DOCSLIB.ORG

Hnag-1 Increases Lifespan by Regulating Energy Metabolism And

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Hnag-1 Increases Lifespan by Regulating Energy Metabolism And www.impactaging.com AGING, August 20014 Vol. 6, No 8 Research Paper hNAG‐1 increases lifespan by regulating energy metabolism and insulin/IGF ‐1/mTOR signaling 1,4 1 1 2 3 Xingya Wang , Kali Chrysovergis , Justin Kosak , Grace Kissling , Mike Streicker , Glenda 3 1 1 Moser , Ruifang Li , and Thomas E. Eling 1 Laboratory of Molecular Carcinogenesis,National Institute of Environmental Health Sciences (NIEHS), Research Triangle Park NC 27709; USA 2 Biostatistics Branch, National Institute of Environmental Health Sciences (NIEHS), Research Triangle Park, NC 27709; USA 3Integrated Laboratory Systems, Inc., Morrisville, NC 27560, USA; 4 College of Pharmaceutical Sciences, Zhejiang Chinese Medical University, Zhejiang, China 310053. Key words: hNAG‐1/GDF15, lifespan, metabolism, insulin/IGF‐1/mTOR Received: 6/23/14; Accepted: 8/24/14; Published: 8/28/14 Correspondence to: Thomas E. Eling, PhD; E‐mail: [email protected] Copyright: Wang et al. This is an open‐access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited Abstract: Nonsteroidal anti‐inflammatory drug‐activated gene (NAG‐1) or GDF15 is a divergent member of the transforming growth factor beta (TGF‐β) superfamily and mice expressing hNAG‐1/hGDF15 have been shown to be resistant to HFD‐induced obesity and inflammation. This study investigated if hNAG‐1 increases lifespan in mice and its potential mechanisms. Here we report that female hNAG‐1 mice had significantly increased both mean and median life spans in two transgenic lines, with a larger difference in life spans in mice on a HFD than on low fat diet. hNAG‐1 mice displayed significantly reduced body and adipose tissue weight, lowered serum IGF‐1, insulin and glucose levels, improved insulin sensitivity, and increased oxygen utilization, oxidative metabolism and energy expenditure. Gene expression analysis revealed significant differences in conserved gene pathways that are important regulators of longevity, including IGF ‐1, p70S6K, and PI3K/Akt signaling cascades. Phosphorylation of major components of IGF‐1/mTOR signaling pathway was significantly lower in hNAG‐1mice. Collectively, hNAG‐1 is an important regulator of mammalian longevity and may act as a survival factor. Our study suggests that hNAG‐1 has potential therapeutic uses in obesity‐related diseases where life span is frequently shorter. INTRODUCTION to increase mammalian lifespan other than genetic modifications [4]. In early life, rodents fed a caloric Aging is characterized by decline in cellular function restriction diet have lower IGF-1 levels than rodents fed and is associated with obesity, inflammation, altered a normal chow diet, and many rodent genetic models energy metabolism, and insulin resistance [1, 2]. with a prolonged lifespan have lower levels of serum Understanding the mechanisms of aging with the goal IGF-1 or IIS signaling compared to control groups [5- of increased lifespan remains an area of intensive study. 7]. In contrast, HFD promotes mortality and decreases Metabolic dysfunction is a common hallmark of aging lifespan in laboratory animals [8, 9]. [2]. The insulin/IGF-1 (IIS) signaling pathway is the most characterized metabolic pathway implicated in hNAG-1 plays a complex, but poorly understood role in aging [2, 3]. Genetic suppression of IIS signaling several human diseases [10]. Circulating hNAG-1 is extends longevity in worms, insects, and mammals [1]. elevated in physiological and pathological processes, Caloric restriction is the only efficient treatment known including early pregnancy, liver injury, heart failure, www.impactaging.com 690 AGING, August 2014, Vol. 6 No.8 and cancers [11, 12]. hNAG-1 has been shown to play a median lifespan of hNAG-1 mice was 18.8 weeks role in adiposity as transgenic mice expressing hNAG-1 (19.5%) and 13.0 weeks (12.8%) longer than WT have reduced body weight and fat content compared to littermates, respectively for lines 1377 and 1398 (log rank their wild-type littermates [2, 13]. Recently, we have χ2 = 4.60, 1 d.f., p=0.032 for line 1377; log rank χ2 = shown that hNAG-1 transgenic mice are resistant to 8.03, 1 d.f., p=0.005 for line 1398, Table 1). On HFD, the both genetic and dietary-induced obesity, and have median lifespan of hNAG-1 mice was 22.4 weeks improved insulin sensitivity and higher oxidative (23.6%) and 33.6 weeks (43.6%) longer than WT metabolism compared to wild-type controls [14]. We littermates, respectively for lines 1377 and 1398 (log rank also found that hNAG-1 mice have lower inflammation χ2 = 13.0, 1 d.f., p<0.001 for line 1377; log rank χ2 = [15, 16]. In addition, hNAG-1 transgenic mice have 28.9, 1 d.f., p<0.001 for line 1398, Table 1). Consistent significantly reduced serum level of IGF-1[14]. with previous findings that HFD could shorten lifespan[8, However, it has not been determined if hNAG-1 9], survival of line 1398 WT mice in the HFD group was increases lifespan and if it alters the IGF-1/mTOR significantly lower than the LFD group (median was 24 pathway, a key pathway in the regulation of aging [4]. weeks lower, log rank χ2 = 11.2, 1 d.f., p < 0.001). However, there were no significant differences in In this study, we measured the lifespan of hNAG-1 lifespan between HFD and LFD in either WT or hNAG-1 transgenic and wild type mice and examined effects of transgenic mice in line 1377. Consistent with previous HFD on lifespan. Lifespans of the hNAG-1 transgenic findings that young hNAG-1mice (20 to 30 weeks) are mice are significantly longer with both LFD and HFD. resistant to obesity on a 12 week-long HFD [14], both We also found increased oxidative metabolism, insulin mean body and abdominal white adipose tissue (WAT) sensitivity, and reduced signaling cascade of IGF- weights are significantly reduced in old hNAG-1 mice (> 1/Insulin/mTOR in the hNAG-1 transgenic mice which 95 weeks) after prolonged feeding with either diets may be responsible, in part, for the increased lifespan. (Figure 1c and 1d, Supplementary Figures 1 and 2). With aging and especially on HFD, mice (C57/BL6) develop RESULTS spontaneous skin lesions and mass growths (tumors or non-tumors) in organs and experience lymph node and hNAG-1 female mice have increased lifespan spleen enlargement [17-19]. Fewer hNAG-1 mice have skin lesions, spleen enlargement and gross liver lesions A total of 200 female hNAG-1 mice and their wild-type compared to WT littermates (Supplementary Tables 1 (WT) littermates from two transgenic lines (1377 and and 2). Percentages of mice with lymph node 1398) were placed on either 10% (LFD) or 60% fat enlargements were similar between hNAG-1 and WT diets (HFD) (n = 25 in each line-genotype-diet group). mice. Collectively, hNAG-1 overexpression increases Log-rank tests showed lifespan was significantly longer lifespan in female mice. hNAG-1 mice are resistant to for hNAG-1 mice than for WT mice in both lines with diet-induced obesity, as well as age- and diet-induced both diets (Figure 1a and 1b, Table 1). On LFD, the pathological lesions. Table 1. Median survival times (weeks) with comparisons of hNAG‐1 and WT mice. 10% Fat Diet (LFD) 60% Fat Diet (HFD) Line Genotype N Median P-Value N Median P-Value 1377 NAG-1 25 115.1 25 117.3 0.032 <0.001 WT 25 96.3 25 94.9 1398 NAG-1 25 114.0 25 110.6 0.005 <0.001 WT 25 101.0 25 77.0 Median lifespans were calculated by Kaplan–Meier survival curve analysis. Statistical comparisons between genotypes and diets was performed using the log rank test (N=25, p<0.05). www.impactaging.com 691 AGING, August 2014, Vol. 6 No.8 Figure 1. Increased lifespan of female hNAG‐1 transgenic mice . (a‐b), Kaplan‐Meier survival curves for female Wt and hNAG‐1 mice from two transgenic lines, line 1377 and line 1398 (a) LFD (b) HFD. (c), Terminal mean body weights of hNAG‐1 and Wt mice at 95±5 wk old in two lines (g). (d), Mean abdominal white adipose tissue (WAT) weights of the mice (g). n=9~18. Data are presented as mean ± SE. a, p<0.05, b, p<0.01 and c, p<0.001 as determined by Student’s t‐test. hNAG-1 female mice have increased circulating was the same for hNAG-1 and WT mice (data not growth hormone level shown). The downstream GH signaling cascade including phosphorylation of JAK2, ERK1/2, and In mice, disruption of growth hormone (GH) signaling SMAD were not different in hNAG-1 mice. that leads to major alterations in IIS has a well- Recombinant hNAG-1 did not inhibit GH-induced documented positive impact on lifespan [4]. The long- downstream signaling or IGF-1 secretion in cell culture lived GH-resistant GH receptor (GHR)-KO mice which studies using HepG2 cells (Data not shown). These data have high GH level, as well as Ames dwarf and Snell suggest that hNAG-1 mice are not GH resistant and the dwarf mice lacking GHexhibit dwarfism, increased effects on longevity in hNAG-1 mice appear to be subcutaneous adiposity, change in tissue sizes, and independent of GH. However, the cause of the reduction increased insulin sensitivity[1, 20]. Although hNAG-1 in IGF-1 levels and elevated GH levels in hNAG-1 mice mice are significantly shorter in body length (Figure 2a) is unclear. there are no significant differences in tissue sizes, length of femurs or organ weights (data not shown).
Load more

Recommended publications
  • COVID-19—The Potential Beneficial Therapeutic Effects of Spironolactone During SARS-Cov-2 Infection
    pharmaceuticals Review COVID-19—The Potential Beneficial Therapeutic Effects of Spironolactone during SARS-CoV-2 Infection Katarzyna Kotfis 1,* , Kacper Lechowicz 1 , Sylwester Drozd˙ zal˙ 2 , Paulina Nied´zwiedzka-Rystwej 3 , Tomasz K. Wojdacz 4, Ewelina Grywalska 5 , Jowita Biernawska 6, Magda Wi´sniewska 7 and Miłosz Parczewski 8 1 Department of Anesthesiology, Intensive Therapy and Acute Intoxications, Pomeranian Medical University in Szczecin, 70-111 Szczecin, Poland; [email protected] 2 Department of Pharmacokinetics and Monitored Therapy, Pomeranian Medical University, 70-111 Szczecin, Poland; [email protected] 3 Institute of Biology, University of Szczecin, 71-412 Szczecin, Poland; [email protected] 4 Independent Clinical Epigenetics Laboratory, Pomeranian Medical University, 71-252 Szczecin, Poland; [email protected] 5 Department of Clinical Immunology and Immunotherapy, Medical University of Lublin, 20-093 Lublin, Poland; [email protected] 6 Department of Anesthesiology and Intensive Therapy, Pomeranian Medical University in Szczecin, 71-252 Szczecin, Poland; [email protected] 7 Clinical Department of Nephrology, Transplantology and Internal Medicine, Pomeranian Medical University, 70-111 Szczecin, Poland; [email protected] 8 Department of Infectious, Tropical Diseases and Immune Deficiency, Pomeranian Medical University in Szczecin, 71-455 Szczecin, Poland; [email protected] * Correspondence: katarzyna.kotfi[email protected]; Tel.: +48-91-466-11-44 Abstract: In March 2020, coronavirus disease 2019 (COVID-19) caused by SARS-CoV-2 was declared Citation: Kotfis, K.; Lechowicz, K.; a global pandemic by the World Health Organization (WHO). The clinical course of the disease is Drozd˙ zal,˙ S.; Nied´zwiedzka-Rystwej, unpredictable but may lead to severe acute respiratory infection (SARI) and pneumonia leading to P.; Wojdacz, T.K.; Grywalska, E.; acute respiratory distress syndrome (ARDS).
    [Show full text]
  • Deciphering the Nature of Trp73 Isoforms in Mouse
    cancers Article Deciphering the Nature of Trp73 Isoforms in Mouse Embryonic Stem Cell Models: Generation of Isoform-Specific Deficient Cell Lines Using the CRISPR/Cas9 Gene Editing System Lorena López-Ferreras 1,2,†, Nicole Martínez-García 1,3,†, Laura Maeso-Alonso 1,2,‡, Marta Martín-López 1,4,‡, Ángela Díez-Matilla 1,‡ , Javier Villoch-Fernandez 1,2, Hugo Alonso-Olivares 1,2, Margarita M. Marques 3,5,* and Maria C. Marin 1,2,* 1 Instituto de Biomedicina (IBIOMED), Universidad de León, 24071 León, Spain; [email protected] (L.L.-F.); [email protected] (N.M.-G.); [email protected] (L.M.-A.); [email protected] (M.M.-L.); [email protected] (Á.D.-M.); [email protected] (J.V.-F.); [email protected] (H.A.-O.) 2 Departamento de Biología Molecular, Universidad de León, 24071 León, Spain 3 Departamento de Producción Animal, Universidad de León, 24071 León, Spain 4 Biomar Microbial Technologies, Parque Tecnológico de León, Armunia, 24009 León, Spain 5 Instituto de Desarrollo Ganadero y Sanidad Animal (INDEGSAL), Universidad de León, 24071 León, Spain * Correspondence: [email protected] (M.M.M.); [email protected] (M.C.M.); Tel.: +34-987-291757 Citation: López-Ferreras, L.; (M.M.M.); +34-987-291490 (M.C.M.) Martínez-García, N.; Maeso-Alonso, † Equal contribution. ‡ Equal contribution. L.; Martín-López, M.; Díez-Matilla, Á.; Villoch-Fernandez, J.; Simple Summary: The Trp73 gene is involved in the regulation of multiple biological processes Alonso-Olivares, H.; Marques, M.M.; Marin, M.C. Deciphering the Nature such as response to stress, differentiation and tissue architecture.
    [Show full text]
  • SHOC2–MRAS–PP1 Complex Positively Regulates RAF Activity and Contributes to Noonan Syndrome Pathogenesis
    SHOC2–MRAS–PP1 complex positively regulates RAF activity and contributes to Noonan syndrome pathogenesis Lucy C. Younga,1, Nicole Hartiga,2, Isabel Boned del Ríoa, Sibel Saria, Benjamin Ringham-Terrya, Joshua R. Wainwrighta, Greg G. Jonesa, Frank McCormickb,3, and Pablo Rodriguez-Vicianaa,3 aUniversity College London Cancer Institute, University College London, London WC1E 6DD, United Kingdom; and bHelen Diller Family Comprehensive Cancer Center, University of California, San Francisco, CA 94158 Contributed by Frank McCormick, September 18, 2018 (sent for review November 22, 2017; reviewed by Deborah K. Morrison and Marc Therrien) Dephosphorylation of the inhibitory “S259” site on RAF kinases CRAF/RAF1 mutations are also frequently found in NS and (S259 on CRAF, S365 on BRAF) plays a key role in RAF activation. cluster around the S259 14-3-3 binding site, enhancing CRAF ac- The MRAS GTPase, a close relative of RAS oncoproteins, interacts tivity through disruption of 14-3-3 binding (8) and highlighting the with SHOC2 and protein phosphatase 1 (PP1) to form a heterotri- key role of this regulatory step in RAF–ERK pathway activation. meric holoenzyme that dephosphorylates this S259 RAF site. MRAS is a very close relative of the classical RAS oncoproteins MRAS and SHOC2 function as PP1 regulatory subunits providing (H-, N-, and KRAS, hereafter referred to collectively as “RAS”) the complex with striking specificity against RAF. MRAS also func- and shares most regulatory and effector interactions as well as tions as a targeting subunit as membrane localization is required transforming ability (9–11). However, MRAS also has specific for efficient RAF dephosphorylation and ERK pathway regulation functions of its own, and uniquely among RAS family GTPases, it in cells.
    [Show full text]
  • The Tumor Suppressor SCRIB Is a Negative Modulator of the Wnt/-Catenin Signaling Pathway
    The Tumor Suppressor SCRIB is a Negative Modulator of the Wnt/β-Catenin Signaling Pathway Avais Daulat, Mônica Silveira Wagner, Alexandra Walton, Emilie Baudelet, Stéphane Audebert, Luc Camoin, Jean-Paul Borg To cite this version: Avais Daulat, Mônica Silveira Wagner, Alexandra Walton, Emilie Baudelet, Stéphane Audebert, et al.. The Tumor Suppressor SCRIB is a Negative Modulator of the Wnt/β-Catenin Signaling Pathway. Pro- teomics, Wiley-VCH Verlag, 2019, 19 (21-22), pp.1800487. 10.1002/pmic.201800487. hal-02518664 HAL Id: hal-02518664 https://hal.archives-ouvertes.fr/hal-02518664 Submitted on 7 Apr 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. PROTEOMICS Page 2 of 35 1 2 3 1 The tumor suppressor SCRIB is a negative modulator of the Wnt/-catenin signaling 4 5 6 2 pathway 7 8 3 Avais M. Daulat1,§, Mônica Silveira Wagner1,§, Alexandra Walton1, Emilie Baudelet2, 9 10 4 Stéphane Audebert2, Luc Camoin2, #,*, Jean-Paul Borg1,2,#,* 11 12 13 5 14 15 6 16 17 7 18 19 8 20 21 For Peer Review 1 22 9 Centre de Recherche en Cancérologie de Marseille, Equipe
    [Show full text]
  • In Vivo Sensitivity of Human Melanoma to Tumor Necrosis Factor
    [CANCER RESEARCH 59, 205–212, January 1, 1999] In Vivo Sensitivity of Human Melanoma to Tumor Necrosis Factor (TNF)-␣ Is Determined by Tumor Production of the Novel Cytokine Endothelial-Monocyte Activating Polypeptide II (EMAPII) Peter C. Wu, H. Richard Alexander, James Huang, Patrick Hwu, Michael Gnant, Adam C. Berger, Ewa Turner, Olga Wilson, and Steven K. Libutti1 Surgical Metabolism Section, Surgery Branch, National Cancer Institute [P. C. W., H. R. A., J. H., P. H., M. G., A. C. B., E. T., S. K. L.], and Hematology Section, Clinical Pathology, Clinical Center [O. W.], NIH, Bethesda, Maryland 20892 ABSTRACT of different tumor histologies (3). However, the results were disap- pointing because TNF resulted in significant systemic toxicity and no ␣ Tumor necrosis factor (TNF)- is a potent anticancer agent that seems significant antitumor effects at the maximally tolerated doses. The to selectively target tumor-associated vasculature resulting in hemor- clinical use of TNF was largely abandoned until Lienard et al. (4) rhagic necrosis of tumors without injury to surrounding tissues. The major limitation in the clinical use of TNF has been severe dose-limiting reported their initial results of isolated limb perfusion as a means of toxicity when administered systemically. However, when administered in delivering high concentrations to the extremity in patients with in isolated organ perfusion it results in regression of advanced bulky tumors. transit melanoma or unresectable sarcoma, while minimizing systemic A better understanding of the mechanisms of TNF-induced antitumor exposure. We and others have used isolated organ perfusion of the effects may provide valuable information into how its clinical use in limb or liver using TNF plus chemotherapeutic agents to treat unre- cancer treatment may be expanded.
    [Show full text]
  • Stool-Derived Eukaryotic RNA Biomarkers for Detection of High-Risk Adenomas
    bioRxiv preprint doi: https://doi.org/10.1101/534412; this version posted January 29, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Stool-derived eukaryotic RNA biomarkers for detection of high-risk adenomas Erica Barnell1,2*, Yiming Kang2,3*, Andrew Barnell2, Katie Campbell1,2, Kimberly R. Kruse2, Elizabeth M. Wurtzler2, Malachi Griffith1,4,5,6, Aadel A. Chaudhuri3,6,7+, Obi L. Griffith1,4,5,6+ 1 McDonnell Genome Institute, Washington University School of Medicine, St. Louis, MO, USA 2 Geneoscopy LLC, Division of Gastroenterology and Hepatology, St. Louis, MO, USA 3 Department of Computer Science and Engineering, Washington University, St. Louis, MO, USA 4 Department of Genetics, Washington University School of Medicine, St. Louis, MO, USA 5 Division of Oncology, Department of Medicine, Washington University School of Medicine, St. Louis, MO, USA 6 Siteman Cancer Center, Washington University School of Medicine, St. Louis, MO, USA 7 Department of Radiation Oncology, Washington University School of Medicine, St. Louis, MO, USA +Corresponding author *These authors contributed equally to this work. Abbreviations AUC area under the curve LRA low-risk adenoma ANOVA analysis of variance MRA medium-risk adenoma CRC colorectal cancer NPV negative predictive value DE differentially expressed PPV positive predictive value FC fold-change ROC receiver operating characteristic FIT fecal immunochemical test seRNA stool-derived eukaryotic RNA HRA high-risk adenoma Abstract Background and aims: Colorectal cancer (CRC) is the second leading cause of cancer related deaths in the United States.
    [Show full text]
  • Supplemental Information Loss of Estrogen Regulated MIR135A1 At
    Supplemental Information Loss of Estrogen Regulated MIR135A1 at 3p21.1 Promotes Tamoxifen Resistance in Breast Cancer Weijie Zhang, Mingming Wu, Qing-Yun Chong, Min Zhang, Xiao Zhang, Lan Hu, Yanghao Zhong, Pengxu Qian, Xiangjun Kong, Sheng Tan, Gaopeng Li, Keshuo Ding, Peter E. Lobie, and Tao Zhu. Supplemental data include 5 supplemental tables, and 7 supplemental figures and legends. Supplemental Tables Supplementary Table S1. Sequences of the miRNA mimics/siRNAs, shRNAs, and primers for cloning, ChIP assays and qRT-PCR analysis. miRNAs Sense Strand (5'-3') Antisense Strand (5'-3') hsa-miR-135a UAUGGCUUUUUAUUCCUAUGU ACAUAGGAAUAAAAAGCCAUA mimics GA UU siERK1 GAAACUACCUACAGUCUCUTT AGAGACUGUAGGUAGUUUCTT siERK2 GUGCUCUGCUUAUGAUAAUTT AUUAUCAUAAGCAGAGCACTT siAKT GCACCUUCAUUGGCUACAATT UUGUAGCCAAUGAAGGUGCTT Negative Control (NC) UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT shRNAs Sense Strand (5'-3') CCGGCTACAGGCCAAATTCAGATAACTCGAGTTATCTGAATTTGGC shESR1 CTGTAGTTTTT CCGGGTGAATGCACTGGTGTCTCATCTCGAGATGAGACACCAGTGC shESRRA ATTCACTTTTT CCGGCGGAAGTCAGATTGTAGCCAACTCGAGTTGGCTACAATCTGA shNCOA1 CTTCCGTTTTT CCGGGCTTGACTGGTTTGAGACACACTCGAGTGTGTCTCAAACCAG shPIM2 TCAAGCTTTTT CCGGCCACCTCTCAATGTCGACAAACTCGAGTTTGTCGACATTGAG shMRAS AGGTGGTTTTTG CCGGGTCATCAAGATTGGGTTGTTTCTCGAGAAACAACCCAATCTTG shLCP1 ATGACTTTTTG CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTA shScr GG Primers for plasmid construction Sense Strand (5'-3') Antisense Strand (5'-3') pri-miR-135a-1 CGAATTCAGGAACTCCATGCCA AATGTCGACCCTGAAGTCAGCC cloning primer GCACAG CTTCAGTG TCACATAGGAATTTAAGCCATACGATTCACATAGGAATTTAAGCCA
    [Show full text]
  • The RAS–Effector Interaction As a Drug Target Adam B
    Published OnlineFirst January 6, 2017; DOI: 10.1158/0008-5472.CAN-16-0938 Cancer Review Research The RAS–Effector Interaction as a Drug Target Adam B. Keeton1,2, E. Alan Salter3, and Gary A. Piazza1,2 Abstract About a third of all human cancers harbor mutations in one direct inhibitors of RAS proteins. Here, we review this evidence of the K-, N-, or HRAS genes that encode an abnormal RAS with a focus on compounds capable of inhibiting the interac- protein locked in a constitutively activated state to drive malig- tion of RAS proteins with their effectors that transduce the nant transformation and tumor growth. Despite more than signals of RAS and that drive and sustain malignant transfor- three decades of intensive research aimed at the discovery of mation and tumor growth. These reports of direct-acting RAS RAS-directed therapeutics, there are no FDA-approved drugs inhibitors provide valuable insight for further discovery and that are broadly effective against RAS-driven cancers. Although development of clinical candidates for RAS-driven cancers RAS proteins are often said to be "undruggable," there is involving mutations in RAS genes or otherwise activated RAS mounting evidence suggesting it may be feasible to develop proteins. Cancer Res; 77(2); 221–6. Ó2017 AACR. Introduction Activating mutations at codons 12, 13, or 61 of KRAS occur de novo in approximately one third of all human cancers and are Cancer is a leading cause of death in the developed world with especially prevalent in pancreatic, colorectal, and lung tumors. more than one million people diagnosed and more than 500,000 These mutations affect the P-loop and switch-2 regions of the deaths per year in the United States alone.
    [Show full text]
  • Identifying Genetic Risk Variants for Coronary Heart Disease in Familial Hypercholesterolemia: an Extreme Genetics Approach
    European Journal of Human Genetics (2015) 23, 381–387 & 2015 Macmillan Publishers Limited All rights reserved 1018-4813/15 www.nature.com/ejhg ARTICLE Identifying genetic risk variants for coronary heart disease in familial hypercholesterolemia: an extreme genetics approach Jorie Versmissen1,31, Danie¨lla M Oosterveer1,31, Mojgan Yazdanpanah1,31, Abbas Dehghan2, Hilma Ho´lm3, Jeanette Erdman4, Yurii S Aulchenko2,5, Gudmar Thorleifsson3, Heribert Schunkert4, Roeland Huijgen6, Ranitha Vongpromek1, Andre´ G Uitterlinden1,2, Joep C Defesche6, Cornelia M van Duijn2, Monique Mulder1, Tony Dadd7, Hro´bjartur D Karlsson8, Jose Ordovas9, Iris Kindt10, Amelia Jarman7, Albert Hofman2, Leonie van Vark-van der Zee1, Adriana C Blommesteijn-Touw1, Jaap Kwekkeboom11, Anho H Liem12, Frans J van der Ouderaa13, Sebastiano Calandra14, Stefano Bertolini15, Maurizio Averna16, Gisle Langslet17, Leiv Ose17, Emilio Ros18,19,Fa´tima Almagro20, Peter W de Leeuw21, Fernando Civeira22, Luis Masana23, Xavier Pinto´ 24, Maarten L Simoons25, Arend FL Schinkel1,25, Martin R Green7, Aeilko H Zwinderman26, Keith J Johnson27, Arne Schaefer28, Andrew Neil29, Jacqueline CM Witteman2, Steve E Humphries30, John JP Kastelein6 and Eric JG Sijbrands*,1 Mutations in the low-density lipoprotein receptor (LDLR) gene cause familial hypercholesterolemia (FH), a disorder characterized by coronary heart disease (CHD) at young age. We aimed to apply an extreme sampling method to enhance the statistical power to identify novel genetic risk variants for CHD in individuals with FH. We selected cases and controls with an extreme contrast in CHD risk from 17 000 FH patients from the Netherlands, whose functional LDLR mutation was unequivocally established. The genome-wide association (GWA) study was performed on 249 very young FH cases with CHD and 217 old FH controls without CHD (above 65 years for males and 70 years of age for females) using the Illumina HumanHap550K chip.
    [Show full text]
  • Download a Subgraph Composed of the Initially 32 Raso- of Proteins Underlying Rasopathies in Order to Iden- Pathy Proteins Selected in This Study
    Montero‑Bullón et al. Orphanet J Rare Dis (2021) 16:303 https://doi.org/10.1186/s13023‑021‑01934‑x RESEARCH Open Access Integrated in silico MS‑based phosphoproteomics and network enrichment analysis of RASopathy proteins Javier‑Fernando Montero‑Bullón1, Óscar González‑Velasco2, María Isidoro‑García3,4,5,6 and Jesus Lacal3,7* Abstract Background: RASopathies are a group of syndromes showing clinical overlap caused by mutations in genes afect‑ ing the RAS‑MAPK pathway. Consequent disruption on cellular signaling leads and is driven by phosphoproteome remodeling. However, we still lack a comprehensive picture of the diferent key players and altered downstream efectors. Methods: An in silico interactome of RASopathy proteins was generated using pathway enrichment analysis/STRING tool, including identifcation of main hub proteins. We also integrated phosphoproteomic and immunoblotting stud‑ ies using previous published information on RASopathy proteins and their neighbors in the context of RASopathy syndromes. Data from Phosphosite database (www. phosp hosite. org) was collected in order to obtain the potential phosphosites subjected to regulation in the 27 causative RASopathy proteins. We compiled a dataset of dysregulated phosphosites in RASopathies, searched for commonalities between syndromes in harmonized data, and analyzed the role of phosphorylation in the syndromes by the identifcation of key players between the causative RASopathy proteins and the associated interactome. Results: In this study, we provide a curated data set of 27 causative RASopathy genes, identify up to 511 protein– protein associations using pathway enrichment analysis/STRING tool, and identify 12 nodes as main hub proteins. We found that a large group of proteins contain tyrosine residues and their biological processes include but are not limited to the nervous system.
    [Show full text]
  • Identification of RRAS Gene Related to Nasopharyngeal Carcinoma Based on Pathway and Network-Based Analyses
    675 Original Article Identification of RRAS gene related to nasopharyngeal carcinoma based on pathway and network-based analyses Ruowen Xiao1#, Lu Shi2#, Te Yang3, Meiyin Zhang1, Huiyun Wang1, Shijuan Mai1 1State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangdong Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, Guangzhou 510060, China; 2Department of Thoracic Oncology, the Cancer Center of the Fifth Affiliated Hospital of Sun Yat-sen University, Zhuhai 519000, China; 3Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou 510120, China Contributions: (I) Conception and design: S Mai, H Wang; (II) Administrative support: S Mai, H Wang, M Zhang; (III) Provision of study materials or patients: R Xiao, L Shi, T Yang; (IV) Collection and assembly of data: R Xiao, L Shi; (V) Data analysis and interpretation: All authors; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. #These authors contributed equally to this work. Correspondence to: Professor Shijuan Mai; Professor Huiyun Wang. Key Laboratory of Nasopharyngeal Carcinoma Diagnosis and Therapy, Sun Yat-sen University Cancer Center, 651 East Dongfeng Road, Guangzhou 510060, China. Email: [email protected]; [email protected]. Background: Nasopharyngeal carcinoma (NPC) is a highly aggressive neoplasm mainly distributed in the eastern and southeastern parts of Asia. NPC has a poor prognosis among head and neck cancers, and molecular-targeted therapies showed limited clinical efficacy. Methods: We reviewed publications in the PubMed database and extracted genes associated with NPC.
    [Show full text]
  • R-Ras Gtpases Signaling Role in Myelin Neurodegenerative Diseases
    International Journal of Molecular Sciences Review R-Ras GTPases Signaling Role in Myelin Neurodegenerative Diseases Berta Alcover-Sanchez , Gonzalo Garcia-Martin , Francisco Wandosell and Beatriz Cubelos * Departamento de Biología Molecular and Centro Biología Molecular “Severo Ochoa”, Universidad Autónoma de Madrid, 28049 Madrid, Spain; [email protected] (B.A.-S.); [email protected] (G.G.-M.); [email protected] (F.W.) * Correspondence: [email protected]; Tel.: +34-91-1964561 Received: 23 July 2020; Accepted: 14 August 2020; Published: 17 August 2020 Abstract: Myelination is required for fast and efficient synaptic transmission in vertebrates. In the central nervous system, oligodendrocytes are responsible for creating myelin sheaths that isolate and protect axons, even throughout adulthood. However, when myelin is lost, the failure of remyelination mechanisms can cause neurodegenerative myelin-associated pathologies. From oligodendrocyte progenitor cells to mature myelinating oligodendrocytes, myelination is a highly complex process that involves many elements of cellular signaling, yet many of the mechanisms that coordinate it, remain unknown. In this review, we will focus on the three major pathways involved in myelination (PI3K/Akt/mTOR, ERK1/2-MAPK, and Wnt/β-catenin) and recent advances describing the crosstalk elements which help to regulate them. In addition, we will review the tight relation between Ras GTPases and myelination processes and discuss its potential as novel elements of crosstalk between the pathways. A better understanding of the crosstalk elements orchestrating myelination mechanisms is essential to identify new potential targets to mitigate neurodegeneration. Keywords: myelin; oligodendrocyte; neurodegeneration; PI3K/Akt/mTOR; ERK1/2-MAPK; Wnt/β-catenin; R-Ras 1.
    [Show full text]