DOCSLIB.ORG

Supplementary Table 2 Differentially Expressed Genes in PC3 Prostate Adenocarcinoma Cells 48 H After Transfection with Sirxfp1 Versus Sinc Control Sirna

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Table 2 Differentially Expressed Genes in PC3 Prostate Adenocarcinoma Cells 48 H After Transfection with Sirxfp1 Versus Sinc Control Sirna Supplementary Table 2 Differentially expressed genes in PC3 prostate adenocarcinoma cells 48 h after transfection with siRXFP1 versus siNC control siRNA. Genes with P<0.05 are shown Average fold change PROBE_ID TargetID Title (siRXFP1/siNC) ILMN_1757406 HIST1H1C histone cluster 1, H1c 2.358875 ILMN_1691846 G0S2 G0/G1switch 2 2.148632 ILMN_1706505 COL5A1 collagen, type V, alpha 1 2.030442 ILMN_1715684 LAMB3 laminin, beta 3 1.891462 ILMN_1809402 MAN2A1 mannosidase, alpha, class 2A, member 1 1.843399 ILMN_1666503 DENND2A DENN/MADD domain containing 2A 1.794946 ILMN_1746465 FJX1 four jointed box 1 (Drosophila) 1.777726 ILMN_1688670 CDCP1 CUB domain containing protein 1 1.743697 ILMN_1708341 PDZK1 PDZ domain containing 1 1.740739 ILMN_1658702 HIST1H2BJ histone cluster 1, H2bj 1.621722 ILMN_1756777 HBEGF heparin-binding EGF-like growth factor 1.594607 ILMN_1727315 DENND1A DENN/MADD domain containing 1A 1.581216 CKLF-like MARVEL transmembrane domain ILMN_1705442 CMTM3 containing 3 1.529026 estrogen receptor binding site associated, ILMN_1729144 EBAG9 antigen, 9 1.507585 ILMN_1666507 PLAUR plasminogen activator, urokinase receptor 1.480579 plakophilin 1 (ectodermal dysplasia/skin ILMN_1663454 PKP1 fragility syndrome) 1.475808 ILMN_1706643 COL6A3 collagen, type VI, alpha 3 1.47301 ILMN_1795055 LRRC3 leucine rich repeat containing 3 1.471709 ILMN_1722845 RAB3B RAB3B, member RAS oncogene family 1.432296 ILMN_1691508 PLAUR plasminogen activator, urokinase receptor 1.423904 ILMN_1703531 EDG3 sphingosine-1-phosphate receptor 3 1.421666 ILMN_1803728 SLC35E4 solute carrier family 35, member E4 1.361908 adenosine deaminase, tRNA-specific 2, ILMN_1676554 DEADC1 TAD2 homolog (S. cerevisiae) 0.752997 ILMN_1752889 PLSCR1 phospholipid scramblase 1 0.73679 ILMN_1783621 LOC129607 0.723609 ILMN_1685275 MCAM melanoma cell adhesion molecule 0.71626 eukaryotic translation initiation factor 1A ILMN_1717834 MGC11102 domain containing 0.712811 cytochrome P450, family 2, subfamily S, ILMN_1705403 CYP2S1 polypeptide 1 0.710565 ILMN_1786601 PLAGL2 pleiomorphic adenoma gene-like 2 0.699806 ILMN_1738989 GOLSYN Golgi-localized protein 0.693171 echinoderm microtubule associated ILMN_1791990 EML2 protein like 2 0.692269 ILMN_1742547 NRP1 neuropilin 1 0.685449 NHP2 non-histone chromosome protein 2- ILMN_1763460 NHP2L1 like 1 (S. cerevisiae) 0.683673 grancalcin, EF-hand calcium binding ILMN_1800602 GCA protein 0.680923 ILMN_1665909 LASP1 LIM and SH3 protein 1 0.678523 proteasome (prosome, macropain) 26S ILMN_1732767 PSMD9 subunit, non-ATPase, 9 0.67817 solute carrier family 16, member 14 ILMN_1736546 SLC16A14 (monocarboxylic acid transporter 14) 0.677312 ILMN_1712985 C17ORF58 chromosome 17 open reading frame 58 0.676035 ILMN_1669497 OSBPL10 oxysterol binding protein-like 10 0.67551 ILMN_1749821 MED28 mediator complex subunit 28 0.673531 RAB3 GTPase activating protein subunit 1 ILMN_1739876 RAB3GAP1 (catalytic) 0.673259 ILMN_1756992 MUC1 mucin 1, cell surface associated 0.67274 guanine nucleotide binding protein (G protein), alpha inhibiting activity ILMN_1775762 GNAI2 polypeptide 2 0.671533 ILMN_1654392 KIAA0323 KIAA0323 0.664346 ILMN_1725842 CSNK1G2 casein kinase 1, gamma 2 0.660565 ILMN_1689336 HOXA10 homeobox A10 0.653391 ILMN_1653404 NKIRAS2 NFKB inhibitor interacting Ras-like 2 0.644015 ILMN_1769390 LOC116236 hypothetical protein LOC116236 0.640575 ILMN_1759003 SNX12 sorting nexin 12 0.638957 ILMN_1754174 LOXL4 lysyl oxidase-like 4 0.637852 ILMN_1677877 UBE2L3 ubiquitin-conjugating enzyme E2L 3 0.637458 solute carrier family 35 (UDP-galactose ILMN_1792135 SLC35A2 transporter), member A2 0.631048 myosin phosphatase-Rho interacting ILMN_1678692 M-RIP protein 0.626517 protein phosphatase 2, regulatory subunit ILMN_1780940 PPP2R5D B', delta isoform 0.625489 branched chain aminotransferase 2, ILMN_1695110 BCAT2 mitochondrial 0.62442 ILMN_1791478 MTPN myotrophin 0.622552 ILMN_1754199 BCL7B B-cell CLL/lymphoma 7B 0.620721 ILMN_1788878 C10ORF83 chromosome 10 open reading frame 83 0.620467 ILMN_1667839 C14ORF130 chromosome 14 open reading frame 130 0.620264 ILMN_1789505 ITPR1 inositol 1,4,5-triphosphate receptor, type 1 0.618577 ILMN_1697872 C21ORF121 chromosome 21 open reading frame 121 0.617437 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small ILMN_1728163 CTDSP1 phosphatase 1 0.615529 interferon (alpha, beta and omega) ILMN_1752923 IFNAR1 receptor 1 0.614082 translocase of inner mitochondrial ILMN_1765332 TIMM10 membrane 10 homolog (yeast) 0.613879 ILMN_1804815 ACP2 acid phosphatase 2, lysosomal 0.611762 ILMN_1723912 IFI44L interferon-induced protein 44-like 0.611461 ILMN_1723768 NLRX1 NLR family member X1 0.610799 myxovirus (influenza virus) resistance 1, ILMN_1662358 MX1 interferon-inducible protein p78 (mouse) 0.607699 ILMN_1689318 NUAK1 NUAK family, SNF1-like kinase, 1 0.607489 ILMN_1813746 CORO2A coronin, actin binding protein, 2A 0.601455 isocitrate dehydrogenase 1 (NADP+), ILMN_1696432 IDH1 soluble 0.600654 ILMN_1656361 LOC201175 hypothetical protein LOC201175 0.592056 ILMN_1729767 TARBP2 TAR (HIV-1) RNA binding protein 2 0.591086 chaperonin containing TCP1, subunit 4 ILMN_1776073 CCT4 (delta) 0.58872 phosphatidylinositol 4-kinase, catalytic, ILMN_1666597 PI4KB beta 0.585031 ILMN_1793267 ETHE1 ethylmalonic encephalopathy 1 0.583694 solute carrier family 7 (cationic amino acid ILMN_1720373 SLC7A5 transporter, y+ system), member 5 0.583536 ILMN_1694432 CRIP2 cysteine-rich protein 2 0.578778 ILMN_1720319 SLC35A4 solute carrier family 35, member A4 0.559968 ubiquitin related modifier 1 homolog (S. ILMN_1774196 URM1 cerevisiae) 0.549359 UDP-Gal:betaGlcNAc beta 1,4- ILMN_1692267 B4GALT3 galactosyltransferase, polypeptide 3 0.544992 ILMN_1742450 TAPBP TAP binding protein (tapasin) 0.535814 ILMN_1683263 TSPAN8 tetraspanin 8 0.529905 solute carrier family 35 (UDP-galactose ILMN_1742731 SLC35A2 transporter), member A2 0.528521 ILMN_1755405 FRAG1 FGF receptor activating protein 1 0.52765 sarcospan (Kras oncogene-associated ILMN_1775486 SSPN gene) 0.521142 ILMN_1654465 GPI glucose phosphate isomerase 0.520037 ILMN_1775501 IL1B interleukin 1, beta 0.515477 ILMN_1788163 SNX15 sorting nexin 15 0.512142 aldo-keto reductase family 7, member A2 ILMN_1677043 AKR7A2 (aflatoxin aldehyde reductase) 0.51088 ILMN_1707727 ANGPTL4 angiopoietin-like 4 0.491705 ILMN_1753345 SCAMP5 secretory carrier membrane protein 5 0.479704 ILMN_1722905 MRPS11 mitochondrial ribosomal protein S11 0.47849 ILMN_1658577 C8ORF30A chromosome 8 open reading frame 30A 0.476033 ubiquitination factor E4B (UFD2 homolog, ILMN_1675674 UBE4B yeast) 0.462687 pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of ILMN_1786105 PCBD1 hepatocyte nuclear factor 1 alpha 0.455866 lysosomal-associated protein ILMN_1745110 LAPTM4A transmembrane 4 alpha 0.447195 translocase of inner mitochondrial ILMN_1813260 TIMM17B membrane 17 homolog B (yeast) 0.439358 aldehyde dehydrogenase 3 family, ILMN_1702503 ALDH3A1 memberA1 0.439124 pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of ILMN_1795906 PCBD1 hepatocyte nuclear factor 1 alpha 0.403219 ILMN_1725852 S100A2 S100 calcium binding protein A2 0.403094 ILMN_1726108 LASS2 LAG1 homolog, ceramide synthase 2 0.3713 hypoxanthine phosphoribosyltransferase 1 ILMN_1736940 HPRT1 (Lesch-Nyhan syndrome) 0.371294 .
Load more

Recommended publications
  • Characterization of Genomic Copy Number Variation in Mus Musculus Associated with the Germline of Inbred and Wild Mouse Populations, Normal Development, and Cancer
    Western University Scholarship@Western Electronic Thesis and Dissertation Repository 4-18-2019 2:00 PM Characterization of genomic copy number variation in Mus musculus associated with the germline of inbred and wild mouse populations, normal development, and cancer Maja Milojevic The University of Western Ontario Supervisor Hill, Kathleen A. The University of Western Ontario Graduate Program in Biology A thesis submitted in partial fulfillment of the equirr ements for the degree in Doctor of Philosophy © Maja Milojevic 2019 Follow this and additional works at: https://ir.lib.uwo.ca/etd Part of the Genetics and Genomics Commons Recommended Citation Milojevic, Maja, "Characterization of genomic copy number variation in Mus musculus associated with the germline of inbred and wild mouse populations, normal development, and cancer" (2019). Electronic Thesis and Dissertation Repository. 6146. https://ir.lib.uwo.ca/etd/6146 This Dissertation/Thesis is brought to you for free and open access by Scholarship@Western. It has been accepted for inclusion in Electronic Thesis and Dissertation Repository by an authorized administrator of Scholarship@Western. For more information, please contact [email protected]. Abstract Mus musculus is a human commensal species and an important model of human development and disease with a need for approaches to determine the contribution of copy number variants (CNVs) to genetic variation in laboratory and wild mice, and arising with normal mouse development and disease. Here, the Mouse Diversity Genotyping array (MDGA)-approach to CNV detection is developed to characterize CNV differences between laboratory and wild mice, between multiple normal tissues of the same mouse, and between primary mammary gland tumours and metastatic lung tissue.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • B4GALT3 (B4GALT2) (NM 030587) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC233988 B4GALT3 (B4GALT2) (NM_030587) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: B4GALT3 (B4GALT2) (NM_030587) Human Tagged ORF Clone Tag: Myc-DDK Symbol: B4GALT2 Synonyms: B4Gal-T2; B4Gal-T3; beta4Gal-T2 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC233988 representing NM_030587 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTGTGGAAGTCCAGGAGCAGTGGCCTTGTTTGCCAGCAGCCGGATGCCCGGGCCCACTGGGCGGGC CAGTGGCCGCCTGCGGGATGAGCAGACTGCTGGGGGGGACGCTGGAGCGCGTCTGCAAGGCTGTGCTCCT TCTCTGCCTGCTGCACTTCCTCGTGGCCGTCATCCTCTACTTTGACGTCTACGCCCAGCACCTGGCCTTC TTCAGCCGCTTCAGTGCCCGAGGCCCTGCCCATGCCCTCCACCCAGCTGCTAGCAGCAGCAGCAGCAGCA GCAACTGCTCCCGGCCCAACGCCACCGCCTCTAGCTCCGGGCTCCCTGAGGTCCCCAGTGCCCTGCCCGG TCCCACGGCTCCCACGCTGCCACCCTGTCCTGACTCGCCACCTGGTCTTGTGGGCAGACTGCTGATCGAG TTCACCTCACCCATGCCCCTGGAGCGGGTGCAGAGGGAGAACCCAGGCGTGCTCATGGGCGGCCGATACA CACCGCCCGACTGCACCCCAGCCCAGACGGTGGCGGTCATCATCCCCTTTAGACACCGGGAACACCACCT GCGCTACTGGCTCCACTATCTACACCCCATCTTGAGGCGGCAGCGGCTGCGCTACGGCGTCTATGTCATC AACCAGCATGGTGAGGACACCTTCAACCGGGCCAAGCTGCTTAACGTGGGCTTCCTAGAGGCGCTGAAGG AGGATGCCGCCTATGACTGCTTCATCTTCAGCGATGTGGACCTGGTCCCCATGGATGACCGCAACCTATA CCGCTGCGGCGACCAACCCCGCCACTTTGCCATTGCCATGGACAAGTTTGGCTTCCGGCTTCCCTATGCT
    [Show full text]
  • Supplementary Table 3: Genes Only Influenced By
    Supplementary Table 3: Genes only influenced by X10 Illumina ID Gene ID Entrez Gene Name Fold change compared to vehicle 1810058M03RIK -1.104 2210008F06RIK 1.090 2310005E10RIK -1.175 2610016F04RIK 1.081 2610029K11RIK 1.130 381484 Gm5150 predicted gene 5150 -1.230 4833425P12RIK -1.127 4933412E12RIK -1.333 6030458P06RIK -1.131 6430550H21RIK 1.073 6530401D06RIK 1.229 9030607L17RIK -1.122 A330043C08RIK 1.113 A330043L12 1.054 A530092L01RIK -1.069 A630054D14 1.072 A630097D09RIK -1.102 AA409316 FAM83H family with sequence similarity 83, member H 1.142 AAAS AAAS achalasia, adrenocortical insufficiency, alacrimia 1.144 ACADL ACADL acyl-CoA dehydrogenase, long chain -1.135 ACOT1 ACOT1 acyl-CoA thioesterase 1 -1.191 ADAMTSL5 ADAMTSL5 ADAMTS-like 5 1.210 AFG3L2 AFG3L2 AFG3 ATPase family gene 3-like 2 (S. cerevisiae) 1.212 AI256775 RFESD Rieske (Fe-S) domain containing 1.134 Lipo1 (includes AI747699 others) lipase, member O2 -1.083 AKAP8L AKAP8L A kinase (PRKA) anchor protein 8-like -1.263 AKR7A5 -1.225 AMBP AMBP alpha-1-microglobulin/bikunin precursor 1.074 ANAPC2 ANAPC2 anaphase promoting complex subunit 2 -1.134 ANKRD1 ANKRD1 ankyrin repeat domain 1 (cardiac muscle) 1.314 APOA1 APOA1 apolipoprotein A-I -1.086 ARHGAP26 ARHGAP26 Rho GTPase activating protein 26 -1.083 ARL5A ARL5A ADP-ribosylation factor-like 5A -1.212 ARMC3 ARMC3 armadillo repeat containing 3 -1.077 ARPC5 ARPC5 actin related protein 2/3 complex, subunit 5, 16kDa -1.190 activating transcription factor 4 (tax-responsive enhancer element ATF4 ATF4 B67) 1.481 AU014645 NCBP1 nuclear cap
    [Show full text]
  • Supplementary Data
    Supplementary Fig. 1 A B Responder_Xenograft_ Responder_Xenograft_ NON- NON- Lu7336, Vehicle vs Lu7466, Vehicle vs Responder_Xenograft_ Responder_Xenograft_ Sagopilone, Welch- Sagopilone, Welch- Lu7187, Vehicle vs Lu7406, Vehicle vs Test: 638 Test: 600 Sagopilone, Welch- Sagopilone, Welch- Test: 468 Test: 482 Responder_Xenograft_ NON- Lu7860, Vehicle vs Responder_Xenograft_ Sagopilone, Welch - Lu7558, Vehicle vs Test: 605 Sagopilone, Welch- Test: 333 Supplementary Fig. 2 Supplementary Fig. 3 Supplementary Figure S1. Venn diagrams comparing probe sets regulated by Sagopilone treatment (10mg/kg for 24h) between individual models (Welsh Test ellipse p-value<0.001 or 5-fold change). A Sagopilone responder models, B Sagopilone non-responder models. Supplementary Figure S2. Pathway analysis of genes regulated by Sagopilone treatment in responder xenograft models 24h after Sagopilone treatment by GeneGo Metacore; the most significant pathway map representing cell cycle/spindle assembly and chromosome separation is shown, genes upregulated by Sagopilone treatment are marked with red thermometers. Supplementary Figure S3. GeneGo Metacore pathway analysis of genes differentially expressed between Sagopilone Responder and Non-Responder models displaying –log(p-Values) of most significant pathway maps. Supplementary Tables Supplementary Table 1. Response and activity in 22 non-small-cell lung cancer (NSCLC) xenograft models after treatment with Sagopilone and other cytotoxic agents commonly used in the management of NSCLC Tumor Model Response type
    [Show full text]
  • Clinical Impact of Copy Number Variation Changes in Bladder Cancer Samples
    EXPERIMENTAL AND THERAPEUTIC MEDICINE 22: 901, 2021 Clinical impact of copy number variation changes in bladder cancer samples VICTORIA SPASOVA1, BORIS MLADENOV2, SIMEON RANGELOV3, ZORA HAMMOUDEH1, DESISLAVA NESHEVA1, DIMITAR SERBEZOV1, RADA STANEVA1,4, SAVINA HADJIDEKOVA1,4, MIHAIL GANEV1, LUBOMIR BALABANSKI1,5, RADOSLAVA VAZHAROVA5,6, CHAVDAR SLAVOV3, DRAGA TONCHEVA1 and OLGA ANTONOVA1 1Department of Medical Genetics, Medical University‑Sofia, 1431 Sofia;2 Department of Urology, UMBALSM N.I. Pirogov, 1606 Sofia; 3Department of Urology, Tsaritsa Yoanna University Hospital, 1527 Sofia; 4Medical Genetics Laboratory, Nadezhda Women's Health Hospital, 1373 Sofia; 5Medical Genetics Laboratory, GARH Malinov, 1680 Sofia; 6Department of Biology, Medical Genetics and Microbiology, Faculty of Medicine, Sofia University St. Kliment Ohridski, 1407 Sofia, Bulgaria Received November 30, 2019; Accepted February 18, 2021 DOI: 10.3892/etm.2021.10333 Abstract. The aim of the present study was to detect copy uroepithelial tumours may lay a foundation for implementing number variations (CNVs) related to tumour progression and molecular CNV profiling of bladder tumours as part of a metastasis of urothelial carcinoma through whole‑genome routine progression risk estimation strategy, thus expanding scanning. A total of 30 bladder cancer samples staged from the personalized therapeutic approach. pTa to pT4 were included in the study. DNA was extracted from freshly frozen tissue via standard phenol‑chloroform extraction Introduction and CNV analysis was performed on two alternative platforms (CytoChip Oligo aCGH, 4x44K and Infinium OncoArray‑500K The most successful approach to treating a disease has BeadChip; Illumina, Inc.). Data were analysed with BlueFuse always been etiological therapy. In the case of bladder Multi software and Karyostudio, respectively.
    [Show full text]
  • Association of Cnvs with Methylation Variation
    www.nature.com/npjgenmed ARTICLE OPEN Association of CNVs with methylation variation Xinghua Shi1,8, Saranya Radhakrishnan2, Jia Wen1, Jin Yun Chen2, Junjie Chen1,8, Brianna Ashlyn Lam1, Ryan E. Mills 3, ✉ ✉ Barbara E. Stranger4, Charles Lee5,6,7 and Sunita R. Setlur 2 Germline copy number variants (CNVs) and single-nucleotide polymorphisms (SNPs) form the basis of inter-individual genetic variation. Although the phenotypic effects of SNPs have been extensively investigated, the effects of CNVs is relatively less understood. To better characterize mechanisms by which CNVs affect cellular phenotype, we tested their association with variable CpG methylation in a genome-wide manner. Using paired CNV and methylation data from the 1000 genomes and HapMap projects, we identified genome-wide associations by methylation quantitative trait locus (mQTL) analysis. We found individual CNVs being associated with methylation of multiple CpGs and vice versa. CNV-associated methylation changes were correlated with gene expression. CNV-mQTLs were enriched for regulatory regions, transcription factor-binding sites (TFBSs), and were involved in long- range physical interactions with associated CpGs. Some CNV-mQTLs were associated with methylation of imprinted genes. Several CNV-mQTLs and/or associated genes were among those previously reported by genome-wide association studies (GWASs). We demonstrate that germline CNVs in the genome are associated with CpG methylation. Our findings suggest that structural variation together with methylation may affect cellular phenotype. npj Genomic Medicine (2020) 5:41 ; https://doi.org/10.1038/s41525-020-00145-w 1234567890():,; INTRODUCTION influence transcript regulation is DNA methylation, which involves The extent of genetic variation that exists in the human addition of a methyl group to cytosine residues within a CpG population is continually being characterized in efforts to identify dinucleotide.
    [Show full text]
  • B-1,4-Galactosyltransferase III Enhances Invasive Phenotypes Via B1-Integrin and Predicts Poor Prognosis in Neuroblastoma
    Published OnlineFirst February 26, 2013; DOI: 10.1158/1078-0432.CCR-12-2367 Clinical Cancer Human Cancer Biology Research b-1,4-Galactosyltransferase III Enhances Invasive Phenotypes Via b1-Integrin and Predicts Poor Prognosis in Neuroblastoma Hsiu-Hao Chang1, Chia-Hua Chen5, Chih-Hsing Chou5, Yung-Feng Liao6, Miao-Juei Huang5,9, Ya-Hsin Chen5,9, Wei-Jen Wang5,9, John Huang4, Ji-Shiang Hung4, Wan-Ling Ho7,10, Yung-Ming Jeng2, Mei-Ieng Che5, Hsinyu Lee4,8, Meng-Yao Lu1, Yung-Li Yang1,3, Shiann-Tarng Jou1, Dong-Tsamn Lin1,3, Kai-Hsin Lin1, Wen-Ming Hsu4,9, and Min-Chuan Huang5,9 Abstract Purpose: Neuroblastoma (NB) is a neural crest-derived tumor that commonly occurs in childhood. b-1,4-Galactosyltransferase III (B4GALT3) is highly expressed in human fetal brain and is responsible for the generation of poly-N-acetyllactosamine, which plays a critical role in tumor progression. We therefore investigated the expression and role of B4GALT3 in NB. Experimental Design: We examined B4GALT3 expression in tumor specimens from 101 NB patients by immunohistochemistry and analyzed the correlation between B4GALT3 expression and clinicopathologic factors or survival. The functional role of B4GALT3 expression was investigated by overexpression or knockdown of B4GALT3 in NB cells for in vitro and in vivo studies. Results: We found that B4GALT3 expression correlated with advanced clinical stages (P ¼ 0.040), unfavorable Shimada histology (P < 0.001), and lower survival rate (P < 0.001). Multivariate analysis showed that B4GALT3 expression is an independent prognostic factor for poor survival of NB patients. B4GALT3 overexpression increased migration, invasion, and tumor growth of NB cells, whereas B4GALT3 knockdown suppressed the malignant phenotypes of NB cells.
    [Show full text]
  • Download Special Issue
    BioMed Research International Novel Bioinformatics Approaches for Analysis of High-Throughput Biological Data Guest Editors: Julia Tzu-Ya Weng, Li-Ching Wu, Wen-Chi Chang, Tzu-Hao Chang, Tatsuya Akutsu, and Tzong-Yi Lee Novel Bioinformatics Approaches for Analysis of High-Throughput Biological Data BioMed Research International Novel Bioinformatics Approaches for Analysis of High-Throughput Biological Data Guest Editors: Julia Tzu-Ya Weng, Li-Ching Wu, Wen-Chi Chang, Tzu-Hao Chang, Tatsuya Akutsu, and Tzong-Yi Lee Copyright © 2014 Hindawi Publishing Corporation. All rights reserved. This is a special issue published in “BioMed Research International.” All articles are open access articles distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Contents Novel Bioinformatics Approaches for Analysis of High-Throughput Biological Data,JuliaTzu-YaWeng, Li-Ching Wu, Wen-Chi Chang, Tzu-Hao Chang, Tatsuya Akutsu, and Tzong-Yi Lee Volume2014,ArticleID814092,3pages Evolution of Network Biomarkers from Early to Late Stage Bladder Cancer Samples,Yung-HaoWong, Cheng-Wei Li, and Bor-Sen Chen Volume 2014, Article ID 159078, 23 pages MicroRNA Expression Profiling Altered by Variant Dosage of Radiation Exposure,Kuei-FangLee, Yi-Cheng Chen, Paul Wei-Che Hsu, Ingrid Y. Liu, and Lawrence Shih-Hsin Wu Volume2014,ArticleID456323,10pages EXIA2: Web Server of Accurate and Rapid Protein Catalytic Residue Prediction, Chih-Hao Lu, Chin-Sheng
    [Show full text]
  • Integrative Analysis of Disease Signatures Shows Inflammation Disrupts Juvenile Experience-Dependent Cortical Plasticity
    New Research Development Integrative Analysis of Disease Signatures Shows Inflammation Disrupts Juvenile Experience- Dependent Cortical Plasticity Milo R. Smith1,2,3,4,5,6,7,8, Poromendro Burman1,3,4,5,8, Masato Sadahiro1,3,4,5,6,8, Brian A. Kidd,2,7 Joel T. Dudley,2,7 and Hirofumi Morishita1,3,4,5,8 DOI:http://dx.doi.org/10.1523/ENEURO.0240-16.2016 1Department of Neuroscience, Icahn School of Medicine at Mount Sinai, New York, New York 10029, 2Department of Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, New York, New York 10029, 3Department of Psychiatry, Icahn School of Medicine at Mount Sinai, New York, New York 10029, 4Department of Ophthalmology, Icahn School of Medicine at Mount Sinai, New York, New York 10029, 5Mindich Child Health and Development Institute, Icahn School of Medicine at Mount Sinai, New York, New York 10029, 6Graduate School of Biomedical Sciences, Icahn School of Medicine at Mount Sinai, New York, New York 10029, 7Icahn Institute for Genomics and Multiscale Biology, Icahn School of Medicine at Mount Sinai, New York, New York 10029, and 8Friedman Brain Institute, Icahn School of Medicine at Mount Sinai, New York, New York 10029 Visual Abstract Throughout childhood and adolescence, periods of heightened neuroplasticity are critical for the development of healthy brain function and behavior. Given the high prevalence of neurodevelopmental disorders, such as autism, identifying disruptors of developmental plasticity represents an essential step for developing strategies for prevention and intervention. Applying a novel computational approach that systematically assessed connections between 436 transcriptional signatures of disease and multiple signatures of neuroplasticity, we identified inflammation as a common pathological process central to a diverse set of diseases predicted to dysregulate Significance Statement During childhood and adolescence, heightened neuroplasticity allows the brain to reorganize and adapt to its environment.
    [Show full text]
  • Integrated Bioinformatic Analysis Identifies UBE2Q1 As a Potential
    Topno et al. BMC Cancer (2021) 21:220 https://doi.org/10.1186/s12885-021-07928-z RESEARCH ARTICLE Open Access Integrated bioinformatic analysis identifies UBE2Q1 as a potential prognostic marker for high grade serous ovarian cancer Rachel Topno1,2†, Ibha Singh3†, Manoj Kumar1* and Pallavi Agarwal3* Abstract Background: High grade serous ovarian cancer (HGSOC) accounts for nearly 60% of total cases of epithelial ovarian cancer. It is the most aggressive subtype, which shows poor prognosis and low patient survival. For better management of HGSOC patients, new prognostic biomarkers are required to facilitate improved treatment strategies and ensure suitable healthcare decisions. Methods: We performed genome wide expression analysis of HGSOC patient samples to identify differentially expressed genes (DEGs) using R based Limma package, Clust and other statistical tools. The identified DEGs were subjected to weighted gene co-expression network analysis (WGCNA) to identify co-expression patterns of relevant genes. Module trait and gene ontology analyses were performed to establish important gene co-expression networks and their biological functions. Overlapping the most relevant DEG cluster 4 with prominent WGCNA cyan module identified strongest correlation of UBE2Q1 with ovarian cancer and its prognostic significance on survival probability of ovarian cancer patients was investigated. The predictive value of UBE2Q1 as a potential biomarker was analysed by correlating its expression with 12-months relapse free survival of patients in response to platin/ taxane, the standard first-line chemotherapy for ovarian cancer, and analysing area under the ROC curve. Results: An integrated gene expression analysis and WGCNA, identified UBE2Q1 as a potential prognostic marker associated with poor relapse-free survival and response outcome to platin/taxane treatment of patients with high grade serous ovarian cancer.
    [Show full text]
  • FUT9-Driven Programming of Colon Cancer Cells Towards a Stem Cell-Like State
    cancers Article FUT9-Driven Programming of Colon Cancer Cells towards a Stem Cell-Like State Athanasios Blanas y, Anouk Zaal y, Irene van der Haar Àvila , Maxime Kempers , Laura Kruijssen, Mike de Kok , Marko A. Popovic, Joost C. van der Horst and Sandra J. van Vliet * Department of Molecular Cell Biology and Immunology, Amsterdam Infection & Immunity Institute, Cancer Center Amsterdam, Vrije Universiteit Amsterdam, Amsterdam UMC, 1081 HZ Amsterdam, The Netherlands; [email protected] (A.B.); [email protected] (A.Z.); [email protected] (I.v.d.H.À.); [email protected] (M.K.); [email protected] (L.K.); [email protected] (M.d.K.); [email protected] (M.A.P.); [email protected] (J.C.v.d.H.) * Correspondence: [email protected]; Tel.: +31-20-4448080 Equal contribution. y Received: 9 June 2020; Accepted: 1 September 2020; Published: 10 September 2020 Simple Summary: Aberrant glycosylation, for instance heightened expression of fucosylated structures, is a frequent feature observed in tumor cells. Our paper outlines the role of aberrant fucosylation by the Fucosyltransferase 9 (FUT9) as a potent reprogramming factor marking the acquisition of a stem-like state both by murine and human colon cancer cells. Importantly, our study reinforces the implication of aberrant fucosylation in promoting tumor growth and resistance to chemotherapy in the context of colon cancer. Abstract: Cancer stem cells (CSCs) are located in dedicated niches, where they remain inert to chemotherapeutic drugs and drive metastasis. Although plasticity in the CSC pool is well appreciated, the molecular mechanisms implicated in the regulation of cancer stemness are still elusive.
    [Show full text]