US006680047B2 (12) United States Patent (10) Patent No.: US 6,680,047 B2 Klaveness et al. (45) Date of Patent: Jan. 20, 2004

(54) DIAGNOSTIC/THERAPEUTICAGENTS 5,632,986 A 5/1997 Tait et al. 5,643,553 A 7/1997 Schneider et al. (75) Inventors: Jo Klaveness, Oslo (NO); P?l 5,650,156 A 7/1997 Grinstaff et al. Rongved, Oslo (NO); Anders Høgset, 5,656,211 A 8/1997 Unger et al. 5,665,383 A 9/1997 Grinstaff et al. Oslo (NO); Helge Tolleshaug, Oslo 5,690,907 A 11/1997 Lanza et al. (NO); Alan Cuthbertson, Oslo (NO); 5,716,594 A 2/1998 Elmaleh et al. Aslak Godal, Oslo (NO); Lars Hoff, 5,733,572 A 3/1998 Unger et al. Oslo (NO); Geir Gogstad, Oslo (NO); 5,780,010 A 7/1998 Lanza et al. Klaus Bryn, Oslo (NO); Anne 5,846,517 A 12/1998 Unger ...... 424/9.52 Naevestad, Oslo (NO); Dagfinn 5,849,727 A 12/1998 Porter et al...... 514/156 Løvhaug, Oslo (NO); Halldis 5,891,468 A 4/1999 Martin et al...... 424/450 Hellebust, Oslo (NO); Magne 5,910,300 A 6/1999 Tournier et al. 5,997,898 A 12/1999 Unger ...... 424/450 Solbakken, Oslo (NO) 6,217,869 B1 * 4/2001 Meyer et al...... 424/178.1 (73) Assignee: Amersham Health AS, Oslo (NO) 6,245,318 B1 6/2001 Klibanov et al...... 424/9.52 FOREIGN PATENT DOCUMENTS (*) Notice: Subject to any disclaimer, the term of this patent is extended or adjusted under 35 CA 2 145 505 4/1994 DE 19 626 530 7/1996 U.S.C. 154(b) by 35 days. EP O 727 225 8/1996 WO WO 93/20802 10/1993 (21) Appl. No.: 09/925,715 WO WO 94/07539 4/1994 WO WO 94/28873 12/1994 (22) Filed: Aug. 10, 2001 WO WO 94/28874 12/1994 (65) Prior Publication Data WO WO 95/03356 2/1995 WO WO 95/03357 2/1995 US 2002/0102217 A1 Aug. 1, 2002 WO WO 95/07072 3/1995 WO WO 95/15118 6/1995 Related U.S. Application Data WO WO 96/39149 12/1996 WO WO 96/40277 12/1996 (63) Continuation of application No. 08/959,206, filed on Oct. WO WO 96/40285 12/1996 28, 1997, now Pat. No. 6,331,289. WO WO 96/41647 12/1996 (60) Provisional application No. 60/049,263, filed on Jun. 6, WO WO 97/23855 7/1997 1997, provisional application No. 60/049,264, filed on Jun. WO WO 97/33474 9/1997 6, 1997, and provisional application No. 60/049,266, filed WO WO 97/41898 11/1997 on Jun. 7, 1997. WO WO 98/00172 1/1998 (30) Foreign Application Priority Data WO WO 98/04293 2/1998 WO WO 98/19705 5/1998 Oct. 28, 1996 (GB) ...... 96.22366 WO WO 98/20856 5/1998 Oct. 28, 1996 (GB) ...... 9622369 WO WO 98/42384 10/1998 Feb. 4, 1997 (GB) ...... 97021.95 Apr. 24, 1997 (GB) ...... 9708265 OTHER PUBLICATIONS Jun. 6, 1997 (GB) ...... 9711837 Worthington Enzyme Manual, Worthington Biochemical Jun. 6, 1997 (GB) ...... 97.11839 Corporation, 1972. (51) Int. Cl." ...... A61B 8/00; A61B 51/00; Medline database extract No. XP-002063692, 1997. A61B 5/055; A61B 9/127; A61B 9/14 Biosis database extract No. XP-002063693, Nov. 1997. (52) U.S. Cl...... 424/9.52; 424/1.21; 424/9.32; Medline database extract No. KP-002064110, 1997. 424/9.4; 424/450; 424/489 Muzykantov et al., J. Nuclear Medicine, 35(8): 1358–1365 (58) Field of Search ...... 424/9.52, 9.51, (1994). 424/9.5, 1.21, 1.29, 1.49, 1.53, 1.69, 9.1, Klibanov et al., Acta Radiologica, 38 (Supp 412): 113–120 9.3, 9.4, 9.6, 450, 489; 516/11, 77; 600/441, (1997). 458 * cited by examiner (56) References Cited Primary Examiner—Michael G. Hartley (74) Attorney, Agent, or Firm—Bacon & Thomas U.S. PATENT DOCUMENTS (57) ABSTRACT 4,927,916 A 5/1990 Matsueda et al...... 530/387 5,013,556 A 5/1991 Woodle et al...... 424/450 Targetable diagnostic and/or therapeutically active agents, 5,154,924 A 10/1992 Friden ...... 424/85.91 e.g. ultrasound contrast agents, comprising a suspension in 5,198,424 A 3/1993 McEver ...... 514/13 an aqueous carrier liquid of a reporter comprising gas 5,356,633 A. 10/1994 Woodle et al. . ... 424/450 5,362.478 A 11/1994 Desai et al...... 424/9 containing or gas-generating material, said agent being 5,498,421 A 3/1996 Grinstaff et al. capable of forming at least two types of binding pairs with 5,505,932 A. 4/1996 Grinstaff et al...... 424/9.3 a target. 5,534,241 A 7/1996 Torchilin et al. 5,612,057 A. 3/1997 Lanza et al. 30 Claims, 1 Drawing Sheet U.S. Patent Jan. 20, 2004 US 6,680,047 B2

256 Gm: 15. 62 CW. 31.39 (1,1,–1023) 18l.30 (92.2 °/.)

i US 6,680,047 B2 1 2 DIAGNOSTIC/THERAPEUTIC AGENTS number of other molecules/structures, again creating pos sible background problems. This application is a continuation application of pending There is a limited body of prior art relating to targeted U.S. application Ser. No. 08/959,206, filed Oct. 28, 1997 ultrasound contrast agents. Thus, for example, U.S. Pat. No. now U.S. Pat. No. 6,331,289, (of which the entire disclosure 5,531,980 is directed to systems in which the reporter of the pending, prior application is hereby incorporated by comprises an aqueous suspension of air or gas microbubbles reference) which has been allowed and the Issue Fee paid on stabilised by one or more film-forming surfactants present at Aug. 6, 2001, which claims benefit of three U.S. provisional least partially in lamellar or laminar form, said surfactant(s) applications serial Nos. 60/049,263, filed June 6, 1997, being bound to one or more vectors comprising “bioactive 60/049,264, filed Jun. 6, 1997 and 60/049,266, filed Jun. 7, 10 species designed for specific targeting purposes”. It is stated 1997. that the microbubbles are not directly encapsulated by This invention relates to diagnostic and/or therapeuti surfactant material but rather that this is incorporated in cally active agents, more particularly to diagnostic and/or liquid-filled liposomes which stabilise the microbubbles. It therapeutically active agents incorporating moieties having will be appreciated that lamellar or laminar surfactant mate affinity for sites and/or structures within the body so that 15 rial such as phospholipids present in such liposomes will diagnostic imaging and/or therapy of particular locations inevitably be present in the form of one or more lipid within the body may be enhanced. Of particular interest are bilayers with the lipophilic tails “back-to-back” and the diagnostic agents for use in ultrasound imaging, which are hydrophilic heads both inside and outside (see e.g. hereinafter referred to as targeted ultrasound contrast agents. Schneider, M. on “Liposomes as drug carriers: 10 years of It is well known that ultrasonic imaging comprises a 20 research” in Drug targeting, Nyon, Switzerland, Oct. 3–5, potentially valuable diagnostic tool, for example in studies 1984, Buri, P and Gumma, A. (Ed), Elsevier, Amsterdam of the vascular system, particularly in cardiography, and of 1984). tissue microvasculature. A variety of contrast agents has EP-A-0727225 describes targeted ultrasound contrast been proposed to enhance the acoustic images so obtained, agents in which the reporter comprises a chemical having a including suspensions of solid particles, emulsified liquid 25 sufficient vapour pressure such that a proportion of it is a gas droplets, gas bubbles and encapsulated gases or liquids. It is at the body temperature of the subject. This chemical is generally accepted that low density contrast agents which associated with a surfactant or albumin carrier which are easily compressible are particularly efficient in terms of includes a protein-, peptide- or carbohydrate-based cell the acoustic backscatter they generate, and considerable adhesion molecule ligand as vector. The receptor moieties in interest has therefore been shown in the preparation of 30 such contrast agents correspond to the phase shift colloid gas-containing and gas-generating systems. systems described in WO-A-9416739; it is now recognised Gas-containing contrast media are also known to be that administration of such phase shift colloids may lead to effective in magnetic resonance (MR) imaging, e.g. as generation of microbubbles which grow uncontrollably, susceptibility contrast agents which will act to reduce MR possibly to the extent where they cause potentially danger signal intensity. Oxygen-containing contrast media also rep 35 ous embolisation of, for example, the myocardial vascula resent potentially useful paramagnetic MR contrast agents. ture and brain (see e.g. Schwarz, Advances in Echo-Contrast Furthermore, in the field of x-ray imaging it has been [1994(3)], pp. 48–49). observed that gases such as carbon dioxide may be used as WO-A-9320802 proposes that tissue-specific ultrasonic negative oral contrast agents or intravascular contrast image enhancement may be achieved using acoustically agents. 40 reflective oligolamellar liposomes conjugated to tissue The use of radioactive gases, e.g. radioactive isotopes of specific ligands such as antibodies, peptides, lectins etc. The inert gases such as xenon, has also been proposed in liposomes are deliberately chosen to be devoid of gas and so scintigraphy, for example for blood pool imaging. will not have the advantageous echogenic properties of Targeted ultrasound contrast agents may be regarded as gas-based ultrasound contrast agents. Further references to comprising (i) a reporter moiety capable of interacting with 45 this technology, e.g. in targeting to fibrin, thrombi and ultrasound irradiation to generate a detectable signal; (ii) one atherosclerotic areas are found in publications by or more vectors having affinity for particular target sites Alkanonyuksel, H. et al. in J. Pharm. Sci. (1996) 85(5), and/or structures within the body, e.g. for specific cells or 486–490; J. Am. Coll. Cardiol. (1996) 27(2) Suppl A, 298A; areas of pathology; and (iii) one or more linkers connecting and Circulation, 68 Sci. Sessions, Anaheim Nov. 13–16, said reporter and vector(s), in the event that these are not 50 1995. directly joined. There is also a number of publications concerning ultra The molecules and/or structure to which the contrast sound contrast agents which refer in passing to possible use agent is intended to bind will hereinafter be referred to as the of monoclonal antibodies as vectors without giving signifi target. In order to obtain specific imaging of a selected cant practical detail and/or to reporters comprising materials region/structure in the body the target must be present and 55 which may be taken up by the reticuloendothelial system available in this region/structure. Ideally it will be expressed and thereby permit image enhancement of organs such as the only in the region of interest, but usually will also be present liver—see, for example WO-A-9300933, WO-A-9401140, at other locations in the body, creating possible background WO-A-9408627, WO-A-9428874, U.S. Pat. Nos. 5,088, problems. The target may either be a defined molecular 499, 5,348,016 and 5,469,854. In general these prior art species (i.e. a target molecule) or an unknown molecule or 60 targeted contrast agents are intended to enhance contrast at more complex structure (i.e. a target structure) which is specific sites in the body, for example tumour cells, by using present in the area to be imaged, and is able to bind one vector to bind strongly to one target, in order to achieve specifically or selectively to a given vector molecule. concentration at the target cells. In contrast to this principle The vector is attached to the reporter moiety in order to of using one vector to bind with high affinity to one target, bind these moieties to the region/structure to be imaged. The 65 the present invention is based in part on the finding that vector may bind specifically to a chosen target, or it may diagnostic and/or therapeutically active agents with more bind only selectively, having affinity also for a limited favourable properties may be obtained by use of multiple US 6,680,047 B2 3 4 kinds of vector-target interactions (e.g. involving agents The term multiple-specificity is also used to describe an associated with a plurality of different vectors and/or with injectable carrier liquid, of gas-containing or gas-generating one or more vectors having affinity for different targets on material composed of one or more vectors with a specificity the same or different cell types). In this way, binding of for one or more cellular surface receptors while at the same gas-containing and gas-generating diagnostic and/or thera time comprising a second element with specificity for a peutic agents may, for example, be obtained by forming substrate or receptor system binding to which induces a multiple binding pairs between one vector with specificity therapeutic response. Thus included within the scope of the for more than one receptor or between more than one vector present invention are multiple-specific imaging agents com with affinity for one or more types of target, with either low or high affinities. Such multiple binding of the vector prising a targeting vector, such as the anti-fibrin antibody conjugated agent to one or more target molecules/structures 10 described by Lanza et al. (Circulation, (1996) 94 (12),pp may result in advantageous targeting properties, for example 3334), annexin V atherosclerotic plaque binding peptides by enhancing target specificity and/or by distinguishing such as YRALVDTLK, or any other vector known to interactions at a desired target area from background inter associate with fibrin clots, in combination with a drug or actions with lower levels of molecules/structures similar to enzyme with fibrinolytic activity such as streptokinase, target expressed elsewhere in the body. 15 plasminogen activator (tPA), urokinase (uPA) or prouroki It is well known to use one vector binding with high nase (scuPA) resulting in a localised therapeutic antithrom affinity to one target. The present invention, however, is botic effect. This invention is also extended to include based on the finding that the desired binding of gas vectors with increased specificity for tumour cells in com containing and gas-generating diagnostic and/or therapeutic bination with vectors or drug molecules functioning as agents may be obtained by forming multiple binding pairs 20 chemotherapeutic agents capable of inhibiting tumour with low affinity between one type of vector and one type of growth. target, or by forming multiple binding pairs between one or It is well known that many, if not all, target molecules are more types of vectors and one or more types of target, with not expressed exclusively at target sites; a common situation either low or high affinities. Thus multiple binding of the is that such molecules are over-expressed by target cells or vector conjugated agent to one or more target molecules/ 25 at a target structure but are also expressed at lower levels structures may have advantageous targeting properties, for elsewhere in the body. The use of reporters carrying a example in enhancing target specificity and/or in distin multiplicity of vectors with relatively low affinity for the guishing interactions at a desired target area from back target may be advantageous in this situation, since the ground interactions with lower levels of molecules/ reporter will then tend to concentrate in regions of high structures similar to target expressed elsewhere in the body. 30 target density which permit multiple (and therefore strong) Thus according to one aspect of the present invention binding to the reporter (e.g. a gas-containing agent incor there is provided a targetable diagnostic and/or therapeuti porating the vectors folic acid and glutathione for multiple cally active agent, e.g. an ultrasound contrast agent, com specific binding to folic acid receptors and glutathione-S prising a suspension in an aqueous carrier liquid, e.g. an trasferase receptors respectively which are over-expressed injectable carrier liquid, of a reporter comprising gas 35 as tumour cells). Areas of low target density, on the other containing or gas-generating material characterised in that hand, will not provide sufficient interaction with such low said agent is capable of forming at least two types of binding affinity vectors to bind the target. In such embodiments of pairs, e.g. being conjugated to at least two vectors or to one the invention, low affinity vectors may be regarded as having vector capable of binding to at least two binding sites. an association constant K, for interaction with a target One advantageous embodiment of the invention is based 40 molecule or structure of less than 10° MT', e.g. less than 107 on the additional finding that limited adhesion to targets is MT', preferably less than 10° MT*. A further embodiment of a highly useful property of diagnostic and/or therapeutically this invention is thus based on the finding that the desired active agents, which property may be achieved using vectors binding of gas-containing and gas-generating diagnostic giving temporary retention rather than fixed adhesion to a and/or therapeutic agents may be obtained by forming target. Thus such agents, rather than being fixedly retained 45 binding pairs with low affinity between more than one type at specific sites, may for example effectively exhibit a form of vector and one or more type of target. Multiple vectors of retarded flow along the vascular endothelium by virtue of may therefore be used to increase specificity, so that the their transient interactions with endothelial cells. Such reporter will bind only to target cells or structures expressing agents may thus become concentrated on the walls of blood a particular combination of target molecules. vessels, in the case of ultrasound contrast agents providing 50 It may also be useful to select a plurality of vectors which enhanced echogenicity thereof relative to the bulk of the bind to different parts, e.g. epitopes, of a target structure in bloodstream, which is devoid of anatomical features. They order to give increased binding strength. This may be therefore may permit enhanced imaging of the capillary particularly advantageous when the target density is low. system, including the microvasculature, and so may facili Products comprising two or more vectors with different tate distinction between normal and inadequately perfused 55 specificities, i.e. which bind to different target molecules on tissue, e.g. in the heart, and may also be useful in visualising different cells, may advantageously be used as “general structures such as Kupffer cells, thrombi and atherosclerotic purpose” agents for detection of a range of diseases, e.g. lesions or for visualising neo-vascularized and inflamed different forms of cancer. Thus, for example, the use of such tissue areas. The present invention is well suited to imaging agents may enable detection of metastases, which are often changes occurring in normal blood vessels which are situ 60 heterogeneous with respect to expression of target molecules ated in areas of tissue necrosis. (i.e. antigens). It will be appreciated that binding affinities are dependent Within the context of the present invention, the reporter on numbers of interactions as well as their strength. The unit will usually remain attached to the vectors. In another density of vector molecules at the surface of the reporter type of targeting procedure, sometimes called pre-targeting, units may therefore be selected so as appropriately to adjust 65 the vector (often, a monoclonal antibody) is administered the degree of interactions between particular agents and alone; subsequently, the reporter is administered, coupled to targets. a moiety which is capable of specifically binding the vector US 6,680,047 B2 5 6 molecule (when the vector is an antibody, the reporter may non-polymerisable wall-forming material (for example as be coupled to an immunoglobulin-binding molecule, such as described in WO-A-9521631), or a surfactant (for example protein A or an anti-immunoglobulin antibody). An advan a polyoxyethylene-polyoxypropylene block copolymer sur tage of this protocol is that time may be allowed for factant such as a Pluronic, a polymer surfactant as described elimination of the vector molecules that do not bind their in WO-A-9506518, or a film-forming surfactant such as a targets, substantially reducing the background problems that phospholipid, e.g. as described in WO-A-921.1873, WO-A are connected with the presence of an excess of reporter 9217212, WO-A-9222247, WO-A-9428780 or WO-A vector conjugate. Within the context of the present 9503835). invention, pre-targeting with one specific vector might be Other useful gas-containing contrast agent formulations envisaged, followed by reporter units that are coupled to 10 include gas-containing solid systems, for example micro another vector and a moiety which binds the first vector. particles (especially aggregates of microparticles) having Within the context of the present invention, in some cases gas contained therewithin or otherwise associated therewith and in particular for the assessment of blood perfusion rates (for example being adsorbed on the surface thereof and/or in defined areas, for example in myocardium, it is of interest contained within voids, cavities or pores therein, e.g. as to measure the rate at which ultrasound contrast agents 15 described in EP-A-0122624, EP-A-01.23235, EP-A bound to the target are displaced or released from the target. 0365467, WO-A-922.1382, WO-A-9300930, WO-A This can be achieved in a controlled fashion by subsequent 9313802, WO-A-9313808 or WO-A-9313809). It will be administration of a vector or other agent able to displace or appreciated that the echogenicity of such microparticulate release the contrast agent from the target. contrast agents may derive directly from the contained/ Vectors useful in accordance with the invention include 20 associated gas and/or from gas (e.g. microbubbles) liberated ligands for cell adhesion proteins, as well as cell adhesion from the solid material (e.g. upon dissolution of the micro proteins themselves where these have corresponding ligands particulate structure). on endothelial cell surfaces. Examples of cell adhesion The disclosures of all of the above-described documents proteins include integrins, most of which bind the Arg-Gly relating to gas-containing contrast agent formulations are Asp (RGD) amino acid sequence. If desired, the vector may 25 incorporated herein by reference. be targeted to specific cell adhesion proteins expressed Gas microbubbles and other gas-containing materials mainly on activated endothelial cells such as are found at or such as microparticles preferably have an initial average size close to sites of inflammation or other pathological not exceeding 10 um (e.g. of 7 um or less) in order to permit responses. Other vectors which may be used include pro their free passage through the pulmonary system following teins and peptides that bind to cell-surface proteoglycans, 30 administration, e.g. by intravenous injection. which are complexes of proteins and sulphated polysaccar Where phospholipid-containing compositions are ides found on most cells, including endothelial cells. Such employed in accordance with the invention, e.g. in the form proteoglycans contribute to the negative surface charge of of phospholipid-stabilised gas microbubbles, representative all nucleated cells from vertebrate animals; this charge may examples of useful phospholipids include lecithins (i.e. also be exploited in accordance with the invention by using 35 phosphatidylcholines), for example natural lecithins such as positively charged vectors, e.g. comprising cationic lipids, egg yolk lecithin or soya bean lecithin and synthetic or which will interact electrostatically with the endothelial semisynthetic lecithins such as dimyristoylphosphatidyl surface. choline, dipalmitoylphosphatidylcholine or distearoylphos A further aspect of the present invention is for example phatidylcholine; phosphatidic acids; phosphatidylethanola where a vector or vectors is attached to the reporter or 40 mines; phosphatidylserines; phosphatidylglycerols; phos included non-covalently into the reporter in a manner where phatidylinositols; cardiolipins; sphingomyelins; fluorinated the said vector or vectors is not readily exposed to the targets analogues of any of the foregoing; mixtures of any of the or receptors. Increased tissue specificity may therefore be foregoing and mixtures with other lipids such as cholesterol. achieved by applying an additional process to expose the The use of phospholipids predominantly (e.g. at least 75%) vectors, e.g. the agent is exposed after administration to 45 comprising molecules individually bearing net overall external ultrasound to change the diffusibility of the moieties charge, e.g. negative charge, for example as in naturally containing the vectors. occurring (e.g. soya bean or egg yolk derived), semisyn The reporter may be in any convenient form, for example thetic (e.g. partially or fully hydrogenated) and synthetic being any appropriate gas-containing or gas-generating phosphatidylserines, phosphatidylglycerols, ultrasound contrast agent formulation. Representative 50 phosphatidylinositols, phosphatidic acids and/or examples of such formulations include microbubbles of gas cardiolipins, may be particularly advantageous. stabilised (e.g. at least partially encapsulated) by a Other exemplary lipids which may be used to prepare coalescence-resistant surface membrane (for example gas-containing contrast agents include fatty acids, stearic gelatin, e.g. as described in WO-A-8002365), a filmogenic acid, palmitic acid, 2-n-hexadecylstearic acid, oleic acid and protein (for example an albumin such as human serum 55 other acid containing lipid structures. These lipid structures albumin, e.g. as described in U.S. Pat. Nos. 4,718,433, are considered particularly interesting when coupled by 4,774,958, 4,844,882, EP-A-0359246, WO-A-9112823, amide bond formation to amino acids containing one or WO-A-9205806, WO-A-9217213, WO-A-9406477 or more amino groups. The resulting lipid modified amino WO-A-9501187), a polymer material (for example a syn acids (e.g. dipal mitoyllysine, diste a royl-2,3 thetic biodegradable polymer as described in EP-A 60 diaminopropionic acid) are considered useful precursors for 0398935, an elastic interfacial synthetic polymer membrane the attachment of functionalised spacer elements featuring as described in EP-A-0458745, a microparticulate biode coupling sites for conjugation of one or more vector mol gradable polyaldehyde as described in EP-A-0441468, a ecules. microparticulate N-dicarboxylic acid derivative of a A further extension of this invention relates to the polyamino acid-polycyclic imide as described in EP-A 65 synthesis of lipopeptide structures comprising a lipid 0458079, or a biodegradable polymer as described in reporter attached to a linker portion (e.g. PEG, polyamino WO-A-9317718 or WO-A-9607434), a non-polymeric and acid, alkylhalide etc) the said linker being suitably func US 6,680,047 B2 7 8 tionalised for coupling to one or more vector molecules. A as cyclopropane, cyclobutane or cyclopentane, an alkene particular preference is the inclusion of a positively charged such as ethylene, propene, propadiene or a butene, or an linker element (e.g. two or more lysine residues) for anchor alkyne such as acetylene or propyne; an ether such as ing of the reporter element in the microbubble through dimethyl ether; a ketone; an ester; a halogenated low electrostatic interaction with the negatively charged mem molecular weight hydrocarbon (erg. containing up to 7 brane. Multiple-specific targeting is achievable by mixing carbon atoms); or a mixture of any of the foregoing. Advan and ‘doping of phospholipid gas-containing structures with tageously at least some of the halogen atoms in halogenated one or more targeted lipopeptide sequences. Multiple gases are fluorine atoms; thus biocompatible halogenated specificity can also be achieved by assembling more than hydrocarbon gases may, for example, be selected from one vector on a branched lysine core structure such as those 10 described by Tam et al. (Proc. Natl. Acad. Sci. USA, 1989, bromochlorodifluoromethane, chlorodifluoromethane, 86, 9084) or by incorporating multiple vectors in a linear dichlorodifluoromethane, bromotrifluoromethane, sequence. Multiple-specificity can also be achieved using chlorotrifluoromethane, chloropentafluoroethane, lipopeptides or phospholipids comprising combinatorial dichlorote trafluoroethane, chlorotrifluoroethylene, libraries synthesised by chemical synthesis as described by 15 fluoroethylene, ethylfluoride, 1,1-difluoroethane and Lowe (Combinatorial Chemistry, Chemical Society perfluorocarbons, e.g. perfluoroalkanes such as Reviews, 1995, 309–317). perfluoromethane, perfluoroethane, perfluoropropanes, per Also within the scope of this invention are functionalised fluorobutanes (e.g. perfluoro-n-butane, optionally in admix microbubbles carrying one or more reactive groups for ture with other isomers such as perfluoro-iso-butane), non-specific reaction with receptor molecules located on cell 20 perfluoropentanes, perfluorohexanes and perfluoroheptanes; surfaces. Microbubbles comprising a thiol moiety,for perfluoroalkenes such as perfluoropropene, perfluorobutenes example, can bind to cell surface receptors via disulphide (e.g. perfluorobut-2-ene) and perfluorobutadiene; perfluoro exchange reactions. The reversible nature of this covalent alkynes such as perfluorobut-2-yne; and perfluorocycloal bond means that bubble flow can be controlled by altering kanes such as perfluorocyclobutane, perfluoro the redox environment. Similarly ‘activated’ microbubbles 25 methylcyclobutane, perfluorodimethylcyclobutanes, of membranes comprising active esters such as perfluorotrimethylcyclobutanes, perfluorocyclopentane, N-hydroxysuccinimide esters can be used to modify amino perfluoromethylcyclopentane, perfluorodimethyl groups found on a multiplicity of cell surface molecules. cyclopentanes, perfluorocyclohexane, perfluoromethylcy Representative examples of gas-containing micropar clohexane and perfluorocycloheptane. Other halogenated ticulate materials which may be useful in accordance with 30 gases include methyl chloride, fluorinated (e.g. the invention include carbohydrates (for example hexoses perfluorinated) ketones such as perfluoroacetone and fluori such as glucose, fructose or galactose; disaccharides such as nated (e.g. perfluorinated) ethers such as perfluorodiethyl Sucrose, lactose or maltose; pentoses such as arabinose, ether. The use of perfluorinated gases, for example sulphur xylose or ribose; Cº-, fl- and Y-cyclodextrins; polysaccharides he xafluoride and perfluoro carbons such as such as starch, hydroxyethyl starch, amylose, amylopectin, 35 perfluoropropane, perfluorobutanes and perfluoropentanes, glycogen, inulin, pulullan, dextran, carboxymethyl dextran, may be particularly advantageous in view of the recognised dextran phosphate, ketodextran, aminoethyldextran, high stability in the bloodstream of microbubbles containing alginates, chitin, chitosan, hyaluronic acid or heparin; and such gases. sugar alcohols, including alditols such as mannitol or The reporter may be made by any convenient process, for sorbitol), inorganic salts (e.g. sodium chloride), organic salts 40 example by making gas-containing or gas-generating for (e.g. sodium citrate, sodium acetate or sodium tartrate), mulations. Representative examples include the preparation X-ray contrast agents (e.g. any of the commercially avail of a suspension of gas microbubbles by contacting a sur able carboxylic acid and non-ionic amide contrast agents factant with gas and mixing them in the presence of an typically containing at least one 2,4,6-triiodophenyl group aqueous carrier, as described in WO 911524.4; or by atom having substituents such as carboxyl, carbamoyl, 45 ising a solution or dispersion of a wall-forming material in N-alkylcarbamoyl, N-hydroxyalkylcarbamoyl, acylamino, the presence of a gas in order to obtain hollow N-alkylacylamino or acylaminomethyl at the 3- and/or microcapsules, as described in EP 512693A1; preparation of 5-positions, as in metrizoic acid, diatrizoic acid, iothalamic solid microspheres by a double emulsion process, as acid, ioxaglic acid, iohexol, iopentol, iopamidol, iodixanol, described in U.S. Pat. No. 5,648,095; or a process for iopromide, metrizamide, iodip amide, meglumine 50 forming hollow microcapsules by spray-drying as described iodipamide, meglumine acetrizoate and meglumine in EP 68.1843A2; or preparing gas-filled liposomes by diatrizoate), and polypeptides and proteins (e.g. gelatin or shaking an aqueous solution comprising a lipid in the albumin such as human serum albumin). presence of a gas as described in U.S. Pat. No. 5,469,854. Any biocompatible gas may be present in the reporter of A suitable process for attachment of the desired vector to contrast agents according to the invention, the term “gas” as 55 the reporter comprises a surface modification of the pre used herein including any substances (including mixtures) formed reporter with a suitable linker employing reactive substantially or completely in gaseous (including vapour) groups on the surface of both the reporter and vector. It may form at the normal human body temperature of 37° C. The be particularly advantageous physically to mix the reporter gas may thus, for example, comprise air; nitrogen; oxygen; material with the vector-containing substance at any step of carbon dioxide; hydrogen; an inert gas such as helium, 60 the process. Such a process will result in incorporation or an argon, xenon or krypton; a sulphur fluoride such as sulphur attachment of the vector to the reporter. An optional process hexafluoride, disulphur decafluoride or trifluoromethylsul step may remove the excess of vector not bound to the phur pentafluoride; selenium hexafluoride; an optionally reporter by washing the gas-containing particles following halogenated silane such as methylsilane or dimethylsilane; a separation, by for example, floatation. A preferred aspect is low molecular weight hydrocarbon (e.g. containing up to 7 65 the use of lipopeptide structures incorporating functional carbon atoms), for example an alkane such as methane, groups such as thiol, maleimide biotin etc. which can be ethane, a propane, a butane or a pentane, a cycloalkane such premixed if desired with other reporter molecules before

US 6,680,047 B2 11 12 which react through O-acylurea formation followed by 270(49), 29075-29078. Annexins are a class of amide bond formation, may also usefully be employed; phospholipid-binding proteins, many of which bind particu linking may be facilitated through addition of an amine or larly avidly to phosphatidyl-serine (reviewed in Raynal, P. may result in direct vector-receptor coupling. Useful water and H. B. Pollard. Annexins: the problem of assessing the soluble carbodiimides include 1-cyclohexyl-3-(2 biological role for a gene family of multifunctional calcium morpholinyl-4-ethyl)carbodiimide (CMC) and 1-ethyl-3-(3 and phospholipid-binding proteins”. Biochim. Biophys. dimethylaminopropyl)carbodiimide (EDC), e.g. as Acta 1197: 63–93). A conjugate of a vector with such a described by Zot, H. G. and Puett, D. in J. Biol. Chem. phosphatidylserine-binding protein may therefore be used to (1989) 264, 15552. Other useful carboxylic acid modifying attach the vector to phosphatidylserine-encapsulated reagents include isoxazolium derivatives such as Wood 10 microbubbles. When the amino acid sequence of a binding wards re age nt K, chloro for mates such as protein is known, the phospholipid-binding portion may be p-nitrophenylchloroformate; carbonyldiimidazoles such as synthesised or isolated and used for conjugation with a 1,1'-carbonyldiimidazole; and N-carbalkoxydihydroquino vector, thus avoiding the biological activity which may be lines such as N-(ethoxycarbonyl)-2-ethoxy-1,2 located elsewhere in the molecule. dihydroquinoline. 15 It is also possible to obtain molecules that bind specifi Other potentially useful reactive moieties include vicinal cally to the surface (or in the “membrane”) of microspheres diones such as p-phenylenediglyoxal, which may be used to by direct screening of molecular libraries for microsphere react with guanidinyl groups, e.g. as described by Wagner et binding molecules. For example, phage libraries displaying al. in Nucleic acid Res. (1978) 5,4065; and diazonium salts, small peptides could be used for such selection. The selec which may undergo electrophilic substitution reactions, e.g. 20 tion may be made by simply mixing the microspheres and as described by Ishizaka, K. and Ishizaka T. in J. Immunol. the phage display library and eluting the phages binding to (1960) 85, 163. Bis-diazonium compounds are readily pre the floating microspheres. If desired, the selection can be pared by treatment of aryl diamines with sodium nitrite in done under “physiological conditions” (e.g. in blood) to acidic solutions. It will be appreciated that functional groups eliminate peptides which cross-react with blood compo in the reporter and/or vector may if desired be converted to 25 ments. An advantage of this type of selection procedure is other functional groups prior to reaction, e.g. to confer that only binding molecules that do not destabilize the additional reactivity or selectivity. Examples of methods microspheres should be selected, since only binding mol useful for this purpose include conversion of amines to ecules attached to intact floating microspheres will rise to carboxylic acids using reagents such as dicarboxylic anhy the top. It may also be possible to introduce some kind of drides; conversion of amines to thiols using reagents such as 30 “stress” during the selection procedure (e.g. pressure) to N-acetylhomocysteine thiol acto ne , ensure that destabilizing binding moieties are not selected. S-acetylmercaptosuccinic anhydride, 2-iminothiolane or Furthermore the selection could be done under shear con thiol-containing succinimidyl derivatives; conversion of thi ditions e.g. by first letting the phages react with the micro ols to carboxylic acids using reagents such as spheres and then letting the microspheres pass through a Ot-haloacetates; conversion of thiols to amines using 35 surface coated with anti-phage antibodies under flow con reagents such as ethylenimine or 2-bromoethylamine; con ditions. In this way it may be possible to select binders version of carboxylic acids to amines using reagents such as which may resist shear conditions present in vivo. Binding carbodiimides followed by diamines; and conversion of moieties identified in this way may be coupled (chemically alcohols to thiols using reagents such as tosyl chloride via peptide synthesis, or at the DNA-level using recombi followed by transesterification with thioacetate and hydroly 40 nant vectors) to a vector molecule, constituting a general sis to the thiol with sodium acetate. tool for attaching any vector molecule to the microspheres. Vector-receptor coupling may also be effected using A vector which comprises or is coupled to a peptide or enzymes as zero-length crosslinking agents; thus, for lipopeptide linker which contains a element capable of example, transglutaminase, peroxidase and xanthine oxidase mediating membrane insertion may also be useful. One have been used to produce crosslinked products. Reverse 45 example is described by Leenhouts, J. M. et al. in Febs proteolysis may also be used for crosslinking through amide Letters (1995) 370(3), 189–192. Non-bioactive molecules bond formation. consisting of known membrane insertion anchor/signal Non-covalent vector-receptor coupling may, for example, groups may also be used as vectors for certain applications, be effected by electrostatic charge interactions e.g. between an example being the H1 hydrophobic segment from the a polylysinyl-functionalised reporter and a polyglutamyl 50 Na,K-ATPase O-subunit described by Xie, Y. and Morimoto, functionalised vector, through chelation in the form of stable T. in J. Biol. Chem. (1995) 270(20), 11985–11991. The metal complexes or through high affinity binding interaction anchor group may also be fatty acid(s) or cholesterol. such as avidin/biotin binding. Polylysine, coated non Coupling may also be effected using avidin or covalently to the negatively charged membrane surface can streptavidin, which have four high affinity binding sites for also increase non-specifically the affinity of a microbubble 55 biotin. Avidin may therefore be used to conjugate vector to for a cell through charge interactions. reporter if both vector and reporter are biotinylated. Alternatively, vectors may be coupled to a protein or Examples are described by Bayer, E. A. and Wilchek, M. in peptide sequence known to bind phospholipids. In many Methods Biochem. Anal. (1980) 26, 1. This method may also instances, a single molecule of phospholipid may attach to be extended to include linking of reporter to reporter, a a protein such as a translocase, while other proteins may 60 process which may encourage bubble association and con attach to surfaces consisting mainly of phospholipid head sequent potentially increased echogenicity. groups and so may be used to attach vectors to phospholipid Non-covalent coupling may also utilise the bifunctional microspheres; one example of such a protein is nature of bispecific immunoglobulins. These molecules can £2-glycoprotein I (Chonn, A., Semple, S.C. and Cullis, P. R., specifically bind two antigens, thus linking them. For Journal of Biological Chemistry (1995) 270, 25845–25849). 65 example, either bispecific IgG or chemically engineered Phosphatidylserine-binding proteins have been described, bispecific F(ab')2 fragments may be used as linking agents. e.g. by Igarashi, K. et al. in Journal of Biological Chemistry Heterobifunctional bispecific antibodies have also been US 6,680,047 B2 13 14 reported for linking two different antigens, e.g. as described The major mechanism for uptake of particles by the cells by Bode, C. et al. in J. Biol. Chem. (1989) 264,944 and by of the reticuloendothelial system (RES) is opsonisation by Staerz, U. D. et al. in Proc. Natl. Acad. Sci. USA (1986) 83, plasma proteins in blood; these mark foreign particles which 1453. Similarly, any reporter and/or vector containing two or are then taken up by the RES. The biological properties of more antigenic determinants (e.g. as described by Chen, Aa PEG spacer elements used in accordance with the invention et al. in Am. J. Pathol. (1988) 130, 216) may crosslink may serve to increase contrast agent circulation time in a antibody molecules and lead to formation of multi-bubble similar manner to that observed for PEGylated liposomes cross-linked assemblies of potentially increased echogenic (see e.g. Klibanov, A. L. et al. in FEBS Letters (1990) 268, ity. 235–237 and Blume, G. and Cevc, G. in Biochim. Biophys. So-called zero-length linking agents, which induce direct 10 Acta (1990) 1029, 91–97). covalent joining of two reactive chemical groups without Other potentially useful protein modifications which can introducing additional linking material (e.g. as in amide be made to vectors include partial or complete deglycosi bond formation induced using carbodiimides or dation by neuraminidase, endoglycosydases or periodate, enzymatically) may, if desired, be used, as may agents such since deglycosidation often results in less uptake by liver, as biotin/avidin systems which induce non-covalent reporter-vector linking and agents which induce hydropho 15 spleen, macrophages etc., whereas neo-glycosylation of bic or electrostatic interactions. proteins often results in increased uptake by the liver and Most commonly, however, the linking agent will com macrophages); preparation of truncated forms by proteolytic prise two or more reactive moieties, e.g. as described above, cleavage, leading to reduced size and shorter half life in connected by a spacer element. The presence of such a circulation; and cationisation, e.g. as described by Kumagi spacer permits bifunctional linkers to react with specific 20 et al. in J. Biol. Chem. (1987) 262, 15214–15219; Triguero functional groups within a molecule or between two differ et al. in Proc. Natl. Acad. Sci. USA (1989) 86,4761–4765; ent molecules, resulting in a bond between these two com Pardridge et al. in J. Pharmacol. Exp. Therap. (1989) 251, ponents and introducing extrinsic linker-derived material 821–826 and Pardridge and Boado, Febs Lett. (1991) 288, into the reporter-vector conjugate. The reactive moieties in 30–32. a linking agent may be the same (homobifunctional agents) 25 Increased coupling efficiency to areas of interest may also or different (heterobifunctional agents or, where several be achieved using antibodies bound to the terminii of PEG dissimilar reactive moieties are present, heteromultifunc spacers (see e.g. Maruyama, K. et al. in Biochim. Biophys. tional agents), providing a diversity of potential reagents Acta (1995) 1234, 74–80 and Hansen, C. B. et al. in that may bring about covalent bonding between any chemi Biochim. Biophys. Acta (1995) 1239, 133–144). cal species, either intramolecularly or intermolecularly. 30 In some instances it is considered advantageous to include The nature of extrinsic material introduced by the linking a PEG component as a stabiliser in conjunction with a vector agent may have a critical bearing on the targeting ability and general stability of the ultimate product. Thus it may be or vectors or directly to the reporter in the same molecule desirable to introduce labile linkages, e.g. containing spacer where the PEG does not serve as a spacer. arms which are biodegradable or chemically sensitive or Other representative spacer elements include structural which incorporate enzymatic cleavage sites. Alternatively 35 type polysaccharides such as polygalacturonic acid, the spacer may include polymeric components, e.g. to act as glycosaminoglycans, heparinoids, cellulose and marine surfactants and enhance bubble stability. The spacer may polysaccharides such as alginates, chitosans and carrageen also contain reactive moieties, e.g. as described above to ans; storage-type polysaccharides such as starch, glycogen, enhance surface crosslinking, or it may contain a tracer dextran and aminodextrans; polyamino acids and methyl and element such as a fluorescent probe, spin label or radioactive 40 ethyl esters thereof, as in homo- and co-polymers of lysine, material. glutamic acid and aspartic acid; and polypeptides, oligo Spacer elements may typically consist of aliphatic chains nucleotides and oligosaccharides, which may or may not which effectively separate the reactive moieties of the linker contain enzyme cleavage sites. by distances of between 5 and 30 Å. They may also comprise In general, spacer elements may contain cleavable groups macromolecular structures such as polytethylene glycols). 45 such as vicinal glycol, azo, sulfone, ester, thioester or Such polymeric structures, hereinafter referred to as PEGs, disulphide groups. Spacers containing biodegradable meth are simple, neutral polyethers which have been given much ylene diester or diamide groups of formula attention in biotechnical and biomedical applications (see e.g. Milton Harris, J. (ed) “Poly(ethylene glycol) chemistry, biotechnical and biomedical applications” Plenum Press, 50 [where X and Z are selected from —O—, –S-, and New York, 1992). PEGs are soluble in most solvents, —NR— (where R is hydrogen or an organic group); each Y including water, and are highly hydrated in aqueous is a carbonyl, thiocarbonyl, sulphonyl, phosphoryl or similar environments, with two or three water molecules bound to acid-forming group: m and n are each zero or 1; and R' and each ethylene glycol segment; this has the effect of prevent R* are each hydrogen, an organic group or a group –X.Y. ing adsorption either of other polymers or of proteins onto 55 (Z), L, or together form a divalent organic group] may also PEG-modified surfaces. PEGs are known to be nontoxic and be useful; as discussed in, for example, WO-A-9217436 not to harm active proteins or cells, whilst covalently linked such groups are readily biodegraded in the presence of PEGs are known to be non-immunogenic and non-antigenic. esterases, e.g. in vivo, but are stable in the absence of such Furthermore, PEGs may readily be modified and bound to enzymes. They may therefore advantageously be linked to other molecules with only little effect on their chemistry. 60 therapeutic agents to permit slow release thereof. Their advantageous solubility and biological properties are Poly[N-(2-hydroxyethyl)methacrylamides] are poten apparent from the many possible uses of PEGs and copoly tially useful spacer materials by virtue of their low degree of mers thereof, including block copolymers such as PEG interaction with cells and tissues (see e.g. Vol?ová, I., Rihov polyurethanes and PEG-polypropylenes. ã, B. and V. R. and Vetvicka, P in J. Bioact. Comp. Polymers Appropriate molecular weights for PEG spacers used in 65 (1992) 7, 175–190). Work on a similar polymer consisting accordance with the invention may, for example, be between mainly of the closely related 2-hydroxypropyl derivative 120 Daltons and 20 kDaltons. showed that it was endocytosed by the mononuclear phago US 6,680,047 B2 15 16 cyte system only to a rather low extent (see Goddard, P., linkages (see e.g. Song, C. X., Cui, X. M. and Williamson, I., Bron, J., Hutchkinson, L. E., Nicholls, J. and Schindler, A. in Med. Biol. Eng. Comput. (1993) 31, Petrak, K. in J. Bioct. Compat. Polym. (1991) 6, 4–24). S147–150), and which may include glycolide units to Other potentially useful poymeric spacer materials improve their absorbability (see Bezwada, R. S., include: Shalaby, S. W. and Newman, H. D. J. in Agricultural i) copolymers of methyl methacrylate with methacrylic and synthetic polymers: Biodegradability and utiliza acid; these may be erodible (see Lee, P. I. in Pharm. tion (1990) (ed Glass, J. E. and Swift, G.), 167–174— Res. (1993) 10, 980) and the carboxylate substituents ACS symposium Series, #433, Washington D.C., may cause a higher degree of swelling than with neutral U.S.A.—American Chemical Society); polymers; 10 ii) block copolymers of polymethacrylates with biode xii) polyanhydrides such as copolymers of sebacic acid gradable polyesters (see e.g. San Roman, J. and (octanedioic acid) with bis(4-carboxy-phenoxy) Guillen-Garcia, P. in Biomaterials (1991) 12, propane, which have been shown in rabbit studies (see 236–241); Brem, H., Kader, A., Epstein, J. I., Tamargo, R. J., iii) cyanoacrylates, i.e. polymers of esters of 15 Domb, A., Langer, R. and Leong, K. W. in Sel. Cancer 2-cyanoacrylic acid—these are biodegradable and have Ther. (1989) 5, 55–65) and rat studies (see Tamargo, R. been used in the form of nanoparticles for selective J., Epstein, J. I., Reinhard, C. S., Chasin, M. and Brem, drug delivery (see Forestier, F., Gerrier, P., Chaumard, H. in J. Biomed. Mater Res. (1989) 23, 253–266) to be C., Quero, A. M., Couvreur, P. and Labarre, C. in J. useful for controlled release of drugs in the brain Antimicrob. Chemoter (1992) 30, 173–179); 20 without evident toxic effects; iv) polyvinyl alcohols, which are water-soluble and gen xiii) biodegradable polymers containing ortho-ester erally regarded as biocompatible (see e.g. Langer, R. in groups, which have been employed for controlled J. Control. Release (1991) 16, 53–60); release in vivo (see Maa, Y. F. and Heller, J. in J. v) copolymers of vinyl methyl ether with maleic Control. Release (1990) 14, 21–28); and anhydride, which have been stated to be bioerodible 25 xiv) polyphosphazenes, which are inorganic polymers (see Finne, U., Hannus, M. and Urtti, A. in Int. J. consisting of alternate phosphorus and nitrogen atoms Pharm. (1992) 78. 237–241), (see Crommen, J. H., Vandorpe, J. and Schacht, E. H. vi) polyvinylpyrrolidones, e.g. with molecular weight less in J. Control. Release (1993) 24, 167–180). than about 25,000, which are rapidly filtered by the The following tables list linking agents and agents for kidneys (see Hespe, W., Meier, A. M. and Blankwater, 30 protein modification which may be useful in preparing Y. M. in Arzeim.-Forsch./Drug Res. (1977) 27, targetable contrast agents in accordance with the invention. 1158–1162); vii) polymers and copolymers of short-chain aliphatic hydroxyacids such as glycolic, lactic, butyric, valeric and caproic acids (see e.g. Carli, F. in Chim. Ind. 35 Heterobifunctional linking agents (Milan) (1993) 75, 494–9), including copolymers Linking agent Reactivity 1 Reactivity 2 Comments which incorporate aromatic hydroxyacids in order to ABH carbohydrate photoreactive increase their degradation rate (see Imasaki, K., ANB-NOS —NH, photoreactive Yoshida, M., Fukuzaki, H., Asano, M., Kumakura, M., APDP (1) —SH photoreactive iodinable 40 disulphide Mashimo, T., Yamanaka, H. and Nagai. T. in Int. J. linker Pharm. (1992) 81, 31–38); APG —NH, photoreactive reactS viii) polyesters consisting of alternating units of ethylene selectively glycol and terephthalic acid, e.g. Dacron", which are with Arg at pH 7–8 non-degradable but highly biocompatible; 45 ASIB (1) —SH photoreactive iodinable ix) block copolymers comprising biodegradable segments ASBA (1) —COOH photoreactive iodinable of aliphatic hydroxyacid polymers (see e.g. Younes, H., EDC —NH, —COOH zero-length Nataf, P. R., Cohn, D., Appelbaum, Y. J., Pizov, G. and linker GMBS —NH, —SH Uretzky, G. in Biomater. Artif. Cells Artif. Organs Sulfo-GMBS —NH, —SH water-soluble (1988) 16, 705–719), for instance in conjunction with 50 HSAB —NH, photoreactive polyurethanes (see Kobayashi, H., Hyon, S. H. and Sulfo-HSAB —NH, photoreactive water-soluble Ikada, Y. in “Water-curable and biodegradable Sulfo-MBS —NH, —SH water-soluble prepolymers”—J. Biomed. Mater. Res. (1991) 25, M.C.,H carbohydrate —SH 1481–1494); MPBPI carbohydrate —SH x) polyurethanes, which are known to be well-tolerated in 55 NHS-ASA (1) —NH, photoreactive iodinable Sulfo-NHS- —NH, photoreactive water-soluble, implants, and which may be combined with flexible ASA (1) iodinable “soft” segments, e.g. comprising poly(tetra methylene sulfo-NHS-LC- —NH, photoreactive water-soluble, glycol), poly(propylene glycol) or poly(ethylene ASA (1) iodinable glycol)) and aromatic “hard” segments, e.g. comprising PDPH carbohydrate —SH disulphide linker 4,4'-methylenebis(phenylene isocyanate) (see e.g. 60 PNP-DTP —NH, photoreactive Ratner, B. D., Johnston, A. B. and Lenk, T. J. in J. SADP —NH, photoreactive disulphide Biomed. Mater. Res: Applied Biomaterials (1987) 21, linker Sulfo-SADP —NH, photoreactive water-soluble 59–90; Sa Da Costa, V. et al. in J. Coll. Interface Sci. disulphide (1981) 80,445–452 and Affrossman, S. et al. in Clini linker cal Materials (1991) 8, 25–31); 65 SAED —NH, photoreactive disulphide xi) poly(1,4-dioxan-2-ones), which may be regarded as linker biodegradable esters in view of their hydrolysable ester

US 6,680,047 B2 19 20 9507072, these products lack vectors having affinity for Representative and non-limiting examples of drugs useful particular sites and thereby show comparitively poor specific in accordance with the invention include antineoplastic retention at desired sites prior to or during drug release. agents such as vincristine, vinblastine, vindesine, busulfan, Therapeutic compounds used in accordance with the chlorambucil, spiroplatin, cisplatin, carboplatin, present invention may be encapsulated in the interior of the methotrexate, adriamycin, mitomycin, bleomycin, cytosine microbubbles or attached to or incorporated in the encap arabinoside, arabinosyl adenine, mercaptopurine, mitotane, sulating walls. Thus, the therapeutic compound may be procarbazine, dactinomycin (antinomycin D), daunorubicin, linked to a part of the wall, for example through covalent or doxorubicin hydrochloride, taxol, plicamycin, ionic bonds, or may be physically mixed into the encapsu aminoglutethimide, estramustine, flutamide, leuprolide, lating material, particularly if the drug has similar polarity or 10 megestrol acetate, tamoxifen, testolactone, trilostane, amsa solubility to the membrane material, so as to prevent it from crine (m-AMSA), asparaginase (L-asparaginase), etoposide, leaking out of the product before it is intended to act in the interferon a-2a and 2b, blood products such as hematopor body. The release of the drug may be initiated merely by phyrins or derivatives of the foregoing; biological response wetting contact with blood following administration or as a modifiers such as muramylpeptides; antifungal agents such consequence of other internal or external influences, e.g. 15 as ketoconazole, nystatin, griseofulvin, flucytosine, micona dissolution processes catalyzed by enzymes or the use of of zole or amphotericin B; hormones or hormone analogues ultrasound. The destruction of gas-containing microparticles such as growth hormone, melanocyte stimulating hormone, using external ultrasound is a well known phenomenon in estradiol, beclomethasone dipropionate, betamethasone, respect of ultrasound contrast agents, e.g. as described in cortisone acetate, dexamethasone, flunisolide, WO-A-9325241; the rate of release may be varied depend 20 hydrocortisone, methylprednisolone, paramethasone ing on the type of therapeutic application, using a specific acetate, prednisolone, prednisone, triamcinolone or fludro amount of ultrasound energy from the transducer. cortisone acetate; vitamins such as cyanocobalamin or ret The therapeutic agent may be covalently linked to the inoids; enzymes such as alkaline phosphatase or manganese encapsulating membrane surface using a suitable linking superoxide dismutase; antiallergic agents such as amelex agent, e.g. as described herein. Thus, for example, one may 25 anox; inhibitors of tissue factor such as monoclonal anti initially prepare a phospholipid or lipopeptide derivative to bodies and Fab fragments thereof, synthetic peptides, non which the drug is bonded through a biodegradable or selec peptides and compounds downregulating tissue factor tively cleavable linker followed by incorporation of the expression; inhibitors of platelets such as, GPIa, GPIb and material into the microbubble. Alternatively lipidated drug GPIIb-IIIa, ADP receptors, thrombin receptors, von Will molecules which do not require processing to liberate an 30 ebrand factor, prostaglandins, aspirin, ticlopidin, clopigogrel active drug are incorporated directly into the membrane. The and reopro; inhibitors of coagulation protein targets such as: active lipidated-drug can be released by increasing the FIIa FVa, FVIIa, FVIIIA, FIXa, tissue factor, hepatins, strength of the ultrasound beam. hirudin, hirulog, argatroban, DEGR-rPVIIa and annexin V, Exemplary drug delivery systems suitable for use in the inhibitors of fibrin formation and promoters of fibrionolysis present compositions include any known therapeutic drugs 35 such as t-PA, urokinase, Plamin, Streptokinase, or active analogues thereof containing thiol groups which rt-Plasminogen Activator and rstaphylokinase; antiangio are coupled to thiol containing microbubbles under oxida genic factors such as medroxyprogesteron, pentosan tive conditions yielding disulphide bridges. In combination polysulphate, Suramin, taxol, thalidomide, angiostatin, with a vector or vectors the drug/vector modified interferon-alpha, metalloproteinase inhibitors, platelet factor microbubbles are allowed to accumulate in the target tissue. 40 4, somatostatin, thromobospondin; circulatory drugs such as Administration of a reducing agent such as reduced glu propranolol; metabolic potentiators such as glutathione; tathione then liberates the drug molecule from the targeted antituberculars such as p-aminosalicylic acid, isoniazid, microbubble in the vicinity of the target cell increasing the capreomycin sulfate, cyclosexine, ethambutol, ethionamide, local concentration of the drug and enhancing therapeutic pyrazinamide, rifampin or streptomycin sulphate; antivirals effect. The product may also be prepared without the thera 45 such as acyclovir, amantadine, azidothymidine, ribavirin or peutic if desired. The drug may then be coupled to or coated vidarabine; blood vessel dilating agents such as diltiazem, on the microbubbles prior to use. Thus, for example, a nifedipine, verapamil, erythritol tetranitrate, isosorbide therapeutic could be added to a suspension of microbubbles dinitrate, nitroglycerin or pentaerythritol tetranitrate; antibi in aqueous media and shaken in order to attach or adhere the otics such as dapsone, chloramphenicol, neomycin, cefaclor, therapeutic to the microbubbles. 50 cefadroxil, cephalexin, cephradine, erythromycin, Other drug delivery systems include vector modified clindamycin, lincomycin, amoxicillin, ampicillin, phospholipid membranes doped with lipopeptide structures bacampicillin, carbenicillin, dicloxacillin, cyclacillin, comprising a poly-L-lysine or poly-D-lysine chain in com picloxacillin, hetacillin, methicillin, nafcillin, penicillin, bination with a targeting vector. Applied to gene therapy/ polymyxin or tetracycline; antiinflammatories such as antisense technologies with particular emphasis on receptor 55 diflunisal, ibuprofen, indomethacin, meclefenamate, mefe mediated drug delivery the microbubble carrier is condensed namic acid, naproxen, phenylbutazone, piroxicam, tolmetin, with DNA or RNA via elecrostatic interaction with the aspirin or salicylates; antiprotozoans such as chloroquine, polycation. This method has the advantage that the vector or metronidazole, quinine or meglumine antimonate; antirheu vectors used for targeted delivery are not directly attached to matics such as penicillamine; narcotics such as paregoric; the polysine carrier moiety. The polylysine chain is also 60 opiates such as codeine, morphine or opium; cardiac glyco anchored more tightly in the microbubble membrane due to sides such as deslaneside, digitoxin, digoxin, digitalin or the presence of the lipid chains. The use of ultrasound to digitalis; neuromuscular blockers such as atracurium increase the effectiveness of delivery is also considered mesylate, gallamine triethiodide, hexafluorenium bromide, useful. metocurine iodide, pancuronium bromide, succinylcholine Alternatively free polylysine chains are firstly modified 65 chloride, tubocurarine chloride or vecuronium bromide; with drug or vector molecules then condensed onto the sedatives such as amobarbital, amobarbital sodium, negative surface of targeted microbubbles. apropbarbital, butabarbital sodium, chloral hydrate,

US 6,680,047 B2 23 24 properties such as very high specificity, high affinity (if viii) Various small molecules, including bioactive com desired), the possiblity of modifying affinity according pounds known to bind to biological receptors of various to need etc. Whether or not antibodies will be bioactive kinds. Such vectors or their targets may be used for will depend on the specific vector/target combination. generate non-bioactive compounds binding to the same targets. Both conventional and genetically engineered antibod ix) Proteins or peptides which bind to glucosamino ies may be employed, the latter permitting engineering glycan side chains e.g. haparan Sulphate, including of antibodies to particular needs, e.g. as regards affinity glucosoaminoglycan-binding portions of larger and specificity. The use of human antibodies may be molecules, since binding to such glucosoaminoglycans preferred to avoid possible immune reactions against side chains does not result in a biological response. the vector molecule. A further useful class of antibodies 10 Proteoglycans are not found on red blood cells, thus comprises so-called bispecific antibodies, i.e. antibod eliminating undesirable adsorption to these cells. ies having specificity for two different target molecules Other peptide vectors and lipopeptides thereof of particu in one antibody molecule. Such antibodies may, for lar interest for targeted ultrasound imaging are listed below: Atherosclerotic plaque binding peptides such as example, be useful in promoting formation of bubble 15 clusters and may also be used for various therapeutic YRALVD TLK, YAKFRETLEDTR DRMY and purposes, e.g. for carrying toxic moieties to the target. RALVDTEFKVKQEAGAK; Thrombus binding peptides such as NDGDFEEIPEEYLQ and GPRG; Platelet binding Various aspects of bispecific antibodies are described peptides such as PLYKKIIKKLLES; and cholecystokinin, by McGuinness, B. T. et al. in Nat. Biotechnol. (1996) O-melanocyte-stimulating hormone, heat stable enterotoxin 14, 1149–1154; by George, A. J. et al. in J. Immunol. 20 1, vasoactive intestinal peptide, synthetic alpha-M2 peptide (1994) 152, 1802–1811; by Bonardi et al. in Cancer from the third heavy chain complementarity-determining Res. (1993) 53, 3015–3021; and by French, R. R. et al. region and analogues thereof for tumor targeting. in Cancer Res. (1991) 51,2353–2361. The following tables identify various receptors which ii) Cell adhesion molecules, their receptors, cytokines, may be targeted by particular types of vectors and conse growth factors, peptide hormones and pieces thereof. 25 Such vectors rely on normal biological protein– quent areas of use for targetable ultrasound contrast agents protein interactions with target molecule receptors, and according to the invention which contain such vectors. so in many cases will generate a biological response on binding with the targets and thus be bioactive; this may be a relatively insignificant concern with vectors which 30 Protein and peptide vectors - antibodies target proteoglycans. iii) Non-peptide agonists/antagonists or non-bioactive Vector type Receptor Comments/areas of use Ref binders of receptors for cell adhesion molecules, antibodies CD34 vascular diseases in general, cytokines, growth factors and peptide hormones. This (general) normal vessel wall (e.g 35 myocardium), activated category may include non-bioactive vectors which will endothelium, immune cells be neither agonists nor antagonist but which may antibodies ICAM-1 vascular diseases in general, nonetheless exhibit valuable targeting ability. (general) normal vessel wall (e.g myocardium), activated iv) Oligonucleotides and modified oligonucleotides which endothelium, immune cells bind DNA or RNA through Watson-Crick or other types antibodies ICAM-2 vascular diseases in general, of base-pairing. DNA is usually only present in extra 40 (general) normal vessel wall (e.g cellular space as a consequence of cell damage, so that myocardium), activated endothelium, immune cells such oligonucleotides, which will usually be non antibodies ICAM-3 vascular diseases in general, bioactive, may be useful in, for example, targeting of (general) normal vessel wall (e.g necrotic regions, which are associated with many dif myocardium), activated ferent pathological conditions. Oligonucleotides may 45 endothelium, immune cells antibodies E-selectin vascular diseases in general, also be designed to bind to specific DNA- or RNA (general) normal vessel wall (e.g binding proteins, for example transcription factors myocardium), activated which are very often highly overexpressed or activated endothelium, immune cells in tumour cells or in activated immune or endothelial antibodies P-selectin vascular diseases in general, 50 (general) normal vessel wall (e.g cells. Combinatorial libraries may be used to select myocardium), activated oligonucleotides which bind specifically to possible endothelium, immune cells target molecules (from proteins to caffeine) and which antibodies PECAM vascular diseases in general, therefore may be employed as vectors for targeting. (general) normal vessel wall (e.g myocardium), activated v) DNA-binding drugs may behave similarly to 55 endothelium, immune cells oligonuclotides, but may exhibit biological activity antibodies Integrins, vascular diseases in general, (general) e.g. VLA-1, normal vessel wall (e.g and/or toxic effects if taken up by cells. VLA-2, VLA- myocardium), activated vi) Various small molecules, including bioactive com 3, VLA-4, endothelium, immune cells pounds known to bind to biological receptors of various VLA-5, VLA kinds. Such vectors or their targets may be used to 60 6, [107, B10s, B.Cºv, generate non-bioactive compounds binding to the same LFA-1, targets. Mac-1, CD41a, vii) Vector molecules may be selected from combinatorial etc. libraries without necessarily knowing the exact antibodies GlyCAM Vessel wall in lymph nodes molecular target, by functionally selecting (in vitro, ex 65 (general) (quite specific for lymph vivo or in vivo) for molecules binding to the region/ nodes) structure to be imaged. US 6,680,047 B2 25 26

-continued -continued Protein and peptide vectors - antibodies Protein and peptide vectors - cell adhesion molecules etc. Vector type Receptor Comments/areas of use Ref 5 Vector type Receptor Comments/areas of use Ref antibodies MadCam 1 Vessel wall in lymph nodes Other selectins carbohydrate vascular diseases in (general) (quite specific for lymph ligands general, normal vessel nodes) (sialyl Lewis x) wall (e.g. myocardium), antibodies fibrin Thrombi heparan sulfate activated endothelium (general) 10 RGD-peptides integrins angiogenisis antibodies Tissue Activated endothelium, PECAM PECAM, Endothelium, (general) Factor tumours and other Cells in immune system antibodies Myosin Necrosis, myocardial Integrins, Laminin, Endothelium, (general) infaction e.g. VLA-1, VLA- collagen, Vessel wall antibodies CEA Tumours 2, VLA-3, VLA-4, fibronectin, etc. (general) (carcinoem 15 VLA-5, VLA-6, VCAM-1, bryonal É107, fºots, ?º Cºv, thrombo antigen) LFA-1, Mac-1, spondin, antibodies Mucins Tumours CD41a, etc. vitronectin (general) etc. antibodies Multiple Tumours Integrin Integrins, Cells in immune system (general) drug 20 receptors, e.g. VLA-1, vessel wall resistance e.g. Laminin, VLA-2, VLA-3, etc. protein collagen, VLA-4, VLA-5, antibodies Prostate Prostate cancer fibronectin, VLA-6, [310.7, (general) specific VCAM-1, B10s, B.Cºv, antigen thrombospondin, LFA-1, Mac-1, antibodies Cathepsin Tumours (proteases of various vitronectin CD41a, etc. (general) B kinds- are often more or less 25 etc. specifically overexpressed in Nerve cell proteoglycans a variety of tumours - adhesion N-CAM Cathepsin B is such a molecule (N- (homophilic) protease) CAM) antibodies Transferrin Tumors, 30 RGD-peptides integrins angiogenesis Ç (general) receptor vessel wall MOAb 9.2.27 Tumours Antigen upregulated on cell growth VAP-1 Adhesion molecule Band 3 Upregulated during phagocytic 35 Vectors comprising cytokines/growth factors/peptide protein activity hormones and fragments thereof CD44 tumor cells £2 general Vector type Receptor Comments/areas of use Ref microglobu lin Epidermal growth EGF-receptor or Tumours MHC class general 40 factor related I receptors - - - Nerve growth NGF-receptor Tumours antibody integrin tumors, angiogenisis Ç factor ov[3 Somatostatin ST-receptor Tumours antibodies CD44 tumour cells 3. Endothelin Endothelin- Vessel wall antibodies £2 general b receptor microglobu 45 Interleukin-1 IL-1-receptor Inflammation, activated lin cells of different kinds antibodies MHC class general b Interleukin-2 IL-2-receptor Inflammation, activated 1 cells of different kinds Chemokines (ca. Chemokine Inflammation a Heider, K. H., M. Sproll, S. Susani, E. Patzelt, P. Beaumier, E. 20 different receptors, Ostermann, H. Ahorn, and G. R. Adolf. 1996. “Characterization of a high- 50 cytokines partly proteoglycans affinity monoclonal antibody specific for CD44v6 as candidate for immu- sharing notherapy of squamous cell carcinomas”. Cancer Immunology Immuno- receptors) therapy 43: 245–253. Tumour necrosis TNF-receptors Inflammation b I. Roitt, J. Brostoff, and D. Male. 1985. Immunology, London: Gower factor Medical Publishing, p. 4.7 Parathyroid PTH-receptors Bone diseases c Stromblad, S., and D. A. Cheresh. 1996. “Integrins, angiogenesis and 55 hormone Kidney diseases vascular cell survival”. Chemistry & Biology 3: 881–885. Bone BMP-receptors Bone Diseases Morphogenetic Protein Calcitonin CT-receptors Bone diseases Colony Corresponding Endothelium Protein and peptide vectors - cell adhesion molecules etc. 60 stimulating specific factors (G-CSF, receptors, Vector type Receptor Comments/areas of use Ref º M-CSF, proteoglycans IL-3 L-selectin CD34 vascular diseases in Insulin like IGF-I receptor Tumours, MadCAM1 general, normal vessel growth factor I other growing tissues Glycam 1 wall (e.g. myocardium), Atrial ANF-receptors Kidney, activated endothelium, 65 Natriuretic vessel wall Lymph nodes Factor US 6,680,047 B2 27 28

-continued Vectors comprising cytokines/growth factors/peptide Vectors comprising non-peptide agonists/antagonists of hormones and fragments thereof cytokines/growth factors/peptide hormones/cell adhesion molecules Vector type Receptor Comments/areas of use Ref Vector type Receptor Comments/areas of use Ref

Vasopressin Vasopressin Kidney, Endothelin Endothelin Vessel wall receptor vessel wall antagonist receptor VEGF VEGF-receptor Endothelium, regions of angiogenesis 10 Desmopressin Vasopressin Kidney Fibroblast FGF-receptors, Endothelium (vasopressin receptor Vessel wall growth factors Proteoglycans Angiogenesis analogue) Schwann cell proteoglycans Demoxytocin Oxytocin Reproductive organs, growth factor specific (oxytocin Receptor Mammary glands, receptors analogue) Brain 15 Angiotensin II Angiotensin II Vessel wall receptor receptors brain antagonists adrenal gland CV-11974, TCV-116 Miscellaneous protein and peptide vectors 20 non-peptide RGD- integrins Cells in immune system analogues vessel wall etc. Vector type Receptor Comments/areas of use Ref Streptavidin Kidney Kidney diseases Bacterial Fibronectin Vessel wall fibronectin binding proteins 25 Fc-part of Fc-receptors Monocytes Vectors comprising anti-angiogenic factors antibodies macrophages liver Vector type Target Comments/areas of use Ref Transferrin transferrin- Tumours receptor vessel walls Angiostatin EC of tumors plasminogen fragment K Streptokinase/ thrombi thrombi 30 cartilage-derived EC of tumors J tissue inhibitor plasminogen [3-Cyclodextrin tumors, C activator tetradecasulfate inflammation Plasminogen, Fibrin Thrombi, fumagillin and analogs tumors, E plasmin tumours inflammation Interferon-Q. EC of tumors K Mast cell proteoglycans 35 proteinases Interferon-y EC of tumors E Elastase proteoglycans interleukin-12 EC of tumors E Lipoprotein proteoglycans linomide tumors, A. lipase inflammation Coagulation proteoglycans medroxyprogesterone EC of tumors K metalloproteinase EC of tumors K enzymes 40 Extracellular proteoglycans inhibitors superoxide pentosan polysulfate EC of tumors K dismutase platelet factor 4 EC of tumors M Heparin cofactor proteoglycans Somatostatin EC of tumors K II Suramin EC of tumors K Retinal survival proteoglycans Taxol EC of tumors K factor specific 45 thalidomide EC of tumors K receptors Thrombospondin EC of tumors K Heparin-binding proteoglycans brain mitogen specific receptors Apolipoprotein, proteoglycans ?.g. specific 50 apolipoprotein B receptors Vectors comprising angiogenic factors (e.g., LDL receptor) Comments/areas of Apolipoprotein E LDL receptor Vector type Target IISè Ref proteoglycans Adhesion- proteoglycans 55 acidic fibroblast growth EC of tumors K promoting factor proteins, adenosine EC of tumors K e.g. Purpurin Angiogenin EC of tumors K Viral coat proteoglycans Angiotensin II EC of tumors K proteins, basement membrane tumors e.g., tenascin, M e.g. HIV, Herpes components collagen IV Microbial “Antigen 85’ fibronectin, collagen, 60 basic fibroblast growth EC of tumors K adhesin complex of fibrinogen, vitronectin, factor mycobacteria heparan sulfate Bradykinin EC of tumors K [3-amyloid proteoglycans fl-amyloid accumulates in Calcitonin gene-related EC of tumors K precursor Alzheimer’s disease peptide Tenascin, heparan sulfate, epidermal growth factor EC of tumors K e.g.tenascin C integrins 65 Fibrin tumors K Fibrinogen tumors K US 6,680,047 B2 29 30

-continued -continued Vectors comprising angiogenic factors Vector molecules other than recognized angiogenetic f 5 factors with known affinity for receptors associated Comments/areas o with angiogenesis Vector type Target IISè Ref H - EC K Vector type Target Comments/areas of use Ref eparin OI illinojºs histamine EC of tumors K placental umors, E hyaluronic acid or EC of tumors K to proliferin-related inflammation ragments thereof protein Interleukin-1C. EC of tumors K plasminogen umors, M aminin, laminin fragments EC of tumors K inflammation nicotinamide EC of tumors K plasminogen activators umors, D platelet activating factor EC of tumors K inflammation Platelet-derived endothelial EC of tumors K 15 plasminogen activator umors, U, V growth factor inhibitors inflammation prostaglandins E1, E2 EC of tumors K platelet activating umors, inhibitors of angiogenesis A. spermine EC of tumors K actor antagonists inflammation spermine EC of tumors K platelet-derived growth Ilim Ojºs E Substance P EC of tumors K § - . ransforming growth EC of tumors K 20 actor - Limilaimination actOr-Cº. pleiotropin umors, ZA ransforming growth EC of tumors K Limilaimination actor-?} proliferin umors, E Tumor necrosis factor-O. EC of tumors K inflammation vascular endothelial growth EC of tumors K proliferin related umors, E actor/vascular permeability 25 protein inflammation actOr selectins umors, e.g., E-selectin D vitronectin A. inflammation SPARC umors, M inflammation snake venoms umors, Q 30 (RGD-containing) inflammation - - - Tissue inhibitor of umors, e g., TIMP-2 U Vector molecules other than recognized angiogenetic metalloproteinases inflammation factors with known affinity for receptors associated hrombi H with angiogenesis thrombin tumors, Limilaimination Vector type Target Comments/areas of use Ref 35 thrombin-receptor tumors, H activating Limilaimination angiopoietin umors, B tetradecapeptide inflammation thymidine umors, D Cº-antiplasmin tumors, phosphorylase inflammation Limilaimination - - - - tumor growth factor umors, ZA combinatorial umors, for instance: compounds 40 :-- ?º - libraries, compounds inflammation that bind to basement Limilaimination from membrane after degradation endoglin umors, D inflammation endosialin umors, D inflammation tº |collagen tumors, M 45 Receptors/targets associated with angiogenesis ragment Limilaimination Factor VII related tumors, D Vector type Target Comments/areas of use Ref antigen Limilaimination fibrinopeptides umors, ZC biglycan umors, dermatan sulfate X inflammation inflammation proteoglycan fibroblast growth umors, E 50 CD34 umors, L factor, basic inflammation inflammation hepatocyte growth umors, I CD44 umors, F factor inflammation inflammation insulin-like growth umors, R collagen type I, IV, umors, A. factor inflammation VI, VIII inflammation interleukins umors, e.g., IL-8 I 55 decorin umors, dermatan sulfate Y inflammation inflammation proteoglycan leukemia inhibitory umors, A. dermatan sulfate umors, X factor inflammation proteoglycans inflammation metalloproteinase umors, e.g., batimastat E endothelin umors, G inhibitors inflammation inflammation Monoclonal antibodies umors, for instance: to 60 endothelin receptors umors, G inflammation angiogenetic factors or inflammation their receptors, or to fibronectin Ilim Ojºs P components of the Flk-1/KDR, Flt-4 umors, VEGF receptor D fibrinolytic system inflammation peptides, for instance umors, B, Q FLT-1 (fms-like umors, VEGF-A receptor O cyclic RGDDFV inflammation tyrosine kinase) inflammation placental growth factor umors, J 65 heparan sulfate umors, P inflammation inflammation US 6,680,047 B2 31 32

-continued Receptors/targets associated with angiogenesis Oligonucleotide vectors

Vector type Target Comments/areas of use Ref Vector type Receptor Comments/areas of use Ref hepatocyte growth tumors, Oligonucleotides DNA made Tumours factor receptor (c-met) inflammation complementary to available by Myocardial infarction insulin-like growth tumors, repeated necrosis All other diseases that factor/mannose-6 inflammation phosphate receptor 10 Sequences, e.g. involves necrosis integrins: Tumors, genes for És and És, inflammation ribosomal RNA, integrin Cºv?ås, Alu-sequences integrin Cºa?t, laminin receptor Oligonucleotides DNA made Tumours integrins Cle, 15 complementary to available by integrins fºl. disease-specific necrosis in a integrin Crºft, mutations (e.g. region of the integrin Cºv?ås, mutated relevant disease integrin Cls subunit of the fibronectin oncogenes). integrin Cºv?ås, receptor Oligonucleotides DNA of infective Viral or bacterial fibrin receptors. 20 complementary to agent infections Intercellular adhesion umors, DNA of infecting molecule-1 and -2 in ammation agent. Jagged gene product umors, in ammation Triple or As in above As in above examples Ly-6 umors, a lymphocyte activation quadruple-helix examples in ammation protein 25 forming matrix umors, oligonucleotides metalloproteinases in ammation Oligonucleotides DNA-binding Tumours MHC class II umors, with recognition protein, e.g. Activated endothelium in ammation sequence for transcription Activated immune Notch gene product umors, DNA-or RNA factors (often cells in ammation 30 binding proteins overexpressed/ Osteopontin tumors activated in PECAM umors, alias CD31 in ammation tumourS Or plasminogen activator umors, activated receptor in ammation endothelium/ platelet-derived growth umors, 35 immune cells factor receptors in ammation Selectins: E-, P umors, in ammation Sialyl Lewis-X umors, blood group antigen in ammation 40 stress proteins: umors, molecular chaperones Modified oligonucleotide vectors glucose regulated, in ammation heat shock families Vector type Receptor Comments/areas of use Ref and others syndecan umors, Phosphorothioate As for As for unmodified oligos in ammation oligos unmodified 45 hrombospondin umors, oligos in ammation 2'-O-methyl As for substituted unmodified TIE receptors umors, tyrosine kinases with Ig in ammation and EGF-Iike domains oligos oligos issue factor circular oligos As for umors, unmodified in ammation 50 oligos issue inhibitor of umors, e.g., TIMP-2 oligos As for metalloproteinases in ammation containing unmodified ransforming growth umors, hairpin oligos actor receptor in ammation Structure to urokinase-type umors, decrease plasminogen activator in ammation 55 degradation receptor oligos with As for Vascular cellular umors, terminal unmodified adhesion molecule in ammation phosphorothioate oligos (VCAM) 2'-fluoro oligos As for Vascular endothelial unmodified umors, oligos growth factor related in ammation 60 protein 2'-amino oligos As for unmodified Vascular endothelial umors, in ammation oligos growth factor-A DNA-binding As for Increased binding affinity receptor drugs conjugated unmodified as compared to pure oligos von Willebrand factor umors, to oligos (for oligos related antigen in ammation 65 examples, see below) US 6,680,047 B2 33 34

-continued -continued Modified oligonucleotide vectors Receptors comprising protease inhibitors Vector type Receptor Comments/areas of use Ref Vector type Receptor Comments/areas of use Ref Peptide Nucleic As for Increased binding affinity Acids (PNAs, unmodified and stability compared to Commercially Angiotensin Endothelial cells oligonucleotides oligos standard oligos. available converting with a peptide inhibitors enzyme backbone) 10 e.g. kaptopril enalapril ricionopril Low specificity Coagulation Vessel wall injury, non-peptidic factors tumours, Nucleoside and nucleotide vectors 15 compounds etc. Vector type Receptor Comments/areas of use Ref Protease nexins proteoglycans (extracellular Adenosine or Adenosine Vessel wall protease analogues receptors Heart inhibitors) ADP, UDP, UTP Various Many tissues, e.g. brain, and others nucleotide spinal cord, kidney, spleen 20 Antithrombin proteoglycans, receptors Coagulation factors

25 Receptors comprising DNA-binding drugs Vector type Receptor Comments/areas of use Ref Vectors from combinatorial libraries acridine DNA made Tumours, Vector type Receptor Comments/areas of use Ref derivatives available by Myocardial infarction and distamycin necrosis all other diseases involving 30 Antibodies with Any of above Any diseased or normal netropsin necrosis or other processes Structure targets - or may structure of interest, e.g. actinomycin D liberating DNA from cells determined be unknown when thrombi, tumours or echinomycin during make functional walls of myocardial vessels bleomycin etc. generation selection of process vector binding 35 to chosen diseased Structure Peptides with Any of above Any diseased or normal Receptors comprising protease substrates sequence targets - or may structure of interest, e.g. determined be unknown when thrombi, tumours or Vector type Receptor Comments/areas of use Ref during make functional walls of myocardial vessels 40 generation selection of Peptidic or non- Cathepsin B Tumours, a variety of which process vector binding peptidic may more or less specifically to chosen substrates overexpress proteases of diseased various kinds, e.g. Structure Cathepsin B Oligonucleotides Any of above Any diseased or normal 45 with sequence targets - or may structure of interest, e.g. determined be unknown when thrombi, tumours or during make functional walls of myocardial vessels generation selection of process vector binding Receptors comprising protease inhibitors to chosen 50 diseased Vector type Receptor Comments/areas of use Ref Structure Modifications of Any of above Any diseased or normal Peptidic or non- Cathepsin B Tumours, a variety oligos obtained targets - or may structure of interest, e.g. peptidic of which may more or as above be unknown when thrombi, tumours or inhibitors less specifically make functional walls of myocardial vessels e.g. N-acetyl- overexpress proteases 55 selection of Leu-Leu- of various kinds, vector binding morleucinal e.g. Cathepsin B to chosen bestatin Aminopeptidases Tumours, diseased ([(2S,3R)-3 e.g. on cell surfaces Structure Amino-2-hydroxy Other chemicals Any of above Any diseased or normal 4-phenyl with structure targets - or may structure of interest, e.g. butanoyl]-L 60 determined be unknown when thrombi, tumours or eucine during make functional walls of myocardial vessels hydrochloride) generation selection of Pefabloc (4-(2 Serine proteases Tumours, process vector binding aminoethyl) vessel wall to chosen benzenesulfonyl etc. diseased fluoride 65 Structure hydrochloride) US 6,680,047 B2 35 36

-continued Carbohydrate vectors Small molecule vectors Vector type Receptor Comments/areas of use Ref Vector type Receptor Comments/areas of use Ref in eC) macrophages Biotin biotin transport general activation/ protein on cell inflammation glycoproteins surface oligosaccharides Asialo liver Folate olate transport Tumours with terminal glycoprotein 10 protein on cell galactose receptor surface Hyaluronan aggrecan (a Riboflavin riboflavin proteoglycan) ransport “link proteins” protein on cell cell-surface surface 15 Methotrexate olate transport receptors: CD44 protein on cell Mannose Blood brain barrier, surface Brain tumours and other chlorambucil general diseases causing changes in ransport BBB mechanisms Bacterial Blood brain barrier, 20 glycopeptides Brain tumours and other References to the preceding tables diseases causing changes in A Auerbach, W., and R. Auerbach. 1994. “Angiogenesis inhibition: a review”. Pharmac. Ther. 63: 265–311. BBB B Barinaga, M. 1997. “Designing Therapies That Target Tumor Blood Vessels”. Science 275 (Jan. 24): 482–484. C Folkman, J., P. B. Weisz, M. M. Joullié, W. W. Li, 25 and W. R. Ewing. 1989. “Control of Angiogenesis With Synthetic Heparin Substitutes”. Science 243: 1490–1493. D Fox, S. B., and A. L. Harris. 1997. “Markers of Lipid vectors tumor angiogenesis: Clinical applications in prognosis and anti-angiogenic therapy”. Investigational New Drugs Vector type Receptor Comments/areas of use Ref 15 (1): 15–28. 30 E Gastl, G., T. Hermann, M. Steurer, J. Zmija, E. LDL-like lipids LDL-receptor Atherosclerosis Gunsilius, C. Unger, and A. Kraft. May 1997. “Angiogenesis as a target for tumor treatment”. Oncology 54 (3): 177–184. F Griffioen, A. W., M. J. H. Coenen, C. A. Damen, S. M. M. Hellwig, D. H. J. Vanweering, W. Vooys, G. H. 35 Blijham, and G. Groenewegen. 1 Aug. 1997. “CD44 is Small molecule vectors involved in tumor angiogenesis; an activation antigen on human endothelial cells”. Blood 90 (3) : 1150–1159. Vector type Receptor Comments/areas of use Ref G Hlatky, L., P. Hahnfeldt, and C. N. Coleman. 1996. “Vacular endothelial growth factor: environmental Adrenalin Corresponding controls and effects in angiogenesis”. Brit. J. Cancer receptors 74 (Suppl. XXVII). S151—S156. Betablockers Adrenergic beta Myocardium for beta-1 40 H Maragoudakis, M. E., E. Pipili-Synethos, E. receptors blockers Sakkoula, D. Panagiotopoulos, N. Craniti, and J. M. Alpha-blockers Adrenergic Vessel wall Matsoukas. 1996. “Inhibition of TRAP-induced alpha-receptors angiogenesis by the tripeptide Phe-Pro-Arg, a benzodiazepines thrombin-receptor-derived peptide analogue”. Letters in serotonin Serotonin Peptide Science 3: 227—232. analogues receptors 45 I Nguyen, M. 1997. “Angiogenic factors as tumor anti-histamines Histamine Vessel wall markers”. Investigational New Drugs 15 (1): 29–37. receptors J Ono, M., H. Izumi, S. Yoshida, D. Gtot, S. Jimi, N. Acetyl-choline ACh-receptors Kawahara, T. Shono, S. Ushiro, M. Ryuto, K. Kohno, Y. receptor Sato, and M. Kuwano. 1996. “Angiogenesis as a new target antagonists for cancer treatment”. Cancer Chemoter. Pharmacol. 38 verapamil Caº-channel Heart muscle 50 (Suppl.) S78–S82. blocker K Passe, T. J., D. A. Bluemke, and S. S. Siegelman. nifedipin Caº-channel Heart muscle June 1997. “Tumor angiogenesis: Tutorial on implications blocker for imaging”. Radiology 203 (3) : 593–600. Amiloride Na"/H"-exchanger Blocks this exchanges in L Saclarides, T. J. February 1997. “Angiogenesis in kidney and is generally colorectal cancer”. Surgical Clinics of North America 77 upregulated in cells 55 (1): 253. stimulated by growth M Sage, E. H. May 1997. “Pieces of eight: Bioactive factors. fragments of extracellular proteins as regulators of Digitalis myocardium angiogenesis”. Trends in Cell Biology 7 (5) : 182—186. glycosides peripheral vasculature, N Sagi-Assif, O., A. Traister, B. Z. Katz, R. Anavi, central nervous system M. Eskenazy, and I. P. Witz. 1996. “TNFo and anti-Fas Thromboxae/ Thromboxane? Vessel wall, antibodies regulate Ly-6E.1 expression by tumor cells: A Prostaglandin prostaglandin Endothelium 60 possible link between angiogenesis and Ly-6E.1”. receptor receptors Immunology Letters 54: 207–213. antagonists or O Strawn, L. M., G. McMahon, H. App, R. Schreck, W. agonists R. Kuchler, M. P. Longhi, T. H. Hui, C. Tang, A. Glutathione Glutathione Lung, Levitzki, A. Gazit, I. Chen, G. Keri, L. Orfi, W. Risau, receptors Brain I. Flamme, A. Ullirch, K. P. Hirth, and L. K. Shawyer. Leukotriene 65 1996. “Flk-1 as a Target for Tumor Growth Inhibition”. receptors Cancer Res. 56: 3340–3545. US 6,680,047 B2 37 38 acetaminosalol, acetanilide, acetarsone, acetazolamide, -continued acetergamine, acetiamine, acetiromate, acetohexamide, acetohydroxamic acid, acetomeroctol, acetophenazine, Small molecule vectors acetorphine, acetosulfone, acet: Ozate, acetryptine, acetyl choline chloride, acetylcolchino1, acetylcysteine, Vector type Receptor Comments/areas of use Ref acetyldigitoxin, acetylleucine, acetylsalicyclic acid, P Stromblad, S., and D. A. Cheresh. December 1996. “Cell adhesion and angiogenesis”. Trends in Cell Biology acevaltrate, acexamic acid, acifran, acipimox, acitemate, 6 (12): 462–468. acitretin, acivicin, aclantate, aclarubicin, aclatonium Q Stromblad, S., and D. A. Cheresh. November 1996. napadisilate, acodazole, aconiazide, aconitine, acoxatrine, “Integrins, angiogenesis and vascular cell survival”. 10 acridorex, acrihellin, acrisorcin, acrivastine, acrocinide, Chemistry & Biology 3 (11): 881–885. acronine, actinoquinol, actodigin, acyclovir, adafenoxate, R Volpert, O., D. Jackson, N. Bouck, and D. I. H. Linzer. September 1996. “The insulin-like growth factor adamexine, ademetionine, adenosine phosphate, adibendan, II/mannose 6-phosphate receptor is required for adicillin, adimolol, adinazolam, adiphenine, aditeren, proliferin-induced angiogenesis”. Endocrinology 137 (9): aditoprim, adrafinil, adrenalone, afloqualone, afurolol, 3871—3876. 15 aganodine, ajmaline, aklomide, alacepril, alafosfalin, ala S Yoshida, O. M., T. Shono, H. Izumi, T. Ishibashi, H. Suzuki, and M. Kuwano. 1997. “Involvement of nine mustard, alanosine, alaproclate, alazanine triclofenate, Interleukin-8, Vascular Endothelial Growth Factor, and albendazole, albendazole oxide, albuterol, albutoin, Basic Fibroblast Growth Factor in Tumor Necrosis Factor alclofenac, alcometasome dipropionate, alcloxa, alcuronium Alpha-Dependent Angiogenesis”. Mol. Cell. Biol. 17: 4015–4023. chloride, aldioxa, aldosterone, alepride, aletamine, T Zimrin, A. B., M. S. Pepper, G. A. McMahon, F. 20 alexidine, alfacalcidol, alfadex, alfadolone, alfaprostol, Nguyen, R. Montesano, and T. Maciag. 1996. “An Antisense alfaxalone, alfentanil, alfuzosin, algestone acetonide, alge Oligonucleotide to the Notch Ligand Jagged Enhances stone acetophenide, alibendol, aliconazole, alifedrine, Fibroblast Growth Factor-induced Angiogenesis in aliflurane, alimadol, alinidine, alipamide, alitame, vitros”. J. Biol. Chem. 271 (Dec. 20): 32499–3502. U Albini, A., R. Soldi, D. Giunciuglio, E. Giraudo, alizapride, allantoin, alletorphine, allobarbital, alloclamide, R. Benelli, R. Primo, D. Noonan, M. Salio, G. Camussi, 25 allocupreide, allomethadione, allopurinol, allylestrenol, W. Rockl, and F. Bussolino. 1996. “The angiogenesis allyl isothicyanate, allylprodine, allylthiourea, almadrate induced by HIV-1 Tat protein is mediated by the sulfate, almasilate, almecillin, almestrone, alminoprofen, Flk-1/KDR receptor on vacular endothelial cells”. Nature Medicine 2 (12 (Dec.)): 1371–1374. almitrine, almoxatone, alonacic, alonimid, aloxistatin, V Ferrara, N. 1996. “The biology of vascular alozafone, alpertine, alphacetylmethadol, alphameprodine, endothelial growth factor”. in Molecular, Cellular and 30 alphamethadol, alphaprodine, alpha-vinylaziridinoethyl Clinical Aspects of Angiogenesis, ed. M. E. acetate, alpidem, alpiropride, alprazolam, alprenolol, Maragoudakis. New York: Plenum Press. X Jackson, R. L., S. J. busch, and A. J. Cardin. alprostadil, alrestatin, altanserin, altapizone, alteconazole, 1991. “Glycosaminoglycans: Molecular Properties, Protein althiazide, altrenogest, altretamine, aluminium acetate, alu Interactions, and Role in Physiological Processes”. minium clofibrate, aluminium subacetate, alverine, amadi Physiological Reviews 71 (2): 481–435. 35 none acetate, amafolone, amanozine, amantadine, amanta Y Kinsella, M. G., C. K. Tsoi, H. T. Jarvelainen, and T. N. Wight. 1997. “Selective expression and processing nium bromide, amantocillin, ambasilide, ambazone, of biglycan during migration of bovine aortic ambenonium chloride, ambenoxan, ambroxol, ambruticin, endothelial cells - The role of endogenous basic ambucaine, ambucetamide, ambuphylline, ambuside, ambu fibroblast growth factor”. Journal of Biological tonium bromide, amcinafal, amcinafide, amcinomide, Chemistry 272: 318–325. Z Folkman, J. 1996. Tumor angiogenesis and tissue 40 amdinocillin, amdinocillin pivoxil, amebucort, amedalin, actor. Nature Medicine 2, 167–8 ametantrone, amezepine, amezinium metilsulfate, amfenac, ZA Relf, M., S. LeJeune, P. A. Scott, S. Fox, K. Smith, amfepentorex, amfetaminil, amflutizole, amfonelic acid, R. Leek, A. Moghaddam, R. Whitehouse, R. Bicknell and amicarbalide, amicibone, amicloral, amicycline, amidantel, A:L. Harris. 1997. #Expression of the angiogenic factors amidapsone, amidephrine, amiflamine, amifloverine, vascular endothelial cell growth factor, acidic and basic fibroblast growth factor, tumor growth factor 45 amifloxacin, amifostine, amikacin, amikhelline, amiloride, beta-1, platelet-derived endothelial cell growth factor, aminacrine, amindocate, amineptine, aminobenzoic acid, placenta growth factor and pleiotrophin in human primary aminocaproic acid, aminoethyl nitrate, aminoglutethimide, breast cancer and its relation to angiogenesis#. Cancer aminohippuric acid, aminometradine, aminopentamide, Res. 57, 963–9. aminophylline, aminopromazine, aminopterin, aminopyrine, ZB Carmeliet, P., L. Moons, M. Dewerchin, N. Mackman, T. Luther, G. Breier, V. Ploplis, M. Müller, A. Nagy, E. 50 aminoquinol, aminoquinuride, aminorex, aminosalicyclic Plow, R. Gerard, T. Edgington, W. Risau, D. Collen. acid, aminothiadiazole, aminothiazole, amiodarone, 997. Ann, N.Y. Acad. Sci. 811, 191–206. amiperone, amiphe azole, amipizone, a miprilose, ZC Van Hinsbergh, P. Koolwijk, R. Haanemaijer. 1997. amiquinsin, amisome tradine, amisulpride, amiterol, “Role of fibrin and plasminogen activators in repair associated angiogenesis: in vitro studies with human amithiozone, amitraz, amitriptyline, amitriptylinoxide, endothelial cells” EXS 79, 391–411. 55 amixe trine, amlexanox, amlodipine, amobarbital, Passe, T. J., D. A. Bluemke and S. S. Siegelman. 1997. a modiaquine, amogastrin, amolanone, a monofide, Radiology 203:593–600. amoproxan, amopyroquin, amorolfine, amocanate, amosulalol, amotriphene, amoxapine, amoxecaine, Representative examples of drugs useful in accordance amoxicillin, amoxydramine camsilate, amperozide, with the invention include: abamectin, abundiazole, 60 amphecloral, amphenidone, amphetamine, amphotalide, acaprazine, acabrose, acebrochol, aceburic acid, acebutolol, amphotericin B, ampicillin, ampiroxicam, amprolium, acecainide, acecarbromal, ace clidine, aceclofenac, ampyrimine, ampyzine, amduinate, amrinone, amsacrine, ace dapsone, ace diasulfone, acedoben, ace fluranol, amygdalin, amylene, amylmetacresol, amyl nitrite, anage acefurtiamine, acefylline clofibrol, acefylline piperazine, stone acetate, anagrelide, anaxirone, anazocine, anazolene, aceglatone, aceglutamide, aceglutamide aluminium, 65 ancarolol, ancitabine, androstanediol, androstanol acemetacin, acenocoumarol, aceperone, acepromazine, propionate, androstenetrione, androstenonol propionate, aceprometazine, acequinoline, acesulfame, acetaminophen, anethole, anguidine, anidoxime, anilamate, anileridine, US 6,680,047 B2 39 40 aniline, anilopam, anipamil, aniracetam, anirolac, anisacril, bibrocathol, bicifadine, biclodil, biclofibrate, biclotymol, anisindione, anisopirol, anisoylbromacrylic acid, bicozamycin, bidimazium iodine, bietamiverine, anitrazafen, anpirtoline, ansoxetine, antafenite, antazoline, bietaserpine, bife melane, bife pramide, bifluranol, antazonite, anthelmycin, anthiolimine, anthralin, bifonazole, binedaline, binfloxacin, binfibrate, bioallethrin, anthramycin, antienite, antimony potassium tartrate, anti bioresmethrin, biotin, bipenamol, biperiden, biphenamine, mony thioglycollate, antipyrine, antrafenine, apalcillin, biriperone, bisacodyl, bisantrene, bis(aziridinyl) butanediol, apazone, apicycline, apomorphine, apovincamine, bisbendazole, bisbentiamine, bisfenazone, bisfentidine, bis apraclonidine, apramycin, aprindine, aprobarbital, aprofene, muth betanaphthol, bismuth-triglycollamate, bismuth aptazapine, aptocaine, arabinosylmercaptopurine, aranotin, subgallate, bismuth subsalicylate, bisorbin, bisoprolol, arbaprostil, arbekacin, arclofenin, arfendazam, arginine, 10 bisorcic, bioxatin acetate, bispyrithione magsulfex, arginine glutamat, arildone, arnolol, aromixil, arotinolol, bithionol, bithionoloxide, bitipazone, bitoterol, bitoscantate, arpinocid, arpromidine, arsanilic acid, arsthinol, artemisinin, bleomycin, bluensomycin, bofumustine, bolandiol articaine, asaley, ascorbic acid, ascorbyl palmitate, dipropionate, bolasterone, bolazine, bolde none asocainol, aspartame, aspartic acid, asperlin, aspoxicillin, undecylenate, bolenol, bolmantalate, bometolol, bopindolol, astemizole, atamestane, atenolol, atipamezole, atiprosin, 15 bornaprine, bornaprolol, bornelone, botiacrine, boxidine, atolide, atracurium besilate, atromepine, atropine, atropine brallobarbital, brazergoline, brefonalol, bremazocine, oxide, auranofin, aurothoiglucose, aurothioglycanide, brequinar, bretylium tosylate, brindoxime, brivundine, avilamycin-A, avridine, axamozide, azabon, azabuperone, brobactam, broclepride, brocresine, brocrinat, brodimoprim, azacitodine, azaclorzine, azaconazole, azacosterol, brofaromine, brofezil, brofoxine, brolaconazole, azacyclonol, azaftozine, azaguanidine, azaloxan, azametho 20 brolamfetamine, bromacrylide, bromadoline, bromamid, nium bromide, azamulin, azanator, azanidazole, azaperone; bromazepam, brom chlore none, brome bric acid, azapicyl, azaprocin, azaquinzole, azaribine, azarole, bromerguride, brometenamine, bromfenac, bromhexine, azaserine, azaspirium chloride, azastene, azastrptonigrin, bromindione, bromisovalum, bromociclen, bromocriptine, azatodine, azathioprine, azauridine, azelastine, azepexole, bromodiphenhydramine, bromofenofos, bromopride, azepindole, azetepa, azidamfenicol, azidocillin, azimexon, 25 bromoxandide, bromperidol, bromperidol decanoate, azintamide, azipramine, azithromycin, azlocillin, azolimine, brompheniramine, bronopol, broparestrol, broperamole, azose mide, azotomycin, aztreonam, azumolene, bropirimine, broquinaldol, brosotamide, broSuximide, bacampicillin, baclofen, bacmecillinam, balsalazide, brotianide, brotizolam, brovanexine, brovincamine, bamaluzole, bambuterol, bamethan, bamifylline, bamipine, broxaldine, broxaterol, broxitalamic acid, broxuridine, bamnidazole, baduiloprim, barbexaclone, barbital, 30 broxyquinoline, bruceantin, brucine, bucainide, bucetin, barucainide, batilol, bazinaprine, becamthone, beclamide, buciclovir, bucillamine, bucindolol, bucladesine, buclizine, beclobrate, beclomethasone dipropionate, beclotiamine, buclosamide, bucloxic acid, bucolome, bucricaine, befiperide, befunolol, befuraline, bekanamycin, belarizine, bucromarone, bucrylate, bucumolol, budesonide, budipine, beloxamide, be marinone, be me gride, be metizide, budotitane, budralazine, bufenadrine, bufeniode, bufetolol, be mitradine, benactyzine, benafentrine, benanserin, 35 bufexamac, bufezolac, buflomedil, bufogenin, buformin, benapryzine, benaxibine, benazepril, bencianol, bencisteine, bufrolin, bufuralol, bumadizone, bumecaine, bumepidil, benclonidine, bencyclane, bendamustine, bendazac, bu metanide, bumetrizole, bunaftine, bunamidine, bendazol, benderizine, bendroflumethiazide, benethamide bunamiodyl, bunaprolast, bunazosin, bunitrolol, bunolol, penicillin, benexate, benflorex, benfosformin, benfotiamine, buparvaquone, bupicomide, bupivacaine, bupranolol, benfurodil hemisuccinate, benhepazone, benidipine, 40 buprenorphine, bupropion, buquineran, buquinolate, benmoxin, benolizime, benorilate, benorterone, benoxafos, buquiterine, buramate, burodiline, buspirone, busulfan, benoxaprofen, benoximate, benperidol, benproperine, butabarbital, butacaine, butacetin, but a clamol, benrixate, bensalan, benserazide, bensuldazic acid, butadiazamide, butafosfan, butalamine, butalbital, bentazepam, bentemazole, bentiamine, bentipimine, butamben, butamirate, butamisole, butamoxane, butanediol bentiromide, benurestat, benzaldehyde, benzalkonium 45 cyclic sulfite, butanilicaine, butanixin, butanserin, chloride, benzaprinoxide, benzarone, benzbromarone, butantrone, butape razine, but aprost, but averine, benzestrol, benzethidine, benzethonium chloride, butedronate, buterizine, bute tamate, butethamine, benzetimide, benzilonium bromide, benzindopyrine, buthiazide, butibufen, butidrine, butikacin, butilfenin, benziodarone, benzmalecene, benznidazole, benzobarbital, butinazocine, butinoline, butirosin, butixirate, butobendine, benzocaine, benzoclidine, benzoctamide, benzodepa, ben 50 butoconazole, butoprolol, butoctamide, butofilolol, zododecinium chloride, benzoic acid, benzoin, benzonatate, butonate, butopamine, butopiprine, butoprozine, butopy benzopyrronium bromide, benzoquinium chloride, rammonium iodide, butorphanol, butoxamine, butoxylate, benzotript, benzoxiduine, benzoxonium chloride, benzoyl butriptyline, butropium bromide, butylated hydroxyanisole, peroxide, benzoylpas, benzphetamine, benzpiperylon, ben butylated hydroxytoluene, butylparaben, butynamine, zpyrinium bromide, benzquercin, benzquinamide, 55 buzepide metiodide, cabastine, cabergoline, cadralazine, benzthiazide, benztropine, benzydamine, benzylpenicillin, cafaminol, cafedrine, caffeine, calcifediol, calcitrol, calcium benzylsulfamide, beperidium iodide, bephenium naphtoate, citrate, calcium dobesilate, calcium glubionate, calcium bepiastine, bepridil, beraprost, berberine sulfate, bermastine, gluceptate, calcium gluconate, calcium glycerophosphate, bermoprofen, berythromycin, besulpamide, beslunide, beta calcium hypophosphite, calcium lactate, calcium caroteine, betacetylmethadol, betahistine, betaine, 60 lactobionate, calcium levulinate, calcium mandelate, cal betameprodine, betamethadol, betamethasone, betametha cium pantothenate, calcium phosphate dibasic, calcium some acetate, betamethasone acibutate, betamethasone phophate tribasic, calcium saccharate, calcium stearate, benzoate, betamethasone dipropionate, betamethasone calusterone, camazepam, cambendazole, camiverine, phosphate, betamethasone valerate, betamicin, betaprodine, camostast, camphotamide, camptothecin, camylofin, betaxolol, betazole, bethanechol chloride, bethanidine, 65 can bisol, cannabino1, canre noic acid, can re none, betiatide, betoxycaine, bevantolol, bevonium metilsulfate, cantharidine, capobenic acid, capreomycin, caproxamine, bezafibrate, bezitramide, bialamicol, bibenzonium bromide, capsaicine, captamine, captodiame, captopril, capuride, US 6,680,047 B2 41 42 caracemide, caramiphen, carazolol, carbachol, carbadox, cilobamine, cilofungin, cilostamide, cilostazol, ciltoprazine, carbaldrate, carbamazepine, carbamide peroxide, carbantel cimaterol, cimenoxin, cimepanol, cimetidine, cimetropium lauryl sulfate, carbaril, carbarsone, carbaspirin calcium, bromide, cimoxatone, cinchonine, cinchophen, cinecromen, carbazeran, carbazochrome, carbazachrome salicylate, car cine paxadil, cinepazet, cinepazic acid, cinepazide, bazachrome sulfonate, carbazocine, carbeniciltin, carbeni cinfenine, cinfenoac, cinflumide, cingestol, cinitapride, cillin indanyl, carbencillin phenyl, carbenoxolone, cinmetacin, cinnamaverine, cinnamedrine, cinnarizine, cin carbenzide, carbestrol, carbetapentane, carbidopa, marizine clofibrate, cinnofuradione, cincotramide, cinodine, carbimazole, carbinoxamine, carbiphene, carbocloral, cinolazepam, cinoquidox, cinoaxin, cinoxate, cinoxolone, carbocysteine, carbofenotion, carbol-fuschin, carbomycin, cinooxopazide, cinperene, cinprazole, cinpropazide, carboplatin, carboprost, carboprost methyl, carboquone, 10 cinromide, cintazone, cintriamide, cinperone, ciprafamide, carbromal, carbubarb, carburazepam, carbutamide, ciprafazone, ciprefadol, ciprocinonide, ciprofibrate, carbuterol, carcainium chloride, carebastine, carfentanil, ciprofloxacin, cipropride, ciproduazone, ciprostene, carfimate, carisoprodol, carmantadine, carmetizide, ciramadol, cirazoline, cisapride, cisconazole, cismadinone, carmofur, carmustine, carnidazole, carnitine, carocainide, cisplatin, cistinexine, citalopram, citatepine, citenamide, caroverine, caroxazone, carpe ridine, cape rone, 15 citemazone, citicoline, citiolone, clamidoxic acid, carphenazine, carpindolol, carpiramine, carprofen, carpro clamoxyquin, clanfenur, clanobutin, clantifen, nium chloride, carsalam, cartazolate, carteolol, carubicin, clarithromycin, clavulanic acid, clazolam, clazolimine, carumonam, carvedilol, carzenide, carzolamide, cathine, clazuril, clebopride, clefamide, clemastine, clemeprol, cathinone, cefaclor, cefadroxil, cefaloniurm, cefaloram, clemizole, clenbuterol, clenpirin, cletoquine, clibucaine, cefamandole, cefamandole naftate, cefaparole, cefatrizine, 20 clidafidine, clidanac, clidinum bromide, climazolam, cefazaflur, cefazedone, cefazolin, cefbuperazone, cefcanel, climbazole, climiqualine, clindamycin, clindamycin cefcanel daloxate, cefedrolor, cefenmpidone, cefepime, palmitate, clindamycin phosphate, clinofibrate, clinolamide, cefetamet, cefetrizole, cefvitril, cefixime, cefnmenoxime, cliquinol, clioxanide, clipoxamine, cliprofen, clobazam, cefnmepidium chloride, cefnmetazole, cefnminox, cefodizime, clobenoside, clobenzepam, clobenzorex, clobenztropine, cefonizid, cefoperazone, ceforamide, cefotaxime, cefotetan, 25 clobetasol propionate, clobetasome butyrate, clobutinol, cefotiam, cefoxazole, cefoxitin, cefpimizole, cefpiramide, clobuzarit, clocanfamide, clocapramine, clociguanil, ce fpirome, cefpodoxime, cefpodoxime proxetil, clocinizine, clocortolone acetate, clocortolone pivalate, cefauinome, cefrotil, cefroxadine, cefsulodin, cefsumide, clocoumarol, clodacaine, clodanolene, clodazon, ceftazidime, cefteram, ceftezole, ceftiofur, ceftiolene, clodoxopone, clodronic acid, clofazimine, clofenamic acid, ceftioxide, ceftizoxime, ceftriaxone, cefuracetime, 30 clofenamide, clofenciclan, clofenetamine, clofenoxyde, cefuroxime, cefuraxime axetil, cefurzonam, celiprolol, clofen vinfos, clofeverine, clofexamide, clofezone, cephacetrile, cephalexin, cephaloglycin, cephaloridine, clofibrate, clofibric acid, clofibride, clofilium phosphate, cephalothin, cephapirin, cephradine, cetaben, cetamolol, cloflucarban, clofoctol, cloforex, clofurac, clogestone cethexonium chloride, cetiedil, cetirizine, cetocycline, acetate, cloguanamil, clomacran, clomegestone acetate, cetohexazine, cetophenicol, cetotiamine, cetoxime, 35 clometacin, clometherone, clomethiazole, clometocillin, cetraxate, chaulmosulfone, chendiol, chiniofon, clomifenoxide, clominorex, clomiphene, clomipramine, chlophedianol, chloracyzine, chloral betaine, chloral clomocycline, clomoxir, clonazepam, clonazoline, hydrate, chloralose, chlorambucil, chloramine, clonidine, clonitazene, clonitrate, clonixeril, clonixin, chloramphenicol, chloramphenicol palmitate, chloram clopamide, clopenthixol, cloperastine, cloperidone, phenicol succinate, chlorazanil, chlorbenzoxamine, 40 clopidogrel, clopidol, clopimozide, clopipazan, clopirac, chlorb et amide, chlorcyclizine, chlordan to in, cloponone, cloprednol, cloprostenol, cloprothiazole, chlordiazepoxide, chlordimorine, chlorhexadol, cloquinate, cloquinozine, cloracetadol, cloranolol, chlorhexidine, chlorhexidine phosphanilate, chlorindanol, clorazepate, clorethate, clorexolone, clorgiline, cloricromen, chlorisondamine chloride, chlormadinone acetate, cloridarol, clorindanic acid, clorindione, clormecaine, chlormerodrin, chlormeza none, chlormidazole, 45 cloroperone, clorophene, cloroqualone, clorotepine, chloronaphazine, chloroazodin, chlorobutanol, chlorocresol, clorprenaline, clorsulon, clortermine, closantel, closiramine, chlorodihydroxyandrostenone, chloroethyl mesylate, clostebol, clothiapine, clothixamide, clotiazepam, clotica 5-chloro-3'-fluoro-2'3-dideoxyuridine, chloroguanide, some propionate, clotioxone, clotrimazole, clovoxamine, chlorophe not hane, chlorop rednisone acetate, cloxacepride, cloxacillin, cloxacillin benza thine, chloroprocaine, chloropyramine, chloroquine, 50 cloxazolam, cloxestradiol, cloximate, cloxotestosterone, chloroserpidine, chlorothen, chlorothiazide, chlorotriansene, cloxypendyl, cloxyquin, clozapine, cobamide, cocaine, chloroxine, chloroxylenol, chlorozotocin, chlorphenesin, cocarboxylase, codeine, codoxime, cofisatin, cogazocine., chlorphemesin carbamate, chlorpheniramine, chlorphenoc colchicine, colestolone, colfenamate, colforsin, colterol, tium amsonate, chlorphenoxamine, chlorphentermine, conessine, conorphone, copper gluconate, cormethasone chlorproethazine, chlorproguanil, chlorpromazine, 55 acetate, corticosterone, cortisone acetate, cortisuzol, chlorpropamide, chlorprothixene, chlorquinaldol, cortivazol, cortodoxone, cotarnine chloride, cotinine, chlortetracycline, chlorthalidone, chlorthenoxazine, cotriptyline, coumaphos, coumazoline, coumermycin, chlorZoaxazone, chloecalciferol, cholic acid, choline coume tarol, creatinolfosfate, crisnatol, croconazole, chloride, choline glycerophosphate, chromocarb, cromakalim, cromitrile, cromolyn, cropropamide, chromonar, ciadox, ciamexon, cianergoline, cianidol, 60 crospovidone, crotamiton, crotetamide, crotoniazide, cianopramine, ciapilome, cicaprost, cicarperone, ciclactate, crufomate, cuprimyxin, cuproxoline, cyacetacide, ciclafrine, ciclazindol, cicletanine, ciclomenol, ciclonicate, cyamemazine, cyanocobalamine, cyclacillin, cyclandelate, ciclonium bromide, ciclopirox, ciclopramine, cicloprofen, cyclarbamate, cyclazocine, cyclazodone, cyclexanone, cicloprolol, ciclosidomine, ciclotizolam, ciclotropium cyclindole, cycliramine, cyclizine, cyclobarbital, bromide, cicloxilic acid, cicloxolone, cicortonide, cicrotic 65 cyclobendazole, cyclobenzaprine, cyclobutoic acid, acid, cidoxepin, cifenline, cifostodine, ciglitazone, cyclobutyrol, cyclofenil, cycloguanil, cloheximide, ciheptolane, ciladopa, cilastatine, cilazapril, cilazaprilat, cycloleu cine, cyclo men ol, cyclomethic one, US 6,680,047 B2 43 44 cyclomethycaine, cyclopentamine, cyclopenthiazide, diphosphate, diethylstilb estrol dip ropio nate, cyclopentolate, cyclope nazine, cyclophosphamide, diethylthiambu tene, diethyltolu amide, dietifen, cyclopregnol, cyclopyrronium bromide, cycloserine, difebarbamate, difemerine, difemetorex, difenamizole, cyclosporine, cyclothiazide, cyclovalone, cycotiamine, difencloxazine, difenoximide, difenoxin, difetarsone, cy crimine, cyheptamide, cyheptropine, cynarine, difeterol, diflorasone diacetate, difloxacin, difluanine, cypenamine, cypothrin, cyprazepam, cyprenophine, diflucortolone, diflurcortolone pivalate, diflumidone, cyprodenate, cyproheptadine, cyprolidol, cyproduinate, diflunisal, difluprednate, diftalone, digalloyl trioleate, cyproterone acetate, cyproximide, cystine, cytarabine, digitoxin, digoxin, dihexy verine, dihydralazine, dacarbazine, dacemazine, dacisteine, dacinomycin, dacuro dihydroazacytidine, dihydroergotamine, dihydrolemperone, nium bromide, dagapamil, dalbraminol, daledalin, 10 dihydro stre p to my cin, dihydrot a chy ste rol, daltroban, dametralast, damotepine, danazol, danitracen, dihydroxy fluoro proge strone, diisopro mine, danosteine, danthron, dantrolene, dapiprazole, dapsone, diisopropanolamine, dilazep, dile valol, dilmefone, daptomycin, darenzepine, darodipine, datelliptium chloride, diloxanide, diltiazem, dimabefylline, dimecamine, dime dunorubicin, dazadrol, dazepinil, dazidamine, dazmegrel, colonium iodide, dimecrotic acid, dimefadane, dimefline, dazolicine, dazopride, dazoquinast, dacoxiben, deanol 15 dimelazine, dimenorfan, dimenhydrinate, dimenoxadol, aceglumate, deanol acetaminobenzoate, deazauridine, dimeheptanol, dimepranol, dimepregnen, dimeprozan, deboxamet, debrisoquin, decamethonium bromide, dimer caprol, dime sna, dimes one, dimetacrine, decimenide, decitropine, declaben, declenperone, dime tamfe tamine, dime th a dione, decloxizine, decominol, decoquinate, deditonium bromide, dimethaminostyrylquinoline, dimethazan, dimethindene, deferoxamine, deflazacort, defosfamide, dehydroacetic acid, 20 dimethiodal, dimethisoquin, dimethisterone, dimetholizine, dehydroemetime, dehydro-7-methyltestosterone, dimethoxa nate, dimethylhydroxy testosterone, delanterone, delapril, delergotrile, delfantrine, delmadinone dimethylnorandrostadienone, dimethylnortestosterone, acetate, delmetacin, delmopinol, delorazepam, deloxone, dimethylstilbestrol, dimethyl, dimethylthiambutene, dim delproste nate, dembrexine, demecarium bromide, ethyltubocurarinium chloride, dimetipirium bromide, demeclocycline, demecolcine, demecycline, demegestone, 25 dimetofrine, dimetridazole, diminazene, dimoxamine, demelverine, demexiptiline, democonazole, demoxepam, dimoxaprost, dimoxyline, dimpylate, dinaline, dinazafone, den averine, denbufylline, denipride, denopamine, diniprofylline, dinitolmide, dinoprost, dinoprostone, dinsed, dempidazone, denzimol, deoxyspergualin, depramine, diosmin, dioxadilol, dioxadrol, dioxamate, dioxaphetyl deprodone, deprostil, deptropine, derpanicate, desacetyl butyrate, dioxethedrin, dioxifedrine, dioxybenzone, dipe colchicine tartrate, desaspidin, desiclovir, descinolone 30 nine bromide, diperodon, diphemanil methylsulfate, acetonide, deserpidine, desipramine, deslanoside, diphenadione, diphenan, diphenhydramine, diphendiol, des methylcolchicine, des methyl misonidazole, diphenoxylate, diphenylpraline, diphoxazide, dipipanone, des methylmoramide, desocriptine, desogestre 1, dipipoverine, dipiverin, diprafenone, dipre norphine, desomorphine, desonide, desoximetasone, desoxycorticos diprobutine, diprofene, diprogulic acid, diproleandomycin, terone acetate, desoxy corticosterone pivalate, 35 diprodualone, diproteverine, diprotriozate, diproxadol, desoxypyridoxine, detajmium bit artrate, detanosal, dipyridamole, dipyrithione, dipyrocetyl, dipyrone, deterenol, detomidine, detorubicin, detrothronine, dirithromycin, disobutamide, disofenin, disogluside, devapamil, dexamethasone, dexamethasone acefurate, dex disopyramide, disoxaril, distigmine bromide, disulergine, amethasone acetate, dexamethasone dipropionate, dexam disulfamide, disulfiram, disuprazole, ditazole, ditercalinium ethasone phosphate, dexamisole, dexbrompheniramine, 40 chloride, dithiazanine iodide, ditiocarb, ditionustine, dexchlorpheniramine, dexclamol, dexetimide, dexetozoline, ditolamide, ditophal, divabuterol, dixanthogen, dizatrifone, dexfenfluramine, deximafen, dexindoprofen, dexivacaine, dizocilpine, dobu pride, dobutamine, docarpamine, dex lofexidine, dexme de to midine, dexoxadro1, doconazole, docusate, doliracetam, domazoline, domiodol, dexpanthe no.1, dexpropranolol, dex.proxibutene, domiphen bromide, domipizone, domoprednate, domoxin, dexe coverine, dextilidine, dextroamphetamine, 45 domperidone, don, donetidine, dopamantine, dopamine, dextrofemine, dextromethorphan, dextromoramide, dopexamine, dopropidil, dogualast, dorastine, doreptide, dextrorphan, dextrothyroxine, dezaguanine, dezocine, dosergoside, dotarizine, dotefonium bromide, dothiepin, diacerein, diacetamate, diacetolol, diacetylmorphine, doxacurium chloride, doxaminol, doxapram, doxaprost, diamfenetide, diaminomethylphenazinium chloride, doxazosin, doxefazepam, doxenitoin, doxepin, doxibetasol, diamo caine, diam promide, diamth azole, 50 doxifluridine, doxofylline, doxorubicin, doxpicomine, dian hydrogalactitol, diap amide, diarbarone, doxycycline, doxylamine, dramedilol, draquinolol, diathymosulfone, diatrizoic acid, diaveridine, diazepam, deazidox, dribendazole, drindene, drobuline, drocinonide, diaziquone, diazoacetylglycine hydrazide, diazouracil, droclidinium bromide, drocode, drofenine, droloxifene, diazoxide, dibekacin, dibemethine, dibenamine, dibenzepin, drometrizole, dromostanolone, dromostanolone propionate, dibrompropamidine, dibromsalan, dibrospidium chloride, 55 dronabinol, dropempine, droperidol, droprenilamine, dibucaine, dibuprol, dibupyrone, dibusadol, dicarbine, dropropizine, drotaverine, drotebanol, droxacin, dicarfen, dichlorallyl lawsone, dichlorisone acetate, droxicainide, droxicam, droxidopa, droxypropine, dichlormezanone, dichlorofluormethane, dichlorom, dulofibrate, dulozafone, duome tacin, duoperone, ethotrexate, dichlorophen, dichlorophen arsine, dupracetam, durapatite, dyclonine, dydrogesterone, dichlorote trafluoroeth a ne, dichloroxyle no 1, 60 dymanthine, dyphylline, ebastine, ebrotidine, ebselen, dichlorphenamide, dichlorvos, diciferron, dicirenone, ecastolol, echinomycin, echothiophate iodide, ecipramidil, diclazuril, diclofenac, diclofensine, diclofurime, eclanamine, eclazolast, econazole, ectylurea, edelfosine, diclometide, diclonixin, dicloxacillin, dicobalt edetate, edetic acid, edetol, edifolone, edogestrone, edoxudine, edro dicolinium iodide, dicresulene, dicumarol, dicyclomine, phonicum chloride, efaroxan, efetozole, efornithine, didemnin, dideoxycytidine, didrovaltrate, dieldrin, 65 efloxate, efrotomycin, elantrine, elanzepine, elderfield’s die nestrol, die no gest, die thadione, dieth azine, pyrimidine mustard, elfazepam, ellagic acid, elliptinium diethylpropion, diethylstilbestrol, diethylstilbestrol acetate, elmustine, elnadipine, eltenac, eltoprazine, elucaine, US 6,680,047 B2 45 46 elziverine, embramine, embutramide, emepronium bromide, fenlozic acid, fendiline, fendosal, feneritrol, fenestrel, emetime, emiglitate, emilium tosylate, emopanil, fenethazine, fenethylline, fenetradil, fenflumizole, emorfazone, emylcamate, enalapril, enalaprilat, enbucrilate, fenfluramine, fenfluthrin, fengabine, fenharmane, fenimide, encainide; enciprazine, enclomiphene, encyprate, endomide, feniodium chloride, femipentol, femirofibrate, fenisorex, endralazine, endrysone, enefexine, enestebol, enfenamic femme tozole, fen metramide, fenobam, fenocino1, acid, enflurane, eniclobrate, enilconazole, enilospirone, fenoctimine, fenofibrate, fenoldopam, fenoprofen, fenoterol, enisoprost, enocitabine, enolicam, enoxacin, enoxamast, fe noverine, fenoxazoline, fenoxe dil, fenozolone, enoximone, enoxolone, eniprazole, eniproline, emprazepine, fenpentadiol, femperate, fenipalone, femipramide, femiprane, emprofylline, empromate, emprostil, enrofloxacin, entSufon fempiverinium bromide, fenprinast, femproporex, sodium, enviomycin, enviradene, epalretat, epanolol, 10 femprostalene, fenduizone, fenretinide, fenspiride, fentanyl, eperisone, ephedrine, epicainide, epicillin, epicriptine, fentiazac, fenticlor, fenticonazole, fentonium bromide, epiestriol, epimestrol, epinastine, epinephrine, epinephryl femyripol, fepentolic acid, fepitrizol, fepradinol, feprazone, borate, epipropidine, epirizole, epiroprim, epirubicin, fepromide, feprosidnine, ferriclate calcium, ferrotremine, epithiazide, epitiostanol, epoprostenol, epostane, ferrous fumarate, ferrous gluconate, fetoxylate, fexicaine, eprazinone, eprovafen, eproxindine, eprozinol, epsiprantel, 15 fexinidazole, fezatione, fezolamine, fiacitabine, fibracillin, eptaloprost, eptazocine, equilin, erdosteine, ergocalciferol, filenadol, filipin, fifexide, flamenol, flavamine, flavodic acid, ergoloid mesylates, ergonovine, ergosterol, ergotamine, flavodil, flavoneactic acid, flavoxate, flazalone, flecainide, ericolol, erizepine, erocainide, erythrity1 tetranitrate, flerobuterol, fleroxacin, flesinoxan, flestolol, fletazepam, erythromycin, erythromycin acistrate, erythromycin floctafenine, flomoxef, flopropione, florantyrone, flordipine, ethylsuccinate, erythromycin propionate, erythrosine, 20 floredil, florfenicol, florifemine, flosequinan, flotrenizine, esaprazole, esculamine, eseridine, esflurbiprofen, esmolol, floverine, floxacillin, floxacrine, floxuridine, fluacizine, esorubicin, esproguin, estazolam, estradiol, estradiol flualamide, fluanisone, fluazacort, flubanilate, flubendazole, benzoate, estradiol cypionate, estradiol dipropionate, estra flubepride, flucabril, flucetorex, flucindole, fluciprazine, diol enanthate, estradiol undecylate, estradiol valerate, flucloronide, fluconazole, flucrylate, flucytosine, estramustine, estramustine phosphate, estrapronicate, 25 fludalanine, fludarabine phosphate, fludazonium chloride, estrazinol, estriol, estrofurate, estrone, estrone hydrogen fludiazepam, fludorex, fludoxopone, fludrocortisone acetate, sulfate, estropipate, esuprone, etabenzarone, etacepride, flufenamic acid, flufenisal, flufosal, flufylline, fluindarol, etafedrine, etafenone, etamestrol, etamiline, etamiphyllin, fluindione, flumazenil, flumecinol, flumedroxone-17 etamocycline, etanidazole, etanterol, etaqualone, etasuline, acetate, flumequine, flumeridone, flumethasone, flumetha etazepine, etazolate, etebenecid, eterobarb, etersalate, 30 some pivalate,flumethiazide, flumetramide, flumexadol, ethacridine, ethacrynic acid, ethambutol, ethamivan, flumezapine, fluminorex, flumizole, flumoxonide, ethamsy late, ethanolamine oleate, etha verine, flunamine, flunarizine, flunidazole, flunisolide, flunisolide ethchlorvynol, ethenzamide, ethazide, ethidium chloride, acetate, flunitrazepan, flumixin, flunoprost, flunoxaprofen, ethinamate, ethinyl estradiol, ethiofos, ethionamide, fluocinolone acetonide, fluocinonide, flour.cortin butyrate, ethsterone, ethoheptazine, ethomoxane, ethonam, 35 fluocortolone, fluocortolone caproate, fluorescein, ethopropazine, ethosuximide, ethotoin, ethoxazene, fluoresone, fluoroadenosine, 3-fluoroandrostanol, ethoxazorutoside, ethoxzolamide, ethyybenztropine, ethyl fluorodopane, fluorohydroxyandrosterone, fluorometholone, biscoumacetate, ethyl carfluzepate, ethyl cartrizoate, ethyl fluorometholone acetate, fluorosalan, 6-fluorotestosterone dibunate, ethyl dirazepate, ethylenediamine, ethylestrenol, propionate, fluorouracil, 9-fluoroxotestenololactone, ethylhydro cup reine, ethyl 1 of a zep a te, 40 9-fluoroxotestololacetone, fluotracen, fludxetine, ethylmethylthiambutene, ethylmorphine, 9-ethyl-6 fluoxymesterone, fluparoxan, flupentixol, fluperamide, mercaptopurine, ethyl nitrite, ethylnorepinephrine, fluperlapine, fluperolone acetate, fluphenazine, fluphenazine ethylparaben, ethylphenace mide, ethylstibamine, enanthate, flupimazine, flupirtine, flupranone, fluprazine, ethynerone, ethynodiol diacetate, ethypicone, etibendazole, fluprednidene, fluprednisolone, fluprednisolone valerate, eticlopride, eticyclidine, etidocaine, etidronic acid, 45 flu profen, fluprofylline, fluproduazone, fluprostenol, etifelmine, etifenin, etifoxine, etilamfetamine, etilefrine, fluguazone, fluradoline, flurandrenoline, flurantel, etilefrine pivalate, etintidine, etiochlanolone, etipirium flurazepam, flurbiprofen, fluretofen, flurithromycin, iodide, etiproston, etiracetam, etiroxate, etisazole, flurocitabine, flurofamide, flurogestone acetate, flurothyl, etisomicin, etisulergine, etizolam, etocarlide, etocrylene, fluroxene, flusoxolol, fluspiperone, fluspirilene, flutamide, etodolac, etodroxzine, etofamide, etofenamate, etofemprox, 50 flutazolam, flutemazepam, flutiazin, fluticasone propionate, etofibrate, etoformin, etofuradine, etofylline, etoglucid, flutizenol, flutonidine, flutoprazepam, flutroline, flutropium etolorex, etolotifen, etoloxamine, etomidate, etomidoline, bromide, fluvoxamine, fluzinamide, fluzoperine, folescutol, etomoxir, etonitazene, etoperidone, etoposide, etoprindole, folic acid, fomidacillin, fominoben, fomocaine, fonazine, etoprine, etorphine, etosalamide, etoxadrol, etoxeridine, fopirtoline, forfenimex, formebolone, formetorex, etozolin, etrabamine, etretinate, etryptamine, etymemazine, 55 formintrazole, formocortal, formoterol, fosarilate, eucalyptol, eucatropine, eugenol, euprocin, evandamine, fosazepam, foscarnet, foscolic acid, fosenazide, Evans blue, exalamide, exametazine, exaprolol, exepanol, fosfocreatine, fosfomycin, fosfonet, fosfosal, fosinapril, fos exifone, exiproben, falintolol, falipamil, famiraprinium menic acid, fosmidomycin, forpirate, fostedil, fostriecin, chloride, famotidine, famotine, famiprofazone, fanetizole, fotemustine, fotreamine, frabuprofen, frentizole, fronepidil, fantridone, fazadinium bromide, fazaribine, febantel, 60 froxiprost, ftaxilide, ftivazide, ftorafur, ftormetazine, febarbamate, februpol, febuverine, feclemine, feclobuzone, ftorpropazine, fubrogonium iodide, fuchsin, fumagillin, fedrilate, felbamate, felbinac, felipyrine, felodipine, fumoxcillin, fuprazole, furacrinic acid, furafylline, femoxetine, fenabutene, fenacetinol, fenaclon, fenadiazole, furalazine, furaltadone, furaprofen, furazabol, furazolidone, fenaptic acid, femalamide, femalcomine, fenamifuril, furazolium chloride, furbucillin, furcloprofen, furegrelate, penamole, fenaperone, fenbendazole, fenbencillin, 65 furethidine, furfenorex, furidarone, furmethoxadone, fenbufen, fenbutrazate, fencamfamine, fencibutirol, fen furobufen, furodazole, furofenac, furomazine, furosemide, clexonium metilsulfate, fenclofenac, fenclonine, fenclorac, furostilbestrol, fursalan, fursultiamine, furterene, furtretho US 6,680,047 B2 47 48 nium iodide, fusidic acid, fuzlocillin, gabapentin, gabexate, hydroxytetracaine, hydroxytoluic acid, hydroxyurea, gaboxadol, galantamine, gallamine triethodide, gallopamil, hydroxyzine, hymecromone, hyoscyamine, hypericin, galosemide, galtifenin, gampexine, gamolenic acid, ibacitabine, ibafloxacin, ibazocine, ibopamine, ibrotamide, ganciclovir, gangle fene, gapicomine, gapromidine, ibudilast, ibufenac, ibuprofen, ibuprofen piconol, gefarnate, gemazocine, gemcadiol, gemeprost, gemfibrozil, ibuproxam, ibuterol, ibuverine, icazepam, icosipiramide, gentamicin, gentian violet, gepefrine, gepirone, geroquinol, icotidine, idarubicin, idaverine, idazoxan, idebenone, gestaclone, gestadienol, gestodene, gestonorone caproate, idenast, idoxuridine, idralfidine, idrocilamide, idropranolol, gestrinone, giparmen, gitaloxin, gitoformate, glafenine, ifenprodil, ifosfamide, ifoxetine, ilmofosine, iloprost, glaziovine, glia milide, glibornu ride, glibutimine, imafen, imanixil, imazodan, imcarbofos, imexon, glicaramide, glicetanile,geroquinol, gestaclone, gestadienol, 10 imiclopazine, imidazole salicylate, imidazopyrazole, imide gestodene, gestonorone caproate, gestrinone, giparmen, cyl iodine, imidocarb, imidoline, imidurea, imiloxan, gitaloxin, gitoformate, glafenine, glaziovine, gliamilide, iminophendimide, imipenem, imipramine, imipraminoxide, glibornuride, glibutimine, glicaramide, glicetanile, imirestat, imolamine, imoxite rol, impacarzine, gliclazide, glicondamide, glidazamide, gliflumide, impromidine, improsulfan, imuracetam, inaperisone, glimepiride, glipentide, glipizide, gliquidone, glisamuride, 15 indacrinone, indalpine, indanazoline, indanidine, indanorex, glisindamide, glisolamide, glisoxepide, gloxazone, indapamide, indatraline, indacainide, indeloxazine, gloximonam, glucametacin, glucosamine, glucosulfamide, indenolol, indicine-N-oxide, indigotindisulfonic acid, glucosulfone, glucurolactone, glucuronamide, glunicate, indobufen, indocate, indocyanine green, indolapril, glutamic acid, glutaral, glutarimide, glutaurine, indolidan, indomethacin, indopanolol, indopine, indoprofen, glutethimide, glyburide, glybuthiazol, glybuzole, glyceryl 20 indoramin, indorenate, indoxole, indriline, inicarone, monoste a rate, glycidyl methacrylate, glycine, inocoterone, inosine, inosine dialdehyde, inositol niacinate, glyclopyramide, glybiarsol, glycopyrrolate, glycyclamide, inproduone, intrazole, intriptyline, iobenzamic acid, iobutic glyhexamide, glymidine, glyoctamide, glypinamide, acid, iocarmic acid, iocetamic acid, iodamide, iodecimol, glyprothiazol, glysobuzole, gold thiomalate, gold sodium iodetryl, iodipamide, iodixanol, iodoalphionic acid, iodol, thiosulfate, granisetron, griseofulvin, guabenxan, guacetisal, 25 iodophthalein, iodoquinol, iodothiouracil, iodoxamic acid, guafe cainol, guaiactamine, guaiapate, guaietolin, ioglicic acid, ioglucol, ioglucomide, ioglunide, ioglycamic guaifenesin, guaimeSal, guaisteine, guaithylline, acid, iogulamide, iohexol, iodlidonic acid, iolixanic acid, guame cycline, guanabenz, guanacline, guanadre 1, iomeglamic acid, iomeprol, iomorinic acid, iopamidol, guana Zodine, guanazole, guanclofine, guancydine, iopanoic acid, iopentol, iophendylate, iophenoxic acid, guanethidine, guanfacine, guanisoquin, guanoclor, 30 ioprocemic acid, iopromide, iopronic acid, iopydol, guanoctine, guanoxabenz, guanoxan, guanoxy fen, iopydone, iosarcol, iosefamic acid, ioseric acid, iosimide, hadacidin, halazepam, halazone, halcinonide, halethazole, iosulamide, iosumetic acid, iotasul, iotetric acid, iothalamic halocortolone, halofantrine, halofenate, halofuginone, acid, iotranic acid, iotrizoic acid, iotrolan, iotroxic acid, halometasone, halonamine, halopemide, halopenium ioversol, ioxabrolic acid, ioxaglic acid, ioxitalamic acid, chloride, haloperidol, haloperidol decanoate, haloperidone 35 ioxotrizoic acid, iozomic acid, ipexidine, ipodic acid, acetate, haloprogesterone, haloprogin, halothane, ipragratine, ipramidil, ipratropium bromide, iprazochrome, haloxazolam, haloxon, halquinols, hedaquinium chloride, ipriflavone, iprindole, iprocinodine, iproclozide, iprocrolol, he pronicate, heptabarbital, heptaminol, heptaverine, iprofenin, iproheptine, iproniazid, iproidazole, iproplatin, heptolamide, hepzidine, hetacillin, hetaflur, heteronium iprotiazem, iproxamine, iprozilamine, ipsalazide, bromide, hexachlorophene, hexacyclonate, hexacyprone, 40 ipsapirone, iguindamine, irindalone, irloxacin, irolapride, hexadiline, hexadimethrine bromide, hexafluorenium irsogladine, isamfazone, isamoltan, isamoxole, isaxonine, bromide, hexamethonium bromide, hexamidine, isbogrel, isepamicin, isoaminile, isobromindione, hexapradol, hexaprofen, hexapropymate, hexasonium isobucaine, isobutamben, isocarboxazid, isoconazole, iodide, hexacarbacholine bromide, hexedine, hexestrol, isocromil, isoetharine, isofezolac, isoflupredone acetate, hexetidine, hexobarbital, hexobendine, hexocyclium 45 isoflurane, isoflurophate, isoleucine, isomazole, isomerol, methylsulfate, hexoprenaline, hexopyrronium bromide, isometamidium, isomethadone, isome the ptene, hexylcaine, hexylene glycol, hexylresorcinol, histamine, isomylamine, isoniazid, isonixin, isoprazone, isoprednidene, histapyrrodine, homarylamine, homatropine, homatropine isoprofen, isoprofamide iodide, isopropicillin, isopropyl methylbromide, homidium bromide, homochlorcyclizine, myristate, isopropyl palmitate, isoproterenol, isosorbide, homofenazine, homoharringtonine, homopipramol, 50 isosorbide dinitrate, isosorbide mononitrate, isospalglumic homosalate, homotestosterone propionate, homprenorphine, acid, isosulfan blue, isosulpride, isothipendyl, isotic, hopantenic acid, hoquizil, hycanthone, hydracarbazine, isotiquimide, isotretinoin, isoxaprolol, isoxepac, isoxicam, hydra lazine, hydrarga phen, hydrobe n tizide, isoxSuprine, isradipine, itanoxone, itazigrel, itraconazole, hydrochlorthiazide, hydrocodone, hydrocortamate, itrocainide, ivermectin bib, ivoqualine, josamycin, kainic hydrocortisone, hydrocortisone aceponate, hydrocortisone 55 acid, kalafungin, kanamycin, kebuzone, keracyanin, acetate, hydrocortisone butyrate, hydrocortisone cypionate, ketamine, ketanserin, ketazocine, ketazolam, kethoxal, hydrocortisone-phosphate, hydrocortisone succinate, hydro ketipramine, ketobemidone, ketocaine, ketocaino1, cortisone valerate, hydroflumethiazide, hydromadinone, ketoconazole, ketoprofen, ketorfanol, ketorolac, ketotifen, hydromorphinol, hydromorphone, hydroquinone, ketotrexate, khellin, khelloside, kitasamycin, labetalol, hydroximdasate, hydroximdasol, hydroxyoxocobalamin, 60 lacidipine, lactalfate, lactose, lactulose, lamotrigine, hydroxy ampheta mine, hydroxychloroquine, lamtidine, lanatoside, lapachol, lapinone, lapyrium chloride, hydroxydimethandrostadienone, hydroxydione succinate, lasalocid, laudexium methyl sulfate, lauralkonium chloride, hydroxymethylandrostanone, 10-hydroxymorehisterone, laureth, laurixamine, laurocapram, lauroguadine, lauro hydroxypethidine, hydroxyphenamate, hydroxyprocaine, linium acetate, lauryl isoquinolinium, lefetamine, hydroxyprogeserone, hydroxyprogesterone caproate, 65 leflunomide, leiopyrrole, lemidosul, le nampicillin, hydroxypyridine tart rate, hydroxy stilb amidine, leniquinsin, lemperone, leptacline, lergotrile, letimide, 7-hydroxytestololacetone, hydroxytestosterone propionate, letosteine, leucine, leucinocaine, leucocianidol, leucovorin, US 6,680,047 B2 49 50 levacecarnine, levallorphan, levamfetamine, levamisole, mercaptamine, mercaptomerin, mercaptopurine, levdrop ropizine, levisoprenaline, levlofexidine, mercuderamide, mercufenol chloride, mercumatilin, levobunolol, levocabastine, levocarnitine, levodopa, mercurobutol, mergocriptine, merophan, mersalyl, levofacetoperane, levofenfluramine, levofuraltadone, mesabolone, mesalamine, meseclazone, mesna, mesocarb, levoglutamide, levomenol, levomethadone, levomethadyl 5 meso-hexestrol, mesoridazine, mesipirenone, mestanolone, acetate, levomethorphan, levometio meprazine, mesterolone, mestranol, mesudipine, mesulergine, levo mopranol, levo moramide, lev on an tradiol, mesulfamide, mesulfen, mesuprine; metabromsalan, levonordeprin, levonorgestrel, levophenacyl morphan, metacetamol, metaclazepam, metaglycodol, metahexamide, levopropoxyphene, levopropylcillin, levopropylhexedrine, metamelfalan, metamfazone, metamfe pramone, levoprotiline, levorin, levorphanol, levothyroxine, 10 metampicillin, metamixin, metapramine, metaproterenol, levoxadrol, lexofenac, libecillide, libenzapril, lidamidine, metaraminol, metaterol, metaxalone, metazamide, metazide, lidocaine, lidofenin, lidoflazine, lifibrate, lilopristone, metazocine, metbufen, metene prost, metergoline, limaprost, lincomycin, lindane, linsidomine, iothyronine, metergotamine, metescu fylline, mete scule to 1, liroldine, lisinopril, lisuride, lithium carbonate, lithium metethoheptazine, metformin, methacholine chloride, citrate, litracen, lividomycin, lixazinone, lobeline, 15 methacycline, methadone, methadyl acetate, methallenestril, lobendazole, lobenzarit, lobuprofen, locicortone, methallibure, methalthiazide, methamphetamine, lodaxaprine, lodacezarlodinixil, lodiperone, lodoxamide, methandriol, methandrostenolone, methaniazide, meth lodoxamide ethyl, lofemizole, lofendazam, lofentanil, antheline bromide, methaphenilene, methapyrilene, lofepramine, lofexidine, loflucarban, lombazole, meth a qualone, meth arbital, methasty rid one, lomefloxacin, lometraline, lomevactone, lomifylline, 20 methazolamide, methdilazine, methenamine, methenolone lomofungin, lomustine, lonapalene, lonaprofen, lonazolac, acetate, methenolone enanthate, metheptazine, methestrol, lonidamine, loperamide, loperamide oxide, lopirazepam, methetoin, methicillin, methimazole, methiodal sodium, loprazolam, loprodiol, lorajmine, lorapride, loratadine, methioguanine, methiomeprazine, methionine, methisazone, lorazepam, lorbamate, lorcainide, lorcinadol, lorglumide, methitural, methixene, methocarbamol, methohexital, lormetazepam, lortalamine, lorzafone, losindole, losulazine, 25 methopholine, methose rpidine, methotrexate, lotifazole, lotrifen, lotucaine, lovastatin, loxanast, loxapine, methotrimeprazine, methoxamine, methoxsale n, loxiglumide, loxoprofen, loxtidine, lozilurea, lucanthone, methoxyflurane, methoxyphedrine, methoxyphenamine, lucartamide, lucimycin, lufuradom, lupitidine, luprostiol, methoxypromazine, methscopolamine bromide, luxabendazole, lyapolate sodium, lycetamine, lydimycin, methsuximide, methyllothiazide, N-methyladrealone hcl, lymecycline, lynestrenol, lysergide, lysine, mabuterol, 30 methyl alcohol, methylatropine nitrate, methylbenactyzium maduramicin, mafenide, mafoprazine, mafosfamide, mag bromide, methylbenzethonium, methylchromone, nesium citrate, magnesium gluconate, magnesium methyldesorphine, methyldihydromorphine, methyldopa, salicylate, malathion, malethamer, malic acid, malotilate, methyldopate, methylene blue, methylphedrine, manidipine, manganese gluconate, mannitol, mannitol methylergonovine, methylformamide, methyl nicotinate, hexanitrate, mannomustine, mannosulfan, manozodil, 35 2-methyl-19-nortestosterone, 2-methyl-11-oxoprogestrone, maprotiline, maridomycin, mariptiline, maroxepin, methyl palmoxirate, methylparaben, methylphendiate, may tansine, mazaticol, mazindol, mazipredone, methylprednisolone, methylprednisolone aceponate, meth mebanazine, mebendazole, mebenoside, mebeverine, meb ylprednisolone acetate, methylprednisolone hemisuccinate, eZonium iodide, mebhydrolin, mebiquine, mebolazine, methylprednisolone phosphate, methylprednisolone mebrofenin, mebutamate, mebutizide, mecamylamine, 40 suleptanate, methyl salicylate, methylstreptonigrin, mecarbinate, mecetronium ethylsulfate, mechlorethamine, 4-methyl testosterone, 7-methyl testosterone, meciadanol, mecinarone, meclizine, meclocycline, meclo 17-methyltestosterone, 7-methyltesosterone propionate, cycline sulfosalicylate, meclofenamic acid, meclofenoxate, methylthionosine, 16-methylthio proges to ne, meclonazepam, mecloqualone, mecloralurea, meclorisone methylthiouracil, methynodiol diacetate, methyprylon, dibutyrate, mecloxamine, mecobalamin, mecrylate, 45 methysergide, metiamide, metiapine, metiazinic acid, mecysteine, medazepam, medazomide, medetomidine, metibride, meticrane, metildigoxin, metindizate, metioprim, medibazine, medifoxamine, medorinone, medorubicin, metioxate, metipirox, metipranolol, metiprenaline, me droges to me, me dronic acid, me droxalo 1, metitepine, metizoline, metkephamid, metochalcone, meto medroxyprogestrone, medroxyprogestrone acetate, cinium iodide, metoclopramide, metocurine iodide; medrylamine, medrysone, mefeclorazine, mefenamic acid, 50 metofenazate, metogest, metolazone, metomidate, mefenidil, mefenidramium metilsulfate, mefenorex, me topimazine, metopon, metoprine, metoprolol, mefeserpine, mefexamide, mefloquine, mefruside, metoquizine, metoserpate, metostilenol, metoxepin, megalomicin, megestrol acetate, meglitimide, megucycline, metrafazoline, metralindole, metrazifone, metrenperone, meglumine, meglutol, meladrazine, melarsonyl, metribolone, metrifonate, metrifudil, metrizamide, metri melarsoprol, melengestrol acetate, meletimide, melinamide, 55 zoic acid, metronidazole, meturedepa, mety rapone, melitracen, melizame, meloxicam, melperone, melphalan, mety ridine, metyrosine, mevastatin, mexafylline, memantine, memotine, menabitan, menadiol, menadiol mexazolam, mexenone, mexile time, mexiprostil, diphosphate, menadiol disulfate, menadione, menadione mexoprofen, mexre noate, mezacopride, mezepine, sodium bisulfite, menatetrenone, membutone; menfegol, mezilamine, mezlocillin, mianserin, mibolerone, micinicate, menglytate, menitrazepam, menoctone, menogaril, menthol, 60 miconazole, micronomicin, midaflur, midaglizole, meobentine, meparfynol, mepazine, mepenzolate bromide, midalcipran, midamaline, midazogrel, midazolam, meperidine, mephenesin, mephenoxalone, mephentermine, midecamycin, midodrine, mifentidine, mifepristone, mephenyton, mephobarbital, mepindolol, mepiprazole, mifobate, miglitol, mikamycin, milacemide, milemperone, me piroxol, mepitiostane, mepivacaine, mepixanox, milipertine, miloxacin, milrinone, milverine, mimbane, mepramidil, meprednisone, meprobamate, meproscillarin, 65 minaprine, minaxolone, mindolilol, mindoperone, meproxitol, meprylcaine, meptazinol, meduidox, meduinol, minepentate, minocromil, minocycline, minoxidil, meduitazine, meralein, meralluride, merbarone, merbromin, mioflazine, mipimazole, mirincamycin, miristalkonium US 6,680,047 B2 51 52 chloride, miroprofen, mirosamicin, misonidazole, nitraquazone, nitrazepam, nitrefazole, nitrendipine, misoprostol, mitindomide, mitobronitol, mitoclomine, nitricholine, nitrochlofene, nitrocycline, nitrodan, mitoguazone, mitolactol, mitomycin, mitonafide, nitrofurantoin, nitrofurazone, nitroglycerin, nitromersol, mitopodozide, mitoquidone, mitotane, mitotenamine, nitromide, nitromifene, nitroscanate, nitrosulfathiazole, mitoxantrone, mitozolomide, mivacurium chloride, nitroximil, nitroxoline, nivazol, nivinmeldone, mixylic acid, mixidine, misoprostol, mitindomide, mitobronitol, nizatidine, mizofenone, noberastine, nocloprost, nocodazole, mitoclomine, mitoguazone, mitolactol, mitomycin, nofecainide, nogalamycin, nolinium bromide, nomegestrol, mitonafide, mitopodozide, mitoguidone, mitotane, nomelidine, nomifensine, nonabine, nonaperone, mitotenamine, mitoxantrone, mitozolomide, mivacurium nonapyrimine, nonoxynol-4, nonoxynol-9, noracymethadol, chloride, mixidine, mizoribine, mobecarb, mobenzoxamine, 10 norbolethone, norbudrine, norclostebol, norcodeine, mocimycin, mociprazine, moclobemide, moctamide, nordazepam, nordefrin, nordinone, norepinephrine, modafinil, modaline, mofebutazone, mofloverine, norethandrolone, norethindrone, norethindrone acetate, mofoxime, molfarnate, molinazone, molindone, norethynodrel, noreximide, norfenefrine, norfloxacin, nor molracetam, molsidomine, mometasome furoate, monala floxacin succinil, norflurane, norgesterone, norgestimate, zone diso dium, m on ensin, mono be n zone, 15 norgestomet, norgestrel, norgestrienone, norletimol, mo no eth a no la mine, mono met a crine, norlevorphanol, norm ethadone, normethandrone, monophosphothiamine, monothioglycerol, monoxerutin, normorphine, norpipanone, nortestosterone propionate, montinelin, moperone, mopidamol, mopidralazine, nortetrazepam, nortriptyline, norvinisterone, nosantine, moprolol, moduizone, morantel, morazone, morclofone, noscapine, nosiheptide, novobiocin, noxiptiline, noxytiolin, morforex, moricizine, morinamide, morniflumate, 20 nuclomedone, nuclotixine, nufenoxole, nuvenzepine, morocromen, moroxydine, morpheridine, morphine, nylestriol, nylidrin, nystatin, obidoxime, ociltide, ocrylate, morsuximide, motapizone, motrazepam, motretinide, octabenzone, octacaine, octafonium chloride, octamoxin, moveltipril, moxadolen, moxalactam, moxaprindine, octamylamine, octanoic acid, octapinol, octastine, moxastine, moxaverine, moxazocine, moxestrol, octaverine, octazamide, octenidine, octenidine saccharin, moxicoumone, moxipraquine, moxisylyte, moxnidazole, 25 octicizer, octimibate, octorylene, octodrine, octopamine, moxonidine, mupirocin, murabutide, murocainide, octotiamine, octoxynol-9, octriptyline, octrizole, ofioxacin, muzolimine, mycophenolic acid, my fadol, myralact, oformine, oftasceine, olaflur, olaquindox, oleanomycin, myrophine, myrtecaine, nabazenil, nabilone, nabitan, oletimol, oleyl alcohol, olivomycin a, olmidine, olpimedone, naboctate, nabumetone, nadide, nadolol, nadoxolol, olsalazine, oltipraz, olvanil, omeprazole, omidoline, naepaine, nafamostat, nafazatrom, nafcaproic acid, nafcillin, 30 omoconazole, omonasteine, onapristone, ondansetron, nafenodone, nafenopin, nafetolol, nafimidone, nafiverine, ontianil, opiniazide, opipramol, orazamide, orbutopril, naflocort, nafonine,nafoxadol, nafoxidine, nafronyl, orconazole, orestrate, ormetoprim, ornidazole, ornipressin, naftalofos, naftazone, naftifine, naftopidil, naftoxate, ornithine, ornoprostil, orotic acid, orotirelin, orpanoxin, naftypramide, nalbuphine, nalidixic acid, nalmefene, orphenadrine, ortetamine, osalmid, osmadizone, otilonium nalmexone, nalorphine, naltrexone, naminterol, namoxyrate, 35 bromide, otimerate sodium, ouabain, oxabolone cipionate, nanaprocin, nandrolone cyclotate, nandrolone decanoate, oxabrexine, oxaceprol, oxacillin, oxadimedine, oxaflozane, nandrolone phen propionate, nanofin, nant rado1, oxaflumazine, oxagrelate, oxalinast, oxaliplatin, oxamarin, napactadine, napamezole, naphazoline, naphthonone, Oxametacin, oxamisole, oxamniquine, Oxanamide, naprodoxime, naproxen, naproxol, naranol, narasin, oxandrolone, oxantel, oxapadol, oxapium iodide, oxapropa natamycin, naxagolide, naxaprostene, nealbarbital, 40 nium iodide, oxaprotiline, oxaprozin, oxarbazole, nebidrazine, nebivolol, nebracetam, nedocromil, Oxatomide, oxazafone, oxazepam, oxazidione, oxazolam, nefazodone, neflumozide, nefopam, nele Zaprine, oxazorone, oxcarbazepine, oxdralazine, oxeladin, neoarsphenamine, neocinchophen, neomycin, neostigmine oxendolone, oxepinac, oxetacillin, oxethazaine, oxetorone, bromide, nequinate, neraminol, nerbacadol, nesapidil, oxfendazole, oxfenicine, oxibendazole, oxibetaine, mesosteine, netilmicin, netobimin, neutramycin, nexeridine, 45 oxiconazole, oxidopamine, oxidronic acid, oxifentorex, niacin, niacinamide, nialamide, niaprazine, nibroxane, oxifungin, oxilorphan, oximonam, oxindanac, oxiniacic nicafenine, nicainoprol, nicametate, nicarbazin, nicarpidine, acid, oxiperomide, oxiracetam, oxiramide, oxisopred, nicergoline, niceritrol, niceverine, niclofolan, niclosamide, oxisuran, oxitefonium bromide, oxitriptan, oxitriptyline, nicoboxil, nicoclonate, nicocodine, nicocortonide, oxitropium bromide, oxmetidine, oxodipine, oxogestone nicodicodine, nicofibrate, nicofuranose, nicofurate, 50 phenpropionate, oxolamine, oxolinic acid, oxomemazine, nicogrelate, nicomol, nicomorphine, nicopholine, oxonazine, oxophenarsine, oxoprostol, oxpheneridine, nicorandil, nicothiazone, nicotinyl alcohol, nicoxamat, oxpreno ate potassium, oxprenolol, oxtriphylline, nictiazem, nictindole, nodroxyzone, nifedipine, nifemalol, oxybenzone, oxybutynin, oxychlorosene, oxycinchophen, nife nazone, niflumic acid, nifluridide, nifuradene, oxyclozanide, oxycodone, oxydipentonium chloride, nifuraldezone, nifuralide, nifuratel, nifuratrone, nifurdazil, 55 oxyfedrine, oxymesterone, oxymetazoline, oxymetholone, nifurethazone, nifurfoline, nifurimide, nifurizone, oxymorphone, oxypendyl, oxypertine, oxyphenbutazone, nifurmazole, nifurmerone, nifuroquine, nifuroxazide, oxyphenonium bromide, oxypurinol, oxypyrronium nifuroxime, nifurpipone, nifurpirinol, nifurprazine, bromide, oxyquinoline, oxyridazine, oxysonium iodide, nifurduinazole, nifursemizone, nifursol, nifurthiazole, oxytetracycline, oxytiocin, ozagrel, Ozolinone, pacrinolol, nifurtimox, nifurtoinol, nifurvidine, nifurzide, niguldipine, 60 pactamycin, padimate, pafenolol, palatrigine, paldimycin, nihydrazone, nikethamide, mileprost, nilprazole, niludipine, palmidrol, palmoxiric acid, pamabrom, pamaquine, nilutamide, nilvadipine, nimazone, nime sulide, pamatolol, pamidronic acid, pancuronium bromide, nimetazepam, nimidane, nimodipine, nimorazole, panidazole, panomifene, patenicate, panthenol, pantothenic nimustine, niometacin, niperotidine, nipradilol, niprofazone, acid, p a nura mine, papa verine, papave roline, niridazole, nisbuterol, nisobamate, nisoldipine, nisoxetine, 65 parachlorophenol, paraflutizide, paraldehyde, nisterime acetate, nitarsone, nitazoxanide, nithiamide, paramethadione, paramethasone acetate, paranyline, parap nitracrine, nitrafudam, nitralamine, nitramisole, enzolate bromide, parapropamol, pararosaniline, pararosa US 6,680,047 B2 53 54 niline embonate, paraxazone, parbendazole, parconazole, piperoxan, piperylone, pipobroman, pipoctanone, pareptide, parethoxycaine, pargeverine, pargolol, pargyline, pipofezine, piposulfan, pipotiazine palmiate, pipoxizine, paridocaine, parodilol, paromomycin, paroxetine, pipoxolan, pipradimadol, pipradol, pipramadol, pipratecol, paroxypropione, parsalmide, partricin, parvaquone, piprinhydrinate, piprocurarium iodide, piprofurol, pasiniazid, paulomycin, paxamate, pazelliptine, pazoxide, piprozolin, piquindone, piquízil, piracetam, pirandamine, pcnu, pecilocin, pecocycline, pefloxacin, pelanserin, pirarubicin, piraxelate, pirazmonam, pirazolac, pirbenicillin, pelretin, pelrinone, pemedolac, pemerid, pemoline, pirbuterol, pirdonium bromide, pirenoxine, piremperone, pempidine, penamecillin, penbutolol, pendecamaine, pirenzepine, pirepolol, piretanide, pirfenidone, piribedil, penfluridol, penflutizide, pengitoxin, penicillamine, penicil piridicillin, piridocaine, piridoxilate, piridronic acid, lin procaine, penicillin, penimepicycline, penimocycline, 10 pirifibrate, pirindazole, pirinixic acid, pirinixil, piriprost, .penirolol, penmesterol, penoctonium bromide, penprostene, piriqualone, pirisudanol, piritramide, piritrexim, pirlimycin, pentabamate, pentacynium chloride, pentaerythritol pirlindole, pirmagrel, pirmenol, pirnabine, piroctone, tetranitrate, pentafluranol, pentagastrin, pentagestrone, pirogliride, piroheptine, pirolate, pirolazamide, piromidic pental amide, pent a methonium bromide, acid, piroxantrone hcl, piroxicam, piroxicam cinnamate, pentamethylmelamine, pentamidine, pentamoxane, 15 piroxicillin, piroximone, pirozadil, pirprofen, pirquinozol, pentamustine, pentapiperide, pentapiperium methylsulfate, pirralkonium bromide, pirtenidine, pitenodil, pitofenone, pentaquine, pentazocine, pentetate calcium trisodium, pen pituxate, pivampicillin, pivenfrine, pivopril, pivoxazepam, tetic acid, penthienate bromide, penthrichloral, pentiapine pizotyline, plafibride, plaunotol, pleuromulin, plicamycin, male ate, pentifylline, pentige tide, pentisomicin, podilfen, podophylloxoxin, poldine methylsulfate, pentisomide, pentizidone, pentobarbital, pentolinium 20 polidocanol, ploymyxin, polythiazide, ponal restat, tartrate, pentomone, pentopril, pentorex, pentosan polysul ponfibrate, porfi rom y cin, poskine, potassium fate sodium, pentostatin, pentoxifylline, pentrinitrol, guaiacolsulfonate, potassium nitrazepate, potassium sodium pentylenetrazole, peplomycin, pepstatin, peraclopone, tartrate, potassium sorbate, potassium thiocyanate, practolol, peradoxime, perafensine, peralopride, peraquinsin, prajmalium, pralidoxime chloride, pramipexole, perastine, peratizole, perbufylline, perflu amine, 25 pramiracetam, pramiverine, pramoxime, prampine, prano perflunafene, pergolide, perhexilene, periciazine, lium chloride, pranoprofen, pranosal, prasterone, perimetazine, perindopril, perindoprilat, perisoxal, pravastatin, praxadine, prazepam, prazepine, praziquantel, perlapine, permethrin, perphenazine, persilic acid, prazitone, prazocillin, prazosin, preclamol, prednazate, petrichloral, per antel, phanqu one, phen acaine, p red nazoline, prednicarbate, prednimustine, phenacemide, phenacetin, phenacttropinium chloride, 30 prednisolamate, prednisolone, prednisolone acetate, pred phen adoxone, phenaglycodol, phen amazoline, nisolone hemisuccinate, prednisolone phosphate, predniso phenampromide, phenarsone sulfoxylate, phenazocine, lone steaglate, prednisolone tebutate, prednisone, prednival, phenazopyridine, phen carb amide, phencyclidine, prednylidene, preferamate, pregnenolone, pregnenolone phendimetrazine, phenelzine, pheneridine, phenesterin, succinate, premazepam, prenalterol, premisteine, penethicillin, phenformin, phenglutarimide, phenicarbazide, 35 prenoverine, prenoxdiazine, prenylamine, pretamazium phenindamine, phenindione, pheniprazine, pheniraminie, iodide, pretiadil, pribecaine, pridefine, prideperone, pridinol, phenisonone, phenmetrazine, phenobarbital, phenobutiodil, prifelone, pri?inium bromide, prifuroline, prilocaine, phenolphtalein, phenolsulfonphthalein, phenomorphan, primaperone, primaquine, primidolol, primidone, primycin, phen op e ridine, phe nothiazine, phen oth rin, prinomide, pristinamycin, prizidilol, proadifen, probarbital, phenoxybenzamine, phenoxypropazine, phenprobamate, 40 probenecid, probicromil, probucol, procainamide, procaine, phenprocoumon, phen promethamine, phensuximide, procarbazine, procaterol, prochlorperazine, procinolol, phentermine, phentolamine, phenylalanine, phenyl procinomide, proclonol, procodazole, procyclidine, aminosalicylate, phenylbutazone, phenylrphrine, phenyl procymate, prodeconium bromide, prodilidine, prodipine, ethyl alcohol, phenylmercuric acetate, phenylmercuric prodolic acid, profadol, profexalone, proflavine, borate, phenylmercuric chloride, phenylmercuric nitrate, 45 proflazepam, progabide, progesterone, proglu metacin, phenylmethylbarbituric acid, phenylpropanolamine, proglumide, proheptazine, proligestone, proline, prolintane, phenylthildne, phenyltoloxamine, phenyramidol, phenytoin, prolonium iodide, promazine, promegestone, promestriene, phethafbital, pholcodine, pholedrine, phosphoramide promethazine, promolate, promoxolane, pronetalol, mustard, phoxim, phthalofyne, phthalysulfacetamide, propacetamol, propafenone, propamidine, propanidid, phthalylsulfame thizole, phthalylsulfa thiazole, 50 propanocaine, propantheline bromide, proparacaine, pro physostigmine, phytic acid, phytonadiol diphosphate, paty 1 nitrate, propazolamide, prope ndiazole, phytonadione, pibecarb, pibenzimol, pibecarb, pibenzimol, propentofylline, propenzolate, properidine, propetamide, piberaline, picafibrate, picartamide, picenadol, picilorex, propetandrol, propicillin, propikacin, propinetidine, piclonidine, piclopastine, picloxydine, picobenzide, propiolactone, propiomazine, propipocaine, propiram, picodralazine, picolamine, piconol, picoperine, picoprazole, 55 propisergide, propiverine, propizepine, propofol, propoxate, picotamide, picotrin diolamine, picumast, pidolic acid, propoxycaine, propoxyphene, propranolol, propyl pifarnine, pife nate, pifexole, piflutixole, pifoxime, docetrizoate, propylene glycol, propylene glycol piketoprofen, pildralazine, pilocarpine, pimoclone, monoste a rate, propyl gallate, propylhexe drine, pimefylline, pimelautde, pimetacin, pimethixene, pimetime, propyliodone, propylparaben, propylthiou racil, pimetremide, piminodine, pimobendan, pimondiazole, 60 propyperone, propyphenazone, propyromazine bromide, pimozide, pinacidil, pinadoline, pinafide, pinaverium proguazone, produinolate, prorenoate potassium, proroxan, bromide, pinazepam, pincainide, pindolol, pinolcaine, proscillaridin, prospidium chloride, prostalene, prosulpride, pinoxepin, pioglitazone, pipacycline, pipamazine, prosultiamine, proterguride, protheobromine, prothipendyl, pipaperone, pipaze thate, pipebuzone, pipecuronium prothixene, protiofate, protionamide, protirelin, protizinic bromide, pipemidic acid, pipenzolate bromide, pipequaline, 65 acid, protokylol, protoveratine, protriptyline, proxazole, piperacetazine, piperacillin, piperamide, piperazine, proxibarbal, proxibutene, proxicromil, proxifezone, piperazinedione, piperidolate, piperilate, piperocaine, proxorphan, proxyphylline, prozapine, pseudoephedrine, US 6,680,047 B2 55 56 psilocybine, pumiteba, puromycin, pyrabrom, pyran nitroprusside, sodium oxybate, sodium phenylacetate, copolymer, pyrantel, pyrathiazine, pyrazinamide, sodium picofosfate, sodium picosulfate, sodium propionate, pyrazofurin, pyricarbate, pyridarone, pyridofylline, pyri sodium stibocaptate, sodium stibogluconate, sodium tetrade dostigmine bromide, pyridoxine, pyrilamine, cyl sulfate, sodium thiosulfate, sofalcone, solasulfone, pyrimethamine, pyrimitate, pyrinoline, pyrithione zinc, solpe.cainol, solypertine, somantadine, sopitazine, pyrithyldione, pyritidium bromide, pyritinol, pyronine, sopromidine, soduinolol, sorbic acid, sorbinicate, sorbinil, pyrophenindane, pyrovalerone, pyroxamine, pyrrobutamine, sorbitan monolaurate, sorbitan monooleate, sorbitan pyrrocaine, pyrroliphene, pyrrolnitrin, pyrvinium chloride, monopalmitate, sorbitan monostearate, sorbitan trioleate, pytamine, quadazocine, quadrosilan, quatacaine, quazepam, sorbitan tristearate, sorbitol, Sorndipine, Sotalol, Soterenol, quazinone, quaZodine, quazolast, quifenadine, quillifoline, 10 spaglumic acid, sparfosic acid, sparsomycin, Sparteine, quinacainol, quinacillin, quinacrine, quinaldine blue, spectinomycin, spiclamine, spiclomazine, spiperone, quinapril, quinaprilat, quinazosin, quinbolone, quincarbate, spiradoline, spiramide, spiramycin, spirapril, spiraprilat, quinde camine, quindonium bromide, quindoxin, spirendolol, spirgetine, spirilene, spirofylline, quinestradol, quinestrol, quine thazone, quinetolate, spirogermanium, spiromustine, spironolactone, spiroplatin, quine Zamide, quin famide, quingestanol acetate, 15 spirorenone, spirotriazine, spiroxasone, spiroxatrine, quingestrone, quindine, quinine, quinocide, quinpirole, spiroxepin, spizofurone, stallimycin, stanolone, stanzolol, quinterenol, quintiofos, quinuclium bromide, quinupramine, stearic acid, stearyl alcohol, stearylsulfamide, Steffimycin, quipazine, quisultazine, race femine, racemethionine, stenbolone acetate, stepronin, stercuronium iodide, racemethorphan, racemetirosine, raclopride, ractopamine, stevaladil, stibamine glucoside, stibophen, stilbamidine, stil rafoxanide, ralitoline, raloxifene, ramciclane, ramefenazone, 20 bazium iodide, stilonium iodide, stirimazole, stiripentol, ramipril, ramiprilat, ramixotidine, ramnodignin, stirocainide, stirifos, streptomycin, streptonicozid, ranimustine, ranimycin, ranitidine, ranolazine, rathyronine, streptonigrin, streptovarycin, streptozocin, strinoline, razinodil, razobazam, razoxane, reboxetine, recainam, Strychnine, styramate, subathizome, subendazole, succimer, reclazepam, relomycin, remoxipride, renanolone, rentiapril, succinylcholine chloride, succinylsulfathiazole, repirinast, repromicin, reproterol, recimetol, rescinnamine, 25 succisulfone, suclofenide, sucralfate, sucrose octaacetate, reserpine, resorantel, resorcinol, resorcinol monoacetate, sudexanox, Sudoxicam, sufentanil, sufosfamide, sufotidine, retelliptine, retinol, revenast, ribavirin, riboflavin, riboflavin sulazepam, sulbactam, sulbactam pivoxil, sulbenicillin, 5'-phosphate, riboprine, ribostamycin, ridazolol, ridiflone, sulbenox, sulbentine, sulbutiamine, sulclamide, sulconazole, rifabutin, rifamide, rifampin, rifamycin, rifapentine, sulfabenz, sulfabenzamide, sulfacarbamide, sulface.cole, rifaximin, rilapine, rilmazafone, rilmenidine, rilopirox, 30 sulfacetamide, sulfachlorpyridazine, sulfachrysoidine, rilozarone, rimantadine, rimazolium metilsulfate, rim.cazole, sulfaclomide, sulfaclorazole, sulfaclozine, sulfacytine, rimexolone, rimiterol, rimoprogin, riodipine, rioprostil, sulfadiazine, sulfadicramide, sulfadimethoxine, sulfadoxine, ripazepam, risocaine, risperidone, ristianol, ristocetin, sulfaethidole, sulfaguandide, Sulfaguanole, sulfalene, sulfa ritanserin, ritionetan, ritodrine, ritropirronium bromide, loxic acid, sulfamazone, sulfamerazine, sulfameter, ritrosulfan, robenidine, rocastine, rociverine, rodocaine, 35 sulfamethazine, sulfamethizole, sulfamethoxazole, rodorubicin, rofelodine, roflurante, rokitamycin, roletamide, sulfamethoxypyridazine, sulfamethoxypyridazine acetyl, rolgamidine, rolicyclidine, rolicyprine, rolipram, sulfametomidine, sulfametrole, sulfamonomethoxine, rolitetracycline, rolodine, rolziracetam, romifenone, sulfamoxole, sulfanil amide, sulfanitran, sulfaperin, romifidine, ronactolol, ronidazole, ronifibrate, ronipamil, sulfaphenazole, sulfaproxyline, sulfapyridine, ronnel, ropitoin, ropivacaine, ropizine, roquinimex, 40 sulfaquinoxaline, sulfarsphenamine, sulfasalazine, rosaprostol, rosaramicin, rosaramicin butyrate, rosaramicin sulfasomizole, sulfasuccinamide, sulfasymazine, propionate, rosoxacin, rosterolone, rotamicillin, rotoxamine, sulfathiazole, sulfathiourea, sulfatolamide, sulfatroxazole, rotraxate, roxarsone, roxatidine acetate, roxibolone, sulfatrozole, sulfazamet, sulfinalol, sulfinpyrazone, sulfiram, roxindole, roxithromycin, roxolonium metilsulfate, sulfi so midine, sulfisoxazole, sulfi soxazole, roxoperone, rufloxacin, rutamycin, rutin, ruvazone, 45 sulfobromophthalein, sulfonethylmethane, sulfonmethane, sabeluzole, saccharin, salacetamide, salafibrate, salantel, sulfonterol, sulforidazine, sulfoxone sodium, Sulicrinat, salazodine, salazossulfadimedine, salazosulfamide, sulindac, Sulisatin, sulisobenzone, sulmarin, sulmazole, salazosulfathiazole, salethamide, Salfluverine, salicin, sali Sulme pride, sulinidazole, Sulocarbilate, Suloctidil, cyl alcohol, salicylamide, salicylanilide, salicylic acid, sulosemide, sulotroban, Suloxifen, Sulpiride, sulprosal, salinazid, salinomycin, salmefanol, salmeterol, salmisteine, 50 sulprostone, Sultamicillin, sulthiame, sultopride, sultosilic salprotoside, salsalate, salverine, sancycline, sangivamycin, acid, sultroponium, sulverapride, Sumacetamol, Sumatriptan, saperconazole, sarcolysin, sarmazenil, sarmoxicillin, sumetizide, Sunagrel, suncillin, supidimide, suproclone, sarpicillin, saterinone, satranidazole, savoxepin, scarlet red, suprofen, Suramin, Suricainide, Suriclone, suxemerid, sux scopafungin, scopolamine, seclazone, secnidazole, ethonium chloride, suxibuzone, symclosene, symetime, secobarbital, secoverine, securinine, sedecamycin, 55 synephrine, Syrisingopine, taclamine, tacrine, taglutimide, seganserin, seglitide, selegiline, selenium sulfide, talampicillin, talastine, talbutal, taleranol, talinolol, selprazine, sematilide, semustine, sepazonium chloride, talipexole, talisomycin, talmetacin, talmetoprim, seperidol, sequifenadine, serfibrate, sergolexole, serine, talniflumate, talopram, talosalate, taloximine, talsupram, sermetacin, serotonin, sertaconazole, sertraline, setastine, taltrimide, tameridone, tameticillin, tametraline, tamitinol, setazindol, setiptiline, setoperone, Sevitropium mesilate, 60 tamoxipen, tampramine, tandamine, taprostene, tartaric sevoflurane, sevopramide, siagoside, sibutramine, siccanin, acid, tasuldine, taurocholic acid, taurolidine, tauromustine, silandrone, silibinin, silicristin, silidianin, silver tauroselcholic acid, taurultam, taxol, tazadolene, tazanolast, sulfadiazine, simetride, simfibrate, simtrazene, simvastatin, tazaburate, tazeprofen, tazifylline, taziprinone, tazolol, sinefungin, sintropium bromide, sisomicin, sitalidone, tebatizole, tebuquine, teclothiazide, teclozan, tedisamil, sitofibrate, sitogluside, sodium benzoate, sodium dibunate, 65 tefazoline, tefenperate, tefludazine, teflurane, teflutixol, sodium ethasulfate, sodium formaldehyde sulfoxylate, tegafur, telenzepine, temafloxacin, temarotene, temazepam, sodium gentisate, sodium gualenate, sodium nitrite, sodium temefos, temelastine, temocillin, temodox, temozolomide, US 6,680,047 B2 57 58 temurtide, tenamfetamine, tenilapine, teniloxazine, tonazocine, topiramate, toprilidine, topterone, toguizine, tenilsetam, teniposide, tenocyclidine, tenonitrozole, torasemide, toebafylline, toremifene, tosifen, tosufloxacin, tenoxicam, tenylidone, teopranitol, teoprolol, tepirindole, tosulur, toyocamycin, toyomycin, traboxepine, tracazolate, tepoxalin, terazosin, terbinafine, terbucromil, terbufibrol, tralonide, tramadol, tramazoline, trandolapril, tranexamic terbuficin, terbuprol, terbutaline, terciprazine, terconazole, acid, tranilast, transcainide, trantelinium bromide, terfenadine, terfluranol, terguride, terizidone, termidazole, tranylcypromine, trapencaine, trapidil, traxanox, trazilitine, terodiline, terofenamate, teroxalene, teroxirone, terpin trazium esilate, trazodone, trazolopride, trebenzomine, hydrate, tertatolol, tesicam, tesimide, testolactone, trecadrine, treloxinate, trenbolone acetate, trengestone, testosterone, testosterone cypionate, testosterone enanthate, trenizine, trosulfan, trepibutone, trepipam, trepirium iodide, testosterone ketolaurate, testosterone phenylacetate, test 10 treptilamine, trequensin, trestolone acetate, trethinium osterone propionate, tetrabarbital, tetrabenazine, tetracaine, tosilate, trethocanoic acid, tretinoin, tretoquinol, triacetin, tetrachloroethylene, tetracycline, tetradonium bromide, tet triafungin, triamcinolone, triamcinolone acetonide, triamci raethylammonium chloride, tetrahydrozoline, tetramethrin, nolone acetonide-phosphate, triamcinolone benetonide, tri tetramisole, tetrandrine, tetrantoin, tetrazepam, tetriprofen, amcinolone diacetate, triamcinolone furetonide, triamcino tetronasin 5930, tetroquinone, tetroxoprim, tetrydamine, 15 lone hexacetonide, triampyzine, triamterene, triazinate, texacromil, thalicarpine, thalidomide, thebacon, thebaine, triaziquone, triazolam, tribendilol, tribe noside, thenalidine, thenium closylate, thenyldiamine, theobromine, tribromoethanol, tribromsalan, tribuzone, triacetamide, theodrenaline, theofibrate, theophylline, thiabendazole, trichlormethiazide, trichlormethine, trichloroacetic acid, thiacetarsamide, thialbarbital, thiambutosine, thiamine, trichloroethylene, tricribine phosphate, triclabendazole, thiamiprine, thiamphenicol, thiamylal, thiazesim, thiazina 20 triclacetamol, triclazate, triclobisonicum chloride, mium chloride, thiazolsulfone, thiethyperazine, thihexinol triclocarban, triclodazol, triclofenol, piperazine, triclofos, methylbromide, thimerfonate, thimerosal, thiocarbanidin, triclofylline, triclonide, triclosan, tricyclamol chloride, tridi thiocarzolamide, thiocolchioside, thiofuradene, thioguanine, hexethyl chloride, trientine, triethylene melamine, thioguanine alpha-deoxyriboside, thioguanine beta triethylenephosphoramide, trifenagrel, trifezolac, triflocin, deoxyriboside, thioguanosine, thiohexamide, thioinosine, 25 triflubazam, triflumidate, trifluomeprazine, trifluoperazine, thiopental, thiopropazate, thioproperazine, thioridazine, trifluperidol, triflu promazine, trifluridine, triflusal, thiosalan, thiotepa, thiotetrabarbital, thiothixene, thiouracil, trigevolol, trihexyphenidyl, triletide, trilostane, trimazosin, thiphenamil, thiphencillin, thiram, thonzonium bromide, trimebutine, trime caine, trime doxime bromide, thonzylamine, thozalinone, threonine, thymidine, thymol, trimeperidine, trimeprazine, trimetazidine, trimethadione, thymol iodide, thymopentin, thyromedan, thyropropic acid, 30 trimethamide, trimethaphan camsylate, trimethidinium tiacrilast, tiadenol, tiafibrate, tiamenidine, tiametonium methosulfate, trimethobenzamide, trimethoprim, iodide, tiamulin, tianafac, tianeptine, tiapamil, tiapirinol, trimetozine, trimetrexate, trimexiline, trimipramine, tiapride, tiaprofenic acid, tiaprost, tiaramide, tiazofurin, trimoprostil, trimoxamine, trioxifene, trioxsalem, tripamide, tiazuril, tibalosin, tibenalast sodium, tibenzate, tibezonium triparanol, tripelennamine, tripotassium dicitratobismuthate, iodide, tibolone, tibric acid, tibrofan, tic-mustard, ticabesone 35 triprolidine, tritiozine, tritoqualine, trityl cysteine, trixolane, propionate, ticarbodine, ticarcillin, ticarcillin cresyl, trizoxime, trocimine, troclosene potassium, trofosfamide, ticlatone, ticlopidine, ticrynafen, tidiacic, tiemoium iodide, troleandomycin, trolnitrate, tromantadine, tromethamine, tienocarbine, tienopramine, tienoxolol, tifemoxone, tropabazate, tropanserin, tropapride, tropatepine, tropen tiflamizole, tiflorex, tifluadom, tiflucarbine, tiformin, tifurac, Ziline bromide, tropicamide, tropigline, tropiprine, tigemonam, tigestol, tigloidine, tilbroquinol, tiletamine, 40 tropodifene, trospectomycin, trospium chloride, troxerutin, tilidine, tiliquinol, tilisolol, tilmicosin, tilomisole, tilorone, troxipide, troxolamide, troxonium tosilate, troxypyrrolium tilozepine, tilsuprost, timefurone, timegadine, timelotem, tosilate, troxypyrrolium tosilate, truxicurium iodide, truxi timepidium bromide, timiperone, timobesone acetate, picurium iodide, tryparsamide, tryptophan, tryptophane timofibrate, timolol, timonacic, timoprazole, tinabinol, mustard, tuaminoheptane, tubercidine, tubocurarine tinazoline, tinidazole, tinisulpride, tinofedrine, tinoridine, 45 chloride, tubulozole, tuclazepam, tulobutrol, tuvatidine, tiocarlide, tioclomarol, tioconazole, tioctilate, tiodazosin, tybamate, tylocrebin, tylosin, tyramine, tyropanic acid, tiodonium chloride, tiomergine, tionesterone, tioperidone, tyrosine, ubenimex, ubidecarenone, ubisindine, ufenamate, tiopinac, tiopronin, tiopropamine, tiospirone, tiotidine, ufiprazole, uldazepam, ulobetasol, undecoylium chloride, tioxacin, tioxamast, tioxaprofen, tioxidazole, tioxolone, undecyclenic acid, uracil mustard, urapidil, urea, uredepa, tipentosin, tipepidine, tipetropium bromide, tipindole, 50 uredofos, urefibrate, urethane, uridine, ursodeoxycholic tipredane, tiprenolol, tiprinast, tipropidil, tiprostanide, acid, ursucholic acid, vadocaine, Valconazole, valdetamide, tiprotimod, tiquinamide, tiquizium bromide, tiratricol, valdipromide, valine, valnoctamide, valofane, valperinol, tiropramide, tisocromide, tisopurine, tisoquone, tivandizole, valproate pivoxil, valproic acid, valpromide, valtrate, van tixadil, tixanox, tixocortol pivalate, tizabrin, tianidine, comycin hel, vane prim, vanillin, vanitolide, tizolemide, tizoprolic acid, tobramycin, tobuterol, tocainide, 55 vanyldisulfamide, vapiprost, vecuronium bromide, velma tocamphyl, tocofenoxate, tocofibrate, tocophersolan, crine maleate, venlafaxine, veradoline, veralipride, todralazine, tofenacin, tofetridine, tofisoline, tofisopam, verapamil, verazide, verilopam, verofylline, vesnarinone, tolamolol, tolazamide, tolazoline, tolboxane, tolbutamide, vetrabutine, vidarabine, vidarabine phophate, vigabatrin, tolciclate, toldimfos, tolfamide, tolfenamic acid, tolgabide, viloxazine, viminol, vinbarbital, vinblastine, vinburnine, tolimidone, tolindate, toliodium chloride, toliprolol, 60 vincamine, Vincanol, Vincantril, vincofos, vinconate, tolmesoxide, tolmetin, tolnaftate, tolnapersine, tolnidamine, vincristine, vindrburnol, vindesine, vindepidine, vinformide, toloconium metilsulfate, tolonidine, tolonium chloride, vinglycinate, vinorelbine, vinpocetine, vinpoline, toloxatone, toloxychlorinol, tolpadol, tolpentamide, vinrosidine, vintiamol, vintriptol, vinylbital, vinylether, tolperisone, toliprazole, tolpromine, tolpropamine, vinzolidine, viomycin, viprostol, vidualine, viguidil, virgin tolpyrramide, tolduinzole, tolrestat, toltraZuril, tolufazepam, 65 iamycin factors, viroxime, visnadine, visnafylline, vitamine, tolycaine, tomelukast, tomoglumide, tomoxetine, volazocine, warfarin, xamoterol, xanoxic acid, xanthinol tomoxiprole, tonazocine, topiramate, toprilidine, niacinate, xanthiol, xantifibrate, xantocillin, xenalipin, xena US 6,680,047 B2 59 60 zoic acid, xenbucin, xenipentone, xenthiorate, xenygloxal, lation of cells expressing the target structure and a further xenyhexenic acid, xenytropium bromide, xibenolol, population of cells not expressing the target. Radioactive, xibornol, xilobam, ximoprofen, xinidamine, xinomiline, fluorescent or enzyme-labelled streptavidin/avidin may be xipamide, xipranolol, xorphanol, xylamidine, xylazine, xylocoumarol, xylometazoline, xyloxemine, yohimbic acid, used to analyse biotin attachment. Zabicipril, Zacopride, zafuleptine, zaltidine, zapizolam, Zaprinast, Zardaverine, Zenazocine mesylate, Zepastine, EXAMPLE 1. Zeranol, Zetidoline, Zidapamide, zidometacin, zidovudine, zilantel, Zimeldine, zimidoben, zinc acetate, zinc Preparation and Biological Evaluation of Multiple phenolsulfonate, zinc undecylenate, zindotrine, zindoxifene, 10 specific Qas-containing Microbubbles of DSPS Zinoconazole, Zinterol, zinviroxime, zipeprol, zocainone, zofenopril, Zoficonazole, zolamine, Zolazepam, Zolenzepine, ‘Doped’ with a Lipopeptide Consisting of a zolertine, zolimidine, zoliprofen, Zoloperone, zolpidem, Heparin Sulphate Binding Peptide (KRKR) and a zome bazam, Zome pirac, Zome tapine, Zonisamide, Fibronectin Peptide (WOPPRARI) zopiclone, Zorubicin, zote pine, Zoxazolamine, Zuclomiphene, Zuclophenthixol, Zylofuramine. 15 This example is directed at the preparation of targeted The following non-limitative examples serve to illustrate microbubbles comprising multiple peptidic vectors arranged the concept of multiple receptor specificity. Other combina in a linear sequence. tions of vectors, spacers and reporters and conjugation a) Synthesis of a Lipopeptide Consisting of a Heparin technologies leading to multiple vector incorporation are Sulphate Binding Peptide (KRKR) and Fibronectin Peptide also considered relevant to this invention. Confirmation of (WOPPRARI)

O

NH

O O O H N § N N s’ H H H O O

H2N

O O H H N N OH N N H i O O O

NH NH

HN NH2 HN NH2 the microparticulate nature of products is performed using The lipopeptide was synthesised on a ABI 433A auto microscopy as described in WO-A-9607434. Ultrasonic matic peptide synthesiser starting with Fmoc-Ile-Wang resin transmission measurements may be made using a broadband 60 (Novabiochem) on a 0.1 mmol scale using 1 mmol amino transducer to indicate suspensions of products giving an acid cartridges. All amino acids and palmitic acid were increased sound beam attenuation compared to a standard. preactivated using HBTU before coupling. The simulta Flow cytometric analysis of products can be used to confirm neous removal of peptide from the resin and side-chain attachment of antibodies thereto. The ability of targeted protecting groups was carried out in TFA containing 5% agents to bind specifically to cells expressing a target may be 65 phenol, 5% EDT, 5% anisole and 5% H2O for 2 hours giving studied by microscopy and/or using a flow chamber con a crude product yield of 150 mg. Purification by preparative taining immobilised cells, for example employing a popu HPLC (Vydac 218TP1022 column) of a 40 mg aliquot of US 6,680,047 B2 61 62 crude material was carried out using a gradient of 70 to cells. Control bubbles not carrying the vector did not adhere 100% B over 40 min (A=0.1% TFA/water and B=MeOH) at to the endothelial cells and disappeared from the cells under a flow rate of 9 mL/min. After lyophilization 16 mg of pure minimal flow conditions. material was obtained (Analytical HPLC; Gradient, d) In Vivo Experiment in Dog 70–100% B where B-MeOH, A=0.01% TFA/water: Case 1) column—vydac 218TP54: Detection—UV 260 and A 22 kg mongrel dog was anaesthetized with pentobar fluorescence, Ex2so, Emsso–product retention time=19.44 bital and mechanically ventilated. The chest was opened by min). Further product characterization was carried out using a midline sternotomy, the anterior pericardium was MALDI mass spectrometry; expected, M+H at 2198, found, removed, and a 30 mm gelled silicone rubber spacer was at 21.99. 10 inserted between the heart and a P5–3 transducer of an ATL b) Preparation of Gas-containing Microbubbles of DSPS HDI-3000 ultrasound scanner. The scanner was set for ‘Doped’ with a Multiple-specific Lipopeptide Consisting of intermittent short axis imaging once in each end-systole by a Heparin Sulphate Binding Peptide (KRKR) and Fibronec delayed EGC triggering. tin Peptide (WOPPRARI) A net volume of 2 mL of microbubbles from b) were DSPS (Avanti, 4.5 mg) and lipopeptide from a) (0.5 mg) 15 injected as a rapid intravenous bolus. 3 seconds later, the were weighed into each of 2 vials and 0.8 mL of a solution imaged right ventricle was seen to contain contrast material, of 1.4% propylene glycol/2.4% glycerol was added to each another 3 seconds later, the left ventricle was also filled, and vial. The mixture was warmed to 80° C. for 5 minutes (vials a transient attenuation shadow that obscured the view of the shaken during warming). The samples were cooled to room posterior parts of the left ventricle was observed. A substan temperature and the head space flushed with perfluorobutane 20 tial increase in brightness of the myocardium was seen, also gas. The vials were shaken in a cap mixer for 45 s and the in the portions of the heart distal to the left ventricle when microbubbles rolled overnight. Bubbles were washed sev the attenuation shadow subsided. eral times with deionised water and analysed by Coulter After passage of the inital bolus, the ultrasound scanner counter (Size: 1–3 micron (87%), 3–5 micron (11.5%)) and was set to continuous, high frame rate high output power acoustic attenuation (frequency max att.: 3.5 MHz). The 25 imaging, a procedure known to cause destruction of utra microbubbles were stable at 120 mm Hg. sound contrast agent bubbles in the imaged tissue regions. MALDI mass spectral analysis was used to confirm After a few seconds, the scanner was adjusted back to its incorporation into DSPS microbubbles as follows; ca. initial setting. The myocardium was then darker, and closer 0.05–0.1 mL of microbubble suspension was transferred to to the baseline value. Moving the imaged slice to a new a clean vial and 0.05–0.1 mL methanol added. The suspen 30 sion was sonicated for 30 s and the solution analysed by position resulted in re-appearance of contrast effects, mov MALDIMS. Positive mode gave M+H at 2200, expected for ing the slice back to the initial position again resulted in a lipopeptide, 2198. tissue brightness again close to baseline. c) In Vitro Study of Gas-containing Microbubbles of DSPS Case 2) [Comparative] ‘Doped’ with a Multiple-specific Lipopeptide Consisting of 35 A net volume of 2 mL microbubbles prepared in an a Heparin Sulphate Binding Peptide (KRKR) and Fibronec identical manner to b) above with the exception that no tin Peptide (WOPPRARI): Binding to Endothelial Cells lipopeptide was included in the preparation was injected, Under Flow Conditions using the same imaging procedure as above. The myocardial The human endothelial cell line ECV 304, derived from a echo enhancement was far less intense and of shorter normal umbilical cord (ATCC CRL-1998) was cultured in 40 duration than observed in case 1. At the completion of the 260 mLNunc culture flasks (chutney 153732) in RPMI 1640 left ventricular attenuation phase, there was also almost medium (Bio Whittaker) to which L-Glutamine 200 mM, complete loss of myocardial contrast effects, and a myocar Penicillin/Streptomycin (10.000 U/mL and 10.000mcg/mL) dial echo increases in the posterior part of the left ventricle and 10% Fetal Bovine Serum (Hyclone Lot no. AFE 5183) as in case 1 was not observed. were added. 45 The cells were subcultured with a split ratio of 1:5 to 1:7 EXAMPLE 2 when reaching confluence. Cover-glasses, 22 mm in diam eter (BDH, Cat no. 406/0189/40) were sterilised and placed Multiple-specific Gas-containing Microbubbles of on the bottom of 12 well culture plates (Costar) before cells DSPS ‘Doped with RGDC-Mal-PEG-ooo-DSPE in 0.5 mL complete medium with serum was added on top. 50 and a Lipopeptide Consisting of a Heparin Sulphate When the cells reached confluence the coverslips were Binding Peptide (KRKR) and Fibronectin Peptide placed in a custom made flow-chamber. The chamber con (WOPPRARI) sists of a groove carved into a glass plate upon which the cover slip with cells was placed with the cells facing the This example is directed at the preparation of targeted groove forming a flow channel. Ultrasound microbubbles 55 microbubbles comprising multiple peptidic vectors. from section b) were passed from a reservoir held at 37 a) Synthesis of 3-Maleimidopropionylamido-PEG2000-acyl degree Celsius through the flow chamber and back to the distearoyl phosphatidylethanolamine (PE-PEG-MAL) reservoir using a peristaltic pump. The flow rate was A mixture of distearoyl phosphatidyl ethanolamine adjusted to simulate physiological relevant shear rates. The (DSPE), (37.40 mg, 0.005 mmol), N-hydroxysuccinimido flow chamber was placed under a microscope and the 60 PEG2000-maleimide, NHS-PEG-MAL, (100 mg, 0.25 interaction between the microspheres and cells viewed mmol) and triethylamine (35 ul, 0.25 mmol) in a solution of directly. A camera mounted on the microscope was con chloroform/methanol (3:1) was stirred at room temperature nected to a colour video printer and a monitor. for 24 hours. After evaporation of the solvents under reduced A gradual accumulation of the microbubbles on the cells pressure, the residue was purified by flash chromatography took place which was dependant on the flow rate. By 65 (chloroform/methanol, 8:2). The product was obtained as a increasing the flow rate the cells started to become detached white wax, 92 mg (66%) and structure was verified by NMR from the coverslip, the microbubbles were still bound to the and maldi-MS. US 6,680,047 B2 63 64 b) Synthesis of RGDC h. Excess reagent was separated from the modified protein The RGDC peptide was synthesised on a ABI 433A on a NAP-5 column (Pharmacia). automated peptide synthesiser (0.25 mmol scale, Fmoc-Cys c) Conjugation of Thiolated Anti-CD62 and Anti-ICAM-1 (Trt)-Wang resin, (Novabiochem). All amino acids were Antibodies to Gas-containing Microbubbles Encapsulated activated using HBTU. The crude peptide was removed with DSPS and DSPE-PEG2000-MAL from the resin and simultaneously deprotected in TFA con 0.5 mL of the mixed thiolated antibody preparation from taining 5% EDT, 5% phenol and 5% water. Following b) was added to an aliquot of microbubbles from a) and the evaporation of the excess cleavage solution the peptide was conjugation reaction allowed to proceed for 30 min on a precipitated and triturated several times with diethyl ether roller table. Following centrifugation at 2000 rpm for 5 min before air drying. The crude peptide was purified by pre 10 the infranatant was removed. The microbubbles were parative hplc and fractions containing pure product com washed a further three times with water. bined and freeze dried. Final characterisation was performed The PEG spacer length may also be varied to include using analytical hplc and MALDI MS. longer e.g. PEGsaoo and PEGsooo or shorter e.g. PEGooo or c) Preparation of Multiple-specific Gas-filled Microbubbles PEGsoo chains. Addition of a third antibody such as Encapsulated by Phosphatidylserine and ‘Doped’ with 15 thiolated-anti-CD34 is also envisaged. RGDC-Mal-PEGsaoo-DSPE and a Lipopeptide Comprising a Heparin Sulphate Binding Peptide (KRKR) and Fibronec EXAMPLE 4 tin Peptide (WOPPRARI) Targeted Multiple-specific Gas-containing DSPS (Avanti, 5.0 mg), lipopeptide (0.5 mg) from Microbubbles of DSPS Coated Non-covalently with example 1 a) and PE-PEG-MAL (0.5 mg) from section a) 20 was weighed into a clean vial and 1.0 mL of a solution of Polylysine and a Fusion Peptide Comprising a PS 1.4% propylene glycol/2.4% glycerol added. The mixture Binding Component and a Fibronectin Peptide was sonicated for 3–5 mins, warmed to 80° C. for 5 minutes Sequence then filtered through a 4.5 micron filter. The mixture was NH.F.N.F.R.L.K.A.G.O.K.I.R.F.G.G.G.G.W.O.P.P.R.A.I. cooled to room temperature and the head space flushed with 25 OH. perfluorobutane gas. The vials were shaken in a cap mixer a) Synthesis of PS Binding/Fibronectin Fragment Fusion for 45 s and the microbubbles centrifuged at 1000 rpm for Peptide 3 minutes. The infranatant was exchanged with 1 mL of PBS NH.F.N.F.R.L.K.A.G.O.K.I.R.F.G.G.G.G.W.O.P.P.R.A.I. containing 1 mg of the peptide RGDC and the pH adjusted OH. to 8. The conjugation reaction was allowed to proceed for 2 30 The peptide was synthesised on an ABI 433A automatic h. The bubbles were washed in PBS then with water until all peptide synthesiser starting with Fmoc-Ile-Wang resin unreacted RGDC had been removed from the infranatant as (Novabiochem) on a 0.1 mmol scale using 1 mmol amino observed by MALDI-MS. The microbubbles were further acid cartridges. All amino acids were preactivated using analysed by Coulter counter (98% between 1 and 7 micron). HBTU before coupling. d) In Vitro Binding Assay 35 The simultaneous removal of peptide from the resin and The binding of microbubbles to endothelial cells was side-chain protecting groups was carried out in TFA con carried out under flow conditions using the in vitro assay taining 5% phenol, 5% EDT and 5% H2O for 2 hours giving described in example 1c). A gradual accumulation of the a crude product yield of 302 mg. Purification by preparative microbubbles on the cells took place which was dependant HPLC (Vydac 218TP1022 column) of a 25 mg aliquot of on the flow rate. Control bubbles not carrying the vectors did 40 crude material was carried out using a gradient of 20 to 40% not adhere to the endothelial cells detaching from the cells B over 40 min (A=0.1% TFA/water and B=0.1% TFA/ under minimal flow conditions. acetonitrile) at a flow rate of 9 mL/min. After lyophilization 10 mg of pure material was obtained (Analytical HPLC; EXAMPLE 3 Gradient, 20 to 50% B where B=0.1% TFA/acetonitrile, Preparation of Multiple-specific Gas-containing 45 A=0.01% TFA/water: column—vydac 218TP54: Detection—UV 214 and 260 nm-product retention time= Microbubbles Encapsulated with DSPS and 12.4 min). Further product characterization was carried out Thiolated Anti-CD62-Mal-PEG2000-PE and using MALDI mass spectrometry; expected, M+H at 2856, Thiolated-anti-ICAM-1-Mal-PEG2000-PE found, at 2866. This example is directed at the preparation of 50 b) Preparation of Microbubbles of DSPS Coated Non microbubbles comprising multiple antibody vectors for tar covalently with Polylysine and the PS Binding/Fibronectin geted ultrasound. Fragment Fusion Peptide a) Preparation of Gas-containing Microbubbles Encapsu NH.F.N.F.R.L.K.A.G.O.K.I.R.F.G.G.G.G.W.O.P.P.R.A.I. lated with DSPS and PE-PEG-ooo-MAL OH. DSPS (Avanti, 4.5 mg) and PE-PEG2000-Maleimide from 55 DSPS (5 mg, Avanti) was weighed into a clean vial along example 2a) (0.5 mg) were weighed into a clean vial and 1 with poly-L-lysine (Sigma, 0.2 mg) and peptide from a) mL of a solution of 1.4% propylene glycol/2.4% glycerol above (0.2 mg). To the vial was added 1.0 mL of a solution added. The mixture was warmed to 80° C. for 5 minutes then of 1.4% propylene glycol/2.4% glycerol. The mixture was filtered through a 4.5 micron filter. The sample was cooled warmed to 80° C. for 5 minutes. The sample was cooled to to room temperature and the head space flushed with per 60 room temperature and the head space flushed with perfluo fluorobutane gas. The vials were shaken in a cap mixer for robutane gas. The vials were shaken in a cap mixer for 45 s 45s and the microbubbles washed three times with distilled and the microbubbles centrifuged at 1000 rpm for 3 minutes. Water. Following extensive washing with water, PBS and water b) Thiolation of Anti-CD62 and Anti-ICAM-1 Antibodies the final solution was examined for polylysine and peptide To 0.3 mg each of anti-CD62 and anti-ICAM-1 antibodies 65 content using MALDI MS. No polypeptide material was dissolved in PBS buffer (pH 7, 0.5 mL) was added Traut’s observed in the final wash solution. Acetonitrile (0.5 mL) reagent and the solutions stirred at room temperature for 1 was then added and the microbubbles destroyed by sonica US 6,680,047 B2 65 66 tion. Analysis of the resulting solution for polylysine and c) Synthesis of Biotinyl-fibrin-anti-polymerant Peptide PS-binding/fibronectin fusion peptide was then carried out (Biotin-GPRPPERHOS.NH.) using MALDI MS. The results were as follows: This peptide was synthesised and purified using similar protocols to those described in section b) above. The pure product was characterised by hplc and MALDI MS. d) Preparation of Multiple-specific Gas-filled Microbubbles MALDI expected MALDI found Encapsulated with Phosphatidylserine and Biotin-PEGs loo Poly-L-lysine 786,914, 1042, 1170 790, 919, fl-Alanine Cholesterol 1048, 1177 DSPS (Avanti, 4.5 mg) and biotin-PEGsaoo-fl-Alanine DSPS-binding peptide 2856 2866 10 cholesterol from section a) (0.5 mg) were weighed into a vial and 0.8 mL of a solution of 1.4% propylene glycol/2.4% The spacer element contained within the PS binding/ glycerol added. The mixture was warmed to 80° C. for 5 Fibronectin fusion peptide (-GGG-) can also be replaced minutes (vials shaken during warming). The sample was with other spacers such as PEG2000 or poly alanine (-AAA-). cooled to room temperature and the head space flushed with It is also envisaged that a form of pre-targeting may be 15 perfluorobutane gas. The vial was shaken in a cap mixer for employed, whereby the DSPS binding/Fibronectin fragment 45 s and the microbubbles rolled overnight. The fusion peptide is firstly allowed to associate with cells via microbubble suspension was washed several times with the fibronectin peptide binding. This is followed by admin deionised water and analysed by Coulter counter and acous istration of PS microbubbles which then bind to the PS tic attenuation. binding peptide. 20 e) Conjugation with Fluorescein Labelled Streptavidin and Biotinylated Peptides from Section b) and c) EXAMPLE 5 To the microbubble preparation from d) was added fluo rescein conjugated streptavidin (0.2 mg) dissolved in PBS (1 Multiple-specific Gas-containing Microbubbles mL). The bubbles were placed on a roller table for 3 h at Encapsulated with Phosphatidylserine and Biotin 25 room temperature. Following extensive washing with water PEGsaoo-alanyl-cholesterol and Functionalised with and analysis by fluorescence microscopy the microbubbles Streptavidin/biotinyl-endothelin-1 Peptide (Biotin were incubated in 1 mL of PBS containing biotinyl D-Trp-Leu-Asp-Ile-Ile-Trp.OH) and Biotinyl-fibrin Endothelin-1 peptide (0.5 mg) and biotinyl-Fibrin-anti anti-polymerant Peptide (Biotin polymerant peptide (0.5 mg) from sections b) and c) respec GPRPPERHOS.NH.) 30 tively for 2 h. Extensive washing of the microbubbles was performed to remove unconjugated peptide. This example is directed at the preparation of targeted ultrasound microbubbles whereby streptavidin is used as a EXAMPLE 6 linker between biotinylated reporter(s) and vector(s). Multiple-specific Gas-filled Microbubbles a) Synthesis of Biotin-PEGsaoo-fl-Alanine Cholesterol 35 Encapsulated with Phosphatidylserine and a To a solution of cholesteryl-[3-alanine hydrochloride (15 Biotinylated Lipopeptide Used to Prepare a mg, 0.03 mmol) in 3 mL chloroform/wet methanol (2.6:1), Streptavidin Sandwich with a Mixture of was added triethylamine (42 mL, 0.30 mmol). The mixture Biotinyl-endothelin-1 Peptide (Biotin-D-Trp-Leu was stired for 10 minutes at room temperature and a solution Asp-Ile-Ile-Trp.OH) and Biotinyl-fibrin-anti of biotin-PEGsaoo-NHS (100 mg, 0.03 mmol) in 1,4-dioxan 40 polymerant Peptide (Biotin-GPRPPERHOS.NH2) (1 mL) was added dropwise. After stirring at room tempera a) Synthesis of Lipopeptide Dipalmitoyl-lysinyl ture for 3 h, the mixture was evaporated to dryness and the tryptophanyl-lysinyl-lysinyl-lysinyl(biotinyl)-glycine residue purified by flash chromatography to give white The lipopeptide was synthesised on a ABI 433A auto crystals, yield; 102 mg (89%). The structure was verified by matic peptide synthesiser starting with Fmoc-Gly-Wang MALDI-MS and NMR. 45 resin (Novabiochem) on a 0.1 mmol scale using 1 mmol b) Synthesis of Biotinylated Endothelin-1 Peptide (Biotin amino acid cartridges. All amino acids and palmitic acid D-Trp-Leu-Asp-Ile-Ile-Trp.OH) were preactivated using HBTU before coupling. The simul The peptide was synthesised on a ABI 433A automatic taneous removal of peptide from the resin and side-chain peptide synthesiser starting with Fmoc-Trp(Boc)-Wang protecting groups was carried out in TFA containing 5% resin (Novabiochem) on a 0.1 mmol scale using 1 mmol 50 phenol, 5% EDT, 5% anisole and 5% H2O for 2 hours giving amino acid cartridges. All amino acids were preactivated a crude product yield of 150 mg. Purification by preparative using HBTU before coupling. HPLC (Vydac 218TP1022 column) of a 40 mg aliquot of The simultaneous removal of peptide from the resin and crude material was carred out using a gradient of 70 to 100% side-chain protecting groups was carried out in TFA con B over 40 min (A=0.1% TFA/water and B=MeOH) at a flow taining 5% anisole and 5% H2O for 2 hours giving a crude 55 rate of 9 mL/min. After lyophilization 14 mg of pure product yield of 75 mg. Purification by preparative HPLC material (Analytical HPLC; Gradient, 70–100% B where (Vydac 218TP1022 column) of a 20 mg aliquot of crude B=MeOH, A=0.01% TFA/water; column—vydac 218TP54. material was carried out using a gradient of 30 to 80% B Detection—UV 260 and fluorescence, Ex280, Em350– over 40 min (A=0.1% TFA/water and B=0.1% TFA/ product retention time=22 min). Further product character acetonitrile) and a flow rate of 9 mL/min. After lyophiliza 60 ization was carried out using MALDI mass spectrometry; tion of the pure fractions 2 mg of pure material was obtained expected, M+H at 1478, found, 1471. (Analytical HPLC; Gradient, 30–80% B where B=0.1% b) Preparation of Gas-containing Microbubbles of DSPS TFA/acetonitrile, A=0.01% TFA/water: column—vydac ‘Doped’ with the Biotinylated Lipopeptide Sequence from 218TP54: Detection—UV 214 mm—product retention time= Section a) 12.6 min). Further product characterization was carried out 65 DSPS (Avanti, 4.5 mg) and lipopeptide from a) (0.5 mg) using MALDI mass spectrometry; expected, M+H at 1077, were weighed into each of 2 vials and 0.8 mL of a solution found, 1077. of 1.4% propylene glycol/2.4% glycerol was added to each US 6,680,047 B2 67 68 vial. The mixture was warmed to 80° C. for 5 minutes (vials seconds, whereafter the sample is put on a roller table. After shaken during warming). The samples were cooled to room centrifugation the infranatant is exchanged with water and temperature and the head space flushed with perfluorobutane the washing is repeated. gas. The vials were shaken in a cap mixer for 45 s and the c) Coupling of Streptavidin to Gas-filled Microbubbles microbubbles formed rolled overnight. The microbubbles 5 Encapsulated with Phosphatidylserine and Succ-PEGsaoo were washed several times with deionised water and analy DSPE sed by Coulter counter and acoustic attenuation. Streptavidin is covalently bound to Succ-PEGsaoo-DSPE MALDI mass spectral analysis was used to confirm in the membrane by standard coupling methods using a incorporation into DSPS microbubbles as described in water-soluble carbodiimide. The sample is placed on a roller example 1b). 10 table during the reaction. After centrifugation the infranatant c) Preparation of Multiple-specific Gas-filled Microbubbles is exchanged with water and the washing is repeated. The Encapsulated with Phosphatidylserine and a Biotinylated functionality of the attached streptavidin is analysed by Lipopeptide and Functionalised with Streptavidin/biotinyl binding, e.g. to fluorescently labeled biotin, biotinylated endothelin-1 Peptide (Biotin-D-Trp-Leu-Asp-Ile-Ile antibodies (detected with a fluorescently labeled secondary Trp.OH)/biotinyl-fibrin-anti-polymerant Peptide (Biotin 15 antibody) or biotinylated and fluorescence- or radioactively GPRPPERHOS.N.H.) labeled oligonucleotides. Analysis is performed by fluores The microbubble preparation from b) above was treated in cence microscopy or scintillation counting. an analogous manner to that described in example 5 section d) Preparation of Multiple-specific Gas-filled Microbubbles e). Encapsulated with Phosphatidylserine and Streptavidin 20 Succ-PEGsaoo-DSPE Non-covalently Functionalised with EXAMPLE 7 Biotinylated Human Transferrin and Human Endothelium Multiple-specific Gas-filled Microbubbles IgG Antibody Encapsulated with Phosphatidylserine and Biotin Microbubbles from section c) are incubated in a solution DPPE Used to Prepare a Streptavidin Sandwich containing human transferrin and human endothelium IgG with a Mixture of Biotinyl-endothelin-1 Peptide 25 antibody biotinylated using the method described by Bayer (Biotin-D-Trp-Leu-Asp-Ile-Ile-Trp.OH) and et al., Meth. Enzymol., 62, 308. The vector-coated Biotinyl-fibrin-anti-polymerant Peptide (Biotin microbubbles are washed as described above. GPRPPERHOS.NH.) EXAMPLE 9 a) Preparation of Biotin Containing Microbubbles 30 To a mixture of phosphatidylserine (5 mg, Avanti) and Multiple-specific Gas-filled Microbubbles biotin-DPPE (0.6 mg, Pierce) in a clean vial was added 5% Encapsulated with Phosphatidylserine/streptavidin propyleneglycol-glycerol in water (1 mL). The dispersion Succ-PEG-DSPE and the Oliaonucleotides Biotin was heated to 80° C. for 5 minutes and then cooled to GAAAGGTAGTGGGGTCGTGTGCCGG and ambient temperature. The head space was then flushed with 35 Biotin-GGCGCTGATGATGTTGTTGATTCTT perfluorobutane and the vial shaken in a cap-mixer for 45 a) Synthesis of Succ-PEGsaoo-DSPE seconds. After centrifugation the infranatant was removed Described in Example 8a) and the microbubbles formed washed extensively with b) Preparation of Gas-filled Microbubbles Encapsulated Water. with Phosphatidylserine and Succ-PEGs oo-DSPE b) Conjugation of Gas-filled Microbubbles Encapsulated 40 Described in Example 8b) with Phosphatidylserine and Biotin-DPPE with Streptavidin c) Coupling of Streptavidin to Gas-filled Microbubbles and a Mixture of Biotinyl-Endothelin-1 (Biotin-D-Trp-Leu Encapsulated with Phosphatidylserine and Succ-PEGsaoo Asp-Ile-Ile-Trp.OH) and Biotinyl-Fibrin-anti-polymerant DSPE Peptide (Biotin-GPRPPERHOS.NH2) Described in Example 8c). The procedure detailed in example 5 section e) was 45 d) Preparation of Gas-filled Microbubbles Encapsulated followed. with Phosphatidylserine/streptavidin-Succ-PEG-DSPE and EXAMPLE 8 the Oligonucleotides biotin-GAAAGGTAGTGGGGTCGT GTGCCGG and Biotin-GGCGCTGATGATGTTGTTGAT Multiple-specific Gas-filled Microbubbles TCTT Encapsulated with Phosphatidylserine, Streptavidin 50 Microbubbles from section c) are incubated in a solution Succ-PEG-DSPE and a Mixture of Biotinylated containing a mixture of biotin-GAAAGGTAGTGGGGT Human Endothelium IgG Antibody and CGTGTGCCGG and biotin-GGCGCTGATGATGTTGT Biotinylated Transferrin TGATTCTT. The oligonucleotide-coated microbubbles are a) Synthesis of Succ-PEGs loo-DSPE washed as described above. Binding of the oligonucleotide NH2-PEGsaoo-DSPE is carboxylated using succinic 55 to the bubbles is detected e.g. by using fluorescent-labeled anhydride, e.g. by a similar method to that described by oligonucleotides for attachment to the bubbles, or by hybri Nayar, R. and Schroit, A. J. in Biochemistry (1985) 24, dising the attached oligonucleotide to a labeled 5967–71. (fluorescence or radioactivity) complementary oligonucle b) Preparation of Gas-filled Microbubbles Encapsulated otide. The functionality of the oligonucleotide-carrying with Phosphatidylserine and Succ-PEGsaoo-DSPE 60 microbubbles is analysed, e.g. by hybridising the bubbles To a mixture (5 mg) of phosphatidylserine (90–99.9 mol with immobilized DNA-containing sequences complemen %) and Succ-PEGsaoo-DSPE (10–0.1 mol %) is added 5% tary to the attached oligonucleotide. propyleneglycol-glycerol in water (1 mL). The dispersion is Other useful examples include an oligonucleotide heated to not more than 80° C. for 5 minutes and then cooled complementary to ribosomal DNA (of which there are many to ambient temperature. The dispersion (0.8 mL) is trans 65 copies per haploid genome) and an oligonucleotide comple ferred to a vial (1 mL) and the head space is flushed with mentary to an oncogene (e.g. ras of which there is one copy perfluorobutane. The vial is shaken in a cap-mixer for 45 per haploid genome) are used. US 6,680,047 B2 69 70 EXAMPLE 10 mTorr for 24 h to remove excess solvent. The powder was reconstituted as a suspension of hollow particles by addition Multiple-specific Gas-filled Microbubbles of 1.0 mL water. The resulting ultrasound contrast agent was Encapsulated with Phosphatidylserine and confirmed by microscopy observation, Coulter size Phosphatidylethanolamine Covalently distribution, acoustic attenuation and resistance to external Functionalised with the Fibronectin and Transferrin pressure. Proteins b) Synthesis of Biotin-D-Trp-Leu-Asp-Ile-Ile-Trp.OH a) Microbubbles Preparation Described in Example 5b) DSPS (Avanti, 4.5 mg) and DSPE (Avanti, 1.0 mg) were c) Conjugation of Polymer Particles Incorporating Avidin weighed into a clean vial and 1 mL of a solution of 1.4% 10 The particles from a) were centrifuged and the superna propylene glycol/2.4% glycerol added. The mixture was tant replaced with 1 mL of PBS buffer pH 7.5 containing 0.2 warmed to 80° C. for 5 minutes then filtered through a 4.5 mg of biotin-GGCGCTGATGATGTTGTTGATTCTT and micron filter. The sample was cooled to room temperature 0.2 mg of biotin-D-Trp-Leu-Asp-Ile-Ile-Trp.OH from b) and the head space flushed with perfluorobutane gas. The above. After incubation for 24 h the particles were washed vial was shaken in a cap mixer for 45s and the microbubbles 15 extensively with PBS and water. washed two times with distilled water then resuspended in 0.1 M sodium borate buffer pH 9. EXAMPLE 12 b) Modification of Fibronectin/Transferrin Fibronectin (0.5 mg) and transferrin (1.3 mg) were mixed Functionalisation of Gas-filled Albumin in PBS and a solution containing NHS-fluorescin in DMSO 20 Microspheres (GAM) with Biotin for Multiple added. The mixture was stirred at room temperature for 1 specific Targeting hour then the protein purified on a Superdex 200 column. a) Preparation of Biotinylated Albumin Microspheres The fluorescein-labelled protein mixture in phosphate buffer A homogeneous suspension of GAM (6×10° particles/ pH 7.5 was freeze dried. mL) in 5 mg/mL albumin was used, with all manipulations c) Microbubble Modification 25 being carried out at room temperature. Two 10 mL aliquots The freeze-dried product from b) was re-dissolved in 0.5 were centrifuged (170×g, 5 minutes) to promote floatation of mL water and to the fluorescein labelled fibronectin/ the microspheres and 8 mL of the underlying infranatant was transferrin mixture was added 0.1 mmol of the crosslinker removed by careful suction and replaced by an equal volume SDBP (Pierce). The solution was incubated on ice for 2 30 of air-saturated phosphate buffered saline, the preparations hours, charged on a NAP-5 column and eluted with PBS. To being rotated for 15–20 minutes to resuspend the micro this was added 1 mL of the microbubble suspension from a) spheres. This procedure was repeated twice, whereafter only and incubation allowed to proceed for 2 h at room tempera negligible amounts of free non-microsphere-associated ture on a roller table. Unreacted material was removed by albumin were assumed to remain. 50 ul of NHS-biotin (10 allowing the microbubbles to float then replacing the buffer 35 mM in dimethylsulphoxide) was added to one of the aliquots with water, this process was repeated 3 times. (final concentration 50 un?); the other (control) aliquot received 50 ul of dimethylsulphoxide. The tubes containing EXAMPLE 11 the samples were rotated for 1 hour whereafter 20 ul portions of 50% aqueous glutaraldehyde were added to each tube to Preparation of Multiple-specific Hollow Polymer 40 crosslink the microspheres. After rotation for another hour Particles Incorporating Avidin in the Polymer Wall the tubes were positioned vertically overnight to allow Conjugated with the Oligonucleotide Biotin floatation of the microspheres. The next day, the suspensions GGCGCTGATGATGTTGTTGATTCTT and the were washed twice with phosphate buffered saline contain Endothelin-1 Peptide Biotin-D-Trp-Leu-Asp-Ile-Ile ing 1 mg/mL human serum albumin (PBS/HSA) and were Trp.OH resuspended in PBS/HSA after the last centrifugation. 45 In order to determine the presence of microsphere This example is directed at the preparation of polymeric associated biotin, streptavidin conjugated to horseradish ultrasound contrast agents comprising multiple vectors peroxidase (strep-HRP) was added to both suspensions and attached to non-surfactant for targeting/therapeutic applica the tubes were rotated for 1 hour to allow for reaction. The tions. 50 microspheres were then washed three times, resuspended in a) Preparation of Polymer Particles Incorporating Avidin in 100 mM citrate-phosphate buffer (pH 5) containing 0.1 the Polymer Wall mg/mL phenylenediamine dihydrochloride and 0.01% Hollow polymer particles of P73 (as described in patent hydrogen peroxide, and rotated for 10 minutes. Develop WO 96/07434) containing avidin were prepared by a process ment of a yellow-green colour was indicative of the presence involving the freeze-drying of an oil-in-water emulsion 55 of enzyme. The following results were obtained: using the following procedure: An oil solution was prepared by dissolving 0.25 g of the biodegradable polymer P73 [poly(ethylidene bis(16-hydroxyhexadecanoate) co (adipic Sample Colour development acid)] in 5 mL of camphene at 60° C. To 0.2 mL of the oil solution was added 2 mg avidin. An aqueous solution was 60 Biotinylated spheres + strp-HRP 2+ then prepared by dissolving 0.4 g of the polymer, a-(16 Control spheres + strp-HRP + he x a de cano y loxy he x a de can oy 1) - w - This confirms that GAM were biotinylated. methoxypolyoxyethylene ester, in 20 mL of water at 60° C. The oil solution (0.2 mL) was then mixed with of the b) Multiple-specific Gas-containing Microparticles aqueous solution (0.8 mL) in a vibromixer (Capmix) for 15 65 The biotinylated microspheres are then used to prepare s to form the oil-in-water emulsion. The emulsion was multiple-specific targeting products in an analogous manner frozen in dry ice and methanol then dried at a pressure of 200 to those exemplified in examples 5), 6) and 7). US 6,680,047 B2 71 72 EXAMPLE 1.3 Detection—UV 260—product retention time=20–22 min). Further product characterization was carried out using MALDI mass spectrometry; expected, M+H at 1922, found, at 1920. Multiple-specific Gas-containing Microbubbles of b) Synthesis of a Lipopeptide Containing a Heparin Sulphate DSPS Functionalised with Heparin Sulphate Binding Sequence and a Fibronectin Peptide Binding Peptide/Fibronectin Peptide/RGD Peptide Synthesis and Purification Described in Example 1a) and Fluorescein c) Preparation of Multiple-specific Gas-containing Microbubbles of DSPS Functionalised with a Heparin Sul 10 phate Binding Peptide a Fibronectin Peptide, Acetyl-RGD a) Synthesis of a Lipopeptide Containing the RGD Sequence Peptide and Fluorescein and a Fluorescein Reporter Group: Dipalmitoyl-Lys-Lys DSPS (Avanti, 4 mg) and lipopeptide from a) (0.5 mg, 0.2 Lys-Lys? Acetyl-Ara-Gly-Asp-Lys(Fluorescein)]Gly.OH mmol) and lipopeptide from b) (0.5 mg) were weighed into

O

NH HO HO

HN O O O O O O O H H H

Js N "J's N Js- N N JJ- N Js H H # H H É H O O \ E O

O NH NH2

COOH 2’ |

O O OH

The lipopeptide was synthesised as described in example 55 each of 2 vials and 0.8 mL of a solution of 1.4% propylene 1) using commercially available amino acids and polymers. glycol/2.4% glycerol was added to each vial. The mixture The lipopeptide was cleaved from the resin in TFA contain was warmed to 80° C. for 5 minutes (vials shaken during ing 5% water, 5% phenol, 5% EDT for 2 h. Following warming). The samples were cooled to room temperature evaporation in vacuo the crude product was precipitated and and the head space flushed with perfluorobutane gas. The triturated with diethyl ether. Purification by preparative 60 vials were shaken in a cap mixer for 45 s and the HPLC (Vydac 218TP1022 column) of a 40 mg aliquot of microbubbles formed rolled overnight. The microbubbles crude material was carried out using a gradient of 60 to were washed several times with deionised water and 100% B over 40 min (A=0.1% TFA/water and B=0.1% analysed by MALDI mass spectrometry as described in TFA/acetonitrile) at a flow rate of 9-mL/min. After lyo example 1b). The microbubbles following analysis by philization 10 mg of pure material (Analytical RPLC; 65 microscopy were seen to consist of a range of sizes between Gradient, 60–100% B where B=0.1% TFA/acetonitrile), 1 and 5 micron. Furthermore the microbubbles were fluo A=0.01% TFA/water: column—vydac 218TP54: rescent. US 6,680,047 B2 73 74 EXAMPLE 1.4 b) Preparation of Gas-containing Microbubbles of DSPS ‘Doped’ with a Endothelial Cell Binding Lipopeptide and PE-PEG2000-MAL Multiple-specific Gas Containing Microbubbles of DSPS (Avanti, 4.5 mg) and lipopeptide from a) (0.5 mg) DSPS Covalently Modified with CD71 FITC along with PE-PEG2000-Maleimide from example 2 (0.5 labelled Anti-transferrin Receptor Antibody and mg) were weighed into a clean vial and 1 mL of a solution ‘Doped’ with a Lipopeptide with Affinity for of 1.4% propylene glycol/2.4% glycerol added. The mixture Endothelial Cells was warmed to 80° C. for 5 minutes then filtered through a 4.5 micron filter. The sample was cooled to room tempera This example is directed at the preparation of multiple to ture and the head space flushed with perfluorobutane gas. vector targeted ultrasound agents. The vials were shaken in a cap mixer for 45 s and the a) Synthesis of an Endothelial Cell Binding Lipopeptide microbubbles washed three times with distilled water. 2-n-hexadecylstearyl-Lys-Leu-Ala-Leu-Lys-Leu-Ala-Leu c) Thiolation of FITC-labelled Anti-transferrin Receptor Lys-Ala-Leu-Lys-Ala-Ala-Leu-Lys-Leu-Ala-NH2 Antibody 15 FITC labelled CD71 anti-transferrin receptor Ab (100 The lipopeptide shown below was synthesised on a ABI mg/mL, Becton Dickinson), 0.7 ml, in PBS was modified 433A automatic peptide synthesiser starting with a Rink with Traut’s reagent (0.9 mg, Pierce) at room temperature amide resin on a 0.1 mmol scale using 1 mmol amino acid for 1 h. Excess reagent was separated from modified protein cartridges. on a NAP-5 column (Pharmacia).

O | O | O | sº $J.# Js# N ^ - H O E H O - H O

N N

O | O | O

N Js= N Js= N $Js= N N–H| | = | = | = | H H O - H O H O H O

50 All amino acids and 2-m-hexadecylstearic acid were pre d) Conjugation of Thiolated FITC-labelled Anti-transferrin activated using HBTU before coupling. The simultaneous Receptor Antibody to Gas-containing Microbubbles of removal of peptide from the resin and side-chain protecting DSPS ‘Doped with an Endothelial Cell Binding Lipopep groups was carried out in TFA containing 5% EDT, and 5% tide and DSPE-PEG2000-MAL H2O for 2 hours giving a crude product yield of 150 mg. 55 A 0.5 mL aliquot of the protein fraction (2 mL in total) from c) above was added to the microbubbles from b) and Purification by preparative RPLC (Vydac 218TP1022 the conjugation reaction allowed to proceed for 10 min on a column) of a 40 mg aliquot of crude material was carried out roller table. Following centrifugation at 1000 rpm for 3 min using a gradient of 90 to 100% B over 50 min (A=0.1% the protein solution was removed and the conjugation TFA/water and B=MEOH) at a flow rate of 9 mL/min. After 60 repeated a further two times with 1 mL and 0.5 mL aliquots lyophilization 10 mg of pure material was obtained of protein solution respectively. The bubbles were then (Analytical HPLC; Gradient, 90–100% B where B=MeOH, washed four times in distilled water and a sample analysed A=0.01% TFA/water: column—vydac 218TP54: for the presence of antibody by flow cytometry and micros Detection—UV 214 mm—product retention time=23 min). copy. A fluorescent population of >92% was observed. Further product characterization was carried out using 65 Incorporation into the microbubbles of lipopeptide was MALDI mass spectrometry; expected, M+H at 2369, found, confirmed by MALDI mass spectrometry as described in at 2373. example 1b). US 6,680,047 B2 75 76 EXAMPLE 1.5 of a solution containing 1.4% propylene glycol/2.4% glyc erol in water added. The mixture was warmed to 80° C. for Preparation of Multiple-specific Transferrin/Avidin 5 minutes (vials shaken during warming) and filtered while Coated Gas-filled Microbubbles for Targeted still hot through a 40 micron filter. The samples were cooled Ultrasound Imaging to room temperature and the head space flushed with per This example is directed to the preparation of fluorobutane gas. The vials were shaken in a cap mixer for microbubbles containing multiple protein vectors for tar 45s and the microbubbles placed on roller table overnight. geted ultrasound/therapy. Bubbles were washed several times with deionised water a) Synthesis of a Thiol Functionalised Lipid Molecule and analysed for thiol group incorporation using Ellmans Dipalmitoyl-Lys-Lys-Lys-Aca-Cys.OH Reagent.

O

~~~~~~~~'sN - s’ H # H O F

NH2

NH2

S O H º N OH H O O

The lipid structure shown above was synthesised on a ABI 45 c) Modification of Transferrin and Avidin with Fluorescein 433A automatic peptide synthesiser starting with Fmoc-Cys NHS and Sulpho-SMPB (Trt)-Wang resin (Novabiochem) on a 0.25 mmol scale using 1 mmol amino acid cartridges. All amino acids and palmitic To a mixture of 2 mg of transferrin (Holo, human, Alpha acid were preactivated using HBTU coupling chemistry. Therapeutic Corp) and 2 mg of avidin (Sigma) in PBS (1 The simultaneous removal of peptide from the resin and 50 mL) was added 0.5 mL DMSO solution containing 1 mg deprotection of side-chain protecting groups was carried out Sulpho-SMPB (Pierce) and 0.5 mg Fluorescein-NHS in TFA containing 5% EDT, and 5% H2O for 2 hours giving (Pierce). The mixture was stirred for 45 minutes at room a crude product yield of 250 mg. Purification by preparative temperature then passed through a Sephadex 200 column HPLC (Vydac 218TP1022 column) of a 40 mg aliquot of using PBS as eluent. The protein fraction was collected and crude material was carried out using a gradient of 90 to 55 100% B over 50 min (A=0.1% TFA/water and B=MeOH) at stored at 4° C. prior to use. a flow rate of 9 mL/min. After lyophilization 24 mg of pure d) Microbubble Conjugation with Modified Transferrin/ material was obtained (Analytical HPLC; Gradient, Avidin 70–100% B where B=0.1% TFA/acetonitrile, A=0.01% TFA/water; column—vydac 218TP54: Detection—UV 214 60 To the thiol containing microbubbles from b) was added mm-product retention time=23 min). Further product char 1 mL of the modified transferrin/avidin protein solution c). acterization was carried out using MALDI mass spectrom After adjusting the pH of the solution to 9 the conjugation etry; expected, M+H at 1096, found, at 1099. reaction was allowed to proceed for 2 h at room temperature. b) Preparation of Gas-containing Microbubbles of DSPS Following extensive washing with deionised water the ‘Doped’ with a Thiol Containing Lipid Structure 65 microbubbles were analysed by Coulter counter (81% DSPS (Avanti, 4.5 mg) and the lipid structure from a) between 1 and 7 micron) and fluorescence microscopy above (0.5 mg) were weighed into a clean vial and 0.8 ml (highly fluorescent microbubbles were observed). US 6,680,047 B2 77 78 EXAMPLE 16 The structure shown above was synthesised using a manual nitrogen bubbler apparatus starting with Fmoc pro Preparation of Functionalised Gas-filled tected Rink Amide MBHA resin (Novabiochem) on a 0.125 Microbubbles for Targeted Ultrasound Imaging mmol scale. All amino acids were purchased from Nova This example is directed to the preparation of 5 biochem and palmitic acid from Fluka. Coupling was carried microbubbles having a reactive group on the surface for non-specific targeting, principally utilising disulphide out using standard TBTU/HOBt/DIEA protocols. Bro exchange reactions to effect binding to a multiplicity of moacetic acid was coupled through the side-chain of Lys as cellular targets. a symmetrical anhydride using DIC preactivation. Captopril DSPS (Avanti, 5.0 mg) and the thiol containing lipid 10 (Sigma) dissolved in DMF was introduced on the solid structure from example 15a)(1.0 mg) were weighed into a phase using DBU as base. clean vial and 0.8 ml of a solution containing 1.4% propy lene glycol/2.4% glycerol in water added. The mixture was Simultaneous removal of the peptide from the resin and warmed to 80° C. for 5 minutes (vials shaken during 15 warming) and filtered while still hot through a 40 micron deprotection of side-chain protecting groups was carried out filter. The samples were cooled to room temperature and the in TFA containing 5% EDT, 5% water and 5% ethyl methyl head space flushed with perfluorobutane gas. The vials were sulphide for 2 h. An aliquot of 10 mg of the crude material shaken in a cap mixer for 45 s and the microbubbles placed was purified by preparative liquid chromatography (Vydac on roller table overnight. Bubbles were washed several 20 218TP1022 column) using a gradient of 70 to 100% B over times with deionised water and analysed for thiol group 60 min (A=0.1% TFA/water and B=0.1% TFA/acetonitrile) incorporation using Ellmans Reagent. at a flow rate of 10 mL/min. After lyophilization a yield of 2 mg of pure material was obtained (analytical HPLC. EXAMPLE 1.7 gradient 70–100% B over 20 min, A=0.1% TFA/water and Multiple-specific Gas-containing Microbubbles of 25 B=0.1% DSPS Comprising a Lipopeptide for Endothelial Cell Targeting and a Captopril Containing Molecule TFA/acetonitrile; flow rate 1 mL/min; column Vydac This example is directed to the preparation of ultrasound 218TP54; detection UV 214 mm; retention time 26 min). agents for combined targeting and therapeutic applications. 30 Further characterisation was carried out using MALDI mass a) Synthesis of a Lipopeptide Functionalised with Captopril spectrometry, giving M+H at 1265 as expected. ~~~~~~~~O

O § N > H O

O H

N Js: NH2 H = O -

O O OH

NH2 ~'s: N US 6,680,047 B2 79 80 b) Synthesis of a Lipopeptide with Affinity for Endothelial mL of a solution of 1.4% propylene glycol/2.4% glycerol Cells: Dipalmitoyl-Lys-Lys-Lys-Aca-Ile-Ara-Ara-Val-Ala was added to each vial. The mixture was warmed to 80° C. Arr-Pro-Pro-Leu-NH2 for 5 minutes (vials shaken during warming). The samples

O

~~~~~~~~ NH2

O O H H

~~~~~~~~ N "J's: N *Svºs 2 S. H = H O F O

NH2

H2N NH

O O O O H H H O NH2 N N N N N : N : N : N H O © 2 S. O N O *NH *NH

The lipopeptide was synthesised on a ABI 433A auto were cooled to room temperature and the head space flushed matic peptide synthesiser starting with Rink amide resin 45 with perfluorobutane gas. The vials were firstly shaken in a (Novabiochem) on a 0.1 mmol scale using 1 mmol amino acid cartridges. All amino acids and palmitic acid were cap mixer for 45 s then rolled for 1 h followed by extensive preactivated using HBTU before coupling. The simulta washing with deionised water. No detectable levels of start neous removal of peptide from the resin and side-chain ing material were found in the final wash solution as protecting groups was carried out in TFA containing 5% 50 evidenced by MALDI MS. MALDI mass spectral analysis phenol, 5% EDT and 5% H2O for 2 hours giving a crude was used to confirm incorporation of the products from product yield of 160 mg. Purification by preparative HPLC section a) and b) into the microbubbles as described in (Vydac 218TP1022 column) of a 35 mg aliquot of crude example 1b). material was carried out using a gradient of 70 to 100% B d) In Vitro Study of Gas-containing Microbubbles of DSPS over 40 min (A=0.1% TFA/water and B=MeOH) at a flow 55 Comprising a Lipopepitole for Endothelial Cell Targeting rate of 9 mL/min. After lyophilization 20 mg of pure and a Captopril Containing Molecule for Therapeutic Appli material was obtained (Analytical HPLC; Gradient, cations 70–100% B where B-MeOH, A=0.01% TFA/water: column—vydac 218TP54: Detection—UV 214 and 260 The in vitro assay described in example 1c) was used to nm—product retention time=16 min). Further product char 60 examine cell binding under flow conditions. A gradual acterization was carried out using MALDI mass accumulation of the microbubbles on the cells took place specstrometry; expected, M+H at 2050, found, at 2055. which was dependant on the flow rate. By increasing the c) Preparation of Gas-containing Microbubbles of DSPS flow rate the cells started to become detached from the Comprising a Lipopeptide for Endothelial Cell targeting and coverslip, the microbubbles were still bound to the cells. a Captopril Containing Molecule for Drug Delivery 65 Control bubbles not carrying the vector did not adhere to the DSPS (Avanti, 4.5 mg), product from a) (0.5 mg) and endothelial cells and disappeared from the cells under mini product from b) (0.5 mg) were weighed into a vial and 1.0 mal flow conditions. US 6,680,047 B2 81 82 EXAMPLE 1.8 sulphate or lipopeptide could be detected in the infranatant Preparation of Multiple-specific Gas-containing by MALDI-MS. Microscopy showed that the size distribu Microbubbles of DSPS Loaded with a Lipopeptide tion of the bubble population was-between 1–8 micron as Comprising a Helical Peptide with Affinity for cell desired. To the washed bubbles (ca. 0.2 mL) was added Membranes and the Peptide Antibiotic Polymixin B methanol (0.5 mL) and the mixture placed in a sonic bath for Sulphate 2 min. The resulting clear solution, following analysis by MALDI-MS, was found to contain both lipopeptide and This example is directed at the preparation of targeted microbubbles comprising multiple peptidic vectors having a polymixin B sulphate (expected 1203, found 1207). combined targeting and a therapeutic application. 10 a) Synthesis of a Lipopeptide Comprising a Helical Peptide EXAMPLE 1.9 with Affinity for Cell Membranes:hexadecylstearyl-Lys Leu-Ala-Leu-Lys-Leu-Ala-Leu-Lys-Ala-Leu-Lys-Ala-Ala Preparation of Multiple-specific Gas-containing Leu-Lys-Leu-Ala-NH2 Microbubbles of DSPS ‘Doped’ with a Lipopeptide Described in Example 14 a) 15 Comprising a IL-1 Receptor Binding Sequence and b) Preparation of Multiple-specific Gas-containing Modified with a Branched Structure Containing the Microbubbles Drug Methotrexate DSPS (Avanti, 5.0 mg), lipopeptide from a)(0.3 mg) and polymixin B sulphate (Sigma,0.5 mg) were weighed into a This example is directed at the preparation of targeted clean vial and 1.0 mL of a solution of 1.4% propylene 20 microbubbles comprising multiple vectors for targeted/ glycol/2.4% glycerol added. The mixture was sonicated for 3–5 mins, warmed to 80° C. for 5 minutes then filtered therapeutic/drug release applications. through a 4.5 micron filter. The mixture was cooled to room a) Synthesis of a Lipopeptide Comprising an Interleukin-1 temperature and the head space flushed with perfluorobutane Receptor Binding Peptide: Dipalmitoyl-Lys-Gly-Asp-Trp gas. The vial was shaken in a cap mixer for 45 s and the Asp-Gln-Phe-Gly-Leu-Trp-Arg-Gly-Ala-Ala.OH

o” H

O O O

N N S. s’ | | s | H O H O § H 2^s NH

H–N Sº N—H NH

H O O O ! N J. N J. N Jss N Js N JsE O s | | = | § H O H O - H 2. N—H

H

65 microbubbles centrifuged at 1000 rpm for 3 minutes. The The lipopeptide was synthesised on a ABI 433A auto microbubbles were washed in water until no polymixin B matic peptide synthesiser starting with Fmoc-Ala-Wang US 6,680,047 B2 83 84 resin (Novabiochem) on a 0.1 mmol scale using 1 mmol mixture was cooled to room temperature and the head space amino acid cartridges. All amino acids and palmitic acid flushed with perfluorobutane gas. The vials were shaken in were preactivated using HBTU before coupling. The simul a cap mixer for 45 s and the microbubbles centrifuged at taneous removal of lipopeptide from the resin and side-chain 1000 rpm for 3 minutes following which the infranatant was protecting groups was carried out in TFA containing 5% discarded. H2O, 5% anisole, 5% phenol and 5% EDT for 2 hours giving d) Conjugation of Methotrexate Branched Structure to Thi a crude product yield of 150 mg. Purification by preparative olated Microbubbles HPLC (Vydac 218TP1022 column) of a 30 mg aliquot of The methotrexate structure from b) above (0.5 mg) was crude material was carried out using a gradient of 90 to dissolved in PBS pH 8.0. The solution was then added to the 100% B over 40 min (A=0.1% TFA/water and B=MeOH) at 10 thiol containing bubbles from c) and disulphide bond for a flow rate of 9 mL/min. After lyophilization 4 mg of pure mation allowed to proceed for 16 h. Following extensive material was obtained (Analytical HPLC; Gradient, washing with PBS and water the bubbles were analysed by 90–100% B over 20 min where B=MeOH, A=0.01% TFA/ microscopy and MALDI MS. water: column—vydac 218TP54: Detection—UV 214 mm; It is also considered relevant that the disulphide bond product retention time=23 min). Further product character- 15 linking the methotrexate structure to the microbubble may ization was carried out using MALDI mass spectrometry; be reduced in vivo liberating the free drug molecule. This in expected, M+H at 2083, found, at 2088. combination with a tumour specific vector is a drug delivery b) Synthesis of a Branched Methotrexate Core Structure system. A physiologically relevant reducing agent such as Containing a Thiol Moiety glutathione may be used to bring about drug release.

H2N N N COOH

N 2 N OCUS. N O H H NH2 N "J's- N # H O = ºr O O H2N N N N 2. | S | COOH COOH O N 22 N H S N O HN "J's: COOH NH2 N § É "J's- N O `sh # H O O S O COOH

The methotrexate structure was synthesised on a ABI EXAMPLE 20 433A automatic peptide synthesiser starting with Fmoc-Cys (Trt) Tentagel resin on a 0.1 mmol scale. The simultaneous Preparation of Microbubbles Coated with Poly-L removal of product from the resin and deprotection of 45 lysine Complexed to Fluorescein Labeled DNA protecting groups was carried out in TFA containing 5% Fragments from Plasmid pHR322 EDT and 5% H2O for 2 hours giving a crude product yield of 160 mg. Purification by preparative HPLC (Vydac This example is directed to the preparation of 218TP1022 column) of a 30 mg aliquot of crude material microbubbles for gene therapy/anti-sense applications. It is was carried out using a gradient of 10 to 30% B over 40 min 50 envisaged that specific targeting may be achieved by further (A=0.1% TFA/water and B=0.1% TFA/acetonitrile) and a doping of microbubble membranes with vector modified flow rate of 9 mL/min. After lyophilization of the pure lipid structures as described in example 1. fractions 9 mg of pure material was obtained (Analytical a) Preparation of DSPS Gas-containing Microbubbles HPLC; Gradient, 5–50% B where B=0.1% TFA/acetonitrile, DSPS (Avanti, 4.5 mg) was weighed into a clean vial. 1.0 A=0.01% TFA/water: column—vydac 218TP54: 55 mL of a solution of 1.4% propylene glycol/2.4% glycerol Detection—UV 214 mm—product retention time=9.5 min). was added and the mixture sonicated for 2 min then warmed Further product characterization was carried out using to 80° C. for 5 minutes. Immediately following warming the MALDI mass spectrometry; expected, M+H at 1523, found, solution was filtered through a 4 micron filter. The sample 1523. was cooled to room temperature and the head space flushed c) Preparation of Multiple-specific Gas-containing 60 with perfluorobutane gas. The vial was shaken in a cap mixer Microbubbles for 45 s. Bubbles were then washed once with deionised DSPS (Avanti, 4.5 mg) and thiol containing lipopeptide water and the infranatant discarded. The microbubbles were from example 15a) (0.5 mg) and lipopeptide from a) (0.2 then resuspended in 0.5 mL water. mg) above were weighed into a clean vial and 1.0 mL of a b) Preparation of Poly-L-lysine/DNA Complex and Loading solution of 1.4% propylene glycol/2.4% glycerol added. The 65 of DSPS Microbubbles mixture was sonicated for 3–5 mins, warmed to 80° C. for To 1 mg of poly-L-lysine (70–150 kD) in a clean vial was 5 minutes then filtered through a 4.5 micron filter. The added 0.1 mL of a fluorescein labeled digest of plasmid US 6,680,047 B2 85 86 pBR322 (Biorad) dissolved in TE buffer (10 mM tris-HCl, The simultaneous removal of peptide from the resin and pH 8). The solution was made up to a total of 0.6 mL by side-chain protecting groups was carried out in TFA con addition of water and the pH adjusted to 8. Complexation taining 5% phenol, 5% EDT and 5% H2O for 2 hours giving was allowed to proceed for 1 h then 0.05 mL of the a crude product yield of 160 mg. Purification by preparative polylysine-DNA solution was added to the microbubble HPLC (Vydac 218TP1022 column) of a 30 mg aliquot of suspension from a) above. After 1 h microscopy was used to crude material was carried out using a gradient of 10 to 60% show that the bubbles were fluorescent confirming the B over 40 min (where A=0.1% TFA/water and B presence of DNA. acetonitrile) at a flow rate of 9 mL/min. After lyophilization 2.5 mg of pure material was obtained (Analytical HPLC; EXAMPLE 21 10 Gradient, 10–50% B over 20 min where B=0.1% TFA/ acetonitrile and A=0.01% TFA/water: column—vydac Preparation of Multiple-specific Gas-filled 218TP54: Detection—UV 214 and 435 mm—product reten Microbubbles Containing a Branched Core Peptide tion time=21 min). Further product characterization was Comprising a Dabsylated-atherosclerotic Plague carried out using MALDI mass spectrometry; expected, Binding Sequence and RGDS 15 M+H at 2070, found, at 2073. This example is directed to the preparation of b) Preparation of Thiol Containing Gas-filled Microbubbles microbubbles having a thiol group on the surface for modi As Described in Example 15 a) and b) fication with thiol containing vectors for targeting/drug c) Oxidative Coupling of Thiolated Microbubbles with delivery and drug release. psa) Synthesis of the Branched Multiple-specific Peptide Via Disulphide Bond Formation Peptide Dabsyl-Tyr-Arg-Ala-Leu-Val-Asp-Thr-leu-Lys-Lys 20 The infranatant from the microbubbles from b) above was (NH2-Arg-Gly-Asp-Ser)-Gly-Cys.OH discarded and replaced with a solution of dabsyl-peptide

OH

O O

N S—N Js: N : N > \ H - H # H O O O X O NH NH2 NH /

OH O O O H H H N N N N : N : N : OH H `coon O Yºsh

HO O O H

N "J's: N NH H # H O F`coon O

NH

NH

The peptide was synthesised on a ABI 433A automatic from a) (1 mg) in 0.7 mL dil. ammonia solution (pH 8). To peptide synthesiser starting with Fmoc-Cys(Trt)-Tentagel this was added 0.2 mL of a stock solution containing 6 mg resin on a 0.1 mmol scale using 1 mmol amino acid 65 of potassiumferricyanate dissolved in 2 mL of water. The cartridges. All amino acids were preactivated using HBTU vial was placed on a roller table and thiol oxidation allowed before coupling. to proceed for 2 h. The bubbles were then washed exten US 6,680,047 B2 87 88 sively with water until the infranatant was free of the f) Multiple-specific Microparticles dabsyl-peptide as evidenced by hplc and MALDI MS. The biotinylated microspheres are then used to prepare Detection of microbubble bound peptide was carried out multiple-specific targeting products similar to those exem by reduction of the disulphide bond using the water souble plified in examples 5), 6) and 7). reducing agent tris-(2-carboxyethyl)-phosphine. Following reduction the infranatant was found to contain free dabsyl EXAMPLE 23 peptide as evidenced by hplc and MALDI MS. Preparation of Multiple-specific Gas-containing Other physiological relevant reducing agents such as Microbubbles Encapsulated with DSPS and Biotin reduced glutathione are also considered useful for initiating PEGsaoo-acyl-phosphatidylethanolamine and release. Functionalised with Streptavidin, Oligonucleotide 10 Biotin-GAAAGGTAGTGGGGTCGTGTGCCGG EXAMPLE 22 and Biotinylated Fibrin-anti-polymerant Peptide Gas-containing Microparticles Comprising Polymer (Biotin-GPRPPERHOS.NH2) from Ethylidene bis(16-hydroxyhexadecanoate) and a) Synthesis of Biotin-PEGsaoo-acyl-phosphatidyl Ethano Adipoyl Chloride and Biotin-amidocaproate-Ala lamine Covalently Attached to the Polymer 15 A mixture of dipalmitoyl phosphatidyl ethanolamine, a) Synthesis of Z-Ala-polymer (3-O-(carbobenzyloxy-L (21.00 mg, 0.03 mmol), biotin-PEG-CO2-NHS, (100 mg, alanyl)-polymer) 0.03 mmol) and triethylamine (42 ul, 0.30 mmol) in a The polymer is prepared from ethylidene bis(16 solution of chloroform/methanol (3:1) was stirred at room hydroxyhexadecanoate) and adipoyl chloride as described in temperature for 2 hours. After evaporation of the solvents WO-A-9607434, and a polymer fraction with molecular 20 under reduced pressure, the residue was flash chromato weight 10000 is purified using gel permeation chromatog graphed (methylene chloride/methanol/water, 40.8:1). The raphy (GPC). 10 g of the material (corresponding to 1 mmol product was obtained as a yellow gum, 112 mg (94%) and OH groups), Z-alanine (5 mmol) and dimethylaminopyri structure verified by NMR and MALDI-MS. dine (4 mmol) are dissolved in dry dimethylformamide/ b) Binding of Fluorescein-conjugated Streptavidin to Gas tetrahydrofuran and dicyclohexylcarbodiimide is then 25 Filled Microbubbles added. The reaction mixture is stirred at ambient tempera Gas-containing microbubbles were prepared by mixing ture overnight. Dicyclohexylurea is filtered off and the DSPS and biotin-PEGsaoo-acyl-phosphatidyl ethanolamine solvent is removed using rotary evaporation. The product is as described in example 5a). The microbubble suspension purified by chromatography, fractions containing the title was divided into 0.2 mL aliquots and fluorescein conjugated compound are combined and the solvent is removed using 30 streptavidin added as shown in the table below. The samples rotary evaporation. The structure of the product is confirmed were incubated on a roller table for 15 or 30 minutes at by NMR. ambient temperature before removal of excess protein by b) Synthesis of Ala-polymer (3-O-(L-alanyl)-polymer) washing in PBS. Z-Ala-polymer (0.1 mmol) is stirred in toluene/ tetrahydrofuran and glacial acetic acid (15% of the total 35 volume) and hydrogenated in the presence of 5% palladium on charcoal for 2 hours. The reaction mixture is filtered and Results: concentrated in vacuo. Added Particle c) Synthesis of Biotinamidocaproate-Ala-polymer Streptavidin Incubation median Asolution of biotinamidocaproate N-hydroxysuccinimide 40 Aliquot (ug/200:1 time (amb. 9% Fluorescent diameter ester in tetrahydrofuran is added to H2N-Ala-polymer dis in O. sample) temp.) particles (microns) solved in a mixture of tetrahydrofuran and dimethylforma 1 O 2.0 - mide and 0.1 M sodium phosphate buffer having a pH of 7.5. 2 O - 12 (foam) The reaction mixture is heated to 30° C. and stirred vigor 3 0.2 30 min 7.8 3.9 45 (3 x 10-9 mmol) ously; the reaction is followed by TLC to completion. The 4 2 30 min 26.2 4.2 solvent is evaporated and the crude product is used without (3 x 10-9 mmol) further purification. 5 10 15 min 30.5 ima d) Gas-containing Particles Comprising Biotin (1.5 x 10-7 mmol) 6 20 30 min 97.9 5.2 amidocaproate-Ala-polymer and PEG 10000 methyl ether (3 x 10-7 mmol) 16-hexadecanoyloxyhexadecanoate 50 7 40 15 min 96.7 5.1 10 mL of a 5% w/w solution of biotin-amidocaproate (6 x 10–7 mmol) Ala-polymer in (-)-camphene maintained at 60°C. is added 8 DSPS 20 15 min 0.6 3.7 to 30 mL of an 1% w/w aqueous solution of PEG 10000 control (3 x 10-7 mmol) methyl ether 16-hexadecanoyloxyhexadecanoate (prepared as described in WO-A-9607434) at the same temperature. 55 The samples were analysed by flow cytometry and The mixture is emulsified using a rotor stator mixer (Ultra Coulter Counter. The results are summarized in the table Turax(B) T25) at a slow speed for several minutes, and above. thereafter is frozen in a dry ice/methanol bath and lyo c) Conjugation of Streptavin Coated Microbubbles with the philized for 48 hours, giving the title product as a white Oligonucleotide Biotin-GAAAGGTAGTGGGGTCGTGT powder. 60 GCCGG and Biotinylated Fibrin-anti-polymerant Peptide e) Acoustic Characterisation and Microscopy of the Product Biotin-GPRPPERHOS Confirmation of the microparticulate nature of the product The particles from aliquot no. 6 above were centrifuged is performed using light microscopy as described in WO-A and the supernatant replaced with 1 mL of PBS buffer pH 7.5 9607434. Ultrasonic transmission measurements using a 3.5 containing 0.2 mg of biotin-GAAAGGTAGTGGGGTCGT MHz broadband transducer indicate that a particle suspen 65 GTGCCGG and 0.2 mg of biotin-GPRPPERHQS (example sion of ~2 mg/mL gives a sound beam attenuation of at least 5c). After incubation for 24 h the particles were washed 5 dB/cm. extensively with PBS and water. US 6,680,047 B2 89 90 It is envisaged that other biotinylated vectors or thera of Sulpho-SMPB (Pierce) dissolved in 0.05 mL DMSO. The peutic agents may be conjugated to streptavidin or avidin protein solution was left standing at room temperature for 45 coated microbubbles using this procedure. min then purification carried out on a Superdex 200 column. The product was eluted in PBS and the modified protein EXAMPLE 24 fraction collected. c) Preparation of Microbubbles Encapsulated with DSPS/ Preparation of Microbubbles Encapsulated with thrombi-binding Lipopeptide and Thiol Containing Lipoep DSPS and Functionalised with a Thrombi-targeting tide and Conjugation to Modified Tissue Plasminogen Acti Lipopeptide and the Thrombolytic Enzyme Tissue Vator Plasminogen Activator DSPS (Avanti, 5.0 mg) was weighed into a clean vial 10 along with 0.5 mg of the lipopeptide from a) and 0.5 mg of This example is directed at the preparation of thrombus the thiol containing lipopeptide from example 15a). To this targeted US agents comprising a therapeutic thromolytic was added 1.0 mL of a solution of 1.4% propylene glycol/ agent. 2.4% glycerol and the mixture sonicated for 2 min then a) Synthesis of a Lipopeptide with Affinity for Thrombi warmed to 80° C. for 5 minutes. Immediately following (Diplannitoyl-Lys-Asn-Gly-Asp-Phe-Glu-Glu-Ile-Pro-Glu 15 warming the solution was filtered through a 4 micron filter. Glu-Tyr-Leu-Gln.NH2) The sample was cooled to room temperature and the head

COOH COOH O O H H

N "J's- N "J's N H à H H O -Yoosu, O

COOH

COOH

O O O H H O O N N : N : N : NH2 COOH S O F. O S COOH CONH2 OH

The lipopeptide was synthesised on a ABI 433 A auto 50 space flushed with perfluorobutane gas. The vials were matic peptide synthesiser starting with Rink amide resin shaken in a cap mixer for 45 s and the microbubbles washed (Novabiochem) on a 0.1 mmol scale using 1 mmol amino 2 times with deionised water. The infranatant was discarded acid cartridges. All amino acids and palmitic acid were and replaced with a 1 mLaliquot of the protein solution from preactivated using HBTU before coupling. The simulta b) above. The conjugation reaction was allowed to proceed neous removal of peptide from the resin and side-chain 55 protecting groups was carried out in TFA containing 5% for 1 h. The bubbles were centrifuged and infranatant phenol, 5% EDT, 5% anisole and 5% H2O for 2 h giving a exchanged with a further 1 mL of protein solution. The crude product yield of 80 mg. Purification by preparative incubation step was repeated until all protein solution was HPLC (Vydac 218TP1022 column) of a 20 mg aliquot of the used up. The microbubbles were then washed extensively crude material was carried out. After lyophilization 6 mg of 60 with water and analysed by Coulter counter. The pure material was obtained. The product was characterized microbubbles were tested in the flow chamber assay by MALDI mass spectrometry and analytical HPLC. described in example 1c). Microbubbles modified with b) Modification of Tissue Plasminogen Activator with protein were found to bind in higher numbers than those Sulpho-SMPB comprising either lipopeptide/DSPS or DSPS alone. A solution of 0.1 mL of ammonium carbonate buffer 65 It is envisaged that the targeting/therapeutic/ultrasound containing 0.1 mg of t-PA (Sigma) was made up to 0.2 mL activities of these microbubbles be evaluated in models of in by the addition of water. To this solution was added 0.4 mg vitro and in vivo thrombogenisis. US 6,680,047 B2 91 92 EXAMPLE 25 next step without further purification. The structure was verified by *H and **C NMR analysis. Multiple-specific PFB Gas-filled Microbubbles iii) Synthesis of 4-[2-hydroxy-3-[(1-methylethyl)amino] Encapsulated with DSPS and a Lipopeptide propoxy]phenylacetic acid hydrochloride Comprising a Heparin Sulphate Binding Peptide 5 (KRKR) and a Fibronectin Peptide (WOPPRARI) A solution of Methyl for Targeting and a Lipopeptide Containing 4-[2-hydroxy-3-[(1-methylethyl)amino]-propoxy] Atenolol for Therapeutic Applications phenylacetate (563 mg, 2.00 mmol) in 6 M hydrochloric a) Synthesis of a Lipopeptide Consisting of a Heparin acid (15 ml) was heated at 100° C. for 4 h. The reaction Sulphate Binding Peptide (KRKR) and a Fibronectin Pep 10 mixture was concentrated (rotavapor) and the residue was tide (WOPPRARI) taken up in water and lyophilised. "H and **CNMR spectra Synthesis and Purification Described in Example 1a) were in accordance with the structure and MALDI mass b) Synthesis of a Protected Atenolol Derivative Suitable for spectrometry gave a M+H at 268 as expected. Solid Phase Coupling iv) Synthesis of N-Boc-4-[2-hydroxy-3-[(1-methylethyl) i) Synthesis of Methyl 4-[(2,3-epoxy)propoxy]phenylacetate 15 amino]-propoxy]phenylacetic Acid A mixture of methyl 4-hydroxyphenylacetate (4.98 g, A solution of the 4-[2-hydroxy-3-[(1-methylethyl) 0.03 mol), epichlorohydrin (23.5 ml, 0.30 mol) and pyridine amino]-propoxy]phenylacetic acid hydrochloride (2.0 (121 ul, 1.5 mmol) was stirred at 85°C. for 2 h. The reaction mmol) in water (2 ml) was added to a solution of sodium mixture was cooled, and excess epichlorohydrin was dis bicarbonate (0.60 g, 7.2 mmol) in water/dioxane (2:1, 15 tilled off (rotavapor). The residue was taken up in ethyl 20 ml). A solution of di-tert-butyl dicarbonate (0.48 g, 2.2 acetate, washed with brine and dried (Na2SO4) The solution mmol) in dioxane (5 ml) was added. Progress of the reaction was filtered and concentrated. The dark residue was chro was monitored by TLC analysis (silica, CHCls/MeOH/ matographed (silica, hexane/ethyl acetate 7:3) to give 2.25 g AcOH 85:10:5), and portions of di-tert-butyl dicarbonate (34%) of a colourless oil. ‘H (300 MHz) and **C NMR (75 were added until conversion was complete. The reaction MHz) spectra were in accordance with the structure. 25 mixture was poured onto water saturated with potassium ii) Synthesis of Methyl-4-[2-hydroxy-3-[(1-methylethyl) hydrogensulphate and organic material was extracted into amino]-propoxy]phenylacetate ethyl acetate. The organic phase was washed with water and A mixture of methyl 4-[(2,3-epoxy)propoxy] brine, dried (Na2SO) and filtered to give 0.6 g of crude phenylacetate (2.00 g, 9.00 mmol), isopropylamine (23 ml, material. The product was purified by chromatography 0.27 mol) and water (1.35 ml, 74.7 mmol) was stirred at 30 (silica, CHCla/MeOH/AcOH 85:10:5). The solution was room temperature overnight. The reaction mixture was con concentrated and the residue was taken up in glacial acetic centrated (rotavapor) and the oily residue was dissolved in acid and lyophilised. Yield 415 mg (56%), white solid. The chloroform and dried (Na2SO4). Filtration and concentration structure was confirmed by "H and 13C NMR analysis. gave quantitative yield of a yellow oil that was used in the c) Synthesis of a Lipopeptide Functionalised with Atenolol

§ i NH2

i

NH2 HN US 6,680,047 B2 93 94 The structure shown above was synthesised on a manual purified by column chromatography (silica, chloroform) to nitrogen bubbler starting with Fmoc protected Rink Amide give 560 mg (83%) yield of colourless oil. The product was MBHA resin (Novabiochem) on a 0.125 mmol scale, using characterised by MALDI mass spectrometry, giving M+H at amino acids from Novabiochem, palmitic acid from Fluka 674 as expected. Further characterisation was carried out and the compound from a). Coupling was carried out using using "H (500 MHz) and **C (125 MHz) NMR analysis, standard TBTU/HOBt/DIEA protocols. Simultaneous giving spectra in accordance with the structure. removal of the peptide from the resin and deprotection of b) Preparation of Gas-containing Microbubbles of DSPS Comprising a Cholesterol Ester of Chlorambucil for Diag side-chain protecting groups was carried out in TFA con nostic and/or Therapeutic Applications taining 5% EDT and 5% water for 2 h. Crude material was A solution of 1.4% propylene glycol/2.4% glycerol (1.0 precipitated from ether and purified by preparative liquid 10 ml) was added to a mixture of DSPS (Avanti, 4.5 mg) and chromatography (Vydac 218TP1022 column) using a gra product from a) (0.5 mg) in a vial. The mixture was dient of 70 to 100% B over 60 min (A=0.1% TFA/water and sonicated for 5 min and then heated at 80°C. for 5 min (vial B=0.1% TFA/acetonitrile) at a flow rate of 10 ml/min. After was shaken during warming) and cooled. Head space was lyophilisation a yield of 38 mg of pure material was obtained flushed with perfluorobutane gas and the vial was shaken in (analytical HPLC: gradient 70–100% B over 20 min, 15 a cap mixer for 45 s followed by extensive washing with A=0.1% TFA/water and B=0.1% TFA/acetonitrile, flow rate deionised water. MALDI mass spectrometry showed no 1 ml/min, column Vydac 218TP54, detection UV 214 nm, detectable level of compound from a) in the final wash retention time 25 min). Further characterisation was carried solution. Incorporation of chlorambucil cholesteryl ester out using MALDI mass spectrometry (ACH matrix), giving into the bubbles was confirmed by MALDI-MS as follows: M+H at 1258, expected 1257. 20 ca 50 ul of microbubbles were transferred to a clean vial d) Preparation of Gas-filled Microbubbles of DSPS Com containing ca 100 ul of 90% methanol. The mixture was prising a Lipopeptide Consisting of a Heparin Sulphate sonicated for 30 s and analysed by MALDI-MS, giving a Binding Peptide (KRKR) and a Fibronectin Peptide M+H peak at 668 corresponding to structure from a). (WOPPRARI) and a Lipopeptide Containing Atenolol In combination with a tumour specific vector these A solution of 1.4% propylene glycol/2.4% glycerol (1.0 25 microbubbles are considered useful as targeted drug delivery ml) was added to a mixture of DSPS (Avanti, 5.0 mg), agents. product from a) (0.5 mg) and product from c) (0.5 mg) in a vial. The mixture was sonicated for 5 min and then heated EXAMPLE 27 at 80° C. for 5 min (vial was shaken during warming). The Multiple-specific Gas-filled Microbubbles of DSPS solution was filtered and cooled. Head space was flushed 30 Comprising a Lipopeptide Containing Atenolol and with perfluorobutane gas and the vial was shaken in a cap a Cholesterol Derivative of Chlorambucil for mixer for 45s followed by extensive washing with deionised Diagnostic and Therapeutic Applications Water. a) Synthesis of a Protected Atenolol Derivative Suitable for Incorporation of atenolol containing lipopeptide into the Solid Phase Coupling bubbles was confirmed by MALDI-MS as described in 35 As Described in Example 25 Section b) example 1b). b) Synthesis of a Lipopeptide Functionalised with Atenolol e) In Vitro Study of Multiple-specific Gas-filled As Described in Example 25 Section c) Microbubbles c) Synthesis of Cholesterol 4-[4-(bis(2-chloroethyl)amino] In vitro analysis of the microbubble suspension was phenyl]butanoate carried out as described in example 1c). A gradual accumu 40 As Described in Example 25 Section d) lation of the microbubbles on the cells took place which was d) Preparation of Microbubbles of DSPS Comprising a dependant on the flow rate. By increasing the flow rate the Lipopeptide Containing Atenolol and a Cholesterol Ester of cells started to become detached from the coverslip, the Chlorambucil microbubbles were still bound to the cells. Control bubbles A solution of 1.4% propylene glycol/2.4% glycerol (1.0 not carrying the vector did not adhere to the endothelial cells 45 ml) was added to a mixture of DSPS (Avanti, 5.0 mg), and disappeared from the cells under minimal flow condi product from b) (0.5 mg) and c) (0.5 mg) and in a vial. The tions. mixture was sonicated for 5 min and then warmed to 80° C. for 5 min (vial was shaken during warming). The solution EXAMPLE 26 was filtered and cooled. Head space was flushed with PFB Gas-filled Microbubbles of DSPS Containing 50 perfluorobutane gas and the vial was shaken in a cap mixer a Cholesterol Ester of Chlorambucil for Diagnostic for 45 s followed by extensive washing with deionised and Therapeutic Applications water. Incorporation of atenolol containing lipopeptide and chlorabucil analogue into the bubble membrane was con This example is directed at non-specific modification of a firmed by MALDI-MS as described in example 1c). multiplicity of cell receptors on endothelial cells. 55 e) In Vitro Study of Multiple-specific PFB Gas-containing a) Synthesis of Cholesterol 4-[4-(bis(2-chloroethyl)amino] Microbubbles of DSPS Comprising a Lipopeptide Contain phenyl]butanoate ing Atenolol and a Cholesterol Derivative of Chlorambucil DIC (170 ul, 1.10 mmol) was added to a solution of for Diagnostic and Therapeutic Applications chlorambucil (Sigma, 669 mg, 2.20 mmol) in dry dichlo The in vitro assay described in example 1c) was used to romethane (15 ml). The mixture was stirred at room tem 60 assess cellular binding under flow conditions. A gradual perature for 0.5 h and added to a solution of cholesterol accumulation of the microbubbles on the cells took place (Aldrich, 387 mg, 1.00 mmol) and DMAP (122 mg, 1.00 which was dependant on the flow rate. By increasing the mmol) in dichloromethane (10 ml). The reaction mixture flow rate the cells started to become detached from the was stirred overnight and then poured onto 5% sodium coverslip, the microbubbles were still bound to the cells. bicarbonate. The phases were separated and the organic 65 Control bubbles not carrying the vector did not adhere to the phase was washed with brine and dried (MgSO4). The endothelial cells and disappeared from the cells under mini solution was filtered and concentrated and the product was mal flow conditions. US 6,680,047 B2 95 96 EXAMPLE 28 inert atmosphere. The reaction mixture was stirred for 30 Multiple-specific Gas-filled Microbubbles of DSPS min and then transferred to a flask containing a solution of Comprising a Lipopeptide Containing Atenolol for cholesterol (1.16 g, 3.00 mmol) and DMAP (367 mg, 3.00 Cell Targeting and a Lipophilic Thiol Ester of mmol) in dichloromethane (15 ml). The reaction mixture Captopril for Therapeutic Use was stirred for 2 h and then mixed with an aqueous solution a) Synthesis of a Protected Atenolol Derivative Suitable for of potassium hydrogensulphate. The phases were separated Solid Phase Coupling and the aqueous phase extracted with chloroform. The As Described in Example 25 Section b) combined organic phases were washed with aqueous potas b) Synthesis of a Lipopeptide Functionalised with Atenolol sium hydrogensulphate and water and dried over MgSO4. As Described in Example 25 Section c) 10 c) Synthesis of Cholanic Acid Thiol Ester of Captopril After filtration and evaporation the crude product was chro A mixture of 5-3-cholanic acid (Sigma, 361 mg, 1.00 matographed (silica, chloroform/methanol 99:1) to give 1.63 mmol) and DIC (77 ul, 0.50 mmol) in dichloromethane (5 g (97%) of white solid. The structure was confirmed by "H ml) was stirred for 10 min and then added to a solution of NMR (500 MHz) captopril (Sigma, 130 mg, 0.600 mmol) and DBU (180 ul, 15 b) Synthesis of Cholesterol fl-alaninate Hydrochloride 1.20 mmol) in dichloromethane (10 ml). The reaction mix A solution of compound from a) (279 mg, 0.500 mmol) in ture was stirred overnight and then poured onto dilute 1 M hydrochloric acid in 1,4-dioxan (5 ml) was stirred at hydrochloric acid. Chloroform (30 ml) was added. The room temperature for 4 h. The reaction mixture was con phases were separated and the organic phase was washed centrated to give a quantitative yield of cholesteryl with water and brine and dried (MgSO4). After filtration and 20 fl-alaninate hydrochloride. The structure was confirmed by concentration the crude material was chromatographed 1H NMR (500 MHz) analysis and by MALDI mass (silica, chloroform/methanol/acetic acid 95:4:1). The prod spectrometry, giving a M+Na peak at 482, expected 481. uct was lyophilised from a acetonitrile/water/ethanol mix ture. Yield 137 mg (49%) of off-white solid. The structure c) Biotin-PEGsaoo-B-Ala-Cholesterol was verified by *H (500 MHz) and **C (125 MHz) NMR 25 To a solution of cholesteryl B-alaninate hydrochloride (15 spectroscopy. Further characterisation was carried out using mg, 0.03 mmol) in chloroform/wet methanol (2.6:1, 3 ml) MALDI mass spectrometry, giving a M+Na peak in positive was added triethylamine (42 ul, 0.30 mmol). The mixture mode at m/z 584. was stirred for 10 minutes at room temperature and a d) Preparation of Gas-filled Microbubbles of DSPS Com solution of biotin-PEG3400-NHS (100 mg, 0.03 mmol) in prising a Lipopeptide Containing Atenolol for Cell Targeting 30 1,4-dioxane (1 ml) was added dropwise. After stirring at and a Lipophilic Thiol Ester of Captopril for Therapeutic room temperature for 3 hours, the mixture was evapourated Use to dryness and the residue purified by flash chromatography A solution of 1.4% propylene glycol?2.4% glycerol (1.0 to give white crystals, yield; 102 mg (89%). The structure ml) was added to a mixture of DSPS (Avanti, 5.0 mg) and was verified by MALDI-MS and by NMR analysis. product from b) (0.5 mg) and c) (0.5 mg) in a vial. The 35 d) Synthesis of Cholesteryl 4-[4-(bis(2-chloroethyl)amino] mixture was sonicated for 5 min and then heated at 80° C. phenyl]butanoate for 5 min (vial was shaken during warming) and cooled. DIC (170 ul, 1.10 mmol) was added to a solution of Head space was flushed with perfluorobutane gas and the chlorambucil (Sigma, 669 mg, 2.20 mmol) in dry dichlo vial was shaken in a cap mixer for 45 s followed by romethane (15 ml). The mixture was stirred at room tem extensive washing with deionised water. MALDI mass 40 perature for 0.5 h and added to a solution of cholesterol spectrometry showed no detectable level of compound from (Aldrich, 387 mg, 1.00 mmol) and DMAP (122 mg, 1.00 b) and c) in the final wash solution. Incorporation of mmol) in dichloromethane (10 ml). The reaction mixture compounds from b) and from c) into the bubbles was was stirred overnight then poured into a solution of 5% confirmed by MALDI-MS as follows. Ca. 50 ul of sodium bicarbonate. The organic phase was washed with microbubbles were transferred to a clean vial containing ca 45 brine and dried over MgSO4. The solution was filtered and 100 ul of 90% methanol. The mixture was sonicated for 30 concentrated and the product was purified by column chro s and analysed by MALDI-MS (ACH-matrix), giving peaks matography (silica, chloroform) to give 560 mg (83%) yield according to structures from b) and c), respectively. of colourless oil. The product was characterised by MALDI e) In Vitro Study of Gas-containing Microbubbles from d) mass spectrometry, giving M+H at 674 as expected. Further The in vitro assay described in example 1c) was used to 50 characterisation was carried out using "H (500 MHz) and assess cellular binding under flow conditions. A gradual *C (125 MHz) NMR analysis, giving spectra in accordance accumulation of the microbubbles on the cells took place with the structure. which was dependant on the flow rate. By increasing the flow rate the cells started to become detached from the e) Preparation of Gas-filled Microbubbles coverslip, the microbubbles were still bound to the cells. 55 A solution of 1.4% propylene glycol/2.4% glycerol (1.0 Control bubbles not carrying the vector did not adhere to the ml) was added to a mixture of DSPS (Avanti, 5 mg) and endothelial cells and disappeared from the cells under mini product from c) (0.5 mg) and d) (0.5 mg) in a vial. The mal flow conditions. mixture was sonicated for 5 min and then heated at 80° C. for 5 min (vial was shaken during warming) and cooled. EXAMPLE 29 60 Head space was flushed with perfluorobutane gas and the Gas-filled Microbubbles of Phosphatidylserine vial was shaken in a cap mixer for 45 s followed by Comprising Biotinamide-PEG-fl-Ala-Cholesterol extensive washing with deionised water. MALDI mass and a Cholesterol Ester of Chlorambucil for spectrometry showed no detectable level of compound from Diagnostic and Therapeutic Applications c and d) in the final wash solution. a) Synthesis of Cholesterol N-Boc-f-alaninate 65 Incorporation of compounds from c) and d) into the DIC (510 ul) was added to a solution of Boc-fl-Ala-OH bubbles was confirmed by MALDI-MS as described in (1.25 g, 6.60 mmol) in dichloromethane (15 ml) under an example 1b). US 6,680,047 B2 97 98 EXAMPLE 30 Further characterisation was carried out using MALDI mass spectrometry, giving M+H at 1295, expected 1294. Gas-filled Microbubbles of DSPS Comprising a b) Preparation of Gas-filled Microbubbles Comprising a Lipopeptide Containing Chlorambucil for Lipopeptide Containing Chlorambucil for Diagnostic and Diagnostic and Therapeutic Applications Therapeutic Applications A solution of 1.4% propylene glycol/2.4% glycerol (1.0 This example is directed at the preparation of ml) was added to a mixture of DSPS (Avanti, 4.5 mg) and functionalised-microbubbles with non-specific affinity for a product from a) (0.5 mg) in a vial. The mixture was multiplicity of cell surface molecules. sonicated for 5 min and then heated at 80°C. for 5 min (vial a) Synthesis of a Lipopeptide Containing Chlorambucil was shaken during warming) and cooled. Head space was ~~~~~~~~O

O § ~~~~~~~~ N \ H O

O O H N sºs, : NH2 F H O F

l, 2 HN

Cl

The structure shown above was synthesised on a manual flushed with perfluorobutane gas and the vial was shaken in nitrogen bubbler starting with Fmoc protected Rink Amide a cap mixer for 45 s followed by extensive washing with MBHA resin (Novabiochem) on a 0.125 mmol scale. Stan 50 deionised water. MALDI mass spectrometry showed no dard amino acids were purchased from Novabiochem and detectable level of compound from a) in the final wash palmitic acid from Fluka. Coupling was carried out using solution. standard TBTU/HOBt/DIEA protocol. Chlorambucil Incorporation of chlorambucil containing lipopeptide into (Sigma) was coupled through the side-chain of Lys as a the bubbles was confirmed by MALDI-MS as follows. Ca50 symmetrical anhydride using DIC preactivation. Simulta 55 ul of microbubbles were transferred to a clean vial contain neous removal of the peptide from the resin and deprotection ing ca 100 ul of 90% methanol. The mixture was sonicated of side-chain protecting groups was carried out in TFA for 30s and analysed by MALDI-MS (ACH-matrix), giving containing 5% EDT, 5% water and 5% ethyl methyl sulphide a M+H peak at 1300, expected at 1294 and a M+Na peak at for 2 h. An aliqout of 10 mg of the crude material was 1324, expected 1317. purified by preparative liquid chromatography (Vydac 60 c) In Vitro Study of Gas-containing Microbubbles of DSPS 218TP1022 column) using a gradient of 70 to 100% B over ‘Doped’ with a Lipopeptide Containing Chlorambucil for 60 min (A=0.1% TFA/water and B=0.1% TFA/acetonitrile) Diagnostic and Therapeutic Applications at a flow rate of 10 ml/min. After lyophilisation a yield of 30 The microbubbles were evaluated using the in vitro flow mg of pure material was obtained (analytical HPLC: gradi assay described in example 1c). A gradual accumulation of ent 70–100% B over 20 min, A=0.1% TFA/water and 65 the microbubbles on the cells took place which was depen B=0.1% TFA/acetonitrile; flow rate 1 ml/min; column Vydac dant on the flow rate. By increasing the flow rate the cells 218TP54; detection UV 214 mm; retention time 26.5 min). started to become detached from the coverslip, the US 6,680,047 B2 99 100 microbubbles were still bound to the cells. Control bubbles Nunc culture flasks (chutney 153732) in RPMI 1640 not carrying the vector did not adhere to the endothelial cells medium (Bio Whitaker) to which L-Glutamine 200 mM, and disappeared from the cells under minimal flow condi Penicillin/Streptomycin (10.000 U/ml and 10.00 meg/ml) tions. and 10% Fetal Calf Serum (Hyclone Lot no AFE 5183) were added. The cells were subcultured following trypsination EXAMPLE 31 with a split ratio of 1:5 to 1:7 when reaching confluence. 2 Gas-filled Microbubbles of DSPS Comprising a mill. cells from trypsinated confluent cultures were added to Lipopeptide Containing Atenolol and a Lipophilic a set of 5 centrifuge tubes followed by either control Derivative of Captopril for Diagnostic and microbubbles of DSPS, microbubbles from example 1 or Therapeutic Applications 10 microbubbles of DSPS doped with the endothelial cell a) Synthesis of a Protected Atenolol Derivative Suitable for binding lipopeptide from example 14a) at a concentration of Solid Phase Coupling 2, 4, 6, 8 or 10 mill bubbles per tube. The cells at the bottom As Described in Example 25) b) of the tubes after centrifugation at 400 g for 5 minutes were b) Synthesis of N-[(S)-3-hexadecylthio-2-methylpropionyl] counted by Coulter counter. It was found that binding of four or more microbubbles to a cell brought about floatation. proline 15 DIEA (188 ul, 1.10 mmol) was added to a solution of Furthermore all cells were floated by the endothelial cell 1-iodohexadecane (176 mg, 0.500 mmol), captopril (120 binding lipopeptide bubbles while around 50% were floated mg, 0.550 mmol) and DBU (165 ul, 1.10 mmol) in tetrahy with microbubbles from example 1). drofuran (5 ml). The mixture was heated at 70° C. for 2 hand EXAMPLE 33 then concentrated. The residue was poured onto water 20 Gene Transfer by PFB Gas-filled Microbubbles saturated with potassium hydrogensulphate and organic This example is directed at the preparation of targeted material was extracted into chloroform. The organic phase microbubbles for gene transfer. was washed with water and dried (MgSO4). The product a) Preparation of DSPS Lipopeptide Bubbles/PFB Gas, purified by chromatography (silica, CHCls/MeOH/AcOH Coated with Polyl-L-lysine 85:10:5) and lyophilised to give 105 mg (48%) of white 25 DSPS (4.5 mg) and lipopeptide from 17b) (0.5 mg) were solid material. The structure was verified by 1H (500 MHz) weighed in two 2-ml vials. To each vial, 0.8 ml and 13C (125 MHz) analysis and further characterised by propyleneglycol/glycerol (4%) in water was added. The MALDI mass spectrometry, giving M-H in negative mode solution was heated at 80° C. for 5 minutes and shaken. The at m/z 440 as expected. solution was then cooled to ambient temperature and the c) Preparation of Gas-filled Microbubbles of DSPS Com 30 headspace flushed with perfluorobutane. The vials were prising a Lipopeptide Containing Atenolol and a Lipophilic shaken on a Capmix (Espe Capmix, 4450 oscillations/min) Derivative of Captopril for Diagnostic and Therapeutic for 45 seconds and put on a roller table for 5 minutes. The Applications content of the vials were mixed and the sample washed by A solution of 1.4% propylene glycol/2.4% glycerol (1.0 centrifugation at 2000 rpm for 5 minutes. The infranatant was removed and the same volume of distilled water added. ml) was added to a mixture of DSPS (Avanti, 4.5 mg), 35 product from b) (0.5 mg) and c) in a vial. The mixture was The washing procedure was repeated once. poly-L-lysine HBr (Sigma, 20.6 mg) was dissolved in 2 sonicated for 5 min and then heated at 80°C. for 5 min (vial mL water then an aliquot (0.4 mL) made up to 2 mL water. was shaken during warming) and cooled. Head space was To 1.2 mL of the diluted poly-L-lysine solution was added flushed with perfluorobutane gas and the vial was shaken in 0.12 mL of the DSPS-lipopeptide bubble suspension. Fol a cap mixer for 45 s followed by extensive washing with 40 lowing incubation excess polylysine was removed by exten deionised water. MALDI mass spectrometry showed no sive washing with water. detectable level of compound from b) or c) in the final wash b) Transfection of Cells solution. Incorporation of compound b) and c) containing Endothelial cells (ECV304) were cultured in 6 well plates lipopeptide into the bubbles was confirmed by MALDI-MS to a uniform subconfluent layer. A transfection mixture as described in example 1b). 45 consisting of 5 ug DNA (an Enhanced Green Fluorescent d) In Vitro Study of Gas-containing Microbubbles of DSPS Protein vector from CLONTECH) and 50 ul of microbubble Comprising a Lipopeptide Containing Atenolol and a Lipo suspension from a) in RPMI medium at a final volume of philic Derivative of Captopril for Diagnostic and Therapeu 250 ul was prepared. The mixture was left standing for 15 tic Applications min at room temperature then 1 mL of complete RPMI The microbubbles were evaluated using the in vitro flow 50 medium added. The medium was removed from the cell assay described in example 1c). A gradual accumulation of culture dish, and the DNA-microbubble mixture added to the microbubbles on the cells took place which was depen the cells. The cells were incubated in a cell culture incubator dant on the flow rate. By increasing the flow rate the cells (37° C). started to become detached from the coverslip, the microbubbles were still bound to the cells. Control bubbles c) Ultrasonic Treatment 55 After 15 minutes incubation, selected wells were exposed not carrying the vector did not adhere to the endothelial cells to continious wave ultrasound of 1 MHz, 0.5 W/cm3, for 30 and disappeared from the cells under minimal flow condi seconds. tions. d) Incubation and Examination EXAMPLE 32 The cells were further incubated in the cell culture incu 60 bator (37° C) for approximately 4% hours. The medium Floatation of Endothelial Cells by DSPS containing DNA-microbubbles was then removed by Microbubbles Comprising a Multiple-specific aspiration, and 2 ml complete RPMI medium was added. Lipopeptide That Binds to the Endothelial Cells The cells were incubated for 40–70 hours before examina This example was carried out to show that the invention tion. Most of the medium was then removed, and the cells could also be used for cell separation. 65 were examined by fluorescence microscopy. The results The human endothelial cell line ECV 304, derived from a were compared to the results from control experiments were normal umbilical cord (ATCC CRL-1998) was cultures in DNA or DNA-polylysine were added to the cells. US 6,680,047 B2 101 102

SEQUENCE LISTING

<160> NUMBER OF SEQ ID NOS: 27 <210: SEQ ID NO 1 <211: LENGTH : 4 <2 12: TYPE : PRT <213> ORGANISM: Artificial Sequence <2 20: FEATURE : <223> OTHER INFORMATION: Description of Artificial Sequence: Heparin sulphate binding peptide

<400: SEQUENCE: 1 Lys Arg Lys Arg 1

<210: SEQ ID NO 2 <2 11: LENGTH - 8 <2 12: TYPE : PRT <213> ORGANISM: Artificial Sequence <2 20: FEATURE : <223> OTHER INFORMATION: Description of Artificial Sequence: Fibronectin peptide

<400: SEQUENCE: 2 Trp Gln Pro Pro Arg Ala Arg Ile 1 5

<210: SEQ ID NO 3 <2 11: LENGTH - 13 <2 12: TYPE : PRT <213> ORGANISM: Artificial Sequence <2 20: FEATURE : <223> OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide consisting of heparin sulphate binding peptide and fibronectin peptide <221: NAME/KEY: MOD RES <222> LOCATION: (1) <223> OTHER INFORMATION: Dipalmitoyl-lysine <400: SEQUENCE: 3 Lys Lys Arg Lys Arg Trp Gln Pro Pro Arg Ala Arg Ile 1 5 10

<210: SEQ ID NO 4 <211: LENGTH : 4 <2 12: TYPE : PRT <213> ORGANISM: Artificial Sequence <2 20: FEATURE : <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic RGDC sequence <400: SEQUENCE: 4 Arg Gly Asp Cys 1

<210: SEQ ID NO 5 <211: LENGTH : 24 <2 12: TYPE : PRT <213> ORGANISM: Artificial Sequence <2 20: FEATURE : <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic fusion peptide comprising a PS binding component and a fibronectin peptide sequence

<400: SEQUENCE: 5 Phe Asn Phe Arg Leu Lys Ala Gly Gln Lys Ile Arg Phe Gly Gly Gly 1 5 10 15 US 6,680,047 B2 103 104

—continued Gly Trp Gln Pro Pro Arg Ala Ile 20

<210: SEQ ID NO 6 <2 11: LENGTH = 6 <2 12: TYPE : PRT <213> ORGANISM: Artificial Sequence <2 20: FEATURE : <223> OTHER INFORMATION: Description of Artificial Sequence: Biotinylated endothelin-1 peptide <221: NAME/KEY: MOD RES <222> LOCATION: (1) <223> OTHER INFORMATION: Biotin–D–Trp <400: SEQUENCE: 6 Trp Leu Asp Ile Ile Trp 1 5

<210: SEQ ID NO 7 <2 11: LENGTH = 10 <2 12: TYPE : PRT <213> ORGANISM: Artificial Sequence <2 20: FEATURE : <223> OTHER INFORMATION: Description of Artificial Sequence: Biotinylated fibrin-antipolymerant peptide <221: NAME/KEY: MOD RES <222> LOCATION: (1) <223> OTHER INFORMATION: Biotin-Gly <221: NAME/KEY: MOD RES <222> LOCATION: (10) <223: OTHER INFORMATION: AMIDATION

<400: SEQUENCE: 7 Gly Pro Arg Pro Pro Glu Arg His Gln Ser 1 5 10

<210: SEQ ID NO 8 <2 11: LENGTH = 6 <2 12: TYPE : PRT <213> ORGANISM: Artificial Sequence <2 20: FEATURE : <223> OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide <221: NAME/KEY: MOD RES <222> LOCATION: (5) <223> OTHER INFORMATION: Biotinylated—lys <221: NAME/KEY: MOD RES <222> LOCATION: (1) <223> OTHER INFORMATION: Dipalmitoyl-lysine <400: SEQUENCE: 8 Lys Trp Lys Lys Lys Gly 1 5

<210: SEQ ID NO 9 <2 11: LENGTH - 25 <2 12: TYPE : DNA <213> ORGANISM: Artificial Sequence <2 20: FEATURE : <223> OTHER INFORMATION: Description of Artificial Sequence: Biotinylated synthetic oligonucleotide <221: NAME/KEY: misc feature <222> LOCATION: (1) <223> OTHER INFORMATION: Biotinylated <400: SEQUENCE: 9 gaaaggtagt goggtogtgt gcc.gg 25

<210: SEQ ID NO 10 <2 11: LENGTH - 25 <2 12: TYPE : DNA US 6,680,047 B2 105 106

—continued <213> ORGANISM: Artificial Sequence <2 20: FEATURE : <223> OTHER INFORMATION: Description of Artificial Sequence: Biotinylated synthetic oligonucleotide <221: NAME/KEY: misc feature <222> LOCATION: (1) <223> OTHER INFORMATION: Biotinylated <400: SEQUENCE: 10 ggcgctgatg atgttgttga ttctit 25

<210: SEQ ID NO 11 <2 11: LENGTH - 5 <2 12: TYPE : PRT <213> ORGANISM: Artificial Sequence <2 20: FEATURE : <223> OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide containing the RGD sequence and a fluorescein reporter group <221: NAME/KEY: MOD RES <222> LOCATION: (1) <223> OTHER INFORMATION: Dipalmitoyl-lys <221: NAME/KEY: MOD RES <222> LOCATION: (4) <223> OTHER INFORMATION: Acetyl-RGD–K-fluorescein side chain <400: SEQUENCE: 11 Lys Lys Lys Lys Gly 1 5

<210: SEQ ID NO 12 <2 11: LENGTH = 18 <2 12: TYPE : PRT <213> ORGANISM: Artificial Sequence <2 20: FEATURE : <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic endothelial cell binding lipopeptide <221: NAME/KEY: MOD RES <222> LOCATION: (1) <223> OTHER INFORMATION: 2–n-hexadecylstearyl-lysine <221: NAME/KEY: MOD RES <222> LOCATION: (18) <223: OTHER INFORMATION: AMIDATION

<400: SEQUENCE: 12 Lys Leu Ala Leu Lys Leu Ala Leu Lys Ala Leu Lys Ala Ala Leu Lys 1 5 10 15

Leu Ala

<210: SEQ ID NO 13 <2 11: LENGTH - 5 <2 12: TYPE : PRT <213> ORGANISM: Artificial Sequence <2 20: FEATURE : <221: NAME/KEY: MOD RES <222> LOCATION: (1) <223> OTHER INFORMATION: Dipalmitoyl-lysine <221: NAME/KEY: MOD RES <222> LOCATION: (4) <223> OTHER INFORMATION: Acp <223> OTHER INFORMATION: Description of Artificial Sequence: Thiol functionalised lipid molecule <400: SEQUENCE: 13 Lys Lys Lys Xaa Cys 1 5

<210: SEQ ID NO 14 <211: LENGTH : 4 <2 12: TYPE : PRT <213> ORGANISM: Artificial Sequence US 6,680,047 B2 107 108

—continued

FEATURE : NAME/KEY: MOD RES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-lysine NAME/KEY: MOD RES LOCATION: (4) OTHER INFORMATION: Amide-linked via side chain to captopril NAME/KEY: MOD RES LOCATION: (4) OTHER INFORMATION: AMIDATION OTHER INFORMATION: Description of Artificial Sequence: Synthetic lipopeptide functionalised with captopril SEQUENCE: 14 Lys Lys Lys Lys 1

SEQ ID NO 15 LENGTH - 13 TYPE : PRT ORGANISM: Artificial Sequence FEATURE : OTHER INFORMATION: Description of Artificial Sequence: Synthetic lipopeptide with affinity for endothelial cells NAME/KEY: MOD RES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-lysine NAME/KEY: MOD RES LOCATION: (4) OTHER INFORMATION: Acp NAME/KEY: MOD RES LOCATION: (13) OTHER INFORMATION: AMIDATION

SEQUENCE: 15 Lys Lys Lys Xaa Ile Arg Arg Val Ala Arg Pro Pro Leu 1 5 10

SEQ ID NO 16 LENGTH = 14 TYPE : PRT ORGANISM: Artificial Sequence FEATURE : OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide comprising an interleukin 1 receptor binding peptide NAME/KEY: MOD RES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-lysine SEQUENCE: 16 Lys Gly Asp Trp Asp Gln Phe Gly Leu Trp Arg Gly Ala Ala 1 5 10

SEQ ID NO 17 LENGTH = 12 TYPE : PRT ORGANISM: Artificial Sequence FEATURE : OTHER INFORMATION: Description of Artificial Sequence:Core peptide comprising dabsylated—atherosclerotic plaque binding sequence and RGDS NAME/KEY: MOD RES LOCATION: (1) OTHER INFORMATION: Dabsylated-tyrosine NAME/KEY: MOD RES LOCATION: (10) OTHER INFORMATION: Arg-Gly-Asp-Ser chain linked via NH2 group of lysine

SEQUENCE: 17 Tyr Arg Ala Leu Val Asp Thr Leu Lys Lys Gly Cys 1 5 10 US 6,680,047 B2 109 110

—continued

SEQ ID NO 18 LENGTH - 15 TYPE : PRT ORGANISM: Artificial Sequence FEATURE : OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide with an affinity for thrombi NAME/KEY: MOD RES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-lysine NAME/KEY: MOD RES Local?TON: (15) OTHER INFORMATION: AMIDATION

SEQUENCE: 18 Lys Asn Asp Gly Asp Phe Glu Glu Ile Pro Glu Glu Tyr Leu Gln 1 5 15

SEQ ID NO 19 LENGTH = 4 TYPE : PRT ORGANISM: Artificial Sequence FEATURE : OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide functionalised with atenolol NAME/KEY: MOD RES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-lysine NAME/KEY: MOD RES LOCATION: (4) OTHER INFORMATION: Lysine with side chain linked via amide bond to atenolol NAME/KEY: MOD RES LOCATION: (4) OTHER INFORMATION: AMIDATION

SEQUENCE: 19 Lys Lys Lys Lys 1

SEQ ID NO 20 LENGTH = 4 TYPE : PRT ORGANISM: Artificial Sequence FEATURE : OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide containing chlorambucil NAME/KEY: MOD RES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-lysine NAME/KEY: MOD RES LOCATION: (4) OTHER INFORMATION: Lysine with side chain linked via amide bond to chlorambucil NAME/KEY: MOD RES LOCATION: (4) OTHER INFORMATION: AMIDATION

SEQUENCE: 20 Lys Lys Lys Lys 1

SEQ ID NO 21 LENGTH = 4 TYPE : PRT ORGANISM: Artificial Sequence FEATURE : OTHER INFORMATION: Description of Artificial Sequence: Synthetic RGDS sequence SEQUENCE: 21 US 6,680,047 B2 111 112

—continued

Arg Gly Asp Ser 1

<210: SEQ ID NO 22 <2 11: LENGTH - 9 <2 12: TYPE : PRT <213> ORGANISM: Artificial Sequence <2 20: FEATURE : <223> OTHER INFORMATION: Description of Artificial Sequence: Atherosclerotic plaque-binding peptide <400: SEQUENCE: 22 Tyr Arg Ala Leu Val Asp Thr Leu Lys 1 5

<210: SEQ ID NO 23 <2 11: LENGTH - 16 <2 12: TYPE : PRT <213> ORGANISM: Artificial Sequence <2 20: FEATURE : <223> OTHER INFORMATION: Description of Artificial Sequence: Atherosclerotic plaque-binding peptide <400: SEQUENCE: 23 Tyr Ala Lys Phe Arg Glu Thr Leu Glu Asp Thr Arg Asp Arg Met Tyr 1 5 10 15

<210: SEQ ID NO 24 <2 11: LENGTH = 1 7 <2 12: TYPE : PRT <213> ORGANISM: Artificial Sequence <2 20: FEATURE : <223> OTHER INFORMATION: Description of Artificial Sequence: Atherosclerotic plaque-binding peptide <400: SEQUENCE: 24 Arg Ala Leu Val Asp Thr Glu Phe Lys Val Lys Gln Glu Ala Gly Ala 1 5 10 15 Lys

<210: SEQ ID NO 25 <211: LENGTH : 14 <2 12: TYPE : PRT <213> ORGANISM: Artificial Sequence <2 20: FEATURE : <223> OTHER INFORMATION: Description of Artificial Sequence: Thrombus binding peptide

<400: SEQUENCE: 25 Asn Asp Gly Asp Phe Glu Glu Ile Pro Glu Glu Tyr Leu Gln 1 5 10

<210: SEQ ID NO 26 <211: LENGTH : 4 <2 12: TYPE : PRT <213> ORGANISM: Artificial Sequence <2 20: FEATURE : <223> OTHER INFORMATION: Description of Artificial Sequence: Thrombus binding peptide

<400: SEQUENCE: 26 Gly Pro Arg Gly 1

<210: SEQ ID NO 27 <2 11: LENGTH - 13 US 6,680,047 B2 114

—continued

<2 12: TYPE : PRT <213> ORGANISM: Artificial Sequence <2 20: FEATURE : <223> OTHER INFORMATION: Description of Artificial Sequence: Platelet binding peptide

<400: SEQUENCE: 27 Pro Leu Tyr Lys Lys Ile Ile Lys Lys Leu Leu Glu Ser 1 5 10

What is claimed is: oligonucleotides and modified oligonucleotides; DNA 1. A combined formulation comprising: 15 binding drugs; protease substrates/inhibitors; and proteins i) a first administrable composition comprising a first and peptides which bind to cell-surface proteoglycans. pre-targeting vector; and 12. A combined formulation as claimed in claim 1 ii) a second administrable composition comprising a wherein the vectors have affinity for targets at a level such targetable diagnostic and/or therapeutically active that the agent interacts with but does not fixedly bind to said agent, said agent comprising a suspension in an aque 20 ous carrier liquid of a reporter comprising gas targets. containing or gas-generating material, said reporter 13. A combined formulation as claimed in claim 12 further comprising a moiety having affinity for said wherein the vectors are selected from ligands for cell adhe pre-targeting vector and a second vector, the first and sion proteins and cell adhesion proteins which have corre second vectors binding to different targets on the same 25 sponding ligands on endothelial cell surfaces. or different cells. 14. A combined formulation as claimed in claim 1 2. A combined formulation as claimed in claim 1 wherein wherein the vectors are sited such that they are not readily the gas is selected from the group consisting of air, nitrogen, exposed to the target. oxygen, carbon dioxide, hydrogen, an inert gas, a sulphur 15. A combined formulation as claimed in claim 1 fluoride, selenium hexafluoride, a low molecular weight 30 wherein the vectors are coupled or linked to the reporter by hydrocarbon, a ketone, an ester, a halogenated low molecu means of avidin-biotin and/or streptavidin-biotin interac lar weight hydrocarbon and a mixture of any of the forego tions. ing. 16. A combined formulation as claimed in claim 1 3. A combined formulation as claimed in claim 2 wherein wherein the vectors may be covalently or non-covalently the gas is selected from the group consisting of a perfluori 35 coupled or linked to the reporter. nated ketone, a perfluorinated ether and a perfluorocarbon. 17. A combined formulation as claimed in claim 1 4. A combined formulation as claimed in claim 2 wherein wherein the vectors are coupled or linked to the reporter by the gas is selected from the group consisting of sulphur means of electrostatic charge interaction. hexafluoride, perfluoropropane, perfluorobutane and per 18. A combined formulation as claimed in claim 1 which fluoropentane. 40 further contains moieties which are radioactive or are effec 5. A combined formulation as claimed in claim 1 com tive as X-ray contrast agents, light imaging probes or spin prising gas microbubbles stabilised by a coalescence labels. resistant surface membrane, a filmogenic protein, a polymer 19. A combined formulation as claimed in claim 1 further material, a non-polymeric, non-polymerisable wall-forming comprising a therapeutic compound. material or a surfactant. 45 6. A combined formulation as claimed in claim 5 wherein 20. A combined formulation as claimed in claim 19 said surfactant comprises at least one phospholipid. wherein said therapeutic compound is an antineoplastic 7. A combined formulation as claimed in claim 6 wherein agent, blood product, biological response modifier, antifun at least 75% of the phospholipid suspended comprises gal agent, hormone or hormone analogue, vitamin, enzyme, phospholipid molecules individually bearing net overall 50 antiallergic agent, tissue factor inhibitor, platelet inhibitor, charge. coagulation protein target inhibitor, fibrin formation 8. A combined formulation as claimed in claim 7 wherein inhibitor, fibrinolysis promoter, antiangiogenic, circulatory at least 75% of the phospholipids are selected from the group drug, metabolic potentiator, antitubercular, antiviral, consisting of phosphatidylserines, phosphatidylglycerols, vasodilator, antibiotic, antiinflammatory, antiprotozoan, phosphatidylinositols, phosphatidic acids and cardiolipins. 55 antirheumatic, narcotic, opiate, cardiac glycoside, neuro 9. A combined formulation as claimed in claim 8 wherein muscular blocker, sedative, local anaesthetic, general anaes at least 80% of said phospholipids are phosphatidylserines. thetic or genetic material. 10. A combined formulation as claimed in claim 1 21. A combined formulation as claimed in claim 19 wherein said gas-containing material further comprises moi wherein said therapeutic compound is covalently coupled or eties capable of binding to a receptor system so as to induce 60 linked to the reporter through disulphide groups. a therapeutic response. 22. A combined formulation as claimed in claim 19 11. A combined formulation as claimed in claim 1 wherein wherein a lipophilic or lipophilically-derivatised therapeutic the vectors are selected from the group consisting of anti compound is linked to the reporter through hydrophobic bodies; cell adhesion molecules; cell adhesion molecule interactions. receptors; cytokines; growth factors; peptide hormones; 65 23. A combined formulation as claimed in claim 1 non-bioactive binders of receptors for cell adhesion wherein said pre-targeting vector comprises a monoclonal molecules, cytokines, growth factors and peptide hormones; antibody. US 6,680,047 B2 115 116 24. A method of generating enhanced images of a human 28. A method as claimed in claim 24 which comprises the or non-human animal body which comprises administering steps: to said body a combined formulation as claimed in claim 1 i) administering to said body a combined formulation; and and generating an ultrasound, magnetic resonance, X-ray, thereafter radiographic or light image of at least a part of said body. ii) administering a substance capable of displacing or 25. A method as claimed in claim 24 for generation of an releasing said agent from its target. ultrasound image. 29. A method as claimed in claim 24 wherein said agent 26. A method as claimed in claim 24 which comprises the further comprises a therapeutic compound. steps: 30. A method as claimed in claim 29 wherein said i) administering to said body a pre-targeting vector having 10 therapeutic compound is covalently coupled or linked to the affinity for a selected target; and thereafter reporter through disulphide groups, and a composition com ii) administering said agent comprising a vector having prising a reducing agent capable of reductively cleaving said affinity for said pre-targeting vector. disulphide groups is subsequently administered. 27. A method as claimed in claim 26 wherein said pre-targeting vector comprises a monoclonal antibody.