DOCSLIB.ORG

Supplemental Information Loss of Estrogen Regulated MIR135A1 At

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplemental Information Loss of Estrogen Regulated MIR135A1 At Supplemental Information Loss of Estrogen Regulated MIR135A1 at 3p21.1 Promotes Tamoxifen Resistance in Breast Cancer Weijie Zhang, Mingming Wu, Qing-Yun Chong, Min Zhang, Xiao Zhang, Lan Hu, Yanghao Zhong, Pengxu Qian, Xiangjun Kong, Sheng Tan, Gaopeng Li, Keshuo Ding, Peter E. Lobie, and Tao Zhu. Supplemental data include 5 supplemental tables, and 7 supplemental figures and legends. Supplemental Tables Supplementary Table S1. Sequences of the miRNA mimics/siRNAs, shRNAs, and primers for cloning, ChIP assays and qRT-PCR analysis. miRNAs Sense Strand (5'-3') Antisense Strand (5'-3') hsa-miR-135a UAUGGCUUUUUAUUCCUAUGU ACAUAGGAAUAAAAAGCCAUA mimics GA UU siERK1 GAAACUACCUACAGUCUCUTT AGAGACUGUAGGUAGUUUCTT siERK2 GUGCUCUGCUUAUGAUAAUTT AUUAUCAUAAGCAGAGCACTT siAKT GCACCUUCAUUGGCUACAATT UUGUAGCCAAUGAAGGUGCTT Negative Control (NC) UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT shRNAs Sense Strand (5'-3') CCGGCTACAGGCCAAATTCAGATAACTCGAGTTATCTGAATTTGGC shESR1 CTGTAGTTTTT CCGGGTGAATGCACTGGTGTCTCATCTCGAGATGAGACACCAGTGC shESRRA ATTCACTTTTT CCGGCGGAAGTCAGATTGTAGCCAACTCGAGTTGGCTACAATCTGA shNCOA1 CTTCCGTTTTT CCGGGCTTGACTGGTTTGAGACACACTCGAGTGTGTCTCAAACCAG shPIM2 TCAAGCTTTTT CCGGCCACCTCTCAATGTCGACAAACTCGAGTTTGTCGACATTGAG shMRAS AGGTGGTTTTTG CCGGGTCATCAAGATTGGGTTGTTTCTCGAGAAACAACCCAATCTTG shLCP1 ATGACTTTTTG CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTA shScr GG Primers for plasmid construction Sense Strand (5'-3') Antisense Strand (5'-3') pri-miR-135a-1 CGAATTCAGGAACTCCATGCCA AATGTCGACCCTGAAGTCAGCC cloning primer GCACAG CTTCAGTG TCACATAGGAATTTAAGCCATACGATTCACATAGGAATTTAAGCCA TAACCGGTTCACATAGGAATTTAAGCCATATCACTCACATAGGAAT TTAAGCCATACCCGGTGCATGACTAAGCTAGATAATCACATAGGAA TTTAAGCCATACGATTCACATAGGAATTTAAGCCATAACCGGTTCA CATAGGAATTTAAGCCATATCACTCACATAGGAATTTAAGCCATAA miR-135a Sponge CGCGTCGACCTAAGTATCCTCCTCTTGGA ESR1 3’UTR TACTCGAGAGCCCTGGGGCATG GTGCGGCCGCGCTATGGCTTGG cloning primer GAGCTGAAC TTAAACATATC ESR1 3’UTR Mut GCAGATATGTTTAACCGCCCAT CTCAAAAGGCATGGGCGGTTAA primer GCCTTTTGAG ACATATCTGC ESRRA 3’UTR ATCTCGAGAGGGGTGGGACTG CCGCGGCCGCTTTCTCTTTGCAG cloning primer GTGGGGG CAAATATAC ESRRA 3’UTR CAGTGCTGCCCCTTGCACGTGC CACTCTGGGGGCACGTGCAAGG MutA primer CCCCAGAGTG GGCAGCACTG GTAGGGGGCCTTGCGGGGGGG CATCCCGTGCAGCCCCCCCGCA ESRRA 3’UTR CTGCACGGGATG AGGCCCCCTAC MutB primer NCOA1 3’UTR CGCGCTCGAGCCACTTTTAAAG ATGCGGCCGCCTTCAGGGATGC cloning primer GAATGTGAAA TTTATTATCC NCOA1 3’UTR CAGACTTCAAGGAAGTCCCCA AGGAAGGACCTGGGGACTTCCT MutA primer GGTCCTTCCTTCTGCATCTC TGAAGTCTGAGTCCATGC NCOA1 3’UTR CATTTCCAGCTTGAAAGCCTAC GGTAGGGACTAGAGTAGGCTTT MutB primer TCTAGTCCCTACC CAAGCTGGAAATG PIM2 3’UTR ATCTCGAGAATGGTCAGAAGA GCGCGGCCGCCTATTACTTTTAT cloning primer GCCATCCCA TAAATAGTGGG PIM2 3’UTR Mut GCCTGGATTATTTAAATGTGGA ATAGTGGGTTTCCACATTTAAA primer AACCCACTAT TAATCCAGGC MRAS 3’UTR ATCTCGAGCAGGCCTGAGGCCC GCGCGGCCGCCACTCGTTTCAC cloning primer TGGGCACA GACAATGGCC MRAS 3’UTR CATACAAAGTACAAAACAACA GGAAAGAAGCTTGTTGTTTTGT MutA primer AGCTTCTTTCC ACTTTGTATG MRAS 3’UTR CAGCACCAAGACCTGTTCCCTT CAGTTGACTCCAAGGGAACAGG MutB primer GGAGTCAACTG TCTTGGTGCTG LCP1 3’UTR ATCTCGAGGGCCCAATGGGGCT GCGCGGCCGCGGCTACAGTAAG cloning primer GGGTGGGA TTCAATCTGAAG LCP1 3’UTR Mut GCTCCAGGGATGATTCCCAAAG CCAAGTTGAACTTTGGGAATCA primer TTCAACTTGG TCCCTGGAGC Promoter L GCGCTCGAGAGCAGGGAAGTG TATAAGCTTTCAGGGAGCTCTT cloning primer GCTCATTATTTC GGCTCAGGGAG Promoter S ATACTCGAGTGAGAGAGACCC TATAAGCTTCCCTGCTGTTTGCA cloning primer TCAGGGGGACCT ACTCTGGGCA Promoter L Mut CGGCACCGTCCAGGGGCACAA CACAGGCACTTGTGCCCCTGGA primer GTGCCTGTG CGGTGCCG Primers for ChIP assay Sense Strand (5'-3') Antisense Strand (5'-3') Site 1 Primer ACTTCGCGGCCACTCATC CCTCACTGCCCATAGTCCTG Site 2 Primer GGAACAGTGTATGCCCAGTCCT GGAGTAGCCCCAGCACATTCCA Site 3 Primer AGGCTCACAGGTTTTACTCCA ACTGCAGGAATATCTAGGCTCT Site 4 Primer TCGCACATGACCCAGACCC TGGCACTAGGCAGGCACCA Site 5 Primer ACCCAGTGCCAATACTCATGCT CTGTGCTGGCATGGAGTTCCT Site 6 Primer CAGAGCCCGCTTACCACGTT GGCTGGCAGGACTTTCCCC ACGGCTCCAATCCCTATATGAG Site 7 Primer GGCCCCTCCACACCCTCAG T TFF1 site Primer CCGGCCATCTCTCACTATGAA CCTCTTTCCCATGGGAGTCTC NC site Primer ATGGTTGCCACTGGGGATCT TGCCAAAGCCTAGGGGAAGA Primers for RNA Pull down assay Sense Strand (5'-3') Antisense Strand (5'-3') ESR1 site GCCGTAATGATTCTATAATGCC AAATCAAAGACTGCACTTCC ESRRA site CCATAACGTGCCCCCAGAGTGT TAGGTTTCTGCCTCCCACGCATC NCOA1 site TGAAAGCCAGCCATATTACTCT TCTGCGCGTCTAAATATCACA PIM2 site GACCCTACTCTGTTATCCCAA CTTATTTCCCCTAGCCCAT MRAS site 1 CAAAGTACAAAACAAGCCAT CTATAAAAGACATCCAAGCTCA MRAS site 2 TTCATGCTGGATCTTAACCAA TCTGCTCATTGACTAGGCTT LCP1 site GGATGATTCAAGCCATTCCAA CTCCTGCAAAGAATGAAGCAC GAPDH site TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG Primers for qRT-PCR Sense Strand (5'-3') Antisense Strand (5'-3') GTCGTATCCAGTGCAGGGTCCG miR-135a RT AGGTATTCGCACTGGATACGAC Primer TCACAT miR-135a qRT-PCR Primer CGGCTATGGCTTTTTATTCC GTGCAGGGTCCGAGGT TGGAACGATACAGAGAAGATT snRNA U6 AGCA AACGCTTCACGAATTTGCGT pri-miR-135a-1 TATAGGGATTGGAGCCG GCAGCCTGGGTTGAGA pri-miR-135a-2 TAAAGTCTCATGTAGGGATG GCTCCACAGGCTAACG TFF1 ATACCATCGACGTCCCTCCA AAGCGTGTCTGAGGTGTCCG NR3C2 GGCCAGCTTAATATTGTCCAG GTGCCTGAACATGAATGCTT APC GAGGTCAGCCTAAACCCAT ACCGGAGTATTTTCAATAGCAA MTSS1 AGGCAGATCAGCAGGAGT ACAGAAGGCTTGGTGGAA JAK2 GAATAGCCAAAGAAAACGAT ATCTGTACCTTATTCGCTTC SIAH1 CAGCAGTTCTTCGCAATCGT TCGCCTATGACCATTTAGCTC HOXA10 CTTCCGAGAGCAGCAAAGCCT CTTCCGACCACTCTTTGCCGTGA ESR1 GCATTCTACAGGCCAAATT CACAGGACCAGACTCCATAA ESRRA CGTGGCTACCCTCTGTGACCT GCACCTCCATCCACACGCTCT NCOA1 GAGCCAGGGACCGAGAA GCCGTGCAATACAAATCAG PIM2 CACTGCCATTCCCGTGGAGT AAGCAGGGCACCAGAACCAA MRAS AAAGCCTTCCATGACCTCGTT GTCTCCCCGCCATTTGGTT TCCCAATGAACCCAAACACGA LCP1 A TCATCAATTGTGTCTGGCACT GAPDH TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG Supplementary Table S2. List of antibodies used in western blot and chromatin immunoprecipitation assay. Incubation Protein Assay Antibody Origin Dilution period ERα WB mmab #sc-8005, Santa Cruz 1:500 Over night ERα IHC mmab #sc-8005, Santa Cruz 1:50 Over night pERα (S118) WB mmab #2511, Cell Signaling 1:1000 Over night pERα #64508, Cell (S167) WB rmab Signaling 1:1000 Over night ERα ChIP mmab #sc-8005, Santa Cruz 5 ug Over night ESRRA WB mmab #sc-65718, Santa Cruz 1:500 Over night ESRRA IHC mmab #sc-65718, Santa Cruz 1:50 Over night NCOA1 WB rpab #sc-8995, Santa Cruz 1:500 Over night NCOA1 IHC rpab #sc-8995, Santa Cruz 1:50 Over night PIM2 WB mmab #sc-13514, Santa Cruz 1:500 Over night PIM2 IHC mmab #sc-13514, Santa Cruz 1:50 Over night #sc-292844, Santa MRAS WB rpab Cruz 1:500 Over night #sc-292844, Santa MRAS IHC rpab Cruz 1:50 Over night #sc-133218, Santa LCP1 WB mmab Cruz 1:500 Over night #sc-133218, Santa LCP1 IHC mmab Cruz 1:50 Over night pAKT (S473) WB rpab #9271, Cell Signaling 1:1000 Over night pAKT #sc-7985-R, Santa (S473) WB rpab Cruz 1:1000 Over night pAKT (S473) IHC rpab #9271, Cell Signaling 1:100 Over night AKT1 WB mmab #sc-5298, Santa Cruz 1:1000 Over night pERK1/2 (T202/Y204) WB mmab #9106, Cell Signaling 1:1000 Over night pERK1/2 (T202/Y204) IHC mmab #9106, Cell Signaling 1:100 Over night tERK1/2 WB mmab #13-6200, Zymed 1:1000 Over night TWIST1 WB rpab #sc-15393, Santa Cruz 1:1000 Over night EZH2 WB rpab #5246, Cell Signaling 1:1000 Over night FN1 WB mmab # 610077, BD 1:5000 Over night #13409-1-AP, Occludin WB rpab Proteintech 1:1000 Over night γ-catenin WB mmab #sc-8415, Santa Cruz 1:1000 Over night #60008-1-Ig, β-actin WB mmab Proteintech 1:5000 Over night Abbreviations: WB, Western blot; ChIP, chromatin immunoprecipitation; mmab, mouse monoclonal antibody; rmab, rabbit monoclonal antibody; rpab, rabbit polyclonal antibody. Supplementary Table S3. The correlation of MIR135A1 deletion with the clinicopathologic features of breast cancer in the TCGA breast tumor dataset Parameter n MIR135A1 loss, n (%) p value Menopause pre 213 78 (37) 0.072 peri 35 14 (40) post 649 190 (29) Age <=35 29 15 (52) 0.006 35-55 401 139 (35) >55 573 162 (28) Vital status alive 906 277 (31) 0.052 dead 97 39 (40) Recurrence free 746 225 (30) 0.294 recurred 63 23 (37) Histological type IDC 730 265 (36) 0.000 ILC 177 33 (19) Other types 95 18 (19) Pathologic T T1 262 57 (22) 0.000 T2 582 213 (37) T3* 156 45 (29) Pathologic stage I 169 40 (24) 0.052 II 570 191 (34) III* 246 79 (32) Estrogen receptor － 215 112 (52) 0.000 ＋ 744 192(26) Progesterone receptor － 308 151 (49) 0.000 ＋ 648 153 (24) HER2 low 306 104 (34) 0.447 high 525 165 (31) * includes higher categories. Supplementary Table S4. The correlation of pri-miR-135a-1 expression with the clinicopathologic features of breast cancer in the TCGA breast tumor dataset Parameter n Lower pri-miR-135a-1, n (%) p value Menopause pre 213 78 (37) 0.000 period 35 22 (63) post 649 358 (55) Age <=35 29 13 (45) 0.041 35-55 401 182 (45) >55 573 306 (53) Vital status alive 906 453 (50) 0.989 dead 97 48 (50) Recurrence free 746 369 (50) 0.353 recurred 63 35 (56) Histological type IDC 730 366 (50) 0.989 ILC 177 88 (50) Other types 95 47 (50) Pathologic T T1 262 132 (50) 0.746 T2 582 294 (51) T3* 156 75 (48) Pathologic stage I 169 79 (47) 0.148 II 570 285 (50) III* 230 129 (56) Estrogen receptor － 215 132 (61) 0.000 ＋ 744 339 (46) Progesterone receptor － 308 193(63) 0.000 ＋ 648 277 (43) HER2 low 306 174 (57) 0.004 high 525 244 (47) * includes higher categories. Supplementary Table S5. Gene List EMT markers examined in the Oxford breast tumor set CDH1, CDH2, VIM, FN1, SNAI1, SNAI2, TCF3, TWIST1, ZEB1, JUP, CTNNB1, ZEB2, TJP1, OCLN, GJA1, GJB1, CTNNA1, FOXC2, MMP2, MMP9, EZH2 ERα cofactors and interacting proteins AHR, BCAR1, BRCA1, CAV1, CCND1, EFNA5, ESR1, ESR2, ESRRA, ESRRB, ESRRG, IGF1, MTA1, NCOA1, NCOA2, NCOA3, NCOR1, NCOR2, NR0B1, NR0B2, NRIP1, PELP1, PHB2, SAFB,
Load more

Recommended publications
  • COVID-19—The Potential Beneficial Therapeutic Effects of Spironolactone During SARS-Cov-2 Infection
    pharmaceuticals Review COVID-19—The Potential Beneficial Therapeutic Effects of Spironolactone during SARS-CoV-2 Infection Katarzyna Kotfis 1,* , Kacper Lechowicz 1 , Sylwester Drozd˙ zal˙ 2 , Paulina Nied´zwiedzka-Rystwej 3 , Tomasz K. Wojdacz 4, Ewelina Grywalska 5 , Jowita Biernawska 6, Magda Wi´sniewska 7 and Miłosz Parczewski 8 1 Department of Anesthesiology, Intensive Therapy and Acute Intoxications, Pomeranian Medical University in Szczecin, 70-111 Szczecin, Poland; [email protected] 2 Department of Pharmacokinetics and Monitored Therapy, Pomeranian Medical University, 70-111 Szczecin, Poland; [email protected] 3 Institute of Biology, University of Szczecin, 71-412 Szczecin, Poland; [email protected] 4 Independent Clinical Epigenetics Laboratory, Pomeranian Medical University, 71-252 Szczecin, Poland; [email protected] 5 Department of Clinical Immunology and Immunotherapy, Medical University of Lublin, 20-093 Lublin, Poland; [email protected] 6 Department of Anesthesiology and Intensive Therapy, Pomeranian Medical University in Szczecin, 71-252 Szczecin, Poland; [email protected] 7 Clinical Department of Nephrology, Transplantology and Internal Medicine, Pomeranian Medical University, 70-111 Szczecin, Poland; [email protected] 8 Department of Infectious, Tropical Diseases and Immune Deficiency, Pomeranian Medical University in Szczecin, 71-455 Szczecin, Poland; [email protected] * Correspondence: katarzyna.kotfi[email protected]; Tel.: +48-91-466-11-44 Abstract: In March 2020, coronavirus disease 2019 (COVID-19) caused by SARS-CoV-2 was declared Citation: Kotfis, K.; Lechowicz, K.; a global pandemic by the World Health Organization (WHO). The clinical course of the disease is Drozd˙ zal,˙ S.; Nied´zwiedzka-Rystwej, unpredictable but may lead to severe acute respiratory infection (SARI) and pneumonia leading to P.; Wojdacz, T.K.; Grywalska, E.; acute respiratory distress syndrome (ARDS).
    [Show full text]
  • Deciphering the Nature of Trp73 Isoforms in Mouse
    cancers Article Deciphering the Nature of Trp73 Isoforms in Mouse Embryonic Stem Cell Models: Generation of Isoform-Specific Deficient Cell Lines Using the CRISPR/Cas9 Gene Editing System Lorena López-Ferreras 1,2,†, Nicole Martínez-García 1,3,†, Laura Maeso-Alonso 1,2,‡, Marta Martín-López 1,4,‡, Ángela Díez-Matilla 1,‡ , Javier Villoch-Fernandez 1,2, Hugo Alonso-Olivares 1,2, Margarita M. Marques 3,5,* and Maria C. Marin 1,2,* 1 Instituto de Biomedicina (IBIOMED), Universidad de León, 24071 León, Spain; [email protected] (L.L.-F.); [email protected] (N.M.-G.); [email protected] (L.M.-A.); [email protected] (M.M.-L.); [email protected] (Á.D.-M.); [email protected] (J.V.-F.); [email protected] (H.A.-O.) 2 Departamento de Biología Molecular, Universidad de León, 24071 León, Spain 3 Departamento de Producción Animal, Universidad de León, 24071 León, Spain 4 Biomar Microbial Technologies, Parque Tecnológico de León, Armunia, 24009 León, Spain 5 Instituto de Desarrollo Ganadero y Sanidad Animal (INDEGSAL), Universidad de León, 24071 León, Spain * Correspondence: [email protected] (M.M.M.); [email protected] (M.C.M.); Tel.: +34-987-291757 Citation: López-Ferreras, L.; (M.M.M.); +34-987-291490 (M.C.M.) Martínez-García, N.; Maeso-Alonso, † Equal contribution. ‡ Equal contribution. L.; Martín-López, M.; Díez-Matilla, Á.; Villoch-Fernandez, J.; Simple Summary: The Trp73 gene is involved in the regulation of multiple biological processes Alonso-Olivares, H.; Marques, M.M.; Marin, M.C. Deciphering the Nature such as response to stress, differentiation and tissue architecture.
    [Show full text]
  • SHOC2–MRAS–PP1 Complex Positively Regulates RAF Activity and Contributes to Noonan Syndrome Pathogenesis
    SHOC2–MRAS–PP1 complex positively regulates RAF activity and contributes to Noonan syndrome pathogenesis Lucy C. Younga,1, Nicole Hartiga,2, Isabel Boned del Ríoa, Sibel Saria, Benjamin Ringham-Terrya, Joshua R. Wainwrighta, Greg G. Jonesa, Frank McCormickb,3, and Pablo Rodriguez-Vicianaa,3 aUniversity College London Cancer Institute, University College London, London WC1E 6DD, United Kingdom; and bHelen Diller Family Comprehensive Cancer Center, University of California, San Francisco, CA 94158 Contributed by Frank McCormick, September 18, 2018 (sent for review November 22, 2017; reviewed by Deborah K. Morrison and Marc Therrien) Dephosphorylation of the inhibitory “S259” site on RAF kinases CRAF/RAF1 mutations are also frequently found in NS and (S259 on CRAF, S365 on BRAF) plays a key role in RAF activation. cluster around the S259 14-3-3 binding site, enhancing CRAF ac- The MRAS GTPase, a close relative of RAS oncoproteins, interacts tivity through disruption of 14-3-3 binding (8) and highlighting the with SHOC2 and protein phosphatase 1 (PP1) to form a heterotri- key role of this regulatory step in RAF–ERK pathway activation. meric holoenzyme that dephosphorylates this S259 RAF site. MRAS is a very close relative of the classical RAS oncoproteins MRAS and SHOC2 function as PP1 regulatory subunits providing (H-, N-, and KRAS, hereafter referred to collectively as “RAS”) the complex with striking specificity against RAF. MRAS also func- and shares most regulatory and effector interactions as well as tions as a targeting subunit as membrane localization is required transforming ability (9–11). However, MRAS also has specific for efficient RAF dephosphorylation and ERK pathway regulation functions of its own, and uniquely among RAS family GTPases, it in cells.
    [Show full text]
  • The Tumor Suppressor SCRIB Is a Negative Modulator of the Wnt/-Catenin Signaling Pathway
    The Tumor Suppressor SCRIB is a Negative Modulator of the Wnt/β-Catenin Signaling Pathway Avais Daulat, Mônica Silveira Wagner, Alexandra Walton, Emilie Baudelet, Stéphane Audebert, Luc Camoin, Jean-Paul Borg To cite this version: Avais Daulat, Mônica Silveira Wagner, Alexandra Walton, Emilie Baudelet, Stéphane Audebert, et al.. The Tumor Suppressor SCRIB is a Negative Modulator of the Wnt/β-Catenin Signaling Pathway. Pro- teomics, Wiley-VCH Verlag, 2019, 19 (21-22), pp.1800487. 10.1002/pmic.201800487. hal-02518664 HAL Id: hal-02518664 https://hal.archives-ouvertes.fr/hal-02518664 Submitted on 7 Apr 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. PROTEOMICS Page 2 of 35 1 2 3 1 The tumor suppressor SCRIB is a negative modulator of the Wnt/-catenin signaling 4 5 6 2 pathway 7 8 3 Avais M. Daulat1,§, Mônica Silveira Wagner1,§, Alexandra Walton1, Emilie Baudelet2, 9 10 4 Stéphane Audebert2, Luc Camoin2, #,*, Jean-Paul Borg1,2,#,* 11 12 13 5 14 15 6 16 17 7 18 19 8 20 21 For Peer Review 1 22 9 Centre de Recherche en Cancérologie de Marseille, Equipe
    [Show full text]
  • In Vivo Sensitivity of Human Melanoma to Tumor Necrosis Factor
    [CANCER RESEARCH 59, 205–212, January 1, 1999] In Vivo Sensitivity of Human Melanoma to Tumor Necrosis Factor (TNF)-␣ Is Determined by Tumor Production of the Novel Cytokine Endothelial-Monocyte Activating Polypeptide II (EMAPII) Peter C. Wu, H. Richard Alexander, James Huang, Patrick Hwu, Michael Gnant, Adam C. Berger, Ewa Turner, Olga Wilson, and Steven K. Libutti1 Surgical Metabolism Section, Surgery Branch, National Cancer Institute [P. C. W., H. R. A., J. H., P. H., M. G., A. C. B., E. T., S. K. L.], and Hematology Section, Clinical Pathology, Clinical Center [O. W.], NIH, Bethesda, Maryland 20892 ABSTRACT of different tumor histologies (3). However, the results were disap- pointing because TNF resulted in significant systemic toxicity and no ␣ Tumor necrosis factor (TNF)- is a potent anticancer agent that seems significant antitumor effects at the maximally tolerated doses. The to selectively target tumor-associated vasculature resulting in hemor- clinical use of TNF was largely abandoned until Lienard et al. (4) rhagic necrosis of tumors without injury to surrounding tissues. The major limitation in the clinical use of TNF has been severe dose-limiting reported their initial results of isolated limb perfusion as a means of toxicity when administered systemically. However, when administered in delivering high concentrations to the extremity in patients with in isolated organ perfusion it results in regression of advanced bulky tumors. transit melanoma or unresectable sarcoma, while minimizing systemic A better understanding of the mechanisms of TNF-induced antitumor exposure. We and others have used isolated organ perfusion of the effects may provide valuable information into how its clinical use in limb or liver using TNF plus chemotherapeutic agents to treat unre- cancer treatment may be expanded.
    [Show full text]
  • Stool-Derived Eukaryotic RNA Biomarkers for Detection of High-Risk Adenomas
    bioRxiv preprint doi: https://doi.org/10.1101/534412; this version posted January 29, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Stool-derived eukaryotic RNA biomarkers for detection of high-risk adenomas Erica Barnell1,2*, Yiming Kang2,3*, Andrew Barnell2, Katie Campbell1,2, Kimberly R. Kruse2, Elizabeth M. Wurtzler2, Malachi Griffith1,4,5,6, Aadel A. Chaudhuri3,6,7+, Obi L. Griffith1,4,5,6+ 1 McDonnell Genome Institute, Washington University School of Medicine, St. Louis, MO, USA 2 Geneoscopy LLC, Division of Gastroenterology and Hepatology, St. Louis, MO, USA 3 Department of Computer Science and Engineering, Washington University, St. Louis, MO, USA 4 Department of Genetics, Washington University School of Medicine, St. Louis, MO, USA 5 Division of Oncology, Department of Medicine, Washington University School of Medicine, St. Louis, MO, USA 6 Siteman Cancer Center, Washington University School of Medicine, St. Louis, MO, USA 7 Department of Radiation Oncology, Washington University School of Medicine, St. Louis, MO, USA +Corresponding author *These authors contributed equally to this work. Abbreviations AUC area under the curve LRA low-risk adenoma ANOVA analysis of variance MRA medium-risk adenoma CRC colorectal cancer NPV negative predictive value DE differentially expressed PPV positive predictive value FC fold-change ROC receiver operating characteristic FIT fecal immunochemical test seRNA stool-derived eukaryotic RNA HRA high-risk adenoma Abstract Background and aims: Colorectal cancer (CRC) is the second leading cause of cancer related deaths in the United States.
    [Show full text]
  • Hnag-1 Increases Lifespan by Regulating Energy Metabolism And
    www.impactaging.com AGING, August 20014 Vol. 6, No 8 Research Paper hNAG‐1 increases lifespan by regulating energy metabolism and insulin/IGF ‐1/mTOR signaling 1,4 1 1 2 3 Xingya Wang , Kali Chrysovergis , Justin Kosak , Grace Kissling , Mike Streicker , Glenda 3 1 1 Moser , Ruifang Li , and Thomas E. Eling 1 Laboratory of Molecular Carcinogenesis,National Institute of Environmental Health Sciences (NIEHS), Research Triangle Park NC 27709; USA 2 Biostatistics Branch, National Institute of Environmental Health Sciences (NIEHS), Research Triangle Park, NC 27709; USA 3Integrated Laboratory Systems, Inc., Morrisville, NC 27560, USA; 4 College of Pharmaceutical Sciences, Zhejiang Chinese Medical University, Zhejiang, China 310053. Key words: hNAG‐1/GDF15, lifespan, metabolism, insulin/IGF‐1/mTOR Received: 6/23/14; Accepted: 8/24/14; Published: 8/28/14 Correspondence to: Thomas E. Eling, PhD; E‐mail: [email protected] Copyright: Wang et al. This is an open‐access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited Abstract: Nonsteroidal anti‐inflammatory drug‐activated gene (NAG‐1) or GDF15 is a divergent member of the transforming growth factor beta (TGF‐β) superfamily and mice expressing hNAG‐1/hGDF15 have been shown to be resistant to HFD‐induced obesity and inflammation. This study investigated if hNAG‐1 increases lifespan in mice and its potential mechanisms. Here we report that female hNAG‐1 mice had significantly increased both mean and median life spans in two transgenic lines, with a larger difference in life spans in mice on a HFD than on low fat diet.
    [Show full text]
  • The RAS–Effector Interaction As a Drug Target Adam B
    Published OnlineFirst January 6, 2017; DOI: 10.1158/0008-5472.CAN-16-0938 Cancer Review Research The RAS–Effector Interaction as a Drug Target Adam B. Keeton1,2, E. Alan Salter3, and Gary A. Piazza1,2 Abstract About a third of all human cancers harbor mutations in one direct inhibitors of RAS proteins. Here, we review this evidence of the K-, N-, or HRAS genes that encode an abnormal RAS with a focus on compounds capable of inhibiting the interac- protein locked in a constitutively activated state to drive malig- tion of RAS proteins with their effectors that transduce the nant transformation and tumor growth. Despite more than signals of RAS and that drive and sustain malignant transfor- three decades of intensive research aimed at the discovery of mation and tumor growth. These reports of direct-acting RAS RAS-directed therapeutics, there are no FDA-approved drugs inhibitors provide valuable insight for further discovery and that are broadly effective against RAS-driven cancers. Although development of clinical candidates for RAS-driven cancers RAS proteins are often said to be "undruggable," there is involving mutations in RAS genes or otherwise activated RAS mounting evidence suggesting it may be feasible to develop proteins. Cancer Res; 77(2); 221–6. Ó2017 AACR. Introduction Activating mutations at codons 12, 13, or 61 of KRAS occur de novo in approximately one third of all human cancers and are Cancer is a leading cause of death in the developed world with especially prevalent in pancreatic, colorectal, and lung tumors. more than one million people diagnosed and more than 500,000 These mutations affect the P-loop and switch-2 regions of the deaths per year in the United States alone.
    [Show full text]
  • Identifying Genetic Risk Variants for Coronary Heart Disease in Familial Hypercholesterolemia: an Extreme Genetics Approach
    European Journal of Human Genetics (2015) 23, 381–387 & 2015 Macmillan Publishers Limited All rights reserved 1018-4813/15 www.nature.com/ejhg ARTICLE Identifying genetic risk variants for coronary heart disease in familial hypercholesterolemia: an extreme genetics approach Jorie Versmissen1,31, Danie¨lla M Oosterveer1,31, Mojgan Yazdanpanah1,31, Abbas Dehghan2, Hilma Ho´lm3, Jeanette Erdman4, Yurii S Aulchenko2,5, Gudmar Thorleifsson3, Heribert Schunkert4, Roeland Huijgen6, Ranitha Vongpromek1, Andre´ G Uitterlinden1,2, Joep C Defesche6, Cornelia M van Duijn2, Monique Mulder1, Tony Dadd7, Hro´bjartur D Karlsson8, Jose Ordovas9, Iris Kindt10, Amelia Jarman7, Albert Hofman2, Leonie van Vark-van der Zee1, Adriana C Blommesteijn-Touw1, Jaap Kwekkeboom11, Anho H Liem12, Frans J van der Ouderaa13, Sebastiano Calandra14, Stefano Bertolini15, Maurizio Averna16, Gisle Langslet17, Leiv Ose17, Emilio Ros18,19,Fa´tima Almagro20, Peter W de Leeuw21, Fernando Civeira22, Luis Masana23, Xavier Pinto´ 24, Maarten L Simoons25, Arend FL Schinkel1,25, Martin R Green7, Aeilko H Zwinderman26, Keith J Johnson27, Arne Schaefer28, Andrew Neil29, Jacqueline CM Witteman2, Steve E Humphries30, John JP Kastelein6 and Eric JG Sijbrands*,1 Mutations in the low-density lipoprotein receptor (LDLR) gene cause familial hypercholesterolemia (FH), a disorder characterized by coronary heart disease (CHD) at young age. We aimed to apply an extreme sampling method to enhance the statistical power to identify novel genetic risk variants for CHD in individuals with FH. We selected cases and controls with an extreme contrast in CHD risk from 17 000 FH patients from the Netherlands, whose functional LDLR mutation was unequivocally established. The genome-wide association (GWA) study was performed on 249 very young FH cases with CHD and 217 old FH controls without CHD (above 65 years for males and 70 years of age for females) using the Illumina HumanHap550K chip.
    [Show full text]
  • Download a Subgraph Composed of the Initially 32 Raso- of Proteins Underlying Rasopathies in Order to Iden- Pathy Proteins Selected in This Study
    Montero‑Bullón et al. Orphanet J Rare Dis (2021) 16:303 https://doi.org/10.1186/s13023‑021‑01934‑x RESEARCH Open Access Integrated in silico MS‑based phosphoproteomics and network enrichment analysis of RASopathy proteins Javier‑Fernando Montero‑Bullón1, Óscar González‑Velasco2, María Isidoro‑García3,4,5,6 and Jesus Lacal3,7* Abstract Background: RASopathies are a group of syndromes showing clinical overlap caused by mutations in genes afect‑ ing the RAS‑MAPK pathway. Consequent disruption on cellular signaling leads and is driven by phosphoproteome remodeling. However, we still lack a comprehensive picture of the diferent key players and altered downstream efectors. Methods: An in silico interactome of RASopathy proteins was generated using pathway enrichment analysis/STRING tool, including identifcation of main hub proteins. We also integrated phosphoproteomic and immunoblotting stud‑ ies using previous published information on RASopathy proteins and their neighbors in the context of RASopathy syndromes. Data from Phosphosite database (www. phosp hosite. org) was collected in order to obtain the potential phosphosites subjected to regulation in the 27 causative RASopathy proteins. We compiled a dataset of dysregulated phosphosites in RASopathies, searched for commonalities between syndromes in harmonized data, and analyzed the role of phosphorylation in the syndromes by the identifcation of key players between the causative RASopathy proteins and the associated interactome. Results: In this study, we provide a curated data set of 27 causative RASopathy genes, identify up to 511 protein– protein associations using pathway enrichment analysis/STRING tool, and identify 12 nodes as main hub proteins. We found that a large group of proteins contain tyrosine residues and their biological processes include but are not limited to the nervous system.
    [Show full text]
  • Identification of RRAS Gene Related to Nasopharyngeal Carcinoma Based on Pathway and Network-Based Analyses
    675 Original Article Identification of RRAS gene related to nasopharyngeal carcinoma based on pathway and network-based analyses Ruowen Xiao1#, Lu Shi2#, Te Yang3, Meiyin Zhang1, Huiyun Wang1, Shijuan Mai1 1State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangdong Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, Guangzhou 510060, China; 2Department of Thoracic Oncology, the Cancer Center of the Fifth Affiliated Hospital of Sun Yat-sen University, Zhuhai 519000, China; 3Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou 510120, China Contributions: (I) Conception and design: S Mai, H Wang; (II) Administrative support: S Mai, H Wang, M Zhang; (III) Provision of study materials or patients: R Xiao, L Shi, T Yang; (IV) Collection and assembly of data: R Xiao, L Shi; (V) Data analysis and interpretation: All authors; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. #These authors contributed equally to this work. Correspondence to: Professor Shijuan Mai; Professor Huiyun Wang. Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, 651 East Dongfeng Road, Guangzhou 510060, China. Email: [email protected]; [email protected]. Background: Nasopharyngeal carcinoma (NPC) is a highly aggressive neoplasm mainly distributed in the eastern and southeastern parts of Asia. NPC has a poor prognosis among head and neck cancers, and molecular-targeted therapies showed limited clinical efficacy. Methods: We reviewed publications in the PubMed database and extracted genes associated with NPC.
    [Show full text]
  • R-Ras Gtpases Signaling Role in Myelin Neurodegenerative Diseases
    International Journal of Molecular Sciences Review R-Ras GTPases Signaling Role in Myelin Neurodegenerative Diseases Berta Alcover-Sanchez , Gonzalo Garcia-Martin , Francisco Wandosell and Beatriz Cubelos * Departamento de Biología Molecular and Centro Biología Molecular “Severo Ochoa”, Universidad Autónoma de Madrid, 28049 Madrid, Spain; [email protected] (B.A.-S.); [email protected] (G.G.-M.); [email protected] (F.W.) * Correspondence: [email protected]; Tel.: +34-91-1964561 Received: 23 July 2020; Accepted: 14 August 2020; Published: 17 August 2020 Abstract: Myelination is required for fast and efficient synaptic transmission in vertebrates. In the central nervous system, oligodendrocytes are responsible for creating myelin sheaths that isolate and protect axons, even throughout adulthood. However, when myelin is lost, the failure of remyelination mechanisms can cause neurodegenerative myelin-associated pathologies. From oligodendrocyte progenitor cells to mature myelinating oligodendrocytes, myelination is a highly complex process that involves many elements of cellular signaling, yet many of the mechanisms that coordinate it, remain unknown. In this review, we will focus on the three major pathways involved in myelination (PI3K/Akt/mTOR, ERK1/2-MAPK, and Wnt/β-catenin) and recent advances describing the crosstalk elements which help to regulate them. In addition, we will review the tight relation between Ras GTPases and myelination processes and discuss its potential as novel elements of crosstalk between the pathways. A better understanding of the crosstalk elements orchestrating myelination mechanisms is essential to identify new potential targets to mitigate neurodegeneration. Keywords: myelin; oligodendrocyte; neurodegeneration; PI3K/Akt/mTOR; ERK1/2-MAPK; Wnt/β-catenin; R-Ras 1.
    [Show full text]