DOCSLIB.ORG

In Vivo Sensitivity of Human Melanoma to Tumor Necrosis Factor

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
In Vivo Sensitivity of Human Melanoma to Tumor Necrosis Factor [CANCER RESEARCH 59, 205–212, January 1, 1999] In Vivo Sensitivity of Human Melanoma to Tumor Necrosis Factor (TNF)-␣ Is Determined by Tumor Production of the Novel Cytokine Endothelial-Monocyte Activating Polypeptide II (EMAPII) Peter C. Wu, H. Richard Alexander, James Huang, Patrick Hwu, Michael Gnant, Adam C. Berger, Ewa Turner, Olga Wilson, and Steven K. Libutti1 Surgical Metabolism Section, Surgery Branch, National Cancer Institute [P. C. W., H. R. A., J. H., P. H., M. G., A. C. B., E. T., S. K. L.], and Hematology Section, Clinical Pathology, Clinical Center [O. W.], NIH, Bethesda, Maryland 20892 ABSTRACT of different tumor histologies (3). However, the results were disap- pointing because TNF resulted in significant systemic toxicity and no ␣ Tumor necrosis factor (TNF)- is a potent anticancer agent that seems significant antitumor effects at the maximally tolerated doses. The to selectively target tumor-associated vasculature resulting in hemor- clinical use of TNF was largely abandoned until Lienard et al. (4) rhagic necrosis of tumors without injury to surrounding tissues. The major limitation in the clinical use of TNF has been severe dose-limiting reported their initial results of isolated limb perfusion as a means of toxicity when administered systemically. However, when administered in delivering high concentrations to the extremity in patients with in isolated organ perfusion it results in regression of advanced bulky tumors. transit melanoma or unresectable sarcoma, while minimizing systemic A better understanding of the mechanisms of TNF-induced antitumor exposure. We and others have used isolated organ perfusion of the effects may provide valuable information into how its clinical use in limb or liver using TNF plus chemotherapeutic agents to treat unre- cancer treatment may be expanded. We describe here that the release of sectable tumors with dramatic responses in the majority of patients a novel tumor-derived cytokine endothelial-monocyte-activating polypep- (5–9). Despite these encouraging results, much remains unknown tide II (EMAPII) renders the tumor-associated vasculature sensitive to regarding the mechanism by which TNF exerts its effects on tumors. TNF. EMAPII has the unique ability to induce tissue factor production by tumor vascular endothelial cells that initiates thrombogenic cascades, A better understanding of this mechanism may improve the therapeu- which may play a role in determining tumor sensitivity to TNF. tic efficacy of TNF and help minimize systemic toxicity which limits We demonstrate here that constituitive overexpression of EMAPII in a wider application of this potent agent. TNF-resistant human melanoma line by retroviral-mediated transfer of There are several postulated theories to explain the mechanism of EMAPII cDNA renders the tumor sensitive to the effects of systemic TNF action of TNF. These include the stimulation of T cell-mediated in vivo, but not in vitro. This interaction between tumors and their responses resulting in the generation of CD8ϩ tumor-specific CTLs associated neovasculature provides an explanation for the focal effects of (10, 11), TNF-induced apoptosis (12–16), macrophage/granulocyte- TNF on tumors and possibly for the variable sensitivity of tumors to mediated injury (17), activation of cellular adhesion molecules (18), bioactive agents. and induction of fibrin deposition on endothelial surfaces and throm- bus formation (19–21). Most of the evidence, however, supports an INTRODUCTION indirect mechanism via the tumor vasculature rather than direct cyto- toxic effects of TNF. The clinical experience with TNF administered ␣2 TNF- induces procoagulant effects within tumor neovasculature, via isolated organ perfusion in patients with melanomas also supports resulting in endothelial fibrin deposition, localized thrombosis, and this hypothesis (22). Renard et al. (18) demonstrated in limb perfu- ischemic necrosis of responsive tumors. The mechanism responsible sions using TNF that coagulative and/or hemorrhagic necrosis of for this effect as well as the apparent variable in vivo sensitivity of tumors was specific for TNF because isolated limb perfusion with tumors to TNF is not well understood. O’Malley et al. (1) first melphalan alone failed to show this type of necrosis. Fig. 1 demon- demonstrated that the serum of animals treated with LPS contained an strates the complete obliteration of tumor neovasculature after a endogenous factor that could induce hemorrhagic necrosis of tumors hyperthermic isolated limb perfusion with TNF and melphalan, while in animals not exposed to LPS. Carswell et al. (2) later isolated a leaving the normal host vessels apparently unaffected. circulating protein from mice, pretreated with Bacillus Calmette- The distinction between tumor and host vasculature centers on the Guerin and challenged with LPS, that could induce significant hem- phenotypic difference of the vascular endothelium. In general, tumor orrhagic necrosis of methylcholanthrene A-induced fibrosarcomas vessel endothelium is more prone to thrombosis and capillary leakage (Meth A) that was termed “TNF.” Systemic administration of TNF to (20, 23). Cytokines present in the microenvironment of solid tumors mice bearing s.c. MethA tumors resulted in marked hemorrhagic necrosis of the tumors without observable effects on nontumor tissue. may alter the endothelium of tumor vessels influencing characteristics This observation formed the basis for several clinical trials using TNF of tumor growth and metastatic spread (24–27). Specifically, tumor- once the recombinant protein was made available. derived cytokines may play fundamental roles in determining tumor Systemic TNF was used in multiple clinical trials against a variety phenotypes relating to tumor angiogenesis, tumor progression, meta- static potential, and sensitivity to therapeutic agents. EMAPII is a cytokine that may influence interactions between Received 8/20/98; accepted 10/29/98. The costs of publication of this article were defrayed in part by the payment of page tumor cells and associated neovasculature. EMAPII was first de- charges. This article must therefore be hereby marked advertisement in accordance with scribed by Kao et al. (28, 29), using the MethA tumor as a model for 18 U.S.C. Section 1734 solely to indicate this fact. 1 To whom requests for reprints should be addressed, at Surgery Branch, National Cancer studying host-tumor responses and the effects of tumor-derived fac- Institute, NIH, Building 10, Room 2B17, 10 Center Drive MSC 1502, Bethesda, MD tors. The protein was isolated from MethA supernatant by its ability 20892-1502. Phone: (301) 496-5049; Fax: (301) 402-1788; E-mail: Steven–[email protected]. to activate endothelial cells inducing tissue factor procoagulant activ- 2 The abbreviations used are: TNF, tumor necrosis factor; LPS, lipopolysaccharide; EMAPII, endothelial-monocyte-activating polypeptide II; LTR, long terminal repeat; ity and up-regulating leukocyte adhesion molecules P-selectin and MTT, 3-(4,5-dimethyl-2-thiazoyl)-2, 5-diphenyl-2H tetrazolium bromide; TNFR1, TNF E-selectin. EMAPII is a polypeptide synthesized as a Mr 34,000 p55 receptor; MethA, methylcholanthrene A-induced fibrosarcoma; HUVEC, human umbilical vein endothelial cell; MRA, magnetic resonance angiogram; IRES, internal precursor and cleaved to produce an active Mr 22,000 mature protein. ribosomal entry site. Because EMAPII was isolated from a TNF-sensitive tumor and in- 205 Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 1999 American Association for Cancer Research. EMAPII AND TNF SENSITIVITY IN HUMAN MELANOMA Fig. 1. MRA of a patient diagnosed with an unresectable Ewing’s sarcoma of the left forearm who underwent a hyperthermic isolated limb per- fusion with melphalan and TNF. By comparing baseline and follow-up MRAs, accurate assessment of vessel integrity and patency are made possible. a, a large forearm tumor diagnosed as Ewing’s sarcoma. b, the baseline preoperative MRA dem- onstrating the extensive neovasculature of the tu- mor and normal major vessels of the upper limb. c, another MRA taken 16 days after perfusion, dem- onstrating complete obliteration of the tumor vas- culature while the normal major arm vessels remain patent. duced tissue factor production by endothelial cells, it seemed to be a selection. Presence and directionality of the EMAPII insert in the pWU-EII putative TNF-sensitizing agent. Marvin et al. (30) treated mice bear- construct were confirmed by PCR amplification and restriction digest. ing TNF-resistant tumors with intratumor injection of recombinant Stable Transduction of EMAPII Into a Low-expressing Melanoma EMAPII and rendered the tumors sensitive to systemic TNF. The Line. The pWU-EII retroviral vector and pSAMEN vector control were each effect was confined to the tumor vasculature resulting in thrombohe- transfected into the amphotropic packaging cell line PA317 by calcium phos- phate precipitation (Invitrogen). The viral supernatants from the PA317 pro- morrhage and tumor regression. ducer cells were used to infect the Gibbon ape ecotropic packaging cell line The identification of tumor cytokines, such as EMAPII, that spe- PG13 with polybrene at a concentration of 8 ␮g/ml. PG13 viral supernatants cifically activate endothelial cells suggests a novel mechanism of TNF were then used to infect the human wild-type Pmel tumor line, which expresses sensitivity. If tumors express variable levels of EMAPII, overexpres- the lowest levels of EMAPII. Transduced Pmel
Load more

Recommended publications
  • COVID-19—The Potential Beneficial Therapeutic Effects of Spironolactone During SARS-Cov-2 Infection
    pharmaceuticals Review COVID-19—The Potential Beneficial Therapeutic Effects of Spironolactone during SARS-CoV-2 Infection Katarzyna Kotfis 1,* , Kacper Lechowicz 1 , Sylwester Drozd˙ zal˙ 2 , Paulina Nied´zwiedzka-Rystwej 3 , Tomasz K. Wojdacz 4, Ewelina Grywalska 5 , Jowita Biernawska 6, Magda Wi´sniewska 7 and Miłosz Parczewski 8 1 Department of Anesthesiology, Intensive Therapy and Acute Intoxications, Pomeranian Medical University in Szczecin, 70-111 Szczecin, Poland; [email protected] 2 Department of Pharmacokinetics and Monitored Therapy, Pomeranian Medical University, 70-111 Szczecin, Poland; [email protected] 3 Institute of Biology, University of Szczecin, 71-412 Szczecin, Poland; [email protected] 4 Independent Clinical Epigenetics Laboratory, Pomeranian Medical University, 71-252 Szczecin, Poland; [email protected] 5 Department of Clinical Immunology and Immunotherapy, Medical University of Lublin, 20-093 Lublin, Poland; [email protected] 6 Department of Anesthesiology and Intensive Therapy, Pomeranian Medical University in Szczecin, 71-252 Szczecin, Poland; [email protected] 7 Clinical Department of Nephrology, Transplantology and Internal Medicine, Pomeranian Medical University, 70-111 Szczecin, Poland; [email protected] 8 Department of Infectious, Tropical Diseases and Immune Deficiency, Pomeranian Medical University in Szczecin, 71-455 Szczecin, Poland; [email protected] * Correspondence: katarzyna.kotfi[email protected]; Tel.: +48-91-466-11-44 Abstract: In March 2020, coronavirus disease 2019 (COVID-19) caused by SARS-CoV-2 was declared Citation: Kotfis, K.; Lechowicz, K.; a global pandemic by the World Health Organization (WHO). The clinical course of the disease is Drozd˙ zal,˙ S.; Nied´zwiedzka-Rystwej, unpredictable but may lead to severe acute respiratory infection (SARI) and pneumonia leading to P.; Wojdacz, T.K.; Grywalska, E.; acute respiratory distress syndrome (ARDS).
    [Show full text]
  • Deciphering the Nature of Trp73 Isoforms in Mouse
    cancers Article Deciphering the Nature of Trp73 Isoforms in Mouse Embryonic Stem Cell Models: Generation of Isoform-Specific Deficient Cell Lines Using the CRISPR/Cas9 Gene Editing System Lorena López-Ferreras 1,2,†, Nicole Martínez-García 1,3,†, Laura Maeso-Alonso 1,2,‡, Marta Martín-López 1,4,‡, Ángela Díez-Matilla 1,‡ , Javier Villoch-Fernandez 1,2, Hugo Alonso-Olivares 1,2, Margarita M. Marques 3,5,* and Maria C. Marin 1,2,* 1 Instituto de Biomedicina (IBIOMED), Universidad de León, 24071 León, Spain; [email protected] (L.L.-F.); [email protected] (N.M.-G.); [email protected] (L.M.-A.); [email protected] (M.M.-L.); [email protected] (Á.D.-M.); [email protected] (J.V.-F.); [email protected] (H.A.-O.) 2 Departamento de Biología Molecular, Universidad de León, 24071 León, Spain 3 Departamento de Producción Animal, Universidad de León, 24071 León, Spain 4 Biomar Microbial Technologies, Parque Tecnológico de León, Armunia, 24009 León, Spain 5 Instituto de Desarrollo Ganadero y Sanidad Animal (INDEGSAL), Universidad de León, 24071 León, Spain * Correspondence: [email protected] (M.M.M.); [email protected] (M.C.M.); Tel.: +34-987-291757 Citation: López-Ferreras, L.; (M.M.M.); +34-987-291490 (M.C.M.) Martínez-García, N.; Maeso-Alonso, † Equal contribution. ‡ Equal contribution. L.; Martín-López, M.; Díez-Matilla, Á.; Villoch-Fernandez, J.; Simple Summary: The Trp73 gene is involved in the regulation of multiple biological processes Alonso-Olivares, H.; Marques, M.M.; Marin, M.C. Deciphering the Nature such as response to stress, differentiation and tissue architecture.
    [Show full text]
  • Summer/Fall 2010PDF Only
    EINSTEINSUMMER/FALL 2010 The Magazine for Alumni and Friends of Albert Einstein College of Medicine of Yeshiva University Lighting Up Cells, Curing Diseases On the cover: Research Fellow Timothée Lionnet, Ph.D., works on a microscope that he helped to develop in Einstein’s Gruss-Lipper Biophotonics Center Innovation Laboratory. The image on the screen shows living cells in which molecules were “lit up” by photoactivatable fl uorescent proteins. Fluorescent proteins have opened up a new world, allowing scientists to tag and observe molecules as they carry out their functions in living cells. Since glitches in molecular activity underlie all diseases, insights gained through use of these glowing proteins may lead to better treatments or even cures. contents FEATURES 2 A Message from the Dean 24 Lighting Up the Cell With help from a glowing Pacifi c jellyfish, Einstein researchers can now see biology in action 32 Einstein, AIDS and Africa Faculty members build research expertise in Africa, one student at a time 38 Einstein’s Dynamic Duo of the Decade Curiosity plus collaboration equals success for this research team DEPARTMENTS 3 Letters to the Editor 4 Upfront: Collegial Life 12 Upfront: Lab Dish 22 Upfront: Einstein Editions 46 Passionate Pursuits 48 Our DNA: Alumni News & Class Notes 62 Making a Difference 68 A Look Back gg EINSTEIN Summer/Fall 2010 The magazine for alumni, faculty, students, friends and supporters of Albert Einstein College of Medicine of Yeshiva University Published by A Message from the Dean The Philip and Rita Rosen Department of Communications and Public Affairs Gordon Earle, Associate Dean he theme that unites the Department of Institutional Advancement diverse stories in this issue Glenn Miller, Associate Dean of Einstein is collabora- Ira Lipson, Director tion—literally, “working Science and Publications Editor Ttogether.” The cover article, “Lighting Larry Katzenstein Up the Cell,” describes the collaborative Managing Editor work of protein chemist Vlad Verkhusha Joan Lippert and structural biologist Steve Almo.
    [Show full text]
  • AAES Winter Newsletter
    OF E ON ND TI O A C I R C I N O E S S S U A AAES Winter R N G A E C I O R N E S M A Newsletter THE AMERICAN ASSOCIatION OF Endocrine Surgeons endocrinesurgery.org JANUARY 2011 INSIDE President’s Message 2010 Pittsburgh Meeting Report 2010 Annual Meeting Awards 2011 Annual Meeting 2012 Annual Meeting Surgical Oncology Advisory Council Education & Research Committee Paul LoGerfo Education Research Fund A Message from Membership Committee AAES / AACE Liaison our President Fellowship DOUGLAS B. EVANS Office of the Recorder see page 2 for full article In Memoriam OF E ON ND TI O A C I R C I THE AMERICAN ASSOCIatION OF N O E S S S U A R N G A E C I O R N Endocrine Surgeons E S M A Dedicated to the advancement of the science and art of endocrine surgery and maintenance of high standards in the practice of endocrine surgery. AAES OFFICERS, COUNCIL MEMBERS & COMMITTEE MEMBERS 2010-11 PRESIDENT COUNCIL MEMBERSHIP PAUL LOGERFO ESC REPRESENTATIVE Douglas B. Evans Michael J. Demeure COMMITTEE COMMITTEE Sonia L. Sugg Paul G. Gauger Julie Ann Sosa, Chair Jack M. Monchik, Chair PRESIDENT-ELECT William B. Inabnet, III Electron Kebebew John A. Chabot NSQIP Ashok R. Shaha Electron Kebebew Nancy D. Perrier REPRESENTATIVEE Nancy D. Perrier NOMINATING Julie Ann Sosa VICE PRESIDENT Sareh Parangi COMMITTEE ON COMMITTEE Gerard M. Doherty Janice L. Pasieka EDUCATION AND Michael J. Demeure, Chair AAES FOUNDATION Julie Ann Sosa RESEARCH Janice L. Pasieka Geoffrey B.
    [Show full text]
  • Angiogenesis and Apoptosis
    Seminars in Cancer Biology 13 (2003) 159–167 Angiogenesis and apoptosis Judah Folkman∗ Department of Surgery, Children’s Hospital and Harvard Medical School, Hunnewell 103 300 Longwood Avenue, Boston, MA 02115, USA Abstract This review assembles the laboratory and clinical evidence that cytotoxic chemotherapy and antiangiogenic therapy are each de- pendent on endothelial cell apoptosis. During cytotoxic chemotherapy, apoptosis of endothelial cells in the vascular bed of tumors precedes apoptosis of tumor cells, even when the tumor has been made drug resistant. Administration of an angiogenesis inhibitor which is not directly cytotoxic to tumor cells can increase tumor cell apoptosis and inhibit tumor growth by inhibiting endothelial proliferation and migration and/or by inducing endothelial apoptosis. Furthermore, oncogene expression and loss of tumor suppres- sor gene activity can at once protect tumor cells against apoptosis and increase their angiogenic output. Both of these survival ad- vantages conferred on the tumor can be overcome by antiangiogenic therapy. They can also be overcome by cytotoxic chemotherapy administered on a low dose ‘antiangiogenic schedule’ which continuously exposes endothelial cells in the tumor bed to the drug. As a result, endothelial apoptosis can be demonstrated to precede tumor cell apoptosis, and tumors regress or are inhibited, whether or not the tumor cells are resistant to the drug, and with little or no host toxicity. In contrast, cytotoxic chemotherapy administered on a ‘conventional schedule’ of maximal tolerated dose followed by an off-therapy interval, becomes ineffective after drug resistance is acquired. On the basis of these experimental findings, chemotherapy of cancer may possibly be improved—i.e.
    [Show full text]
  • SHOC2–MRAS–PP1 Complex Positively Regulates RAF Activity and Contributes to Noonan Syndrome Pathogenesis
    SHOC2–MRAS–PP1 complex positively regulates RAF activity and contributes to Noonan syndrome pathogenesis Lucy C. Younga,1, Nicole Hartiga,2, Isabel Boned del Ríoa, Sibel Saria, Benjamin Ringham-Terrya, Joshua R. Wainwrighta, Greg G. Jonesa, Frank McCormickb,3, and Pablo Rodriguez-Vicianaa,3 aUniversity College London Cancer Institute, University College London, London WC1E 6DD, United Kingdom; and bHelen Diller Family Comprehensive Cancer Center, University of California, San Francisco, CA 94158 Contributed by Frank McCormick, September 18, 2018 (sent for review November 22, 2017; reviewed by Deborah K. Morrison and Marc Therrien) Dephosphorylation of the inhibitory “S259” site on RAF kinases CRAF/RAF1 mutations are also frequently found in NS and (S259 on CRAF, S365 on BRAF) plays a key role in RAF activation. cluster around the S259 14-3-3 binding site, enhancing CRAF ac- The MRAS GTPase, a close relative of RAS oncoproteins, interacts tivity through disruption of 14-3-3 binding (8) and highlighting the with SHOC2 and protein phosphatase 1 (PP1) to form a heterotri- key role of this regulatory step in RAF–ERK pathway activation. meric holoenzyme that dephosphorylates this S259 RAF site. MRAS is a very close relative of the classical RAS oncoproteins MRAS and SHOC2 function as PP1 regulatory subunits providing (H-, N-, and KRAS, hereafter referred to collectively as “RAS”) the complex with striking specificity against RAF. MRAS also func- and shares most regulatory and effector interactions as well as tions as a targeting subunit as membrane localization is required transforming ability (9–11). However, MRAS also has specific for efficient RAF dephosphorylation and ERK pathway regulation functions of its own, and uniquely among RAS family GTPases, it in cells.
    [Show full text]
  • The Tumor Suppressor SCRIB Is a Negative Modulator of the Wnt/-Catenin Signaling Pathway
    The Tumor Suppressor SCRIB is a Negative Modulator of the Wnt/β-Catenin Signaling Pathway Avais Daulat, Mônica Silveira Wagner, Alexandra Walton, Emilie Baudelet, Stéphane Audebert, Luc Camoin, Jean-Paul Borg To cite this version: Avais Daulat, Mônica Silveira Wagner, Alexandra Walton, Emilie Baudelet, Stéphane Audebert, et al.. The Tumor Suppressor SCRIB is a Negative Modulator of the Wnt/β-Catenin Signaling Pathway. Pro- teomics, Wiley-VCH Verlag, 2019, 19 (21-22), pp.1800487. 10.1002/pmic.201800487. hal-02518664 HAL Id: hal-02518664 https://hal.archives-ouvertes.fr/hal-02518664 Submitted on 7 Apr 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. PROTEOMICS Page 2 of 35 1 2 3 1 The tumor suppressor SCRIB is a negative modulator of the Wnt/-catenin signaling 4 5 6 2 pathway 7 8 3 Avais M. Daulat1,§, Mônica Silveira Wagner1,§, Alexandra Walton1, Emilie Baudelet2, 9 10 4 Stéphane Audebert2, Luc Camoin2, #,*, Jean-Paul Borg1,2,#,* 11 12 13 5 14 15 6 16 17 7 18 19 8 20 21 For Peer Review 1 22 9 Centre de Recherche en Cancérologie de Marseille, Equipe
    [Show full text]
  • Stool-Derived Eukaryotic RNA Biomarkers for Detection of High-Risk Adenomas
    bioRxiv preprint doi: https://doi.org/10.1101/534412; this version posted January 29, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Stool-derived eukaryotic RNA biomarkers for detection of high-risk adenomas Erica Barnell1,2*, Yiming Kang2,3*, Andrew Barnell2, Katie Campbell1,2, Kimberly R. Kruse2, Elizabeth M. Wurtzler2, Malachi Griffith1,4,5,6, Aadel A. Chaudhuri3,6,7+, Obi L. Griffith1,4,5,6+ 1 McDonnell Genome Institute, Washington University School of Medicine, St. Louis, MO, USA 2 Geneoscopy LLC, Division of Gastroenterology and Hepatology, St. Louis, MO, USA 3 Department of Computer Science and Engineering, Washington University, St. Louis, MO, USA 4 Department of Genetics, Washington University School of Medicine, St. Louis, MO, USA 5 Division of Oncology, Department of Medicine, Washington University School of Medicine, St. Louis, MO, USA 6 Siteman Cancer Center, Washington University School of Medicine, St. Louis, MO, USA 7 Department of Radiation Oncology, Washington University School of Medicine, St. Louis, MO, USA +Corresponding author *These authors contributed equally to this work. Abbreviations AUC area under the curve LRA low-risk adenoma ANOVA analysis of variance MRA medium-risk adenoma CRC colorectal cancer NPV negative predictive value DE differentially expressed PPV positive predictive value FC fold-change ROC receiver operating characteristic FIT fecal immunochemical test seRNA stool-derived eukaryotic RNA HRA high-risk adenoma Abstract Background and aims: Colorectal cancer (CRC) is the second leading cause of cancer related deaths in the United States.
    [Show full text]
  • Meeting Report: Innovations in Prostate Cancer Research Wadih Arap,1,2 Martin Trepel,3 Bruce R
    Published OnlineFirst February 1, 2008; DOI: 10.1158/0008-5472.CAN-07-3232 Meeting Report Meeting Report: Innovations in Prostate Cancer Research Wadih Arap,1,2 Martin Trepel,3 Bruce R. Zetter,4 and Renata Pasqualini1,2 Departments of 1Genitourinary Medical Oncology and 2Cancer Biology, The University of Texas M.D.Anderson Cancer Center, Houston, Texas; 3University of Freiburg Medical Center, Department of Hematology and Oncology and Institute for Molecular Medicine and Cell Research, Freiburg, Germany; and 4Children’s Hospital, Harvard Medical School, Boston, Massachusetts Introduction cells.In closing, he proposed that, because compounds may inter- The incidence of prostate cancer has increased with serum fere in different steps during angiogenesis, combination antiangio- prostate-specific antigen (PSA) screening.Although organ-confined genic therapy should be evaluated as a therapeutic approach. prostate cancer can be cured by surgery and/or radiation therapy, metastatic disease cannot.Androgen ablation in this setting has Detection and Prediction long been recognized as effective, but tumors almost invariably Otis Brawley (Winship Cancer Center) analyzed population-based relapse over time; unfortunately, outcome of patients with meta- PSA screening for prostate cancer detection; he questioned such static androgen-independent disease remains poor despite incre- programs regarding cost/labor intensity (3).Dr.Brawley emphasized mental improvements in chemotherapy.The purpose of this that three kinds of prostate cancer must be distinguished:
    [Show full text]
  • Hnag-1 Increases Lifespan by Regulating Energy Metabolism And
    www.impactaging.com AGING, August 20014 Vol. 6, No 8 Research Paper hNAG‐1 increases lifespan by regulating energy metabolism and insulin/IGF ‐1/mTOR signaling 1,4 1 1 2 3 Xingya Wang , Kali Chrysovergis , Justin Kosak , Grace Kissling , Mike Streicker , Glenda 3 1 1 Moser , Ruifang Li , and Thomas E. Eling 1 Laboratory of Molecular Carcinogenesis,National Institute of Environmental Health Sciences (NIEHS), Research Triangle Park NC 27709; USA 2 Biostatistics Branch, National Institute of Environmental Health Sciences (NIEHS), Research Triangle Park, NC 27709; USA 3Integrated Laboratory Systems, Inc., Morrisville, NC 27560, USA; 4 College of Pharmaceutical Sciences, Zhejiang Chinese Medical University, Zhejiang, China 310053. Key words: hNAG‐1/GDF15, lifespan, metabolism, insulin/IGF‐1/mTOR Received: 6/23/14; Accepted: 8/24/14; Published: 8/28/14 Correspondence to: Thomas E. Eling, PhD; E‐mail: [email protected] Copyright: Wang et al. This is an open‐access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited Abstract: Nonsteroidal anti‐inflammatory drug‐activated gene (NAG‐1) or GDF15 is a divergent member of the transforming growth factor beta (TGF‐β) superfamily and mice expressing hNAG‐1/hGDF15 have been shown to be resistant to HFD‐induced obesity and inflammation. This study investigated if hNAG‐1 increases lifespan in mice and its potential mechanisms. Here we report that female hNAG‐1 mice had significantly increased both mean and median life spans in two transgenic lines, with a larger difference in life spans in mice on a HFD than on low fat diet.
    [Show full text]
  • Supplemental Information Loss of Estrogen Regulated MIR135A1 At
    Supplemental Information Loss of Estrogen Regulated MIR135A1 at 3p21.1 Promotes Tamoxifen Resistance in Breast Cancer Weijie Zhang, Mingming Wu, Qing-Yun Chong, Min Zhang, Xiao Zhang, Lan Hu, Yanghao Zhong, Pengxu Qian, Xiangjun Kong, Sheng Tan, Gaopeng Li, Keshuo Ding, Peter E. Lobie, and Tao Zhu. Supplemental data include 5 supplemental tables, and 7 supplemental figures and legends. Supplemental Tables Supplementary Table S1. Sequences of the miRNA mimics/siRNAs, shRNAs, and primers for cloning, ChIP assays and qRT-PCR analysis. miRNAs Sense Strand (5'-3') Antisense Strand (5'-3') hsa-miR-135a UAUGGCUUUUUAUUCCUAUGU ACAUAGGAAUAAAAAGCCAUA mimics GA UU siERK1 GAAACUACCUACAGUCUCUTT AGAGACUGUAGGUAGUUUCTT siERK2 GUGCUCUGCUUAUGAUAAUTT AUUAUCAUAAGCAGAGCACTT siAKT GCACCUUCAUUGGCUACAATT UUGUAGCCAAUGAAGGUGCTT Negative Control (NC) UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT shRNAs Sense Strand (5'-3') CCGGCTACAGGCCAAATTCAGATAACTCGAGTTATCTGAATTTGGC shESR1 CTGTAGTTTTT CCGGGTGAATGCACTGGTGTCTCATCTCGAGATGAGACACCAGTGC shESRRA ATTCACTTTTT CCGGCGGAAGTCAGATTGTAGCCAACTCGAGTTGGCTACAATCTGA shNCOA1 CTTCCGTTTTT CCGGGCTTGACTGGTTTGAGACACACTCGAGTGTGTCTCAAACCAG shPIM2 TCAAGCTTTTT CCGGCCACCTCTCAATGTCGACAAACTCGAGTTTGTCGACATTGAG shMRAS AGGTGGTTTTTG CCGGGTCATCAAGATTGGGTTGTTTCTCGAGAAACAACCCAATCTTG shLCP1 ATGACTTTTTG CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTA shScr GG Primers for plasmid construction Sense Strand (5'-3') Antisense Strand (5'-3') pri-miR-135a-1 CGAATTCAGGAACTCCATGCCA AATGTCGACCCTGAAGTCAGCC cloning primer GCACAG CTTCAGTG TCACATAGGAATTTAAGCCATACGATTCACATAGGAATTTAAGCCA
    [Show full text]
  • Special Supplement for Njbiz
    SPECIAL SUPPLEMENT FOR NJBIZ CANCER CARE 2020 Valley’s Breast Cancer Care Team: Skilled, innovative, personalized care Accredited by the National Accreditation Program for Breast Centers, the highest level of recognition. Chad DeYoung, M.D. Moira Christoudias, M.D. Thomas Rakowski, M.D. Eleonora Teplinsky, M.D. Scott DeGregorio, M.D. Laura Klein, M.D. Michael Wesson, M.D. Radiation Oncologist Breast Surgeon Medical Oncologist Medical Oncologist Radiologist Breast Surgeon Radiation Oncologist Proven. Innovative. Here. Valley Health System’s team of breast cancer specialists is elevating cancer care in our region. Dedicated to achieving the best possible results, these doctors collaborate on innovative treatments and techniques — including oncoplastic and plastic surgery for the best possible cosmetic outcomes — to ensure each woman not only receives the care and treatment she needs, but is also cared for as a whole person. And through Valley’s partnership with the Mount Sinai Health System for cancer care, these doctors offer women access to innovative research and clinical trials. If you are facing a breast cancer diagnosis, this is the team to choose. For more information about Valley’s Breast Cancer Team and the treatments they offer, please visit ValleyHealth.com/BreastCancer or call -6- ­. 20-VHS-0524 Breast Care Team_NJBIZ Cancer Care Flyer_10.125 x 13.5_v1-0.indd 1 2/4/20 4:42 PM TABLE OF CONTENTS Mailing Address A holistic approach to cancer 220 Davidson Ave., Suite 122, NJ hospitals balance technology with a human touch 6C Somerset,
    [Show full text]