP. Three temperatures,

20, 25 and 30°C were set up in the growth chambers and three light intensities, 68,

108 and 250μE/m2 were included. Since the light intensity for two growth chambers could not be adjusted, we used four different combinations of temperature and light intensity, which were 20°C − 108μE/m2; 20°C − 250μE/m2; 25°C − 250μE/m2 and

30°C − 68μE/m2, and three replicates were performed for each treatment.

Expression of MFSV N and 3 in transmitters

Expression of MFSV N and 3 in transmitters under three treatments was examined, which were 20°C − 108μE/m2, 20°C − 250μE/m2 and 25°C − 250μE/m2.

Except for the treatment 20°C − 108μE/m2, six transmitters were pooled as one biological replicate for RNA isolation. Three biological replicates were used from one environmental treatment to evaluate the expression of MFSV N and 3 in transmitters.

100 There was limited number of transmitters remaining for the treatment of 20°C −

108μE/m2; therefore, two, five and one transmitters was used respectively, for three biological replicates. DNA contamination was removed from the isolated RNA using

TURBO DNA-free kit. Then, same amount of treated RNA (1μg) of each biological replicate was used for cDNA synthesis using the SuperScript III First-Strand

Synthesis System. Expression of MFSV N and 3 were evaluated by RT-qPCR, using

40ng of reversed transcribed cDNA template and the same protocol described in previous chapters. The relative expression of these two MFSV genes was normalized to G. nigrifrons RPS13 first, and then was calibrated to MFSV N of 20°C −

108μE/m2.

Data analysis

Dead leafhoppers were recorded and stored at -80°C after 1-week IAP. Test plants were moved to either a green house or a separate growth chamber for three weeks for MFSV symptom development with the same conditions set as above. The number of dead test plants before this 3-week symptom development period was recorded. Transmitters were identified based on MFSV symptoms (chlorotic streaks along the major veins) showing on test plants (Redinbaugh et al., 2002). The transmission of each temperature regime under certain light intensity was calculated using the number of observed transmitters divided by the “actual” number of leafhoppers (the number of dead leafhoppers and test plants was subtracted from the initial number). The mortality of leafhoppers and test plants was calculated using the number of dead leafhoppers (after 1-week IAP) plus the dead test plants (during the

3-week symptoms showing period) divided by the initial number of tested leafhoppers.

101 The difference of mortality of leafhoppers and test plants, transmission and the expression of MFSV N and 3 in transmitters under each treatment was analyzed by

ANOVA using Minitab 15. T-test was used to compare the transmission between the treatments that have either same temperature but different light intensities or same light intensities but different temperatures. Expression of MFSV N in transmitters under 20°C, 250μE/m2 and 25°C, 250μE/m2 was compared using T-test.

Results

The average mortality of leafhoppers and test plants under all temperature-light intensity treatments was 9.3%. A significantly higher mortality (15.1%) was observed under the treatment of 30°C, 68μE/m2 than other environmental treatments (P =

0.0046) (Figure 5.1). However, under lower temperatures (20 or 25°C) and stronger light (108 or 250μE/m2), the mortality was significantly decreased (average mortality was 7.3%). In addition, the smallest number of dead leafhoppers and test plants was recorded from the treatment of 20°C, 250μE/m2, with an average mortality of three replicates was 5.5%.

We did not detect a significant difference in transmission among different treatments (Figure 5.2). The transmission highly varied among replicates under the same treatment. Comparing the two treatments which had same temperature but different light intensities (20°C, 108μE/m2 and 20°C, 250μE/m2), the transmission increased from 9% to 14.6% under stronger light intensity. Similarly, a slight increase

(1%) of transmission was observed under the same light intensity (250μE/m2) but at different temperatures (20°C to 25°C). However, none of the increased transmission was significant (P = 0.92 and 0.47 respectively). At the highest temperature (30°C), regardless of low light intensity (68μE/m2), the transmission (13.9%) was much

102 higher than the under low temperature (20°C, 108μE/m2). In addition, the transmission of male and female leafhoppers was similar under every temperature and light intensity treatment. Overall, it could be seen that the average transmission increased when the temperature or light intensity rises, and the effect of light intensity on transmission is more obvious at low temperature (20°C).

Expression of MFSV N and 3 was not statistically differently. Expression of

MFSV N was highly varied among biological replicates within environmental treatments, especially in the treatment of 20°C, 108μE/m2. Therefore, no significant difference of MFSV N expression was observed when comparing all 3 environmental treatments. However, MFSV N expression was significantly higher in transmitters under 20°C, 250μE/m2 than 25°C, 250μE/m2 (P = 0.0381). MFSV 3 expressed similarly in transmitters among all treatments, and significantly higher than MFSV N

(P = 0.0002) (Figure 5.3).

Discussion

G. nigrifrons is the only reported vector for MFSV; however, the efficiency of transmission is naturally low. In laboratory populations, the average transmission and acquisition is only 4 and 16% respectively after a 4-week PADP (3-week AAP plus

1-week IAP) (Todd et al., 2010). Vector competence of arboviruses could be affected by both intrinsic and extrinsic factors (Ammar et al., 2009; Gingery et al., 2004;

Hardy et al., 1983; Hogenhout et al., 2003). Intrinsic factors, such as insect immune response and their genetic variation were studied in previous chapters. In this chapter, effects of extrinsic factors, particularly the temperature and light intensity on MFSV transmission were examined.

103 It has been observed that high temperature (33°C) significantly decreased the latent period of WMSV and also increased the transmission of this rhabdovirus by the leafhopper Endria inimical (Say) (Belles, 2010). In this study, we did not focus on the effects of environmental factors on latent period but rather the transmission.

Therefore, different temperature-light intensity treatments were used during the

1-week IAP, by which time MFSV is proposed to reach the salivary glands of G. nigrifrons. Identical environmental conditions were used during 3-week AAP in order to avoid the variation of development rate of G. nigrifrons affected by environmental factors (Larsen et al., 1990; Sedlacek et al., 1990). Four temperature-light intensity treatments were used in this study. Significantly higher mortality of leafhoppers and test plants was observed under the treatment of 30°C, 68μE/m2 than other environmental treatments. These leafhoppers had been challenged by MFSV since their nymphal stage for 3 weeks, and they emerged to adults immediately prior to transfer onto individual test plants. This high mortality suggested that, despite a short,

7 day exposure, high temperature might shorten the life span of MFSV challenged leafhoppers, although we did not test the life span of unchallenged leafhoppers.

Moreover, since the test plants were only 4-days old when they were inoculated by

MFSV challenged leafhoppers, low light intensity combined with the high temperature might affect the photosynthesis of test plants, and subsequently influence the plant development and antiviral defense, as well as the nutritional host quality of the plant for the leafhoppers (Usuda et al., 1985).

Due to the high variation among replicates, a significant difference in transmission was not detected among treatments. However, higher temperature and higher light intensity tended to increase the transmission. At low temperature (20°C), using stronger light intensity resulted in a large increase of transmission. At high light

104 intensity (250μE/m2), increased transmission was also seen at higher temperature, although the average increase was about 1%, less than that of light intensity. 30°C was the highest temperature we used, and we expected the transmission to be the highest among all treatments. However, the mean transmission was very similar as the other two treatments which used high light intensity (250μE/m2). This similar transmission might be caused by using the low light intensity (68μE/m2).

Alternatively, some transmitters could have been missed due to the significantly high mortality of leafhoppers and test plants under this treatment. Even we did not detect the transmission under 30°C but higher light intensity; it seemed that there could be an environmental threshold causing the maximum transmission. Once one of the environmental factors achieves the threshold, the transmission reaches the maximum, which is mostly affected by genetic variation. These results suggested that neither temperature nor light intensity is the single factor impacting transmission, however, their interaction on transmission could have important implications for virus spread in the field.

Transmission varied among different environmental treatments, and examining the expression of MFSV genes in transmitters under these environmental treatments might help to understand the effects of environmental factors on virus replication, and subsequently transmission. Therefore, expression of MFSV N and 3 was evaluated in transmitters under the treatments that either had same temperature or light intensity.

Statistically, neither gene expressed differently in transmitters among three treatments. MFSV 3 expressed significantly higher than N, which was similar to the results observed by Cisneros Delgadillo (Cisneros Delgadillo, 2013). Due to the low expression of MFSV N and variation among replicates, it was difficult to detect the significant difference of expression among treatments although MFSV N seemed to

105 express higher in treatment 20°C, 250μE/m2. Replicates of 20°C, 108μE/m2 caused most variation, therefore, we also used T-test to compare the expression of MFSV N in transmitters from the other two treatments 20°C, 250μE/m2 and 25°C, 250μE/m2, and the significance was seen (Figure 5.3). However, the overall results indicated a similar expression of MFSV N and 3 in transmitters among all three environmental treatments. Increasing viral concentration ingested by female mosquito resulted in shortened latent period for virus transmission, however, high viral concentration is not sufficient for arboviruses transmission (Hardy et al., 1983). Therefore, effects of temperature and light intensity on MFSV transmission during 1-week IAP might not be through changing viral gene expression. This study only focused on the effects of temperature and light intensity on transmission, it is not clear what the role of these environmental factors play on MFSV acquisition and on expression of viral genes in acquirers. Our future work will target these questions.

Effects of environmental factors on MCDV transmission by G. nigrifrons have been previously examined. Under higher temperature, light intensity or longer day length treatments, MCDV transmission was progressively increased (Gingery et al.,

2004). MCDV is transmitted by G. nigrifrons in a semi-persistent, non-circulative manner, which suggests that no MCDV replication occurs within G. nigrifrons, and the virus particles are only detected at foregut of viruliferous G. nigrifrons individuals. MFSV is transmitted by G. nigrifrons in a persistent propagative manner, and virions reach almost every tissue of G. nigrifrons except the reproductive tissues.

However, environmental factors positively affected the transmission of the two different viruses, which indicates that the effects might associate with insect behavior.

Since temperature affects development rate of G. nigrifrons (Larsen et al., 1990;

Sedlacek et al., 1990), under higher temperature, the feeding activity G. nigrifrons

106 might be increased. Therefore, more MFSV virions could be inoculated into maize seedling by G. nigrifrons transmitters during their feeding, which might results in higher transmission. Similar effects might occur at different light intensities, if G. nigrifrons is unable to obtain adequate nutrients on photosynthetically poor plants.

Additionally, host plant resistance for viral diseases is known to be temperature sensitive. For example in the wheat resistance for Wheat streak mosaic virus

(WSMV), high temperature resulted in the resistance break down (Seifers et al.,

2006). Maize resistance to MFSV might be reduced under higher temperature and light intensity, which led to observed higher transmission. However, when temperature rose to 30°C, its effect on transmission was not functional, since genetic factors might also affect the transmission. It is still unknown what the maximum transmission within the G. nigrifrons population is, but the interactions between genetic, molecular and environment are essential factors for vector competence

(Ammar et al., 2009; Hogenhout et al., 2003).

Gingery et al., (2004) observed a higher transmission of MCDV by G. nigrifrons females than males, however, we did not detect the difference of MFSV transmission between G. nigrifrons males and females under any temperature and light intensity treatment. This result might suggest the difference of transmission mechanisms between semi-persistent and persistent viruses.

We did not test all possible environmental conditions that could influence

MFSV transmission. Additional factors that might influence the variation include day length and CO2 concentration (Gingery et al., 2004), as well as the inherent differences among maintaining conditions in greenhouse compared to a growth chamber during the MFSV symptom development period. The test plants from one entire replicate were maintained in the same room in the green house, but the test

107 plants from different replicates were maintained in the different room due to the limit capacity of each room, which possibly contributed to the variation seen among replicates. Even if the conditions in the green house were set up identically, the actual temperature might not be the same among rooms, and light intensity could not be controlled since the natural light was used in green house. Therefore, the actual environmental conditions could have been different among replications during the symptom development period, and affected the plant resistance and symptom development. Therefore, even though the mortality was similar as other replicates, replicate 2 had the overall lower transmission, which caused the large variation. More consistent environmental conditions should be used during the symptom development period in future work.

The tendency that higher temperature and light intensity seemed to increase the

MFSV transmission was seen, even though the difference of transmission and expression of MFSV N and 3 in transmitters under various temperature-light intensity treatments was not statistically significant. We have not found an efficient method to significantly increase the number of competent vectors (transmitters) within G. nigrifrons laboratory population. Therefore, a small portion of transmitters likely causes large variation, which could mask the effect of environmental factors on both transmission and viral gene expression in transmitters. Additionally, environmental factors could affect MFSV transmission at both AAP and IAP, although we only tested IAP, which suggested the complex effects of natural environmental factors on persistent propagative viruses, especially those have long latent period. Based on this preliminary result, we could not detect the difference of neither MFSV transmission nor expression of MFSV N and 3 in transmitters under these three temperature-light

108 intensity treatments, indicating vector competence is quite complex and could be determined by multiple factors.

References

Abraham, G., and Banerjee, A. K. (1976). Sequential transcription of the genes of vesicular stomatitis virus. Proc Natl Acad Sci U S A 73, 1504-8.

Agrawal, N., Dasaradhi, P. V., Mohmmed, A., Malhotra, P., Bhatnagar, R. K., and Mukherjee, S. K. (2003). RNA interference: biology, mechanism, and applications. Microbiol Mol Biol Rev 67, 657-85.

Ammar, E. D., and Nault, L. R. (2002). Virus transmission by leafhoppers, planthoppers and treehoppers (Auchenorrhyncha, Homoptera). Advances in Botanical Research, Vol 36 36, 141-167.

109 Bai, X., Zhang, W., Orantes, L., Jun, T. H., Mittapalli, O., Mian, M. A., and Michel, A. P. (2010). Combining next-generation sequencing strategies for rapid molecular resource development from an invasive aphid species, Aphis glycines. Plos One 5, e11370.