DOCSLIB.ORG

Prenatal Sex Differences in the Human Brain

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Prenatal Sex Differences in the Human Brain Molecular Psychiatry (2009) 14, 988–991 & 2009 Nature Publishing Group All rights reserved 1359-4184/09 $32.00 www.nature.com/mp LETTERS TO THE EDITOR Prenatal sex differences in the human brain Molecular Psychiatry (2009) 14, 988–989. doi:10.1038/ development. These genes are not only expressed in mp.2009.79 the brain before birth but some of them are also known to have sex differences in adult brain,1,4 whereas others are expressed during infancy, but The presence of genetic sex differences in the adult reduced later on during their lifetime.5 human brain is now recognized.1 We hypothesized Intriguingly, SRY, a well-known determinant of that the basis of this sex bias is already established in testicle development during midgestation,6 showed the brain before birth. Here, we show that several no evidence of expression in any of the brain regions genes encoded in the Y-chromosome are expressed in analyzed (Figure 1b, and Supplementary Figure 1), many regions of the male prenatal brain, likely having suggesting that the main somatic sex determinants functional consequences for sex bias during human may be different for the brain and gonads during brain development. human gestation. The marked sex differences in age at onset, In humans, all 11 genes described here are encoded prevalence and symptoms for numerous neuropsy- in the male-specific region of the Y-chromosome,7 chiatric disorders2 indicate the importance to study with RPS4Y1 and ZFY located in the p-arm very close the emergence of a sex bias during human brain to SRY and most of the remaining genes located in the development. A recent article includes for the first q-arm. Interestingly, the expression of Y-linked genes time comprehensive data on the human brain tran- scriptome before birth.3 This elegant work reveals a large number of gene and alternative splicing differ- ences specific to certain regions of the brain during development. A total of 12 regions in the midgesta- tion human brain were analyzed in both male and 10 female human fetal brain specimens. This data set provides for the first time the opportunity to evaluate 8 the existence of embryonic sex bias in the human 6 brain. To do this, we re-analyzed human fetal brain expression expression data from the Gene expression Omnibus 2 log 4 (GEO accession GSE 13344, Human Exon 1.0 ST Array) according to sex. The database included 95 2 array hybridizations, of which 72 corresponded with different brain regions from three midgestation female UTY ZFY SRY PRKY DDX3YUSP9Y EIF1AY fetuses and 23 were from equivalent brain regions RPS4Y1 NLGN4Y TMSB4Y PCDH11Y CYorf15B from a male. The largest sex differences observed male female (ind.1,2,3) mean bg were in genes encoded on the Y-chromosome, show- ing the existence of prenatal gender bias in brain Figure 1 Expression of Y-linked genes in male prenatal expression. Figure 1a shows the expression levels of brain. (a) Identification of 11 Y-linked genes that are 11 Y-chromosome-encoded genes, including RPS4Y1, expressed in the male prenatal brain. The genes were PCDH11Y, DDX3Y, USP9Y, NLGN4Y, EIF1AY, UTY, identified by comparing microarray measurements of mRNA levels in 12 different brain regions in prenatal male ZFY, TMSB4Y, CYorf15B and PRKY. For 10 genes out brain (yellow, n = 23) and in prenatal female brain (blue, of these 11, expression was detected in all the 12 arrays narrays = 72). As female samples do not contain Y-linked brain regions analyzed (Supplementary Figure 1), genes, the signals obtained in females were used as suggesting that they may be present throughout the measurements of the local probe background level for each whole brain during development. PRKY on the other individual Y-linked gene, and the criterion for expression hand was expressed in a more restricted manner in was a mean fold-change of at least two as compared with the the cortex samples, with low expression in cerebel- female signals. (b) SRY did not show evidence of expression lum and basal ganglia. Some evidence of specific in any of the male prenatal brain samples. The band on the splice variant expression was found. For example, box represents the median, and the lower and upper hinge only one out of three ZFY transcripts produced of the box represent the first and third quartile. Whiskers designate the most extreme data points which are no more positive signals in cortex, striatum and thalamus than 1.5 times the interquartile range from the box. Round (Supplementary Figure 1). circles show outliers. The horizontal dashed line represents The expression of more than one-third of the genes the overall mean signal level of all Y-linked genes in encoded on the Y-chromosome in prenatal human females, shown as an indicator of the global background brain indicates their importance for sex-biased brain signal levels in the arrays. Letters to the Editor 989 in prenatal brain is only partially conserved between rodents and humans. USP9Y, DDX3Y and UTY have Stem cell signaling in known orthologous genes in the mouse Y-chromo- some, and their expression is conserved in terms of newly diagnosed, sex bias prenatally in both groups.8 Other genes with antipsychotic-naive prenatal sex bias in humans, such as RPS4Y1 and EIF1AY, have rodent homologs encoded in somatic subjects with nonaffective chromosomes and are not known to be sexually dimorphic. PCDH11Y and CYorf15B only have known psychosis mouse homologs in the X-chromosome and are not known to have sex differences in the brain. TMSB4Y and NLGN4Y lack known homologous in rodents. Molecular Psychiatry (2009) 14, 989–991. doi:10.1038/ Finally, ZFY, which encodes for a transcription factor mp.2009.45 in the Y-chromosome in both groups, is expressed in human brain before birth, but absent in prenatal mouse brain.8 The differences in prenatal expression Widespread metabolic abnormalities have been de- of Y-linked genes mentioned above suggest that parts scribed in newly diagnosed, antipsychotic-naive of the programming of gender biases in the brain are patients with nonaffective psychosis, including a human-, or at least, primate-specific. shorter telomere,1 abnormal glucose tolerance,2 an Although the importance of X-chromosome-encoded increase in the pro-inflammatory molecule interleu- genes for mental function has been well established,9 the kin-62 and an increased pulse pressure.1 Stromal- relevance of Y-chromosome genes on brain function is derived factor 1-alpha (SDF-1a), the major chemokine less known. The results presented here, together with for adult stem cells (SCs), is involved in glucose the well-known rapid evolution of Y-chromosomes,10 regulation3 and is abnormal in diabetes.4 SDF1 is clearly point to the importance of future investigation critical in homing, maintenance and mobilization of on Y-linked gene function in the developing human adult SCs.5 We tested the hypothesis that newly brain. diagnosed, antipsychotic-naive patients with nonaf- fective psychosis would have a decreased concentra- tion of circulating SDF-1a compared with control Conflict of interest subjects. The authors declare no conflict of interest. The psychosis (N = 24) and control (N = 24) subjects were matched for race (Caucasian), gender, B Reinius and E Jazin age, body mass index, smoking habit, cortisol blood Department of Development & Genetics, Evolutionary levels, socioeconomic status and catchment area Biology Centre, Uppsala University, Uppsala, Sweden (Table 1). The two groups were matched before E-mail: [email protected] or assaying SDF-1a concentrations. All subjects were [email protected] interviewed using the Structured Clinical Interview for DSM-IV Axis I Disorders. Psychopathology was rated using the Positive and Negative Syndromes References Scale (PANSS). Subjects in the psychosis group had a 1 Reinius B, Saetre P, Leonard JA, Blekhman R, Merino-Martinez R, maximum lifetime antipsychotic exposure of 1 week Gilad Y et al. PLoS Genet 2008; 4: e1000100. and no antipsychotic use in the 30 days before the 2 Paus T, Keshavan M, Giedd JN. Nat Rev Neurosci 2008; 9: study, and had a diagnosis of nonaffective psychosis. 947–957. Exclusion criteria for the control subjects included a 3 Johnson MB, Kawasawa YI, Mason CE, Krsnik Z, Coppola G, Bogdanovic D et al. Neuron 2009; 62: 494–509. history of psychosis or major depressive disorder. 4 Galfalvy HC, Erraji-Benchekroun L, Smyrniotopoulos P, Pavlidis P, Additional general inclusion criteria were age from Ellis SP, Mann JJ et al. BMC Bioinformatics 2003; 4:37. 18 to 64 years, no history of serious medical or 5 Weickert CS, Elashoff M, Richards AB, Sinclair D, Bahn S, Paabo S neurological condition and not using any medication et al. Mol Psychiatry 2009; 14: 558–561. 6 Maatouk DM, Capel B. Curr Top Dev Biol 2008; 83: 151–183. that impacts glucose tolerance. All subjects gave 7 Skaletsky H, Kuroda-Kawaguchi T, Minx PJ, Cordum HS, Hillier L, informed consent for participation in the study, Brown LG et al. Nature 2003; 423: 825–837. which was conducted under the supervision of the 8 Xu J, Burgoyne PS, Arnold AP. Hum Mol Genet 2002; 11: local institutional review board. 1409–1419. Blood was drawn between 0800 and 0900 hours 9 Skuse DH. Hum Mol Genet 2005; 14(Spec No 1): R27–R32. 10 Goto H, Peng L, Makova KD. J Mol Evol 2009; 68: 134–144. after an overnight fast. Plasma was collected on ice using EDTA and centrifuged for 15 min at 1000 Â g Supplementary Information accompanies the paper within 30 min of collection. An additional centrifuga- on the Molecular Psychiatry website (http://www. tion step of the separated plasma at 10 000 Â g for 1 nature.com/mp) 10 min at 2–8 C was performed for complete platelet removal.
Load more

Recommended publications
  • Zfyl Encodes a Nuclear Sequence-Specific DNA Binding
    View metadata, citation and similar papers at core.ac.uk brought to you byCORE provided by Elsevier - Publisher Connector FEBS 15213 FEBS Letters 360 (1995) 315-319 Zfyl encodes a nuclear sequence-specific DNA binding protein Pamela Taylor-Harris, Sally Swift, Alan Ashworth* CRC Centre of Cell and Molecular Biology, Chester Beatty Laboratories, The Institute of Cancer Research, 237 Fulham Road, London, SW3 6JB, UK Received 19 January 1995; revised version received 3 February 1995 sively to RNA and have functions in RNA storage or processes Abstract Zfyl is a mouse Y chromosomal gene encoding a zinc such as splicing. finger protein which is thought to have some function during In order to analyse the properties of the ZFY family of zinc spermatogenesis. Here we show that, when introduced into tissue finger proteins, we have raised specific antibodies to murine culture cells, Zfyl is targeted to the nucleus. Two independent signals are present within the protein for nuclear localization. Zfyl. These have been used to demonstrate that Zfyl protein This nuclear Zfyl protein is able to bind strongly to DNA-ceHu- localizes to the nucleus of transfected cells and to identify spe- lose and, using site-selection assays, we have identified specific cific DNA binding sites for Zfyl, suggesting a role for this Zfyl DNA binding sites. Taken together these results suggest protein as a transcription factor regulating gene expression that Zfyl is a nuclear-located sequence-specific DNA binding during spermatogenesis. protein which functions during spermatogenesis. Key words: Spermatogenesis; Zinc finger protein; 2. Materials and methods Y chromosome; Nucleus; DNA binding; Transcription factor 2.1.
    [Show full text]
  • Downloaded from Interpro Database (IPR013087)
    bioRxiv preprint doi: https://doi.org/10.1101/637298; this version posted May 15, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Why Do Long Zinc Finger Proteins have Short Motifs? A case study of ZFY and CTCF reveals non-independent recognition of tandem zinc finger proteins. Zheng Zuo1*, Timothy Billings6, Michael Walker6, Petko Petkov6, Polly Fordyce1, 2, 3, 4, Gary D. Stormo5* 1. Department of Genetics, Stanford University, CA, USA 2. Chan Zuckerberg Biohub, San Francisco, CA, USA 3. Department of Bioengineering, Stanford University, CA, USA 4. Stanford CheM-H Institute, Stanford University, CA, USA 5. Department of Genetics, Washington University in St. Louis, MO, USA 6. The Jackson Laboratory, ME, USA Correspondence: [email protected] Summary The human genome has more than 800 C2H2 Zinc Finger-containing genes, and many of them are composed of long tandem arrays of zinc fingers. Current Zinc Finger Protein (ZFP) motif prediction models assume longer finger arrays correspond to longer DNA-binding motifs and higher specificity. However, recent experimental efforts to identify ZFP binding sites in vivo contradict this assumption with many having short reported motifs. Using Zinc Finger Y (ZFY), which has 13 ZFs, we quantitatively characterize its DNA binding specificity with several complementary methods, including Affinity-seq, HT-SELEX, Spec-seq and fluorescence anisotropy. Besides the previously identified core motif GGCCT recognized by fingers 12-13, we find a novel secondary irregular motif recognized by accessory fingers.
    [Show full text]
  • UTY (NM 001258249) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG235303 UTY (NM_001258249) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: UTY (NM_001258249) Human Tagged ORF Clone Tag: TurboGFP Symbol: UTY Synonyms: KDM6AL; KDM6C; UTY1 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG235303 representing NM_001258249 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAATCCTGCGCAGTGTCGCTCACTACCGCCGCTGTTGCCTTCGGTGATGAGGCAAAGAAAATGGCGG AAGGAAAAGCGAGCCGCGAGAGTGAAGAGGAGTCTGTTAGCCTGACAGTCGAGGAAAGGGAGGCGCTTGG TGGCATGGACAGCCGTCTCTTCGGGTTCGTGAGGCTTCATGAAGATGGCGCCAGAACGAAGACCCTACTA GGCAAGGCTGTTCGCTGCTACGAATCTTTAATCTTAAAAGCTGAAGGAAAAGTGGAGTCTGACTTCTTTT GCCAATTAGGTCACTTCAACCTCTTGTTGGAAGATTATTCAAAAGCATTATCTGCATATCAGAGATATTA CAGTTTACAGGCTGACTACTGGAAGAATGCTGCGTTTTTATATGGCCTTGGTTTGGTCTACTTCTACTAC AATGCATTTCATTGGGCAATTAAAGCATTTCAAGATGTCCTTTATGTTGACCCCAGCTTTTGTCGAGCCA AGGAAATTCATTTACGACTTGGGCTCATGTTCAAAGTGAACACAGACTACAAGTCTAGTTTAAAGCATTT TCAGTTAGCCTTGATTGACTGTAATCCATGTACTTTGTCCAATGCTGAAATTCAATTTCATATTGCCCAT TTGTATGAAACCCAGAGGAAGTATCATTCTGCAAAGGAGGCATATGAACAACTTTTGCAGACAGAAAACC TTCCTGCACAAGTAAAAGCAACTGTATTGCAACAGTTAGGTTGGATGCATCATAATATGGATCTAGTAGG AGACAAAGCCACAAAGGAAAGCTATGCTATTCAGTATCTCCAAAAGTCTTTGGAGGCAGATCCTAATTCT GGCCAATCGTGGTATTTTCTTGGAAGGTGTTATTCAAGTATTGGGAAAGTTCAGGATGCCTTTATATCTT
    [Show full text]
  • A Genetic Method for Sex Identification of Raccoons (Procyon Lotor) with Using the ZFX and ZFY Genes
    NOTE Wildlife Science A Genetic Method for Sex Identification of Raccoons (Procyon lotor) with Using the ZFX and ZFY Genes Minami W. OKUYAMA1), Michito SHIMOZURU1) and Toshio TSUBOTA1)* 1)Laboratory of Wildlife Biology and Medicine, Graduate School of Veterinary Medicine, Hokkaido University, Kita18, Nichi9, Kita-ku, Sapporo, Hokkaido 060–0818, Japan (Received 19 November 2013/Accepted 2 January 2014/Published online in J-STAGE 23 January 2014) ABSTRACT. A genetic method for sex determination in raccoons was developed based on nucleotide differences of the zinc finger protein genes ZFX and ZFY. Four novel internal primers specific for ZFX or ZFY were designed. PCR amplification using two primer sets followed by agarose gel electrophoresis enabled sex determination. 141-bp and 447-bp bands were in both sex, and 346-bp band was specific only in male with primer set I. 345-bp and 447-bp bands were in both sex, and 141-bp band was specific only in male with primer set II, which could distinguish raccoon’s electrophoresis pattern from three native carnivores in Hokkaido. This method will be useful for conservation genetics studies or biological analyses of raccoons. KEY WORDS: PCR, raccoons, sex identification, ZFX and ZFY genes. doi: 10.1292/jvms.13-0577; J. Vet. Med. Sci. 76(5): 773–775, 2014 Sex is one of the most important pieces of information between ZFX and ZFY in raccoons and to establish a new about an animal, as it is related to physiology, behavior and genetic method for sex determination of raccoons. reproduction. Thus, developing methods for sex identifica- Hair or whisker samples were collected from the carcasses tion are essential in many fields of study, including zoology of feral raccoons that were euthanized for eradication control and ecology.
    [Show full text]
  • Normal Structure and Expression of Zfy Genes in XY Female Mice Mutant in Tdy
    Development 109, 647-653 (1990) 647 Printed in Great Britain ©The Company of Biologists Limited 1990 Normal structure and expression of Zfy genes in XY female mice mutant in Tdy JOHN GUBBAY1, PETER KOOPMAN1, JEROME COLLIGNON1, PAUL BURGOYNE2 and ROBIN LOVELL-BADGE1* [ Laboratory of Eukaryotic Molecular Genetics, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW71AA, UK 2MRC Mammalian Development Unit, Wolfson House, 4 Stephenson Way, London NWI 2HE, UK •To whom correspondence should be addressed Summary Zfy-1 and Zfy-2 are candidate genes for Tdy, the testis- show a normal structure and expression pattern in mice determining gene in mice. We have analysed these genes with a Y chromosome known to carry a mutation in Tdy in a line of XY female mice that have been shown to be and that mutant embryos develop into females despite mutated in Tdy. We have used Southern blot analysis to Zfy-1 expression, strongly supports other recent evi- show that the Zfy genes have not undergone any major dence that Zfy genes are not directly involved in primary structural alterations, and have also demonstrated that testis determination. both genes are transcribed normally from the mutant Y chromosome (¥) in both adult XY¥ testis and X¥ Key words: sex determination, Tdy, Zfy, zinc finger genes, female embryonic gonads. The fact that these genes polymerase chain reaction, gene expression. Introduction conservation and cell autonomous action of the testis- determining gene (Burgoyne et al. 1988). Sex determination in mammals is dependent upon the However, theories of the mode of action of ZFY in action of a Y-linked testis-determining gene termed testis determination have to take into account the TDF in humans and Tdy in mice (Goodfellow and presence of a highly homologous gene (ZFX) present Darling, 1988; McLaren, 1988).
    [Show full text]
  • Quantitative Analysis of Y-Chromosome Gene Expression Across 36 Human Tissues 6 7 8 9 Alexander K
    Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press 1 2 3 4 5 Quantitative analysis of Y-Chromosome gene expression across 36 human tissues 6 7 8 9 Alexander K. Godfrey1,2, Sahin Naqvi1,2, Lukáš Chmátal1, Joel M. Chick3, 10 Richard N. Mitchell4, Steven P. Gygi3, Helen Skaletsky1,5, David C. Page1,2,5* 11 12 13 1 Whitehead Institute, Cambridge, MA, USA 14 2 Department of Biology, Massachusetts Institute of Technology, Cambridge, MA, USA 15 3 Department of Cell Biology, Harvard Medical School, Boston, MA, USA 16 4 Department of Pathology, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA, USA 17 5 Howard Hughes Medical Institute, Whitehead Institute, Cambridge, MA, USA 18 19 20 21 *corresponding author: 22 Email: [email protected] 23 24 25 Running title: 26 Human Y-Chromosome gene expression in 36 tissues 27 28 29 Keywords: 30 Y Chromosome, sex chromosomes, sex differences, EIF1AY, EIF1AX 31 Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press 32 ABSTRACT 33 Little is known about how human Y-Chromosome gene expression directly contributes to 34 differences between XX (female) and XY (male) individuals in non-reproductive tissues. Here, 35 we analyzed quantitative profiles of Y-Chromosome gene expression across 36 human tissues 36 from hundreds of individuals. Although it is often said that Y-Chromosome genes are lowly 37 expressed outside the testis, we report many instances of elevated Y-Chromosome gene 38 expression in a non-reproductive tissue.
    [Show full text]
  • Genetics of Azoospermia
    International Journal of Molecular Sciences Review Genetics of Azoospermia Francesca Cioppi , Viktoria Rosta and Csilla Krausz * Department of Biochemical, Experimental and Clinical Sciences “Mario Serio”, University of Florence, 50139 Florence, Italy; francesca.cioppi@unifi.it (F.C.); viktoria.rosta@unifi.it (V.R.) * Correspondence: csilla.krausz@unifi.it Abstract: Azoospermia affects 1% of men, and it can be due to: (i) hypothalamic-pituitary dysfunction, (ii) primary quantitative spermatogenic disturbances, (iii) urogenital duct obstruction. Known genetic factors contribute to all these categories, and genetic testing is part of the routine diagnostic workup of azoospermic men. The diagnostic yield of genetic tests in azoospermia is different in the different etiological categories, with the highest in Congenital Bilateral Absence of Vas Deferens (90%) and the lowest in Non-Obstructive Azoospermia (NOA) due to primary testicular failure (~30%). Whole- Exome Sequencing allowed the discovery of an increasing number of monogenic defects of NOA with a current list of 38 candidate genes. These genes are of potential clinical relevance for future gene panel-based screening. We classified these genes according to the associated-testicular histology underlying the NOA phenotype. The validation and the discovery of novel NOA genes will radically improve patient management. Interestingly, approximately 37% of candidate genes are shared in human male and female gonadal failure, implying that genetic counselling should be extended also to female family members of NOA patients. Keywords: azoospermia; infertility; genetics; exome; NGS; NOA; Klinefelter syndrome; Y chromosome microdeletions; CBAVD; congenital hypogonadotropic hypogonadism Citation: Cioppi, F.; Rosta, V.; Krausz, C. Genetics of Azoospermia. 1. Introduction Int. J. Mol. Sci.
    [Show full text]
  • Product Description SALSA MLPA Probemix P360-B2 Y-Chromosome
    MRC-Holland ® Product Description version B2-01; Issued 20 March 2019 MLPA Product Description SALSA ® MLPA ® Probemix P360-B2 Y-Chromosome Microdeletions To be used with the MLPA General Protocol. Version B2. As compared to version B1, one probe length has been adjusted . For complete product history see page 14. Catalogue numbers: • P360-025R: SALSA MLPA Probemix P360 Y-Chromosome Microdeletions, 25 reactions. • P360-050R: SALSA MLPA Probemix P360 Y-Chromosome Microdeletions, 50 reactions. • P360-100R: SALSA MLPA Probemix P360 Y-Chromosome Microdeletions, 100 reactions. To be used in combination with a SALSA MLPA reagent kit, available for various number of reactions. MLPA reagent kits are either provided with FAM or Cy5.0 dye-labelled PCR primer, suitable for Applied Biosystems and Beckman capillary sequencers, respectively (see www.mlpa.com ). This SALSA MLPA probemix is for basic research and intended for experienced MLPA users only! This probemix is intended to quantify genes or chromosomal regions in which the occurrence of copy number changes is not yet well-established and the relationship between genotype and phenotype is not yet clear. Interpretation of results can be complicated. MRC-Holland recommends thoroughly screening any available literature. Certificate of Analysis: Information regarding storage conditions, quality tests, and a sample electropherogram from the current sales lot is available at www.mlpa.com . Precautions and warnings: For professional use only. Always consult the most recent product description AND the MLPA General Protocol before use: www.mlpa.com . It is the responsibility of the user to be aware of the latest scientific knowledge of the application before drawing any conclusions from findings generated with this product.
    [Show full text]
  • X- and Y-Linked Chromatin-Modifying Genes As Regulators of Sex-Specific Cancer Incidence and Prognosis
    Author Manuscript Published OnlineFirst on July 30, 2020; DOI: 10.1158/1078-0432.CCR-20-1741 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. X- and Y-linked chromatin-modifying genes as regulators of sex- specific cancer incidence and prognosis Rossella Tricarico1,2,*, Emmanuelle Nicolas1, Michael J. Hall 3, and Erica A. Golemis1,* 1Molecular Therapeutics Program, Fox Chase Cancer Center, Philadelphia, PA, 19111, USA; 2Department of Biology and Biotechnology, University of Pavia, 27100 Pavia, Italy; 3Cancer Prevention and Control Program, Department of Clinical Genetics, Fox Chase Cancer Center, Philadelphia, PA, 19111, USA Running title: Allosomally linked epigenetic regulators in cancer Conflict Statement: The authors declare no conflict of interest. Funding: The authors are supported by NIH DK108195 and CA228187 (to EAG), by NCI Core Grant CA006927 (to Fox Chase Cancer Center), and by a Marie Curie Individual Fellowship from the Horizon 2020 EU Program (to RT). * Correspondence should be directed to: Erica A. Golemis Fox Chase Cancer Center 333 Cottman Ave. Philadelphia, PA 19111 USA [email protected] (215) 728-2860 or Rossella Tricarico Department of Biology and Biotechnology University of Pavia Via Ferrata 9, 27100 Pavia, Italy [email protected] +39 340-2429631 1 Downloaded from clincancerres.aacrjournals.org on September 25, 2021. © 2020 American Association for Cancer Research. Author Manuscript Published OnlineFirst on July 30, 2020; DOI: 10.1158/1078-0432.CCR-20-1741 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Abstract Biological sex profoundly conditions organismal development and physiology, imposing wide-ranging effects on cell signaling, metabolism, and immune response.
    [Show full text]
  • Original Article Identification of Differentially Expressed Genes Between Male and Female Patients with Acute Myocardial Infarction Based on Microarray Data
    Int J Clin Exp Med 2019;12(3):2456-2467 www.ijcem.com /ISSN:1940-5901/IJCEM0080626 Original Article Identification of differentially expressed genes between male and female patients with acute myocardial infarction based on microarray data Huaqiang Zhou1,2*, Kaibin Yang2*, Shaowei Gao1, Yuanzhe Zhang2, Xiaoyue Wei2, Zeting Qiu1, Si Li2, Qinchang Chen2, Yiyan Song2, Wulin Tan1#, Zhongxing Wang1# 1Department of Anesthesiology, The First Affiliated Hospital of Sun Yat-sen University, Guangzhou, China; 2Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, China. *Equal contributors and co-first au- thors. #Equal contributors. Received May 31, 2018; Accepted August 4, 2018; Epub March 15, 2019; Published March 30, 2019 Abstract: Background: Coronary artery disease has been the most common cause of death and the prognosis still needs further improving. Differences in the incidence and prognosis of male and female patients with coronary artery disease have been observed. We constructed this study hoping to understand those differences at the level of gene expression and to help establish gender-specific therapies. Methods: We downloaded the series matrix file of GSE34198 from the Gene Expression Omnibus database and identified differentially expressed genes between male and female patients. Gene ontology, Kyoto Encyclopedia of Genes and Genomes pathway enrichment analy- sis, and GSEA analysis of differentially expressed genes were performed. The protein-protein interaction network was constructed of the differentially expressed genes and the hub genes were identified. Results: A total of 215 up-regulated genes and 353 down-regulated genes were identified. The differentially expressed pathways were mainly related to the function of ribosomes, virus, and related immune response as well as the cell growth and proliferation.
    [Show full text]
  • Distinct Prophase Arrest Mechanisms in Human Male Meiosis
    bioRxiv preprint doi: https://doi.org/10.1101/195321; this version posted September 28, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Distinct prophase arrest mechanisms in human male meiosis Sabrina Z. Jan1, Aldo Jongejan2, Cindy M. Korver1, Saskia K.M. van Daalen1, Ans M.M. van Pelt1, Sjoerd Repping1 and Geert Hamer1,* 1 Center for Reproductive Medicine, Amsterdam Research Institute Reproduction and Development, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands 2 Bioinformatics Laboratory, Department of Clinical Epidemiology, Biostatistics and Bioinformatics, Academic Medical Center Amsterdam, The Netherlands * Correspondence: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/195321; this version posted September 28, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. To prevent chromosomal aberrations to be transmitted to the offspring, strict meiotic checkpoints are in place to remove aberrant spermatocytes. However, in about 1% of all males these checkpoints cause complete meiotic arrest leading to azoospermia and subsequent infertility. We here unravel two clearly distinct meiotic arrest mechanisms that act during the prophase of human male meiosis. Type I arrested spermatocytes display severe asynapsis of the homologous chromosomes, disturbed XY-body formation and increased expression of the Y-chromosome encoded gene ZFY and seem to activate a DNA damage pathway leading to induction of p63 mediated spermatocyte elimination. Type II arrested spermatocytes display normal chromosome synapsis, normal XY-body morphology and meiotic crossover formation but have a lowered expression of several cell cycle regulating genes and fail to properly silence the X-chromosome encoded gene ZFX.
    [Show full text]
  • Computational Analysis of High Risk Missense Variant in Human UTY Gene: a Candidate Gene of Azfa Sub-Region
    Original Article Computational Analysis of High Risk Missense Variant in Human UTY Gene: A Candidate Gene of AZFa Sub-region Mili Nailwal, Jenabhai Bhathibhai Chauhan * - P.G. Department of Genetics, Ashok & Rita Patel Institute of Integrated Study & Research in Biotechnology and Allied Sciences (ARIBAS), Gujarat, India Abstract Background: The human Ubiquitously transcribed tetratricopeptide repeat gene, Y- linked (UTY) gene encodes histone demethylase involved in protein-protein interac- tions. UTY protein evidence at protein level predicted intracellular and secreted pro- tein. UTY is also involved in spermatogenesis process. Methods: The high-risk non-synonymous single nucleotide polymorphism in the coding region of the UTY gene was screened by SNP database and identified mis- sense variants were subjected to computational analysis to understand the effect on protein function, stability and structure by SIFT, PolyPhen 2, PANTHER, PROVEAN, I-Mutant 2, iPTREE-STAB, ConSurf, ModPred, SPARKS-X, QMEAN, PROCHECK, project HOPE and STRING. * Corresponding Author: Jenabhai B. Chauhan, Results: A total of 151 nsSNPs variants were retrieved in UTY gene out of which Department of Genetics, one missense variant (E18D) was predicted to be damaging or deleterious using Ashok & Rita Patel SIFT, PolyPhen 2, PANTHER and PROVEAN. Additionally, E18D variant showed Institute of Integrated less stability, high conservation and having role in post translation modification us- Study & Research in Biotechnology and Allied ing i-Mutant 2 and iPTREE-STAB, ConSurf and ModPred, respectively. The pre- Sciences (ARIBAS), New dicted 3D model of UTY using SPARKS-X with z-score of 15.16 was generated and Vallabh Vidyanagar- validated via QMEAN (Z-score of 0.472) and PROCHECK which plots Ramacha- 388121, Dist-Anand, ndran plot (85.3% residues in most favored regions, 12.3% in additionally allowed Gujarat, India regions, 2.0% in generously allowed regions and 4.0% were in disallowed regions) E-mail: jenabhaichauhan@aribas.
    [Show full text]