DOCSLIB.ORG

Supporting Online Material

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supporting Online Material Supplementary Information for Epigenetic inactivation of oncogenic brachyury (TBXT) by H3K27 histone demethylase controls chordoma cell survival Lucia Cottone, Edward S Hookway, Adam Cribbs, Graham Wells, Patrick Lombard, Lorena Ligammari, Anthony Tumber, Roberto Tirabosco, Fernanda Amary, Tamas Szommer, Catrine Johannson, Paul E. Brennan, Nischalan Pillay, Udo Oppermann, Adrienne M. Flanagan Corresponding authors Adrienne M Flanagan [email protected] and Udo Oppermann [email protected] This PDF file includes: Figs. S1 to S6 Tables S1 to S5 Captions for Datasets S1 to S2 Supplementary text References for SI reference citations Other supplementary materials for this manuscript include the following: Datasets S1 to S2 1 Supplementary Figures Fig. S1. Ligand structure of human KDM6C/UTY in complex with KDOBA67. Crystal structure of UTY/KDM6C in complex with the inhibitor KDOBA67a shows identical ligand binding as KDM6B/GSK-J1. (a) Representation of the ligand binding pocket in KDM6C/UTY (pdb 5A1L, rendered in pink) in complex with KDOBA67a (cyan). Amino acid side-chains lining the active site are depicted as sticks. The position of the catalytic metal ion and water molecules are shown as orange/brown spheres. The 2FoFc electron density map is contoured at 1.0 sigma. (b) KDOBA67 occupies part of the cofactor site in KDM6 enzymes, demonstrated through an overlay of UTY (pdb 5A1L, pink) with KDM6B (grey) in complex with the 2'oxoglutarate cofactor (yellow) (PDB 2XUE). (c) KDOBA67 shows equivalent occupation and residue contacts in the active site of KDM6 enzymes, demonstrated through an overlay of KDM6C/KDOBA67 and KDM6B/GSK-J1 (magenta) (PDB 4ASK) complexes. 2 A DMSO GSK-J4 GSK-J5 KDOBA67 B MUG 72h 100 ** *** s l l e 75 * c f G o e U g a 50 t M *** n e c r e P 25 * *** 0 DMSO GSK-J4 GSK-J5 KDOBA67 t n u UM-Chor 72h o 100 C *** s r l l o e 75 c h f o C e - g a 50 t M n e c U r e P 25 *** 0 DMSO GSK-J4 GSK-J5 KDOBA67 SubG1 S G2 G1 Propidium Iodide C DMSO GSK-J4 GSK-J5 KDOBA67 D MUG 72h 20 s l l **** e c 15 *** + I P G + V U 10 n i x M e n n 5 A e % d i 0 d DMSO GSKJ4 GSKJ5 KDOBA67 o I m u i UmChor 72h d i p 20 **** o s l l r e c r P 15 + I o P h + V 10 C n i - x e *** n M n 5 A U % 0 DMSO GSKJ4 GSKJ5 KDOBA67 Annexin V - APC E F UCH1 48h MUG 48h UM-Chor 48h UCH1 48h MUG 48h UMChor 48h 100 100 100 ** *** ** * 15 10 6 ** * * **** s s s s l l l s l ** s l l l l ** l l l l e e e e 8 e * e c c 75 75 75 c c c c + + + f f I I I f 10 4 o o P P P o * 6 + + + e e e V V V g g g n n n a a i i 50 i 50 a 50 t t t x x x 4 n n n e e e e 5 2 e e n n n c c c n n n r r r e A A A 2 e e P P 25 25 P 25 % % % 0 0 0 ** DMSO GSKJ4 GSKJ5 KDOBA67 DMSO GSKJ4 GSKJ5 KDOBA67 DMSO GSKJ4 GSKJ5 KDOBA67 0 0 0 DMSO GSK-J4 GSK-J5 KDOBA67 DMSO GSK-J4 GSK-J5 KDOBA67 DMSO GSK-J4 GSK-J5 KDOBA67 Fig. S2. H3K27 lysine demethylase inhibitors induce cell cycle arrest and apoptosis in chordoma cell lines. Cell cycle changes (A-B) and cell death analysis (C-D) in response to the compounds after 72 hours of treatment in UM-Chor1 and MUG-Chor1. By 72 hours, there is evidence of apoptosis as determined by an increase in sub- G1 and in AnnexinV-PI positive population in response to GSK-J4 and KDOBA67. Cell cycle changes (E) and cell death analysis (F) in response to the compounds after 48 hours of treatment in UCH1, UM-Chor and MUG- Chor. By 48 hours, there is evidence of G1 arrest as determined by an increase in G1 population and reduction in 3 the S population together with a slight increase AnnexinV-PI positive population in response to GSK-J4 and KDOBA67. Representative histogram/dot plots and quantification of 3 independent experiments, with 3 replicates per condition. *p ≤0.05, **p ≤0.01, ***p ≤0.001, ****p ≤0.0001. 4 A UCH1 B UM-Chor l l l l l l tr O tr O tr tr O O tr tr O O C K C K C C K K C C K K KDM6A KDM6B KDM6A KDM6B C Ctrl KDM6A KO KDM6B KO KDM6A/B KO UCH1 D UM-Chor E Ctrl KDM6A KO KDM6B KO KDM6A/B KO **** 250 n.s. ) n.s m n 200 . 0 9 5 / 0 6 150 5 ( e c n 100 e c e r o 50 u l F 0 Ctrl KDM6A KO KDM6B KO KDM6A/B KO UM-Chor F MUG G Ctrl KDM6A KO KDM6B KO J 400 * TBXT - MUG-Chor H ) **** D 2.0 P m *** A n 0 G 9 300 r 5 e 1.5 / v 0 o 6 5 n ( o 200 i 1.0 e s c s n e r e p c x 0.5 e r 100 e o A u l N F R 0.0 0 m DMSO KDOBA67 Ctrl KDM6A KO KDM6B KO MUG-Chor H I K TBXT - UM-Chor TBXT - UM-Chor H H D D 6 * 1.5 P P A *** A G G r r e e v v 4 1.0 o o n n o o i i s s s s e e r r 2 0.5 p p x x e e A A N N R 0.0 R 0 m m Control KDM6A/B KO DMSO KDOBA67 Fig. S3. CRISPR/Cas9 mediated KDM6A and KDM6B knockout. (A-B) Cleavage assay for UCH1 and UM- Chor for cells transduced with empy-Lenti-Cas9-vector, guideRNA-directed at KDM6A or KDM6B, show efficient gene editing at the predicted site. (C) Bright field images of UCH1 with CRISPR editing of KDM6A/B or both. (D-E) CRISPR/Cas9 knock-out of KDM6A and KMD6B induces cell growth arrest in UM-Chor chordoma cell line. Cell viability and representative images of chordoma cells transduced with empy-Lenti-Cas9-vector, guideRNA-directed towards KDM6A, KDM6B or co-transduced with both. (F-G) In MUG-Chor cell line knockout of KDM6A is sufficient to reduce cell viability as MUG-Chor contains a biallelic deletion of KDM6B (H) as visualised by genome sequencing generated from the ChIP input. (I) Expression of TBXT is reduced in UM-Chor upon double KO of KDM6A/B, as assessed by qPCR. Quantification of 2 independent experiments, with 2 5 replicates per condition. (J-K) Expression of TBXT is reduced in chordoma cell lines as assessed by qPCR. *p ≤0.05, **p ≤0.01, ***p ≤0.001, ****p ≤0.0001. 6 Fig. S4. Methylation profiles of TBXT promoter in a range of solid tumours. Data from the Cancer Tumor Genome Atlas (TCGA) showed that the promoter of TBXT is unmethylated is a variety of malignancies, known not to express TBXT. Low levels of methylation are prominent in cervical squamous cell carcinomas, diffuse B cell lymphomas and adenocarcinomas of the gastrointestinal tract, tumours which are rarely reported to express TBXT protein 7 A B MUG-Chor C MUG-Chor (replicate) D UCH1 E UCH7 Fig. S5. Transcriptomic analysis of chordoma cell lines in response to KDOBA67. (A) PCA plot of all RNA sequencing data for UCH1, UCH7, MUG-Chor, UM-Chor. Two independent datasets were generated for MUG- Chor, and the very close clustering shows high reproducibility of the data. (B-E) Volcano plot summarising differential expression in chordoma cells following treatment with KDOBA67. 8 A B C D MUG 0.6 0.20 UM-Chor INHBE H Mt1X H H H D D D D P 15 60 P 0.15 P P A **** 0.4 A A A G G G G r r e e r *** r TBXT v v e e 0.10 o v o 10 v 40 ATF4 o 0.2 o n n TBXT o n n o i DDIT3 i o o s s i i 0.05 ATF4 s s s s e INHBE e s s r r DDIT3 e e p r r 5 20 p x x p p 0.0003 INHBE e e x x e e e e 0.0003 n n A A e 0.0002 e N N G 0.0002 G R 0 R 0 m DMSO KDOBA67 m DMSO KDOBA67 0.0000 0.0000 0 3 6 24 48 0 3 6 24 48 Time (hours) Time (hours) E DDIT3 F ATF4 DDIT3 G ATF4 DDIT3 H H H H H D D D D D 8 8 40 3 10 P P P P P **** * A A A A A O O O O O * * G ** * G G **** *** G G S S S * * S S r r r r 8 r M M M M e e M 6 e e 30 e 6 D v v D D v D v v D 2 o o o o o o o o o o t t t t 6 n t n n n n o d o d o d o d i i o d i 4 i e e 20 i e 4 e s s e s s s s s s s s i s i s s s i i l l s i 4 l l e e l e e a a r e r a a 1 r r a r p p m p p m m m p r 2 x m x r x r x 2 r 10 x r e o e o e e 2 o o e o n n n n A A n A A A N N N N N R 0 R 0 R R 0 0 R 0 m m 7 7 m O B 7 7 m 7 7 O IB 6 6 7 7 m 7 7 I 6 6 O IB 6 S O IB 6 6 O IB 6 S R A A S 6 R A A S S 6 M S R A A M IS B B R A A R A A D I B B M IS B B D M IS B B M IS B B O O D O O D D D D O O D D O O O O D D K K D D D D K K K K K K K K + + + + + IB B B B B R I I I I S R R R R I IS IS IS IS INHBE INHBE TBXT INHBE TBXT H H H H H D D D D 2.0 15 1.5 D 3 1.5 P P P P P A A A A A O O O O n.s.
Load more

Recommended publications
  • UTY (NM 001258249) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG235303 UTY (NM_001258249) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: UTY (NM_001258249) Human Tagged ORF Clone Tag: TurboGFP Symbol: UTY Synonyms: KDM6AL; KDM6C; UTY1 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG235303 representing NM_001258249 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAATCCTGCGCAGTGTCGCTCACTACCGCCGCTGTTGCCTTCGGTGATGAGGCAAAGAAAATGGCGG AAGGAAAAGCGAGCCGCGAGAGTGAAGAGGAGTCTGTTAGCCTGACAGTCGAGGAAAGGGAGGCGCTTGG TGGCATGGACAGCCGTCTCTTCGGGTTCGTGAGGCTTCATGAAGATGGCGCCAGAACGAAGACCCTACTA GGCAAGGCTGTTCGCTGCTACGAATCTTTAATCTTAAAAGCTGAAGGAAAAGTGGAGTCTGACTTCTTTT GCCAATTAGGTCACTTCAACCTCTTGTTGGAAGATTATTCAAAAGCATTATCTGCATATCAGAGATATTA CAGTTTACAGGCTGACTACTGGAAGAATGCTGCGTTTTTATATGGCCTTGGTTTGGTCTACTTCTACTAC AATGCATTTCATTGGGCAATTAAAGCATTTCAAGATGTCCTTTATGTTGACCCCAGCTTTTGTCGAGCCA AGGAAATTCATTTACGACTTGGGCTCATGTTCAAAGTGAACACAGACTACAAGTCTAGTTTAAAGCATTT TCAGTTAGCCTTGATTGACTGTAATCCATGTACTTTGTCCAATGCTGAAATTCAATTTCATATTGCCCAT TTGTATGAAACCCAGAGGAAGTATCATTCTGCAAAGGAGGCATATGAACAACTTTTGCAGACAGAAAACC TTCCTGCACAAGTAAAAGCAACTGTATTGCAACAGTTAGGTTGGATGCATCATAATATGGATCTAGTAGG AGACAAAGCCACAAAGGAAAGCTATGCTATTCAGTATCTCCAAAAGTCTTTGGAGGCAGATCCTAATTCT GGCCAATCGTGGTATTTTCTTGGAAGGTGTTATTCAAGTATTGGGAAAGTTCAGGATGCCTTTATATCTT
    [Show full text]
  • Prenatal Sex Differences in the Human Brain
    Molecular Psychiatry (2009) 14, 988–991 & 2009 Nature Publishing Group All rights reserved 1359-4184/09 $32.00 www.nature.com/mp LETTERS TO THE EDITOR Prenatal sex differences in the human brain Molecular Psychiatry (2009) 14, 988–989. doi:10.1038/ development. These genes are not only expressed in mp.2009.79 the brain before birth but some of them are also known to have sex differences in adult brain,1,4 whereas others are expressed during infancy, but The presence of genetic sex differences in the adult reduced later on during their lifetime.5 human brain is now recognized.1 We hypothesized Intriguingly, SRY, a well-known determinant of that the basis of this sex bias is already established in testicle development during midgestation,6 showed the brain before birth. Here, we show that several no evidence of expression in any of the brain regions genes encoded in the Y-chromosome are expressed in analyzed (Figure 1b, and Supplementary Figure 1), many regions of the male prenatal brain, likely having suggesting that the main somatic sex determinants functional consequences for sex bias during human may be different for the brain and gonads during brain development. human gestation. The marked sex differences in age at onset, In humans, all 11 genes described here are encoded prevalence and symptoms for numerous neuropsy- in the male-specific region of the Y-chromosome,7 chiatric disorders2 indicate the importance to study with RPS4Y1 and ZFY located in the p-arm very close the emergence of a sex bias during human brain to SRY and most of the remaining genes located in the development.
    [Show full text]
  • Quantitative Analysis of Y-Chromosome Gene Expression Across 36 Human Tissues 6 7 8 9 Alexander K
    Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press 1 2 3 4 5 Quantitative analysis of Y-Chromosome gene expression across 36 human tissues 6 7 8 9 Alexander K. Godfrey1,2, Sahin Naqvi1,2, Lukáš Chmátal1, Joel M. Chick3, 10 Richard N. Mitchell4, Steven P. Gygi3, Helen Skaletsky1,5, David C. Page1,2,5* 11 12 13 1 Whitehead Institute, Cambridge, MA, USA 14 2 Department of Biology, Massachusetts Institute of Technology, Cambridge, MA, USA 15 3 Department of Cell Biology, Harvard Medical School, Boston, MA, USA 16 4 Department of Pathology, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA, USA 17 5 Howard Hughes Medical Institute, Whitehead Institute, Cambridge, MA, USA 18 19 20 21 *corresponding author: 22 Email: [email protected] 23 24 25 Running title: 26 Human Y-Chromosome gene expression in 36 tissues 27 28 29 Keywords: 30 Y Chromosome, sex chromosomes, sex differences, EIF1AY, EIF1AX 31 Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press 32 ABSTRACT 33 Little is known about how human Y-Chromosome gene expression directly contributes to 34 differences between XX (female) and XY (male) individuals in non-reproductive tissues. Here, 35 we analyzed quantitative profiles of Y-Chromosome gene expression across 36 human tissues 36 from hundreds of individuals. Although it is often said that Y-Chromosome genes are lowly 37 expressed outside the testis, we report many instances of elevated Y-Chromosome gene 38 expression in a non-reproductive tissue.
    [Show full text]
  • Product Description SALSA MLPA Probemix P360-B2 Y-Chromosome
    MRC-Holland ® Product Description version B2-01; Issued 20 March 2019 MLPA Product Description SALSA ® MLPA ® Probemix P360-B2 Y-Chromosome Microdeletions To be used with the MLPA General Protocol. Version B2. As compared to version B1, one probe length has been adjusted . For complete product history see page 14. Catalogue numbers: • P360-025R: SALSA MLPA Probemix P360 Y-Chromosome Microdeletions, 25 reactions. • P360-050R: SALSA MLPA Probemix P360 Y-Chromosome Microdeletions, 50 reactions. • P360-100R: SALSA MLPA Probemix P360 Y-Chromosome Microdeletions, 100 reactions. To be used in combination with a SALSA MLPA reagent kit, available for various number of reactions. MLPA reagent kits are either provided with FAM or Cy5.0 dye-labelled PCR primer, suitable for Applied Biosystems and Beckman capillary sequencers, respectively (see www.mlpa.com ). This SALSA MLPA probemix is for basic research and intended for experienced MLPA users only! This probemix is intended to quantify genes or chromosomal regions in which the occurrence of copy number changes is not yet well-established and the relationship between genotype and phenotype is not yet clear. Interpretation of results can be complicated. MRC-Holland recommends thoroughly screening any available literature. Certificate of Analysis: Information regarding storage conditions, quality tests, and a sample electropherogram from the current sales lot is available at www.mlpa.com . Precautions and warnings: For professional use only. Always consult the most recent product description AND the MLPA General Protocol before use: www.mlpa.com . It is the responsibility of the user to be aware of the latest scientific knowledge of the application before drawing any conclusions from findings generated with this product.
    [Show full text]
  • X- and Y-Linked Chromatin-Modifying Genes As Regulators of Sex-Specific Cancer Incidence and Prognosis
    Author Manuscript Published OnlineFirst on July 30, 2020; DOI: 10.1158/1078-0432.CCR-20-1741 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. X- and Y-linked chromatin-modifying genes as regulators of sex- specific cancer incidence and prognosis Rossella Tricarico1,2,*, Emmanuelle Nicolas1, Michael J. Hall 3, and Erica A. Golemis1,* 1Molecular Therapeutics Program, Fox Chase Cancer Center, Philadelphia, PA, 19111, USA; 2Department of Biology and Biotechnology, University of Pavia, 27100 Pavia, Italy; 3Cancer Prevention and Control Program, Department of Clinical Genetics, Fox Chase Cancer Center, Philadelphia, PA, 19111, USA Running title: Allosomally linked epigenetic regulators in cancer Conflict Statement: The authors declare no conflict of interest. Funding: The authors are supported by NIH DK108195 and CA228187 (to EAG), by NCI Core Grant CA006927 (to Fox Chase Cancer Center), and by a Marie Curie Individual Fellowship from the Horizon 2020 EU Program (to RT). * Correspondence should be directed to: Erica A. Golemis Fox Chase Cancer Center 333 Cottman Ave. Philadelphia, PA 19111 USA [email protected] (215) 728-2860 or Rossella Tricarico Department of Biology and Biotechnology University of Pavia Via Ferrata 9, 27100 Pavia, Italy [email protected] +39 340-2429631 1 Downloaded from clincancerres.aacrjournals.org on September 25, 2021. © 2020 American Association for Cancer Research. Author Manuscript Published OnlineFirst on July 30, 2020; DOI: 10.1158/1078-0432.CCR-20-1741 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Abstract Biological sex profoundly conditions organismal development and physiology, imposing wide-ranging effects on cell signaling, metabolism, and immune response.
    [Show full text]
  • Original Article Identification of Differentially Expressed Genes Between Male and Female Patients with Acute Myocardial Infarction Based on Microarray Data
    Int J Clin Exp Med 2019;12(3):2456-2467 www.ijcem.com /ISSN:1940-5901/IJCEM0080626 Original Article Identification of differentially expressed genes between male and female patients with acute myocardial infarction based on microarray data Huaqiang Zhou1,2*, Kaibin Yang2*, Shaowei Gao1, Yuanzhe Zhang2, Xiaoyue Wei2, Zeting Qiu1, Si Li2, Qinchang Chen2, Yiyan Song2, Wulin Tan1#, Zhongxing Wang1# 1Department of Anesthesiology, The First Affiliated Hospital of Sun Yat-sen University, Guangzhou, China; 2Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, China. *Equal contributors and co-first au- thors. #Equal contributors. Received May 31, 2018; Accepted August 4, 2018; Epub March 15, 2019; Published March 30, 2019 Abstract: Background: Coronary artery disease has been the most common cause of death and the prognosis still needs further improving. Differences in the incidence and prognosis of male and female patients with coronary artery disease have been observed. We constructed this study hoping to understand those differences at the level of gene expression and to help establish gender-specific therapies. Methods: We downloaded the series matrix file of GSE34198 from the Gene Expression Omnibus database and identified differentially expressed genes between male and female patients. Gene ontology, Kyoto Encyclopedia of Genes and Genomes pathway enrichment analy- sis, and GSEA analysis of differentially expressed genes were performed. The protein-protein interaction network was constructed of the differentially expressed genes and the hub genes were identified. Results: A total of 215 up-regulated genes and 353 down-regulated genes were identified. The differentially expressed pathways were mainly related to the function of ribosomes, virus, and related immune response as well as the cell growth and proliferation.
    [Show full text]
  • Computational Analysis of High Risk Missense Variant in Human UTY Gene: a Candidate Gene of Azfa Sub-Region
    Original Article Computational Analysis of High Risk Missense Variant in Human UTY Gene: A Candidate Gene of AZFa Sub-region Mili Nailwal, Jenabhai Bhathibhai Chauhan * - P.G. Department of Genetics, Ashok & Rita Patel Institute of Integrated Study & Research in Biotechnology and Allied Sciences (ARIBAS), Gujarat, India Abstract Background: The human Ubiquitously transcribed tetratricopeptide repeat gene, Y- linked (UTY) gene encodes histone demethylase involved in protein-protein interac- tions. UTY protein evidence at protein level predicted intracellular and secreted pro- tein. UTY is also involved in spermatogenesis process. Methods: The high-risk non-synonymous single nucleotide polymorphism in the coding region of the UTY gene was screened by SNP database and identified mis- sense variants were subjected to computational analysis to understand the effect on protein function, stability and structure by SIFT, PolyPhen 2, PANTHER, PROVEAN, I-Mutant 2, iPTREE-STAB, ConSurf, ModPred, SPARKS-X, QMEAN, PROCHECK, project HOPE and STRING. * Corresponding Author: Jenabhai B. Chauhan, Results: A total of 151 nsSNPs variants were retrieved in UTY gene out of which Department of Genetics, one missense variant (E18D) was predicted to be damaging or deleterious using Ashok & Rita Patel SIFT, PolyPhen 2, PANTHER and PROVEAN. Additionally, E18D variant showed Institute of Integrated less stability, high conservation and having role in post translation modification us- Study & Research in Biotechnology and Allied ing i-Mutant 2 and iPTREE-STAB, ConSurf and ModPred, respectively. The pre- Sciences (ARIBAS), New dicted 3D model of UTY using SPARKS-X with z-score of 15.16 was generated and Vallabh Vidyanagar- validated via QMEAN (Z-score of 0.472) and PROCHECK which plots Ramacha- 388121, Dist-Anand, ndran plot (85.3% residues in most favored regions, 12.3% in additionally allowed Gujarat, India regions, 2.0% in generously allowed regions and 4.0% were in disallowed regions) E-mail: jenabhaichauhan@aribas.
    [Show full text]
  • Y Chromosome
    G C A T T A C G G C A T genes Article An 8.22 Mb Assembly and Annotation of the Alpaca (Vicugna pacos) Y Chromosome Matthew J. Jevit 1 , Brian W. Davis 1 , Caitlin Castaneda 1 , Andrew Hillhouse 2 , Rytis Juras 1 , Vladimir A. Trifonov 3 , Ahmed Tibary 4, Jorge C. Pereira 5, Malcolm A. Ferguson-Smith 5 and Terje Raudsepp 1,* 1 Department of Veterinary Integrative Biosciences, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX 77843-4458, USA; [email protected] (M.J.J.); [email protected] (B.W.D.); [email protected] (C.C.); [email protected] (R.J.) 2 Molecular Genomics Workplace, Institute for Genome Sciences and Society, Texas A&M University, College Station, TX 77843-4458, USA; [email protected] 3 Laboratory of Comparative Genomics, Institute of Molecular and Cellular Biology, 630090 Novosibirsk, Russia; [email protected] 4 Department of Veterinary Clinical Sciences, College of Veterinary Medicine, Washington State University, Pullman, WA 99164-6610, USA; [email protected] 5 Department of Veterinary Medicine, University of Cambridge, Cambridge CB3 0ES, UK; [email protected] (J.C.P.); [email protected] (M.A.F.-S.) * Correspondence: [email protected] Abstract: The unique evolutionary dynamics and complex structure make the Y chromosome the most diverse and least understood region in the mammalian genome, despite its undisputable role in sex determination, development, and male fertility. Here we present the first contig-level annotated draft assembly for the alpaca (Vicugna pacos) Y chromosome based on hybrid assembly of short- and long-read sequence data of flow-sorted Y.
    [Show full text]
  • Ep 3378954 B1
    (19) *EP003378954B1* (11) EP 3 378 954 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: C12Q 1/6851 (2018.01) C12Q 1/6879 (2018.01) (2018.01) (2018.01) 17.02.2021 Bulletin 2021/07 C12Q 1/6881 C12Q 1/6883 (21) Application number: 18151693.1 (22) Date of filing: 27.04.2012 (54) QUANTIFICATION OF A MINORITY NUCLEIC ACID SPECIES QUANTIFIZIERUNG EINER MINDERHEITSVARIANTE EINER NUKLEINSÄURE QUANTIFICATION D’UNE MINORITÉ D’ESPÈCES D’ACIDE NUCLÉIQUE (84) Designated Contracting States: • DOMINGUEZ PATRICK L ET AL: "Wild-type AL AT BE BG CH CY CZ DE DK EE ES FI FR GB blocking polymerase chain reaction for detection GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO of single nucleotide minority mutations from PL PT RO RS SE SI SK SM TR clinical specimens", ONCOGENE, NATURE PUBLISHING GROUP UK, LONDON, vol. 24, no. (30) Priority: 29.04.2011 US 201161480686 P 45, 1 October 2005 (2005-10-01), pages 6830-6834, XP002503989, ISSN: 0950-9232, DOI: (43) Date of publication of application: 10.1038/SJ.ONC.1208832 [retrieved on 26.09.2018 Bulletin 2018/39 2005-08-22] • X. LIU ET AL: "The ribosomal small-subunit (62) Document number(s) of the earlier application(s) in protein S28 gene from Helianthus annuus accordance with Art. 76 EPC: (Asteraceae) is down-regulated in response to 12718553.6 / 2 702 168 drought, high salinity, and abscisic acid", AMERICAN JOURNAL OF BOTANY, vol. 90, no. (73) Proprietor: Sequenom, Inc.
    [Show full text]
  • The Y Chromosome: a Blueprint for Men’S Health?
    European Journal of Human Genetics (2017) 25, 1181–1188 Official journal of The European Society of Human Genetics www.nature.com/ejhg REVIEW The Y chromosome: a blueprint for men’s health? Akhlaq A Maan1, James Eales1, Artur Akbarov1, Joshua Rowland1, Xiaoguang Xu1, Mark A Jobling2, Fadi J Charchar3 and Maciej Tomaszewski*,1,4 The Y chromosome has long been considered a ‘genetic wasteland’ on a trajectory to completely disappear from the human genome. The perception of its physiological function was restricted to sex determination and spermatogenesis. These views have been challenged in recent times with the identification of multiple ubiquitously expressed Y-chromosome genes and the discovery of several unexpected associations between the Y chromosome, immune system and complex polygenic traits. The collected evidence suggests that the Y chromosome influences immune and inflammatory responses in men, translating into genetically programmed susceptibility to diseases with a strong immune component. Phylogenetic studies reveal that carriers of a common European lineage of the Y chromosome (haplogroup I) possess increased risk of coronary artery disease. This occurs amidst upregulation of inflammation and suppression of adaptive immunity in this Y lineage, as well as inferior outcomes in human immunodeficiency virus infection. From structural analysis and experimental data, the UTY (Ubiquitously Transcribed Tetratricopeptide Repeat Containing, Y-Linked) gene is emerging as a promising candidate underlying the associations between Y-chromosome variants and the immunity-driven susceptibility to complex disease. This review synthesises the recent structural, experimental and clinical insights into the human Y chromosome in the context of men’s susceptibility to disease (with a particular emphasis on cardiovascular disease) and provides an overview of the paradigm shift in the perception of the Y chromosome.
    [Show full text]
  • Regulatory Effects of the Uty/Ddx3y Locus on Neighboring Chromosome Y Genes and Autosomal Mrna Transcripts in Adult Mouse Non-Reproductive Cells
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.30.180232; this version posted July 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Regulatory effects of the Uty/Ddx3y locus on neighboring chromosome Y genes and autosomal mRNA transcripts in adult mouse non-reproductive cells Christian F. Deschepper Cardiovascular Biology Research Unit, Institut de recherches cliniques de Montréal (IRCM) and Université de Montréal Address : 100 Pine Ave West Montréal (QC) Canada H2W 1R7 E-mail : [email protected] Phone : 514 987 5759 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.30.180232; this version posted July 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 2 ABSTRACT In addition to sperm-related genes, the male-specific chromosome Y (chrY) contains a class of ubiquitously expressed and evolutionary conserved dosage-sensitive regulator genes that include the neighboring Uty, Ddx3y and (in mice) Eif2s3y genes. However, no study to date has investigated the functional impact of targeted mutations of any of these genes within adult non-reproductive somatic cells. We thus compared adult male mice carrying a gene trap within their Uty gene (UtyGT) to their wild-type (WT) isogenic controls, and performed deep sequencing of RNA and genome-wide profiling of chromatin features in extracts from either cardiac tissue, cardiomyocyte-specific nuclei or purified cardiomyocytes. The apparent impact of UtyGT on gene transcription concentrated mostly on chrY genes surrounding the locus of insertion, i.e.
    [Show full text]
  • Regulatory Effects of the Uty/Ddx3y Locus on Neighboring Chromosome Y Genes and Autosomal Mrna Transcripts in Adult Mouse Non-Re
    www.nature.com/scientificreports OPEN Regulatory efects of the Uty/Ddx3y locus on neighboring chromosome Y genes and autosomal mRNA transcripts in adult mouse non‑reproductive cells Christian F. Deschepper In addition to sperm‑related genes, the male‑specifc chromosome Y (chrY) contains a class of ubiquitously expressed and evolutionary conserved dosage‑sensitive regulator genes that include the neighboring Uty, Ddx3y and (in mice) Eif2s3y genes. However, no study to date has investigated the functional impact of targeted mutations of any of these genes within adult non‑reproductive somatic cells. We thus compared adult male mice carrying a gene trap within their Uty gene (UtyGT) to their wild‑type (WT) isogenic controls, and performed deep sequencing of RNA and genome‑wide profling of chromatin features in extracts from either cardiac tissue, cardiomyocyte‑specifc nuclei or purifed cardiomyocytes. The apparent impact of UtyGT on gene transcription concentrated mostly on chrY genes surrounding the locus of insertion, i.e. Uty, Ddx3y, long non‑coding RNAs (lncRNAs) contained within their introns and Eif2s3y, in addition to possible efects on the autosomal Malat1 lncRNA. Notwithstanding, UtyGT also caused coordinate changes in the abundance of hundreds of mRNA transcripts related to coherent cell functions, including RNA processing and translation. The results altogether indicated that tightly co‑regulated chrY genes had nonetheless more widespread efects on the autosomal transcriptome in adult somatic cells, most likely due to mechanisms other than just transcriptional regulation of corresponding protein‑coding genes. Although the contributions of genes on the male sex chrY have long believed to be restricted to their efects on reproductive functions in sex organs, increasing evidence indicates that their impact may in fact extend to somatic cells as well.
    [Show full text]