DOCSLIB.ORG

Ep 3378954 B1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Ep 3378954 B1 (19) *EP003378954B1* (11) EP 3 378 954 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: C12Q 1/6851 (2018.01) C12Q 1/6879 (2018.01) (2018.01) (2018.01) 17.02.2021 Bulletin 2021/07 C12Q 1/6881 C12Q 1/6883 (21) Application number: 18151693.1 (22) Date of filing: 27.04.2012 (54) QUANTIFICATION OF A MINORITY NUCLEIC ACID SPECIES QUANTIFIZIERUNG EINER MINDERHEITSVARIANTE EINER NUKLEINSÄURE QUANTIFICATION D’UNE MINORITÉ D’ESPÈCES D’ACIDE NUCLÉIQUE (84) Designated Contracting States: • DOMINGUEZ PATRICK L ET AL: "Wild-type AL AT BE BG CH CY CZ DE DK EE ES FI FR GB blocking polymerase chain reaction for detection GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO of single nucleotide minority mutations from PL PT RO RS SE SI SK SM TR clinical specimens", ONCOGENE, NATURE PUBLISHING GROUP UK, LONDON, vol. 24, no. (30) Priority: 29.04.2011 US 201161480686 P 45, 1 October 2005 (2005-10-01), pages 6830-6834, XP002503989, ISSN: 0950-9232, DOI: (43) Date of publication of application: 10.1038/SJ.ONC.1208832 [retrieved on 26.09.2018 Bulletin 2018/39 2005-08-22] • X. LIU ET AL: "The ribosomal small-subunit (62) Document number(s) of the earlier application(s) in protein S28 gene from Helianthus annuus accordance with Art. 76 EPC: (Asteraceae) is down-regulated in response to 12718553.6 / 2 702 168 drought, high salinity, and abscisic acid", AMERICAN JOURNAL OF BOTANY, vol. 90, no. (73) Proprietor: Sequenom, Inc. 4, 1 April 2003 (2003-04-01), pages 526-531, San Diego, CA 92121 (US) XP055034688, ISSN: 0002-9122, DOI: 10.3732/ajb.90.4.526 (72) Inventor: NYGREN, Anders • PILAR SÃ NCHEZ ET AL: "Effects of Sulpiride on San Diego, CA 92122 (US) Prolactin and mRNA Levels of Steroid 5Î+--reductase Isozymes in Adult Rat Brain", (74) Representative: Vossius & Partner NEUROCHEMICAL RESEARCH, KLUWER Patentanwälte Rechtsanwälte mbB ACADEMIC PUBLISHERS-PLENUM Siebertstrasse 3 PUBLISHERS, NE, vol. 33, no. 5, 17 October 2007 81675 München (DE) (2007-10-17), pages 820-825, XP019579128, ISSN: 1573-6903 (56) References cited: • KRISTENSEN LASSE SOMMER ET AL: EP-A1- 1 435 394 WO-A1-02/18616 "PCR-Based Methods for Detecting Single-Locus WO-A1-2011/034631 US-A- 6 057 134 DNA Methylation Biomarkers in Cancer Diagnostics, Prognostics, and Response to Treatment", CLINICAL CHEMISTRY, AMERICAN ASSOCIATION FOR CLINICAL CHEMISTRY, WASHINGTON, DC, vol. 55, no. 8, 1 August 2009 (2009-08-01) , pages 1471-1483, XP002596712, ISSN: 0009-9147, DOI: 10.1373/CLINCHEM.2008.121962 [retrieved on 2009-06-11] Note: Within nine months of the publication of the mention of the grant of the European patent in the European Patent Bulletin, any person may give notice to the European Patent Office of opposition to that patent, in accordance with the Implementing Regulations. Notice of opposition shall not be deemed to have been filed until the opposition fee has been paid. (Art. 99(1) European Patent Convention). EP 3 378 954 B1 Printed by Jouve, 75001 PARIS (FR) (Cont. next page) EP 3 378 954 B1 • LIU Z ET AL: "Quantification of regional DNA methylation by liquid chromatography/tandem mass spectrometry", ANALYTICAL BIOCHEMISTRY, ACADEMIC PRESS INC, NEW YORK, vol. 391, no. 2, 15 August 2009 (2009-08-15), pages 106-113, XP026218819, ISSN: 0003-2697, DOI: 10.1016/J.AB.2009.05.012 [retrieved on 2009-05-12] 2 EP 3 378 954 B1 Description Field 5 [0001] The technology relates in part to quantification of a minority nucleic acid species. In some embodiments, methods for determining the amount of cell-free fetal DNA in a maternal sample are provided. Background 10 [0002] Cell-free DNA (CF-DNA) is composed of DNA fragments that originate from cell death and circulate in peripheral blood. High concentrations of CF-DNA can be indicative of certain clinical conditions such as cancer, trauma, burns, myocardial infarction, stroke, sepsis, infection, and other illnesses. Additionally, cell-free fetal DNA (CFF-DNA) can be detected in the maternal bloodstream and used for various noninvasive prenatal diagnostics. [0003] The presence of fetal nucleic acid in maternal plasma allows for non-invasive prenatal diagnosis through the 15 analysis of a maternal blood sample. For example, quantitative abnormalities of fetal DNA in maternal plasma can be associated with a number of pregnancy-associated disorders, including preeclampsia, preterm labor, antepartum hem- orrhage, invasive placentation, fetal Down syndrome, and other fetal chromosomal aneuploidies. Hence, fetal nucleic acid analysis in maternal plasma is a useful mechanism for the monitoring of fetomaternal well-being. [0004] Early detection of pregnancy-related conditions, including complications during pregnancy and genetic defects 20 of the fetus is important, as it allows early medical intervention necessary for the safety of both the mother and the fetus. Prenatal diagnosis traditionally has been conducted using cells isolated from the fetus through procedures such as chorionic villus sampling (CVS) or amniocentesis. However, these conventional methods are invasive and present an appreciable risk to both the mother and the fetus. The National Health Service currently cites a miscarriage rate of between 1 and 2 per cent following the invasive amniocentesis and chorionic villus sampling (CVS) tests. An alternative 25 to these invasive approaches is the use of non-invasive screening techniques that utilize circulating CFF-DNA. [0005] WO 2011/034631 discloses a fetal quantifier method which may be carried out on a maternal plasma or serum sample and comprises the following steps: Restriction with enzymes; amplification in a multiplex fashion of a region methylated in fetal DNA, but not methylated in maternal DNA; of the APOE gene as a quantification of the total nucleic acids; of a SRY region; and of a region known not to be methylated. For each of the amplifications a competitor oligo- 30 nucleotide which competes with the target for binding to the PCR primers is added in a known amount. The amplifiable genomes are quantified and the amount and concentration of fetal DNA is calculated. [0006] Dominugez et al. (2005), Oncogene, 24(45):6830-6834 describe the wild-type blocking polymerase chain re- action (WTB-PCR), which allows the sensitive detection of minority mutations in a tissue sample containing excess wild- type DNA. 35 Summary [0007] The present invention is defined by the claims. Accordingly the present invention relates to a kit for determining the amount of a minority nucleic acid species in a sample which contains a minority species and a majority species, the 40 combination of the minority species and the majority species comprising total nucleic acid in the sample, comprising: (a) a first set of amplification primers that specifically amplify a first region comprising a feature that (1) is present in the minority nucleic acid species and is not present in the majority nucleic acid species, or (2) is not present in the minority nucleic acid species and is present in the majority nucleic acid species, (b) a second set of amplification primers that amplify a second region allowing for a determination of total nucleic acid in the sample, where the first region and the 45 second region are different, and (c) one or more inhibitory oligonucleotides, wherein the one or more inhibitory oligonu- cleotides (1) hybridize to the second region but are not extended and (2) reduce the amplification of the second region; thereby generating minority nucleic acid amplification products and total nucleic acid amplification products, wherein the amount of the second set of amplification primers relative to the amount of the one or more inhibitory oligonucleotides comprises a ratio whereby the total nucleic acid amplification products are reduced relative to total amplification products 50 that would be generated if no inhibitory oligonucleotide was present, and whereby the total nucleic acid amplification products are amplified to a similar degree as the minority nucleic acid amplification products. [0008] The term "embodiment" as used herein below relates to embodiments of the disclosure and not necessarily to the embodiments of the invention. [0009] Provided in some embodiments is a method for determining the amount of a minority nucleic acid species in 55 a sample which contains a minority species and a majority species, the combination of the minority species and the majority species comprising total nucleic acid in the sample, comprising (a) contacting under amplification conditions a nucleic acid sample comprising the minority nucleic acid species with: (i) a first set of amplification primers that specifically amplify a first region comprising a feature that (1) is present in the minority nucleic acid species and is not present in 3 EP 3 378 954 B1 the majority nucleic acid species, or (2) is not present in the minority nucleic acid species and is present in the majority nucleic acid species, (ii) a second set of amplification primers that amplify a second region allowing for a determination of total nucleic acid in the sample, where the first region and the second region are different, and (iii) one or more inhibitory oligonucleotides that reduce the amplification of the second region, thereby generating minority and total 5 nucleic acid amplification products, where the total nucleic acid amplification products are reduced relative to total amplification products that would be generated if no inhibitory oligonucleotide was present, (b) separating the minority and total nucleic acid amplification products, thereby generating separated minority and total nucleic acid amplification products, and (c) determining the fraction of the minority nucleic acid species in the sample relative to the total amount of the nucleic acid in the sample based on the amount of each of the separated minority and total nucleic acid amplification 10 products.
Load more

Recommended publications
  • UTY (NM 001258249) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG235303 UTY (NM_001258249) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: UTY (NM_001258249) Human Tagged ORF Clone Tag: TurboGFP Symbol: UTY Synonyms: KDM6AL; KDM6C; UTY1 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG235303 representing NM_001258249 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAATCCTGCGCAGTGTCGCTCACTACCGCCGCTGTTGCCTTCGGTGATGAGGCAAAGAAAATGGCGG AAGGAAAAGCGAGCCGCGAGAGTGAAGAGGAGTCTGTTAGCCTGACAGTCGAGGAAAGGGAGGCGCTTGG TGGCATGGACAGCCGTCTCTTCGGGTTCGTGAGGCTTCATGAAGATGGCGCCAGAACGAAGACCCTACTA GGCAAGGCTGTTCGCTGCTACGAATCTTTAATCTTAAAAGCTGAAGGAAAAGTGGAGTCTGACTTCTTTT GCCAATTAGGTCACTTCAACCTCTTGTTGGAAGATTATTCAAAAGCATTATCTGCATATCAGAGATATTA CAGTTTACAGGCTGACTACTGGAAGAATGCTGCGTTTTTATATGGCCTTGGTTTGGTCTACTTCTACTAC AATGCATTTCATTGGGCAATTAAAGCATTTCAAGATGTCCTTTATGTTGACCCCAGCTTTTGTCGAGCCA AGGAAATTCATTTACGACTTGGGCTCATGTTCAAAGTGAACACAGACTACAAGTCTAGTTTAAAGCATTT TCAGTTAGCCTTGATTGACTGTAATCCATGTACTTTGTCCAATGCTGAAATTCAATTTCATATTGCCCAT TTGTATGAAACCCAGAGGAAGTATCATTCTGCAAAGGAGGCATATGAACAACTTTTGCAGACAGAAAACC TTCCTGCACAAGTAAAAGCAACTGTATTGCAACAGTTAGGTTGGATGCATCATAATATGGATCTAGTAGG AGACAAAGCCACAAAGGAAAGCTATGCTATTCAGTATCTCCAAAAGTCTTTGGAGGCAGATCCTAATTCT GGCCAATCGTGGTATTTTCTTGGAAGGTGTTATTCAAGTATTGGGAAAGTTCAGGATGCCTTTATATCTT
    [Show full text]
  • Prenatal Sex Differences in the Human Brain
    Molecular Psychiatry (2009) 14, 988–991 & 2009 Nature Publishing Group All rights reserved 1359-4184/09 $32.00 www.nature.com/mp LETTERS TO THE EDITOR Prenatal sex differences in the human brain Molecular Psychiatry (2009) 14, 988–989. doi:10.1038/ development. These genes are not only expressed in mp.2009.79 the brain before birth but some of them are also known to have sex differences in adult brain,1,4 whereas others are expressed during infancy, but The presence of genetic sex differences in the adult reduced later on during their lifetime.5 human brain is now recognized.1 We hypothesized Intriguingly, SRY, a well-known determinant of that the basis of this sex bias is already established in testicle development during midgestation,6 showed the brain before birth. Here, we show that several no evidence of expression in any of the brain regions genes encoded in the Y-chromosome are expressed in analyzed (Figure 1b, and Supplementary Figure 1), many regions of the male prenatal brain, likely having suggesting that the main somatic sex determinants functional consequences for sex bias during human may be different for the brain and gonads during brain development. human gestation. The marked sex differences in age at onset, In humans, all 11 genes described here are encoded prevalence and symptoms for numerous neuropsy- in the male-specific region of the Y-chromosome,7 chiatric disorders2 indicate the importance to study with RPS4Y1 and ZFY located in the p-arm very close the emergence of a sex bias during human brain to SRY and most of the remaining genes located in the development.
    [Show full text]
  • Quantitative Analysis of Y-Chromosome Gene Expression Across 36 Human Tissues 6 7 8 9 Alexander K
    Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press 1 2 3 4 5 Quantitative analysis of Y-Chromosome gene expression across 36 human tissues 6 7 8 9 Alexander K. Godfrey1,2, Sahin Naqvi1,2, Lukáš Chmátal1, Joel M. Chick3, 10 Richard N. Mitchell4, Steven P. Gygi3, Helen Skaletsky1,5, David C. Page1,2,5* 11 12 13 1 Whitehead Institute, Cambridge, MA, USA 14 2 Department of Biology, Massachusetts Institute of Technology, Cambridge, MA, USA 15 3 Department of Cell Biology, Harvard Medical School, Boston, MA, USA 16 4 Department of Pathology, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA, USA 17 5 Howard Hughes Medical Institute, Whitehead Institute, Cambridge, MA, USA 18 19 20 21 *corresponding author: 22 Email: [email protected] 23 24 25 Running title: 26 Human Y-Chromosome gene expression in 36 tissues 27 28 29 Keywords: 30 Y Chromosome, sex chromosomes, sex differences, EIF1AY, EIF1AX 31 Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press 32 ABSTRACT 33 Little is known about how human Y-Chromosome gene expression directly contributes to 34 differences between XX (female) and XY (male) individuals in non-reproductive tissues. Here, 35 we analyzed quantitative profiles of Y-Chromosome gene expression across 36 human tissues 36 from hundreds of individuals. Although it is often said that Y-Chromosome genes are lowly 37 expressed outside the testis, we report many instances of elevated Y-Chromosome gene 38 expression in a non-reproductive tissue.
    [Show full text]
  • Product Description SALSA MLPA Probemix P360-B2 Y-Chromosome
    MRC-Holland ® Product Description version B2-01; Issued 20 March 2019 MLPA Product Description SALSA ® MLPA ® Probemix P360-B2 Y-Chromosome Microdeletions To be used with the MLPA General Protocol. Version B2. As compared to version B1, one probe length has been adjusted . For complete product history see page 14. Catalogue numbers: • P360-025R: SALSA MLPA Probemix P360 Y-Chromosome Microdeletions, 25 reactions. • P360-050R: SALSA MLPA Probemix P360 Y-Chromosome Microdeletions, 50 reactions. • P360-100R: SALSA MLPA Probemix P360 Y-Chromosome Microdeletions, 100 reactions. To be used in combination with a SALSA MLPA reagent kit, available for various number of reactions. MLPA reagent kits are either provided with FAM or Cy5.0 dye-labelled PCR primer, suitable for Applied Biosystems and Beckman capillary sequencers, respectively (see www.mlpa.com ). This SALSA MLPA probemix is for basic research and intended for experienced MLPA users only! This probemix is intended to quantify genes or chromosomal regions in which the occurrence of copy number changes is not yet well-established and the relationship between genotype and phenotype is not yet clear. Interpretation of results can be complicated. MRC-Holland recommends thoroughly screening any available literature. Certificate of Analysis: Information regarding storage conditions, quality tests, and a sample electropherogram from the current sales lot is available at www.mlpa.com . Precautions and warnings: For professional use only. Always consult the most recent product description AND the MLPA General Protocol before use: www.mlpa.com . It is the responsibility of the user to be aware of the latest scientific knowledge of the application before drawing any conclusions from findings generated with this product.
    [Show full text]
  • X- and Y-Linked Chromatin-Modifying Genes As Regulators of Sex-Specific Cancer Incidence and Prognosis
    Author Manuscript Published OnlineFirst on July 30, 2020; DOI: 10.1158/1078-0432.CCR-20-1741 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. X- and Y-linked chromatin-modifying genes as regulators of sex- specific cancer incidence and prognosis Rossella Tricarico1,2,*, Emmanuelle Nicolas1, Michael J. Hall 3, and Erica A. Golemis1,* 1Molecular Therapeutics Program, Fox Chase Cancer Center, Philadelphia, PA, 19111, USA; 2Department of Biology and Biotechnology, University of Pavia, 27100 Pavia, Italy; 3Cancer Prevention and Control Program, Department of Clinical Genetics, Fox Chase Cancer Center, Philadelphia, PA, 19111, USA Running title: Allosomally linked epigenetic regulators in cancer Conflict Statement: The authors declare no conflict of interest. Funding: The authors are supported by NIH DK108195 and CA228187 (to EAG), by NCI Core Grant CA006927 (to Fox Chase Cancer Center), and by a Marie Curie Individual Fellowship from the Horizon 2020 EU Program (to RT). * Correspondence should be directed to: Erica A. Golemis Fox Chase Cancer Center 333 Cottman Ave. Philadelphia, PA 19111 USA [email protected] (215) 728-2860 or Rossella Tricarico Department of Biology and Biotechnology University of Pavia Via Ferrata 9, 27100 Pavia, Italy [email protected] +39 340-2429631 1 Downloaded from clincancerres.aacrjournals.org on September 25, 2021. © 2020 American Association for Cancer Research. Author Manuscript Published OnlineFirst on July 30, 2020; DOI: 10.1158/1078-0432.CCR-20-1741 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Abstract Biological sex profoundly conditions organismal development and physiology, imposing wide-ranging effects on cell signaling, metabolism, and immune response.
    [Show full text]
  • Original Article Identification of Differentially Expressed Genes Between Male and Female Patients with Acute Myocardial Infarction Based on Microarray Data
    Int J Clin Exp Med 2019;12(3):2456-2467 www.ijcem.com /ISSN:1940-5901/IJCEM0080626 Original Article Identification of differentially expressed genes between male and female patients with acute myocardial infarction based on microarray data Huaqiang Zhou1,2*, Kaibin Yang2*, Shaowei Gao1, Yuanzhe Zhang2, Xiaoyue Wei2, Zeting Qiu1, Si Li2, Qinchang Chen2, Yiyan Song2, Wulin Tan1#, Zhongxing Wang1# 1Department of Anesthesiology, The First Affiliated Hospital of Sun Yat-sen University, Guangzhou, China; 2Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, China. *Equal contributors and co-first au- thors. #Equal contributors. Received May 31, 2018; Accepted August 4, 2018; Epub March 15, 2019; Published March 30, 2019 Abstract: Background: Coronary artery disease has been the most common cause of death and the prognosis still needs further improving. Differences in the incidence and prognosis of male and female patients with coronary artery disease have been observed. We constructed this study hoping to understand those differences at the level of gene expression and to help establish gender-specific therapies. Methods: We downloaded the series matrix file of GSE34198 from the Gene Expression Omnibus database and identified differentially expressed genes between male and female patients. Gene ontology, Kyoto Encyclopedia of Genes and Genomes pathway enrichment analy- sis, and GSEA analysis of differentially expressed genes were performed. The protein-protein interaction network was constructed of the differentially expressed genes and the hub genes were identified. Results: A total of 215 up-regulated genes and 353 down-regulated genes were identified. The differentially expressed pathways were mainly related to the function of ribosomes, virus, and related immune response as well as the cell growth and proliferation.
    [Show full text]
  • Computational Analysis of High Risk Missense Variant in Human UTY Gene: a Candidate Gene of Azfa Sub-Region
    Original Article Computational Analysis of High Risk Missense Variant in Human UTY Gene: A Candidate Gene of AZFa Sub-region Mili Nailwal, Jenabhai Bhathibhai Chauhan * - P.G. Department of Genetics, Ashok & Rita Patel Institute of Integrated Study & Research in Biotechnology and Allied Sciences (ARIBAS), Gujarat, India Abstract Background: The human Ubiquitously transcribed tetratricopeptide repeat gene, Y- linked (UTY) gene encodes histone demethylase involved in protein-protein interac- tions. UTY protein evidence at protein level predicted intracellular and secreted pro- tein. UTY is also involved in spermatogenesis process. Methods: The high-risk non-synonymous single nucleotide polymorphism in the coding region of the UTY gene was screened by SNP database and identified mis- sense variants were subjected to computational analysis to understand the effect on protein function, stability and structure by SIFT, PolyPhen 2, PANTHER, PROVEAN, I-Mutant 2, iPTREE-STAB, ConSurf, ModPred, SPARKS-X, QMEAN, PROCHECK, project HOPE and STRING. * Corresponding Author: Jenabhai B. Chauhan, Results: A total of 151 nsSNPs variants were retrieved in UTY gene out of which Department of Genetics, one missense variant (E18D) was predicted to be damaging or deleterious using Ashok & Rita Patel SIFT, PolyPhen 2, PANTHER and PROVEAN. Additionally, E18D variant showed Institute of Integrated less stability, high conservation and having role in post translation modification us- Study & Research in Biotechnology and Allied ing i-Mutant 2 and iPTREE-STAB, ConSurf and ModPred, respectively. The pre- Sciences (ARIBAS), New dicted 3D model of UTY using SPARKS-X with z-score of 15.16 was generated and Vallabh Vidyanagar- validated via QMEAN (Z-score of 0.472) and PROCHECK which plots Ramacha- 388121, Dist-Anand, ndran plot (85.3% residues in most favored regions, 12.3% in additionally allowed Gujarat, India regions, 2.0% in generously allowed regions and 4.0% were in disallowed regions) E-mail: jenabhaichauhan@aribas.
    [Show full text]
  • Y Chromosome
    G C A T T A C G G C A T genes Article An 8.22 Mb Assembly and Annotation of the Alpaca (Vicugna pacos) Y Chromosome Matthew J. Jevit 1 , Brian W. Davis 1 , Caitlin Castaneda 1 , Andrew Hillhouse 2 , Rytis Juras 1 , Vladimir A. Trifonov 3 , Ahmed Tibary 4, Jorge C. Pereira 5, Malcolm A. Ferguson-Smith 5 and Terje Raudsepp 1,* 1 Department of Veterinary Integrative Biosciences, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX 77843-4458, USA; [email protected] (M.J.J.); [email protected] (B.W.D.); [email protected] (C.C.); [email protected] (R.J.) 2 Molecular Genomics Workplace, Institute for Genome Sciences and Society, Texas A&M University, College Station, TX 77843-4458, USA; [email protected] 3 Laboratory of Comparative Genomics, Institute of Molecular and Cellular Biology, 630090 Novosibirsk, Russia; [email protected] 4 Department of Veterinary Clinical Sciences, College of Veterinary Medicine, Washington State University, Pullman, WA 99164-6610, USA; [email protected] 5 Department of Veterinary Medicine, University of Cambridge, Cambridge CB3 0ES, UK; [email protected] (J.C.P.); [email protected] (M.A.F.-S.) * Correspondence: [email protected] Abstract: The unique evolutionary dynamics and complex structure make the Y chromosome the most diverse and least understood region in the mammalian genome, despite its undisputable role in sex determination, development, and male fertility. Here we present the first contig-level annotated draft assembly for the alpaca (Vicugna pacos) Y chromosome based on hybrid assembly of short- and long-read sequence data of flow-sorted Y.
    [Show full text]
  • The Y Chromosome: a Blueprint for Men’S Health?
    European Journal of Human Genetics (2017) 25, 1181–1188 Official journal of The European Society of Human Genetics www.nature.com/ejhg REVIEW The Y chromosome: a blueprint for men’s health? Akhlaq A Maan1, James Eales1, Artur Akbarov1, Joshua Rowland1, Xiaoguang Xu1, Mark A Jobling2, Fadi J Charchar3 and Maciej Tomaszewski*,1,4 The Y chromosome has long been considered a ‘genetic wasteland’ on a trajectory to completely disappear from the human genome. The perception of its physiological function was restricted to sex determination and spermatogenesis. These views have been challenged in recent times with the identification of multiple ubiquitously expressed Y-chromosome genes and the discovery of several unexpected associations between the Y chromosome, immune system and complex polygenic traits. The collected evidence suggests that the Y chromosome influences immune and inflammatory responses in men, translating into genetically programmed susceptibility to diseases with a strong immune component. Phylogenetic studies reveal that carriers of a common European lineage of the Y chromosome (haplogroup I) possess increased risk of coronary artery disease. This occurs amidst upregulation of inflammation and suppression of adaptive immunity in this Y lineage, as well as inferior outcomes in human immunodeficiency virus infection. From structural analysis and experimental data, the UTY (Ubiquitously Transcribed Tetratricopeptide Repeat Containing, Y-Linked) gene is emerging as a promising candidate underlying the associations between Y-chromosome variants and the immunity-driven susceptibility to complex disease. This review synthesises the recent structural, experimental and clinical insights into the human Y chromosome in the context of men’s susceptibility to disease (with a particular emphasis on cardiovascular disease) and provides an overview of the paradigm shift in the perception of the Y chromosome.
    [Show full text]
  • Regulatory Effects of the Uty/Ddx3y Locus on Neighboring Chromosome Y Genes and Autosomal Mrna Transcripts in Adult Mouse Non-Reproductive Cells
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.30.180232; this version posted July 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Regulatory effects of the Uty/Ddx3y locus on neighboring chromosome Y genes and autosomal mRNA transcripts in adult mouse non-reproductive cells Christian F. Deschepper Cardiovascular Biology Research Unit, Institut de recherches cliniques de Montréal (IRCM) and Université de Montréal Address : 100 Pine Ave West Montréal (QC) Canada H2W 1R7 E-mail : [email protected] Phone : 514 987 5759 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.30.180232; this version posted July 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 2 ABSTRACT In addition to sperm-related genes, the male-specific chromosome Y (chrY) contains a class of ubiquitously expressed and evolutionary conserved dosage-sensitive regulator genes that include the neighboring Uty, Ddx3y and (in mice) Eif2s3y genes. However, no study to date has investigated the functional impact of targeted mutations of any of these genes within adult non-reproductive somatic cells. We thus compared adult male mice carrying a gene trap within their Uty gene (UtyGT) to their wild-type (WT) isogenic controls, and performed deep sequencing of RNA and genome-wide profiling of chromatin features in extracts from either cardiac tissue, cardiomyocyte-specific nuclei or purified cardiomyocytes. The apparent impact of UtyGT on gene transcription concentrated mostly on chrY genes surrounding the locus of insertion, i.e.
    [Show full text]
  • Regulatory Effects of the Uty/Ddx3y Locus on Neighboring Chromosome Y Genes and Autosomal Mrna Transcripts in Adult Mouse Non-Re
    www.nature.com/scientificreports OPEN Regulatory efects of the Uty/Ddx3y locus on neighboring chromosome Y genes and autosomal mRNA transcripts in adult mouse non‑reproductive cells Christian F. Deschepper In addition to sperm‑related genes, the male‑specifc chromosome Y (chrY) contains a class of ubiquitously expressed and evolutionary conserved dosage‑sensitive regulator genes that include the neighboring Uty, Ddx3y and (in mice) Eif2s3y genes. However, no study to date has investigated the functional impact of targeted mutations of any of these genes within adult non‑reproductive somatic cells. We thus compared adult male mice carrying a gene trap within their Uty gene (UtyGT) to their wild‑type (WT) isogenic controls, and performed deep sequencing of RNA and genome‑wide profling of chromatin features in extracts from either cardiac tissue, cardiomyocyte‑specifc nuclei or purifed cardiomyocytes. The apparent impact of UtyGT on gene transcription concentrated mostly on chrY genes surrounding the locus of insertion, i.e. Uty, Ddx3y, long non‑coding RNAs (lncRNAs) contained within their introns and Eif2s3y, in addition to possible efects on the autosomal Malat1 lncRNA. Notwithstanding, UtyGT also caused coordinate changes in the abundance of hundreds of mRNA transcripts related to coherent cell functions, including RNA processing and translation. The results altogether indicated that tightly co‑regulated chrY genes had nonetheless more widespread efects on the autosomal transcriptome in adult somatic cells, most likely due to mechanisms other than just transcriptional regulation of corresponding protein‑coding genes. Although the contributions of genes on the male sex chrY have long believed to be restricted to their efects on reproductive functions in sex organs, increasing evidence indicates that their impact may in fact extend to somatic cells as well.
    [Show full text]
  • Edger: Differential Analysis of Sequence Read Count Data User's
    edgeR: differential analysis of sequence read count data User’s Guide Yunshun Chen 1,2, Davis McCarthy 3,4, Matthew Ritchie 1,2, Mark Robinson 5, and Gordon Smyth 1,6 1Walter and Eliza Hall Institute of Medical Research, Parkville, Victoria, Australia 2Department of Medical Biology, University of Melbourne, Victoria, Australia 3St Vincent’s Institute of Medical Research, Fitzroy, Victoria, Australia 4Melbourne Integrative Genomics, University of Melbourne, Victoria, Australia 5Institute of Molecular Life Sciences and SIB Swiss Institute of Bioinformatics, University of Zurich, Zurich, Switzerland 6School of Mathematics and Statistics, University of Melbourne, Victoria, Australia First edition 17 September 2008 Last revised 12 May 2021 Contents 1 Introduction .............................7 1.1 Scope .................................7 1.2 Citation.................................7 1.3 How to get help ............................9 1.4 Quick start ............................... 10 2 Overview of capabilities ...................... 11 2.1 Terminology .............................. 11 2.2 Aligning reads to a genome ..................... 11 2.3 Producing a table of read counts .................. 11 2.4 Reading the counts from a file ................... 12 2.5 Pseudoalignment and quasi-mapping ............... 12 2.6 The DGEList data class ....................... 12 2.7 Filtering ................................ 13 2.8 Normalization ............................. 14 2.8.1 Normalization is only necessary for sample-specific effects .... 14 2.8.2 Sequencing depth ........................ 14 2.8.3 Effective library sizes ....................... 15 2.8.4 GC content ............................ 15 2.8.5 Gene length ........................... 16 2.8.6 Model-based normalization, not transformation .......... 16 2.8.7 Pseudo-counts .......................... 16 2 edgeR User’s Guide 2.9 Negative binomial models ...................... 17 2.9.1 Introduction ........................... 17 2.9.2 Biological coefficient of variation (BCV) .............
    [Show full text]