DOCSLIB.ORG

Regulatory Effects of the Uty/Ddx3y Locus on Neighboring Chromosome Y Genes and Autosomal Mrna Transcripts in Adult Mouse Non-Reproductive Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Regulatory Effects of the Uty/Ddx3y Locus on Neighboring Chromosome Y Genes and Autosomal Mrna Transcripts in Adult Mouse Non-Reproductive Cells bioRxiv preprint doi: https://doi.org/10.1101/2020.06.30.180232; this version posted July 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Regulatory effects of the Uty/Ddx3y locus on neighboring chromosome Y genes and autosomal mRNA transcripts in adult mouse non-reproductive cells Christian F. Deschepper Cardiovascular Biology Research Unit, Institut de recherches cliniques de Montréal (IRCM) and Université de Montréal Address : 100 Pine Ave West Montréal (QC) Canada H2W 1R7 E-mail : [email protected] Phone : 514 987 5759 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.30.180232; this version posted July 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 2 ABSTRACT In addition to sperm-related genes, the male-specific chromosome Y (chrY) contains a class of ubiquitously expressed and evolutionary conserved dosage-sensitive regulator genes that include the neighboring Uty, Ddx3y and (in mice) Eif2s3y genes. However, no study to date has investigated the functional impact of targeted mutations of any of these genes within adult non-reproductive somatic cells. We thus compared adult male mice carrying a gene trap within their Uty gene (UtyGT) to their wild-type (WT) isogenic controls, and performed deep sequencing of RNA and genome-wide profiling of chromatin features in extracts from either cardiac tissue, cardiomyocyte-specific nuclei or purified cardiomyocytes. The apparent impact of UtyGT on gene transcription concentrated mostly on chrY genes surrounding the locus of insertion, i.e. Uty, Ddx3y, long non-coding RNAs (lncRNAs) contained within their introns and Eif2s3y, in addition to possible effects on the autosomal Malat1 lncRNA. Notwithstanding, UtyGT also caused coordinate changes in the abundance of hundreds of mRNA transcripts related to coherent cell functions, including RNA processing and translation. The results altogether indicated that tightly co-regulated chrY genes had nonetheless more widespread effects on the autosomal transcriptome in adult somatic cells, most likely due to mechanisms other than just transcriptional regulation of corresponding protein-coding genes. INTRODUCTION Although the contributions of genes on the male sex chrY have long believed to be restricted to their effects on reproductive functions in sex organs, increasing evidence indicates that their impact may in fact extend to somatic cells as well. Thus, several types of genetic rodent models have shown that chrY and/or some of its genetic variants affect a range of phenotypes within the cardiovascular, immune, metabolic or neurologic systems1,2,3,4,5. In humans, one specific haplotype of the male-specific portion of chrY (MSY) associates with increased coronary artery disease risk, along with altered gene expression within macrophages6, while mosaic loss of chrY in blood cells (a relatively frequent and age-related event) associates with a host of disease manifestations, including shorter survival, increased cancer risk, cardiovascular events, Alzheimer disease and age-related macular degeneration7,8,9,10. In addition of the male sex-determination Sry gene, MSY carries only a handful of protein-coding genes, which fall for the most part in two classes. The first one corresponds to genes expressed only in male reproductive tissues and/or specializing in sperm-related functions11,12. Genes within the second class share a particular set of properties, as they: i) are expressed ubiquitously in all tissues; ii) are X-degenerate genes that have on chromosome X (chrX) counterparts that escape chrX-inactivation in females; iii) exert bioRxiv preprint doi: https://doi.org/10.1101/2020.06.30.180232; this version posted July 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 3 their effects in a dose-related fashion that depends on expression of copies from both sex chromosomes; and iv) belong to an evolutionary conserved core of genes found in MSY from all placental vertebrates12. Although there are some species-specific variation concerning the exact nature of genes found in that shared core group, some of them (including Uty, Ddx3y and Kdm5d) are common to all investigated species12. In addition to the above properties, the X-degenerate genes on MSY have functional annotations that relate mostly to some of the most basic cell functions (such as chromatin modification, ubiquitination, translation, splicing and chromatin modification). To date, there is evidence (albeit limited) that X- degenerate genes on MSY show at least some level functional redundancy with their homologs on chrX. For instance, DDX3Y has been shown to be functionally interchangeable with DDX3X in cultured mammalian cells13,14. Likewise, studies using mice with inactivating gene traps of either Utx or Uty demonstrated that Uty showed high level of functional redundancy with Utx during development, with further tests showing that the effects of both genes were independent of any lysine demethylase activity15. In humans, overexpressed UTY has been shown to rescue preleukemic phenotypes induced by UTX deficiency, also in a manner that was independent of any lysine demethylase activity16. However, there is still no study to date exploring whether targeted mutations of MSY genes do have an impact on somatic non-reproductive cells in adult organisms. To address this particular question, we used male mice carrying an inactivating gene trap within the fourth intron of Uty (UtyGT in short). These mice were previously shown to be fully viable15, but not used for studying phenotypes other than those occurring during the developmental stage. In particular, we performed deep sequencing of RNA (RNA-Seq) in hearts and cardiomyocytes from either adult YUtyGT mice or their isogenic wild-type (WT) controls. The results were compared to those obtained with either a chromatin immunoprecipitation and sequencing (ChIP- Seq) assay of Histone H3 acetyl lysine-27 (H3K27ac) residues (i.e. marks of active enhancers) or with assays for transposase-accessible chromatin using sequencing (ATAC-Seq), which quantifies chromatin accessibility across the genome. We found that despite significant effects on hundreds of mRNA transcripts in cardiac cells, the genomic regulatory effects UtyGT were much more restricted, as they concentrated mostly on genomic regions on MSY. The data suggested that while the transcriptional effects of the Uty locus were restricted to a handful of regulators, the latter could nonetheless further regulate the transcriptomic profile of cells, presumably via post-transcriptional or post-translational mechanisms. bioRxiv preprint doi: https://doi.org/10.1101/2020.06.30.180232; this version posted July 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 4 RESULTS Regulatory effects of UtyGT on surrounding MSY genes and genomic sequences: Combined analysis of the results of RNA-Seq, ChIP-Seq and ATAC-Seq demonstrated that the greatest impact of UtyGT was observed on either the abundance of transcripts from surrounding genes or chromatin marks in corresponding genomic regulatory regions. RNA-Seq revealed that Ddx3y and Eif2s3y were among the top most affected genes, either in terms of statistical significance or absolute fold change (Table 1). Ddx3y was the gene whose expression was (after Uty itself) affected most significantly, with its abundance in either hearts or cardiomyocytes from UtyGT being about 15% of that in their WT counterparts (Table 1). Eif2s3y was among the 60 most affected genes but its expression was (contrary to Ddx3y) increased in hearts or cardiomyocytes from UtyGT mice. RT-qPCR experiments were performed to further validate those results. Since Uty, Ddx3y and Eif2s3y are all ubiquitously expressed MSY genes, non-cardiac tissues (including skeletal muscle, spleen, liver and/or primary lung fibroblasts) were included in the analysis. Regardless of the type of tissue, Ddx3y showed (similarly as detected by RNA-Seq) a greater than five-fold downregulation in samples from UtyGT mice (Fig. 1a). Likewise, Eif2s3y was upregulated in all tested tissues, the abundance of its mRNA transcripts in UtyGT tissues being about 150% of that found in their WT counterparts (Fig. 1b). In additional experiments, we verified whether UtyGT had any effect on expression of the chrX homologs of the above genes. Expression of Utx was unaffected and Ddx3x showed a slight increase of about 10 % (P < 0.05); expression of Eif2s3x was increased by about 40% (P < 0.01) (Supplementary Fig S1). To further test whether the impact of UtyGT could be found at the level of proteins as well, we took advantage of the fact that the protein sequences of mouse Ddx3x and Ddx3y show 92% identity with each other as well as with human DDX3X or DDX3Y, and used two distinct antibodies against human recombinant DDX3X for Western blot analyses. Data obtained with each antibody were pooled by normalizing all data by the average of the values obtained in material from females (Fig. 2). Left ventricles from male XYWT mice contained similar concentrations of overall Ddx3 immunoreactivity as that found in females; in contrast, the concentrations found in left ventricles from in male XYUtyGT mice was about 50% of that found in either male XYWT or female XX mice. Similar differences were observed in primary fibroblasts from male XYWT and XYUtyGT mice (Supplementary Fig S2). Altogether, the data indicated that the Ddx3y transcript was translated into a protein, and that its contribution to overall Ddx3 immunoreactivity was about equal as that of its chrX homolog Ddx3x. bioRxiv preprint doi: https://doi.org/10.1101/2020.06.30.180232; this version posted July 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
Load more

Recommended publications
  • Nuclear and Mitochondrial Genome Defects in Autisms
    UC Irvine UC Irvine Previously Published Works Title Nuclear and mitochondrial genome defects in autisms. Permalink https://escholarship.org/uc/item/8vq3278q Journal Annals of the New York Academy of Sciences, 1151(1) ISSN 0077-8923 Authors Smith, Moyra Spence, M Anne Flodman, Pamela Publication Date 2009 DOI 10.1111/j.1749-6632.2008.03571.x License https://creativecommons.org/licenses/by/4.0/ 4.0 Peer reviewed eScholarship.org Powered by the California Digital Library University of California THE YEAR IN HUMAN AND MEDICAL GENETICS 2009 Nuclear and Mitochondrial Genome Defects in Autisms Moyra Smith, M. Anne Spence, and Pamela Flodman Department of Pediatrics, University of California, Irvine, California In this review we will evaluate evidence that altered gene dosage and structure im- pacts neurodevelopment and neural connectivity through deleterious effects on synap- tic structure and function, and evidence that the latter are key contributors to the risk for autism. We will review information on alterations of structure of mitochondrial DNA and abnormal mitochondrial function in autism and indications that interactions of the nuclear and mitochondrial genomes may play a role in autism pathogenesis. In a final section we will present data derived using Affymetrixtm SNP 6.0 microar- ray analysis of DNA of a number of subjects and parents recruited to our autism spectrum disorders project. We include data on two sets of monozygotic twins. Col- lectively these data provide additional evidence of nuclear and mitochondrial genome imbalance in autism and evidence of specific candidate genes in autism. We present data on dosage changes in genes that map on the X chromosomes and the Y chro- mosome.
    [Show full text]
  • Network Medicine Approach for Analysis of Alzheimer's Disease Gene Expression Data
    International Journal of Molecular Sciences Article Network Medicine Approach for Analysis of Alzheimer’s Disease Gene Expression Data David Cohen y, Alexander Pilozzi y and Xudong Huang * Neurochemistry Laboratory, Department of Psychiatry, Massachusetts General Hospital and Harvard Medical School, Charlestown, MA 02129, USA; [email protected] (D.C.); [email protected] (A.P.) * Correspondence: [email protected]; Tel./Fax: +1-617-724-9778 These authors contributed equally to this work. y Received: 15 November 2019; Accepted: 30 December 2019; Published: 3 January 2020 Abstract: Alzheimer’s disease (AD) is the most widespread diagnosed cause of dementia in the elderly. It is a progressive neurodegenerative disease that causes memory loss as well as other detrimental symptoms that are ultimately fatal. Due to the urgent nature of this disease, and the current lack of success in treatment and prevention, it is vital that different methods and approaches are applied to its study in order to better understand its underlying mechanisms. To this end, we have conducted network-based gene co-expression analysis on data from the Alzheimer’s Disease Neuroimaging Initiative (ADNI) database. By processing and filtering gene expression data taken from the blood samples of subjects with varying disease states and constructing networks based on that data to evaluate gene relationships, we have been able to learn about gene expression correlated with the disease, and we have identified several areas of potential research interest. Keywords: Alzheimer’s disease; network medicine; gene expression; neurodegeneration; neuroinflammation 1. Introduction Alzheimer’s disease (AD) is the most widespread diagnosed cause of dementia in the elderly [1].
    [Show full text]
  • Differences Between Human and Chimpanzee Genomes and Their Implications in Gene Expression, Protein Functions and Biochemical Properties of the Two Species Maria V
    Suntsova and Buzdin BMC Genomics 2020, 21(Suppl 7):535 https://doi.org/10.1186/s12864-020-06962-8 REVIEW Open Access Differences between human and chimpanzee genomes and their implications in gene expression, protein functions and biochemical properties of the two species Maria V. Suntsova1 and Anton A. Buzdin1,2,3,4* From 11th International Young Scientists School “Systems Biology and Bioinformatics”–SBB-2019 Novosibirsk, Russia. 24-28 June 2019 Abstract Chimpanzees are the closest living relatives of humans. The divergence between human and chimpanzee ancestors dates to approximately 6,5–7,5 million years ago. Genetic features distinguishing us from chimpanzees and making us humans are still of a great interest. After divergence of their ancestor lineages, human and chimpanzee genomes underwent multiple changes including single nucleotide substitutions, deletions and duplications of DNA fragments of different size, insertion of transposable elements and chromosomal rearrangements. Human-specific single nucleotide alterations constituted 1.23% of human DNA, whereas more extended deletions and insertions cover ~ 3% of our genome. Moreover, much higher proportion is made by differential chromosomal inversions and translocations comprising several megabase-long regions or even whole chromosomes. However, despite of extensive knowledge of structural genomic changes accompanying human evolution we still cannot identify with certainty the causative genes of human identity. Most structural gene-influential changes happened at the level of expression regulation, which in turn provoked larger alterations of interactome gene regulation networks. In this review, we summarized the available information about genetic differences between humans and chimpanzees and their potential functional impacts on differential molecular, anatomical, physiological and cognitive peculiarities of these species.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • The Role of the X Chromosome in Embryonic and Postnatal Growth
    The role of the X chromosome in embryonic and postnatal growth Daniel Mark Snell A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy of University College London. Francis Crick Institute/Medical Research Council National Institute for Medical Research University College London January 28, 2018 2 I, Daniel Mark Snell, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the work. Abstract Women born with only a single X chromosome (XO) have Turner syndrome (TS); and they are invariably of short stature. XO female mice are also small: during embryogenesis, female mice with a paternally-inherited X chromosome (XPO) are smaller than XX littermates; whereas during early postnatal life, both XPO and XMO (maternal) mice are smaller than their XX siblings. Here I look to further understand the genetic bases of these phenotypes, and potentially inform areas of future investigation into TS. Mouse pre-implantation embryos preferentially silence the XP via the non-coding RNA Xist.XPO embryos are smaller than XX littermates at embryonic day (E) 10.5, whereas XMO embryos are not. Two possible hypotheses explain this obser- vation. Inappropriate expression of Xist in XPO embryos may cause transcriptional silencing of the single X chromosome and result in embryos nullizygous for X gene products. Alternatively, there could be imprinted genes on the X chromosome that impact on growth and manifest in growth retarded XPO embryos. In contrast, dur- ing the first three weeks of postnatal development, both XPO and XMO mice show a growth deficit when compared with XX littermates.
    [Show full text]
  • UTY (NM 001258249) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG235303 UTY (NM_001258249) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: UTY (NM_001258249) Human Tagged ORF Clone Tag: TurboGFP Symbol: UTY Synonyms: KDM6AL; KDM6C; UTY1 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG235303 representing NM_001258249 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAATCCTGCGCAGTGTCGCTCACTACCGCCGCTGTTGCCTTCGGTGATGAGGCAAAGAAAATGGCGG AAGGAAAAGCGAGCCGCGAGAGTGAAGAGGAGTCTGTTAGCCTGACAGTCGAGGAAAGGGAGGCGCTTGG TGGCATGGACAGCCGTCTCTTCGGGTTCGTGAGGCTTCATGAAGATGGCGCCAGAACGAAGACCCTACTA GGCAAGGCTGTTCGCTGCTACGAATCTTTAATCTTAAAAGCTGAAGGAAAAGTGGAGTCTGACTTCTTTT GCCAATTAGGTCACTTCAACCTCTTGTTGGAAGATTATTCAAAAGCATTATCTGCATATCAGAGATATTA CAGTTTACAGGCTGACTACTGGAAGAATGCTGCGTTTTTATATGGCCTTGGTTTGGTCTACTTCTACTAC AATGCATTTCATTGGGCAATTAAAGCATTTCAAGATGTCCTTTATGTTGACCCCAGCTTTTGTCGAGCCA AGGAAATTCATTTACGACTTGGGCTCATGTTCAAAGTGAACACAGACTACAAGTCTAGTTTAAAGCATTT TCAGTTAGCCTTGATTGACTGTAATCCATGTACTTTGTCCAATGCTGAAATTCAATTTCATATTGCCCAT TTGTATGAAACCCAGAGGAAGTATCATTCTGCAAAGGAGGCATATGAACAACTTTTGCAGACAGAAAACC TTCCTGCACAAGTAAAAGCAACTGTATTGCAACAGTTAGGTTGGATGCATCATAATATGGATCTAGTAGG AGACAAAGCCACAAAGGAAAGCTATGCTATTCAGTATCTCCAAAAGTCTTTGGAGGCAGATCCTAATTCT GGCCAATCGTGGTATTTTCTTGGAAGGTGTTATTCAAGTATTGGGAAAGTTCAGGATGCCTTTATATCTT
    [Show full text]
  • Prenatal Sex Differences in the Human Brain
    Molecular Psychiatry (2009) 14, 988–991 & 2009 Nature Publishing Group All rights reserved 1359-4184/09 $32.00 www.nature.com/mp LETTERS TO THE EDITOR Prenatal sex differences in the human brain Molecular Psychiatry (2009) 14, 988–989. doi:10.1038/ development. These genes are not only expressed in mp.2009.79 the brain before birth but some of them are also known to have sex differences in adult brain,1,4 whereas others are expressed during infancy, but The presence of genetic sex differences in the adult reduced later on during their lifetime.5 human brain is now recognized.1 We hypothesized Intriguingly, SRY, a well-known determinant of that the basis of this sex bias is already established in testicle development during midgestation,6 showed the brain before birth. Here, we show that several no evidence of expression in any of the brain regions genes encoded in the Y-chromosome are expressed in analyzed (Figure 1b, and Supplementary Figure 1), many regions of the male prenatal brain, likely having suggesting that the main somatic sex determinants functional consequences for sex bias during human may be different for the brain and gonads during brain development. human gestation. The marked sex differences in age at onset, In humans, all 11 genes described here are encoded prevalence and symptoms for numerous neuropsy- in the male-specific region of the Y-chromosome,7 chiatric disorders2 indicate the importance to study with RPS4Y1 and ZFY located in the p-arm very close the emergence of a sex bias during human brain to SRY and most of the remaining genes located in the development.
    [Show full text]
  • Quantitative Analysis of Y-Chromosome Gene Expression Across 36 Human Tissues 6 7 8 9 Alexander K
    Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press 1 2 3 4 5 Quantitative analysis of Y-Chromosome gene expression across 36 human tissues 6 7 8 9 Alexander K. Godfrey1,2, Sahin Naqvi1,2, Lukáš Chmátal1, Joel M. Chick3, 10 Richard N. Mitchell4, Steven P. Gygi3, Helen Skaletsky1,5, David C. Page1,2,5* 11 12 13 1 Whitehead Institute, Cambridge, MA, USA 14 2 Department of Biology, Massachusetts Institute of Technology, Cambridge, MA, USA 15 3 Department of Cell Biology, Harvard Medical School, Boston, MA, USA 16 4 Department of Pathology, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA, USA 17 5 Howard Hughes Medical Institute, Whitehead Institute, Cambridge, MA, USA 18 19 20 21 *corresponding author: 22 Email: [email protected] 23 24 25 Running title: 26 Human Y-Chromosome gene expression in 36 tissues 27 28 29 Keywords: 30 Y Chromosome, sex chromosomes, sex differences, EIF1AY, EIF1AX 31 Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press 32 ABSTRACT 33 Little is known about how human Y-Chromosome gene expression directly contributes to 34 differences between XX (female) and XY (male) individuals in non-reproductive tissues. Here, 35 we analyzed quantitative profiles of Y-Chromosome gene expression across 36 human tissues 36 from hundreds of individuals. Although it is often said that Y-Chromosome genes are lowly 37 expressed outside the testis, we report many instances of elevated Y-Chromosome gene 38 expression in a non-reproductive tissue.
    [Show full text]
  • "The Genecards Suite: from Gene Data Mining to Disease Genome Sequence Analyses". In: Current Protocols in Bioinformat
    The GeneCards Suite: From Gene Data UNIT 1.30 Mining to Disease Genome Sequence Analyses Gil Stelzer,1,5 Naomi Rosen,1,5 Inbar Plaschkes,1,2 Shahar Zimmerman,1 Michal Twik,1 Simon Fishilevich,1 Tsippi Iny Stein,1 Ron Nudel,1 Iris Lieder,2 Yaron Mazor,2 Sergey Kaplan,2 Dvir Dahary,2,4 David Warshawsky,3 Yaron Guan-Golan,3 Asher Kohn,3 Noa Rappaport,1 Marilyn Safran,1 and Doron Lancet1,6 1Department of Molecular Genetics, Weizmann Institute of Science, Rehovot, Israel 2LifeMap Sciences Ltd., Tel Aviv, Israel 3LifeMap Sciences Inc., Marshfield, Massachusetts 4Toldot Genetics Ltd., Hod Hasharon, Israel 5These authors contributed equally to the paper 6Corresponding author GeneCards, the human gene compendium, enables researchers to effectively navigate and inter-relate the wide universe of human genes, diseases, variants, proteins, cells, and biological pathways. Our recently launched Version 4 has a revamped infrastructure facilitating faster data updates, better-targeted data queries, and friendlier user experience. It also provides a stronger foundation for the GeneCards suite of companion databases and analysis tools. Improved data unification includes gene-disease links via MalaCards and merged biological pathways via PathCards, as well as drug information and proteome expression. VarElect, another suite member, is a phenotype prioritizer for next-generation sequencing, leveraging the GeneCards and MalaCards knowledgebase. It au- tomatically infers direct and indirect scored associations between hundreds or even thousands of variant-containing genes and disease phenotype terms. Var- Elect’s capabilities, either independently or within TGex, our comprehensive variant analysis pipeline, help prepare for the challenge of clinical projects that involve thousands of exome/genome NGS analyses.
    [Show full text]
  • Product Description SALSA MLPA Probemix P360-B2 Y-Chromosome
    MRC-Holland ® Product Description version B2-01; Issued 20 March 2019 MLPA Product Description SALSA ® MLPA ® Probemix P360-B2 Y-Chromosome Microdeletions To be used with the MLPA General Protocol. Version B2. As compared to version B1, one probe length has been adjusted . For complete product history see page 14. Catalogue numbers: • P360-025R: SALSA MLPA Probemix P360 Y-Chromosome Microdeletions, 25 reactions. • P360-050R: SALSA MLPA Probemix P360 Y-Chromosome Microdeletions, 50 reactions. • P360-100R: SALSA MLPA Probemix P360 Y-Chromosome Microdeletions, 100 reactions. To be used in combination with a SALSA MLPA reagent kit, available for various number of reactions. MLPA reagent kits are either provided with FAM or Cy5.0 dye-labelled PCR primer, suitable for Applied Biosystems and Beckman capillary sequencers, respectively (see www.mlpa.com ). This SALSA MLPA probemix is for basic research and intended for experienced MLPA users only! This probemix is intended to quantify genes or chromosomal regions in which the occurrence of copy number changes is not yet well-established and the relationship between genotype and phenotype is not yet clear. Interpretation of results can be complicated. MRC-Holland recommends thoroughly screening any available literature. Certificate of Analysis: Information regarding storage conditions, quality tests, and a sample electropherogram from the current sales lot is available at www.mlpa.com . Precautions and warnings: For professional use only. Always consult the most recent product description AND the MLPA General Protocol before use: www.mlpa.com . It is the responsibility of the user to be aware of the latest scientific knowledge of the application before drawing any conclusions from findings generated with this product.
    [Show full text]
  • X- and Y-Linked Chromatin-Modifying Genes As Regulators of Sex-Specific Cancer Incidence and Prognosis
    Author Manuscript Published OnlineFirst on July 30, 2020; DOI: 10.1158/1078-0432.CCR-20-1741 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. X- and Y-linked chromatin-modifying genes as regulators of sex- specific cancer incidence and prognosis Rossella Tricarico1,2,*, Emmanuelle Nicolas1, Michael J. Hall 3, and Erica A. Golemis1,* 1Molecular Therapeutics Program, Fox Chase Cancer Center, Philadelphia, PA, 19111, USA; 2Department of Biology and Biotechnology, University of Pavia, 27100 Pavia, Italy; 3Cancer Prevention and Control Program, Department of Clinical Genetics, Fox Chase Cancer Center, Philadelphia, PA, 19111, USA Running title: Allosomally linked epigenetic regulators in cancer Conflict Statement: The authors declare no conflict of interest. Funding: The authors are supported by NIH DK108195 and CA228187 (to EAG), by NCI Core Grant CA006927 (to Fox Chase Cancer Center), and by a Marie Curie Individual Fellowship from the Horizon 2020 EU Program (to RT). * Correspondence should be directed to: Erica A. Golemis Fox Chase Cancer Center 333 Cottman Ave. Philadelphia, PA 19111 USA [email protected] (215) 728-2860 or Rossella Tricarico Department of Biology and Biotechnology University of Pavia Via Ferrata 9, 27100 Pavia, Italy [email protected] +39 340-2429631 1 Downloaded from clincancerres.aacrjournals.org on September 25, 2021. © 2020 American Association for Cancer Research. Author Manuscript Published OnlineFirst on July 30, 2020; DOI: 10.1158/1078-0432.CCR-20-1741 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Abstract Biological sex profoundly conditions organismal development and physiology, imposing wide-ranging effects on cell signaling, metabolism, and immune response.
    [Show full text]
  • Original Article Identification of Differentially Expressed Genes Between Male and Female Patients with Acute Myocardial Infarction Based on Microarray Data
    Int J Clin Exp Med 2019;12(3):2456-2467 www.ijcem.com /ISSN:1940-5901/IJCEM0080626 Original Article Identification of differentially expressed genes between male and female patients with acute myocardial infarction based on microarray data Huaqiang Zhou1,2*, Kaibin Yang2*, Shaowei Gao1, Yuanzhe Zhang2, Xiaoyue Wei2, Zeting Qiu1, Si Li2, Qinchang Chen2, Yiyan Song2, Wulin Tan1#, Zhongxing Wang1# 1Department of Anesthesiology, The First Affiliated Hospital of Sun Yat-sen University, Guangzhou, China; 2Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, China. *Equal contributors and co-first au- thors. #Equal contributors. Received May 31, 2018; Accepted August 4, 2018; Epub March 15, 2019; Published March 30, 2019 Abstract: Background: Coronary artery disease has been the most common cause of death and the prognosis still needs further improving. Differences in the incidence and prognosis of male and female patients with coronary artery disease have been observed. We constructed this study hoping to understand those differences at the level of gene expression and to help establish gender-specific therapies. Methods: We downloaded the series matrix file of GSE34198 from the Gene Expression Omnibus database and identified differentially expressed genes between male and female patients. Gene ontology, Kyoto Encyclopedia of Genes and Genomes pathway enrichment analy- sis, and GSEA analysis of differentially expressed genes were performed. The protein-protein interaction network was constructed of the differentially expressed genes and the hub genes were identified. Results: A total of 215 up-regulated genes and 353 down-regulated genes were identified. The differentially expressed pathways were mainly related to the function of ribosomes, virus, and related immune response as well as the cell growth and proliferation.
    [Show full text]