Signaling Implications for G Protein

Home , GNA14, GNAI1, GPR12, GPR3, GPR6, RGS10

Toll-Like Receptor Signaling Alters the Expression of Regulator of G Protein Signaling Proteins in Dendritic Cells: Implications for G Protein-Coupled Receptor This information is current as Signaling of September 26, 2021. Geng-Xian Shi, Kathleen Harrison, Sang-Bae Han, Chantal Moratz and John H. Kehrl J Immunol 2004; 172:5175-5184; ; doi: 10.4049/jimmunol.172.9.5175 Downloaded from http://www.jimmunol.org/content/172/9/5175

References This article cites 49 articles, 26 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/172/9/5175.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists by guest on September 26, 2021

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2004 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Toll-Like Receptor Signaling Alters the Expression of Regulator of G Protein Signaling Proteins in Dendritic Cells: Implications for G Protein-Coupled Receptor Signaling

Geng-Xian Shi,1 Kathleen Harrison,1 Sang-Bae Han,1 Chantal Moratz, and John H. Kehrl2

Conserved structural motifs on pathogens trigger pattern recognition receptors present on APCs such as dendritic cells (DCs). An important class of such receptors is the Toll-like receptors (TLRs). TLR signaling triggers a cascade of events in DCs that includes modiﬁed chemokine and cytokine production, altered chemokine receptor expression, and changes in signaling through G protein- coupled receptors (GPCRs). One mechanism by which TLR signaling could modify GPCR signaling is by altering the expression of regulator of G protein signaling (RGS) proteins. In this study, we show that human monocyte-derived DCs constitutively express signiﬁcant amounts of RGS2, RGS10, RGS14, RGS18, and RGS19, and much lower levels of RGS3 and RGS13. Engagement of Downloaded from TLR3 or TLR4 on monocyte-derived DCs induces RGS16 and RGS20, markedly increases RGS1 expression, and potently down- regulates RGS18 and RGS14 without modifying other RGS proteins. A similar pattern of Rgs protein expression occurred in immature bone marrow-derived mouse DCs stimulated to mature via TLR4 signaling. The changes in RGS18 and RGS1 expres- ␣ ␣ sion are likely important for DC function, because both proteins inhibit G i- and G q-mediated signaling and can reduce CXC chemokine ligand (CXCL)12-, CC chemokine ligand (CCL)19-, or CCL21-induced cell migration. Providing additional evidence, ؊/؊

bone marrow-derived DCs from Rgs1 mice have a heightened migratory response to both CXCL12 and CCL19 when com- http://www.jimmunol.org/ pared with similar DCs prepared from wild-type mice. These results indicate that the level and functional status of RGS proteins in DCs signiﬁcantly impact their response to GPCR ligands such as chemokines. The Journal of Immunology, 2004, 172: 5175Ð 5184.

endritic cells (DC)3 function as the sentinels of the im- main. TLR signaling leads to NF-␬B activation, a requirement for mune system (reviewed in Refs. 1 and 2). Immature DCs the differentiation of iDC to mDC (5). D (iDC) traffic from the blood to inflamed tissues where iDCs express the chemokine receptors CCR1, CCR2, CCR5, they capture Ag, and differentiate into mature DC (mDC). Subse- and CXCR1, and respond to their respective ligands, chemokines quently, they move to the draining lymphoid nodes to prime naive often expressed in inflamed tissues (6, 7). In addition, iDCs mi- by guest on September 26, 2021 T cells. iDC are highly endocytic and well adapted for the capture grate in response to other inflammatory mediators that couple to G of Ag, but they function poorly as APCs. In contrast, mDC are protein-coupled receptors (GPCRs) including histamine (8), sphin- efficient APCs and important modulators of T cell function. Many gosine-1-phosphate (S-1P) (9), lysophosphatidic acid (LPA) (10), pathogen-derived substances are efficient inducers of iDC matura- and ATP (11). Maturing DCs lose their migratory response to tion, and do so predominantly by the engagement of Toll-like re- many of these inflammatory chemoattractants by either receptor ceptors (TLRs) (reviewed in Refs. 3 and 4). In humans, 10 TLR down-regulation or receptor desensitization, and acquire respon- homologs have been identified, the majority displayed by DCs. siveness to CC chemokine ligand (CCL)19 and CCL21 via the TLR contain two major domains, an extracellular domain charac- acquisition of high levels of CCR7 (6, 7). CCL19 and CCL21 have terized by leucine-rich repeats and an intracellular Toll-like do- significant roles in the accumulation of Ag-loaded DCs in T cell- rich areas of draining lymph nodes. Exposure of maturing DCs to B Cell Molecular Immunology Section, Laboratory of Immunoregulation, National histamine, S-1P, LPA, or ATP no longer induces a chemotactic Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, response, but rather down-regulates IL-12 and enhances IL-10 pro- MD 20892 duction (8Ð11). A number of prior studies have demonstrated that Received for publication September 29, 2003. Accepted for publication February signaling via chemokine and other GPCRs can modulate DC IL-12 13, 2004. production (reviewed in Ref. 12). For example, the production of The costs of publication of this article were defrayed in part by the payment of page ϩ charges. This article must therefore be hereby marked advertisement in accordance IL-12 by CD8␣ murine DCs can be triggered by CCR5 with 18 U.S.C. Section 1734 solely to indicate this fact. signaling (13). 1 G.-X.S., K.H., and S.-B.H. contributed equally to the completion of this study. Ligand-activated GPCRs such as chemokine receptors act as a 2 Address correspondence and reprint requests to Dr. John H. Kehrl, B Cell Molecular guanine nucleotide exchange factor for G␣ subunit of the hetero- Immunology Section, Laboratory of Immunoregulation, National Institute of Allergy ␣ and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892. E-mail trimeric G protein (reviewed in Refs. 14 and 15). Once the G address: [email protected] subunit exchanges GDP for GTP, it dissociates from the G␤␥ het- 3 Abbreviations used in this paper: DC, dendritic cell; iDC, immature DC; mDC, erodimer, thereby allowing both G␣ and G␤␥ to activate down- mature DC; TLR, Toll-like receptor; GPCR, G protein-coupled receptor; S-1P, sphin- stream effectors. However, G␣ subunits have an intrinsic GTPase gosine-1-phosphate; LPA, lysophosphatidic acid; CCL, CC chemokine ligand; CXCL, CXC chemokine ligand; GAP, GTPase-activating protein; RGS, regulator of activity that limit the duration that they remain GTP bound and G protein signaling; BM, bone marrow; ERK, extracellular signal-regulated kinase; thus able to signal. In addition, GTPase-activating proteins (GAPs) med, medium; M1, muscarinic type 1; SRE, serum response element; TTBS, Tween for G␣ subunits termed regulator of G protein signaling (RGS) 20 plus TBS; MAPK, mitogen-activated protein kinase; PTX, pertussis toxin; IP3, inositol 1,4,5-trisphosphate; GFP, green fluorescent protein. proteins can further accelerate the intrinsic GTPase activity of G␣

Copyright © 2004 by The American Association of Immunologists, Inc. 0022-1767/04/$02.00 5176 TLR SIGNALING AND RGS PROTEINS subunits (reviewed in Ref. 16). Genetic studies in yeast, Aspergil- Generation of human monocyte-derived DCs lus nidulans, and Caenorhabditis elegans initially identified such PBMC were obtained from heparinized blood of healthy donors by Ficoll proteins (17Ð19). Providing evidence that they function by inter- density gradient centrifugation (Amersham Pharmacia Biotech, Uppsala, ␣ ␣ acting with G subunits, a yeast two-hybrid screen with G i3 iden- Sweden). The isolated PBMC were cultured in RPMI 1640 at 37¡Cin tified a mammalian RGS protein originally termed GAIP and now 100-mm plate (Falcon, Franklin Lakes, NJ) for 3 h, and the nonadherent RGS19 (20). Cementing the functional relationship between the cells were discarded, and the adherent cells were washed with PBS for three times. After this procedure, the resulting cell population was repre- yeast and mammalian proteins, several human RGS proteins sub- sented by Ͼ98% CD14ϩ monocytes, as assessed by flow cytometry using stituted for Sst2p, a protein involved in the desensitizing of pher- FITC-CD14 Ab. Alternatively, elutriated monocytes prepared from leuco- omone signaling, a G protein-coupled signaling pathway in yeast paks were used as the starting population. The monocytes were maintained (21). Rapidly thereafter, RGS proteins were shown to possess GAP in RPMI 1640 medium supplemented with 10% FCS in the presence of GM-CSF (100 ng/ml) and IL-4 (50 ng/ml). After 4Ð6 days of culture, activity for Gi and Gq subfamily members (22Ð24). Coding regions nonadherent and loosely adherent cells were collected and used for sub- for ϳ25 human RGS proteins have now been identified. Two Rho sequent experiments. The purity of the recovered DCs exceeded 95% as guanine exchange factors, which possess divergent RGS domains, assessed by flow cytometry using PE-CD11c Ab. ␣ ␣ selectively act as GAPs for G 12 and G 13 (25, 26). Experimen- Isolation of mouse BM-derived DCs tally, the introduction of expression vectors for RGS1, RGS3, and RGS4 into B lymphocyte cell lines dramatically impairs chemo- DCs were generated from BM cells from 8- to 10-wk-old C57BL/6 female mice (30). Briefly, BM cells were flushed out from the femurs and tibias. kine-induced cell migration (27Ð29). Furthermore, the lack of After lysis of RBC, whole BM cells (2 ϫ 105 cells/ml) were cultured in Rgs1 results in aberrant responses to the chemokines CXCL12 and 100-mm2 culture dishes in 10 ml/dish complete medium containing 2 CXCL13 in murine B cells.4 ng/ml GM-CSF. At day 3, another 10 ml of fresh complete medium con- Downloaded from Differential expression of RGS proteins in iDC and mDC may taining 2 ng/ml GM-CSF was added. On day 6 of the culture, half of the also contribute to the regulation of DC trafficking and regulate medium was changed. On day 8 of the culture, nonadherent DCs and loosely adherent DCs were harvested by gently pipetting and used as iDC. responses to other GPCR ligands. We have examined the expres- iDCs recovered from these cultures were generally ϳ85Ð90% CD11cϩ and sion of RGS proteins by analyzing mRNA expression in iDC and MHC class IImed-high, CD80med, and CD86low-med. Maturation of iDC was mDCs derived from human monocytes and mouse bone marrow accomplished by treating with LPS at 1 ␮g/ml for the last 24 h of culture. mDCs were MHC class IIhigh, CD80high, and CD86high. (BM). Maturation is accompanied by a marked reduction in RGS14 http://www.jimmunol.org/ (Rgs14) and RGS18 (Rgs18) levels and the induction of RGS1 Luciferase reporter gene assay (Rgs1) and RGS16 (Rgs16). Because the effects of RGS18 on cell For the muscarinic type 1 (M1) receptor-mediated serum response element migration had not been previously studied, we examined whether (SRE) and NF-␬B activation, HeLa cells were cotransfected with M1 re- RGS18 modulates CXCL12-, CCL19-, and CCL21-induced cell ceptor gene constructs (0.25 ␮g), SRE (50 ng), or NF-␬B (50 ng) luciferase migration. In addition, we provide evidence for the functional im- reporter gene, and ␤-galactosidase gene (100 ng) in the absence or presence portance of Rgs1 by examining the chemoattractant responses of of RGS18-3XFlag (0.5, 1.0, or 2.0 ␮g), RGS3-Flag (2.0 ␮g), or C3 (0.5 ␮g). After 24 h, the cells were stimulated with 100 ␮mol/L carbachol Rgs1-deficient mouse DCs. (Sigma-Aldrich) for 5Ð6 h while starving cells with fresh DMEM without FCS and then were lysed in reporter lysis buffer (Promega, Ann Arbor, MI). After removing the cell debris, the luciferase and ␤-galactosidase by guest on September 26, 2021 Materials and Methods activity were measured using a luminometer (Analytical Luminescence Plasmids and reagents Laboratory, San Diego, CA). The coding regions of human RGS18 and mouse RGS18 were isolated by Measurement of inositol phosphates PCR from human BM and mouse spleen Marathon-ready cDNA library The COS cells maintained in the inositol-free DMEM in 12-well plate were (BD Clontech, Palo Alto, CA) and then subcloned into the EcoRI/BamH1 transfected with 0.1 ␮g of M1 receptor gene construct in the absence or sites of p3XFLAG-CMV-14 (Sigma-Aldrich, St. Louis, MO) or presence of RGS18-3XFlag (0.25, 0.5, or 1.0 ␮g) or RGS3-Flag (1.0 ␮g). pEGFP-N1 (BD Clontech, Palo Alto, CA). The coding region of CXCR5 Twenty-four hours after transfection, the culture medium was replaced was isolated by RT-PCR using RNA prepared from HS-Sultan cells and with inositol-free DMEM containing 5% FCS and 1 mM sodium pyruvate subcloned into EcoRI site of pAAV-MCS. The coding region of human and for 2 h, after which 2 ␮Ci/ml myo-[2-3H]inositol (Amersham Pharmacia mouse CCR7 were isolated by PCR from human and mouse spleen Mar- Biotech) was added and, 15 min later, 10 mM LiCl. The cells were incu- athon-ready cDNA libraries (BD Clontech) and then subcloned into TA- bated for an additional 14 h and then stimulated with 100 ␮mol/L carba- cloning vector pCR3.1 (Invitrogen, Carlsbad, CA). The Abs against the chol for 15 min before washing with PBS, followed by the addition of 0.5 following were purchased: FLAG (Sigma-Aldrich), phospho-p42/44 extra- ml of 20 mM formic acid. Thirty minutes later, the supernatant was col- cellular signal-regulated kinase (ERK) (Cell Signaling, Beverly, MA), lected, and a second extraction was performed. Each 1-ml extract was ␣ p42/44 ERK, anti-G s (Santa Cruz Biotechnology, Santa Cruz, CA), neutralized to pH 7.5 with 7.5 mM HEPES and 150 mM KOH. The su- CD14, CD11c, CD40, CD95 (BD PharMingen, San Diego, CA), and anti- pernatants were centrifuged for 2 min at 15,000 ϫ g and collected, and RGS1 (Novus Biologicals, Littleton, CO). Rabbit anti-RGS14 was raised each was loaded onto a 0.5-ml Dowex AG-X8 column (Bio-Rad, Rich- against recombinant mouse RGS14 and cross-reacts with human RGS14. mond, CA) that had been previously washed with 2 ml of 1 M NaOH, 2 ml Human GM-CSF, IL-4, IL-15, CXC chemokine ligand (CXCL)12, of 1 M formic acid, and then five washes of 5 ml of water. After loading CXCL13, CCL19, and CCL21 were purchased from R&D Systems (Minne- the sample, the column was washed with 5 ml of water and 5 ml of 5 mM ␣ apolis, MN), and LPS, poly(I:C), and L- -LPA were from Sigma-Aldrich. borax and 60 mM sodium formate. The columns were eluted with 3 ml of 0.9 M ammonium formate and 0.1 M formic acid. A volume of 0.2 ml of each elution was added to 10 ml of CytoScint and analyzed via scintillation Cell lines and cell cultures counting. 293T, CHO-K1, COS, and HeLa were obtained from the American Type Immunoblotting and immunoprecipitations Culture Collection (Manassas, VA). All of the cell lines were maintained in DMEM (Life Technologies, Carlsbad, CA) supplemented with 10% FCS Cell lysates were prepared using an appropriate lysis buffer plus protease (HyClone, Logan, UT) except CHO-K1 cells, which were maintained in inhibitors for 30 min on ice. The detergent-insoluble materials were re- RPMI 1640 (Life Technologies) supplemented with 10% FCS. moved by microcentrifugation for 10 min at 4¡C. Equal amounts of proteins from each sample were fractionated by 10% SDS-PAGE and transferred to pure nitrocellulose. Membranes were blocked with 5% BSA in Tween 20 plus TBS (TTBS) for 1 h and then incubated with an appropriate 4 C. Moratz, J. R. Hayman, H. Gu, and J. H. Kehrl. Abnormal B cell responses to dilution of the primary Ab in 5% BSA in TTBS for2horovernight. The chemokines, disturbed plasma cell localization and distorted tissue architecture in blots were washed three times with TTBS before the addition of a biotin- Rgs1Ϫ/Ϫ mice. Submitted for publication. ylated Ab (DAKO, Carpinteria, CA) diluted 1/5,000 in TTBS containing The Journal of Immunology 5177

5% BSA for 1 h and then incubated with streptavidin conjugated to HRP (ERK) activation was detected by immunoblotting with anti- (DAKO) diluted 1/10,000 in TTBS containing 5% BSA for 1 h. The signal phospho-p42/44 ERK mAb using detergent-soluble fraction of lysates after was detected by ECL according to the manufacturer’s instruction (Amer- fractionation by SDS-PAGE. sham Pharmacia Biotech). RT-PCR and Northern blot analysis Mitogen-activated protein kinase (MAPK) assay or ERK activation Total RNA was isolated using TRIzol reagents. For RT-PCR, 500 ng of total RNA was used for reverse transcription (Qiagen). The PCR primers COS cells were transfected with appropriate receptor expression construct used for the PCR are listed in Table I. (0.5 ␮g, respectively) in presence or absence of RGS18-3XFlag, RGS3- For the quantitative RT-PCR, a Roche LightCycler was used with a Flag, or RGS1-Flag (2.0 ␮g, respectively) using Superfect (Qiagen, Va- LightCycler Fast Start-DNA Master Syber Green 1 kit (no. 2239264; lencia, CA). Pertussis toxin (PTX; Calbiochem, Darmstadt, Germany) Roche, Indianapolis, IN). Melting curve analysis was performed to control treatment for6hatconcentration of 100 ng/ml was used as positive con- the specificity of PCR product fluorescence. Value of the crossing point trol. Twenty-four hours after transfection, the cells were starved with fresh was determined for each gene and sample during real-time PCR. The value DMEM without FCS for 6 h and then stimulated with LPA (30 ␮mol/L), of crossing point represents the number of cycles where fluorescence levels CXCL12 (100 ng/ml), CXCL13 (250 ng/ml), or CCL19 (250 ng/ml) for of each sample are the same. Plasmids with the appropriate PCR insert varying durations, and then lysed with 300 ␮l of kinase lysis buffer. MAPK subcloned served as the control templates. For the Northern blot analysis,

Table I. Primers used for the PCR

Gene 5Ј and 3Ј Primers PCR Product (bp) Downloaded from

RGS1 ACCTGAGATCTATGATCCCACATCTGG & GGCTATTAGCCTGCAGGTCAT 460 RGS2 CAGACCCATGGACAAGAGCGC & TAGCATGAGGCTCTGTGGTGA 590 RGS3L TTGGCTGTCAGGGCAGCTGTACAATAGTGG & CACTGAACTCAGTGCGAAGGAAGGCTTGGA 1300 RGS3P AACCGCTTCAATGGGCTCTGCAAGGTGTGC & CCTCTTCTCATCTGCCTCCGTCTCAAACAT 1200 RGS3S CTCCGAGGCATGTACCTCACTCGCAACGGG & CACTGAACTCAGTGCGAAGGAAGGCTTGGA 200 RGS4 GCCGGCTTCTTGCTTGAGGAG & CACTGAGGGACCAGGGAAGCA 590 RGS5 ATGTGCAAAGGACTTGCAGCTTTGCCCCAC & TTGATTAACTCCTGATAAAACTCAGAGCGC 541 http://www.jimmunol.org/ RGS6 GTCCACAGGCCTGTGCCAGGC & CGTGAGGCGCTTGCCCGCCAG 850 RGS7 TCTGGGACGTGCACAGGCCCG & CCCTCTGCTGGCTCGGTTCTT 390 RGS8 AGACCCTCAGGCCATGAGGAC & GAGCCTCCTCTGGCTTTGGGA 540 RGS9 GTGCACCGATGCCCTCCTGGA & GCTGGGAGCCATGTGCTGGCC 860 RGS10 AGCCTCAAGAGCACAGCCAAATGG & TGCTTCTTAAAGCTGCCAGTCC 494 RGS11 AGGAAGATGGAGCGGGTGGTC & ACGGAGCTTCGTGGGGGCAGC 840 RGS12 ACCAGGAGCACCGGGAGGTCC & CTCTCCCGTAGCCGAGTGGTT 710 RGS13 ATGAGCAGGCGGAATTGTTGGA & GAAACTGTTGTTGGACTGCATA 480 RGS14 GGGCACAGCAGCTTCAGATCTTCA & GCCCTGAGACTCTCGGCGCAAGGC 296 RGS16 CACCTGCCTGGAGAGAGCCAA & TGGCAGAGGCGGCTGAGGCTT 540 by guest on September 26, 2021 RGS17 AGGAACACCTGCCGTGTCTCA & GATTCAGAAGAAGAGCCAGCAGTACTT 600 RGS18 ATGGAAACAACATTGCTTTTCT & TTATAACCAAATGGCAACATCTGA 708 RGS19 AGCCGCAACCCCTGCTGCCTG & AGGAGGACTGTGATGGCCCCT 540 RGS20 GAGCGGGGAGTCGCGGGTCCA & TAGATTTCTCCGATAAGGACTGAAGCA 560 Actin GTTTGAGACCTTCAACACCC & ATACTCCTGCTTGCTGATCC 699 Rgs1 GATCCCACATCTGGAATCTGG & GCTGTCGATTCTCGAGTATGG 310 Rgs2 AGTGCAGGCAACGGCCCCAAG & TGGGGCTCCGTGGTGATCTGT 570 Rgs3S TCCTGAGTCTCAAGGTGGGGGGAC & CAGAGCGGAGGAAGCGAGGGTAAGAGT 562 Rgs3L GTGCTTATTCACTTTGGAGGCACA & TGGGTGGGAGGTCTTGTCCTACAG 410 Rgs4 GCCGGCTTCCTGCCTGAGGAG & TGCAGACTGCACTTCCCTGGT 580 Rgs5 ATGTGTAAGGGACTGGCAGCTCTGCC & CGCTCTGAATTTTATAAGGAGCTAATCAAG 540 Rgs6 TGCCGCCCAGGGCTACATCTT & GCAGTATGTGGAGTACGACCC 630 Rgs7 CAGTGGAGGATCTCCATTTGG & ACAGGCCTGTGCCTGGATGTG 390 Rgs8 GGCAGAGGAAGCCTTCAAGTC & CAGAGTCCTGCTGACGGGGAC 630 Rgs9 GGCTGGTGCACCGAAGTCCGC & GCTCCAGCCCAAGCCCTGTCA 770 Rgs10 AGATGGGAGCTCAAGCAGCGG & GGAGGCTCGCTTAGCTGCGGT 470 Rgs11 CCCAACGTGGCTGCCCCCACA & AGGGAGCCTGCAGCAACCAGT 520 Rgs12 AGCACGGGGCGGTGGGAGAAG & GCTCAGAGCAACAGAGCCGAT 900 Rgs13 TCTACACCATTGTACCAGCATGAG & CCTTCTAAGGTCAATCATGGACATGCTGCT 1080 Rgs14 AACGGGCGCATGGTTCTGGCTGTCTCAGATGG & CCGACTCTCGCTCTCACTCTC 870 Rgs16 GTTCAAGACGCGGCTGGGAAT & AAGGCTCAGCTGGGCTGCCGC 540 Rgs17 TGGAGAGCATCCAGGTCCTAG & GGAAAGTACCACCAGCTGTAC 440 Rgs18 CAGAATATGGATATGTCACTGGTTTTCTTCT & CATAACCAAATGGCAACATCTGACTTTACATC 720 Rgs19 ACCTCCCAGTCGCAATCCCTG & GACTGTGGGGCCCCCTGGAGT 550 Rgs20 GGCTAGCCCAGCGGACCCTGG & GGACTCCCAAGTAGCAGAGGT 520 GNAS ATGGGCTGCCTCGGGAACAGTAAG & CCGGATGACCATGTTGTAGCTGCT 780 GNAI1 TGAGGACGGCGAGAAGGCGGCGCG & CCAGCAAGTTCTGCAGTCATAAAGCCT 289 GNAI2 GGCCGAGCGCTCTAAGATGATCGA & GGACAGGTCATCAGGGAGCACGCC 340 GNAI3 AGTGGAGCGAAGCAAGATGATCGA & TGCCGGGCATCATCTGCCCTGGCA 282 GNAO ATGGGATGTACTCTGAGCGCAGAG & TCGCTGGCCTCCGACGTCAAACAG 620 GNAZ AAAAAGAAGCAGCCCGGCGGTCCC & ATGACGTCTGTCACCGCGTCGAAG 1006 GNAQ ATGACTCTGGAGTCCATCATGGCG & TGCGTAGGCAGGTAGGCAGGGTCA 528 GNA11 TGATGGCGTGTTGCCTGAGCGATG & CCACCAGGTGCGAGTACAGGATCT 861 GNA14 ATGGCCGGCTGCTGCTGCCTGTCC & CTGTAGAATTGTGTCTTTGACAGCAGC 1030 GNA16 ATGGCCCGCTCGCTGACCTGGCGC & CCGTCCACGCACCCGGTGTACATC 980 GNA12 TCTGGCATCAGGGAGGCTTTCAGC & CACGGTCTTCACCTTCTCCACCAG 444 GNA13 GACTTCCTGCCGTCGCGGTCCGTG & GTTTCCACCATTCCTTGGGCTGCC 410 5178 TLR SIGNALING AND RGS PROTEINS

RNA was size fractionated and transferred to nitrocellulose. The membranes were hybridized with a 708-bp RGS18 cDNA fragment or a 1137-bp CCR7 cDNA fragment labeled with [␣-32P]dCTP using Prime-It RmT Random Primer Labeling kit (Stratagene, La Jolla, CA) as a probe. ␤-Actin expression was used as a control. Hybridization was performed at 68¡C for 2 h using QuickHyb (Stratagene), washed three times in 2ϫ SSC/0.1% SDS for 15 min each at room temperature, and then in 0.1ϫ SSC/0.1% SDS at 60¡C for 30 min. Migration assay For CHO cell migration, CHO cells were transfected with or without 0.5 ␮g of expression vector for CCR7 in the presence of 2 ␮g of RGS18-GFP, RGS1-GFP, or pEGFP-N1 as control. After 36 h, the transfected cells were harvested and loaded into upper 8-␮m-pore polycarbonate six-well chamber (Corning, Cambridge, MA). CXCL12 (100 ng/ml), CCL19 (250 ng/ ml), and CCL21 (250 ng/ml) were diluted in serum-free medium and added to the lower compartment. After 6-h incubation at 37¡C, the migrated cells were collected and counted with FACS at high speed for 1 min. The 100 ng/ml PTX-treated pEGFP-N1-transfected cells were used as positive control. For monocyte-derived DC migration, the recovered DCs were transfected with empty pEGFP-N1, hRGS-18-GFP, hRGS13-GFP, and hRGS1-

CT-GFP using Human Dendritic Cell Nucleofector kit I (Amaxa Downloaded from Biosystems, Gaithersburg, MD). The cells were incubated in presence of 100 ng/ml GM-CSF and 50 ng/ml IL4 at 37¡C for 48Ð60 h and then harvested for migration assay using 5-␮m pore polycarbonate ﬁlter in 24- well Transwell chambers (Corning) with or without chemokines in lower well at concentration of SDF1␣/CXCL12 (100 ng/ml), MIP-3␤/CCL19 (250 ng/ml), or 6Ckine/CCL21 (250 ng/ml) for 3 h. The PTX-treated (100 ng/ml) pEGFP-N1-transfected cells (3 h) was used as positive control. The

migrated cells were harvested, and the green ﬂuorescent protein (GFP)- http://www.jimmunol.org/ positive cells were counted with FACS for 1 min at high ﬂow speed. The initial cell pools were counted as control of loaded cell number. The percentage of migration is calculated by dividing migrated GFP-positive cell number with loaded GFP-positive cell number. The migration assays with the murine BM-derived DCs were performed similar to those performed with the human DCs. Generation of Rgs1Ϫ/Ϫ mice The targeting construct was designed by replacing the small Xbal fragment

located at the end of exon 1 with the neomycin gene. For negative selection by guest on September 26, 2021 of nonhomologous recombination, the thymidine kinase gene was placed in opposite transcriptional orientation upstream of exon 1. Following electro- poration with the linearized targeting, ES cells were selected with G418 and resistant clones screened for homologous recombination. Resultant ES clones were injected into C57BL/6J blastocysts. Chimeric mice were bred, and germline transmission was documented by Southern blotting. Screen- ing for homozygous Rgs1Ϫ/Ϫ mice was performed by PCR analysis of genomic DNA using Rgs1-specific primers. The Rgs1 mutation was back- crossed onto a C57BL/6 background six times. Mice were housed in specific pathogen-free conditions and used in accordance to the guidelines of the Institutional Animal Care Committee at the National Institutes of Health. Results RGS protein expression in human monocytes and monocytes- derived DCs We reverse-transcribed RNAs extracted from purified human monocytes, iDC (monocytes cultured with GM-CSF and IL-4 for FIGURE 1. Expression of RGS proteins in DCs. A, Monocyte-derived 4Ð6 days), and iDC stimulated with LPS, poly(I:C), or CD95 for DCs were cultured in medium for 4 or 24 h or stimulated with LPS, CD95, either 4 or 24 h, and amplified the resulting DNA with specific or poly(I:C) for similar durations (lanes 1–8). RNA was extracted and primers for RGS1–14, RGS16–20,or␤-actin (Fig. 1A). We de- subjected to RT-PCR with primers specific for various RGS proteins or tected very low levels or no mRNA expression of RGS3–9, ␤ -actin. In addition, RNAs from monocytes (lane 9) were similarly ana- RGS11, RGS13, or RGS17 in monocytes, iDC, or stimulated iDC lyzed. Lane 10 is from RNA not subjected to reverse transcription before (data not shown). The purified monocytes contained modest amplification (no RT control). PCR products were fractionated on an aga- amounts of RGS2, RGS10, RGS14, and RGS19, and lower amounts rose gel followed by ethidium bromide staining. At the bottom of the figure, a Northern blot is shown, which documents RGS18, CCR7, and ␤-actin expression in similar RNAs. B, Quantitative RT-PCR analysis was performed with the same RNAs to determine changes in RGS18, RGS16,or ␣ RGS14, and G s expression. Human iDCs were cultured with medium for RGS1 relative to ␤-actin levels. The amounts are expressed as mRNA 24 h or stimulated with LPS for 24 or 48 h. Cell lysates were immuno- expression relative to ␤-actin. The RGS18 results (ϫ10) are shown. Be- blotted using a 1/300 dilution of anti-RGS1, 1/1000 dilution of anti- Ϫ4 ␣ cause the RGS16 peak expression level did not exceed 10 , the RGS16 RGS14, or 1/500 dilution of anti-G1 s. The approximate molecular masses results are not shown on the graph. C, Western blot analysis of RGS1, of the identified bands are indicated. The Journal of Immunology 5179 of RGS1, RGS16, and RGS18. In comparison, the iDCs had much affinity. An RGS14-specific Ab (31) documented the fall in RGS14 ␣ less RGS1 and RGS16 expression and a higher level of RGS18. expression following LPS signaling, whereas a G s-specificAb ␣ Signaling through the TLRs, TLR3 and TLR4, markedly enhanced demonstrated no significant change in G s levels, and an actin- RGS1, RGS16, and RGS20 expression, but down-regulated that of specific Ab revealed similar actin levels (Fig. 1C, and data not RGS14 and RGS18. The analysis of the same RNAs by Northern shown). blotting revealed the same pattern of RGS18 expression as detected ␣ by RT-PCR as well as verified the efficacy of the LPS and G expression in human BM-derived DCs poly(I:C) signaling, because both stimuli rapidly induced mRNA Signaling through the yeast pheromone receptor causes a signifi- expression for the chemokine receptor CCR7 (Fig. 1A, and data cant increase in the expression of the yeast RGS homolog SST2 as not shown). well as the yeast G␣ homolog GPA1 (32, 33). To determine Next, we established quantitative PCR assays for the analysis of whether the changes in RGS protein expression in DCs stimulated RGS1, RGS16, RGS18, and ␤-actin expression. We normalized the with TLRs was accompanied by the altered expression of G␣ sub- result from the RGS proteins to that of ␤-actin and expressed the units, we examined RNAs prepared from iDCs and iDCs stimu- data as nanograms per microliter based on standard curves gener- lated with LPS or poly(I:C) (Fig. 2) We found that monocytes and ␣ ␣ ␣ ated from plasmid DNA containing the appropriate inserts. This iDC expressed significant amounts of G s,G i2, and G 16, which approach allowed for a quantitative comparison between the dif- did not change significantly following TLR3 or TLR4 stimulation. ␣ ferent samples (Fig. 1B). We found that the iDC expressed modest iDC expressed low levels of G i3, which were reduced by TLR3 ϳ ␣ levels of RGS18 ( 50% higher than monocytes) and low levels of and TLR4 signaling. iDC also expressed low levels of G q and

␣ ␣ Downloaded from RGS1 (5-fold less than monocytes) and RGS16 (7-fold less than G 13; however, in contrast to G i3, TLR4 and, even more so, monocytes). Stimulation of iDC with LPS led to a ϳ24-fold increase in RGS1 levels, a 6-fold increase in RGS16, and a 100-fold decrease in RGS18 expression, whereas poly(I:C) stimulation caused a 32-fold increase in RGS1, 3-fold increase in RGS16, and a similar drop in RGS18, as did LPS.

Although high-quality Abs for many of the RGS proteins are http://www.jimmunol.org/ lacking, an RGS1 Ab raised against a peptide from the C terminus of RGS1 readily identified an LPS-inducible band at the appropriate molecular mass in human monocyte-derived DCs (Fig. 1C). Similar lysates immunoblotted with affinity-purified Abs raised against the C terminus of RGS18 failed to identify a band at the appropriate molecular mass, which decreased with stimulation (data not shown). Although this antiserum recognized overex- pressed RGS18, it did so poorly, suggesting that the failure to detect endogenous RGS18 may be secondary to a relatively low by guest on September 26, 2021

FIGURE 3. RGS18 inhibits M1 receptor signaling. A,IP3 production. COS cells were transfected with 0.2 ␮g of M1 receptor gene constructs in

the presence or absence of constructs that express RGS18 or RGS3. IP3 production was measured as described in Materials and Methods. The cells were stimulated with 100 ␮mol/L carbachol for 6 h after serum starving the cells. B, SRE activation. HeLa cells were cotransfected with 50 ng of a FIGURE 2. Levels of G␣ subunits in monocytes, monocyte-derived SRE reporter gene construct and 0.25 ␮g of M1 receptor gene construct DCs, and following TLR stimulation. RNAs extracted from monocytes in the presence or absence of RGS18 or RGS3. A construct that ex- (lane 9) or monocyte-derived DCs cultured in medium for 4 or 24 h or presses the Clostridium botulinum C3 exozyme served as a control. The stimulated with LPS, poly(I:C), or CD95 for similar durations were sub- cells were stimulated as above. Luciferase activity was measured and jected to RT-PCR (33 cycles) to analyze the expression of G␣ subunits. normalized to a control plasmid that expressed ␤-galactosidase. C, The RT-PCR products were size fractionated on agarose gels and visual- NF-␬B activation. HeLa cells were cotransfected with 0.2 ␮gofaM1 ized by ethidium bromide staining. The G␣ subunits are referred to by their receptor construct and 100 ng of a NF-␬B reporter gene construct in the GenBank names. There was no detectable expression of GNAI1, GNAO, presence or absence of constructs that express RGS18 or RGS3. Lucif- or GNA14, and low levels of GNAZ relative to the other G␣ subunits. erase activity normalized to ␤-galactosidase activity is shown. 5180 TLR SIGNALING AND RGS PROTEINS

TLR3 signaling caused a signiﬁcant increase in their expression ␣ levels. We did not detect PCR products arising from either G i1 or ␣ G o. Despite the pronounced induction of RGS20, we detected ␣ only a very low level of G z, which did not change following TLR signaling (data not shown). Immunoblotting with G␣-speciﬁc Abs ␣ ␣ ␣ ␣ revealed no changes in G s (above), G 16,G 12,orG i2 following LPS stimulation of iDCs (data not shown).

Comparison of RGS18 with RGS3 on M1 receptor and chemokine receptor signaling The pronounced alteration in RGS18 during DC maturation prompted a comparison between RGS18 and several other RGS proteins on known GPCR signaling pathways (Figs. 3 and 4). The activities of numerous RGS proteins have been assessed using the

M1 receptor, which signals through Gq and G12/13. To monitor Gq signaling, we measured the production of inositol 1,4,5-trisphos-

phates (IP3), and used the activation of a SRE reporter gene to assess both Gq and G12/13 signaling (34, 35). We ﬁrst compared RGS18 to RGS3, because RGS3 is among the most potent of the Downloaded from RGS proteins in inhibiting GPCR signaling (34). We transfected 293 cells with the M1 receptor and the following day stimulated the cells with M1 receptor ligand carbachol and measured the gen-

eration of IP3 and the activation of the SRE reporter (Fig. 5). Both RGS3 and RGS18 blunted to a similar extent the induction of IP3

by M1 receptor signaling. In contrast, RGS3 much more signifi- http://www.jimmunol.org/ cantly interfered with the M1 receptor-mediated activation of the SRE reporter than did RGS18. M1 receptor signaling also activates ␬ an NF- B-dependent reporter gene, probably also via Gq and G12/13 signaling (36). When we compared the effects of RGS3 and RGS18 on M1 receptor, both inhibited, although the effect of RGS3 again exceeded that of RGS18. LPA is a bioactive lipid mediator, which signals through the LPA1, LPA2, and LPA3 receptors, all of which are expressed by iDC and mDC (10). LPA stimulates iDC actin polymerization and by guest on September 26, 2021 chemotaxis, through a PTX-sensitive pathway. To assess the effect of RGS18 on LPA signaling, we transfected COS-7 cells with RGS18 or RGS3 and measured MAPK/ERK activation using phospho-specific Abs following exposure of COS-7 cells to LPA (Fig. 6). In this experiment, LPA signaled through the endogenous LPA receptors on COS-7 cells. We found that both RGS18 and RGS3 inhibited LPA-mediated ERK activation, although RGS3 reduced ERK activation slightly more than did RGS18. Next, we compared RGS18 and RGS3 on signaling through two chemokine receptors, CXCR4 and CXCR5 (Fig. 6). Both iDC and mDC express CXCR4, whereas a subset of DC that home to primary lymphoid follicles express CXCR5. Using a similar approach as with the other receptors, we transfected 293 cells with either CXCR4 or CXCR5 in the presence or absence of expression vectors for RGS18 or RGS3. We again monitored ERK activation using phospho-specific Abs at various time points following exposure to the

The cells (lanes 4–12) were stimulated with CXCL12 for 2, 5, or 10 min. Similar immunoblotting was performed as in the first panel. C, Inhibition FIGURE 4. Comparision of RGS18, RGS1, and RGS3 on signaling of CXCL13 induced ERK activation. Similar experiment as shown in sec- through the LPA receptor, CXCL12, CXCL13, and CCR7. A, Inhibition of ond panel except the cells were transfected with CXCR5 rather than LPA induced ERK activation. COS cells were transfected with or without CXCR4. The cells were stimulated with CXCL13 at final concentration of ␮ 2 g of vectors that express RGS18 (lanes 2, 5, 8, and 11)orRGS3 (lane 250 ng/ml for 5, 10, or 15 min. D, Inhibition of CCL19 induced ERK1 3, 6, 9, and 12). The cells (lanes 4–12) were stimulated with LPA (30 activation. COS cells were transfected with 0.5 ␮g of expression vector of ␮ mol/L) for 2, 5, or 10 min. The amount of phosphorylated ERK1 CCR7 (lanes 1–15) in the presence or absence of 2 ␮g of expression vec- (pERK1) induced was detected with a specific Ab by immunoblotting. The tors for RGS18 (lanes 2, 7, and 12), RGS1 (lanes 3, 8, and 13) or RGS3 levels of RGS3 and RGS18, and of ERK1 and ERK2 in the cell lysates are (lanes 4, 9, and 14). The cells treated with PTX (lanes 5, 10, and 15; 100 shown. B, Inhibition of CXCL12 induced ERK activation. COS cells were ng/ml) for 6 h was used as control. The cells were stimulated with CCL19 transfected with 0.5 ␮g of expression vector for CXCR4 (lanes 1–12)inthe (lanes 6-15)atfinal concentration of 250 ng/ml for 2 or 5 min. Similar presence or absence of 2 ␮g of expression vectors for RGS3 or RGS18. immunoblotting was performed as in the above panels. The Journal of Immunology 5181 Downloaded from

FIGURE 6. Rgs expression in murine BM-derived DCs. A, Rgs expression following LPS stimulation. BM-derived DCs were stimulated or not for 2 or 48 h; RNA was extracted and subjected to RT-PCR with Rgs-

specific primers listed in Table I (30Ð33 cycles). PCR products were frac- http://www.jimmunol.org/ tionated on an agarose gel followed by ethidium bromide staining. B, Effect FIGURE 5. Inhibition of CHO cell and monocyte-derived DC migra- of CXCL12 on Rgs1 and Rgs18 expression. BM-derived DCs were stim- tion in response to CXCL12, CCL19, and CCL21. A, RGS18 inhibits CHO ulated with LPS or CXCL12 for 2, 4, or 24 h. The levels of Rgs1, Rgs18, cell migration to CCL19 and CCL21. CHO cells were transfected with 0.5 and actin expression at the various time points are shown. ␮g of expression construct for CCR7 in the presence or absence of RGS18- GFP, RGS1-GFP, or GFP for 36 h, and then collected for migration assay as described in Materials and Methods. CCL19 and CCL21 were used at 250 ng/ml in the lower chamber. PTX treatment (100 ng/ml) for6hwas significantly inhibited the chemokine-induced enhancement. Fi- used as control. B, RGS18 inhibits human monocyte-derived DC cell mi- nally, we performed a similar experiment using DCs transfected gration. Recovered DCs were transfected with RGS18-GFP, RGS13-GFP, with RGS18-GFP, RGS1-GFP, or RGS13-GFP, inducing cell mi- by guest on September 26, 2021 RGS1-GFP, or GFP vector for 48 h, and then collected for migration assay gration by stimulation through endogenous chemokine receptors. as described in Materials and Methods. The data are represented as X Ϯ Although the transfection procedure had a deleterious effect SD from one experiment performed in triplicate. Medium or medium plus upon the migratory capacity of the DCs, each of the RGS-GFP either CXCL12 (100 ng/ml) or CCL21 (250 ng/ml) were placed in the fusion proteins significantly reduced DC migration in response bottom chamber. Where indicated, the cells were treated with PTX (100 to CXCL12, CCL19 (not shown), and CCL21 when compared ng/ml) for 6 h before the assay. The experiments were performed three with GFP alone. The decreased migratory capacity following times with similar results. transfection was not due to expression of GFP, but rather secondary to the transfection procedure itself (K. Harrison, unpublished observation). appropriate chemokine. Both RGS3 and RGS18 significantly inhibited CXCL12- and CXCL13-induced ERK activation. Finally, Rgs expression in mouse BM-derived DCs we examined signaling through the CCR7, a chemokine receptor Next, we examined the Rgs protein expression in mouse BM-de- induced on mDC (Fig. 6). We compared RGS1, RGS3, and rived DCs induced to mature with LPS for 2 or 48 h or not (Fig. RGS18. We did not detect a significant difference among the three 2A). A similar pattern of Rgs protein expression occurred, although RGS proteins. PTX blocked the CCR7-induced ERK activation, a we noted some differences. Like the human DCs, the levels of result consistent with the known role of Gi in chemokine signaling. Rgs2, Rgs10, and Rgs19 remained unchanged following stimula- Overall, the signaling data did not reveal any significant difference tion, Rgs1 and Rgs16 levels rose, and Rgs18 and Rgs14 levels between RGS18 and either RGS1 or RGS3 in modulating Gi or Gq declined, although by 48 h the levels of Rgs14 had begun to return signaling. toward the level observed in the immature cells. In contrast to the human cells, the mouse DCs expressed Rgs11, Rgs12, and Rgs17, Comparison of RGS18 and RGS on chemokine-induced cell but not Rgs20. migration Because CXCL12 signaling enhanced RGS1 expression in hu- We also tested whether RGS18 like RGS1 and RGS3 can inhibit man monocyte-derived DCs (K. Harrison, unpublished observa- chemokine-induced cell migration. First, we transfected CHO cells tion), we also examined the expression of Rgs1 and Rgs18 follow- with CXCR4 or CCR7 in the presence of expression vectors for ing stimulation of mouse BM-derived DCs with CXCL12 and GFP, RGS18-GFP, or RGS1-GFP, and measured the ability of the compared it to LPS. Again, the stimulation of BM-derived DCs cells to respond to either CXCL12 (data not shown), CCL19, or resulted in an up-regulation of Rgs1 and down-regulation of CCL21 (Fig. 7) using a standard filter-based assay. We found that Rgs18; however, in contrast to the human DCs, signaling through stimulation of the cells with the appropriate chemokine led to an CXCR4 had no effect on Rgs1 and Rgs18 expression (Fig. 2B). increase in CHO cell migration, and that both the RGS proteins Also, several other Rgs proteins including Rgs11, Rgs14, and 5182 TLR SIGNALING AND RGS PROTEINS

we analyzed the response of wild-type and Rgs1Ϫ/Ϫ BM-derived iDCs in a migration assay, using varying concentrations of either CXC12 or CC19 in the bottom well of the chemotaxis chamber. At every concentration that we tested, nearly twice as many Rgs1Ϫ/Ϫ iDCs migrated in response to CXCL12 and to CCL19 as compared with the wild-type iDCs (Fig. 7B). Somewhat surprisingly, the absence of Rgs1 had less effect on the ability of the mDCs to migrate in response to CXCL12 in the chemotaxis assay than it did in the iDCs. Nevertheless, the chemotactic response of the Rgs1Ϫ/Ϫ mDCs exceeded that of wild-type mice at every concentration tested.

Discussion Both TLR and GPCR receptor signaling have substantive roles in the regulation of DC function. Signaling through either TLR3 or TLR4 induces the maturation of iDC and alters the expression of chemokine receptors, i.e., induces CCR7 and CXCR4, and dimin-

ishes CCR5 and CCR6. TLR signaling signiﬁcantly alters the ex- Downloaded from pression of RGS proteins in human monocyte-derived DCs, decreasing RGS18 and RGS14, but augmenting RGS1, RGS16, and RGS20. In addition, TLR signaling induces changes in the expression of several G␣ subunits including increasing the expression of ␣ Gq␣ and G 13 in these cells. This provides a mechanism whereby

TLR signaling can regulate signaling through chemokine receptors http://www.jimmunol.org/ and other GPCRs. Consistent with human monocyte-derived DC data, mouse BM-derived iDCs expressed a similar pattern of Rgs FIGURE 7. Migratory response of BM-derived DCs from wild-type and proteins, whose expression levels responded similarly to LPS sig- Rgs1Ϫ/Ϫ mice. A, Rgs1 and Rgs18 expression in wild-type and Rgs1Ϫ/Ϫ naling. Of the RGS proteins modulated by TLR signaling, we fo- mice. RNA extracted from BM-derived DCs stimulated with LPS for 24 h cused on RGS1 and RGS18 because of their substantial regulation Ϫ Ϫ (mDC) or not (iDC) from wild-type and Rgs1 / was subjected to RT-PCR and the availability of Rgs1Ϫ/Ϫ mice. to detect Rgs1, Rgs18, and actin expression levels. B, Migration of iDCs to We showed that iDC cells express RGS18 and that TLR receptor Ϫ/Ϫ CXCL12 or CCL19. Wild-type and Rgs1 BM-derived iDCs were sub- signaling potently down-regulates it. Three previous reports doc-

jected to a standard chamber chemotaxis assay using increasing concen- by guest on September 26, 2021 umented strong RGS18 expression in megakaryocytes (37Ð39), trations of either CXCL12 or CCL19. Data are shown as percentage of migration and are representative of one of three experiments performed. C, and another report found that hemopoietic stem cells express high Migration of mDCs to CXCL12. Wild-type and Rgs1Ϫ/Ϫ BM-derived DCs amounts of Rgs18 (40). These reports also demonstrated that Ju- ϩ were stimulated to mature by treating with LPS for 24 h. Percentage of rkat, K562, platelets, and CD14 peripheral blood cells expressed Ϫ/Ϫ migration of wild-type and Rgs1 -deﬁcient mDCs in response to increas- RGS18. RGS18 acted as a GAP for Gi␣ and Gq␣ and localized in ing concentrations of CXCL12 is shown. Representative of one of three the cytosol of megakaryocytes. It also inhibited angiotensin-in- experiments performed. duced IP3 production in 293 cells and CCR2 signaling (37, 38, 40). We performed a wider range of functional studies of RGS18 than

previously reported, revealing that it inhibits Gi and/or Gq signal- Rgs16 did not change following exposure to CXCL12 (data not ing through the CXCR4, CXCR5, CCR7, LPA receptors, and the shown). M1 receptor. In most instances, RGS18 behaved similar to RGS3 in its effect on GPCR signaling, and our data suggests that RGS18 Migration of Rgs1-deficient mouse BM-derived DCs is a particularly potent inhibitor of Gq signaling. In addition, we The availability of mice in which Rgs1 has been disrupted allowed demonstrated that RGS18 inhibited chemokine-induced DC mi- us to directly test the effect of Rgs1 on the migratory response of gration; however, its role in DC function will require further study. DCs to chemokines. Mice homozygous for the Rgs1 mutation have Besides decreasing RGS18, TLR signaling also decreased no readily apparent abnormalities, although many of the B cell RGS14 levels in human monocyte-derived iDC and Rgs14 and ␣ ␣ follicles in their spleens have germinal centers even in the absence Rgs11 in mouse BM-derived DCs. RGS14 possesses G i and G o ␣ of immune stimulation. Furthermore, antigenic stimulation of a GAP activity, G i guanine nucleotide dissociation inhibitor activ- Rgs1Ϫ/Ϫ mouse leads to an exaggerated splenic germinal center ity, and a small GTPase binding domain (31, 41, 42). A recent reaction, partial disruption of the normal architecture of the spleen microarray study of DCs exposed to various pathogens (43) also and Peyer’s patches, and abnormal trafficking of Ab-secreting indicates that RGS14 levels decreases in DCs following exposure cells.4 Although many of these abnormalities likely result from to Leishmania major or Toxoplasma gondii. Rgs11, which contains improper trafficking of Rgs1Ϫ/Ϫ B cells, DC defects may also con- a conserved DEP (Dishevelled/EGL-10/Pleckstrin) and a GGL (G tribute. We first verified that the Rgs1Ϫ/Ϫ iDCs and mDCs lacked protein ␥-like) domain, is prominently expressed in the brain and Rgs1 mRNA. We prepared BM-derived DCs from wild-type and not previously reported to be expressed in any BM-derived Rgs1Ϫ/Ϫ mice, stimulated them with LPS or not, and checked Rgs1 cell type. expression. As expected, Rgs1Ϫ/Ϫ DCs lacked Rgs1 expression, Although TLR signaling reduced RGS18 and RGS14 expres- but possessed levels of Rgs18 similar to that of wild-type mice, sion, RGS1 and RGS20 and to a lesser extent RGS16 were induced. indicating that the disruption of Rgs1 did not effect Rgs18 expres- The two original reports of RGS20 documented a largely brain- sion (Fig. 7A). Rgs18 resides near to Rgs1 on chromosome 1. Next, specific expression pattern (44, 45). However, RGS20 expressed The Journal of Immunology 5183 sequence tags suggest a broader range of tissue expression, be- changing pattern of responses (9Ð12), an altered RGS protein ex- cause expressed sequence tags have been found in cDNA libraries pression could explain the apparent switch from a prominent Gi from placenta, liver, melanocytes, and several tumors. The level of response to a Gs response. Two important factors distinguish the RGS20 expression we detected in poly(I:C)-treated DCs was sim- chemokine receptors from the GPCR receptors for the above li- ilar to those observed with RNA from brain (K. Harrison, unpub- gands. First, the LPA, ATP, histamine, and likely the S-1P recep- lished observation). Because RGS20 has potent Gz GAP activity, tors have subtypes that couple to Gs, whereas chemokine receptors ␣ the question arose whether TLR signaling altered DC G z expres- do not. Therefore, a modest reduction in Gi signaling mediated by ␣ sion. However, we detected only low levels of G z, which did not an RGS protein may facilitate a Gs-mediated response in those change with TLR3 or TLR4 signaling. A recent study documented ligands that have Gs- and Gi-coupled receptors. In contrast, no ␣ a role for G z in maintenance of the Golgi apparatus. The over- Gs-coupled response is unmasked with chemokine receptors. Sec- expression of RGS20 caused the dissolution of the Golgi complex ond, mDCs markedly increase their CXCR4 and CCR7 expression in HeLa cells (46). Because DCs are known to tightly control the levels (6, 7), whereas the expression of the nonchemokine recep- compartmentalization and transport of MHC class I and class II tors remain stable. The high receptor levels and large amounts of molecules (47), perhaps Gz and RGS20 have some role in the reg- chemokines may overcome some of the inhibitory effects of the ulation of MHC transport through the Golgi complex. RGS16 ex- RGS proteins, whereas those GPCRs expressed at lower levels pression was also up-regulated in response to TLR signaling, al- remain sensitive. though much more in human than in mouse cells. RGS16 In conclusion, TLR signaling dramatically altered RGS expres- reportedly regulates signaling through CXCR4, CCR3, and CCR5 sion in human and murine iDCs, increasing RGS1 (Rgs1) and in T cells, while having little effect on CCR2 and CCR7 RGS16 (Rgs16), and decreasing RGS14 (Rgs14) and RGS18 Downloaded from signaling (48). (Rgs18). One consequence of the enhanced RGS1, RGS16, and

Human monocyte-derived iDCs express low levels of RGS1, RGS20 expression may be to shunt a prominent Gi response to a Gs and TLR signaling markedly increases RGS1 expression and response to those ligands that have both Gi- and Gs-coupled re- RGS1 protein levels. Similarly, mouse BM-derived iDCs express ceptors. Consistent with that hypothesis is the known shift in lower amounts of Rgs1 than do mDCs stimulated with LPS to GPCR signaling that occurs during DC maturation. Studies of the Ϫ/Ϫ mature. Analysis of the chemotactic response of iDCs from Rgs1 iDCs indicate that RGS1 sets a threshold for chemoat- http://www.jimmunol.org/ Rgs1Ϫ/Ϫ mice revealed a heightened sensitivity to both CXCL12 tractant responses in these cells. The ability of mDCs to respond to and CCL19, arguing that Rgs1 functions in iDCs to set a threshold chemoattractants despite their significant up-regulation of RGS1 for chemokine-triggered cell migration. Those cells with a lower argues for another level regulation, which likely has an important level respond while those cells with a higher level do not. physiological role in DC function. A higher percentage of BM-derived mouse mDCs migrated to CXCL12 than did iDCs at each concentration tested, despite the Acknowledgments normal up-regulation of Rgs1 expression that occurs in wild-type We thank Mary Rust for her editorial assistance and Dr. Anthony Fauci for mDCs. Although the lack of Rgs1 further enhanced the chemotac- his continued support. tic response of mDCs to CXCL12, the difference was not as strik- by guest on September 26, 2021 Ϫ/Ϫ ␣ ing as between wild-type and Rgs1 iDCs. Because G i expres- References sion did not significantly change during DC maturation, an 1. Banchereau, J., F. Briere, C. Caux, J. Davoust, S. Lebecque, Y. T. Liu, ␣ B. Pulendran, and K. Palucka. 2000. Immunobiology of dendritic cells. Annu. increased availability of G i is an unlikely explanation for their Rev. Immunol. 18:767. robust CXCL12-triggered migratory response. What else might ex- 2. Sallusto, F., and A. Lanzavecchia. 2000. Understanding dendritic cell and T- plain the enhanced migratory response of wild-type mDCs? One lymphocyte traffic through the analysis of chemokine receptor expression. Im- possibility is that some of the intracellular pool of RGS1 protein is munol. Rev. 177:134. 3. Janeway, C. A., and R. Medzhitov. 2002. Innate immune recognition. Annu. Rev. unavailable to interfere with chemokine signaling. For example, a Immunol. 20:197. posttranslational modification triggered by TLR signaling might 4. Kaisho, T., and S. Akira. 2003. Regulation of dendritic cell function through interfere with the intracellular localization or function of RGS1. Toll-like receptors. Curr. Mol. Med. 3:373. 5. Rescigno, M., M. Martino, C. L. Sutherland, M. R. Gold, and Another possibility is that the overall balance of RGS proteins in P. Ricciardi-Castagnoli. 1998. Dendritic cell survival and maturation are regu- mDCs favors enhanced signaling: although Rgs1 expression in- lated by different signaling pathways. J. Exp. Med. 188:2175. creases, Rgs18 and Rgs14 expression falls. Finally, the enhanced 6. Sozzani, S., W. Luini, A. Borsatti, N. Polentarutti, D. Zhou, L. Piemonti, G. D’Amico, C. A. Power, T. N. Wells, M. Gobbi, et al. 1997. Receptor expression chemotaxis of mDCs may be secondary to alterations in the levels and responsiveness of human dendritic cell to a defined set of CC and CXC of CXCR4 or other components in the signaling apparatus. Future chemokines. J. Immunol. 159:1993. 7. Sallusto, F., P. Schaerli, P. Loetscher, C. Schaniel, D. Lenig, C. R. Mackay, studies should be able to delineate among these possibilities. S. Quin, and A. Lanzavecchia. 1998. Rapid and coordinated switch in chemokine Several studies have observed differences in the responsiveness receptor expression during dendritic cell maturation. Eur. J. Immunol. 28:2760. of human monocyte-derived iDC and mDC to GPCR signaling. 8. Idzko, M., A. la Sala, D. Ferrari, E. Panther, Y. Herouy, S. Dichmann, M. Mockenhaupt, F. Di Virgilio, G. Girolomoni, and J. Norgauer. 2002. Expres- Although both iDC and mDC have a similar array of S-1P recep- sion and function of histamine receptors in human monocyte-derived dendritic tors, S-1P stimulated a PTX-sensitive (Gi-sensitive) increase in cells. J. Allergy Clin. Immunol. 109:839. actin polymerization and chemotaxis of iDC, but those responses 9. Idzko, M., E. Panther, S. Corinti, A. Morelli, D. Ferrari, Y. Herouy, S. Dichmann, M. Mockenhaupt, P. Gebicke-Haerter, F. Di Virgilio, et al. 2002. Sphingosine were lost by DCs matured with LPS. In mDCs, S-1P inhibited the 1-phosphate induces chemotaxis of immature and modulates cytokine-release in secretion of TNF-␣ and IL-12, and it enhanced secretion of IL-10 mature human dendritic cells for emergence of Th2 immune responses. FASEB J. (9). The differential effect of S-1P on iDCs and mDCs suggests a 16:625. 10. Panther, E., M. Idzko, S. Corinti, D. Ferrari, Y. Herouy, M. Mockenhaupt, prominent Gi response or Gs response, respectively. Although S. Dichmann, P. Gebicke-Haerter, F. Di Virgilio, G. Girolomoni, and J. Norgauer. 2002. The influence of lysophosphatidic acid on the functions of none of the five S1P receptors, S1P1Ð5, functionally couple to Gs, human dendritic cells. J. Immunol. 169:4129. recently S-1P has been shown to be a ligand for GPR3, GPR6, and 11. Idzko, M., S. Dichmann, D. Ferrari, F. Di Virgilio, A. la Sala, G. Girolomoni, GPR12, receptors that do couple to Gs (49). Studies of LPA, ATP, E. Panther, and J. Norgauer. 2002. Nucleotides induce chemotaxis and actin and histamine signaling suggest a similar pattern, G -coupled re- polymerizaton in immature but not mature human dendritic cells via activation of i pertussis toxin-sensitive P2y receptors. Blood 100:925. sponses in iDC and Gs-coupled responses in mDCs (10Ð12). Al- 12. Braun, M. C., and B. L. Kelsall. 2001. Regulation of interleukin-12 production by though a change in receptor expression did not account for the G-protein-coupled receptors. Microbes Infect. 3:99. 5184 TLR SIGNALING AND RGS PROTEINS

13. Aliberti, J., C. ReiseSousa, M. Schito, S. Hieny, T. Wells, G. B. Huffnagle, and 33. Dohlman, H. G., J. Song, D. Ma, W. E. Courchesne, and J. Thorner. 1996. Sst2, A. Sher. 2000. CCR5 provides a signal for microbial induced production of IL-12 a negative regulator of pheromone signaling in the yeast Saccharomyces cerevi- by CD8␣ϩ dendritic cells. Nat. Immunol. 1:83. siae: expression, localization, and genetic interaction and physical association 14. Hepler, J. R., and A. G. Gilman. 1992. G proteins. Trends Biochem. Sci. 17:383. with Gpa1 (the G-protein ␣ subunit). Mol. Cell. Biol. 16:5194. 15. Neer, E. J. 1995. Heterotrimeric G proteins: organizers of transmembrane signals. 34. Scheschonka, A., C. W. Dessauer, S. Sinnarajah, P. Chidiac, C. S. Shi, and Cell 80:249. J. H. Kehrl. 2000. RGS3 is a GTPase-activating protein for Gi␣ and Gq␣ and a 16. Kehrl, J. H. 1998. Heterotrimeric G protein signaling: roles in immune function potent inhibitor of signaling by GTPase-deﬁcient forms of Gq␣ and G11␣. Mol. and ﬁne-tuning by RGS proteins. Immunity 8:1. Pharmacol. 58:719.

17. Dietzel, C., and J. Kurjan. 1987. Pheromonal regulation and sequence of the 35. Shi, C. S., S. Sinnarajah, H. Cho, T. Kozasa, and J. H. Kehrl. 2000. G13␣-me- Saccharomyces cerevisiae SST2 gene: a model for desensitization to pheromone. diated PYK2 activation: PYK2 is a mediator of G13␣-induced serum response Mol. Cell. Biol. 7:4169. element-dependent transcription. J. Biol. Chem. 275:24470. 18. Koelle, M. R., and H. R. Horvitz. 1996. EGL-10 regulates G protein signaling in ␬ 36. Shi, C. S., and J. H. Kehrl. 2001. PYK2 links Gq␣ and G13␣ signaling to NF- B the C. elegans nervous system and shares a conserved domain with many mam- activation. J. Biol. Chem. 276:31845. malian proteins. Cell 84:115. 37. Nagata, Y., M. Oda, H. Nakata, Y. Shozaki, T. Kozasa, and K. Todokoro. 2001. 19. Lee, B. N., and T. H. Adams. 1994. Overexpression of flbA, an early regulator of ␣ ␣ A novel regulator of G-protein signaling bearing GAP activity for G i and G q Aspergillus asexual sporulation, leads to activation of brlA and premature initi- in megakaryocytes. Blood 97:3051. ation of development. Mol. Microbiol. 14:323. 38. Yowe, D., N. Weich, M. Prabhudas, L. Poisson, P. Errada, R. Kapeller, K. Yu, 20. De Vries, L., M. Mousli, A. Wurmser, and M. G. Farquhar. 1995. GAIP, a protein L. Faron, M. Shen, J. Cleary, et al. 2001. RGS18 is a myeloerythroid lineage- ␣ that specifically interacts with the trimeric G protein G i3, is a member of a specific regulator of G-protein-signalling molecule highly expressed in protein family with a highly conserved core domain. Proc. Natl. Acad. Sci. USA megakaryocytes. Biochem. J. 359:109. 92:11916. 39. Gagnon, A. W., D. L. Murray, and R. J. Leadley. 2002. Cloning and character- 21. Druey, K. M., K. J. Blumer, V. H. Kang, and J. H. Kehrl. 1996. Inhibition of ization of a novel regulator of G protein signalling in human platelets. Cell. G-protein-mediated MAP kinase activation by a new mammalian gene family. Signal. 14:595. Nature 379:742. 40. Park, I. K., C. A. Klug, K. Li, L. Jerabek, L. Li, M. Nanamori, R. R. Neubig, 22. Berman, D. M., T. M. Wilkie, and A. G. Gilman. 1996. GAIP and RGS4 are

L. Hood, I. L. Weissman, and M. F. Clarke. 2001. Molecular cloning and char- Downloaded from GTPase-activating proteins for the G ␣ i subfamily of G proteins subunits. Cell acterization of a novel regulator of G-protein signaling from mouse hematopoi- 86:445. etic stem cells. J. Biol. Chem. 276:915. 23. Watson, N., M. E. Linder, K. M. Druey, J. H. Kehrl, and K. J. Blumer. 1996. RGS 41. Kimple, R. J., L. De Vries, H. Tronchere, C. I. Behe, R. A. Morris, M. Faquhar, family members: GTPase-activating proteins for heterotrimeric G-protein ␣-sub- and D. P. Siderovski. 2001. RGS12 and RGS14 GoLoco motifs are G␣ inter- units. Nature 383:172. i action sites with guanine nucleotide dissociation inhibitor activity. J. Biol. Chem. 24. Hunt, T. W., T. A. Fields, P. J. Casey, and E. G. Peralta. 1996. RGS10 is a 276:29275. selective activator of G␣ GTPase activity. Nature 383:175. i 42. Siderovski, D. P., M. Diverse-Pierluissi, and L. De Vries. 1999. The GoLoco 25. Mao, J., H. Yuan, W. Xie, and D. Wu. 1998. Guanine nucleotide exchange factor ␣ motif: a G i/o binding motif and potential guanine-nucleotide exchange factor.

GEF115 speciﬁcally mediates activation of Rho and serum response factor by the http://www.jimmunol.org/ ␣ ␣ Trends Biochem. Sci. 24:340. G protein subunit G 13. Proc. Natl. Acad. Sci. USA 27:12973. 26. Kozasa, T., X. Jiang, M. J. Hart, P. M. Sternweis, W. D. Singer, A. G. Gilman, 43. Chaussabel, D., R. T. Semnani, M. A. McDowell, D. Sacks, A. Sher, and G. Bollag, and P. C. Sternweis. 1998. p115 RhoGEF, a GTPase activating protein T. B. Nutman. 2003. Unique gene expression proﬁles of human macrophages and ␣ ␣ dendritic cells to phylogenetically distinct parasites. Blood 102:672. for G 12 and G 13. Science 280:2109. 27. Bowman, E. P., J. J. Campbell, K. M. Druey, A. Scheschonka, J. H. Kehrl, and 44. Glick, J. L., T. E. Meigs, A. Miron, and P. J. Casey. 1998. RGSZ1, a Gz-selective E. C. Butcher. 1998. Regulation of chemotactic and proadhesive responses to regulator of G protein signaling whose action is sensitive to the phosphorylation chemoattractant receptors by RGS (regulator of G-protein signaling) family state of Gz␣. J. Biol. Chem. 273:26008. members. J. Biol. Chem. 273:28040. 45. Wang, J., A. Ducret, Y. Tu, T. Kozasa, R. Aebersold, and E. M. Ross. 1998. 28. Moratz, C., V. H. Kang, K. M. Druey, C. S. Shi, A. Scheschonka, P. M. Murphy, RGSZ1, a Gz-selective RGS protein in brain: structure, membrane association, ␣ T. Kozasa, and J. H. Kehrl. 2000. Regulator of G protein signaling 1 (RGS1) regulation by G z phosphorylation, and relationship to a Gz GTPase-activating protein subfamily. J. Biol. Chem. 273:26014. markedly impairs Gi␣ signaling responses of B lymphocytes. J. Immunol.

164:1829. 46. Nagahama, M., S. Usui, T. Shinohara, T. Yamaguchi, K. Tani, and M. Tagaya. by guest on September 26, 2021 ␣ 29. Reif, K., and J. G. Cyster. 2000. RGS molecule expression in murine B lympho- 2002. Inactivation of G z causes disassembly of the Golgi apparatus. J. Cell. Sci. cytes and ability to down-regulate chemotaxis to lymphoid chemokines. J. Im- 115:4483. munol. 164:4720. 47. Ackerman, A. L., and P. Cresswell. 2003. Regulation of MHC class I transport in 30. Inaba, K., M. Inaba, N. Romani, H. Aya, M. Deguchi, S. Ikehara, S. Muramatsu, human dendritic cells and the dendritic-like cell line KG-1. J. Immunol. and R. M. Steinman. 1992. Generation of large numbers of DC from mouse bone 170:4178. marrow cultures supplemented with GM-CSF. J. Exp. Med. 176:1693. 48. Lippert, E., D. L. Yowe, J. A. Gonzalo, J. P. Justice, J. M. Webster, E. R. Fedyk, 31. Cho, H., T. Kozasa, K. Takekoshi, J. De Gunzburg, and J. H. Kehrl. 2000. M. R. Hodge, C. Miller, J. C. Gutierrez-Ramos, F. Borrego, et al. 2003. Role of RGS14, a GTPase-activating protein for Gi␣, attenuates Gi␣- and G13␣-mediated regulator of G protein signaling 16 in inﬂammation-induced T lymphocyte mi- signaling pathways. Mol. Pharmacol. 58:569. gration and activation. J. Immunol. 171:1542. 32. Jahng, K. Y., J. Ferguson, and S. I. Reed. 1988. Mutations in a gene encoding the 49. Uhlembrock, K., H. Gassenhuber, and E. Kostenis. 2002. Sphingosine 1-phos- ␣ subunit of a Saccharomyces cerevisiae G protein indicate a role in mating phate is a ligand of the human gpr3, gpr6 and gpr12 family of constitutively pheromone signaling. Mol. Cell. Biol. 8:2484. active G protein-coupled receptors. Cell. Signal. 14:941.