Interspecific hybridization as a tool for enhancing climate resilience of reef-
building corals
Wing Yan Chan
ORCID: 0000-0001-9875-6903
Submitted in total fulfilment of the requirements of the degree of
Doctor of Philosophy
Dec 2018
School of BioSciences
The University of Melbourne
&
The Australian Institute of Marine Science
Declaration
This is to confirm that:
1. this thesis comprises only of my original work towards the PhD, except where indicated in the preface;
2. due acknowledgement has been made in the text to all other material used;
3. the thesis is under 100,000 words, exclusive of tables, maps, bibliographies and appendices.
Signed:
Date: 14 Dec 2018
ii Abstract
The world’s coral reefs are facing unprecedented changes in temperature and carbonate chemistry caused by the increasing concentration of atmospheric CO2. Recent massive loss of corals across the world suggests that their rate of adaptation and/or acclimatization is unlikely fast enough to keep pace with climate change. This thesis examines interspecific hybridization as a conservation management tool to develop coral stock with enhanced climate resilience and adaptive potential.
I start this thesis by discussing the potential benefits and risks of hybridization, and exploring the legal framework associated with hybrids and hybridization (chapter 1). Next, I present the results of interspecific fertilization trials, as well as stress experiments on coral larvae (chapter 2) and recruits (chapter 3) conducted to compare fitness of purebred and hybrid offspring. To understand mechanisms that may have contributed to the observed holobiont fitness differences, bacterial and algal endosymbiont communities associated with these corals were examined using 16S rRNA gene and ITS2 metabarcoding (chapter 4), and coral host gene expression patterns were assessed using RNA sequencing (chapter 5). The following findings and key conclusions have emerged from this thesis.
Firstly, all four tested pairs of Acropora species from the Great Barrier Reef were cross-fertile, but the degree of prezygotic barriers varied (chapters 2, 3). In both years in which hybridization was attempted (2015, 2016), the majority of the target species pairs had no or limited temporal isolation
(i.e., similar spawning dates and times). The only clear temporal isolation was between the ‘early spawner’ A. tenuis and the ‘late spawner’, A. loripes, although their gametes were still compatible.
Gametic incompatibility varied between species pairs and the year of hybridization tests (which involved the same coral species collected from different locations). Levels of cross fertility ranged
iii from no prezygotic barriers in both directions (chapter 3), to successful fertilization in one direction only, and in once case, unsuccessful fertilization in both directions (chapter 2). The observed variations in gametic incompatibility may be a consequence of differences in gamete- gamete recognition molecules.
Secondly, hybrid corals were generally as fit as or more fit than parental purebred species (chapters
2, 3). At the embryonic stage, hybrid embryos developed normally and at similar rates as purebred embryos (chapter 3). At the larval stage, survival and settlement of hybrid larvae under 10 days exposure to ambient and elevated temperatures were mostly similar to that of purebreds, but higher than purebreds in a small number of cases (chapter 2). Hybrid recruits also had similar algal endosymbiont uptake rates and photochemical efficiency as that of purebred recruits (chapter 3).
Under seven months exposure to ambient and elevated temperature and pCO2 conditions, however, some hybrids showed higher survival and grew larger than parental purebred species under both conditions (chapter 3). Overall, maternal effects were observed in hybrids of the A. tenuis x A. loripes cross (i.e., hybrids had similar fitness to the maternal parent species), and over-dominance in hybrids of the A. sarmentosa x A. florida cross (i.e., hybrids had higher fitness than both parental species), with some variations between traits and treatment conditions. While fitness of these hybrids in the field and their reproductive potential are yet to be investigated, these findings provide proof-of concept that interspecific hybridization may enhance coral resilience and this approach may therefore increase the success of coral reef restoration programs.
Thirdly, the observed holobiont fitness differences between offspring groups were likely due to host-related factors (chapter 5), but not the microbial communities associated with these corals
iv
(chapter 4). No differences in the bacterial and microalgal endosymbiont community composition were found between hybrid and purebred corals (chapter 4). Microbial communities of these seven months old recruits were highly diverse and lacked host specificity. Winnowing of the communities occurred over time, resulting in less diverse microbial communities that differed between the two species pair crosses by two years of age. Transcriptome-wide gene expression analysis for the A. tenuis x A. loripes cross showed clear maternal patterns (chapter 5), consistent with the observed fitness results. Hybrids had similar gene expression patterns to their material parents, and only up to 10 differentially expressed genes were observed between them. In contrast, hundreds of genes were found differentially expressed between purebred A. tenuis and A. loripes, as well as between hybrids that had different maternal parents. Due to insufficient material available for the A. sarmentosa x A. florida cross at the end of the seven months aquarium experiment, transcriptome analysis was not conducted for this cross.
Findings from this thesis support the notion that interspecific hybridization may improve coral resilience and facilitate adaptation to climate change. Further, as genetic diversity within species is predicted to decline as a consequence of high mortality disturbances such as mass bleaching events, interspecific hybridization can be used to restore losses in genetic diversity. If future studies can demonstrate high fitness of hybrid corals in the field and in advanced generations, hybrid corals may serve as a stock for reef managers for reseeding degraded reefs and/or enhancing resilience of healthy reefs.
v
Preface
Two out of the six chapters of this thesis (chapters 1, 4) have been submitted to peer-review journals and are under review. Chapter 2 and Chapter 3 have been published in a peer-review journal. Details of contribution for each manuscript are outlined below.
Chapter 1
Chan WY, Hoffmann AA, van Oppen MJH. (2018). Hybridization as a conservation management tool in the Anthropocene. (Revision submitted to Conservation Letters).
All authors contributed to conceptual development and the final edited version of the manuscript.
WYC and MvO wrote the manuscript, and WYC and AH designed the decision tree. WYC contributed to about 70% of this work.
Chapter 2
Chan WY, Peplow LW, van Oppen MJH. (2019). Interspecific gamete compatibility and hybrid larval fitness in reef-building corals: Implications for coral reef restoration. Scientific Reports 9,
4757. doi:10.1038/s41598-019-41190-5.
WYC and MvO designed the experiment. WYC and LP conducted the experiment and collected the data. WYC undertook data analyses. WYC and MvO wrote the manuscript. Approximately
70% of the work was completed by WYC.
vi
Chapter 3
Chan WY, Peplow LM, Menéndez P, Hoffmann AA, van Oppen MJH. (2018). Interspecific hybridization may provide novel opportunities for coral reef restoration. Frontiers in Marine
Science 5. doi:10.3389/fmars.2018.00160.
WYC, MvO, LP, AH designed the experiment. MvO developed the concept for this study. WYC and LP conducted the experiment and collected the data. PM, WYC and AH undertook statistical analyses. WYC and MvO wrote the manuscript and all authors contributed to the final edited version of the manuscript. WYC contributed to about 65% of the work.
Chapter 4
Chan WY, Peplow LM, Menéndez P, Hoffmann AA, van Oppen MJH. (2018). The roles of age, parentage and environment on bacterial and algal endosymbiont communities in Acropora corals.
(Submitted to Molecular Ecology).
WYC, MvO, LP, and AH designed the experiment. WYC and LP performed the experiment. LP carried out the laboratory work. PM, WYC and AH undertook statistical analyses. WYC and MvO wrote much of the manuscript and all authors contributed to the final edited version of the manuscript. Approximately 65% of this work was performed by WYC.
vii
Other relevant publications during candidature
Carr H, et. al., Chan WY. (2019). The Aichi Biodiversity Targets: Achievements for marine conservation and priorities beyond 2020. (Submitted to PeerJ).
Chan WY, and Eggins SM. (2017). Calcification responses to diurnal variation in seawater carbonate chemistry by the coral Acropora formosa. Coral Reefs 36, 763–772. doi:10.1007/s00338-017-1567-8.
van Oppen MJH, et al., Chan WY. (2017). Shifting paradigms in restoration of the world’s coral reefs. Global Change Biology 23, 3437–3448. doi:10.1111/gcb.13647.
Froehlich MB, Chan WY, Tims SG, Fallon SJ, and Fifield LK. (2016). Time-resolved record of
236U and 239,240Pu isotopes from a coral growing during the nuclear testing program at Enewetak
Atoll (Marshall Islands). J Environ Radioact 165, 197–205. doi:10.1016/j.jenvrad.2016.09.015.
viii
Acknowledgment
I would like to express my heartfelt gratitude to my supervisors, Madeleine van Oppen and Ary
Hoffmann, for their guidance and support during my candidature. Madeleine, thank you for being a forthcoming support for everything I did during my PhD, from conducting experiments to writing publications, applying for grants and awards, and participating in the Homeward Bound leadership journey in Antarctica- these would not have been achieved without you. Ary, it was a privilege to be part of your team. Thank you for sharing with me your vast knowledge in the fields of evolution and genetics, and showing me how to do ‘good science’.
I am very grateful to my two collaborators, Lesa Peplow and Patricia Menéndez. Lesa was a vital member of all the experiments and leader of the laboratory works. Patricia was the driver behind many of the statistical analyses and I have learned enormously from her. I would also like to thank
Jessica Chung for bioinformatic support, and members of the Australian Institute of Marine
Science (AIMS) who have supported me and given me advices, specially Britta Schaffelke, Carlos
Alvarez-Roa, Patrick Laffy, Kate Quigley, Carly Kenkel, Andrew Negri and Mikaela Nordborg.
Thanks are also extended to members of the National Sea Simulator of AIMS for coral collection and technical support. I also thank members of the van Oppen team and Gates team for their generous support, especially Leon Hartman, Katarina Damjanovic, Patrick Buerger, Beth Lenz,
Jen Davidson and Kira Hughes.
I thank Pater Harrison, Dexter dela Cruz and members of the Bolinao Marine Laboratory for their support during filed work in the Philippines, my Master student Isabel Nuñez Lendo and intern
ix
Ilse Huizingh for their contributions. I also appreciate critical feedback provided by my advisory committee Andrew Week and committee chair Ed Newbigin.
I am grateful for the scholarships and funding that I received during my candidature, including: the Melbourne International Research Scholarship, Melbourne International Fee Remission
Scholarship, International Coral Reef Society Graduate Fellowship, University of Melbourne
Student Engagement Grant, International Student of the Year Scholarship from the Victorian government, financial support from AIMS and the University of Melbourne for my participation in the Homeward Bound leadership program. I also thank the Paul G. Allen Philanthropies and
AIMS for funding this research.
Lastly, I would like to thank my family for their patience, support and love during my candidature and beyond.
x
Content Declaration ...... ii Abstract ...... iii Preface...... vi Acknowledgement ...... ix Content ...... xi List of tables ...... xvi List of figures ...... xvii
Chapter 1- Hybridization as a conservation management tool in the Anthropocene 1.1 Abstract ...... 1 1.2 Avoiding extinction through genetic adaptation ...... 1 1.3 Improving conservation and restoration success via hybridization ...... 3 1.4 Risks and perceived risks of hybridization as a biodiversity conservation tool ...... 7 1.5 Legal framework that impedes the use of hybridization in conservation...... 9 1.6 Box 1: Case study - legal policy and the hybrid coral Acropora prolifera ...... 10 1.7 Moving forward in conservation strategies and legal policies ...... 12 1.8 Assessing the suitability of hybridization as conservation tool: a decision tree ...... 13 1.9 Directions for future research efforts and concluding remarks ...... 15 References ...... 17 Acknowledgement ...... 24
Chapter 2- Interspecific gamete compatibility and hybrid larval fitness in reef-building corals: Implications for coral reef restoration
2.1 Abstract ...... 25 2.2 Introduction ...... 26 2.3 Materials and methods ...... 29 2.3.1 Parental colony collection and in vitro fertilization ...... 29 2.3.2 Temperature stress experiment ...... 31 2.3.3 Larval survival and settlement ...... 34
xi
2.3.4 Statistical analysis ...... 34 2.3.5 Seawater chemistry ...... 35 2.4 Results ...... 36 2.4.1 Spawning date and time ...... 36 2.4.2 Fertilization rates ...... 38 2.4.3 Larval survival ...... 39 2.4.4 Larval settlement ...... 42 2.4.5 Seawater chemistry ...... 45 2.5 Discussion ...... 46 Data availability ...... 56 References ...... 56 Acknowledgement ...... 63
Chapter 3- Interspecific hybridization may provide novel opportunities for coral reef restoration
3.1 Abstract ...... 64 3.2 Introduction ...... 65 3.3 Materials and methods ...... 70 3.3.1 Coral spawning, in vitro fertilization, and experimental design ...... 70 3.3.2 Fertilization rates and embryonic development ...... 73 3.3.3 Larval settlement and Symbiodinium uptake ...... 74 3.3.4 Survival and recruit size ...... 75 3.3.5 Photochemical efficiency ...... 76 3.3.6 Seawater chemistry ...... 76 3.3.7 Statistical analysis ...... 77 3.3.7.1 Survival ...... 77 3.3.7.2 Size ...... 78 3.3.7.3 Symbiodinium uptake and photochemical efficiency ...... 79 3.4 Results ...... 79 3.4.1 Spawning time, fertilization rates and embryonic development ...... 79
xii
3.4.2 Survival ...... 81 3.4.2.1 Offspring groups ...... 81 3.4.2.2 Treatments ...... 85 3.4.3 Recruit size ...... 86 3.4.3.1 28 weeks ...... 86 3.4.3.2 One year...... 87 3.4.4 Symbiodinium uptake and photochemical efficiency ...... 90 3.4.5 Summary table ...... 90 3.5 Discussion ...... 92 3.5.1 Limited prezygotic barriers to interspecific hybridization in Acropora corals ...... 92 3.5.2 Positive effects of hybridization were observed in some F1 hybrids ...... 93 3.5.3 Hybrid fitness and its relevance to coral reef restoration ...... 95 3.5.4 Knowledge gaps and future studies ...... 97 References ...... 99 Acknowledgement ...... 107
Chapter 4- The roles of age, parentage and environment on bacterial and algal endosymbiont communities in Acropora corals
4.1 Abstract ...... 108 4.2 Introduction ...... 109 4.3 Materials and methods ...... 111 4.3.1 Experimental design and sampling ...... 111 4.3.2 DNA extraction, PCR amplification and library preparation ...... 113 4.3.3 Sequence data processing ...... 115 4.3.4 Statistical analyses ...... 115 4.4 Results ...... 117 4.4.1 Coral life stages differed in their microbial communities ...... 117 4.4.2 Microbial communities were similar between hybrid and purebred Acropora corals ...... 125 4.4.3 Elevated temperature and pCO2 conditions affected microbial communities ...... 127
xiii
4.5 Discussion ...... 128 4.5.1 Winnowing of microbial communities ...... 128 4.5.2 Distinct microbiome succession patterns between species pair crosses ...... 130 4.5.3 Parental species within a cross shared similar bacterial communities ...... 132 4.5.4 Hybridization did not affect microbe association ...... 132 4.5.5 Environmental condition was a primary driver of microbial communities in early life stage corals ...... 133 4.5.6 Summary and implications for future studies ...... 134 Data availability ...... 135 References ...... 136 Acknowledgement ...... 145
Chapter 5- Maternal and long-term treatment effects on transcriptome-wide gene expression in hybrid and purebred Acropora corals
5.1 Abstract ...... 145 5.2 Introduction ...... 146 5.3 Materials and methods ...... 149 5.3.1 Experimental design and sample collection ...... 149 5.3.2 RNA extraction ...... 150 5.3.3 Sequence data processing ...... 151 5.3.4 Statistical analyses ...... 152 5.4 Results ...... 153 5.5 Discussion ...... 156 5.5.1 Gene expression patterns in hybrids follow that of their maternal parent species ...... 156 5.5.2 Gene expression was unaffected by long-term exposure to elevated temperature and pCO2 conditions ...... 158 5.6 Preparation for publication ...... 161 References ...... 162 Acknowledgement ...... 166
xiv
Chapter 6- General discussion
6.1 Cross fertility in coral genera other than Acropora ...... 167 6.2 Reproductive potential of F1 hybrids and fitness of advanced generation hybrids and backcrosses ...... 168 6.3 Field performance of hybrid and purebred corals ...... 169 6.4 Mechanisms underpinning phenotypic performance ...... 170 6.5 Concluding remarks ...... 171 References ...... 172
Supplementary information Chapter 2 supplementary information ...... 174 Chapter 3 supplementary information ...... 182 Chapter 4 supplementary information ...... 190
xv
List of tables Table 1.1 Summary of hybridization studies with a focus on population conservation ...... 5
Table 2.1. Summary of hybrid survival and settlement success relative to parental purebred species ...... 42 Table 2.2. Experimental conditions of the three temperature treatments measured at 12:00 daily prior to the water change ...... 45 Table 2.3. Summary of the effects of elevated temperatures on coral larvae and recruits as reported in the literature and the present study ...... 51
Table 3.1. Experimental conditions of the ambient and elevated treatment ...... 77 Table 3.2. Spawning date and time of the Acropora spp. from Trunk Reef, central GBR ...... 80 Table 3.3. Mean survival, SE, as well as lower and upper 95% CI of offspring groups under ambient and elevated conditions ...... 83 Table 3.4. Tukey’s pairwise comparisons of survival between the offspring groups following generalized linear mixed models ...... 84 Table 3.5. Tukey’s pairwise comparisons of treatment effect within an offspring group following generalized linear mixed models ...... 86 Table 3.6. Results of t-tests comparing size at the one-year time point for remaining offspring groups ...... 90 Table 3.7. Summary of the traits measured in the two offspring groups ...... 91
Table 4.1. Summary of testing results (represented via p-values) from permutational multivariate analysis of variance (PERMANOVA) ...... 119
xvi
List of figures Figure 1.1. A three years old interspecific hybrid coral of A. tenuis and A. loripes reared in the laboratory ...... 7 Figure 1.2. Proposed decision tree for the use of hybridization as a conservation management option ...... 14
Figure 2.1. Illustrations showing the experimental setup ...... 33 Figure 2.2. Spawning date and time of the seven Acropora spp. from Trunk Reef, central GBR ...... 37 Figure 2.3. Fertilization rates for the four species pairs ...... 39 Figure 2.4. Larval survival of the offspring groups from the A. tenuis x A. loripes cross, the A. florida x A. nobilis cross, and the A. hyacinthus x A. cytherea cross ...... 47
Figure 3.1. Possible relative fitness of reciprocal F1 hybrids (F1ab and F1ba) based on fitness of the parental species (Pa and Pb) and the driving mechanism ...... 68 Figure 3.2. Experimental set up showing the two interspecific crosses ...... 72 Figure 3.3. Fertilization rates of the offspring groups from the Acropora tenuis x Acropora loripes cross, and the Acropora sarmentosa x Acropora florida cross ...... 80 Figure 3.4. Survival of the offspring groups of under ambient and elevated conditions across 28 weeks ...... 82 Figure 3.5. Boxplots showing the size of the Acropora offspring groups at 28 weeks since treatment began ...... 87 Figure 3.6. Boxplots showing the size of the Acropora offspring groups at one year of age ....89
Figure 4.1. Compositional plots showing the averaged relative abundances of the bacterial taxa at the family level of parental and offspring groups at different life stages ...... 121 Figure 4.2. Alpha-diversity of the bacterial communties for offspring groups at different life stages ...... 122 Figure 4.3. The top 10 taxa at family level that were significantly different in relative abundance between the three life stages ...... 122 Figure 4.4. Compositional plots showing the averaged relative abundances of different Symbiodiniaceae sequence types for parent and offspring groups at different life stages ...... 124 Figure 4.5. nMDS plots of the bacterial communities in hybrid vs. purebred recruits at seven months of age ...... 126
xvii
Figure 4.6. nMDS plots of the Symbiodiniaceae communities in hybrid vs. purebred recruits at seven months of age ...... 126 Figure 4.7. nMDS plots based on an analysis of Bray-Curtis dissimilarity matrices of the Symbiodiniaceae communities of seven months old recruits ...... 128
Figure 5.1. Principal component analyses of the offspring groups under ambient and elevated conditions using the normalized counts of the 9,295 genes retained post filtering...... 154 Figure 5.2. The number of up/down regulated genes between the offspring group pairs under ambient conditions, and Venn diagram showing the number of differentially expressed genes between the pairs of offspring groups under ambient conditions...... 155 Figure 5.3. Mean difference plot showing the log-fold change versus average log-expression) of all 6,592 genes in the four pairwise comparisons under ambient conditions...... 156
xviii
Chapter 1
Hybridization as a conservation management tool in the Anthropocene
1.1 Abstract
The recent extensive loss of biodiversity raises the question of whether organisms will adapt in time to survive the current era of rapid environmental change (the Anthropocene), and whether today’s conservation practices and policies are appropriate. We review the benefits and risks of inter- and intraspecific hybridization as a conservation management tool aimed at enhancing adaptive potential and survival. We conclude that hybridization is an underutilized conservation tool and that many of its perceived risks are overstated; the few applications of hybridization in conservation to date have already shown positive outcomes. Further, we suggest that the uncertain legal status of hybrids as entities of protection can be costly to society and ecosystems, and that a legislative revision of hybrids and hybridization is overdue. This review makes particular reference to coral reefs and presents a decision tree to help assess when and where hybridization can be a suitable conservation tool.
1.2 Avoiding extinction through genetic adaptation
Genetic adaptation is one way by which a population or species may avoid extinction caused by rapid environmental change (1–3). Whether a species will adapt in time to escape extinction depends on factors, such as the rate of environmental change, the amount of adaptive genetic variation present, and generation time (1, 2, 4). Globally, temperature has increased and continues to increase at a rate not previously experience by life on Earth for at least 50 (if not hundreds of) million years (5, 6). Although the 2015 Paris Agreement set the goal to limit warming to less than 1
1.5°C compared to pre-industrial temperatures by 2100, this goal is likely unachievable based on current trajectories with global temperatures expected to increase by 2-4.9°C (7). The negative impacts of warming are evident from many examples across the marine and terrestrial environments (8–11), and perhaps among the most significantly affected ecosystems are coral reefs. In the last 30 years, half of the world’s corals have been lost (12) due to anthropogenic stresses including ocean warming. Some level of rapid adaptation and/or acclimatization is possible as demonstrated by a number of cases of increased bleaching tolerance in corals following mass bleaching events (13–16). However, the enormous bleaching-related mortality of corals in recent years suggests that the rate of adaptation and/or acclimatization is unlikely sufficient to keep up with the pace of climate change (17). In addition, climate models predict that the majority of the world’s coral reefs will experience annual temperature extremes before the end of the century
(18). Timely adaptation to avoid extinction may require new genetic variation sourced from elsewhere via human-assisted interventions (1, 3, 17, 19, 20).
Increasingly, management options targeted at enhancing genetic variation and adaptive potential of a species or population are being discussed both within the context of revegetation and coral reef restoration (1–3, 17, 21–24). This represents a shift from a traditional focus on restoring local genetic materials to consideration of using non-local genetic variation (21). Many ecosystems have already been drastically altered by climate change and other anthropogenic disturbances, resulting in not just a mismatch between locally adapted traits and altered environmental conditions (3, 21), but also an increase in population fragmentation that reduces genetic diversity and adaptive potential (2, 25). Without gene flow from other populations to improve genetic variation and adaptive potential, some populations will unlikely adapt in time to survive. Furthermore, restoring 2
the genetic make-up of the original population may not achieve long-term conservation targets if populations lack the genes or gene combinations necessary to survive the altered or future conditions. For example, American chestnut (Castanea dentata) has been decimated by blight (an introduced fungal disease) because it lacks the genes for blight disease resistance (26). Restoring the original American chestnut population will therefore unlikely result in chestnut forests that persist long-term. The large drop in the population size of American chestnut has caused changes in community composition, insect and wildlife dynamics, as well as soil chemical processes in the local forests (26). Successful restoration of habitat-forming species like canopy trees and corals is critical, particularly as there is a high probability that flow-on effects to other components of biodiversity will occur.
1.3 Improving conservation and restoration success via hybridization
Hybridization is one possible way to enhance adaptive potential of a population (1, 3, 17, 20, 21,
24, 27–29). Hybridization is the successful mating between individuals from two genetically different lineages, and it can be either interspecific (i.e., between different species) or intraspecific
(i.e., between divergent populations of the same species). It increases heterozygosity and creates new gene combinations, potentially reducing extinction risk by increasing adaptive potential and the masking of deleterious alleles. It may lead to new adaptive traits allowing species to invade new niches and expand their distribution ranges (1, 3, 4, 20, 27, 29, 30). The term ‘hybrid vigour’ refers to conditions where hybrid offspring displays higher fitness (i.e., improved function/hardiness in biological qualities) relative to its parents (31, 32). Genetic rescue or evolutionary rescue can be achieved when a population is successfully restored via hybridization
(Table 1.1). Genetic rescue is the increase in population fitness and size following the introduction 3
of new alleles by hybridization (27, 28). It is applicable to small and isolated populations that typically have low genetic diversity and often suffer from inbreeding depression (27, 28).
Evolutionary rescue is an increase in adaptive genetic variation (rather than just an increase in genetic diversity) that allows populations to survive otherwise extinction-inducing environmental stress (27, 28, 33). In some studies, the term evolutionary rescue strictly applies to adaptation to a changing environment from standing genetic variation (3, 34). We use the broader definition, where evolutionary rescue can involve genetic variation already present within a population, arising from de novo mutations, or being introduced through immigration and hybridization (27,
28). Hybridization can bring evolutionary rescue when a shift toward the optimal phenotype occurs via selection on the newly introduced or recombinant later generation hybrid genotypes (27, 28).
The value of hybridization in conservation and restoration has been demonstrated in several cases
(Table 1.1). For example, the introduction of a few males from a genetically divergent population to the remnant population of Mount Buller pygmy possum increased its fitness and saved the population from extinction (35). The persistence and ecosystem function of American chestnut may also be successfully restored following hybridization with the Chinese chestnut that harbours genetically encoded resistance to the fungal pathogen causing blight (26). Other successful examples include hybridization of the Scandinavian wolf, South Island robin, Norfolk Island boobook owl, Florida panther, and Mexican wolf (Table 1.1).
4
Table 1.1 Summary of hybridization studies with a focus on population conservation. Studies are selected if their research aim was to examine the usefulness of hybridisation in restoration or conservation of a population, and either fitness traits or population size following hybridization was reported. Organism Latin name Size of Size and/or species Type of Study F* Traits reported Reference receiving of introducing hybridization environment and effect† population population Staghorn A. tenuis 5 colonies 5 colonies each Interspecific Laboratory F1 Survival+, size+, (24), coral (pair 1), and for each for A. loripes (pair (ambient and algal endosymbiont Figure 1.1 A. sarmentosa species 1), and A. florida elevated uptake‡, (pair 2) (pair 2) temperature and photochemical pCO2 conditions) efficiency‡ Mountain Burramys ~55 5 males in 2011, Intraspecific Nature F1 Survival+, body size+, (75) pygmy parvus individuals 6 males in 2014 reproduction+, possum longevity+, population size+ Trinidadian Poecilia < 100 75 females, Intraspecific Nature F2, Survival+, (70) guppies reticulata individuals 75 males backcross recruitment+, population size+ Scandina- Canis lupus < 10 2 males Intraspecific Nature F1 Reproduction+, (77) vian wolf individuals population size+ Torrey pine Pinus 16 island 10 mainland trees Intraspecific Laboratory F1 Height+, fecundity+ (4) torreyana trees (common garden) Parry American Castanea No. Unknown no. of Interspecific Laboratory F3, Blight resistance+, (26) chestnut dentata unknown Chinese chestnut (common garden) backcross height- (C. mollissima) South Petroica 5 31 females Intraspecific Nature F1 Survival+, (76) Island robin australis individuals recruitment+, sperm quality+, immunocompetence+ 5
Norfolk Ninox 1 individual 2 male of N. n. Interspecific Nature F2 Population size+, (53) Island novaesee- novaeseelandiae other traits not boobook landiae measured owl undulata Florida Puma concolor 22 8 females pumas Interspecific Nature F2 Survival+, (78) panther coryi individuals (P. c. stanleyana) population size+ Mexican Canis lupus No. Crossing inbred Intraspecific Nature F1 Reproduction+, (79) wolf baileyi unknown lineages, no. survival+ unknown * F refers to the most advanced generation examined in the study (e.g., F1 = first generation) † + = positive effect; ‡ = no effect; - = negative effect
6
Figure 1.1. A three years old interspecific hybrid coral of A. tenuis and A. loripes reared in the laboratory.
1.4 Risks and perceived risks of hybridization as a biodiversity conservation tool
Perceptions about risks associated with genetic and evolutionary rescue via hybridization have hindered its application. These concerns include 1) the possibility of outbreeding depression, and 2) the loss of parental species via genetic swamping. Outbreeding depression is the reduction in fitness of hybrid offspring crossed from two genetically divergent populations or species (36). This may occur when hybridization breaks up co-adapted gene complexes or brings together allele combinations with negative effects by segregation and recombination (3,
25, 37, 38). For example, hybridization between Calylophus serrulatus (a short-lived perennial plant) from two different environments reduced body size and fecundity in F1 hybrids (39).
Similarly, although hybridization between marine copepod populations increased fitness in first generation (F1) hybrids, later generation hybrids had relatively lower fitness due to the breakdown of co-adapted gene complexes (36). However, the risk of outbreeding depression has likely been overstated (2, 40) and empirical evidence of inbreeding depression is vastly greater than that of outbreeding depression (25). Simulations also show that outbreeding
7
depression is likely temporary and overcome by natural selection (41). The effects of outbreeding depression versus hybrid vigour are environmentally dependent, where the occurrence of hybrid vigour tends to increase under challenging conditions (25). Meta-analysis demonstrated that hybridizing an inbred population with another population increased composite fitness (i.e., fecundity and survival) by 148% under stressful environments compared to 45% under benign environments (40). The advantage of hybridization is thus likely more common in damaged or degraded environments, which are becoming increasingly prominent under climate change.
The loss of parental species identity and genetic uniqueness due to genetic swamping through hybridization is another concern that has been repeatedly raised (42–44). For instance, a change in species distribution ranges has led to hybridization of the obligately estuarine Black bream
(Acanthopagrus butcheri) with the migratory marine Yellowfin bream (A. australis), and subsequently only 5% of the populations remained purebred A. australis (43). However, the risk of genetic swamping can be perceived very differently if one adopts a gene-centric instead of species-centric view (3, 45, 46). Under a gene-centric view, hybrids can be considered as repositories of their parental genomes, particularly at loci essential to adaptation (46). A gene- centric view can also reveal conservation opportunities that would have otherwise gone unnoticed under a species-centric view. For example, when a population or species is at risk of extinction, hybridization can preserve part of the parental genome that would otherwise be lost by species extinction. This has been demonstrated in cases such as the mountain pygmy possum and Florida panther (Table 1.1). The conservation of genetic uniqueness should not be prioritized at the cost of (adaptive) genetic diversity (2, 47). For instance, conservation efforts based on the protection of genetic uniqueness have deliberately isolated Galaxiella pusilla
8
(freshwater fish) populations and this has likely resulted in a decrease in their genetic diversity and adaptive potential (47).
1.5 Legal framework that impedes the use of hybridization in conservation
Other than the perceived biological risks, the uncertain legal status of hybrids have also impeded their use in conservation. Other than a few exceptional cases, interspecific hybrids are not protected under the Endangered Species Act (ESA) in the US and there are no official policies or guidelines for the conservation of hybrids (48). These exceptional cases include the
Florida panther, where interspecific hybrids of Puma concolor coryi and P. c. stanleyana are protected under ESA alongside with purebreds (49, 50), and a few plant species that arise as a result of hybridization (51). In 1996, an Intercross Policy was proposed to the ESA, outlining possible criteria when a hybrid population or species should receive legal status for protection
(42, 48). Over 20 years later, however, the policy remains neither accepted nor rejected by the
US Fish and Wildlife Service and the National Marine Fishers Services, and the legal status of hybrids is assessed on a case-by-case basis upon application (48).
Similarly, the legal status of interspecific hybrids is also unclear under the Environment
Protection and Biodiversity Conservation (EPBC) Act in Australia. For example, the Norfolk
Island boobook owl population was reduced to a single female in 1986 and two males of New
Zealand boobook owl were introduced to rescue the population. Subsequent breeding of the second and third generation hybrids has established a population of 45 individuals (52). In
2010, the Norfolk Island Region Threatened Species Recovery Plan stated that due to the hybrid nature of this population, they are excluded from a recovery plan under the EPBC Act
(52), but the legal status of this population has never been clarified (53). At an international level, the International Union for Conservation of Nature’s (IUCN) Red List of Threatened 9
Species also exclude consideration of interspecific hybrids for listing, with the exception of apomictic (i.e., asexually reproducing hybrid plants (51). Ignoring hybrids in conservation represents a mismatch between policy, science and real-world conservation needs (54), and a major revision of conservation legislation is overdue.
A revision of conservation legislation should include several considerations. Firstly, the species-based conservation approach in current legislation is difficult to apply as species are not fixed entities and are always evolving. With the advent of genomic technologies, traces of genetic admixture have been found in many ‘purebred’ populations, making many species currently being protected under the ESA no longer compliant to its rigid interpretations (48,
50). For instance, new evidence suggests that red wolves (Canis rufus) that are currently protected under ESA are likely hybrids of gray wolves (C. lupus) and coyotes (C. latrans) (48,
55). Secondly, incidents of hybridization have increased and will continue to increase in nature as climate change shifts species distributions and brings together previously isolated species and populations (8, 46, 56–59). Thirdly, the lack of recognition of hybrids can be a loss of opportunity to protect entities that can maintain vital ecosystem functions. For instance, the hybrid coral Acropora prolifera continues to provide ecosystem functions to Caribbean reefs while its parental lineages, A. palmata and A. cervicornis, suffer significant declines (Box 1).
Given the rate of climate change, environmental degradation and species loss, rejection of hybrid species and populations can thus be costly to society and ecosystems generally.
1.6 Box 1: Case study - legal policy and the hybrid coral Acropora prolifera
Approximately 80% of the corals on Caribbean reefs have been lost since late 1970s (60), representing a significant decline in ecosystem function and human welfare. In 2004, the
National Marine Fisheries Service in the US received a petition from the Center of Biological 10
Diversity to list the only three extant Caribbean Acropora corals, A. palmata, A. cervicornis and A. prolifera (i.e., a natural hybrid of A. palmata and A. cervicornis) as either threatened or endangered under the Endangered Species Act (ESA) (61). The Biological Review Team was subsequently assembled to review the status of these corals and to provide recommendations.
While A. palmata and A. cervicornis have been listed as threatened, the team concluded that the hybrid coral A. prolifera could not meet the species criteria under the ESA definitions and legal status was subsequently not granted (61, 62). Under the ESA, “the term species includes any subspecies of fish or wildlife or plants, and any distinct population segment of any species of vertebrate fish or wildlife which interbreeds when mature.” (i.e., biological species concept)
(61). Although there is evidence that A. prolifera can backcross with A. cervicornis (63, 64), there is currently no evidence that it can produce second generation hybrids.
However, there is a variety of species concepts that exist other than the biological species concept. A growing body of molecular data has resulted in better taxonomic resolution, and consequently a slightly more flexible attitude toward species was adopted by the National
Marine Fisheries Service, as demonstrated in its 2014 reply to a petition to list 83 reef-building corals under the ESA. In this case, the Biological Review Team distinguished between a ‘good species’, which is a species that shows signatures of interbreeding and/or backcrossing in its evolutionary history, versus a ‘hybrid species’, which is a species that is composed entirely of hybrid individuals (62). Under this new definition, a ‘good species’, even having a history of hybridization, still fulfills the definition of a species and can be protected under the ESA.
Nonetheless, A. prolifera was classified as a ‘hybrid species’ where legal protection status cannot be granted. Ironically, the Biological Review Team also commented that A. palmata and A. cervicornis “exhibit branching morphologies that provide important habitat for other reef organisms; no other Caribbean reef-building coral species are able to fulfill these 11
ecosystem functions”, and the rate of coral loss suggests “it is highly likely that these ecosystem functions have been greatly compromised” (61). Contrary to the decline of A. palmata and A. cervicornis, the hybrid, A. prolifera, shows a recent increase in abundance in multiple
Caribbean reef locations (65–67), and laboratory as well as field studies demonstrate that A. prolifera is equally fit as or fitter than its parental species (65). A. prolifera continues to provide habitat and ecosystem functions to the Caribbean reefs and supports communities of other coral reef organisms that may have otherwise been lost as its parental species diminished.
1.7 Moving forward in conservation strategies and legal policies
Enhancing adaptive potential of a population via hybridization is currently an under-utilized management choice due to its perceived risks (68–70) and limitations in its existing legal framework (48). As explained above, the perceived risks are overstated and applications of hybridization in conservation have resulted in several positive outcomes. We suggest that conservation policies move away from the rigid view of species and focus instead on evolutionary processes that are important to adaptive potential, and on the conservation of ecosystem function. We propose a number of recommendations that may assist such a transition:
1. Adopt a dynamic view on ‘species’, recognizing ‘species’ are continuously evolving
lineages and not as fixed entities.
2. Adopt a gene-centric instead of a species-centric view in conservation management
practices and legal policies (3, 45, 46), and include the consideration of evolutionary
processes that are essential for maximizing adaptive potential (1, 2, 71, 72). In this context,
hybrid populations (e.g., the coral A. prolifera) that are reservoirs of their parents’ genetic
material should receive legal protection status. 12
3. Prepare to move beyond preserving or restoring local genetic diversity when traditional
management has failed to maintain the population or ecosystem functions, or failure is
imminent. This includes 1) populations that are small, isolated and suffering from
inbreeding depression, 2) populations that lack the gene(s) vital for survival, and 3)
populations that are unlikely to adapt in time to keep up with climate change (see decision
tree, Figure 1.2).
4. Assess the risk of alternative management options (e.g., hybridization) against the risk of
extinction and ecosystem system function loss if these alternative options are not
considered (22, 73, 74). Consider what is the likely trajectory of the population at risk if
only traditional conservation efforts continue.
1.8 Assessing the suitability of hybridization as conservation tool: a decision tree
A decision tree is presented here as a practical guide for conservation managers regarding the use of hybridization (Figure 1.2).
13
Figure 1.2. Proposed decision tree for the use of hybridization as a conservation management option. The blue boxes represent questions and grey boxes represents actions. Italic text shows available tools to assist decision making.
14
1.9 Directions for future research efforts and concluding remarks
When a population is unlikely to adapt in time to survive climate change within this century, results of laboratory and field studies on hybrid fitness become an important piece of information in terms of deciding whether or not to implement hybridization (see decision tree, Figure 1.2). Since it is not possible to provide experimental data for every species, results of a subset of species or population may provide proof-of-concept for groups that share similar biological and ecological characteristics. Research to inform decision making should involve multi-generation testing of hybrids in the laboratory and in the wild (4). Our review shows that long-term studies are rare for hybridization research related to conservation, and most data have been obtained for the F1 and
F2 generations (Table 1.1). To decide if hybridization will likely enhance conservation success, a minimum of two generations should be tested so that the reproductive potential of hybrids, as well as the potential effect of segregation and recombination (e.g., the possibility of outbreeding depression) can be evaluated (4, 25). Furthermore, successful restoration of a population at risk is not only measured from an enhancement of individual traits, but also by a significant rebound in population size (27, 28). An increase in hybrid fitness in one or several traits in the laboratory may not reflect results in nature, therefore field studies are essential (70). When decisions are made and hybridization is implemented, ongoing monitoring should be in place to quantify the fitness advantages associated with hybridization and genetic change (see decision tree, Figure 1.2) (75).
In the case where populations are small and isolated, genetic drift and inbreeding can again decrease genetic diversity over time, and multiple or periodical hybridization may be required (76).
Advancements in genomic technologies and climate science call for a review of our current attitude and approach to and legal policies for conservation. We are now in a position to make more
15 informed decisions based on better understanding of species delineations and predictions of future climate change. Adopting a gene-centric view and a less rigid position on ‘species’, as well as recognizing the importance of evolutionary processes and adaptative potential on population survival, will facilitate timely and practical measures to address conservation needs within the
Anthropocene.
16
References
1. A. A. Hoffmann, C. M. Sgrò, Climate change and evolutionary adaptation. Nature. 470, 479–485 (2011).
2. A. Hoffmann, P. Griffin, S. Dillon, R. Catullo, R. Rane, M. Byrne, R. Jordan, J. Oakeshott, A. Weeks, L. Joseph, P. Lockhart, J. Borevitz, C. Sgrò, A framework for incorporating evolutionary genomics into biodiversity conservation and management. Climate Change Responses. 2, 1 (2015).
3. J. A. Hamilton, J. M. Miller, Adaptive introgression as a resource for management and genetic conservation in a changing climate. Conservation Biology. 30, 33–41 (2016).
4. J. A. Hamilton, R. Royauté, J. W. Wright, P. Hodgskiss, F. T. Ledig, Genetic conservation and management of the California endemic, Torrey pine (Pinus torreyana Parry): Implications of genetic rescue in a genetically depauperate species. Ecology and Evolution. 7, 7370–7381 (2017).
5. B. Hönisch, A. Ridgwell, D. N. Schmidt, E. Thomas, S. J. Gibbs, A. Sluijs, R. Zeebe, L. Kump, R. C. Martindale, S. E. Greene, W. Kiessling, J. Ries, J. C. Zachos, D. L. Royer, S. Barker, T. M. Marchitto, R. Moyer, C. Pelejero, P. Ziveri, G. L. Foster, B. Williams, The Geological Record of Ocean Acidification. Science. 335, 1058–1063 (2012).
6. O. Gaffney, W. Steffen, The Anthropocene equation. The Anthropocene Review. 4, 53–61 (2017).
7. A. E. Raftery, A. Zimmer, D. M. W. Frierson, R. Startz, P. Liu, Less than 2 °C warming by 2100 unlikely. Nature Climate Change. 7, 637 (2017).
8. G. T. Pecl, M. B. Araújo, J. D. Bell, J. Blanchard, T. C. Bonebrake, I.-C. Chen, T. D. Clark, R. K. Colwell, F. Danielsen, B. Evengård, L. Falconi, S. Ferrier, S. Frusher, R. A. Garcia, R. B. Griffis, A. J. Hobday, C. Janion-Scheepers, M. A. Jarzyna, S. Jennings, J. Lenoir, H. I. Linnetved, V. Y. Martin, P. C. McCormack, J. McDonald, N. J. Mitchell, T. Mustonen, J. M. Pandolfi, N. Pettorelli, E. Popova, S. A. Robinson, B. R. Scheffers, J. D. Shaw, C. J. B. Sorte, J. M. Strugnell, J. M. Sunday, M.-N. Tuanmu, A. Vergés, C. Villanueva, T. Wernberg, E. Wapstra, S. E. Williams, Biodiversity redistribution under climate change: Impacts on ecosystems and human well-being. Science. 355, eaai9214 (2017).
9. R. M. Chefaoui, C. M. Duarte, E. A. Serrão, Dramatic loss of seagrass habitat under projected climate change in the Mediterranean Sea. Global Change Biology. 24, 4919–4928 (2018).
10. T. P. Hughes, K. D. Anderson, S. R. Connolly, S. F. Heron, J. T. Kerry, J. M. Lough, A. H. Baird, J. K. Baum, M. L. Berumen, T. C. Bridge, D. C. Claar, C. M. Eakin, J. P. Gilmour, N. A. J. Graham, H. Harrison, J.-P. A. Hobbs, A. S. Hoey, M. Hoogenboom, R. J. Lowe, M. T.
17
McCulloch, J. M. Pandolfi, M. Pratchett, V. Schoepf, G. Torda, S. K. Wilson, Spatial and temporal patterns of mass bleaching of corals in the Anthropocene. Science. 359, 80 (2018).
11. T. Klein, R. Cahanovitc, M. Sprintsin, N. Herr, G. Schiller, A nation-wide analysis of tree mortality under climate change: Forest loss and its causes in Israel 1948–2017. Forest Ecology and Management. 432, 840–849 (2019).
12. The Ocean Agency, 50 Reefs. The Ocean Agency (2018), (available at https://theocean.agency/50-reefs/).
13. R. Berkelmans, Bleaching and mortality thresholds: How much is too much? SpringerLink, Berlin, Heidelberg, 103–119 (2009).
14. J. R. Guest, A. H. Baird, J. A. Maynard, E. Muttaqin, A. J. Edwards, S. J. Campbell, K. Yewdall, Y. A. Affendi, L. M. Chou, Contrasting patterns of coral bleaching susceptibility in 2010 suggest an adaptive response to thermal stress. PLOS ONE. 7, e33353 (2012).
15. J. A. Maynard, K. R. N. Anthony, P. A. Marshall, I. Masiri, Major bleaching events can lead to increased thermal tolerance in corals. Mar Biol. 155, 173–182 (2008).
16. L. Penin, J. Vidal-Dupiol, M. Adjeroud, Response of coral assemblages to thermal stress: are bleaching intensity and spatial patterns consistent between events? Environ Monit Assess. 185, 5031–5042 (2013).
17. M. J. H. van Oppen, R. D. Gates, L. L. Blackall, N. Cantin, L. J. Chakravarti, W. Y. Chan, C. Cormick, A. Crean, K. Damjanovic, H. Epstein, P. L. Harrison, T. A. Jones, M. Miller, R. J. Pears, L. M. Peplow, D. A. Raftos, B. Schaffelke, K. Stewart, G. Torda, D. Wachenfeld, A. R. Weeks, H. M. Putnam, Shifting paradigms in restoration of the world’s coral reefs. Global Change Biology. 23, 3437–3448 (2017).
18. R. van Hooidonk, J. Maynard, J. Tamelander, J. Gove, G. Ahmadia, L. Raymundo, G. Williams, S. F. Heron, S. Planes, Local-scale projections of coral reef futures and implications of the Paris Agreement. Scientific Reports. 6, srep39666 (2016).
19. A. Kremer, O. Ronce, J. J. Robledo‐Arnuncio, F. Guillaume, G. Bohrer, R. Nathan, J. R. Bridle, R. Gomulkiewicz, E. K. Klein, K. Ritland, A. Kuparinen, S. Gerber, S. Schueler, Long- distance gene flow and adaptation of forest trees to rapid climate change. Ecology Letters. 15, 378– 392 (2012).
20. M. J. H. van Oppen, J. K. Oliver, H. M. Putnam, R. D. Gates, Building coral reef resilience through assisted evolution. PNAS. 112, 2307–2313 (2015).
21. T. A. Jones, T. A. Monaco, A role for assisted evolution in designing native plant materials for domesticated landscapes. Frontiers in Ecology and the Environment. 7, 541–547 (2009).
18
22. P. Vitt, K. Havens, A. T. Kramer, D. Sollenberger, E. Yates, Assisted migration of plants: Changes in latitudes, changes in attitudes. Biological Conservation. 143, 18–27 (2010).
23. M. F. Breed, M. G. Stead, K. M. Ottewell, M. G. Gardner, A. J. Lowe, Which provenance and where? Seed sourcing strategies for revegetation in a changing environment. Conserv Genet. 14, 1–10 (2013).
24. W. Y. Chan, L. M. Peplow, P. Menéndez, A. A. Hoffmann, M. J. H. Van Oppen, Interspecific Hybridization May Provide Novel Opportunities for Coral Reef Restoration. Front. Mar. Sci. 5 (2018), doi:10.3389/fmars.2018.00160.
25. S. Edmands, Between a rock and a hard place: evaluating the relative risks of inbreeding and outbreeding for conservation and management. Molecular Ecology. 16, 463–475 (2007).
26. S. L. Clark, S. E. Schlarbaum, A. M. Saxton, F. V. Hebard, Establishment of American chestnuts (Castanea dentata) bred for blight (Cryphonectria parasitica) resistance: influence of breeding and nursery grading. New Forests. 47, 243–270 (2016).
27. S. M. Carlson, C. J. Cunningham, P. A. H. Westley, Evolutionary rescue in a changing world. Trends in Ecology & Evolution. 29, 521–530 (2014).
28. A. R. Whiteley, S. W. Fitzpatrick, W. C. Funk, D. A. Tallmon, Genetic rescue to the rescue. Trends in Ecology & Evolution. 30, 42–49 (2015).
29. J. I. Meier, D. A. Marques, S. Mwaiko, C. E. Wagner, L. Excoffier, O. Seehausen, Ancient hybridization fuels rapid cichlid fish adaptive radiations. Nature Communications. 8, 14363 (2017).
30. M. Becker, N. Gruenheit, M. Steel, C. Voelckel, O. Deusch, P. B. Heenan, P. A. McLenachan, O. Kardailsky, J. W. Leigh, P. J. Lockhart, Hybridization may facilitate in situ survival of endemic species through periods of climate change. Nature Clim. Change. 3, 1039– 1043 (2013).
31. Z. B. Lippman, D. Zamir, Heterosis: revisiting the magic. Trends in Genetics. 23, 60–66 (2007).
32. Z. J. Chen, Genomic and epigenetic insights into the molecular bases of heterosis. Nat Rev Genet. 14, 471–482 (2013).
33. H. A. Orr, R. L. Unckless, The Population Genetics of Evolutionary Rescue. PLOS Genetics. 10, e1004551 (2014).
34. R. A. Hufbauer, M. Szűcs, E. Kasyon, C. Youngberg, M. J. Koontz, C. Richards, T. Tuff, B. A. Melbourne, Three types of rescue can avert extinction in a changing environment. PNAS. 112, 10557–10562 (2015).
19
35. A. Weeks, D. Moro, R. Thavornkanlapachai, H. R Taylor, N. E White, E. Weiser, D. Heinze, in Advances in Reintroduction Biology of Australian and New Zealand Fauna (CSIRO Publishing, Clayton South, Australia, 2015), pp. 127–140.
36. S. Edmands, Heterosis and Outbreeding Depression in Interpopulation Crosses Spanning a Wide Range of Divergence. Evolution. 53, 1757–1768 (1999).
37. H. A. Orr, Dobzhansky, Bateson, and the Genetics of Speciation. Genetics. 144, 1331– 1335 (1996).
38. M. Turelli, N. H. Barton, J. A. Coyne, Theory and speciation. Trends in Ecology & Evolution. 16, 330–343 (2001).
39. D. A. Heiser, R. G. Shaw, The Fitness Effects of Outcrossing in Calylophus Serrulatus , a Permanent Translocation Heterozygote. Evolution. 60, 64–76 (2006).
40. R. Frankham, Genetic rescue of small inbred populations: meta-analysis reveals large and consistent benefits of gene flow. Molecular Ecology. 24, 2610–2618 (2015).
41. S. N. Aitken, M. C. Whitlock, Assisted gene flow to facilitate local adaptation to climate change. Annual Review of Ecology, Evolution, and Systematics. 44, 367–388 (2013).
42. F. W. Allendorf, R. F. Leary, P. Spruell, J. K. Wenburg, The problems with hybrids: setting conservation guidelines. Trends in Ecology & Evolution. 16, 613–622 (2001).
43. D. G. Roberts, C. A. Gray, R. J. West, D. J. Ayre, Marine genetic swamping: hybrids replace an obligately estuarine fish. Molecular Ecology. 19, 508–520 (2010).
44. C. C. Muhlfeld, R. P. Kovach, L. A. Jones, R. Al-Chokhachy, M. C. Boyer, R. F. Leary, W. H. Lowe, G. Luikart, F. W. Allendorf, Invasive hybridization in a threatened species is accelerated by climate change. Nature Clim. Change. 4, 620–624 (2014).
45. R. J. Petit, Biological invasions at the gene level. Diversity and Distributions. 10, 159–165 (2004).
46. E. Crispo, J.-S. Moore, J. A. Lee‐Yaw, S. M. Gray, B. C. Haller, Broken barriers: Human- induced changes to gene flow and introgression in animals. BioEssays. 33, 508–518 (2011).
47. R. A. Coleman, A. R. Weeks, A. A. Hoffmann, Balancing genetic uniqueness and genetic variation in determining conservation and translocation strategies: a comprehensive case study of threatened dwarf galaxias, Galaxiella pusilla (Mack) (Pisces: Galaxiidae). Molecular Ecology. 22, 1820–1835 (2013).
48. R. K. Wayne, H. B. Shaffer, Hybridization and endangered species protection in the molecular era. Molecular Ecology. 25, 2680–2689 (2016).
20
49. J. F. Lind‐Riehl, A. L. Mayer, A. M. Wellstead, O. Gailing, Hybridization, agency discretion, and implementation of the U.S. Endangered Species Act. Conservation Biology. 30, 1288–1296 (2016).
50. A. Erwin, Hybridizing Law: A Policy for Hybridization Under the Endangered Species Act. Arizona Legal Studies Discussion Paper. No. 17-04 (2017) (available at https://papers.ssrn.com/abstract=2930418).
51. B. M. vonHoldt, K. E. Brzeski, D. S. Wilcove, L. Y. Rutledge, Redefining the Role of Admixture and Genomics in Species Conservation. Conservation Letters. 11, e12371 (2018).
52. Director of National Parks, “Norfolk Island Region Threatened Species Recovery Plan” (Department of the Environment, Water, Heritage and the Arts, Canberra., 2010).
53. S. T. Garnett, P. Olsen, S. H. M. Butchart, A. A. Hoffmann, Did hybridization save the Norfolk Island boobook owl Ninox novaeseelandiae undulata? Oryx. 45, 500–504 (2011).
54. Z. T. Richards, J.-P. A. Hobbs, Hybridisation on coral reefs and the conservation of evolutionary novelty. Curr Zool. 61, 132–145 (2015).
55. R. S. Waples, R. Kays, R. J. Fredrickson, K. Pacifici, L. S. Mills, Is the Red Wolf a Listable Unit Under the US Endangered Species Act? J Hered. 109, 585–597 (2018).
56. C. J. Garroway, J. Bowman, T. J. Cascaden, G. L. Holloway, C. G. Mahan, J. R. Malcolm, M. A. Steele, G. Turner, P. J. Wilson, Climate change induced hybridization in flying squirrels. Global Change Biology. 16, 113–121 (2010).
57. C. Moritz, R. Agudo, The Future of Species Under Climate Change: Resilience or Decline? Science. 341, 504 (2013).
58. S. U. Pauls, C. Nowak, M. Bálint, M. Pfenninger, The impact of global climate change on genetic diversity within populations and species. Molecular Ecology. 22, 925–946 (2013).
59. A. J. Chunco, Hybridization in a warmer world. Ecology and Evolution. 4, 2019–2031 (2014).
60. T. A. Gardner, I. M. Côté, J. A. Gill, A. Grant, A. R. Watkinson, Long-Term Region-Wide Declines in Caribbean Corals. Science. 301, 958–960 (2003).
61. Biological Review Team, Atlantic Acropora Status Review Document. Report to National Marine Fisheries Service, Southeast Regional Office (2005).
62. National Marine Fisheries Service, Endangered and Threatened Wildlife and Plants: Final Listing Determinations on Proposal To List 66 Reef-Building Coral Species and To Reclassify Elkhorn and Staghorn Corals (2014), (available at
21 https://www.federalregister.gov/documents/2014/09/10/2014-20814/endangered-and-threatened- wildlife-and-plants-final-listing-determinations-on-proposal-to-list-66).
63. S. V. Vollmer, S. R. Palumbi, Hybridization and the Evolution of Reef Coral Diversity. Science. 296, 2023–2025 (2002).
64. S. V. Vollmer, S. R. Palumbi, Restricted gene flow in the caribbean staghorn coral Acropora cervicornis: implications for the recovery of endangered reefs. J Hered. 98, 40–50 (2007).
65. N. D. Fogarty, Caribbean acroporid coral hybrids are viable across life history stages. Mar Ecol Prog Ser. 446, 145–159 (2012).
66. A. Japaud, C. Fauvelot, C. Bouchon, Unexpected high densities of the hybrid coral Acropora prolifera (Lamarck 1816) in Guadeloupe Island, Lesser Antilles. Coral Reefs. 33, 593– 593 (2014).
67. A. Aguilar-Perera, R. C. Hernández-Landa, Occurrence of large thickets of Acropora prolifera (Scleractinia: Acroporidae) in the southern Gulf of Mexico. Mar Biodiv (2017), doi:10.1007/s12526-017-0685-4.
68. K. M. Hufford, S. J. Mazer, Plant ecotypes: genetic differentiation in the age of ecological restoration. Trends in Ecology & Evolution. 18, 147–155 (2003).
69. R. Frankham, J. D. Ballou, M. D. B. Eldridge, R. C. Lacy, K. Ralls, M. R. Dudash, C. B. Fenster, Predicting the Probability of Outbreeding Depression. Conservation Biology. 25, 465– 475 (2011).
70. S. W. Fitzpatrick, J. C. Gerberich, L. M. Angeloni, L. L. Bailey, E. D. Broder, J. Torres‐ Dowdall, C. A. Handelsman, A. López‐Sepulcre, D. N. Reznick, C. K. Ghalambor, W. C. Funk, Gene flow from an adaptively divergent source causes rescue through genetic and demographic factors in two wild populations of Trinidadian guppies. Evolutionary Applications. 9, 879–891 (2016).
71. A. R. Weeks, C. M. Sgro, A. G. Young, R. Frankham, N. J. Mitchell, K. A. Miller, M. Byrne, D. J. Coates, M. D. B. Eldridge, P. Sunnucks, M. F. Breed, E. A. James, A. A. Hoffmann, Assessing the benefits and risks of translocations in changing environments: a genetic perspective. Evolutionary Applications. 4, 709–725 (2011).
72. C. Eizaguirre, M. Baltazar‐Soares, Evolutionary conservation—evaluating the adaptive potential of species. Evolutionary Applications. 7, 963–967 (2014).
73. J. S. McLachlan, J. J. Hellmann, M. W. Schwartz, A Framework for Debate of Assisted Migration in an Era of Climate Change. Conservation Biology. 21, 297–302 (2007).
22
74. O. Hoegh-Guldberg, L. Hughes, S. McIntyre, D. B. Lindenmayer, C. Parmesan, H. P. Possingham, C. D. Thomas, Assisted Colonization and Rapid Climate Change. Science. 321, 345– 346 (2008).
75. A. R. Weeks, D. Heinze, L. Perrin, J. Stoklosa, A. A. Hoffmann, A. Rooyen, T. Kelly, I. Mansergh, Genetic rescue increases fitness and aids rapid recovery of an endangered marsupial population. Nature Communications. 8, 1071 (2017).
76. S. Heber, A. Varsani, S. Kuhn, A. Girg, B. Kempenaers, J. Briskie, The genetic rescue of two bottlenecked South Island robin populations using translocations of inbred donors. Proc Biol Sci. 280 (2013), doi:10.1098/rspb.2012.2228.
77. M. Åkesson, O. Liberg, H. Sand, P. Wabakken, S. Bensch, Ø. Flagstad, Genetic rescue in a severely inbred wolf population. Molecular Ecology. 25, 4745–4756 (2016).
78. W. E. Johnson, D. P. Onorato, M. E. Roelke, E. D. Land, M. Cunningham, R. C. Belden, R. McBride, D. Jansen, M. Lotz, D. Shindle, J. Howard, D. E. Wildt, L. M. Penfold, J. A. Hostetler, M. K. Oli, S. J. O’Brien, Genetic restoration of the Florida Panther. Science. 329, 1641–1645 (2010).
79. R. J. Fredrickson, P. Siminski, M. Woolf, P. W. Hedrick, Genetic rescue and inbreeding depression in Mexican wolves. Proc Biol Sci. 274, 2365–2371 (2007).
23
Acknowledgement
I thank B. Schaffelke for critical feedback on the manuscript and L. Peplow for photographic assistance. This research was supported by the Paul G. Allen Philanthropies.
24
Chapter 2
Interspecific gamete compatibility and hybrid larval fitness in reef-building corals:
Implications for coral reef restoration
2.1 Abstract
Climate warming is a major cause of the global decline of coral reefs. Active reef restoration, although still in its infancy, is one of several possible ways to help restore coral cover and reef ecosystem function. The deployment of mature coral larvae onto depauperate reef substratum has been shown to significantly increase larval recruitment, providing a novel option for the delivery of ex situ bred coral stock to the reef for restoration purposes. The success of such reef restoration approaches may be improved by the use of coral larval stock augmented for climate resilience.
Here we explore whether coral climate resilience can be enhanced via interspecific hybridization through hybrid vigour. Firstly, we assessed cross-fertility of four pairs of Acropora species from the Great Barrier Reef. Temporal isolation in gamete release between the Acropora species was limited, but gametic incompatibility was present with varying strength between species pairs and depending on the direction of the hybrid crosses. We subsequently examined the fitness of hybrid and purebred larvae under heat stress by comparing their survival and settlement success throughout 10 days of exposure to 28ºC, 29.5ºC and 31ºC. Fitness of the majority of Acropora hybrid larvae was similar to that of the purebred larvae of both parental species, and in some instances it was higher than that of the purebred larvae of one of the parental species. Lower hybrid fertilization success did not affect larval fitness. These findings indicate that high hybrid fitness can be achieved after overcoming partial prezygotic barriers, and that interspecific hybridization may be a tool to enhance coral recruitment and climate resilience.
25
2.2 Introduction
Elevated seawater temperatures, especially when above an organism’s thermal optimum, have well-documented adverse effects on marine organisms. Since 1985, coral reefs worldwide have been warming at a rate distinctly higher than the ocean average, at approximately 0.2ºC per decade1. Many corals live near their upper thermal tolerance limit2, and ocean warming is therefore detrimental to them. As for coral larvae, elevated seawater temperature is known to negatively affect their development, survival and settlement3–5, and larval thermal tolerance can cause a bottleneck to reef recruitment3,6–8. For coral recruits and adults, elevated seawater temperature can cause coral bleaching, where the symbiotic relationship between the coral host and its dinoflagellate endosymbionts (Symbiodinium spp.) is disrupted, often resulting in coral mortality9. In the last three decades, higher-than-usual seawater temperatures caused by global warming have resulted in multiple mass beaching events on coral reefs worldwide, including in
1998, 2010 and 2014-20171,10. On the Great Barrier Reef (GBR), 30% coral mortality was recorded after the 2016 mass bleaching event, and a further 20% mortality was recorded following the 2017 mass bleaching event11. Recent estimates suggest more than 50% of the world’s coral reefs have been lost since the 1980s, and areas such as the Caribbean, Kiritimati, and certain parts of Japan have lost more than 80% of their coral10,12. This loss of corals directly threatens the extraordinary diversity of marine life dependent on reefs, as well as the goods and services reefs provide and that support millions of people 13,14.
Active restoration is one possible way to restore coral cover, ecosystem function and socio- economical values of degraded coral reefs. Although current restoration attempts have not yet succeeded at a scale that can reverse global coral loss, several promising advances have been
26 made15–20. For example, dela Cruz and Harrison20 have shown that the deployment of mature
Acropora larvae into large scale mesh enclosures attached to the reef substratum can re-establish a breeding population of Acropora tenuis in three years’ time. Both larval recruitment rates and the number of surviving Acropora colonies two years after larval deployment were significantly higher at the reseeded sites compared to the control sites20. The process of coral recruitment involves the supply of larvae, the survival and settlement of these larvae, as well as post-settlement survival of the recruits 8,21.The success of interventions, such as those by Heyward et al.15 and dela
Cruz and Harrison20, may be further improved through the use of climate resilient coral stock.
Climate resilient coral stock can potentially be produced via hybrid vigour generated from interspecific hybridization22,23. The benefits of hybridization have been documented extensively in commercial crops for traits of economic interest, such as yield, and disease and drought tolerance24,25. Hybridization creates new gene combinations and increases genetic diversity, which enhances the adaptive potential of species and their prospects of survival under environmental changes22,26–30, facilitates their expansion into new environments27,31–33 and breaks genetic correlations that constrain the evolvability of parental species34. For example, hybridization has led to variation in beak morphology necessary to survive environmental change in Darwin’s finches35, altered chemical defense systems in brassicaceae plants and assisted their survival through the Last Glacial Maximum27, and facilitated large scale adaptive radiation in haplochromine cichlid fishes34. Fitness of the first generation (F1) hybrid relative to its parental species depends on whether the gene effect is dominant (i.e., hybrid fitness is equivalent to the dominant parent, who can either be the more fit or less fit parent), additive (i.e., hybrid fitness is higher than one parent but lower than the other), over-dominant (i.e., hybrid fitness is higher than
27 that of both parents), and under-dominant (i.e., hybrid fitness is lower than that of both parents)25,36,37. The scenarios where hybrids are more fit than both parents, or at least more fit than one parent are relevant for coral reef restoration.
Although the use of hybridization in conservation is limited, existing examples have demonstrated that it can rescue small, inbred populations from extinction (i.e., genetic rescue)28,38. These examples include the highly threatened species of Florida panther39, the Norfolk Island boobook owl40 and the Mt. Buller mountain pygmy-possum41. Similarly, naturally occurring hybrids of
Chaetodon butterflyfishes have been found to have similar fitness as their parental species42.
Several examples have demonstrated that interspecific hybrid corals likely represent useful stock for use in reef restoration23,31,32. Acropora prolifera, for example, the natural interspecific hybrid of A. cervicornis and A. palmata in the Caribbean, has been shown to have equivalent or higher fitness in multiple life history stages and phenotypic traits compared to the parental purebred species43. Similar observations were found in experimentally produced hybrids between Acropora species. Chan et al.44 showed that certain hybrid offspring survived better and grew faster compared to purebred offspring under ambient and elevated temperature and pCO2 conditions.
Willis et al.31 reported that hybrid offspring grew faster than purebred offspring in the reef-flat environment. These examples suggest that hybrid colonies of Acropora are often more resilient than purebred colonies and may represent a superior stock for reseeding of damaged reefs.
The aim of this study was to investigate whether the high hybrid fitness of Acropora recruits and juvenile colonies is also observed in the larval stages. To achieve this aim, we examined four experimentally crossed pairs of Acropora spp. from the GBR using seven parental species, and
28 asked whether hybrid Acropora larvae have enhanced survival and settlement success compared to purebred larvae under ambient and elevated temperatures. As a secondary aim, we examined the extent of temporal reproductive isolation and gametic incompatibility in the four interspecific crosses of Acropora species.
2.3 Materials and methods
2.3.1 Parental colony collection and in vitro fertilization
Parental colonies (5-11 for each species: Acropora tenuis, Acropora loripes, Acropora florida,
Acropora nobilis, Acropora hyacinthus, Acropora cytherea and Acropora sarmentosa) were collected from Trunk Reef (18°35′S, 146°80′E), central GBR. Colonies were collected prior to the full moon on 14th Nov and held in flow-through aquaria of the National Sea Simulator (SeaSim) at the Australian Institute of Marine Science (AIMS) in Townsville, Australia. When signs of imminent spawning were observed (i.e., ‘setting’, where the egg-sperm bundles of a colony are pushed to the mouth of its polyps), colonies were isolated in individual aquaria to avoid unintentional mixing of gametes prior to experimental crossing. Egg-sperm bundles from the four or five most profusely spawning colonies of a species were collected and separated using a 100
µm filter. Eggs were washed three times with filtered seawater to remove any residual sperm and placed in an individual 3 L plastic bowl until the egg-sperm separation step was completed for all targeted colonies (within 3 h). A previous coral hybridization study using the same setup have achieved > 95% fertilization when the egg-sperm separation step for all species was completed within 3h44, suggesting that this time window has little effect on fertilization success. Furthermore, inter- and intra- specific fertilization was conducted at the same time therefore at least one of the gametes in those crosses were spawned at the same time.
29
Similar quantities of sperm (i.e., 107 sperm mL-1) were pooled from colonies of the same species to create a mixed sperm solution. Sperm concentration was estimated using a colour chart calibrated based on sperm count in a hemocytometer. For making the hybrid offspring, 300 mL of the pooled interspecific sperm solution was added to the eggs of each colony of the receiving species to achieve a final volume of 3 L and a sperm concentration of 106 sperm mL-1. There were four to five replicates for each direction of the hybrid crosses, and each replicate was a different colony (i.e., different egg donors). Fertilization was conducted separately for each colony (i.e., the mixed sperm solution was added to each egg donor separately) to avoid unintended fertilization by sperm from other conspecific colonies that was not washed away (if any). Note that self- fertilization is generally uncommon in Acropora corals. For making the purebred offspring, eggs of the conspecific colonies were pooled and 1.1 L of the pooled conspecific sperm solution was added to achieve a final volume of 11 L and a sperm concentration of 106 sperm mL-1. There were two replicates of each purebred cross. We considered two replicates sufficient as each replicate received the same mixed eggs and sperm solution and the containers themselves were unlikely to have an effect on fertilization success. Fertilization was conducted under ambient conditions and fertilization rates were assessed at 2.5 h after introduction of the sperm.
Four species pair crosses were carried out:1) the A. tenuis x A. loripes cross, 2) the A. florida x A. nobilis cross, 3) the A. hyacinthus x A cytherea cross, and 4) the A. tenuis x A. sarmentosa cross.
Four offspring groups were produced from each cross (i.e., two hybrid offspring groups and two purebred offspring groups, Figure 2.1a). The four species pairs were selected to represent two phylogenetically divergent crosses (i.e., A. tenuis x A. loripes and A. tenuis x A. sarmentosa), and
30 two phylogenetically closely related crosses (i.e., A. florida x A. nobilis and A. hyacinthus x A cytherea). The phylogeny of Acropora spp. consists of two distinct groups: the ‘early spawners’ and the ‘late spawners’, where the latter group spawns approximately 1.5- 3 h later than the ‘early spawners’45–47. A. tenuis (early spawner) is phylogenetically divergent from loripes (late spawner) and A. sarmentosa (late spawner), while A. florida and A. nobilis, as well as A. hyacinthus and A cytherea are all late spawners and are closely related to their targeted breeding partner45–47. For the fertilization rate assessment, three samples of approximately 100 eggs of each offspring group taken at 2.5 h since the introduction of sperm were placed into 12-well plates and imaged using a high-resolution camera (Nikon D810). The numbers of fertilized/unfertilized embryos were visually counted. Three samples of approximately 100 eggs were also collected to set up self- fertilization and “no-sperm” controls for each cross conducted. For the self-fertilization control, eggs of each donor colony were mixed with its sperm from the same colony to achieve a final concentration of 106 sperm mL-1 and assessed for fertilization after 3h.
Little information is available from the literature about the relative resilience or thermal tolerance of these four parental species, but this has limited relevance for this study as our purpose was to increase genetic diversity (and thus adaptive potential) via hybridization, and not to conduct targeted breeding with species of known relative bleaching tolerance.
2.3.2 Temperature stress experiment
Coral larvae were reared under ambient conditions for five days until they reached the planula stage. They remained aposymbiotic (i.e., without Symbiodinium) throughout the experiment. The
A. tenuis x A. sarmentosa interspecific cross was unsuccessful (i.e., no fertilization occurred), and
31 thus this species pair was excluded from the experiment. For the remaining three crosses, three offspring groups (i.e., one hybrid group and two purebred groups) of each cross were used for the heat stress experiment (Figure 2.1a). Hybrids in one direction of each cross were excluded due to their low fertilization success (and thus low larval yields). Using a glass pipette, planula larvae of each offspring group were carefully transferred into 6-well plates and reared under 28 ºC (i.e., mean annual temperature at Davies Reef over the period 1991-2016, proximal to Trunk Reef), 29.5
ºC (i.e., mean summer maximum at Davies Reef) and 31 ºC (i.e., elevated temperature) (Figure
2.1b). Temperatures followed the diurnal variation of 0.6 ºC that typically occurs on Davies Reef and were ramped to the targeted temperatures at a rate of 0.5 ºC per day. A total of 360 larvae of each of the nine offspring groups were loaded into 36 wells (i.e., 10 larvae per well) and randomly distributed among the 12 experimental tanks (Figures 2.1b and 2.1c). In other words, each treatment had 120 larvae per offspring group that were distributed among 12 wells and among its four replicate tanks (Figures 2.1b and 2.1c). The experimental tanks served as a water bath to maintain seawater temperatures inside the 6-well plates, and were also a seawater source for daily water change of the wells. Each treatment had four replicate tanks and five 6-well plates were placed in each tank (Figure 2.1c). Positions of the tanks were randomized in the experimental room and positions of the 6-well plates were randomized within a tank (Figure 2.1c).
After the larvae were transferred to the wells, the plates were covered with a lid to avoid evaporation, and floated in the treatment tanks to maintain their temperatures. Each day, 80% of the seawater of a well was exchanged using a transfer pipette. Dead or decomposing larvae that were observed during the water change were removed to maintain quality of the seawater inside
32 the wells. Light was provided at 120 µE m-2 s-1 using Aquaillumination Hydra following the natural summer light/dark cycle.
Figure 2.1. Illustrations showing the experimental setup. a) The three successful Acropora spp. crosses (i.e., the A. tenuis (T) x A. loripes (L) cross, 2) the A. florida (F) x A. nobilis (N) cross, 3) the A. hyacinthus (H) x A. cytherea (C) cross, and the three resultant offspring groups of each cross used in the experiment, b) a set of 6-well plates in each experimental tank with 3 x 10 larvae from
33 each offspring group, and c) the three temperature treatments (i.e., 28, 29.5, and 31 ºC) with four replicate tanks each. The abbreviation of the offspring groups throughout this paper is that the first letter represents the origin of the eggs and the second letter the origin of sperm (e.g., TL is a hybrid crossing A. tenuis eggs with A. loripes sperm).
2.3.3 Larval survival and settlement
Survival and settlement of the larvae were used as proxies for fitness. Larval survival was assessed under a dissecting microscope at day seven after treatment commenced. After the survival assessment, a crustose coralline algae (CCA, Titanoderma prototypum) chip was introduced into each well to induce larval settlement. These CCA were collected from the same reef as the parental coral colonies and maintained in flow-through aquaria at the SeaSim. On the day of larval settlement, the CCA were cut into similarly sized chips (i.e., approximately 4 mm2) using a bone cutter. Larval settlement rates were assessed under a dissecting microscope two days after the
CCA chips were introduced. A larva was counted as ‘settled’ when it was 1) attached to a substrate
(i.e., either on the surface of the well or the CCA chip) and 2) was fully metamorphosed.
2.3.4 Statistical analysis
Statistical analyses were conducted separately for the A. tenuis x A. loripes cross, the A. florida x
A. nobilis cross, and the A. hyacinthus x A cytherea cross using the raw data (n = 12 wells per offspring group per treatment). The response (i.e., larval survival or settlement) was treated as a binomial variable (i.e., survived/dead, settled/not settled) in the analyses. Generalized linear mixed models (GLMM)48 for binomial data with logistic link functions were used to test the effects of treatment and offspring group on larval survival and settlement. A random tank effect was
34 incorporated into the models to account for possible tank effects. Models assumptions were checked visually, and models were assessed for overdispersion using a Chi-square test and goodness of fit using Akaike Information Criteria, and all of which were satisfactory. Tukey's pairwise comparisons were then used to test for differences between treatment and offspring group and p-values of the pairwise comparisons were corrected using the Benjamini-Hochberg method.
An overall comparison of hybrids vs. purebreds was also conducted using a GLMM. Statistical analyses were completed using R49 with packages lme4 and multcomp. For illustration purpose, mean values are shown in the figures with the error bars representing 95% CI calculated using the angular transformed data that were back-transformed into percentages.
2.3.5 Seawater chemistry
Automated controls of seawater temperatures were provided by SeaSim via the SCADA
(Supervisory Control and Data Acquisition) system. Seawater temperature of each tank was monitored hourly using resistance temperature detector (RTD). To confirm the treatment conditions inside the 6-well plates (i.e., where the larvae were located), seawater that was removed from the wells during water change was collected for measurement of O2 level, salinity, temperature and pH every day at 12:00 using the HACH HQ40D Portable Multi Meter. Salinity measurements were calibrated with IAPSO Standard Seawater. Seawater from several wells of the same tank was combined for measurement due to depth requirement of the measurement probes.
Total alkalinity (AT) was measured twice during the 10-day experiment using VINDTA calibrated to Dickson’s Certified Reference Material. Ωarag (aragonite saturation state) and DIC (dissolved inorganic carbon) were calculated using the measured values of seawater AT, pH, temperature and salinity, with the program CO2SYS50 as implemented in Microsoft Excel by Pierrot et al.51.
35
2.4 Results
2.4.1 Spawning date and time
There were differences in the spawning date and time of the seven Acropora spp. from the central
GBR that were used in this study (Figure 1, Supplementary Table S1). A. tenuis, A. loripes and A. sarmentosa spawned on the earlier days after full moon (i.e., 3-8 days) and also spawned earlier in time (i.e., 19:10-21:40), whereas A. florida, A. hyacinthus, A. nobilis and A. cytherea spawned on the later days after full moon (i.e., 8-11 days) and also later in the evening (i.e., 21:35-22:15).
As previously reported in the literature23, A. tenuis spawned at a distinctly earlier time (i.e., ~19:30) compared to the other species (i.e., ~20:30-22:15). Colonies of A. loripes, A. florida, A. hyacinthus,
A. nobilis and A. cytherea all spawned within a narrow 45-minute window. Most species spawned for several consecutive days and overlapped with other species, except for A. nobilis where all colonies spawned on the 9th day after the full moon. Most species spawned within 0.5-1.5 h since setting was observed, with the exception of A. loripes, which spawned between 2 and 2.5 h since setting was observed.
36
Figure 2.2. Spawning date and time of the seven Acropora spp. from Trunk Reef, central GBR, as observed in the SeaSim at AIMS.
Brackets indicate the number of colonies spawned over the total number of colonies of that species, and colours indicate the species pairs of hybridization.
37
2.4.2 Fertilization rates
Fertilization rates, measured 2.5 h after the mixing of sperm and eggs, were high for purebreds
(i.e., 75-100%), and low to moderate for hybrids (i.e., 0-68%) (Figure 2.3). Interspecific hybridization was successful in three out of the four Acropora crosses, namely 1) the A. tenuis x
A. loripes cross (Figure 2.3a), 2) the A. florida x A. nobilis cross (Figure 2.3b), and 3) the A. hyacinthus x A cytherea cross (Figure 2.3c). For these successful crosses, hybrid fertilization was only observed in one direction (i.e., eggs from parent 1 were cross-fertile with sperm from parent
2, but the reciprocal cross was unsuccessful). These included TL (65-68%), FN (9-12% and HC
24-31%) (Figure 2.3). Hybrid crosses in the other direction (i.e., LT, NF and CH) showed no fertilization (i.e., 0-0.3%). For the A. tenuis x A. sarmentosa cross, hybrid crosses failed in both directions (Figure 2.3d) and this cross was thus excluded from the temperature stress experiment.
38
Figure 2.3. Fertilization rates for the four species pairs. a) the A. tenuis (T) x A. loripes (L) cross, b) the A. florida (F) x A. nobilis (N) cross, c) the A. hyacinthus (H) x A. cytherea (C) cross, and d) the A. tenuis (T) x A. sarmentosa cross (S). The first letter in the designation of the offspring groups represents its maternal parent species and the second letter its paternal parent species. Values are mean and error bars represent 95% CI calculated using the angular transformed data back- transformed into percentages.
2.4.3 Larval survival
Survival of hybrid larvae, measured at day seven since treatment commenced, was equivalent to or higher than that of at least one parental purebred species in most cases. Out of the nine species and temperature combinations, hybrid survival was equivalent to both parents in three cases, the
39 same as the more fit parent in four cases, higher than both parents in one case and same as the less fit parent in one case (Figure 2.4, Table 2.1). There was no instance where hybrid survival was lower than both parents (Figure 2.4, Table 2.1). Offspring group (i.e., the specific hybrid or purebred offspring resulting from a cross, see caption of Figure 2.4) had a substantial effect on larval survival, but treatment had very limited effects. For the A. tenuis x A. loripes cross (Figure
2.4, Supplementary Table S2.2), neither offspring group nor treatment affected larval survival. For the A. florida x A. nobilis cross (Figure 2.4, Supplementary Table S2.3), purebred FF had higher survival than NN and hybrid FN at 28ºC (p = 0.030 for both). At 29.5 ºC and 31 ºC, however, survival of both the hybrid FN and purebred offspring FF was higher than that of NN (29.5 ºC: p
= 0.002, < 0.001 respectively; 31 ºC: p < 0.001 for both). For FF and NN, survival within an offspring group was not different between treatments. However, survival of hybrid FN under 29.5
ºC was higher than under 28ºC (p = 0.01). For the A. hyacinthus x A cytherea cross (Figure 2.4,
Supplementary Table S2.4), survival of hybrid HC and purebred HH was higher than that of purebred CC at all three temperatures (p < 0.001 for all pairs). At 28ºC, hybrid HC also had higher survival than purebred HH (p = 0.028). For HH and CC, survival within an offspring group was unaffected by treatment. However, survival of hybrid HC at 28ºC and 29.5 ºC was higher than at
31 ºC (p = 0.028, 0.047 respectively). The results of an overall comparison of hybrid vs. purebred larval survival are shown in Supplementary Table S2.8.
40
Figure 2.4. Larval survival of the offspring groups from the A. tenuis (T) x A. loripes (L) cross, the A. florida (F) x A. nobilis (N) cross, and the A. hyacinthus (H) x A. cytherea (C) cross at a) 28
ºC, b) 29.5 ºC and c) 31 ºC. The first letter in the designation of the offspring groups represents its maternal parent species and the second letter its paternal parent species. Values are mean and error bars represent 95% CI calculated using the angular transformed data back-transformed into percentages. * indicates significantly higher survival (i.e. p < 0.05) of this offspring group compared to the offspring group(s) indicated, or the same offspring group under the temperature treatment indicated after the asterisk.
41
Table 2.1. Summary of hybrid survival and settlement success relative to parental purebred species. Survival of hybrid No. of cases Examples Equivalent to both parents 3 TL 28ºC, TL 29.5ºC, TL 31ºC Higher than one parent* 4 FN 29.5ºC, FN 31 ºC, HC 29 ºC, HC 31ºC Higher than both parents 1 HC 28ºC Same as the parent with the 1 FN 28 ºC lower survival Lower than both parents 0 N/A Settlement success of hybrids No. of cases Examples Equivalent to both parents 5 TL 28ºC, TL 29.5ºC, TL 31ºC, HC 28ºC, HC 29.5ºC Higher than one parent+ 3 FN 29.5ºC, FN 31ºC, HC 31ºC Same as the parent with the 1 FN 28 ºC lower settlement Lower than both parent 0 N/A * Hybrid survival was same as the more fit parent in these examples. + Hybrid settlement was higher than the less fit parent but lower than the more fit parent in FN 29.5ºC, FN 31ºC.
2.4.4 Larval settlement
The larval settlement results, assessed two days after the introduction of the settlement cue, were consistent with the survival results. The majority of the hybrid larvae had settlement rates either similar to those of purebred larvae of both parental species or higher than those of purebred larvae of one parental species. Out of the nine species and temperature combinations, hybrid settlement was the same as that of purebred larvae of both parental species in five cases, more fit than purebred larvae of one parental species in three cases, and the same as that of the less fit purebred larvae of one of the parental species in one case (Figure 2.5, Table 2.1). In the cases of the FN cross at
29.5ºC and 31ºC, settlement of hybrid FN was higher than the less fit purebred NN larvae, but lower than the more fit purebred FF larvae (i.e. additive gene effect) (Figure 2.5, Table 2.1). In none of the cases, hybrid settlement success was lower than both parents (Figure 2.5, Table 2.1).
Offspring group (i.e., the specific hybrid or purebred offspring resulting from a cross, see caption
42 of Figure 2.5) had a substantial effect on settlement, yet treatment had very limited effect. For the
A. tenuis x A. loripes cross (Figure 2.5, Supplementary Table S2.5), larval settlement was not affected by offspring group or treatment. For the A. florida x A. nobilis cross (Figure 2.5,
Supplementary Table S2.6), the hybrid FN had a higher proportion of settled larvae than the purebred NN at 29.5 ºC and 31 ºC (p = 0.005, 0.008 respectively). Purebred FF also had higher settlement rates than NN, as well as FN, at all temperatures (p < 0.001 for all pairs). Treatment did not affect settlement of FN and FF, however, settlement of NN at 31 ºC was significantly lower than at 28 ºC (p = 0.043). For the A. hyacinthus x A cytherea cross (Figure 2.5, Supplementary
Table S2.7), the settlement rate of the hybrid HC was higher than that of the purebred CC at 31 ºC
(p = 0.004). For all other comparisons in this cross, settlement did not differ between offspring groups or temperatures. Abnormal settlement behavior (i.e., metamorphosis without settlement cue and without attachment to a substrate) was frequently observed in the purebred CC at 29.5 ºC and 31 ºC. Such behavior was not observed in the hybrid HC or the other purebred FF. The results of an overall comparison of hybrid vs. purebred larval settlement rates are shown in Supplementary
Table S2.8.
43
Figure 2.5. Larval settlement of the offspring groups from the A. tenuis (T) x A. loripes (L) cross, the A. florida (F) x A. nobilis (N) cross, the A. hyacinthus (H) x A. cytherea (C) cross at a) 28 ºC, b) 29.5 ºC and c) 31 ºC. The first letter in the designation of the offspring groups represents the origin of egg and the second letter the origin of sperm. Values are mean and error bars represent
95% CI calculated using the angular transformed data back-transformed into percentages.
* indicates significantly higher survival (i.e. p < 0.05) of this offspring group compared to the offspring group(s) indicated, or the same offspring group under the temperature treatment indicated after the asterisk.
44
2.4.5 Seawater chemistry
Experimental conditions of the treatment are summarized in Table 2.2. Treatment temperatures were maintained at 28.1 ºC ± 0.2, 29.5 ºC ± 0.1 and 31.0 ºC ± 0.2. O2 levels of the seawater removed from the wells ranged from 95.8 to 96.6%, indicating that the seawater remained well oxygenated throughout the experiment.
Table 2.2. Experimental conditions of the three temperature treatments measured at 12:00 daily prior to the water change. Values are mean ± SD. Parameters* 28 ºC SD 29.5 ºC SD 31 ºC SD Temperature (ºC) 28.1 0.2 29.5 0.1 31.0 0.2 -1 O2 (mg L ) 7.5 0.1 7.4 0.1 7.4 0.2 O2(%) 95.8 1.0 96.5 0.7 96.6 2.1 pHT 8.14 0.01 8.12 0.02 8.12 0.01 Ωarag 4.47 0.08 4.56 0.11 4.72 0.16 -1 AT (µmol kg ) 2378 8 2378 8 2378 8 DIC (µmol kg-1) 1921 8 1915 12 1903 15 Salinity (ppt) 36.5 0.2 36.5 0.2 36.6 0.2
*pHT = pH in total scale; AT = total alkalinity; Ωarag = aragonite saturation state; DIC = dissolved inorganic carbon.
45
2.5 Discussion
For sympatric broadcast spawning corals, temporal isolation and gametic incompatibility are two possible mechanisms that preclude interspecific hybridization in the wild52,53. Since considerable overlap in spawning date and time was observed for all but one species pairs in this study, temporal isolation is unlikely an effective prezygotic barrier. Similar observations have been reported for other Acropora spp.53–55 and Platygyra spp.56 from the GBR. However, one well-documented temporal isolation in Acropora spp. is that between the ‘early spawners’ and the ‘late spawners’, which are separated by about 1.5-3 h in the timing of gamete release45–47. The ‘early spawners’ are represented by only three species46,47. Relative to the 120-140 extant Acropora species, the existence of temporal isolation in this small group is not representative of the whole genus. Similar to the observation in Chan et al.44, the ‘early spawner’ A. tenuis spawned at a distinctly earlier time than all other species yet its gametes were compatible with a ‘late spawner’, A. loripes. Similarly, the Caribbean corals Orbicella franksi and Orbicella annularis have 2 h separation in spawning time but their gametes are compatible57. In both cases, a prezygotic barrier in the form of gametic incompatibility may not have evolved as the gametes are unlikely to encounter one another in nature.
Although temporal isolation was limited, gametic incompatibility was observed and its strength varied between species pairs and the direction of the hybrid cross. Fertilization rates were low to moderate in hybrid offspring groups and hybridization was only possible in one direction (i.e., asymmetric gametic incompatibility). Species-specific gametic incompatibility has previously been reported in experimental crossing of Acropora spp. Among 38 species pairs of Acropora from central GBR, eight pairs yielded high interspecific fertilization (50-80%), seven pairs had
46 moderate fertilization (10-50%), three pairs had low fertilization (3-10%), and the remaining pairs were not cross-fertile58,59. Note that the fertilization rates within a species pair cross were highly variably with SDs ranging from 0 to 50%58,59. Experimental crosses of five Acropora species pairs from Okinawa (Japan) resulted in low interspecific fertilization (i.e., < 2%) in all crosses, except the A. formosa x A. nasuta cross (i.e., 95%)60. Chan et al.44 reported high fertilization success (i.e., averaged 93%) in hybrids of both directions from A. tenuis x A. loripes and A. sarmentosa x A. florida crosses. Asymmetric gametic incompatibility as observed in this study is, however, not uncommon in Acropora spp. and has been reported in Hatta et al. (i.e., 40% vs. 95% in A. formosa x A nasuta cross)60, Fogarty et al. (i.e., 5-12% vs. 55-70% in A. palmata x A cervicornis cross)53 and Isomura et al. (i.e., 34% vs. 64% in A. florida x A. nobilis cross)61. Note that A. intermedia mentioned in Isomura et al.61 is the same species as A. nobilis. Many other taxa such as reef fishes42, sea urchins62, mosquitoes63, tuna64, oak65 and walnut tree66 are also known to show asymmetric gametic incompatibility.
One possible explanation for the observed difference in gametic incompatibility is interspecific differences in gamete-recognition proteins, receptors and molecules. Gamete-recognition proteins can affect fertilization success within species67–70, as well as the extent of reproductive isolation between species52,71. Sperm proteins, such as bindin in sea urchin and sea star, and lysin in abalone, provide species-specific binding of sperm to egg and play an important role in reproductive isolation between species52,60,72,73. Bindin, for example, is a sperm protein in sea urchins that coats the acrosome of the sperm, binds sperm to the vitelline envelope of the egg, and facilitates the fusion of sperm and egg membranes74,75. Interspecific differences in bindin can result in failure of one or all of these processes, preventing fertilization from occurring76. In sea urchins, divergence
47 in bindin amino acid sequence can predict gamete compatibility between species, and species with less than 1% difference in sequence are fully compatible52.
The complementary receptor on the egg surface (e.g., VERL in mollusk and EBR1 in echinoderms) mediates species-specific sperm adhesion and also plays a role in reproductive isolation77,78. The receptor, however, has been much less studied due to its relatively large size compared to the sperm protein (e.g., ~4595 amino acids in the bindin receptor EBR1 compared to 200-300 amino acids in bindin)72. Other than gamete-recognition proteins and receptors, species-specific diffusible molecules from the egg can also affect compatibility between species79. Eggs of marine invertebrates are known to produce diffusible chemo-attractants (e.g. ‘sperm-activating peptides’) that activate and attract sperm to swim toward the egg79–82. Abalone sperm, for example, has been shown to only respond to chemo-attractants from conspecific eggs83. To date, however, little is known about gamete recognition proteins and chemo-attractants in coral.
Gametic incompatibility can also vary between colonies of the same species and between locations. Hatta et al.60 and Isomura et al.61 reported interspecific fertilization rates ranged from 4-
76% and 3-99% respectively between different Acropora colonies of the same species pair cross.
Colonies of the A. tenuis x A. loripes cross in this study are from the same reef location as those in
Chan et al.44 and crossed using similar methods. However, Chan et al.44 reported a hybridization rate of 79-95% in contrast to the 0-67% observed here. Experimental crossing of A. florida x A. nobilis yielded a fertilization rate of 34-64% in colonies from Okinawa Japan61, but the same cross in this study had a fertilization rate of only 0.3-10%. Further, hybridization between M. franksi and M. annularis was possible in both directions in Panama but was only possible in one direction
48 in Bahamas57 . We speculate that gametic incompatibilities can vary between genotypes of the same species, that minor differences in gamete-recognition proteins, receptors, and diffusible molecules associated with the gametes can exist between colonies of the same species, and that these are responsible for the variation in interspecific fertilization observed in these and our studies. For example, sperm from different individuals of the same sea urchin species has been shown to vary in chemotaxis (i.e., the ability to navigate toward the egg using chemical signals), which was demonstrated to influence individual fertilization success84 .
Although prezygotic barriers in the form of gametic incompatibility were observed, survival and settlement success of the majority of the hybrid offspring groups were similar to or higher than that of one of the parental purebred offspring groups, which had higher fertilization rates. This is a common phenomenon in Acropora species. Hybrid larvae from an A. florida x A. nobilis cross showed higher survival than purebred larvae at 5-8 days after fertilization, despite their low fertilization rate61. This is a critical time as Acropora larvae become competent for settlement and metamorphosis at about 5 days of age. High larval survival during the first week in life will thus result in a larger number of larvae that may settle. Similarly, survival of hybrid larvae and 6-week old hybrid recruits from an A. palmata x A. cervicornis cross was equivalent to that of purebreds despite lower hybrid fertilization rate43. The hybrids also had similar settlement rates compared to purebred larvae43.
We observed abnormal settlement behavior in the purebred offspring group CC under elevated temperatures, but not in the corresponding hybrid offspring group HC. Hybrid offspring that can settle normally under elevated temperatures are likely to have an advantage over some of the
49 purebred offspring under climate change scenarios. Overall, existing evidence indicates that gametic incompatibility does not negatively affect hybrid fitness in Acropora corals, and the more resilient hybrid offspring may provide superior coral stock for coral reef restoration. Long term field and aquarium studies have shown higher survival and growth rate in some Acropora hybrids compared to purebreds23,31, suggesting that high hybrid fitness is not limited to the larvae but may also manifest in the later life stages.
Elevated seawater temperatures have well-documented negative effects on coral larvae in terms of larval development and motility (i.e., ciliary activity)4, survival3–5, settlement4, metamorphosis69, ability to establish symbiosis5,85, post-settlement mortality86,87 , photosynthesis3, as well as respiration and rubisco protein expression74 (Table 3). Although we used treatment temperatures similar to those in the studies cited above, treatment had a limited effect on larval survival and settlement. Studies with short exposure times (i.e., 1 to 48 h) have also reported that elevated temperatures did not have a negative impact on survival6,87, motility3, settlement, metamorphosis, photosynthesis and respiratory demand87, post-settlement mortality86, and positive effects on settlement of coral larvae was reported in some instances86,88 (Table 3). Most studies with longer exposure times (i.e., over 48 h), however, observed negative effects of elevated temperatures on coral larvae (Table 3). Randall and Szmant6 for example, showed that elevated temperatures did not affect larval survival after 48 h of exposure, but had a negative impact after 7 days of exposure.
This is not the case in the present study where we used ten days of exposure time.
50
Table 2.3. Summary of the effects of elevated temperatures on coral larvae and recruits as reported in the literature and the present study. Treatment Time Species Larvae type Survival Settlement Meta- Res- Post- Reference morphosis piration settlement mortality 28 ºC*, 29.5 ºC, 10 d A. tenuis, A. loripes, Aposymbiotic x x x/-ve This study 31 ºC A. florida, A. nobiliss, A. hyacinthus, A. cytherea 27 ºC*, 30 ºC 24 h Porites astreoides Symbiotic x x x x -ve 81
25 ºC+ 415 9 d Pocillopora Symbiotic x -ve 8 ppm*, damicornis 29 ºC+ 635 ppm 27 ºC*, 29 ºC, 3 d Fungia scutaria Symbiotic -ve 5 31 ºC 28 ºC*, 29 ºC, 48 h Favia fragum Symbiotic x 6 31 ºC 28 ºC*, 29 ºC, 7 d Favia fragum Symbiotic -ve 6 31 ºC 20 ºC, 23 ºC*, 5 d Acropora solitaryensis Aposymbiotic +ve -ve 80 26 ºC, 29 ºC 27 ºC*, 31 ºC, 1 h Favites chinensis Aposymbiotic +ve x 80 34 ºC 28 ºC*, 30 ºC, 9 d Diploria strigosa Aposymbiotic -ve -ve 4 32 ºC 25 ºC*, 27 ºC*, 1-11 Platygyra daedalea Aposymbiotic +ve 82 29 ºC d 26 ºC, 28 ºC*, 24 h Porites astreoides Symbiotic -ve -ve -ve 3 33 ºC *: represents ambient temperature in the experiment x: represents no effect; -ve: represents a negative effect; +ve: represents a positive effect
51
A possible explanation for the observed discrepancy may be the lower sensitivity of aposymbiotic larvae (i.e., without Symbiodinium) to elevated temperatures compared to symbiotic larvae. The
Acropora spp. used in the present study are broadcast spawners and their larvae are aposymbiotic.
The majority of the relevant larval studies in the literature are from brooding species that release larvae already harbouring Symbiodinium (Table 3). Symbiotic larvae are potentially more sensitive to elevated temperatures as they are exposed to reactive oxygen species (ROS) produced as by-products of photosynthesis3,89. Aposymbiotic larvae have been shown to have higher survival than their symbiotic counterparts of the same species under elevated temperatures89, possibly explaining the limited effect of temperature observed in our experiment.
Elevated temperatures may also have a delayed negative effect in later life stages that were not examined in this study. Latent negative responses to environmental stress have been documented in a variety of marine invertebrate larvae90. Nozawa and Harrison86 and Ross et al.87 showed that elevated temperatures had no or a positive effect on coral larvae initially, but were followed by high post-settlement mortality. In another coral species examined in the same experiment, however, post-settlement mortality was unaffected86. This hypothesis also does not hold for purebreds and hybrids of A. tenuis x A. loripes examined here, as Chan et al.44 showed that high hybrid fitness was consistently observed under seven months of exposure to elevated temperature and pCO2 conditions and no delayed negative effect was reported. Alternatively, pre-exposure to a stressor may result in preconditioning and enhance an organism’s tolerance to subsequent stress events22,91–93. Pre-exposure to elevated temperatures of the larvae from the present study may increase their tolerance to coral bleaching during subsequent temperature stress and possibly to a different extent in hybrid and purebred juveniles. Future longer-term studies investigating the
52 impact of exposure of hybrid and purebred corals to sub-lethal stress on tolerance to a subsequent stress event will be invaluable.
Our findings on coral larvae show that high hybrid fitness can still be achieved after overcoming partial prezygotic barriers, and that interspecific hybridization has the potential to enhance coral recruitment and climate resilience. Although interspecific fertilization is lower than conspecific fertilization, mass-spawning corals are highly fecund and the number of larvae resulting from low or medium fertilization is still enormous. Experimental crossings of A. palmata and A. cervicornis showed low fertilization (i.e., 5-12%) in one hybrid direction53. Nonetheless, naturally produced hybrids of both directions are present on the reef94. The next important questions to investigate are whether these hybrid corals can persist in nature and continue to maintain high fitness in later generations. In the most ideal scenario, F1 hybrids are able to reproduce sexually via hybridization with other F1 hybrids and/or backcrossing with parental species. This process generates novel genotypes that are climate resilient, and high fitness may be maintained in advanced generation hybrids and backcrosses. In this case, the introduction of hybrids can bring large spatial and temporal scale benefits to the reef they are out-planted to and beyond.
Although knowledge on the reproductive potential of hybrid corals is currently limited, Isomura et al.33 have demonstrated that experimentally produced F1 hybrids of A. intermedia × A. florida were fertile and able to produce an F2 generation with high fertilization success (i.e. >80%). These hybrids were also able to backcross with either the maternal parental species only or with both parental species. Given the vast volume and great surface area of the ocean compared to laboratory conditions, the fertilization rates for F2 hybrids and backcrosses may be lower in the wild due to
53 lower sperm concentrations53. Despite this, evidence of unidirectional gene flow from A. palmata into A. cervicornis in the Caribbean indicates that their hybrid A. prolifera is fertile and can successfully backcross with at least one parental species94,95. Moreover, molecular studies also suggested that backcrossing naturally occur in interspecific hybrids of anemonefishes as well as butterflyfishes42,96.
In the case where hybrids have limited success in sexual reproduction, it is possible for hybrids to persist asexually. Fragmentation is a common way of asexual reproduction of mass spawning corals97,98. In the Caribbean, the hybrid A. prolifera is known to persist and spread across large reef areas through asexual reproduction98. The conservation benefits of this scenario is less than the former as the hybrids are not able to promote introgression of genes across the parental species or continue to generate novel genotypes. Nevertheless, Acropora corals are long-lived (up to 13-
24 years for some species99) and F1 hybrid corals with high climate resilience may maintain ecosystem function and buy time for the reef while global warming is being addressed. In the least favorable scenario, hybrids are able to hybridize with other F1 hybrids and backcross with parental species, but hybrid breakdown (i.e., outbreeding depression) occurs in later generations. The occurrence of hybrid breakdown has been documented in certain species, although it is more commonly associated with the crossing of geographically or phenologically distant species38,100. If hybrid breakdown occurs, natural selection will likely remove the unfit genotypes29,101,102 and therefore prevent them from propagating further.
The development of novel interventions is becoming increasingly important to reef systems worldwide which are rapidly losing coral, genetic diversity and ecosystem function following
54 multiple high mortality bleaching events. The efficacy of hybridization as a tool to produce coral stock for restoration purposes is supported by our earlier work, which demonstrated hybrid corals survived equally or better compared to purebreds and grew faster over a seven month period of
23 exposure to ambient and elevated temperature and pCO2 conditions . The next step towards safe implementation of this reef restoration intervention will be to assess F1 hybrid reproductive potential, and the fitness of F1 and advanced generation hybrids in controlled field trials.
Data availability
The datasets generated during the present study are publicly available via the Australian Institute of Marine Science data at: https://apps.aims.gov.au/metadata/view/69f17afe-378b-41a2-8c90-
5fff3318898c.
References 1. Heron, S. F., Maynard, J. A., van Hooidonk, R. & Eakin, C. M. Warming trends and bleaching stress of the world’s coral reefs 1985–2012. Sci Rep 6, (2016).
2. Berkelmans, R. & Willis, B. L. Seasonal and local spatial patterns in the upper thermal limits of corals on the inshore Central Great Barrier Reef. Coral Reefs 18, 219–228 (1999).
3. Edmunds, P., Gates, R. & Gleason, D. The biology of larvae from the reef coral Poritesastreoides, and their response to temperature disturbances. Marine Biology 139, 981–989 (2001).
4. Bassim, K. & Sammarco, P. Effects of temperature and ammonium on larval development and survivorship in a scleractinian coral (Diploriastrigosa). Marine Biology 142, 241–252 (2003).
5. Schnitzler, C. E., Hollingsworth, L. L., Krupp, D. A. & Weis, V. M. Elevated temperature impairs onset of symbiosis and reduces survivorship in larvae of the Hawaiian coral, Fungia scutaria. Mar Biol 159, 633–642 (2012).
6. Randall, C. J. & Szmant, A. M. Elevated Temperature Affects Development, Survivorship, and Settlement of the Elkhorn Coral, Acropora palmata (Lamarck 1816). Biol Bull 217, 269–282 (2009).
55
7. Byrne, M. Global change ecotoxicology: Identification of early life history bottlenecks in marine invertebrates, variable species responses and variable experimental approaches. Marine Environmental Research 76, 3–15 (2012).
8. Putnam, H. M., Mayfield, A. B., Fan, T. Y., Chen, C. S. & Gates, R. D. The physiological and molecular responses of larvae from the reef-building coral Pocillopora damicornis exposed to near-future increases in temperature and pCO2. Mar Biol 160, 2157–2173 (2013).
9. Hoegh-Guldberg, O. Climate change, coral bleaching and the future of the world’s coral reefs. Mar. Freshwater Res. 50, 839–866 (1999).
10. Eakin, C. et al. Global coral bleaching 2014–2017: status and an appeal for observations. Reef Encounter 20–26 (2016).
11. Ward, S. How the 2016 bleaching altered the shape of the northern Great Barrier Reef. The Conversation Available at: http://theconversation.com/how-the-2016-bleaching-altered-the- shape-of-the-northern-great-barrier-reef-95142. (Accessed: 18th July 2018)
12. 50 Reefs. 50 Reefs Available at: https://50reefs.org/. (Accessed: 19th October 2017)
13. Burke, L., Reytar, K., Spalding, M. & Perry, A. Reefs at risk revisited. (2011).
14. de Groot, R. et al. Global estimates of the value of ecosystems and their services in monetary units. Ecosystem Services 1, 50–61 (2012).
15. Heyward, A. J., Smith, L. D., Rees, M. & Field, S. N. Enhancement of coral recruitment by in situ mass culture of coral larvae. Marine Ecology Progress Series 230, 113–118 (2002).
16. Omori, M. Degradation and restoration of coral reefs: Experience in Okinawa, Japan. Marine Biology Research 7, 3–12 (2011).
17. Nakamura, R. et al. Corals mass-cultured from eggs and transplanted as juveniles to their native, remote coral reef. Marine Ecology Progress Series 436, 161–168 (2011).
18. Villanueva, R. D., Baria, M. V. B. & Cruz, D. W. dela. Growth and survivorship of juvenile corals outplanted to degraded reef areas in Bolinao-Anda Reef Complex, Philippines. Marine Biology Research 8, 877–884 (2012).
19. Guest, J. R., Baria, M. V., Gomez, E. D., Heyward, A. J. & Edwards, A. J. Closing the circle: is it feasible to rehabilitate reefs with sexually propagated corals? Coral Reefs 33, 45–55 (2014).
20. dela Cruz, D. W. & Harrison, P. L. Enhanced larval supply and recruitment can replenish reef corals on degraded reefs. Scientific Reports 7, 13985 (2017).
56
21. Ritson-Williams, R. et al. New perspectives on ecological mechanisms affecting coral recruitment on reefs. Smithsonian Contributions to the Marine Sciences (2009).
22. van Oppen, M. J. H., Oliver, J. K., Putnam, H. M. & Gates, R. D. Building coral reef resilience through assisted evolution. PNAS 112, 2307–2313 (2015).
23. Chan, W. Y., Peplow, L. M., Menéndez, P., Hoffmann, A. A. & Van Oppen, M. J. H. Interspecific Hybridization May Provide Novel Opportunities for Coral Reef Restoration. Frontiers in Marine Science in press (2017).
24. Fu, D. et al. Utilization of crop heterosis: a review. Euphytica 197, 161–173 (2014).
25. Lippman, Z. B. & Zamir, D. Heterosis: revisiting the magic. Trends in Genetics 23, 60–66 (2007).
26. Hoffmann, A. A. & Sgrò, C. M. Climate change and evolutionary adaptation. Nature 470, 479–485 (2011).
27. Becker, M. et al. Hybridization may facilitate in situ survival of endemic species through periods of climate change. Nature Clim. Change 3, 1039–1043 (2013).
28. Carlson, S. M., Cunningham, C. J. & Westley, P. A. H. Evolutionary rescue in a changing world. Trends in Ecology & Evolution 29, 521–530 (2014).
29. Hamilton, J. A. & Miller, J. M. Adaptive introgression as a resource for management and genetic conservation in a changing climate. Conservation Biology 30, 33–41 (2016).
30. Stelkens, R. B., Brockhurst, M. A., Hurst, G. D. D. & Greig, D. Hybridization facilitates evolutionary rescue. Evol Appl 7, 1209–1217 (2014).
31. Willis, B. L., Oppen, M. J. H. van, Miller, D. J., Vollmer, S. V. & Ayre, D. J. The role of hybridization in the evolution of reef corals. Annual Review of Ecology, Evolution, and Systematics 37, 489–517 (2006).
32. Fogarty, N. Reproductive isolation and hybridization dynamics in threatened Caribbean acroporid corals. Oceanography Faculty Theses and Dissertations (2010).
33. Isomura, N., Iwao, K., Morita, M. & Fukami, H. Spawning and fertility of F1 hybrids of the coral genus Acropora in the Indo-pacific. Coral Reefs 35, 851–855 (2016).
34. Meier, J. I. et al. Ancient hybridization fuels rapid cichlid fish adaptive radiations. Nature Communications 8, 14363 (2017).
35. Grant, P. R. & Grant, B. R. Conspecific versus heterospecific gene exchange between populations of Darwin’s finches. Philosophical Transactions of the Royal Society of London B: Biological Sciences 365, 1065–1076 (2010).
57
36. Li, L. et al. Dominance, overdominance and epistasis condition the heterosis in two heterotic rice hybrids. Genetics 180, 1725–1742 (2008).
37. Chen, Z. J. Genomic and epigenetic insights into the molecular bases of heterosis. Nat Rev Genet 14, 471–482 (2013).
38. Whiteley, A. R., Fitzpatrick, S. W., Funk, W. C. & Tallmon, D. A. Genetic rescue to the rescue. Trends in Ecology & Evolution 30, 42–49 (2015).
39. Johnson, W. E. et al. Genetic restoration of the Florida Panther. Science 329, 1641–1645 (2010).
40. Garnett, S. T., Olsen, P., Butchart, S. H. M. & Hoffmann, A. A. Did hybridization save the norfolk island boobook owl Ninox novaeseelandiae undulata? Oryx 45, 500–504 (2011).
41. Weeks, A. R. et al. Genetic rescue increases fitness and aids rapid recovery of an endangered marsupial population. Nature Communications 8, 1071 (2017).
42. Montanari, S. R., Hobbs, J.-P. A., Pratchett, M. S., Bay, L. K. & Herwerden, L. van. Naturally occurring hybrids of coral reef butterflyfishes have similar fitness compared to parental species. PLOS ONE 12, e0173212 (2017).
43. Fogarty, N. D. Caribbean acroporid coral hybrids are viable across life history stages. Mar Ecol Prog Ser 446, 145–159 (2012).
44. Chan, W. Y., Peplow, L. M., Menéndez, P., Hoffmann, A. A. & Van Oppen, M. J. H. Interspecific hybridization may provide novel opportunities for coral reef restoration. Front. Mar. Sci. 5, (2018).
45. Fukami, H., Omori, M. & Hatta, M. Phylogenetic relationships in the coral family Acroporidae, reassessed by inference from mitochondrial genes. Zoological Science 17, 689–696 (2000).
46. van Oppen, M. J. H., McDonald, B. J., Willis, B. & Miller, D. J. The evolutionary history of the coral genus Acropora (scleractinia, cnidaria) based on a mitochondrial and a nuclear marker: reticulation, incomplete lineage sorting, or morphological convergence? Mol Biol Evol 18, 1315– 1329 (2001).
47. Márquez, L. M., Van Oppen, M. J. H., Willis, B. L., Reyes, A. & Miller, D. J. The highly cross-fertile coral species, Acropora hyacinthus and Acropora cytherea, constitute statistically distinguishable lineages. Molecular Ecology 11, 1339–1349 (2002).
48. McCulloch, C. E. & Neuhaus, J. M. Generalized linear mixed models. (John Wiley Sons, Ltd., 2013).
58
49. R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing. (R Foundation for Statistical Computing, Vienna, Austria, 2016).
50. Lewis, E. & Wallace, D. W. R. CO2SYS program developed for the CO2 system calculations. Carbon Dioxide Information Analysis Center, Oak Ridge National Laboratory, US Department of Energy, Oak Ridge, Tennessee (1998).
51. Pierrot, D., Lewis, E. & Wallace, D. W. R. CO2SYS DOS program developed for CO2 system calculations. ORNL/CDIAC-105. Carbon Dioxide Information Analysis Center, Oak Ridge National Laboratory, US Department of Energy, Oak Ridge, Tennessee (2016).
52. Zigler, K. S., McCartney, M. A., Levitan, D. R., Lessios, H. A. & Harrison, R. Sea urchin bindin divergence predicts gamete compatibility. Evolution 59, 2399–2404 (2005).
53. Fogarty, N. D., Vollmer, S. V. & Levitan, D. R. Weak prezygotic isolating mechanisms in threatened Caribbean Acropora corals. PLoS ONE 7, e30486 (2012).
54. Harrison, P. L. et al. Mass spawning in tropical reef corals. Science 223, 1186–1189 (1984).
55. Babcock, R. C. et al. Synchronous spawnings of 105 scleractinian coral species on the Great Barrier Reef. Mar. Biol. 90, 379–394 (1986).
56. Miller, K. & Babcock, R. Conflicting Morphological and Reproductive Species Boundaries in the Coral Genus Platygyra. The Biological Bulletin 192, 98–110 (1997).
57. Levitan, D. R. et al. Mechanisms of reproductive isolation among sympatric broadcast- spawning corals of the Montastraea annularis species complex. Evolution 58, 308–323 (2004).
58. Willis, B. L., Babcock, R. C., Harrison, P. L. & Wallace, C. C. Experimental hybridization and breeding incompatibilities within the mating systems of mass spawning reef corals. Coral Reefs 16, S53–S65 (1997).
59. Van Oppen, M. J. H., Willis, B. L., Van Rheede, T. & Miller, D. J. Spawning times, reproductive compatibilities and genetic structuring in the Acropora aspera group: evidence for natural hybridization and semi-permeable species boundaries in corals. Mol. Ecol. 11, 1363–1376 (2002).
60. Hatta, M. et al. Reproductive and genetic evidence for a reticulate evolutionary history of mass-spawning corals. Mol Biol Evol 16, 1607–1613 (1999).
61. Isomura, N., Iwao, K. & Fukami, H. Possible natural hybridization of two morphologically distinct species of Acropora (Cnidaria, Scleractinia) in the Pacific: fertilization and larval survival rates. PLoS ONE 8, e56701 (2013).
59
62. Levitan, D. R. The relationship between conspecific fertilization success and reproductive isolation among three congeneric sea urchins. Evolution 56, 1599–1609 (2002).
63. Donnelly, M. J., Pinto, J., Girod, R., Besansky, N. J. & Lehmann, T. Revisiting the role of introgression vs shared ancestral polymorphisms as key processes shaping genetic diversity in the recently separated sibling species of the Anopheles gambiae complex. Heredity (Edinb) 92, 61–68 (2004).
64. Durand, J. D., Collet, A., Chow, S., Guinand, B. & Borsa, P. Nuclear and mitochondrial DNA markers indicate unidirectional gene flow of Indo-Pacific to Atlantic bigeye tuna (Thunnus obesus) populations, and their admixture off southern Africa. Marine Biology 147, 313–322 (2005).
65. Lepais, O. et al. Species relative abundance and direction of introgression in oaks. Molecular Ecology 18, 2228–2242 (2009).
66. Bai, W. N., Liao, W. J. & Zhang, D.-Y. Nuclear and chloroplast DNA phylogeography reveal two refuge areas with asymmetrical gene flow in a temperate walnut tree from East Asia. New Phytologist 188, 892–901 (2010).
67. Palumbi, S. R. All males are not created equal: fertility differences depend on gamete recognition polymorphisms in sea urchins. PNAS 96, 12632–12637 (1999).
68. Levitan, D. R. & Ferrell, D. L. Selection on gamete recognition proteins depends on sex, density, and genotype frequency. Science 312, 267–269 (2006).
69. Levitan, D. R. & Stapper, A. P. Simultaneous positive and negative frequency-dependent selection on sperm bindin, a gamete recognition protein in the sea urchin strongylocentrotus purpuratus. Evolution 64, 785–797 (2010).
70. Levitan, D. R. Contemporary evolution of sea urchin gamete-recognition proteins: experimental evidence of density-dependent gamete performance predicts shifts in allele frequencies over time. Evolution 66, 1722–1736 (2012).
71. Zigler, K. S. & Lessios, H. A. 250 million years of bindin evolution. The Biological Bulletin 205, 8–15 (2003).
72. Knowlton, N. & Leray, M. Exploring coral reefs using the tools of molecular genetics. SpringerLink 117–132 (2015). doi:10.1007/978-94-017-7249-5_6
73. Patiño, S. et al. Sperm bindin divergence under sexual selection and concerted evolution in sea stars. Mol Biol Evol 33, 1988–2001 (2016).
74. Vacquier, V. D. & Moy, G. W. Isolation of bindin: the protein responsible for adhesion of sperm to sea urchin eggs. PNAS 74, 2456–2460 (1977).
60
75. Ulrich, A. S., Otter, M., Glabe, C. G. & Hoekstra, D. Membrane fusion is induced by a distinct peptide sequence of the sea urchin fertilization protein bindin. J. Biol. Chem. 273, 16748– 16755 (1998).
76. Metz, E. C., Kane, R. E., Yanagimachi, H. & Palumbi, S. R. Fertilization between closely related sea urchins is blocked by incompatibilities during sperm-egg attachment and early stages of fusion. The Biological Bulletin 187, 23–34 (1994).
77. Kamei, N. & Glabe, C. G. The species-specific egg receptor for sea urchin sperm adhesion is EBR1,a novel ADAMTS protein. Genes Dev. 17, 2502–2507 (2003).
78. Hart, M. W. Structure and evolution of the sea star egg receptor for sperm bindin. Mol Ecol 22, 2143–2156 (2013).
79. Jagadeeshan, S., Coppard, S. E. & Lessios, H. A. Evolution of gamete attraction molecules: evidence for purifying selection in speract and its receptor, in the pantropical sea urchin Diadema. Evolution & Development 17, 92–108 (2015).
80. Lillie, F. R. The production of sperm iso-agglutinins by ova. Science 36, 527–530 (1912).
81. Miller, A. Sperm chemo-orientation in the metazoa. (Academic press, 1985).
82. Kaupp, U. b., Hildebrand, E. & Weyand, I. Sperm chemotaxis in marine invertebrates— molecules and mechanisms. J. Cell. Physiol. 208, 487–494 (2006).
83. Riffell, J. A., Krug, P. J. & Zimmer, R. K. The ecological and evolutionary consequences of sperm chemoattraction. Proc Natl Acad Sci U S A 101, 4501–4506 (2004).
84. Hussain, Y. H., Sadilek, M., Salad, S., Zimmer, R. K. & Riffell, J. A. Individual female differences in chemoattractant production change the scale of sea urchin gamete interactions. Developmental Biology 422, 186–197 (2017).
85. Abrego, D., Willis, B. L. & Oppen, M. J. H. van. Impact of light and temperature on the uptake of algal symbionts by coral juveniles. PLOS ONE 7, e50311 (2012).
86. Nozawa, Y. & Harrison, P. L. Effects of elevated temperature on larval settlement and post-settlement survival in scleractinian corals, Acropora solitaryensis and Favites chinensis. Mar Biol 152, 1181–1185 (2007).
87. Ross, C., Ritson-Williams, R., Olsen, K. & Paul, V. J. Short-term and latent post-settlement effects associated with elevated temperature and oxidative stress on larvae from the coral Porites astreoides. Coral Reefs 32, 71–79 (2013).
88. Nozawa, Y. & Harrison, P. Larval settlement patterns, dispersal potential, and the effect of temperature on settlement rates of larvae of the broadcast spawning reef coral, Platygyra daedalea,
61 from the Great Barrier Reef. Proceedings 9th International Coral Reef Symposium 409–415 (2002).
89. Yakovleva, I. M. et al. Algal symbionts increase oxidative damage and death in coral larvae at high temperatures. Marine Ecology Progress Series 378, 105–112 (2009).
90. Pechenik, J. A. Larval experience and latent effects--metamorphosis is not a new beginning. Integr. Comp. Biol. 46, 323–333 (2006).
91. Middlebrook, R., Hoegh-Guldberg, O. & Leggat, W. The effect of thermal history on the susceptibility of reef-building corals to thermal stress. J Exp Biol 211, 1050–1056 (2008).
92. Palumbi, S. R., Barshis, D. J., Traylor-Knowles, N. & Bay, R. A. Mechanisms of reef coral resistance to future climate change. Science 344, 895–898 (2014).
93. Chan, W. Y. & Eggins, S. M. Calcification responses to diurnal variation in seawater carbonate chemistry by the coral Acropora formosa. Coral Reefs 1–10 (2017). doi:10.1007/s00338-017-1567-8
94. Vollmer, S. V. & Palumbi, S. R. Hybridization and the evolution of reef coral diversity. Science 296, 2023–2025 (2002).
95. Vollmer, S. V. & Palumbi, S. R. Restricted gene flow in the caribbean staghorn coral Acropora cervicornis: implications for the recovery of endangered reefs. J Hered 98, 40–50 (2007).
96. Gainsford, A., Herwerden, L. van & Jones, G. P. Hierarchical behaviour, habitat use and species size differences shape evolutionary outcomes of hybridization in a coral reef fish. Journal of Evolutionary Biology 28, 205–222 (2015).
97. Highsmith, R. C. Reproduction by fragmentation in corals. Marine Ecology Progress Series 7, 207–226 (1982).
98. Irwin, A. et al. Age and intraspecific diversity of resilient Acropora communities in Belize. Coral Reefs 36, 1–10 (2017).
99. Guzner, B., Novoplansky, A. & Chadwick, N. E. Population dynamics of the reef-building coral Acropora hemprichii as an indicator of reef condition. Marine Ecology Progress Series 333, 143–150 (2007).
100. Hwang, A. S., Northrup, S. L., Peterson, D. L., Kim, Y. & Edmands, S. Long-term experimental hybrid swarms between nearly incompatible Tigriopus californicus populations: persistent fitness problems and assimilation by the superior population. Conserv Genet 13, 567– 579 (2012).
62
101. Jones, T. A. & Monaco, T. A. A role for assisted evolution in designing native plant materials for domesticated landscapes. Frontiers in Ecology and the Environment 7, 541–547 (2009).
102. Aitken, S. N. & Whitlock, M. C. Assisted gene flow to facilitate local adaptation to climate change. Annual Review of Ecology, Evolution, and Systematics 44, 367–388 (2013).
Acknowledgements
This study was funded by the Paul G. Allen Philanthropies and the Australian Institute of Marine
Science (AIMS). I thank the SeaSim staff at AIMS for their technical support and P. Menéndez for developing and sharing the statistical analysis code of the GLMM applied in this study. I am also grateful to B. Lenz, J. Davidson, K. Hughes, I. Huizingh and K. Damjanovic for help with coral spawning and experimental setup, and M. Shanahan for seawater alkalinity measurements.
63
Chapter 3
Interspecific hybridization may provide novel opportunities for coral reef restoration
3.1 Abstract
Climate change and other anthropogenic disturbances have created an era characterized by the inability of most ecosystems to maintain their original, pristine states, the Anthropocene.
Investigating new and innovative strategies that may facilitate ecosystem restoration is thus becoming increasingly important, particularly for coral reefs around the globe which are deteriorating at an alarming rate. The Great Barrier Reef (GBR) lost half its coral cover between
1985 and 2012, and experienced back-to-back heat-induced mass bleaching events and high coral mortality in 2016 and 2017. Here we investigate the efficacy of interspecific hybridization as a tool to develop coral stock with enhanced climate resilience. We crossed two Acropora species pairs from the GBR and examined several phenotypic traits over 28 weeks of exposure to ambient and elevated temperature and pCO2. While elevated temperature and pCO2 conditions negatively affected size and survival of both purebreds and hybrids, higher survival and larger recruit size were observed in some of the hybrid offspring groups under both ambient and elevated conditions.
Further, interspecific hybrids had high fertilization rates, normal embryonic development, and similar Symbiodinium uptake and photochemical efficiency as purebred offspring. While the fitness of these hybrids in the field and their reproductive and backcrossing potential remain to be investigated, current findings provide proof-of-concept that interspecific hybridization may produce genotypes with enhanced climate resilience, and has the potential to increase the success of coral reef restoration initiatives.
64
3.2 Introduction
The rapid increase in atmospheric CO2 to levels not documented for millions of years (Hönisch et al., 2012) and associated ocean warming and acidification have profoundly transformed the marine realm (Pandolfi et al., 2011). Higher-than-usual seawater temperatures can cause coral bleaching, the breakdown of the symbiotic relationship between the coral host and its dinoflagellate endosymbionts (Symbiodinium spp.), and associated coral mortality (Hoegh-Guldberg, 1999).
Ocean acidification is reducing carbonate ion availability in seawater and can depress calcification rates of calcifying organisms like corals (Langdon et al., 2000; Doney et al., 2009; Chan and
Connolly, 2013). These global changes, coupled with local stressors, such as pollution, overfishing, and outbreaks of crown-of-thorns starfish, have drastically altered coral cover and community composition at a global scale. In the last three decades, multiple mass bleaching events have decimated coral reefs worldwide including in 1998, 2010 and 2014-2017 (Eakin et al., 2016;
Heron et al. 2016; Hughes et al. 2018). The Great Barrier Reef (GBR) is no exception with 50-
80% coral mortality recorded on many northern reefs following the 2016 mass bleaching event
(Great Barrier Reef Marine Park Authority, 2017), followed by another high mortality mass bleaching event in 2017. Climate models predict a less than 5% chance of reaching the Paris agreement target of limiting the global temperature rise to < 2°C compared to pre-industrial times by 2100 (Raftery et al., 2017), and most coral reefs are forecasted to experience annual severe bleaching before the end of the century (van Hooidonk et al., 2016). Several observations of an increase in tolerance of coral bleaching after successive bleaching events suggest that adaptation and/or acclimatization are possible under certain conditions (Maynard et al., 2008; Berkelmans,
2009; Guest et al., 2012; Penin et al., 2013). Nevertheless, over 50% of the world’s coral reefs has been lost in the last three decades, with the Caribbean having lost over 80% of its coral cover (“50
65
Reefs,” 2017), indicating that the rates of natural adaptation and acclimatization are overall insufficient to keep pace with the rate of environmental changes (van Oppen et al., 2017).
Active reef restoration is one way to assist the recovery of coral reefs that are degraded, damaged or destroyed. Reef restoration is still in its infancy and all of the few successful efforts so far occurred on a small spatial scale (e.g. Omori, 2011; Nakamura et al., 2011; Villanueva et al. 2012;
Guest et al., 2014; dela Cruz and Harrison 2017). Traditionally, locally sourced biological material is used for restoration based on the assumption that these populations are locally adapted and therefore most likely to survive (Breed et al., 2013). However, anthropogenic disturbances are rapidly changing the environment and shifting selection pressures (Becker et al., 2013), and locally sourced stock is therefore potentially mismatched with the altered environment. An effective restoration strategy should thus incorporate an understanding of present day ecological characteristics of species, characteristics of future available habitats, and adaptive potential of species (Becker et al., 2013). The use of non-local and climate resilient materials is controversial, but is gaining traction in wildland restoration (Jones and Monaco, 2009), revegetation (Sgrò et al.,
2011; Breed et al., 2013) and coral reef restoration (Rau et al., 2012; van Oppen et al., 2017).
One possible way to improve the adaptive potential of species is via hybridization, which can increase genetic variation, break genetic correlations that constrain evolvability of parental lineages, and assist species to acquire adaptive traits (Hoffmann and Sgrò, 2011; Becker et al.,
2013; Carlson et al., 2014; Hamilton and Miller, 2016; van Oppen et al., 2015; Meier et al., 2017).
Hybridization can be conducted either via targeted crossing of individuals or species carrying desired phenotypic traits (e.g., high thermal tolerance) or via crossing between species with the
66 goal of increasing genetic diversity and new variation for natural selection to act upon, and potentially generating hybrid vigour. The relative fitness of F1 hybrids (Figure 3.1) depends on whether there are additive (i.e., hybrids are of intermediate fitness between the parental species), dominant (i.e., hybrids are of equal fitness to the dominant parent species), over-dominant (i.e., hybrids are more fit than both parental species), under-dominant (i.e., hybrids are less fit than both parental species) gene effects, and/or maternal effects (i.e., hybrids are of equal fitness to their maternal parent species) (for review, see Lippman and Zamir, 2007; Li et al., 2008; Chen, 2013).
Reciprocal hybrids are predicted to have equal fitness, except under maternal inheritance. With maternal effects, the fitness of the hybrids is directly affected by the fitness of the maternal parental species, regardless of the offspring’s own genotype (Roach and Wulff, 1987; Bernardo, 1996). In the context of restoration, hybrid vigour that can be driven by dominant or over-dominant mechanisms, is a desirable outcome. The value of hybridization in enhancing fitness has been demonstrated in multiple cases. For instance, hybridization has provided genetic variance in morphology for adapting to changing environments in Darwin’s finches (Grant and Grant, 2010), altered chemical defense of hybrid Brassicaceae plants and aided their survival through the Last
Glacial Maximum (Becker et al., 2013), and facilitated extensive adaptive radiation in haplochromine cichlid fishes (Meier et al., 2017).
67
Figure 3.1. Possible relative fitness of reciprocal F1 hybrids (F1ab and F1ba) based on fitness of the parental species (Pa and Pb) and the driving mechanism. In the top graphs, parental species are assumed to differ in phenotype while the bottom graphs indicate a situation where parental species are similar. For further explanation, see text.
68
Hybridization is known to occur naturally in some scleractinian corals and has played an important role in the evolution and diversification of the genus Acropora (van Oppen et al., 2001; Willis et al., 2006). In the Caribbean, recent environmental degradation and massive population decline in
Acropora cervicornis and Acropora palmata have favoured hybridization and expansion of their
F1 hybrid, Acropora prolifera (Fogarty, 2012). These hybrids either have equivalent or higher fitness relative to the parent species in most life history stages examined (Fogarty, 2012). In recent years, A. prolifera has been reported in increasingly high abundance in many reef locations
(Fogarty, 2012; Japaud et al., 2014; Aguilar-Perera and Hernández-Landa, 2017) and the hybrid has expanded to marginal environments where parent species are absent (Fogarty, 2012).
Although interspecific hybridization is a potential tool to enhance restoration outcomes, it is often dismissed in restoration initiatives. Concerns raised include the possibility of outbreeding depression in later generations (i.e., F2, F3, backcross), and the loss of diversity through losing part of the parental species’ genome (for review, see Hamilton and Miller, 2016). Most examples of outbreeding depression, however, are associated with the admixture of populations or species that are geographically distant, or when life history or phenological differences are large (Hwang et al., 2012; Whiteley et al., 2015). Outbreeding depression can also be transient and can be overcome by natural selection (Jones and Monaco, 2009; Aitken and Whitlock, 2013; Hamilton and Miller, 2016). Instead of reducing genetic diversity, hybridization may conserve diversity by protecting the parental genome from the risk of extinction, and can also increase genetic diversity by combining two divergent genomes within a single organism (Garnett et al, 2011). For example, hybridization has successfully enhanced genetic diversity, improved the population size and
69 rescued the highly inbred, remnant population of Florida panther (Johnson et al., 2010) and the
Mt. Buller mountain pygmy-possum (Weeks et al. 2017) from extinction (i.e. genetic rescue).
Here we investigate interspecific hybridization as a novel tool to increase genetic diversity and develop coral stock with increased climate resilience. Parental species were not chosen for their relative climate resilience, but based on our expert knowledge of the probability that they would cross-fertilize as well as their evolutionary relatedness. We examined the performance of hybrids from reciprocal crosses of two Acropora species pairs raised under ambient and elevated seawater temperature and pCO2 conditions, and assessed 1) whether prezygotic barriers exist in interspecific hybrids of Acropora corals from the GBR, and 2) whether hybrids show enhanced fitness and resilience compared to the purebreds. Four phenotypic traits (i.e., survival, recruit size,
Symbiodinium uptake and photochemical efficiency) were measured in hybrid and purebred offspring as proxies for fitness. Surviving hybrids and purebreds at the end of the experiment were transplanted to long-term grow-out tank for rearing with the aim to allow future assessment of their reproductive and backcrossing potential when they reach sexual maturity at approximately four years of age. We continued to monitor these survivors for survival and size during the grow- out period.
3.3 Materials and Methods
3.3.1 Coral spawning, in vitro fertilization, and experimental design
A detailed timeline of the experiment, sampling and measurement of each trait is shown in
Supplementary Figure S3.1. Parental colonies were collected from Trunk Reef, central GBR, prior to full moon on 22nd Nov 2015 and maintained in flow-through aquaria of the National Sea
70
Simulator (SeaSim) at the Australian Institute of Marine Science (AIMS). When signs of imminent spawning were observed (‘setting’, i.e., where the sperm-egg bundles begin to protrude through the mouth of the polyps), colonies were isolated in individual tanks to avoid uncontrolled mixing of gametes prior to in vitro crossing. The five most profusely spawning colonies of each parental species were used for crossing to form 1) an Acropora tenuis x Acropora loripes cross, and 2) an
Acropora sarmentosa x Acropora florida cross (Figure 3.2). These two species pairs were chosen to represent a phylogenetically divergent cross and a phylogenetically closely related cross. The phylogeny of Acropora spp. is divided into two distinct groups: the ‘early spawners’ and the ‘late spawners’, where the ‘late spawners’ spawn about 1.5- 3 h before the other group (Fukami et al.,
2000; van Oppen et al., 2001; Marquez et al., 2002). A. tenuis (early spawner) and A. loripes (late spawner) are phylogenetically divergent, while A. sarmentosa and A. florida (both are ‘late spawners’) are closely related and fall within the same phylogenetic clade (Fukami et al., 2000, van Oppen et al., 2001; Marquez et al., 2002). Little information is available from the literature about the relative resilience of these four parental species, but this has limited relevance for this study as our purpose was to increase genetic diversity (and thus adaptive potential) via hybridization, and not to conduct targeted breeding with species of known relative bleaching tolerance. Only two A. florida colonies spawned on the same night as A. sarmentosa, therefore, only two colonies were used for this species.
71
Figure 3.2. Experimental set up showing the two interspecific crosses (i.e., A. tenuis (T) x A. loripes (L) and A. sarmentosa (S) x A. florida (F)), the four resultant offspring groups from each cross (TT, TL, LT, LL; and SS, SF, FS, FF respectively), larval settlement, and comparison of hybrid and purebred fitness under ambient and elevated conditions. The abbreviation of the offspring groups throughout this paper is that the first letter represents the origin of the eggs and the second letter the origin of sperm (e.g., SF is a hybrid of A. sarmentosa (S) eggs with A. florida
(F) sperm). The different colours used for the offspring groups in the figure reflect differently coloured settlement plugs used for each offspring group.
72
Egg-sperm bundles of individual colonies were collected and eggs and sperm were separated using a 100 µm filter. Eggs were washed three times with filtered seawater to remove any residual sperm and placed in a 3 L bowl until crosses were set up (within 3 h). Sperm concentration of every colony was measured with a hemocytometer on a compound microscope with 40x magnification.
Similar quantities of sperm from each conspecific colony were pooled to create a mixed sperm solution. For the hybrid crosses, the mixed sperm solution of the other parental species was added to the eggs of each interspecific colony. This method prevented intraspecific fertilization by possible remaining sperm that was not washed off the eggs (note that no self-fertilization was observed in any of the crosses performed). Fertilization was conducted under ambient conditions at a sperm concentration of 106 sperm mL-1. Three samples of 100 eggs were collected for each species as a self-fertilization test and a ‘no sperm’ control. Each species pair cross produced four offspring groups, two purebreds and two hybrids (Figure 3.2). Embryos of each offspring group were then placed in rearing tanks for development under ambient conditions.
3.3.2 Fertilization rates and embryonic development
Fertilization rates were assessed at 3.5 h, and embryonic development at 9, 15, 21, 33, 45, 57, and
93 h after sperm was added to the eggs. All embryos had reached planula stage and were ready to settle by 93 h. Triplicate samples of 100 embryos of each offspring group were collected and fixed in 4% formaldehyde. Developmental stages were assessed and counted under a dissecting microscope based on the stages described in Randall and Szmant (2009).
73
3.3.3 Larval settlement and Symbiodinium uptake
Prior to coral spawning, ceramic plugs of eight different colours were preconditioned in the outdoor SeaSim flow-through aquaria under ambient conditions for 6 weeks to develop crustose coralline algae (CCA) and a microbial biofilm to provide a larval settlement cue. After preconditioning, the top surfaces (i.e., the surfaces for larval settlement) of all plugs were completely covered with CCA and biofilm and were indistinguishable between the different coloured plugs. Five days after fertilization, planula larvae of the eight offspring groups were each settled onto one assigned colour of the pre-conditioned plugs under ambient conditions. Plugs of eight different colours were used so that each offspring groups could easily be identified and randomized in the experimental PVC trays holding the plugs (Figure 3.2). During settlement,
Symbiodinium (i.e., algal symbionts) isolated from the parent colonies were added to achieve a final density of 2 x 106 cells mL-1 in each settlement tank. Larvae of each offspring group only received Symbiodinium from their parental species. To isolate the Symbiodinium, an approximately
6 cm fragment with three branches was removed from each parental colony with a bone cutter.
Soft tissues of the fragment were then removed using an airbrush. The mixed soft tissues/seawater solution was collected and centrifuged at 200 g for 5 mins to pellet the Symbiodinium. The
Symbiodinium cells were resuspended and washed three times with filtered seawater before being added to the larvae. Symbiodinium uptake was assessed under a dissecting microscope prior to exposure to elevated conditions. Recruits (n = 20 per offspring group) were categorized as either with or without Symbiodinium.
Settled recruits were randomized and evenly distributed on 24 tailor-made PVC trays to rear under
1) ambient conditions of 27ºC, 415 ppm pCO2, or 2) elevated conditions of ambient +1°C, 685
74 ppm pCO2 (Figure 3.2). Recruits for the elevated conditions were ramped to the target temperature and pCO2 from ambient at a rate of + 0.2ºC and + ~50 ppm per day. There were 12 replicate tanks for each of the two treatment conditions and tank positions in the experiment room were randomized (Figure 3.2). Every tank held one PVC tray with 20 plugs of each offspring group, with the exception of A. florida purebred (FF) and hybrid (FS) which had only 10 plugs due to fewer larvae being available. To avoid sediments from accumulating on top of the recruits, the trays were placed at an approximately 45º angle. Experimental conditions followed Davies Reef
(18.83° S, 147.63° E) diurnal and annual temperature variations, a reef in proximity to Trunk Reef were the adult corals used for spawning were collected. A mixed marine microalgae diet of
Isochrysis, Pavlova, Tetraselmis, Chaetocerous calcitrans, Thalassiosira weissflogii and
Thalassiosira pseudonana was fed to the recruits twice a day at a final concentration of ~5000 cells mL-1 in the tank.
3.3.4 Survival and recruit size
Recruits from each tank were imaged using a high-resolution camera (Nikon D810) mounted on a quadpod with a waterproof case. Imaging was conducted fortnightly in the first eight weeks of the experiment, thereafter every four weeks until 28 weeks. The numbers of surviving recruits were visually counted and recorded. Detailed images were taken at 28 weeks for size measurement.
Recruit size was estimated as surface area of a circle from the measured recruit diameter since recruits were circular in shape and were not yet forming upright branches. Measurements were made using the software ImageJ and calibrated on the scale chart presented on every image.
Recruits were maintained under the treatment conditions for 28 weeks. Surviving juveniles were thereafter relocated to long-term grow-out tanks to accommodate their larger size and maintained
75 under ambient raw water (i.e. unfiltered seawater) to cater for higher feeding demand. Due to the small size of some recruits at 28 weeks and therefore difficulty to make comparisons, size was again measured at one year of age (i.e., about five months after all surviving recruits were moved to ambient raw water conditions) using the same measurement method. Furthermore, a set of photos of the median sized juvenile were taken at two years of age.
3.3.5 Photochemical efficiency
Photochemical efficiency (i.e., dark adapted maximum photosystem II quantum yield, Fv/Fm) was measured at week 28 as a proxy for coral health. Measurements were made using Imaging- Pulse
Amplitude Modulation (I-PAM) derived by the software ImagingWin (v2.40b). Recruits (n = 15 per offspring group per treatment) were dark adapted overnight, and remained submerged in the treatment seawater during imaging. A recruit would only be measured if: 1) it was not obscured by filamentous algae, and 2) its size was no smaller than the software’s area of interest requirement.
3.3.6 Seawater chemistry
Automated controls of seawater chemistry were provided by SeaSim via the SCADA (Supervisory
Control and Data Acquisition) system. Experimental conditions are summarized in Table 3.1.
Seawater temperature and pH were recorded every hour using resistance temperature detector
(RTD) and a pH probe (Tophit CPS471D). pCO2 was measured bi-weekly using a CO2 equilibrator calibrated to a standard gas of 500 ppm. Total alkalinity (AT) was measured using VINDTA calibrated to Dickson’s Certified Reference Material. Salinity was measured weekly with an
HACH IntelliCAL™ CDC401 Standard Conductivity Probe calibrated with IAPSO Standard
Seawater. Seawater carbonate chemistry parameters, including Ωarag, DIC (dissolved inorganic
76
2- - carbon), CO3 , and HCO3 were calculated using the measured values of seawater AT, pCO2, temperature and salinity, with the program CO2SYS (Lewis and Wallace 1998 as implemented in
Microsoft Excel by Pierrot et al. 2006).
Table 3.1. Experimental conditions of the ambient and elevated treatment. Means and standard deviations (SDs) are given. Parameter* Ambient Ambient Elevated Elevated mean SD mean SD Temperature (ºC) 26.5 2.1 27.5 2.1 - pCO2 (µatm) 399 5 666 36 pHT 8.04 0.00 7.86 0.02 -1 AT (µmol kg ) 2327 21 2327 21 Ωarag 3.6 0.3 2.7 0.3 - -1 HCO3 (µmol kg ) 1766 25 1915 21 2- -1 CO3 (µmol kg ) 226 15 167 15 DIC (µmol kg-1) 2004 15 2100 12 Salinity (ppt) 35.5 0.8 35.5 0.8
* pCO2 = partial pressure of CO2 of air in equilibrium with seawater; pHT = pH in total scale; AT - 2- = total alkalinity; Ωarag = aragonite saturation state; HCO3 = bicarbonate ion concentration; CO3 = carbonate ion concentration; DIC = dissolved inorganic carbon.
3.3.7 Statistical analysis
3.3.7.1 Survival
Generalized linear mixed models (GLMM) (McCulloch and Neuhaus, 2013) for binomial data with logistic link functions were used to estimate the effects of treatment and offspring group on recruit survival at week 28. Analyses were conducted separately for the offspring groups of the A. tenuis x A. loripes cross and the offspring groups of the A. sarmentosa x A. florida cross using R with packages lme4 (Bates et al., 2014) and multcomp (Hothorn et al., 2008). In order to account for tank differences in the experimental design, a random tank effect was included in the models.
Models were checked for overdispersion using a Chi-square test (Bolker et al, 2009) and goodness
77 of fit using Akaike Information Criteria (Akaike, 1974). AIC of the GLMM of the A. tenuis x A. loripes cross was 397, the A. sarmentosa x A. florida cross was 331. Tukey's pairwise comparisons were then conducted and p-values were corrected using the Benjamini-Hochberg method
(Benjamini and Hochberg, 1995). To obtain a visual overview of survival over time, longitudinal generalized linear models (GLM) for binomial data were used to estimate the survival for the offspring groups across all time points, and the combined hybrid offspring vs. purebred offspring.
A summary table of the mean survival is provided in Table 3.7. Survival data were also analyzed with Cox proportional hazards regression as a comparison to GLMM. Results of the Cox regression were very similar to those of the GLMM and are shown in the Supplementary Methods and Results section.
3.3.7.2 Size
Statistical analyses of size were conducted separately for the offspring groups of the A. tenuis x A. loripes cross and the offspring groups of the A. sarmentosa x A. florida cross at 28 weeks and at one year of age. For the 28-week time point, the absence of growth in a large number of samples under elevated conditions resulted in non-normality of the data, and nonparametric Kruskal-Wallis tests were undertaken followed by Dunn’s pairwise comparisons (Dunn, 1964). P-values for the multiple pairwise comparisons were adjusted with the Benjamini-Hochberg method. For the one year time point, due to the absence of survivors in some offspring groups, not all size comparisons could be undertaken. Offspring groups with no or fewer than three individual survivors were excluded from the analyses. The remaining size data were normally distributed (tested using
Shapiro-Wilk tests; Shapiro and Wilk, 1965) and variances were homogeneous (tested by Levene's tests; Levene, 1960) and five pairwise comparisons were undertaken using combined variance t-
78 tests. For the A. tenuis x A. loripes cross, three t-tests were possible for offspring groups that were previously exposed to ambient conditions (note they have been relocated to long-term grow-out tank under raw ambient seawater after 28 weeks). The p-values of these comparisons were adjusted using the Benjamini-Hochberg method. The above analyses were run in R (version 3.3.1). A summary of the mean sizes of the recruits is shown is Table 3.7.
3.3.7.3 Symbiodinium uptake and photochemical efficiency
Generalized linear models (GLM) (McCulloch and Neuhaus, 2013) were used to test the effect of offspring group on rates of Symbiodinium uptake, which was treated as a binomial distributed variable (i.e. Symbiodinium taken up/not taken up). Treatment was not included in this model as
Symbiodinium uptake was assessed prior to the start of treatment. For photochemical efficiency
(i.e., dark adapted yield, Fv/Fm), generalized linear models were also used to test the effects of offspring group and treatment on the response. Tukey pairwise comparisons were then used and the p-values were adjusted with the Benjamini-Hochberg method. These analyses were run with R packages lme4 (Bates et al., 2014) and multcomp (Hothorn et al., 2008)
3.4 Results
3.4.1 Spawning time, fertilization rates and embryonic development
The date and time of spawning of the Acropora spp. used in this study are summarized in Table
3.2. The A. tenuis x A. loripes cross was conducted on the 6th day after the full moon, where A. tenuis spawned at ~19:00-19:30 and A. loripes at ~21:45. The A. sarmentosa x A. florida cross was conducted on the 7th day after the full moon, where A. sarmentosa spawned at ~20:30-20:45 and
A. florida at ~21:15-21:30. Fertilization rates of all but one hybrid offspring group were high
79
(averaged 93%) (Figure 3.3). Hybrid LT had lower fertilization rates (averaged 79%) compared to all other offspring groups. No fertilization was observed in the ‘no-sperm’ control and self- fertilization tests. Purebred and hybrid embryos developed normally and reached the planula stage
93 h after fertilization (Supplementary Figure S3.2). The hybrid LT also had a slower initial embryonic development rate with the majority of the LT embryos being at the 2-4 cell stage at 3.5 h after fertilization, while embryos of all other offspring groups were at the 8-16 cell stage
(Supplementary Figure S3.2). From 9 h onwards, however, all offspring groups developed at similar rates.
Table 3.2. Spawning date and time of the Acropora spp. from Trunk Reef, central GBR. Date Species Days after Setting time Spawning time full moon 30/11/2015 A. tenuis 4 1815 1900-1930 1/12/2015 A. tenuis 6 1830 1900 1/12/2015 A. loripes 6 2000-2045 2145 2/12/2015 A. loripes 7 1930 2145 2/12/2015 A. sarmentosa 7 1930 2030-2045 2/12/2015 A. florida 7 2030 2130 3/12/2015 A. florida 8 2000 2115
80
Figure 3.3. Fertilization rates of the offspring groups from (A) the Acropora tenuis (T) x Acropora loripes (L) cross, and (B) the Acropora sarmentosa (S) x Acropora florida (F) cross. The abbreviation of the offspring groups is that the first letter represents the origin of the eggs and the second letter the origin of sperm, where TL, LT, SF, FS are hybrids and TT, LL, SS, FF are purebreds. Values are mean and error bars represent 95% CI calculated using the angular transformed data back-transformed into percentages.
3.4.2 Survival
3.4.2.1 Offspring groups
Overall, maternal effects were observed in the hybrid offspring groups of the A. tenuis x A. loripes cross and over-dominance in the A. sarmentosa x A. florida cross, with some variations between treatment conditions (Figure 3.4). Offspring groups differed significantly for survival both in the
A. tenuis x A. loripes cross (GLMM, χ2 = 252.2, df = 3, p < 0.001), and the A. sarmentosa x A. florida cross (GLMM, χ2 = 32.2, df = 3, p < 0.001). The values present below are mean survival and the associated 95% confidence intervals are shown in Table 3.3. For the A. tenuis x A. loripes cross, survival of hybrid LT (49%) and purebred LL (46%) was higher than that of TT (13%) and
TL (16%) under ambient conditions (p < 0.001 for all) (Tables 3.3, 3.4, 3.7). Under elevated conditions, survival of hybrid LT (41%) and purebred LL (36%) was also higher than that of TT
(7%) and TL (23%) (Tables 3.3, 3.4, 3.7). Survival of hybrids was similar to that of their maternal parental purebred offspring. Under elevated conditions, survival of hybrid TL (23%) was also higher than that of purebred TT (7%) (p < 0.001) (Tables 3.3, 3.4, 3.7).
81
Figure 3.4. Averaged survival per tank of the offspring groups of (A) the Acropora tenuis (T) x
Acropora loripes (L) cross, and (B) the Acropora sarmentosa (S) x Acropora florida (F) cross under ambient and elevated conditions across 28 weeks. The abbreviation of the offspring groups is that the first letter represents the origin of the eggs and the second letter the origin of sperm.
Lines represent the estimates of the longitudinal generalized linear models.
82
Table 3.3. Mean survival, SE, as well as lower and upper 95% CI of offspring groups from the Acropora tenuis (T) x Acropora loripes (L) cross and the Acropora sarmentosa (S) x Acropora florida (F) cross under ambient and elevated conditions. The first letter of the abbreviation of the offspring group indicates the origin of the eggs and the second letter the origin of sperm.
Treatment Offspring Effect SE Lower Upper group CI CI Ambient TT 0.13 0.23 0.09 0.19 TL 0.16 0.21 0.11 0.22 LT 0.49 0.20 0.39 0.58 LL 0.46 0.23 0.35 0.57 Elevated TT 0.07 0.23 0.04 0.10 TL 0.23 0.18 0.17 0.29 LT 0.41 0.17 0.33 0.49 LL 0.36 0.19 0.28 0.45 Ambient SS 0.35 0.17 0.28 0.43 SF 0.51 0.26 0.39 0.64 FS 0.53 0.23 0.41 0.64 FF 0.31 0.24 0.22 0.41 Elevated SS 0.18 0.19 0.13 0.24 SF 0.26 0.24 0.18 0.37 FS 0.32 0.22 0.23 0.42 FF 0.20 0.25 0.13 0.29
83
Table 3.4. Tukey’s pairwise comparisons of survival between the offspring groups from the Acropora tenuis (T) x Acropora loripes (L) cross and the Acropora sarmentosa (S) x Acropora florida (F) cross following generalized linear mixed models. The abbreviation of the offspring groups is that the first letter represents the origin of the eggs and the second letter the origin of sperm. An odds ratio of > 1 indicates higher survival, and < 1 indicates lower survival of the first cross in the comparison. Treatment Offspring Log odds SE z-value p-value Odds group ratio ratio Ambient LT - LL 0.13 0.23 0.577 0.564 1.14 TT - TL -0.19 0.22 -0.831 0.437 0.83 TT - LT* -1.83 0.22 -8.426 <0.001 0.16 TL - LT* -1.64 0.20 -8.376 <0.001 0.19 TT - LL* -1.70 0.25 -6.786 <0.001 0.18 TL - LL* -1.51 0.23 -6.451 <0.001 0.22 Elevated LT - LL 0.19 0.18 1.063 0.323 1.21 TT - TL* -1.41 0.22 -6.328 <0.001 0.24 TT - LT* -2.28 0.22 -10.523 <0.001 0.10 TL - LT* -0.87 0.17 -5.212 <0.001 0.42 TT - LL* -2.09 0.23 -8.887 <0.001 0.12 TL - LL* -0.68 0.19 -3.600 <0.001 0.51 Ambient SF - FF* 0.88 0.32 2.772 0.014 2.42 FS - FF* 0.93 0.29 3.160 0.006 2.54 SS - FS* -0.74 0.24 -3.064 0.007 0.48 SS - SF* -0.69 0.27 -2.546 0.022 0.50 SF - FS -0.05 0.31 -0.154 0.878 0.95 SS - FF 0.19 0.25 0.776 0.533 1.21 Elevated SF - FF 0.38 0.32 1.209 0.302 1.47 FS - FF 0.65 0.30 2.148 0.052 1.91 SS - FS* -0.77 0.26 -3.033 0.007 0.46 SS - SF -0.51 0.27 -1.878 0.094 0.60 SF - FS -0.26 0.29 -0.903 0.466 0.77 SS - FF -0.13 0.28 -0.445 0.707 0.88 * indicates significant difference between this offspring group pair.
84
For the A. sarmentosa x A. florida cross, survival of both hybrid SF (51%) and FS (53%) was higher than that of the purebred FF (31%) (p = 0.014, p = 0.006 respectively) and SS (35%) (p =
0.022, p = 0.007 respectively) under ambient conditions (Tables 3.3, 3.4, 3.7). Under elevated conditions, only hybrid FS (32%) had higher survival than purebred SS (18%) (p = 0.007) (Tables
3.3, 3.4, 3.7). When combining the data for all hybrid and purebred offspring groups for an overall comparison, hybrid offspring had a consistently higher survival than purebred offspring
(Supplementary Figure S3.3).
3.4.2.2 Treatments
Treatment had a significant effect on survival of both the A. tenuis x A. loripes cross (GLMM, χ2
= 26.9, df = 1, p < 0.001), and the A. sarmentosa x A. florida cross (GLMM, χ2 = 13.6, df = 1, p <
0.001). Tukey pairwise comparisons suggest that TT, SS, SF and FS had lower survival under elevated conditions compared to ambient conditions at week 28 (p = 0.025, 0.002, 0.007, 0.015 respectively) (Table 3.5).
85
Table 3.5. Tukey’s pairwise comparisons of treatment effect within an offspring group from the Acropora tenuis (T) x Acropora loripes (L) cross and the Acropora sarmentosa (S) x Acropora florida (F) cross following generalized linear mixed models. The abbreviation of the offspring groups is that the first letter represents the origin of the eggs and the second letter the origin of sperm. An odds ratio of > 1 indicates higher survival, and < 1 indicates lower survival under elevated treatment. Treatment Offspring Log odds SE z-value p-value Odds group ratio ratio Elevated vs. Ambient TT* -0.77 0.32 -2.394 0.025 0.46 TL 0.46 0.27 1.678 0.119 1.58 LT -0.32 0.26 -1.227 0.257 0.73 LL -0.38 0.30 -1.253 0.256 0.68 Elevated vs. Ambient SS* -0.90 0.26 -3.531 0.002 0.41 SF* -1.08 0.36 -3.033 0.007 0.34 FS* -0.87 0.32 -2.720 0.015 0.42 FF -0.59 0.35 -1.686 0.135 0.56 * indicates significant difference in survival under different treatments in this offspring group.
3.4.3 Recruit size
3.4.3.1 28 weeks
For the A. tenuis x A. loripes cross, treatment had a significant effect on recruit size (Kruskal-
Wallis, χ2 = 33.6, df = 1, p < 0.001) but offspring group did not (Kruskal-Wallis, χ2 = 6.9, df = 3, p = 0.096) (Figure 3.5). For the A. sarmentosa x A. florida cross, treatment also had a significant effect on recruit size (Kruskal-Wallis, χ2 = 38.2, df = 1, p < 0.001). Offspring group had a significant effect on size under ambient conditions (Kruskal-Wallis, χ2 = 18.2, df = 3, p < 0.001), but not under elevated conditions (Kruskal-Wallis, χ2 = 1.0, df = 3, p = 0.793). Under ambient conditions, the mean size of hybrids FS (41 mm2) and SF (43 mm2) was larger than that of the purebred SS (16 mm2) (z = 3.19, p = 0.003; z = 3.56, p = 0.001 respectively), but not different in size from FF (56 mm2) (Table 3.7).
86
Figure 3.5. Boxplots showing the size of the Acropora offspring groups at 28 weeks since treatment began from (A) the Acropora tenuis (T) x Acropora loripes (L) cross and (B) the
Acropora sarmentosa (S) x Acropora florida (F) cross. The first letter of the offspring groups’ abbreviation represents the origin of the eggs and the second letter the origin of sperm. The horizontal bars represent median values, box length represents the interquartile range, and the small circles denote unusual points.
3.4.3.2 One year
At the one-year time point, several offspring groups no longer had survivors (Figure 3.6, Table
3.7). Note that the treatment condition in this section refers to the treatment conditions that the recruits were exposed to during the 28 week period following settlement, but that they were transferred to long-term grow-out tanks with ambient raw (i.e., unfiltered) seawater afterward. For recruits that were previously under ambient conditions, there were no survivors of purebreds TT and FF, while all hybrid groups had survivors. The mean size of LT (362 mm2) and LL (366 mm2) offspring was larger than that of TL offspring (47 mm2) (t-test, p = 0.008, 0.015 respectively,
87
Tables 3.6, 3.7). The size of the LT hybrids was the same as that of the maternal parent species LL
(i.e., maternal effect). The mean size of FS hybrids (304 mm2) was larger than that of the pure breds SS (30 mm2) (t-test, p = 0.004, Tables 3.6, 3.7). The mean size of hybrid SF (245 mm2, average of 2 recruits) was also relatively larger than SS (30 mm2), however, statistical comparison was not possible due to the low sample size for SF (n = 2) (Table 3.7). For recruits that were previously under elevated conditions, there were no survivors of purebreds TT and SS as well as hybrids TL and SF. The mean size of the hybrid LT recruits (326 mm2) was the same as that of the maternal parent species LL (290 mm2) (Tables 3.6, 3.7). Median sized survivors of hybrid and purebred juveniles at two years of age and are shown in Supplementary Figure S3.4.
88
Figure 3.6. Boxplots showing the size of the Acropora offspring groups at one year of age (i.e.
~five month since relocation to long-term grow-out tank under raw ambient seawater. (A) The
Acropora tenuis (T) x Acropora loripes (L) cross and (B) the Acropora sarmentosa (S) x Acropora florida (F) cross. The first letter of the offspring groups’ abbreviation represents the origin of the eggs and the second letter the origin of sperm. Where no data are presented there were no survivors in that offspring group. The horizontal bars indicate the medians, box length indicates the interquartile range, and the small circles indicate unusual points. Images below the graphs show examples of median size recruits of the offspring groups reared under ambient conditions in the experiment, and the number of survivors of each offspring group.
89
Table 3.6. Results of t-tests comparing size at the one-year time point for remaining offspring groups of the Acropora tenuis (T) x Acropora loripes (L) cross, and the Acropora sarmentosa (S) x Acropora florida (F) cross. The first letter of the offspring groups’ abbreviation represents the origin of the eggs and the second letter the origin of sperm. Treatment Offspring group t df p Ambient TL- LT* 3.204 17 0.008 TL- LL* 2.911 8 0.015 LT- LL 0.054 21 0.478 SS- FS* 3.372 10 0.004 Elevated LT- LL -0.597 18 0.721 * indicates significant difference between this offspring group pair
3.4.4 Symbiodinium uptake and photochemical efficiency
There was no significant difference in Symbiodinium uptake between the offspring groups of the
A. tenuis x A. loripes cross (GLM, χ2 = 3.25, df = 3, p = 0.354) or the offspring groups of the A. sarmentosa x A. florida cross (GLM, χ2 = 5.35, df = 3, p = 0.148) (Supplementary Figure S3.5,
Table 3.7). For the A. sarmentosa x A. florida cross, neither treatment nor offspring groups had a significant effect on photochemical efficiency (Treatment: GLM, χ2 = 0.51, df = 1, p = 0.477; offspring group: GLM, χ2 = 4.28, df = 3, p = 0.233). For the A. tenuis x A. loripes cross, treatment had a significant effect on photochemical efficiency (GLM, χ2 = 6.87, df = 1, p = 0.009) but offspring groups did not (GLM, χ2 = 2.43, df = 3, p = 0.488) (Supplementary Figure S3.6). Tukey pairwise comparisons show that purebreds TT and LL under elevated conditions had lower photochemical efficiency than their counterparts under ambient conditions (p = 0.035, 0.002 respectively).
3.4.5 Summary table
The results of the various traits measured are summarized in Table 3.7.
90
Table 3.7. Summary of the traits measured in the two offspring groups. Values are provided when significant differences between offspring groups were detected. Treatment Cross Survival- Size- Size- Photochemical Symbiodinium 28 weeks 28 weeks one year efficiency uptake^ (%) (mm2) (mm2) Ambient A. tenuis x TT: 13 No difference TT: no survivor No difference# No difference A. loripes TL: 16 TL: 47 LT: 49 LT: 362 LL: 46 LL: 366 Elevated A. tenuis x TT: 7 No difference TT: no survivor No difference# A. loripes TL: 23 TL: no survivor LT: 41 LT: 326 LL: 36 LL: 290 Ambient A. sarmentosa SS: 35 SS: 16 SS: 30 No difference No difference x A. florida SF: 51 SF: 43 SF: 245+ FS: 53 FS: 41 FS: 304 FF: 31 FF: 56 FF: no survivor Elevated A. sarmentosa SS: 18 No difference SS: no survivor No difference x A. florida SF: 26* SF: no survivor FS: 32 FS: 287+ FF: 20* FF: 582+
* Values are not significantly different from other offspring groups of this set. Values are provided for information only. + Statistical comparison was not possible due to low sample sizes (ambient SF: n = 2; elevated FS: n = 2, elevated FF n = 2). Values are provided for information only. # There was no offspring group effect (i.e. no difference between offspring under the same treatment). However, there was a treatment effect, where purebreds TT and LL under elevated conditions had lower photochemical efficiency than their counterparts under ambient conditions. ^ Symbiodinium uptake was assessed before treatment commenced, hence recruits were not under treatment conditions.
91
3.5 Discussion
3.5.1 Limited prezygotic barriers to interspecific hybridization in Acropora corals
To understand the value of hybridization for coral reef restoration, it is important to establish whether prezygotic barriers exist. Interspecific hybridization among Acropora spp. has been shown to occur in experimental crosses, with varying degrees of prezygotic barriers (Willis et al.,
1997; van Oppen et al., 2002; Fogarty et al., 2012; Isomura et al., 2013). Among multiple pairs of
Acropora spp. from the central GBR, crossing resulted in eight pairs with high fertilization (50-
80%), seven pairs with moderate fertilization (10-50%) and three pairs with low fertilization (3-
10%) (Willis et al., 1997; van Oppen et al., 2002). The high fertilization rates and normal embryonic development of the interspecific hybrids produced in this study indicate prezygotic barriers are limited in these species pairs. This was unexpected in the case of the A. tenuis x A. loripes cross which involved an ‘early spawner’ and a ‘late spawner’. These ‘early spawners’ and
‘late spawners’ are believed to have diverged 6.6 Mya (Fukami et al., 2000). We hypothesize that our observations can be explained by the fact that the gametes of these species do not normally encounter one another in the field due to a 2 h difference in spawning times, and selection on prezygotic barriers has therefore been absent. Conversely, A. sarmentosa and A. florida are phylogenetically closely related, occur sympatrically and spawned approximately 30 mins to 1 hour apart. Our results indicate a prezygotic barrier has not evolved to maintain reproductive isolation of these two species either, and that hybridization may occasionally occur in nature.
Lower fertilization in one direction in Acropora hybrid crosses, as was observed for hybrid LT, is not uncommon (Fogarty et al., 2012; Isomura et al., 2013). The likelihood of A. palmata eggs being fertilized by A. cervicornis sperm, for instance, is smaller than the likelihood of A.
92 cervicornis eggs being fertilized by A. palmata sperm (Fogarty et al., 2012). The lower fertilization rate of the hybrid LT, however, did not affect recruit size or survival of this offspring group. The slight delay in embryonic development as observed in the hybrid LT was similar to observations for another Acropora cross in Japan (Isomura at al., 2013). This delay, however, was only limited to one early time point and no aberrant development was observed in the hybrids at any time point.
The results of this and previous studies suggest that the degree of prezygotic barriers varies between Acropora species, and a range of species with limited prezygotic barriers can be used for hybridization with the aim to enhance climate resilience. Interspecific hybridization may also be applied to several other coral genera. Experimental crosses have successfully hybridized species within the genera Montipora and Platygyra (Willis et al., 1997), but were unsuccessful for species in the genus Ctenactis (Baird et al., 2013). Future studies to test the success of interspecific hybridization in additional coral genera will be valuable to determine the extent to which this approach for coral reef restoration can be applied.
3.5.2 Positive effects of hybridization were observed in some F1 hybrids
Given only limited prezygotic barriers exist, we explored whether hybrid offspring had increased resilience and may be used to enhance coral reef restoration efforts. If hybrids are comparatively resilient, interspecific hybridization may be combined with methods being developed for deploying coral larvae or recruits onto reefs requiring restoration (e.g., Omori, 2011; Nakamura et al., 2011; Villanueva et al. 2012; Guest et al., 2014; dela Cruz and Harrison 2017). Overall, maternal effects were observed in hybrids of the A. tenuis x A. loripes cross and over-dominance in hybrids of the A. sarmentosa x A. florida cross, with some variations between traits and treatment conditions. Possible benefits of hybridization in enhancing reef restoration can be
93 observed in both crosses (Table 3.7). In the A. tenuis x A. loripes cross, hybrids of both directions exhibited ~16-34% higher survival than purebred A. tenuis under conditions with elevated temperature and pCO2 (Table 3.7), suggesting hybrids have higher climate resilience than the purebred species. Both purebred species also showed reduced photochemical efficiency under elevated compared to ambient conditions while both hybrid species did not. Furthermore, purebred
A. tenuis had no survivors at the one-year time point, yet hybrids from both directions survived.
For the A. sarmentosa x A. florida cross, hybrids of one or both directions showed ~14-22% higher survival and were larger in size than both or one parental purebred species (Table 3.7). One hybrid offspring group (FS) had survivors in both ambient and elevated conditions at the age of one year, while both purebred species had no survivors in one of these conditions (Table 3.7). The FS hybrid was also 10 times larger in size than the only surviving purebred species (A. sarmentosa) at one year of age under ambient conditions (Table 3.7).
Across all traits measured, hybrids were either equivalent to or more fit than at least one parent, and none of the hybrids performed worse than both parents. These patterns are similar to those seen in some other comparisons. The natural hybrid A. prolifera in the Caribbean (Fogarty, 2012) and experimentally produced hybrids of A. millepora × A. pulchra (Willis et al. 2006) had equivalent or higher fitness compared to their parental species. Experimentally produced hybrids of A. millepora × A. pulchra grow larger in size than purebreds in the reef-flat environment (Willis et al. 2006). In this study, photochemical efficiency was the same between offspring groups in the same treatment, suggesting that 1) the observed differences in recruit size of the offspring groups were unlikely caused by carbon translocation from Symbiodinium, and 2) there was no coral host effect on photochemical efficiency of the Symbiodinium.
94
3.5.3 Hybrid fitness and its relevance to coral reef restoration
A comprehensive assessment of the value of interspecific hybridization to coral reef restoration requires multi-generation fitness examinations of hybrids and backcrosses. Such an assessment will require years given the long generations times of corals (3-7 years to reach reproductive maturity). The present study is one of the few studies that examines the long-term fitness of F1 hybrids and provides detailed assessments from fertilization to embryonic development,
Symbiodinium uptake, photosynthesis efficiency, survival and size. The results provide evidence that hybridization may have value to reef restoration. From the restoration point of view, hybridization increases genetic variation, which can potentially enhance adaptive capacity and release a population from adaptive limits (Hoffmann and Sgrò, 2011; Becker et al., 2013; Carlson et al., 2014; Hamilton and Miller, 2016; van Oppen et al., 2015; Meier et al., 2017). In this study, genetic diversity would have increased in the F1 hybrids and positive effects on survival and recruits size were observed in some cases. Furthermore, none of the hybrid offspring groups performed worse than the purebreds across all traits, suggesting that there was no negative effect of hybridization in the F1. Higher survival and larger recruit size as observed in some hybrids can enhance reef restoration initiatives by reducing post-settlement mortality. Faster growing corals can reach the size that can resist overgrowth by benthic organisms sooner (Buenau et al., 2010) and have greater capacity to survive injury or death of individual polyps (Raymundo and Maypa,
2004; Vermeij and Sandin, 2008). Moreover, reproductive maturity of a coral is related to its size
(Soong and Lang, 1992; Smith et al., 2005). Corals that achieve a large size earlier can begin to reproduce sooner, which may further assist the recovery of degraded reef systems.
95
In the A. tenuis x A. loripes cross, maternal effects were observed in fitness. Hybrid survival and size were similar to that of the maternal purebred species, although it exceeded purebred values in some occasions/conditions. Maternal effects have previously been shown for survival of interspecific hybrid larvae from an A. florida x A. intermedia cross (Isomura et al., 2013), and for thermal tolerance and gene expression levels of intraspecific A. millepora hybrid larvae from a higher and lower latitude cross (Dixon et al., 2015). It is unclear whether the observed fitness for the F1 hybrids from our study is due to nuclear or cytoplasmic maternal effects. If survival and size are governed by nuclear maternal effects, F2 hybrids of both directions will have similar fitness to each other, which will be different from their maternal parent. If survival and size are controlled by cytoplasmic maternal effects, fitness of the F2 hybrids will follow maternal fitness
(Roach and Wulff, 1987; Bernardo, 1996). In this case, species that are known to carry desirable traits under climate change may therefore be ideal candidates as a source of eggs for creating coral stock for restoration via interspecific hybridization.
When selecting species pairs for hybridization to facilitate reef restoration, both targeted crossing with species or individuals that carry phenotypic traits of value under climate change (e.g. high thermal tolerance) and non-targeted crossing between species could be considered. Species with high climate resilience (e.g. A. loripes in the present study) may be useful for targeted hybridization efforts. Alternatively, non-targeted crossing among related species could be used to generate hybrid vigor and increase genetic diversity for future adaptation.
3.5.4 Knowledge gaps and future studies
96
This study provides the first steps towards the assessment of interspecific hybridization as an approach to create coral stock with augmented climate resilience. While our findings are supportive of this novel strategy, additional research is required. Three important outstanding questions are: 1) The fitness of hybrids versus purebreds in the field. While laboratory studies are ideal to investigate the responses of corals to one or two specific stressor(s), corals in the wild are subjected to other selection pressures difficult to simulate in the laboratory. An important next stage of this research would involve outplanting the hybrids and purebreds to the field and monitoring their relative fitness. 2) The reproductive and backcrossing potential of F1 hybrids.
Isomura et al. (2016) have shown that experimentally produced A. intermedia x A. florida F1 hybrids were fertile and able to produce F2 offspring with high fertilization rates. Transgressive segregation can happen in F2 hybrids, where segregating variation of parental species recombines in hybrids at multiple loci to produce extreme phenotypes and may result in some F2 hybrids with extremely high fitness (for review, see Hamilton and Miller, 2016). Conversely, outbreeding depression may become apparent in the F2 generations and result in hybrids with low fitness. For example, F2 hybrids of African haplochromine cichlid fish spp. showed lower survival than F1 hybrids and their parental purebreds (Stelkens et al., 2015).
F1 hybrids of the A. intermedia x A. florida cross were able to backcross with either both parent species or the maternal parent species only, depending on the direction of the hybrid cross (Isomura et al., 2016). In the Caribbean, molecular evidence has shown unidirectional gene flow from A. palmata into A. cervicornis, suggesting that their hybrid A. prolifera is fertile and able to backcross with at least one parental species (Vollmer and Palumbi, 2002; Vollmer and Palumbi, 2007).
Current knowledge on fertility of F1 coral hybrids remains limited and future studies in the area
97 will be invaluable. 3) The fitness of advanced generation hybrids and backcrosses. If F1 hybrids are fertile and sexual reproduction is successful, high fitness will have to be maintained in the F2, backcrosses and advanced generation hybrids for interspecific hybridization to be beneficial to reef recovery and resilience in the long-term (Edmands, 2007; Chan et al., 2017).
F1 hybrids can theoretically propagate via asexual reproduction, and via sexual reproduction with other hybrids or the parental species. The likelihood of the latter depends on the spawning time of the F1 hybrids and the parental species. The A. tenuis x A. loripes cross in the present study had 2 h difference in spawning time and the A. sarmentosa x A. florida cross had 30 min to 1 h difference.
While the spawning time of the hybrids remains unknown until they reach reproductive maturity,
Isomura et al. (2016) showed that F1 Acropora hybrid spawned at the same time as their maternal parental species. This suggests that the F1 in the present study will likely be able to at least backcross with the maternal parent species for the A. tenuis x A. loripes cross, and potentially with both parental species for the A. sarmentosa x A. florida cross due to closer spawning time. Asexual reproduction (i.e., fragmentation, polyp bail-out) is a common reproductive strategy of broadcast spawning scleractinian corals (Highsmith, 1982; Sammarco, 1982) and F1 hybrids may also persist in the wild via this method. A. prolifera, the natural F1 hybrid in the Caribbean for example, is known to persist and colonize large reef areas through asexual reproduction (Irwin et al., 2017).
In sum, it is likely that interspecific Acropora hybrids are able to propagate over extended periods of time, either sexually, asexually or via both reproductive methods. Before hybrids can safely be used as stock for restoration; however, it must be demonstrated that the risk of this strategy is low
98 by showing that the fitness of later generations remains equal or superior to that of the parental species in the wild.
Reference
50 Reefs (2017). Available online at: https://50reefs.org/ (Accessed April 3, 2018).
Aguilar-Perera, A., and Hernández-Landa, R. C. (2017). Occurrence of large thickets of Acropora prolifera (Scleractinia: Acroporidae) in the southern Gulf of Mexico. Mar Biodiv, 1–3. doi:10.1007/s12526-017-0685-4.
Aitken, S. N., and Whitlock, M. C. (2013). Assisted gene flow to facilitate local adaptation to climate change. Annual Review of Ecology, Evolution, and Systematics 44, 367–388. doi:10.1146/annurev-ecolsys-110512-135747.
Akaike, H. (1974). A new look at the statistical model identification. IEEE Transactions on Automatic Control 19, 716–723. doi:10.1109/TAC.1974.1100705.
Baird, A. H., Cumbo, V. R., Figueiredo, J., and Harii, S. (2013). A pre-zygotic barrier to hybridization in two con-generic species of scleractinian corals. F1000Res 2. doi:10.12688/f1000research.2-193.v2
Bates, D., Mächler, M., Bolker, B., and Walker, S. (2014). Fitting linear mixed-effects models using lme4. Journal of Statistical Software 67, 1–48.
Becker, M., Gruenheit, N., Steel, M., Voelckel, C., Deusch, O., Heenan, P. B., et al. (2013). Hybridization may facilitate in situ survival of endemic species through periods of climate change. Nature Clim. Change 3, 1039–1043. doi:10.1038/nclimate2027.
Benjamini, Y., and Hochberg, Y. (1995). Controlling the false discovery rate: A practical and powerful approach to multiple testing. Journal of the Royal Statistical Society. Series B (Methodological) 57, 289–300. doi:10.2307/2346101.
Berkelmans, R. (2009). Bleaching and mortality thresholds: How much is too much? SpringerLink, 103–119. doi:10.1007/978-3-540-69775-6_7.
Bernardo, J. (1996). Maternal effects in animal ecology. Integr Comp Biol 36, 83–105. doi:10.1093/icb/36.2.83.
Bolker, B. M., Brooks, M. E., Clark, C. J., Geange, S. W., Poulsen, J. R., Stevens, M. H. H., et al. (2009). Generalized linear mixed models: a practical guide for ecology and evolution.
99
Trends in Ecology & Evolution 24, 127–135. doi:10.1016/j.tree.2008.10.008.
Breed, M. F., Stead, M. G., Ottewell, K. M., Gardner, M. G., and Lowe, A. J. (2013). Which provenance and where? Seed sourcing strategies for revegetation in a changing environment. Conserv Genet 14, 1–10. doi:10.1007/s10592-012-0425-z.
Buenau, K. E., Price, N. N., and Nisbet, R. M. (2011). Local interactions drive size dependent space competition between coral and crustose coralline algae. Oikos 120, 941–949. doi:10.1111/j.1600-0706.2010.18972.x.
Carlson, S. M., Cunningham, C. J., and Westley, P. A. H. (2014). Evolutionary rescue in a changing world. Trends in Ecology & Evolution 29, 521–530. doi:10.1016/j.tree.2014.06.005.
Chan, N. C. S., and Connolly, S. R. (2013). Sensitivity of coral calcification to ocean acidification: a meta-analysis. Global Change Biology 19, 282–290. doi:10.1111/gcb.12011.
Chen, Z. J. (2013). Genomic and epigenetic insights into the molecular bases of heterosis. Nat Rev Genet 14, 471–482. doi:10.1038/nrg3503. dela Cruz, D. W., and Harrison, P. L. (2017). Enhanced larval supply and recruitment can replenish reef corals on degraded reefs. Scientific Reports 7, 13985. doi:10.1038/s41598-017-14546- y.
Dixon, G. B., Davies, S. W., Aglyamova, G. V., Meyer, E., Bay, L. K., and Matz, M. V. (2015). Genomic determinants of coral heat tolerance across latitudes. Science 348, 1460. doi:10.1126/science.1261224.
Doney, S. C., Fabry, V. J., Feely, R. A., and Kleypas, J. A. (2009). Ocean acidification: The other CO2 problem. Annual Review of Marine Science 1, 169–192. doi:10.1146/annurev.marine.010908.163834.
Dunn, O. J. (1964). Multiple comparisons using rank sums. Technometrics 6, 241–252. doi:10.1080/00401706.1964.10490181.
Eakin, C. M., Liu, G., Gomez, A. M., De La Cour, J. L., Heron, S. F., Skirving, W. J., Geiger, E. F., et al. (2016) Global coral bleaching 2014-2017? Status and an appeal for observations. Reef Encounter 31, 20-26
Fogarty, N. D. (2012). Caribbean acroporid coral hybrids are viable across life history stages. Mar Ecol Prog Ser 446, 145–159. doi:10.3354/meps09469.
Fogarty, N. D., Vollmer, S. V., and Levitan, D. R. (2012). Weak prezygotic isolating mechanisms
100
in threatened Caribbean Acropora corals. PLoS ONE 7, e30486. doi:10.1371/journal.pone.0030486
Fukami, H., Omori, M., and Hatta, M. (2000). Phylogenetic relationships in the coral family Acroporidae, reassessed by inference from mitochondrial genes. Zoological Science 17, 689–696. doi:10.2108/zsj.17.689.
Garnett, S. T., Olsen, P., Butchart, S. H. M., and Hoffmann, A. A. (2011). Did hybridization save the Norfolk Island boobook owl Ninox novaeseelandiae undulata? Oryx 45, 500–504. doi:10.1017/S0030605311000871.
Grant, P. R., and Grant, B. R. (2010). Conspecific versus heterospecific gene exchange between populations of Darwin’s finches. Philosophical Transactions of the Royal Society of London B: Biological Sciences 365, 1065–1076. doi:10.1098/rstb.2009.0283.
Great Barrier Reef Marine Park Authority (2017). Final report: 2016 coral bleaching event on the Great Barrier Reef. Great Barrier Reef Marine Park Authority
Guest, J. R., Baird, A. H., Maynard, J. A., Muttaqin, E., Edwards, A. J., Campbell, S. J., et al. (2012). Contrasting patterns of coral bleaching susceptibility in 2010 suggest an adaptive response to thermal stress. PLOS ONE 7, e33353. doi:10.1371/journal.pone.0033353.
Guest, J. R., Baria, M. V., Gomez, E. D., Heyward, A. J., and Edwards, A. J. (2014). Closing the circle: is it feasible to rehabilitate reefs with sexually propagated corals? Coral Reefs 33, 45–55. doi:10.1007/s00338-013-1114-1.
Hamilton, J. A., and Miller, J. M. (2016). Adaptive introgression as a resource for management and genetic conservation in a changing climate. Conservation Biology 30, 33–41. doi:10.1111/cobi.12574.
Heron, S. F., Maynard, J. A., van Hooidonk, R., and Eakin, C. M. (2016). Warming trends and bleaching stress of the world’s coral reefs 1985–2012. Sci Rep 6. doi:10.1038/srep38402.
Highsmith, R. C. (1982). Reproduction by fragmentation in corals. Marine Ecology Progress Series 7, 207–226. doi:10.2307/24815005.
Hoegh-Guldberg, O. (1999). Climate change, coral bleaching and the future of the world’s coral reefs. Mar. Freshwater Res. 50, 839–866. doi:10.1071/mf99078.
Hoffmann, A. A., and Sgrò, C. M. (2011). Climate change and evolutionary adaptation. Nature 470, 479–485. doi:10.1038/nature09670.
Hönisch, B., Ridgwell, A., Schmidt, D. N., Thomas, E., Gibbs, S. J., Sluijs, A., et al. (2012). The
101
geological record of ocean acidification. Science 335, 1058–1063. doi:10.1126/science.1208277.
Hothorn, T., Bretz, F., and Westfall, P. (2008). Simultaneous inference in general parametric models. Biom. J. 50, 346–363. doi:10.1002/bimj.200810425.
Hughes, T. P., Kerry, J. T., Álvarez-Noriega, M., Álvarez-Romero, J. G., Anderson, K. D., Baird, A. H., et al. (2017). Global warming and recurrent mass bleaching of corals. Nature 543, 373–377.
Hughes, T. P., Anderson, K. D., Connolly, S. R., Heron, S. F., Kerry, J. T., Lough, J. M., et al. (2018). Spatial and temporal patterns of mass bleaching of corals in the Anthropocene. Science 359, 80. doi:10.1126/science.aan8048.
Hwang, A. S., Northrup, S. L., Peterson, D. L., Kim, Y., and Edmands, S. (2012). Long-term experimental hybrid swarms between nearly incompatible Tigriopus californicus populations: persistent fitness problems and assimilation by the superior population. Conserv Genet 13, 567–579. doi:10.1007/s10592-011-0308-8.
Irwin, A., Greer, L., Humston, R., Devlin-Durante, M., Cabe, P., Lescinsky, H., et al. (2017). Age and intraspecific diversity of resilient Acropora communities in Belize. Coral Reefs, 1–10. doi:10.1007/s00338-017-1602-9.
Isomura, N., Iwao, K., and Fukami, H. (2013). Possible natural hybridization of two morphologically distinct species of Acropora (Cnidaria, Scleractinia) in the Pacific: fertilization and larval survival rates. PLoS ONE 8, e56701. doi:10.1371/journal.pone.0056701.
Isomura, N., Iwao, K., Morita, M., and Fukami, H. (2016). Spawning and fertility of F1 hybrids of the coral genus Acropora in the Indo-Pacific. Coral Reefs 35, 851–855. doi:10.1007/s00338-016-1461-9.
Japaud, A., Fauvelot, C., and Bouchon, C. (2014). Unexpected high densities of the hybrid coral Acropora prolifera (Lamarck 1816) in Guadeloupe Island, Lesser Antilles. Coral Reefs 33, 593–593. doi:10.1007/s00338-014-1169-7.
Johnson, W. E., Onorato, D. P., Roelke, M. E., Land, E. D., Cunningham, M., Belden, R. C., et al. (2010). Genetic restoration of the Florida Panther. Science 329, 1641–1645. doi:10.1126/science.1192891.
Jones, T. A., and Monaco, T. A. (2009). A role for assisted evolution in designing native plant materials for domesticated landscapes. Frontiers in Ecology and the Environment 7, 541– 547. doi:10.1890/080028.
102
Langdon, C., Takahashi, T., Sweeney, C., Chipman, D., Goddard, J., Marubini, F., et al. (2000). Effect of calcium carbonate saturation state on the calcification rate of an experimental coral reef. Global Biogeochemical Cycles 14, 639–654. doi:10.1029/1999GB001195.
Levene, H. (1960). Robust tests for equality of variances. Contributions to probability and statistics, 1, 278-292.
Lewis E., Wallace D.W.R. (1998) CO2SYS program developed for the CO2 system calculations. Carbon Dioxide Information Analysis Center, Oak Ridge National Laboratory, US Department of Energy, Oak Ridge, TennesseeLi, L., Lu, K., Chen, Z., Mu, T., Hu, Z., and
Li, X. (2008). Dominance, overdominance and epistasis condition the heterosis in two heterotic rice hybrids. Genetics 180, 1725–1742. doi:10.1534/genetics.108.091942.
Lippman, Z. B., and Zamir, D. (2007). Heterosis: revisiting the magic. Trends in Genetics 23, 60– 66. doi:10.1016/j.tig.2006.12.006.
Márquez, L. M., Van Oppen, M. J. H., Willis, B. L., Reyes, A., and Miller, D. J. (2002). The highly cross-fertile coral species, Acropora hyacinthus and Acropora cytherea, constitute statistically distinguishable lineages. Molecular Ecology 11, 1339–1349. doi:10.1046/j.1365-294X.2002.01526.x.
Maynard, J. A., Anthony, K. R. N., Marshall, P. A., and Masiri, I. (2008). Major bleaching events can lead to increased thermal tolerance in corals. Mar Biol 155, 173–182. doi:10.1007/s00227-008-1015-y.
Mcculloch, C. E., and Neuhaus, J. M. (2013). “Generalized Linear Mixed Models,” in Encyclopedia of Environmetrics (John Wiley & Sons, Ltd). doi:10.1002/9780470057339.vag009.pub2.
Meier, J. I., Marques, D. A., Mwaiko, S., Wagner, C. E., Excoffier, L., and Seehausen, O. (2017). Ancient hybridization fuels rapid cichlid fish adaptive radiations. Nat Commun 8. doi:10.1038/ncomms14363.
Nakamura, R., Ando, W., Yamamoto, H., Kitano, M., Sato, A., Nakamura, M., et al. (2011). Corals mass-cultured from eggs and transplanted as juveniles to their native, remote coral reef. Marine Ecology Progress Series 436, 161–168.
Omori, M. (2011). Degradation and restoration of coral reefs: Experience in Okinawa, Japan. Marine Biology Research 7, 3–12. doi:10.1080/17451001003642317.
Pandolfi, J. M., Connolly, S. R., Marshall, D. J., and Cohen, A. L. (2011). Projecting coral reef futures under global warming and ocean acidification. Science 333, 418–422.
103
doi:10.1126/science.1204794.
Penin, L., Vidal-Dupiol, J., and Adjeroud, M. (2013). Response of coral assemblages to thermal stress: are bleaching intensity and spatial patterns consistent between events? Environ Monit Assess 185, 5031–5042. doi:10.1007/s10661-012-2923-3.
Pierrot D., Lewis E., Wallace D.W.R. (2006) CO2SYS DOS program developed for CO2 system calculations. ORNL/CDIAC-105. Carbon Dioxide Information Analysis Center, Oak Ridge National Laboratory, US Department of Energy, Oak Ridge, Tennessee
R Core Team (2016). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria.
Raftery, A. E., Zimmer, A., Frierson, D. M. W., Startz, R., and Liu, P. (2017). Less than 2 °C warming by 2100 unlikely. Nature Climate Change 7, 637. doi:10.1038/nclimate3352.
Randall, C. J., and Szmant, A. M. (2009). Elevated temperature affects development, survivorship, and settlement of the elkhorn coral, Acropora palmata (Lamarck 1816). Biol. Bull. 217, 269–282. doi:10.1086/BBLv217n3p269.
Rau, G. H., McLeod, E. L., and Hoegh-Guldberg, O. (2012). The need for new ocean conservation strategies in a high-carbon dioxide world. Nature Clim. Change 2, 720–724. doi:10.1038/nclimate1555.
Raymundo, L. J., and Maypa, A. P. (2004). Getting bigger faster: mediation of size-specific mortality via fusion in juvenile coral transplants. Ecol. Appl. 14, 281–295. doi:10.1890/02- 5373.
Roach, D. A., and Wulff, R. D. (1987). Maternal effects in plants. Annual Review of Ecology and Systematics 18, 209–235. doi:10.1146/annurev.es.18.110187.001233.
Sammarco, P. W. (1982). Polyp bail-out: an escape response to environmental stress and a new means of reproduction in corals. Marine Ecology Progress Series 10, 57–65. doi:10.2307/24815014.
Sgrò, C. M., Lowe, A. J., and Hoffmann, A. A. (2011). Building evolutionary resilience for conserving biodiversity under climate change. Evolutionary Applications 4, 326–337. doi:10.1111/j.1752-4571.2010.00157.x.
Shapiro, S. S., and Wilk, M. B. (1965). An analysis of variance test for normality (complete samples). Biometrika 52, 591–611. doi:10.2307/2333709.
Smith, L. D., Devlin, M., Haynes, D., and Gilmour, J. P. (2005). A demographic approach to
104
monitoring the health of coral reefs. Marine Pollution Bulletin 51, 399–407. doi:10.1016/j.marpolbul.2004.11.021.
Soong, K., and Lang, J. C. (1992). Reproductive integration in reef corals. The Biological Bulletin 183, 418–431. doi:10.2307/1542018.
Stelkens, R. B., Schmid, C., and Seehausen, O. (2015). Hybrid Breakdown in Cichlid Fish. PLOS ONE 10, e0127207. doi:10.1371/journal.pone.0127207. van Hooidonk, R., Maynard, J., Tamelander, J., Gove, J., Ahmadia, G., Raymundo, L., et al. (2016). Local-scale projections of coral reef futures and implications of the Paris Agreement. Scientific Reports 6, srep39666. doi:10.1038/srep39666. van Oppen, M. J. H., Gates, R. D., Blackall, L. L., Cantin, N., Chakravarti, L. J., Chan, W. Y., et al. (2017). Shifting paradigms in restoration of the world’s coral reefs. Global Change Biology. doi:10.1111/gcb.13647. van Oppen, M. J. H., McDonald, B. J., Willis, B., and Miller, D. J. (2001). The evolutionary history of the coral genus Acropora (Scleractinia, Cnidaria) based on a mitochondrial and a nuclear marker: reticulation, incomplete lineage sorting, or morphological convergence? Mol Biol Evol 18, 1315–1329. doi:10.1093/oxfordjournals.molbev.a003916. van Oppen, M. J. H., Oliver, J. K., Putnam, H. M., and Gates, R. D. (2015). Building coral reef resilience through assisted evolution. PNAS 112, 2307–2313. doi:10.1073/pnas.1422301112. van Oppen, M. J. H., Willis, B. L., Van Rheede, T., and Miller, D. J. (2002). Spawning times, reproductive compatibilities and genetic structuring in the Acropora aspera group: evidence for natural hybridization and semi-permeable species boundaries in corals. Mol. Ecol. 11, 1363–1376.
Vermeij, M. J. A., and Sandin, S. A. (2008). Density-Dependent Settlement and Mortality Structure the Earliest Life Phases of a Coral Population. Ecology 89, 1994–2004. doi:10.1890/07-1296.1.
Villanueva, R. D., Baria, M. V. B., and Cruz, D. W. dela (2012). Growth and survivorship of juvenile corals outplanted to degraded reef areas in Bolinao-Anda Reef Complex, Philippines. Marine Biology Research 8, 877–884. doi:10.1080/17451000.2012.682582.
Vollmer, S. V., and Palumbi, S. R. (2002). Hybridization and the evolution of reef coral diversity. Science 296, 2023–2025. doi:10.1126/science.1069524.
Vollmer, S. V., and Palumbi, S. R. (2007). Restricted gene flow in the caribbean staghorn coral
105
Acropora cervicornis: implications for the recovery of endangered reefs. J Hered 98, 40– 50. doi:10.1093/jhered/esl057.
Weeks, A. R., Heinze, D., Perrin, L., Stoklosa, J., Hoffmann, A. A., Rooyen, A., et al. (2017). Genetic rescue increases fitness and aids rapid recovery of an endangered marsupial population. Nature Communications 8, 1071. doi:10.1038/s41467-017-01182-3.
Whiteley, A. R., Fitzpatrick, S. W., Funk, W. C., and Tallmon, D. A. (2015). Genetic rescue to the rescue. Trends in Ecology & Evolution 30, 42–49. doi:10.1016/j.tree.2014.10.009.
Willis, B. L., Babcock, R. C., Harrison, P. L., and Wallace, C. C. (1997). Experimental hybridization and breeding incompatibilities within the mating systems of mass spawning reef corals. Coral Reefs 16, S53–S65. doi:10.1007/s003380050242.
Willis, B. L., Oppen, M. J. H. van, Miller, D. J., Vollmer, S. V., and Ayre, D. J. (2006). The role of hybridization in the evolution of reef corals. Annual Review of Ecology, Evolution, and Systematics 37, 489–517.
106
Acknowledgements
This study was funded by the Paul G. Allen Philanthropies and the Australian Institute of Marine
Science (AIMS). I thank staffs of the National Sea Simulator at AIMS for technical support.
Thanks are also extended to M. Nordborg for her contribution to analysing the coral embryos, K.
Damjanovic, R. Alfred and L. Blackall for help with coral spawning work, and M. Shanahan for seawater alkalinity measurements.
107
Chapter 4
The roles of age, parentage and environment on bacterial and algal endosymbiont
communities in Acropora corals
4.1 Abstract
The bacterial and microalgal endosymbiont (Symbiodiniaceae spp.) communities associated with corals have important roles in their health and resilience, yet little is known about the factors driving their succession during early coral life stages. Using 16S rRNA gene and ITS2 metabarcoding, we compared these communities in four Acropora coral species and their hybrids obtained from two laboratory crosses (Acropora tenuis x Acropora loripes, Acropora sarmentosa x Acropora florida) across the parental, recruit (seven months old) and juvenile (two years old) stages. We tested whether these differed 1) between life stages, 2) between hybrids and purebreds, and 3) between treatment conditions (ambient/elevated temperature and pCO2). Microbial communities of early life stage corals were highly diverse, lacked host specificity and were primarily determined by treatment conditions. Over time, a winnowing process occurred, and distinct microbial communities developed between the two species pair crosses by two years of age, irrespective of hybrid or purebred status. These findings suggest that the microbial communities of corals have a period of flexibility prior to adulthood, which can be valuable to future research aimed at the manipulation of coral microbial communities.
108
4.2 Introduction
Reef-building corals associate with diverse microbial communities including dinoflagellates
(Symbiodiniaceae), prokaryotes (bacteria, archaea), fungi, and viruses (Blackall et al., 2015;
Rosenberg et al., 2007). Bacteria and Symbiodiniaceae, in particular, are known to contribute essential functions to the coral hosts (Blackall et al., 2015; Rosenberg et al., 2007). Bacteria occupy the surface mucus layer, tissue, gastrovascular cavity and skeleton of corals (Bourne and Munn,
2005). They scavenge nutrients (Knowlton and Rohwer, 2003; Zhang et al., 2015), providing vital products to their coral host via carbon, nitrogen, sulfur and phosphorus cycling (Kimes et al., 2010;
Lesser et al., 2007; Raina et al., 2009, 2010; Zhang et al., 2015). Bacteria also defend the coral host against predation and pathogens through secondary metabolites and antimicrobial compounds
(Castillo et al., 2001; Nissimov et al., 2009; Raina et al., 2010). Symbiodiniaceae algae live inside the coral gastrodermal cells and provide their host with fixed organic carbon from photosynthesis; in return the algae gain protection and inorganic waste metabolites (Muscatine, 1967).
Symbiodiniaceae and bacterial symbionts can be transmitted vertically (from parent to offspring) and/or horizontally (acquired from the environment) (Apprill et al., 2009; Ceh et al., 2013; Padilla-
Gamiño et al., 2012; Sharp et al., 2010, 2010, 2012, 2012; van Oppen, 2001). Multiple
Symbiodiniaceae and bacterial taxa can co-exist within a coral host, with up to 102-103 bacterial operational taxonomic units (OTUs) and ~ 15 Symbiodiniaceae OTUs (based on 97 % similarity cut-off) found within a coral host (Blackall et al., 2015).
Temporal changes and spatial differences in bacterial communities associated with adult coral colonies are thought to be driven by a variety of factors, including temperature (Bourne et al.,
2007; Lins-de-Barros et al., 2013; Littman et al., 2010; Ritchie, 2006; Santos et al., 2014; Tout et
109 al., 2015; Webster et al., 2016), pH (Meron et al., 2011; Morrow et al., 2015; Webster et al., 2013), coral health status (Frias-Lopez et al., 2002; Jones et al., 2004; Ritchie et al., 1994; Sato et al.,
2013; Ziegler et al., 2017), light intensity, water depth and nutrient level (Hernandez-Agreda et al., 2017). Conversely, bacterial communities of conspecific corals may remain stable despite seasonal environmental variations (Littman et al., 2009b) or exposure to different pCO2/pH conditions (Meron et al., 2012; Webster et al., 2016; Zhou et al., 2016). While the succession of coral-associated bacterial communities is poorly studied, community winnowing during coral development into adulthood is an emerging pattern (Lema et al., 2014; Littman et al., 2009b).
Symbiodiniaceae communities of corals may vary between reef sites and microhabitats that differ in light (Iglesias-Prieto et al., 2004) and temperature (Oliver and Palumbi, 2011), although stable communities over time (Pettay et al., 2011) and with changing temperature conditions (McGinley et al., 2012) have also been observed. Symbiodiniaceae genera and strains can differ in their thermal tolerance and physiological optima, and this affects thermal tolerance of the coral-microbe symbiosis, aka the coral holobiont (Boulotte et al., 2016; Stat and Gates, 2011). The loss of
Symbiodiniaceae (i.e., coral bleaching) as a consequence of thermal stress often results in coral mortality (Douglas, 2003; Hoegh-Guldberg, 1999). A common finding is that corals dominated by
Durusdinium spp. have higher thermal tolerance compared to those dominated by Cladocopium spp. (Berkelmans and Oppen, 2006; Stat and Gates, 2011), although the opposite has also been documented (Abrego et al., 2008). Young coral recruits generally harbour a high diversity of
Symbiodiniaceae strains, but these communities can go through a winnowing process as the coral ages (Abrego et al., 2009; Gómez-Cabrera et al., 2008; Little et al., 2004).
The aim of this study was to investigate the composition and succession of bacterial and
Symbiodiniaceae communities in hybrid and purebred Acropora corals. Hybrid Acropora corals
110 naturally occur in the Caribbean (Fogarty, 2010, 2012; Irwin et al., 2017; Vollmer and Palumbi,
2002) and Indo-Pacific (Richards et al., 2008; van Oppen et al., 2001; Willis et al., 2006), and they have comparatively high fitness in the laboratory (Chan et al., 2018; Isomura et al., 2013; Willis et al., 2006) and in the wild (Fogarty, 2012). However, information about their bacterial and
Symbiodiniaceae communities is completely lacking. Access to purebred and interspecific hybrid offspring from four Acropora species bred in the laboratory and exposed to ambient and elevated temperature and pCO2 conditions for seven months, followed by a 13 month grow-out period under ambient conditions, allowed us to examine the influence of coral age, parentage and treatment conditions on the composition of the microbiome. In addition, we addressed whether the coral- associated microbial communities contributed to the differences in holobiont fitness previously reported (Chan et al., 2018).
4.3 Materials and methods
4.3.1 Experimental design and sampling
Adult parental corals were collected from Trunk Reef, central Great Barrier Reef in November
2015 and bred to form 1) an Acropora tenuis x Acropora loripes cross, and 2) an Acropora sarmentosa x Acropora florida cross, each resulting in two purebred and two hybrid offspring groups. Detailed crossing protocols and experimental design are in Chan et al. (Chan et al., 2018).
After successful fertilization was confirmed, a ~ 6 cm branch of each adult parents was removed and stored in absolute EtOH for microbial community analyses (n = 5 for A. tenuis, n = 2 for A. loripes, n = 5 for A. sarmentosa, and n = 2 for A. florida). Eight offspring groups (four hybrid and four purebred groups) resulted from the two crosses: TT, TL, LT and LL for the A. tenuis x A. loripes cross, and SS, SF, FS and FF for the A. sarmentosa x A. florida cross. The abbreviation of
111 the offspring groups is that the first letter represents the origin of the eggs and the second letter the origin of sperm (e.g., TL is a hybrid crossed with A. tenuis (T) eggs with A. loripes (L) sperm).
During larval settlement, Symbiodiniaceae cells isolated from the parents were added at a density of 2 × 106 cells mL−1 to encourage Symbiodiniaceae uptake (see (Chan et al., 2018) for protocol).
Recruits settled onto ceramic plugs were randomly distributed and reared under ambient conditions
(27ºC and 415 ppm pCO2) or elevated conditions (ambient +1 ºC and 685 ppm pCO2) for seven months in filtered seawater (0.5 µm) (n = 12 tanks per treatment, and n = 20 plugs per offspring group per tank). Light was provided at ~ 120 µE m-2 s-1 using Aquaillumination Hydra following the natural light/dark cycle. Fitness comparisons (e.g., survival, growth) between hybrids and purebreds are reported in (Chan et al., 2018). At the end of the seven-months experiment (Jul
2016), three recruits from three randomly selected tanks of each treatment were sampled and stored in absolute EtOH (n = 3 per offspring group per tank per treatment, 144 samples total).
At one year of age, the recruits were moved to two grow-out tanks. Light was gradually increased to 250 µE m-2 s-1 over two weeks, and the juveniles were maintained under ambient conditions. To assess possible changes in microbial communities between the recruit and juvenile life stages, a branch tip was sampled from two years old juveniles in November 2017 and stored in absolute
EtOH. A total of 33 samples were collected (Supporting information Table 4.1). Three individuals per offspring group per treatment (previous treatment) were sampled whenever possible, however, certain offspring groups/treatment did not have three samples due to mortality (Supporting information Table 4.1). Three 1 L seawater samples were also collected from each rearing tank and filtered on a 0.22 µm Sterivex filter using a peristaltic pump. The total number of samples of the two crosses in this study was 200 (n = 14 for adult parents, n = 144 for seven months old
112 recruits, n = 33 for two years old juveniles, n = 6 for seawater, n = 1 for 16S mock community, n
= 1 for ITS mock community and n = 2 for negative controls - see below).
4.3.2 DNA extraction, PCR amplification and library preparation
Detailed protocols of DNA extraction, PCR amplification and library preparation can be found in the Supplemental Materials and Methods. Briefly, DNA was extracted using a salting-out method with bead beating and additional enzymatic digestion steps with Lysozyme and Proteinase K. A tissue-free extraction was also conducted as a contamination control. For the bacterial 16S rRNA gene, a reference mock community was constructed using equal quantities of PCR-amplified cell lysate of pure cultures of seven bacterial species including Acinetobacter (MH744724),
Bacterioplanes (MH744725), Marinobacter (MK088251), Paracoccus (MH744726),
Pseudoalteromonas (MK088250), Pseudovibrio (KX198136) and Vibrio (X56578) (see
Supplemental Materials and Methods on how the amplicons were quantified and pooled). The
Primers 515fB [5’- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGY
CAGCMGCCGCGGTAA-3’] (Apprill et al., 2015) and 806rB [5’- GTCTCGTGGGCTCGGAG
ATGTGTATAAGAGACAGGGACTACNVGGGTWTCTAAT-3’] (Parada et al., 2016) with
Illumina adapter sequences (underlined) (Illumina, San Diego, California, USA) added at the 5- prime ends were used to amplify the hypervariable V4 region of the bacterial 16S rRNA gene.
A reference mock community was also established for Symbiodiniaceae ITS2 amplicon sequencing using equal quantities of PCR products from 10 Symbiodiniaceae cultures, representing eight sequence types. These included sequence type A (MK007295, MK007303), A2
(MK007324), A3 (MK007259, MK007296), C1 (MK007304), D1a (MH229352), F1(AF427462)
113 and F5.1(MK007305), G3(MH229354) (see Supplemental Materials and Methods for details).
Symbiodiniaceae ITS2 primers itsD [5′-
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATTGCAGAACTCCGTG-3'] and Its2rev2 [5′- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCTCCGCTTACTT
ATATGCTT-3](Pochon et al., 2001) with Illumina adapter sequences (underlined) added at the 5- prime ends were used to amplify the partial 5.8S, entire ITS2 and partial 28S rDNA genes.
For both loci, triplicate 15 µL PCR reactions were set up for each sample, the mock community, tissue-free extraction control and no-template PCR control. PCR cycling conditions included an initial denaturation at 95ºC for 10 min followed by 28 cycles at 95ºC for 30 s, 55ºC for 30 s, and
72ºC for 30 s; and a final extension at 72ºC for 10 min. Triplicate PCR products for each sample were pooled, purified and visualized on agarose gels. A single Indexing PCR reaction was carried out on each purified sample amplicon pool, following the Illumina Metagenome Sequencing library preparation guide. Indexing PCR products were bead purified and quantified. Sample concentrations were normalized to 25 nM, pooled in equal volumes and sent to Ramaciotti Centre for Genomics (UNSW, Sydney, Australia) for MiSeq v3 sequencing.
114
4.3.3 Sequence data processing
Demultiplexed FASTQ files were processed via Qiime1 (v1.9.1) with a custom pipeline. All samples were processed in the same run and read quality was visualized using FastQC.
Conservative quality trimming was conducted using Trimmomatic and sequence reads were joined using PandaSeq. Chimeras were identified using Usearch61 against reference data bases (SILVA
132 for the bacteria data and Arif et al. 2014 (Arif et al., 2014) for the Symbiodiniaceae data) and chimeras were removed. OTU (Operational Taxonomic Unit) picking was conducted at a 97% similarity cut-off for both bacterial 16S and Symbiodiniaceae ITS2 and reference sequences for each OTU were determined. Open reference or closed reference OTU picking was applied to the bacterial data and the Symbiodiniaceae data, respectively. For the bacterial data, sequences classified as eukaryotes and chloroplasts were removed. OTUs with relative abundance of <
0.005% were removed and raw counts were outputted for statistical analyses.
4.3.4 Statistical analyses
Library sizes of the samples were rarefied at a rarefaction level of 1830 reads and 1719 reads for the bacterial and Symbiodiniaceae data, respectively. Of the 201 samples, eleven were removed from the bacterial data and seven from the Symbiodiniaceae data due to low read counts. The negative controls had < 22 reads and typically only one read for each OTU. The relationship between read depths and alpha-diversity (Chao, 2005) was visually checked and this confirmed that alpha-diversity plateaued before the selected rarefaction level (Supporting information Figures
S4.1, S4.2). The subsequent statistical analyses, multivariate ordination analyses, and visualization figures were done using the rarefied data aggregated at family level for the bacterial data, and at sequence type level for the Symbiodiniaceae data. The full dataset (including adult parents, seven
115 months old recruits and two years old juveniles) was used to compare the bacterial and
Symbiodiniaceae communities between life stages. Cross-sectional analyses were then carried out individually for offspring of the A. tenuis x A. loripes and A. sarmentosa x A. florida crosses that were seven months old and two years old to investigate the effects of hybridization (hybrid vs. purebred) and treatment (ambient vs. elevated) on microbial communities within each subset.
Bray-Curtis distance (Legendre and Legendre, 1998) was used to compare Symbiodiniaceae communities between samples for the full dataset and each of the subsets. Ordination analyses using non-metric multidimensional scaling (nMDS) (Legendre and Legendre, 1998) based on the same distance were then conducted. Multivariate homogeneity of variances was tested using multivariate extensions of Levene’s test (Anderson et al., 2006), and differences in microbial communities between 1) life stages, 2) species pair crosses, 3) hybrid vs. purebred corals and 4) ambient vs. elevated conditions were tested using Permutational Multivariate Analysis of Variance
(PERMANOVA) (Oksanen et al., 2016) with 999 permutations. Pairwise comparisons were carried out with p-values corrected using the Benjamini-Hochberg method (Benjamini and
Hochberg, 1995). The possibility of tank effects was tested by comparing the microbial communities of each offspring group in the three tanks within a treatment. These analyses confirmed the absence of a tank effect, hence, it was not considered further in the analyses.
Differential analyses (Love et al., 2014) based on generalized linear models assuming negative binomial distributions for the raw abundance counts were used to identify bacterial taxa that were significantly different in relative abundance between the three life stages and between treatments.
Microbial communities of the seawater and mock community samples were visualized as
116 compositional plots for comparisons with coral samples but were excluded from the nMDS ordination plots and statistical analyses. All the above statistical analyses were conducted using R
(3.5.0)(R Core Team, 2016) and the packages ggplot (Wickham, 2016), phyloseq (McMurdie and
Holmes, 2013), DESeq2 (Love et al., 2014) and vegan (Oksanen et al., 2016).
4.4 Results
4.4.1 Coral life stages differed in their microbial communities
Coral life stages differed significantly in their bacterial communities (PERMANOVA p < 0.001,
Table 4.1) (Figure 4.1, S4.3); pairwise comparisons indicated that the adult parents, the seven months old recruits, and the two years old juveniles were significantly different from each other within the same cross (p < 0.001 for all pairs). Further, the parents and two years old juveniles of the A. tenuis x A. loripes cross differed in their bacterial communities with those of the A. sarmentosa x A. florida cross (PERMANOVA p < 0.001 for both pairs, Table 4.1) (Supporting information Figure S4.4, S4.5). Pairwise comparisons between individual offspring groups were not conducted for the above analyses due to low sample size (n = 2) for some offspring and parental groups. The bacterial 16S rRNA mock community sample was classified accurately at the genus level and had approximately equal proportions of the seven expected taxa (Figure 4.1, Supporting information Table 4.2). Alpha-diversity of seven months old recruits was higher than that of two years old juveniles and adult parents (Figure 4.2), with no taxa occurring at a relative abundance of more than 12% (Figure 4.1). Seven months old recruits had the highest number of OTUs (213 and 1247 taxa at family and species level, respectively) compared to two years old juveniles (193 and 856 taxa) and adult parents (171 and 678 taxa). In the later life stages, stronger dominance by one or a few bacterial taxa was observed (Figures 4.1, 4.3).
117
Table 4.1. Summary of testing results (represented via p-values) from permutational multivariate analysis of variance (PERMANOVA) based on Bray-Curtis dissimilarity matrices to test the differences in bacterial or Symbiodiniaceae communities between 1) life stages, 2) the A. tenuis x A. loripes (AT x AL) and the A. sarmentosa x A. florida cross (AS x AF), 3) hybrid vs. purebred corals, and 4) ambient vs. elevated temperature and pCO2 conditions. Comparison Life stage Cross Bacteria Symbiodiniaceae Homogeneity Permanova Homogeneity Permanova of variances† of variances† Parent vs. 7 months vs. 2 years Parent, 7 months, 2 years AT x AL ≤ 0.001 *** ≤ 0.001 *** 0.002 ** ≤ 0.001 *** Parent vs. 7 months vs. 2 years Parent, 7 months, 2 years AS x AF ≤ 0.001 *** ≤ 0.001 *** 0.021 * ≤ 0.001 ***
AT x AL cross vs. AS x AF cross Parent N/A‡ 0.235 ≤ 0.001 *** 0.016 * 0.014 * AT x AL cross vs. AS x AF cross 7 months (ambient) N/A‡ 0.123 0.089 0.403 0.571 AT x AL cross vs. AS x AF cross 7 months (elevated) N/A‡ 0.129 0.009 ** 0.737 0.739 AT x AL cross vs. AS x AF cross 2 years N/A‡ 0.160 ≤ 0.001 *** 0.014 * ≤ 0.001 ***
Hybrid vs. Purebred 7 months AT x AL 0.831 0.492 0.291 0.548 Hybrid vs. Purebred 7 months AS x AF 0.580 0.476 0.096 0.070 Hybrid vs. Purebred 2 years AT x AL 0.784 0.915 0.786 0.494 Hybrid vs. Purebred 2 years AS x AF 0.955 0.895 0.147 0.496
Ambient vs. Elevated 7 months AT x AL 0.023 * ≤ 0.001 *** 0.014 * ≤ 0.001 *** Ambient vs. Elevated 7 months AS x AF 0.012 * ≤ 0.001 *** ≤ 0.001 *** ≤ 0.001 *** Once Ambient vs. Once Elevated§ 2 years AT x AL 0.063 0.285 0.678 0.209 Once Ambient vs. Once Elevated§ 2 years AS x AF 0.380 0.658 0.452 0.103 * Indicates statistical significance. * p < 0.05, ** p < 0.01, *** p ≤ 0.001. P-values compare homogeneity in variances among groups as well as the two groups. † Although the assumption of homogeneity of variance was violated in some cases, PERMANOVA is largely unaffected by heterogeneity in the presence of balanced designs as shown in (Anderson and Walsh, 2013). Furthermore, PERMANOVA focuses on
118 measuring the differences in the centroids of the groups and under balanced experimental designs the results remained robust despite the lack of variance homogeneity. ‡ This part compares between crosses, therefore subdivision of cross is not applicable (N/A) here. § The two years old juveniles were all under ambient condition. ‘Once ambient’ or ‘once elevated’ indicates whether they were previously under ambient or elevated temperature and pCO2 conditions during the first seven months of their life.
119
Figure 4.1. Compositional plots showing the averaged relative abundances of the bacterial taxa at the family level of parental and offspring groups at different life stages (Parent, 7M: seven months old, 2Y: two years old). Bacterial communities of seawater samples (SW) and a 16S mock communities (16S_mock) are also shown. A similar colour between families in the legend indicates that they belong to the same order. For illustration purpose, only taxa with relative abundance of > 0.2% are display.
120
Figure 4.2. Alpha-diversity (based on Shannon index) of the bacterial communties for offspring groups at different life stages (Parent (red), 7M: seven months old (green), 2Y: two years old
(blue)).
Figure 4.3. The top 10 taxa at family level that were significantly different in relative abundance between the three life stages for the A. tenuis x A. loripes and A. sarmentosa x A. florida cross
(7M: seven months old, 2Y: two years old).
121
For both crosses, adult parents were dominated by the family Endozoicomonadaceae (25-73%)
(Figure 4.3). Endozoicomonadaceae also occurred in moderate abundance in two years old juveniles (2-16%), but not in seven months old recruits (< 0.05%) (Figures 4.3). The family
Oceanospirillaceae occurred only in parents and two years old juveniles (Figure 4.3). At two years of age, all offspring groups of the A. tenuis x A. loripes cross were dominated by Simkaniaceae
(~50%) (Figure 4.3). However, dominance by a single taxon was not observed in the two years old juveniles of the A. sarmentosa x A. florida cross (Figure 4.3). Simkaniaceae also had limited abundance in parents and seven months old recruits (Figure 4.3). Conversely, the families
Cyclobacteriaceae, Flavobacteriaceae, Kiloniellaceae and Rhodobacteraceae were relatively abundant in all seven months old recruits (4-8 %) but not in parents or two years old juveniles (<
1% in most cases) (Figure 4.3). Since the top 10 bacterial taxa that were significantly different between seven months vs. two years and seven months vs. parents were similar, only the top 10 taxa of seven months vs. two years were displayed using bubble plots (Figure 4.3).
Symbiodiniaceae communities also differed significantly between life stages (PERMANOVA p <
0.001 for both crosses, Table 4.1) (Figures 4.4, S4.6), with pairwise comparisons showing that the parents, the seven months old recruits and the two years old juveniles were significantly different from each other within a cross (p < 0.001 for all pairs). The only exception was that there was no difference between the parents and the two years old juveniles of the A. sarmentosa x A. florida cross (p = 0.247). Between crosses, Symbiodiniaceae communities did not differ at the early life stage of seven months (Table 4.1, Figure 4.4). At the later life stages, however, Symbiodiniaceae communities of the A. tenuis x A. loripes cross were significantly different from those of the A. sarmentosa x A. florida cross (PERMANOVA parents: p = 0.014, 2-years old p < 0.0001, Table
122
4.1). The ITS mock community sample was classified accurately at the sequence type level
(Supporting information Table 4.3). The relative abundance of the majority of the sequence types of the mock community sample was close to expectation. The only exception was that sequence type A had a lower relative abundance than expected, which may be a consequence of intragenomic variance (Supporting information Table 4.3).
Figure 4.4. Compositional plots showing the averaged relative abundances of different
Symbiodiniaceae sequence types for parent and offspring groups at different life stages.
Symbiodiniaceae communities of seawater samples (SW) and an ITS mock communities
(ITS_mock) are also shown.
123
Adult parents had fewer OTUs (18 taxa) compared to seven months old recruits and two years old juveniles (23 taxa each). A change in dominant Symbiodiniaceae taxa was also observed with age
(Figure 4.4). At seven months of age, all recruits were dominated by sequence type Cspc (72-
84%), with C33 (type 1) being the second most abundant type (10-23%). Two years old juveniles of the A. tenuis x A. loripes cross were dominated by sequence types A1 (26-44%) and Cspc (53-
66%), with low abundance of D1 (0.03-5%) (Figure 4.4). Juveniles of the A. sarmentosa x A. florida cross, in contrast, were dominated by sequence types C3k (9-40%) and Cspc (29-94%), with low to moderate abundance of D1 (5-17%) (Figure 4.4). Sequence types C33 (type 1), A1 and D1 were absent in all but one parent (and only occurred at < 0.02% in that parent). Adult parents were dominated by sequence type C3k (15-83%) and Cspc (12-79%) (Figure 4.4).
4.4.2 Microbial communities were similar between hybrid and purebred Acropora corals
At both seven months and two years of age, bacterial and Symbiodiniaceae communities did not differ significantly between purebred and hybrid corals within both the A. tenuis x A. loripes and
A. sarmentosa x A. florida cross (see Table 4.1 for p-values) (seven months: Figures 4.5, 4.6; two years: Supporting information Figures S4.7, S4.8).
124
Figure 4.5. nMDS plots of the bacterial communities in hybrid vs. purebred recruits at seven months of age for the A. tenuis x A. loripes and A. sarmentosa x A. florida cross based on an analysis of Bray-Curtis dissimilarity matrices.
Figure 4.6. nMDS plots of the Symbiodiniaceae communities in hybrid vs. purebred recruits at seven months of age for the A. tenuis x A. loripes cross and A. sarmentosa x A. florida cross based on an analysis of Bray-Curtis dissimilarity matrices.
125
4.4.3 Elevated temperature and pCO2 conditions affected microbial communities
There was a significant difference in bacterial and Symbiodiniaceae communities between seven months old recruits reared under ambient versus elevated temperature and pCO2 conditions for both the A. tenuis x A. loripes and A. sarmentosa x A. florida cross (p < 0.001 for each comparison,
Table 4.1) (Figures 4.7, S4.9). For example, Blattabacteriaceae occurred at 2-5% under ambient conditions, but only occurred at 0.4-2% under elevated conditions (Supporting information Figure
S4.10). Similarly, Mycoplasmataceae occurred at 2-6% and 0.8-2% under ambient conditions and elevated condition, respectively, with the exception of purebred A. sarmentosa which maintained this taxon at 5% (Supporting information Figure S4.10). For Symbiodiniaceae communities, sequence type C33 (type 1) occurred in moderate to high abundance in all offspring groups under ambient conditions (15- 42%), but only occurred in 2-5% under elevated conditions (Supporting information Figure S4.11). Sequence types in the genus Durusdinium (D1, D1a, D2) ranged from
0-1.5% under ambient conditions and from 0-12% under elevated conditions (Supporting information Figure S4.11). Sequence type Cspc remained the most abundant type under both ambient (54- 78%) and elevated conditions (75- 92%). At two years of age (after 17 months at ambient conditions), bacterial and Symbiodiniaceae communities of the juveniles that were under ambient and elevated conditions during the first seven months of their life, were indistinguishable from one another (Table 4.1, Supporting information Figure S4.13, S4.14).
126
Figure 4.7. nMDS plots based on an analysis of Bray-Curtis dissimilarity matrices of the
Symbiodiniaceae communities of seven months old recruits reared under ambient vs. elevated temperature and pCO2 conditions.
4.5 Discussion
4.5.1 Winnowing of microbial communities
DNA metabarcoding data obtained here showed that coral-associated microbial communities go through a winnowing process as the coral recruits develop into adults. At seven months of age, the bacterial communities of recruits had higher alpha-diversity than both the two years old recruits and the adult parents. Winnowing of bacterial communities has been reported in other cnidarian species (Franzenburg et al., 2013). Hydra, for instance, has highly diverse and variable bacterial communities in early life stages but diversity is drastically decreased in the adult stage
(Franzenburg et al., 2013). Two previous coral studies are also in agreement with our findings
(Lema et al., 2014; Littman et al., 2009a). Lema et al. (Lema et al., 2014) found distinct bacterial communities in A. millepora larvae, early recruits (one and two weeks old) and recruit/juvenile
127
(three, six, 12 months old). The highest number of OTUs (590 OTUs) was observed in the three months old recruits but this declined to 423 OTUs by 12 months of age (Lema et al., 2014).
Similarly, Littman et al. (Littman et al., 2009a) observed two to almost three times more bacterial
OTUs in both A. millepora and A. tenuis nine months old recruits compared to adult conspecifics.
In addition to the change in bacterial diversity, the dominant bacterial taxa associated with corals also shifted with age. The moderate to high abundance of members in the families
Endozoicomonadaceae and Simkaniaceae in the two years old juveniles and adult parents suggests that these families may play an important role beyond the earliest life stages. Some
Endozoicomonas strains can metabolize DMSP (Raina et al., 2009) and are believed to contribute to nutrient acquisition and cycling of organic compounds (Morrow et al., 2012). A high abundance in Endozoicomonas spp. has been found in adult corals across geographical regions (Bayer et al.,
2013; Morrow et al., 2012; Rodriguez‐Lanetty et al., 2013; van Oppen et al., 2018). For example, this taxon accounted for > 70 % of the bacterial communities of Pocillopora damicornis from
Australia (van Oppen et al., 2018) and the Red Sea (Bayer et al., 2013). In contrast, the families that were relatively abundant in the seven months old recruits (Cyclobacteriaceae,
Flavobacteriaceae, Kiloniellaceae and Rhodobacteraceae) were rare in older life stages.
Unfortunately, little is known about the possible roles of these bacteria in holobiont functioning.
The change in bacterial communities with age may be due to changing needs at different life stages and the coral host may actively select for bacteria suitable for its state of development.
It is well established that Symbiodiniaceae taxa may change in relative abundance during ontogeny of corals (Abrego et al., 2009; Gómez-Cabrera et al., 2008; Little et al., 2004). For instance,
128 recruits of A. tenuis gradually shifted from dominance by Cladocopium and Durusdinium spp. to dominance by Durusdinium spp. from four to 37 weeks of age (Little et al., 2004). In contrast, conspecific adults from the same reef were dominated by Cladocopium spp. (Little et al., 2004).
Similarly, adults of Acropora longicyathus showed dominance by Cladocopium spp., while 10 days and three months old conspecific recruits were dominated by Symbiodinium spp., or a mix of
Symbiodinium, Cladocopium and Durusdinium spp. (Gómez-Cabrera et al., 2008). Possible explanations for the change in dominant Symbiodiniaceae taxa with age are a change in growth form (Abrego et al., 2009) and coral pigmentation (Gómez-Cabrera et al., 2008). In the present study, vertical growth was absent in the seven months old recruits while the two years old juveniles had simple vertical growth and adult parents showed complex 3D structures. Vertical growth may alter light and other environmental conditions inside the host tissues, favoring certain types of
Symbiodiniaceae (Abrego et al., 2009). In addition, the increase in tissue thickness and pigmentation with age can modify the irradiance level that the algae experience (Salih et al., 2000).
It is also possible that the coral host actively selects Symbiodiniaceae taxa to maximize their effectiveness to suit ontogenetic changes in physiological needs (Little et al., 2004), resulting in the succession pattern observed in this study.
4.5.2 Distinct microbiome succession patterns between species pair crosses
The succession patterns of bacterial and Symbiodiniaceae communities differed between the two species pair crosses. While offspring groups of the A. tenuis x A. loripes cross showed strong dominance of one bacterial taxon by two years of age, offspring groups of the A. sarmentosa x A. florida cross at the same age did not. Similarly, the rate of change to adult-like Symbiodiniaceae communities also differed between the two species pair crosses. The A. sarmentosa x A. florida
129 cross established parent-like Symbiodiniaceae communities by two years of age. All offspring groups of this cross were dominated by sequence types of the genera Cladocopium and
Diusdurnum while all offspring groups of the A. tenuis x A. loripes cross were dominated by
Cladocopium and Symbiodinium. Since all juveniles were under the same treatment conditions and randomly distributed in the same tanks, the observed differences in microbial communities between the crosses indicate coral host selectivity or specificity. The dominance of Symbiodinium spp., as observed in all offspring groups of the A. tenuis x A. loripes cross at two years of age, is unusual in adult populations (Abrego et al., 2009; Gómez-Cabrera et al., 2008; Little et al., 2004).
Symbiodinium is the only Symbiodiniaceae genus known to synthesize mycosporine-like amino acids, a compound that may act as a shield against ultraviolet radiation (Banaszak et al., 2000).
Members of Symbiodinium are more commonly found in shallow water corals (Baker, 2003;
LaJeunesse, 2001) and are tolerant to high irradiance (Rowan, 1998). The dominance of
Symbiodinium in these offspring groups may be a response to the increased light levels (from 120 to 250 µE m-2 s-1) from the age of one year.
It has previously been observed that bacterial communities harboured by adult corals can be species-specific (Bourne and Munn, 2005; Frias-Lopez et al., 2002; Rohwer et al., 2001), although it is unknown at what age this specificity develops. For Symbiodiniaceae communities, it is known that the onset of specificity can vary between Acropora species (Abrego et al., 2009); A. tenuis harboured similar Symbiodiniaceae communities to that of the conspecific adults by ~3.5 year of age, but A. millepora from the same locations did not (Abrego et al., 2009). The present study showed that the onset of specificity in bacterial and Symbiodiniaceae communities occurred in multiple Acropora species by two years of age. Interestingly, the difference in the extent and taxa
130 of specialization in bacterial and Symbiodiniaceae communities occurred only between the two crosses. Within a cross, the hybrid and purebred offspring groups had similar microbial communities, suggesting that hybrid and purebred corals underwent a similar succession and winnowing process as they grew.
4.5.3 Parental species within a cross shared similar bacterial communities
While parental colonies of all four species were collected from the same reef, bacterial communities of A. tenuis and A. loripes adult parents differed from those of A. sarmentosa and A. florida. A. sarmentosa and A. florida are closely related species (van Oppen, 2001; Fukami et al.,
2000; Márquez et al., 2002), therefore it is not surprising for these to harbour similar bacterial communities. However, A. tenuis and A. loripes are phylogenetically divergent and fall within different clades (van Oppen, 2001; Fukami et al., 2000; Márquez et al., 2002). It is uncertain why
A. tenuis and A. loripes in this study share similar bacterial communities, and whether this is a contributing factor behind successful hybridization between them. For future coral hybridization studies, investigating the bacterial communities of parental species from successful and unsuccessful crosses will provide valuable insights into this question.
4.5.4 Hybridization did not affect microbe association
Bacterial and Symbiodiniaceae communities were the same in hybrid and purebred Acropora offspring within each cross, indicating that parentage plays a minor role in shaping these communities at the early coral life stages. At seven months of age, hybrids showed ~16-34% higher survival than purebred A. tenuis in the A. tenuis x A. loripes cross, and ~14-22% higher survival than both purebred offspring groups in the A. sarmentosa x A. florida cross (Chan et al.,
131
2018). Our findings suggest these early life stage fitness differences are unlikely due to the microbial communities, unless the same communities expressed different genes in hybrid and purebred corals (which was not tested).
4.5.5 Environmental condition was a primary driver of microbial communities in early life stage corals
Treatment conditions had a major impact on the bacterial and Symbiodiniaceae communities harboured by early life stage recruits. However, our results cannot resolve whether the change in microbial communities was a passive response to treatment conditions or a consequence of active selection by the coral host (Webster et al., 2016). Changes in bacterial communities have previously been observed when adult conspecific corals were exposed to different temperatures
(Bourne et al., 2007; Lins-de-Barros et al., 2013; Littman et al., 2010; Ritchie, 2006; Santos et al.,
2014; Tout et al., 2015; Webster et al., 2016) and/or pH (Meron et al., 2011; Morrow et al., 2015;
Webster et al., 2013) treatments. Conversely, bacterial communities of adult conspecific corals were unaffected by changing temperature or pCO2/pH conditions is other studies (Littman et al.,
2009b; Meron et al., 2012; Webster et al., 2016; Zhou et al., 2016). This discrepancy might be due to differences in study durations, the extent of the stress, the origin, species and age of the corals studied. For adult A. millepora, abundance of Endozoicomonas spp. declined significantly when subjected to low pH conditions (Morrow et al., 2015; Webster et al., 2016), while Chlorobi spp. increased when exposed to elevated temperatures (Webster et al., 2016). However,
Endozoicomonas and Chlorobi spp. were either absent or barely present in the seven months old recruits of this study. The two bacterial families that were consistently suppressed under elevated conditions in this study, Blattabacteriaceae and Mycoplasmataceae, have not been previously
132 reported from corals, perhaps due to the comparatively small number of studies on microbiomes from early life stage corals. An additional consideration is that the bacterial communities can differ between corals that were raised in filtered seawater in the laboratory (the present study) and those that were raised in the field (the other studies) (Lema et al., 2014).
For the Symbiodiniaceae communities, the increase in occurrence and abundance of Durusdinium spp. in recruits under elevated temperature and pCO2 conditions can be a mechanism of acclimatization under these challenging conditions (Berkelmans and Oppen, 2006; Chen et al.,
2005; Mieog et al., 2007; Silverstein et al., 2015; Stat et al., 2013; Stat and Gates, 2011). While members of Durusdinium generally account for < 1% of a corals’ Symbiodiniaceae community
(Boulotte et al., 2016), they tend to occur in higher abundance in corals experiencing environmental stress. Examples include corals from the Persian Gulf where seawater temperatures typically exceeded 33ºC (Baker et al., 2004; Mostafavi et al., 2007), corals from the back-reef environments in American Samoa (Oliver and Palumbi, 2009) and from the lagoonal environment in Palau where diurnal variations in temperature and pH were extreme (Fabricius et al., 2004); as well as corals recovered from a bleaching event (Baker et al., 2004; Bay et al., 2016; Boulotte et al., 2016; Cunning et al., 2015; van Oppen et al., 2005).
4.5.6 Summary and implications for future studies
The lack of host specificity and the occurrence of a strong treatment effect on microbial communities of the seven months old recruits suggest environmental factors play a more important role than host factors at the early life stage. The importance of host factors increased over time, resulting in unique microbial communities between the two species pair crosses by two years of
133 age. This in combination with the highly diverse bacterial communities in early life stages suggest a period of flexibility before adult assemblages are established in corals. In contrast to corals that have a long generation time, microbes are capable of more rapid changes and their roles in assisting host climate change adaptation and acclimatization within the host’s reproductive lifetime are increasingly being recognized (Rosenberg et al., 2007; Theis et al., 2016; van Oppen et al., 2015,
2017). The manipulation of microbial communities in corals via inoculation with resilient microbial strains may serve as a tool to increase coral stress tolerance (Damjanovic et al., 2017; van Oppen et al., 2015, 2017). Our findings suggest that such interventions may be most successful in the earliest coral life stages, and testing this is an important new avenue of research.
Data availability
Sequences of the bacterial and Symbiodiniaceae cultures for the reference mock communities are available on Genbank with the accession numbers provided in the Materials and methods section.
The bacterial and Symbiodiniaceae OTU tables and metadata generated in this study are publicly available via the Australian Institute of Marine Science at: https://apps.aims.gov.au/metadata/view/90287ada-10c5-4afc-a38f-330303c6d6ea
References
Abrego, D., Ulstrup, K. E., Willis, B. L., and Oppen, M. J. H. van (2008). Species–specific interactions between algal endosymbionts and coral hosts define their bleaching response to heat and light stress. Proceedings of the Royal Society of London B: Biological Sciences 275, 2273–2282. doi:10.1098/rspb.2008.0180.
Abrego, D., Van Oppen, M. J. H., and Willis, B. L. (2009). Onset of algal endosymbiont specificity varies among closely related species of Acropora corals during early ontogeny. Molecular Ecology 18, 3532–3543. doi:10.1111/j.1365-294X.2009.04276.x.
Anderson, M. J., Ellingsen, K. E., and McArdle, B. H. (2006). Multivariate dispersion as a measure of beta diversity. Ecology Letters 9, 683–693. doi:10.1111/j.1461-0248.2006.00926.x.
134
Anderson, M. J., and Walsh, D. C. I. (2013). PERMANOVA, ANOSIM, and the Mantel test in the face of heterogeneous dispersions: what null hypothesis are you testing? Ecological Monographs 83, 557–574. doi:10.1890/12-2010.1.
Apprill, A., Marlow, H. Q., Martindale, M. Q., and Rappé, M. S. (2009). The onset of microbial associations in the coral Pocillopora meandrina. The ISME Journal 3, 685–699. doi:10.1038/ismej.2009.3.
Apprill, A., McNally, S., Parsons, R., and Weber, L. (2015). Minor revision to V4 region SSU rRNA 806R gene primer greatly increases detection of SAR11 bacterioplankton. Aquatic Microbial Ecology 75, 129–137. doi:10.3354/ame01753.
Arif, C., Daniels, C., Bayer, T., Banguera-Hinestroza, E., Barbrook, A., Howe, C. J., et al. (2014). Assessing Symbiodinium diversity in scleractinian corals via next-generation sequencing- based genotyping of the ITS2 rDNA region. Mol Ecol 23, 4418–4433. doi:10.1111/mec.12869.
Baker, A. C. (2003). Flexibility and specificity in coral-algal symbiosis: diversity, ecology, and biogeography of symbiodinium. Annual Review of Ecology, Evolution, and Systematics 34, 661–689. doi:10.1146/annurev.ecolsys.34.011802.132417.
Baker, A. C., Starger, C. J., McClanahan, T. R., and Glynn, P. W. (2004). Coral reefs: Corals’ adaptive response to climate change. Nature 430, 430741a. doi:10.1038/430741a.
Banaszak, Anastazia T., LaJeunesse, T. C., and Trench, R. K. (2000). The synthesis of mycosporine-like amino acids (MAAs) by cultured, symbiotic dinoflagellates. Journal of Experimental Marine Biology and Ecology 249, 219–233. doi:10.1016/S0022- 0981(00)00192-1.
Bay, L. K., Doyle, J., Logan, M., and Berkelmans, R. (2016). Recovery from bleaching is mediated by threshold densities of background thermo-tolerant symbiont types in a reef-building coral. Royal Society Open Science 3. doi:10.1098/rsos.160322.
Bayer, T., Neave, M. J., Alsheikh-Hussain, A., Aranda, M., Yum, L. K., Mincer, T., et al. (2013). The microbiome of the Red sea coral Stylophora pistillata is dominated by tissue- associated Endozoicomonas bacteria. Appl. Environ. Microbiol. 79, 4759–4762. doi:10.1128/AEM.00695-13.
Benjamini, Y., and Hochberg, Y. (1995). Controlling the false discovery rate: a practical and powerful approach to multiple testing. Journal of the Royal Statistical Society. Series B (Methodological) 57, 289–300. doi:10.2307/2346101.
Berkelmans, R., and Oppen, M. J. H. van (2006). The role of zooxanthellae in the thermal tolerance of corals: a ‘nugget of hope’ for coral reefs in an era of climate change. Proceedings of the Royal Society of London B: Biological Sciences 273, 2305–2312. doi:10.1098/rspb.2006.3567.
135
Blackall, L. L., Wilson, B., and van Oppen, M. J. H. (2015). Coral-the world’s most diverse symbiotic ecosystem. Mol. Ecol. 24, 5330–5347. doi:10.1111/mec.13400.
Boulotte, N. M., Dalton, S. J., Carroll, A. G., Harrison, P. L., Putnam, H. M., Peplow, L. M., et al. (2016). Exploring the Symbiodinium rare biosphere provides evidence for symbiont switching in reef-building corals. ISME J 10, 2693–2701. doi:10.1038/ismej.2016.54.
Bourne, D. G., and Munn, C. B. (2005). Diversity of bacteria associated with the coral Pocillopora damicornis from the Great Barrier Reef. Environmental Microbiology 7, 1162–1174. doi:10.1111/j.1462-2920.2005.00793.x.
Bourne, D., Iida, Y., Uthicke, S., and Smith-Keune, C. (2007). Changes in coral-associated microbial communities during a bleaching event. ISME J 2, 350–363. doi:10.1038/ismej.2007.112.
Castillo, I., Lodeiros, C., Núñez, M., and Campos, I. (2001). In vitro evaluation of antibacterial substances produced by bacteria isolated from different marine organisms. Rev Biol Trop 49, 1213–1222.
Ceh, J., van Keulen, M., and Bourne, D. G. (2013). Intergenerational transfer of specific bacteria in corals and possible implications for offspring fitness. Microb Ecol 65, 227–231. doi:10.1007/s00248-012-0105-z.
Chan, W. Y., Peplow, L. M., Menéndez, P., Hoffmann, A. A., and Van Oppen, M. J. H. (2018). Interspecific hybridization may provide novel opportunities for coral reef restoration. Front. Mar. Sci. 5. doi:10.3389/fmars.2018.00160.
Chao, A. (2005). “Species richness estimation.,” in, eds. C. B. Read and B. Vidakovic (New York: Encyclopedia of Statistical Sciences), 7909–7916.
Chen, C. A., Wang, J.-T., Fang, L.-S., and Yang, Y.-W. (2005). Fluctuating algal symbiont communities in Acropora palifera (Scleractinia: Acroporidae) from Taiwan. Marine Ecology Progress Series 295, 113–121. doi:10.3354/meps295113.
Cunning, R., Gillette, P., Capo, T., Galvez, K., and Baker, A. C. (2015). Growth tradeoffs associated with thermotolerant symbionts in the coral Pocillopora damicornis are lost in warmer oceans. Coral Reefs 34, 155–160. doi:10.1007/s00338-014-1216-4.
Damjanovic, K., Blackall, L. L., Webster, N. S., and van Oppen, M. J. H. (2017). The contribution of microbial biotechnology to mitigating coral reef degradation. Microb. Biotechnol. 10, 1236–1243. doi:10.1111/1751-7915.12769.
Douglas, A. E. (2003). Coral bleaching––how and why? Marine Pollution Bulletin 46, 385–392. doi:10.1016/S0025-326X(03)00037-7.
Fabricius, K. E., Mieog, J. C., Colin, P. L., Idip, D., and H. Van Oppen, M. J. (2004). Identity and diversity of coral endosymbionts (zooxanthellae) from three Palauan reefs with contrasting
136
bleaching, temperature and shading histories. Molecular Ecology 13, 2445–2458. doi:10.1111/j.1365-294X.2004.02230.x.
Fogarty, N. (2010). Reproductive isolation and hybridization dynamics in threatened Caribbean acroporid corals. Oceanography Faculty Theses and Dissertations. Available at: http://nsuworks.nova.edu/occ_facetd/4.
Fogarty, N. D. (2012). Caribbean acroporid coral hybrids are viable across life history stages. Mar Ecol Prog Ser 446, 145–159. doi:10.3354/meps09469.
Franzenburg, S., Fraune, S., Altrock, P. M., Künzel, S., Baines, J. F., Traulsen, A., et al. (2013). Bacterial colonization of Hydra hatchlings follows a robust temporal pattern. The Isme Journal 7, 781.
Frias-Lopez, J., Zerkle, A. L., Bonheyo, G. T., and Fouke, B. W. (2002). Partitioning of Bacterial Communities between Seawater and Healthy, Black Band Diseased, and Dead Coral Surfaces. Appl. Environ. Microbiol. 68, 2214–2228. doi:10.1128/AEM.68.5.2214- 2228.2002.
Fukami, H., Omori, M., and Hatta, M. (2000). Phylogenetic relationships in the coral family Acroporidae, reassessed by inference from mitochondrial genes. Zoological Science 17, 689–696. doi:10.2108/zsj.17.689.
Gómez-Cabrera, M. del C., Ortiz, J. C., Loh, W. K. W., Ward, S., and Hoegh-Guldberg, O. (2008). Acquisition of symbiotic dinoflagellates (Symbiodinium) by juveniles of the coral Acropora longicyathus. Coral Reefs 27, 219–226. doi:10.1007/s00338-007-0315-x.
Hernandez-Agreda, A., Gates, R. D., and Ainsworth, T. D. (2017). Defining the core microbiome in corals’ microbial soup. Trends in Microbiology 25, 125–140. doi:10.1016/j.tim.2016.11.003.
Hoegh-Guldberg, O. (1999). Climate change, coral bleaching and the future of the world’s coral reefs. Mar. Freshwater Res. 50, 839–866. doi:10.1071/mf99078.
Iglesias-Prieto, R., Beltrán, V. H., LaJeunesse, T. C., Reyes-Bonilla, H., and Thomé, P. E. (2004). Different algal symbionts explain the vertical distribution of dominant reef corals in the eastern Pacific. Proc Biol Sci 271, 1757–1763. doi:10.1098/rspb.2004.2757.
Irwin, A., Greer, L., Humston, R., Devlin-Durante, M., Cabe, P., Lescinsky, H., et al. (2017). Age and intraspecific diversity of resilient Acropora communities in Belize. Coral Reefs 36, 1– 10. doi:10.1007/s00338-017-1602-9.
Isomura, N., Iwao, K., and Fukami, H. (2013). Possible natural hybridization of two morphologically distinct species of Acropora (Cnidaria, Scleractinia) in the Pacific: fertilization and larval survival rates. PLoS ONE 8, e56701. doi:10.1371/journal.pone.0056701.
137
Jones, R. J., Bowyer, J., Hoegh-Guldberg, O., and Blackall, L. L. (2004). Dynamics of a temperature-related coral disease outbreak. Marine Ecology Progress Series 281, 63–77.
Kimes, N. E., Van Nostrand, J. D., Weil, E., Zhou, J., and Morris, P. J. (2010). Microbial functional structure of Montastraea faveolata, an important Caribbean reef-building coral, differs between healthy and yellow-band diseased colonies. Environmental Microbiology 12, 541–556. doi:10.1111/j.1462-2920.2009.02113.x.
Knowlton, N., and Rohwer, F. (2003). Multispecies microbial mutualisms on coral reefs: the host as a habitat. The American Naturalist 162, S51–S62. doi:10.1086/378684.
LaJeunesse, T. C. (2001). Investigating the biodiversity, ecology, and phylogeny of endosymbiotic dinoflagellates in the genus Symbiodinium using the its region: in search of a “species” level marker. Journal of Phycology 37, 866–880. doi:10.1046/j.1529-8817.2001.01031.x.
Legendre, P., and Legendre, L. (1998). Numerical ecology. Elsevier Science (Developments in Environmental Modelling).
Lema, K. A., Bourne, D. G., and Willis, B. L. (2014). Onset and establishment of diazotrophs and other bacterial associates in the early life history stages of the coral Acropora millepora. Molecular Ecology 23, 4682–4695. doi:10.1111/mec.12899.
Lesser, M. P., Falcón, L. I., Rodríguez-Román, A., Enríquez, S., Hoegh-Guldberg, O., and Iglesias-Prieto, R. (2007). Nitrogen fixation by symbiotic cyanobacteria provides a source of nitrogen for the scleractinian coral Montastraea cavernosa. Marine Ecology Progress Series 346, 143–152. doi:10.3354/meps07008.
Lins-de-Barros, M. M., Cardoso, A. M., Silveira, C. B., Lima, J. L., Clementino, M. M., Martins, O. B., et al. (2013). Microbial community compositional shifts in bleached colonies of the Brazilian reef-building coral Siderastrea stellata. Microbial Ecology 65, 205–213. doi:10.1007/s00248-012-0095-x.
Little, A. F., van Oppen, M. J. H., and Willis, B. L. (2004). Flexibility in algal endosymbioses shapes growth in reef corals. Science 304, 1492. doi:10.1126/science.1095733.
Littman, R. A., Bourne, D. G., and Willis, B. L. (2010). Responses of coral-associated bacterial communities to heat stress differ with Symbiodinium type on the same coral host. Molecular Ecology 19, 1978–1990. doi:10.1111/j.1365-294X.2010.04620.x.
Littman, R. A., Willis, B. L., and Bourne, D. G. (2009a). Bacterial communities of juvenile corals infected with different Symbiodinium (dinoflagellate) clades. Marine Ecology Progress Series 389, 45–59. doi:10.3354/meps08180.
Littman, R. A., Willis, B. L., Pfeffer, C., and Bourne, D. G. (2009b). Diversities of coral-associated bacteria differ with location, but not species, for three acroporid corals on the Great Barrier Reef. FEMS Microbiol Ecol 68, 152–163. doi:10.1111/j.1574-6941.2009.00666.x.
138
Love, M. I., Huber, W., and Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology 15, 550. doi:10.1186/s13059-014-0550- 8.
Márquez, L. M., Van Oppen, M. J. H., Willis, B. L., Reyes, A., and Miller, D. J. (2002). The highly cross-fertile coral species, Acropora hyacinthus and Acropora cytherea, constitute statistically distinguishable lineages. Molecular Ecology 11, 1339–1349. doi:10.1046/j.1365-294X.2002.01526.x.
McGinley, M. P., Aschaffenburg, M. D., Pettay, D. T., Smith, R. T., LaJeunesse, T. C., and Warner, M. E. (2012). Symbiodinium spp. in colonies of eastern Pacific Pocillopora spp. are highly stable despite the prevalence of low-abundance background populations. Marine Ecology Progress Series 462, 1–7. doi:10.3354/meps09914.
McMurdie, P. J., and Holmes, S. (2013). Phyloseq: an R package for reproducible interactive analysis and graphics of microbiome census data. PLOS ONE 8, e61217. doi:10.1371/journal.pone.0061217.
Meron, D., Atias, E., Iasur Kruh, L., Elifantz, H., Minz, D., Fine, M., et al. (2011). The impact of reduced pH on the microbial community of the coral Acropora eurystoma. ISME J 5, 51– 60. doi:10.1038/ismej.2010.102.
Meron, D., Rodolfo-Metalpa, R., Cunning, R., Baker, A. C., Fine, M., and Banin, E. (2012). Changes in coral microbial communities in response to a natural pH gradient. ISME J 6, 1775–1785. doi:10.1038/ismej.2012.19.
Mieog, J. C., Oppen, M. J. H. van, Cantin, N. E., Stam, W. T., and Olsen, J. L. (2007). Real-time PCR reveals a high incidence of Symbiodinium clade D at low levels in four scleractinian corals across the Great Barrier Reef: implications for symbiont shuffling. Coral Reefs 26, 449–457. doi:10.1007/s00338-007-0244-8.
Morrow, K. M., Bourne, D. G., Humphrey, C., Botté, E. S., Laffy, P., Zaneveld, J., et al. (2015). Natural volcanic CO2 seeps reveal future trajectories for host–microbial associations in corals and sponges. ISME J 9, 894–908. doi:10.1038/ismej.2014.188.
Morrow, K. M., Moss, A. G., Chadwick, N. E., and Liles, M. R. (2012). Bacterial associates of two Caribbean coral species reveal species-specific distribution and geographic variability. Appl. Environ. Microbiol., AEM.01162-12. doi:10.1128/AEM.01162-12.
Mostafavi, P. G., Fatemi, S. M. R., Shahhosseiny, M. H., Hoegh-Guldberg, O., and Loh, W. K. W. (2007). Predominance of clade D Symbiodinium in shallow-water reef-building corals off Kish and Larak Islands (Persian Gulf, Iran). Mar Biol 153, 25–34. doi:10.1007/s00227- 007-0796-8.
Muscatine, L. (1967). Glycerol excretion by symbiotic algae from corals and tridacna and its control by the host. Science 156, 516–519. doi:10.1126/science.156.3774.516.
139
Nissimov, J., Rosenberg, E., and Munn, C. B. (2009). Antimicrobial properties of resident coral mucus bacteria of Oculina patagonica. FEMS Microbiol Lett 292, 210–215. doi:10.1111/j.1574-6968.2009.01490.x.
Oksanen, J., Blanchet, F. G., Friendly, M., Kindt, R., Legendre, P., McGlinn, D., et al. (2016). Vegan: community ecology package. R package version 2.4-1.
Oliver, T. A., and Palumbi, S. R. (2009). Distributions of stress-resistant coral symbionts match environmental patterns at local but not regional scales. Marine Ecology Progress Series 378, 93–103.
Oliver, T. A., and Palumbi, S. R. (2011). Do fluctuating temperature environments elevate coral thermal tolerance? Coral Reefs 30, 429–440. doi:10.1007/s00338-011-0721-y.
Padilla-Gamiño, J. L., Pochon, X., Bird, C., Concepcion, G. T., and Gates, R. D. (2012). From parent to gamete: vertical transmission of Symbiodinium (dinophyceae) ITS2 sequence assemblages in the reef building coral Montipora capitata. PLOS ONE 7, e38440. doi:10.1371/journal.pone.0038440.
Parada, A. E., Needham, D. M., and Fuhrman, J. A. (2016). Every base matters: assessing small subunit rRNA primers for marine microbiomes with mock communities, time series and global field samples. Environmental Microbiology 18, 1403–1414. doi:10.1111/1462- 2920.13023.
Pettay, D. T., Wham, D. C., Pinzón, J. H., and Lajeunesse, T. C. (2011). Genotypic diversity and spatial–temporal distribution of Symbiodinium clones in an abundant reef coral. Molecular Ecology 20, 5197–5212. doi:10.1111/j.1365-294X.2011.05357.x.
Pochon, X., Pawlowski, J., Zaninetti, L., and Rowan, R. (2001). High genetic diversity and relative specificity among Symbiodinium-like endosymbiotic dinoflagellates in soritid foraminiferans. Marine Biology 139, 1069–1078. doi:10.1007/s002270100674.
R Core Team (2016). R: A language and environment for statistical computing. R Foundation for Statistical Computing. R Foundation for Statistical Computing, Vienna, Austria.
Raina, J.-B., Dinsdale, E. A., Willis, B. L., and Bourne, D. G. (2010). Do the organic sulfur compounds DMSP and DMS drive coral microbial associations? Trends in Microbiology 18, 101–108. doi:10.1016/j.tim.2009.12.002.
Raina, J.-B., Tapiolas, D., Willis, B. L., and Bourne, D. G. (2009). Coral-associated bacteria and their role in the biogeochemical cycling of sulfur. Appl. Environ. Microbiol. 75, 3492– 3501. doi:10.1128/AEM.02567-08.
Richards, Z. T., Oppen, M. J. H. van, Wallace, C. C., Willis, B. L., and Miller, D. J. (2008). Some Rare Indo-Pacific Coral Species Are Probable Hybrids. PLOS ONE 3, e3240. doi:10.1371/journal.pone.0003240.
140
Ritchie, K. B. (2006). Regulation of microbial populations by coral surface mucus and mucus- associated bacteria. Marine Ecology Progress Series 322, 1–14.
Ritchie, K. B., Dennis, J. H., McGrath, T., and Smith, G. W. (1994). Bacteria associated with bleached and nonbleached areas of Montastrea annularis. Proceedings, 5th symposium on the Natural History of the Bahamas., 75–79.
Rodriguez‐Lanetty, M., Granados‐Cifuentes, C., Barberan, A., Bellantuono, A. J., and Bastidas, C. (2013). Ecological Inferences from a deep screening of the Complex Bacterial Consortia associated with the coral, Porites astreoides. Molecular Ecology 22, 4349–4362. doi:10.1111/mec.12392.
Rohwer, F., Breitbart, M., Jara, J., Azam, F., and Knowlton, N. (2001). Diversity of bacteria associated with the Caribbean coral Montastraea franksi. Coral Reefs 20, 85–91. doi:10.1007/s003380100138.
Rosenberg, E., Koren, O., Reshef, L., Efrony, R., and Zilber-Rosenberg, I. (2007). The role of microorganisms in coral health, disease and evolution. Nat Rev Micro 5, 355–362. doi:10.1038/nrmicro1635.
Rowan, R. (1998). Review—diversity and ecology of zooxanthellae on coral reefs. Journal of Phycology 34, 407–417. doi:10.1046/j.1529-8817.1998.340407.x.
Salih, A., Larkum, A., Cox, G., Kühl, M., and Hoegh-Guldberg, O. (2000). Fluorescent pigments in corals are photoprotective. Nature 408, 850–853. doi:10.1038/35048564.
Santos, H. F., Carmo, F. L., Duarte, G., Dini-Andreote, F., Castro, C. B., Rosado, A. S., et al. (2014). Climate change affects key nitrogen-fixing bacterial populations on coral reefs. ISME J 8, 2272–2279. doi:10.1038/ismej.2014.70.
Sato, Y., Willis, B. L., and Bourne, D. G. (2013). Pyrosequencing-based profiling of archaeal and bacterial 16S rRNA genes identifies a novel archaeon associated with black band disease in corals. Environ Microbiol 15, 2994–3007. doi:10.1111/1462-2920.12256.
Sharp, K. H., Distel, D., and Paul, V. J. (2012). Diversity and dynamics of bacterial communities in early life stages of the Caribbean coral Porites astreoides. The ISME Journal 6, 790– 801. doi:10.1038/ismej.2011.144.
Sharp, K. H., Ritchie, K. B., Schupp, P. J., Ritson-Williams, R., and Paul, V. J. (2010). Bacterial acquisition in juveniles of several broadcast spawning coral species. PLOS ONE 5, e10898. doi:10.1371/journal.pone.0010898.
Silverstein, R. N., Cunning, R., and Baker, A. C. (2015). Change in algal symbiont communities after bleaching, not prior heat exposure, increases heat tolerance of reef corals. Global Change Biology 21, 236–249. doi:10.1111/gcb.12706.
141
Stat, M., and Gates, R. D. (2011). Clade D Symbiodinium in scleractinian corals: a “nugget” of hope, a selfish opportunist, an ominous sign, or all of the above? Journal of Marine Biology 2011, 1–9. doi:10.1155/2011/730715.
Stat, M., Pochon, X., Franklin, E. C., Bruno, J. F., Casey, K. S., Selig, E. R., et al. (2013). The distribution of the thermally tolerant symbiont lineage (Symbiodinium clade D) in corals from Hawaii: correlations with host and the history of ocean thermal stress. Ecology and Evolution 3, 1317–1329. doi:10.1002/ece3.556.
Theis, K. R., Dheilly, N. M., Klassen, J. L., Brucker, R. M., Baines, J. F., Bosch, T. C. G., et al. (2016). Getting the hologenome concept right: an eco-evolutionary framework for hosts and their microbiomes. mSystems 1, e00028-16. doi:10.1128/mSystems.00028-16.
Tout, J., Siboni, N., Messer, L. F., Garren, M., Stocker, R., Webster, N. S., et al. (2015). Increased seawater temperature increases the abundance and alters the structure of natural Vibrio populations associated with the coral Pocillopora damicornis. Front Microbiol 6. doi:10.3389/fmicb.2015.00432. van Oppen, M. (2001). In vitro establishment of symbiosis in Acropora millepora planulae. Coral Reefs 20, 200–200. doi:10.1007/s003380100167. van Oppen, M. J. H., Bongaerts, P., Frade, P., Peplow, L. M., Boyd, S. E., Nim, H. T., et al. (2018). Adaptation to reef habitats through selection on the coral animal and its associated microbiome. Molecular Ecology 27, 2956–2971. doi:10.1111/mec.14763. van Oppen, M. J. H., Gates, R. D., Blackall, L. L., Cantin, N., Chakravarti, L. J., Chan, W. Y., et al. (2017). Shifting paradigms in restoration of the world’s coral reefs. Global Change Biology 23, 3437–3448. doi:10.1111/gcb.13647. van Oppen, M. J. H., McDonald, B. J., Willis, B., and Miller, D. J. (2001). The evolutionary history of the coral genus Acropora (scleractinia, cnidaria) based on a mitochondrial and a nuclear marker: reticulation, incomplete lineage sorting, or morphological convergence? Mol Biol Evol 18, 1315–1329. doi:10.1093/oxfordjournals.molbev.a003916. van Oppen, M. J. H., Mieog, J. C., Sánchez, C. A., and Fabricius, K. E. (2005). Diversity of algal endosymbionts (zooxanthellae) in octocorals: the roles of geography and host relationships. Molecular Ecology 14, 2403–2417. doi:10.1111/j.1365-294X.2005.02545.x. van Oppen, M. J. H., Oliver, J. K., Putnam, H. M., and Gates, R. D. (2015). Building coral reef resilience through assisted evolution. PNAS 112, 2307–2313. doi:10.1073/pnas.1422301112.
Vollmer, S. V., and Palumbi, S. R. (2002). Hybridization and the evolution of reef coral diversity. Science 296, 2023–2025. doi:10.1126/science.1069524.
Webster, N. S., Negri, A. P., Botté, E. S., Laffy, P. W., Flores, F., Noonan, S., et al. (2016). Host- associated coral reef microbes respond to the cumulative pressures of ocean warming and ocean acidification. Sci Rep 6. doi:10.1038/srep19324.
142
Webster, N. S., Negri, A. P., Flores, F., Humphrey, C., Soo, R., Botté, E. S., et al. (2013). Near- future ocean acidification causes differences in microbial associations within diverse coral reef taxa. Environmental Microbiology Reports 5, 243–251. doi:10.1111/1758- 2229.12006.
Wickham, H. (2016). Ggplot2: elegant graphics for data analysis. New York: Springer.
Willis, B. L., Oppen, M. J. H. van, Miller, D. J., Vollmer, S. V., and Ayre, D. J. (2006). The role of hybridization in the evolution of reef corals. Annual Review of Ecology, Evolution, and Systematics 37, 489–517.
Zhang, Y., Ling, J., Yang, Q., Wen, C., Yan, Q., Sun, H., et al. (2015). The functional gene composition and metabolic potential of coral-associated microbial communities. Scientific Reports 5, 16191. doi:10.1038/srep16191.
Zhou, G., Yuan, T., Cai, L., Zhang, W., Tian, R., Tong, H., et al. (2016). Changes in microbial communities, photosynthesis and calcification of the coral Acropora gemmifera in response to ocean acidification. Sci Rep 6. doi:10.1038/srep35971.
Ziegler, M., Seneca, F. O., Yum, L. K., Palumbi, S. R., and Voolstra, C. R. (2017). Bacterial community dynamics are linked to patterns of coral heat tolerance. Nat Commun 8. doi:10.1038/ncomms14213.
Acknowledgements
This study was funded by the Paul G. Allen Philanthropies and the Australian Institute of Marine
Science (AIMS). I thank staff of the National Sea Simulator at AIMS for technical support and L.
Hartman for sharing a custom-made pipeline for Qiime. Thanks are extended to P. Buerger and K.
Damjanovic for bioinformatics support, C. Alvarez Roa and K. Damjanovic for supplying sources and sequences of the 16S and ITS mock community, as well as P. Laffy and K. Quigley for fruitful discussions.
143
Chapter 5
Maternal and long-term treatment effects on transcriptome-wide gene expression in hybrid
and purebred Acropora corals
5.1 Abstract
Human-mediated interspecific hybridization has been used in biodiversity conservation for genetic and evolutionary rescue in terrestrial ecosystems. For coral reefs, this approach is only just beginning to be explored. A recent study showed maternal effects on fitness of interspecific hybrid recruits of the coral species Acropora tenuis and A. loripes, and that some hybrids had higher survival and larger recruit sizes than purebred A. tenuis throughout seven months of exposure to both ambient and elevated temperature and pCO2 conditions (chapter 3). The composition of bacterial and microalgal endosymbiont communities associated with these corals showed no differences between hybrids and purebreds, suggesting microbial communities were unlikely responsible for the observed holobiont fitness differences (chapter 4). Here we examine the transcriptome responses of the coral hosts using RNA-sequencing to examine mechanisms underpinning the observed fitness differences. Consistent with the fitness results, gene expression patterns of hybrid Acropora showed clear maternal effects. Between 0 and 10 genes were found differentially expressed between hybrids and their maternal parental species. In contrast, hundreds of differentially expressed genes were observed between purebred A. tenuis and A. loripes, and between hybrids that had different maternal parents. These results suggest that the previously observed holobiont fitness differences were likely due to maternal host-related factors. Unlike findings from most short-term stress experiments in corals, no genes were found to be differentially expressed under long-term elevated temperature and pCO2 conditions. These findings highlight
144 that genomic stress responses to long-term treatment are distinct from those to short-term treatment, and that these may be transient.
5.2 Introduction
Ocean warming and ocean acidification caused by the rapid increase in atmospheric CO2 levels since the industrial revolution are among the major threats to the persistence of coral reefs worldwide. Over the last 30 years, higher-than-usual seawater temperatures have caused high- mortality global mass bleaching events on tropical reefs (i.e., the dissociation of endosymbiotic algae from the coral host (Hoegh-Guldberg, 1988)), including the events of 1998, 2010 and 2014-
2017 (Eakin et al., 2016; Heron et al., 2016). Ocean acidification reduces the availability of carbonate ions and saturation state in seawater, hindering marine calcifiers like reef-building corals in building their calcium carbonate skeleton (Chan and Connolly, 2013; Doney et al., 2009;
Langdon et al., 2000). The recent massive loss of corals worldwide (The Ocean Agency, 2018) has raised concern as to whether corals will adapt in time to persist into the future, and whether more conservation efforts should be directed to human interventions that may assist corals to survive (Oppen et al., 2017; Rau et al., 2012; van Oppen et al., 2015). One such intervention that has received recent attention is interspecific hybridization (Chan et al., 2018; van Oppen et al.,
2015). Interspecific hybridization has been applied for biodiversity conservation in terrestrial ecosystems, and successful genetic or evolutionary rescue was achieved in cases such as the mountain pygmy possum (Weeks et al., 2015), American chestnut (Clark et al., 2016), and Florida panther (Johnson et al., 2010).
145
Similarly, laboratory studies have demonstrated that some interspecific hybrid coral larvae
(chapter 2) and recruits (chapter 3) survived better and grew faster than purebreds under ambient, elevated temperature, and elevated temperature and pCO2 conditions. However, it is not known what factors and/or mechanisms may have contributed to these differences. The bacterial and microalgal endosymbiont (Symbiodiniaceae spp.) communities associated with corals provide vital functions to the coral hosts and can contribute to holobiont fitness differences (Blackall et al.,
2015; Rosenberg et al., 2007). However, previous examinations of the corals from this study found no differences in community composition between the hybrid and purebred offspring groups
(chapter 4). This finding suggests that the microbial communities of these corals were unlikely responsible for the observed holobiont fitness differences, and that coral host genetic and/or non- genetic transgenerational factors may have been the cause.
Transcriptome sequencing is a powerful tool to examine the mechanistic basis of the physiological responses of an organism under changing conditions, and can provide insights into otherwise unnoticed effects of stress on physiology (DeBiasse and Kelly, 2016). Gene expression studies in corals generally focus on the effect of a particular treatment on a single species, e.g., Acropora millepora (Bellantuono et al., 2012; Dixon et al., 2015; Kenkel et al., 2017; Meyer et al., 2011;
Moya et al., 2012; Rocker et al., 2015), Acropora hyacinthus (Barshis et al., 2013; Ruiz-Jones and
Palumbi, 2017), Siderastrea siderea,(Davies et al., 2016), Montastraea faveolata (Desalvo et al.,
2008) and Pocillopora damicornis (Vidal-Dupiol et al., 2013). Interspecific transcriptome comparisons, however, are lacking, despite the fact that interspecific variations in physiological responses to environmental change are often observed in coral studies (Hughes et al., 2003;
Marshall and Baird, 2000). In addition, many coral gene expression studies have concentrated on
146 short-term acute stress (i.e., hours to days) (Barshis et al., 2013; Bellantuono et al., 2012; Desalvo et al., 2008; Dixon et al., 2015; Meyer et al., 2011; Moya et al., 2012, 2015; Ruiz-Jones and
Palumbi, 2017; Souter et al., 2011; Voolstra et al., 2009). Only few investigations have examined whether the predicted increase in background temperature and/or pCO2 triggers gene expression responses (medium- exposure time of ~3-5 weeks (Rocker et al., 2015; Vidal-Dupiol et al., 2013); long-term laboratory exposure of ~3-8 months (Davies et al., 2016; Maor-Landaw et al., 2017); or chronic natural exposure at CO2 seep sites (Kenkel et al., 2017)). Short-term stress responses in corals generally involve the regulation of heat shock protein genes, genes associated with apoptosis, ion transport and metabolism (Meyer et al., 2011; Moya et al., 2012, Barshis et al.,
2013; Dixon et al., 2015). In contrast, studies with longer exposure times tend to find far fewer differentially expressed genes (Kenkel et al., 2017; Rocker et al., 2015), or a broad-scale down regulation of basic metabolic processes (Maor-Landaw et al., 2017; Vidal-Dupiol et al., 2013). To better understand the transcriptomic responses of corals to gradual increases in ocean warming and acidification, further studies are thus required.
The aim of this study was to investigate transcriptome-wide gene expression of four Acropora offspring groups under long-term (i.e., seven months) ambient and elevated temperature and pCO2 conditions. The four Acropora offspring groups were previously produced via a laboratory cross of A. tenuis and A. loripes and include two hybrid and two purebred groups (chapter 3). Previous fitness measurements on these corals found hybrid offspring groups had fitness values similar to their maternal parent species, although they exceeded the maternal parent in one case (chapter 3).
Elevated conditions had a negative impact on survival and size for both purebred and hybrid offspring. To understand mechanisms underpinning these fitness differences, we examined
147 whether gene expression differs among offspring groups exposed to the same environmental conditions, and/or differs between treatment conditions within each offspring group. Although fitness measurements were also carried out for hybrid and purebred groups from an A. sarmentosa
× A. florida cross in chapter 3, only a few samples from this cross had a sufficient library size, and gene expression therefore could not be studied for this group.
5.3 Materials and methods
5.3.1 Experimental design and sample collection
Parental coral colonies of A. tenuis and A. loripes were collected from Trunk Reef, central Great
Barrier Reef in November 2015 and crossed in the laboratory to form two hybrid and two purebred offspring groups (see chapter 3 for detailed crossing protocol and experimental design). The abbreviation of the offspring groups throughout this study are: TT (purebred A. tenuis), TL
(hybrid), LT (hybrid) and LL (purebred A. loripes), where the first letter indicates the origin of the eggs and the second letter the origin of sperm. For example, “TL” is a hybrid formed by crossing
A. tenuis eggs with A. loripes sperm. Recruits settled onto ceramic plugs were randomly and evenly distributed across two treatment conditions (n = 12 replicate tanks per treatment, n = 20 ceramic plugs per offspring group per tank): ambient conditions (27ºC and 415 ppm pCO2) and elevated conditions (ambient +1 °C and 685 ppm pCO2). Coral recruits were reared under treatment conditions in filtered seawater for seven months at the National Sea Simulator of the Australian
Institute of Marine Science. A microalgal diet supplement was supplied to the corals daily and their fitness traits (including survival, growth) were measured (chapter 3). To mimic the natural environment as closely as possible, the experimental conditions followed diurnal and annual
148 temperature variations of Davies Reef (18.83° S, 147.63° E), which is a reef near parental colonies’ collection sites.
At the end of the seven-month experiment, recruits from three tanks of each treatment condition were randomly selected for sampling. Due to the small size (and therefore low RNA quantity) of individual recruits, multiple recruits of the same offspring group from the same tank were pooled to form one sample. Each pooled sample contained ~30 coral polyps. RNA pooling was considered appropriate as the purpose of this study was to examine population-level rather than individual- level differences (Davies et al., 2016; Kendziorski et al., 2003). Three pooled samples per offspring group per treatment were obtained from ambient conditions (n = 12 total). For elevated conditions, n = 2 for TL, and n = 3 for LT and LL were obtained (n = 8 total). No purebred A. tenuis (i.e., TT) was available from elevated condition due to the high mortality rate this offspring group experienced. Samples were snap-frozen in liquid nitrogen and stored at -80 °C until RNA extraction.
5.3.2 RNA extraction
Coral recruit tissues were mechanically disrupted prior to RNA isolation. Approximately 30 acid washed glass beads (Sigma;710-1180 µm diameter) and 600 µL RLT buffer (Qiagen) were added to each sample. The samples were then subjected to 2 x 40 s cycles of bead beating at 4/s in a fast
Prep-245G (MP Biomedicals). Total RNA was isolated from the sample homogenate using Qiagen
RNeasy mini kit following the manufacturer’s instructions (which included the optional DNase treatment). Total RNA was eluted in 40 µL of RNase free water and 3 µL were visualized on a 1% agarose, 0.5 x TBE gel for quality check. RNA concentration was measured using the Qubit RNA
149
HS Assay (Thermo Fisher Scientific/Invitrogen) following the manufacturer’s instructions, with fluorescence analysis on a NanoDrop 3300 Fluorospectrometer (Thermo Fisher Scientific).
Between 500 pg and 100 ng total RNA underwent reverse transcription and cDNA were amplified using NuGen’s Ovation V2.0 kit following the manufacturer’s instructions (with one cycle amplification). The amplified cDNA was then purified using magnetic beads (Beckman Coulter
Agencourt kit) and 1 µL was visualized on a 1% agarose, 0.5 x TBE gel. Purity of sample cDNA was determined by A260/A280 ratios measured with a NanoDrop 2000 spectrophotometer
(Thermo Fisher Scientific). cDNA concentration was measured using the Quant-iT PicoGreen dsDNA Assay (Thermo Fisher Scientific/Invitrogen) as per manufacturer’s instructions. Sample cDNA concentrations were normalized and 25 µL of 20 ng/µL cDNA were sent to Ramaciotti
Centre for Genomics (UNSW, Sydney) for Nextera XT Library Preparation and paired-end sequencing on the Illumina NextSeq platform.
5.3.3 Sequence data processing
Quality and adapter trimming were carried out on raw reads, discarding reads < 50 bp or with an averaged quality score < 20 in a sliding window of five bases. Since the coral holobiont harbours high cell densities of the algal endosymbiont (Symbiodiniaceae spp.), reads were filtered with the following steps: First, reads were compared to an rRNA database (Silva132_LSU, Silva132_SSU) and matches (i.e., e-values ≤ 10-5) were removed using sortmerna (Kopylova et al., 2012). Second, reads were compared to the genome assembly of the algal endosymbiont in the genus Cladocopium
(family Symbiodiniaceae, symC_scaffold_40.fasta (Shoguchi et al., 2018)) and matches were removed using bbduk. The remaining reads were used to create a combined de novo assembly for all four offspring groups using Trinity (Grabherr et al., 2011). Small clusters of < 400 bp were
150 removed (Kenkel and Bay, 2017), and the longest isoform for each trinity contig was obtained.
The contigs were compared to the A. tenuis mitochondrial genome (NC_003522.1.fasta (van
Oppen et al., 2002)) using BLASTn, and the number of matches were negligible and therefore not removed. The remaining contigs were then identified by BLASTx searches against the most complete coral gene model (A. digitifera, GCF_000222465.1_Adig_1.1_protein.faa (Shinzato et al. 2011)) and NCBI’s nonredundant (nr) protein database, with a e-value cut off ≤ 10-5. Due to the time constrains of a PhD candidature, the BLAST against the entire nr protein database and gene annotation are yet to be completed. For the preliminary analyses presented in this chapter, only transcripts that found matches in the coral gene model were used. Transcript abundance of the samples was then estimated using kallisto (i.e., alignment-free methods based on k-mer abundances in the reads and the assembly).
5.3.4 Statistical analyses
Transcript abundance of the samples and the BLAST results were output to R for statistical analyses using the package limma. Transcripts that consistently had zero or very low counts were removed and scale normalization (TMM) was applied to normalize gene expression distribution.
A total of 9,295 genes were retained in the full dataset (i.e., ambient and elevated conditions), and a total of 6,972 genes were retained in the ambient conditions only dataset after filtering. For
Principal Components Analysis (PCA), the full dataset was used and raw counts were transformed into log2-counts per million (log-CPM) to account for library size differences. The ambient dataset was used to identify differentially expressed genes between offspring groups. Voom transformation was applied to the scale-normalized ambient dataset to fit linear model for comparisons. Empirical Bayes moderation was then carried out to obtain more precise pair-wise
151 comparisons and p-values were corrected using the Benjamini-Hochberg method (Benjamini and
Hochberg, 1995). A gene was considered differentially expressed when padj < 0.05 and with log- fold change > 1. The full dataset was then divided into individual offspring groups to compare gene expression between treatment conditions. Treatment effect was not tested in offspring group
TT due to n = 0 under elevated conditions.
5.4 Results
On average, ~10 million raw reads were obtained per sample. After rRNA and algal endosymbiont components were removed, an average of ~5.5 million paired reads were retained per sample. The initial combined assembly contained 1.7 million contigs. A total of ~229 k contigs were retained after removal of small clusters and the longest isoforms were obtained.
Transcriptome-wide gene expression of the hybrids was similar to that of their maternal parent species (Figures 5.1-5.3). Principal component analyses showed similar expression patterns of the hybrid group LT and its maternal parent LL under both ambient and elevated conditions (Figure
5.1). Expression patterns of the hybrid group TL and its maternal parent TT were more similar to each other than those of the other hybrid and purebred groups under ambient conditions, although some separation between offspring groups TL and TT can be found in principal component 2 (PC2)
(Figure 5.1). No differentially expressed genes were found between the TL hybrid group and its maternal parent TT, and only 10 differentially expressed genes were identified between the hybrid group LT and its maternal parent LL (Figures 5.2, 5.3). In contrast, hundreds of differentially expressed genes were found when the offspring groups had different maternal parents (Figure 5.2,
3). A total of 423 and 729 genes were differentially expressed between purebreds TT and LL, and
152 between hybrids TL and LT, respectively (Figure 5.2). Genes that were upregulated in purebred group LL compared to TT (i.e., log-fold change > +1) had relatively lower mean expression, whereas genes that were down regulated (i.e., log-fold change > -1) generally had higher mean expression (Figure 5.3). Within an offspring group, gene expression did not differ between ambient and elevated conditions (Figure 5.1). average log-expression (i.e., means)
Figure 5.1. Principal component analyses of the offspring groups under ambient and elevated conditions using the normalized counts (i.e., log2-counts per million) of the 9,295 genes retained post filtering. The abbreviation of the offspring groups is that the first letter represents the origin of the eggs and the second letter the origin of sperm, where “T” is A. tenuis and “L’ is A. loripes.
153
Figure 5.2. (top) The number of up/down regulated genes between the offspring group pairs under ambient conditions. (bottom) Venn diagram showing the number of differentially expressed genes between the pairs of offspring groups under ambient conditions. The overlapping space between the circles indicates the number of genes that are differentially expressed in both pairs of the comparison. The abbreviation of the offspring groups is that the first letter indicates the origin of the eggs and the second letter the origin of sperm, where “T” is A. tenuis and “L’ is A. loripes.
154
Figure 5.3. Mean difference plot showing the log-fold change (i.e., differences) versus average log-expression (i.e., means) of all 6,592 genes in the four pairwise comparisons under ambient conditions. Significantly differently expressed genes are highlighted in colour, where green (1) indicates up regulation and red (-1) indicates down regulation. The first letter of an offspring group’s abbreviation refers to the origin of the egg and second letter the origin of sperm, where
“T” is A. tenuis and “L’ is A. loripes.
5.5 Discussion
5.5.1 Gene expression patterns in hybrids follow that of their maternal parent species
The maternal effects on gene expression patterns are consistent with recruit survival and size previously reported for these corals (chapter 3). At the time when the corals were sampled for transcriptome analyses, hybrid LT and purebred LL had higher survival (i.e., 36-49 %) compared
155 to hybrid TL and purebred TT (i.e., 7-23 %) under both ambient and elevated conditions (chapter
3). Nevertheless, survival of hybrid TL was higher than that of its maternal parent TT under elevated conditions (chapter 3). Although the corals did not differ in size at seven months of age, maternal effects on size were evident by one year of age (chapter 3). The consistency between host gene expression patterns and the phenotypic results suggests that maternal host-related factors are likely the drivers behind the observed fitness differences.
Maternal effects have previously been observed in hybrids of Indo-Pacific Acropora corals obtained via laboratory crossing. These include: 1) morphology of the interspecific hybrid from an A. pulchra x A. millepora cross (Willis et al., 2006), 2) survival of interspecific hybrid larvae from an A. florida x A. intermedia cross (Isomura et al., 2013), and 3) thermal tolerance of intraspecific A. millepora hybrid larvae from a higher and lower latitude cross (Dixon et al., 2015).
Consistent with this study, gene expression of intraspecific A. millepora hybrid larvae was similar to that of their maternal parents (Dixon et al., 2015). Up to 2,000 genes were found to follow expression patterns of the maternal parent, and analyses of cellular component categories of tolerance associated genes (i.e., genes for which expression levels prior to stress predicted the probability of larval survival under stress) showed enrichment of nuclear-encoded mitochondrial membrane components (Dixon et al., 2015). The most upregulated gene ontology (GO) categories were energy production and conversion, and encompassed mitochondrial proteins, suggesting mitochondrial protein variation in larvae may have contributed to maternal effects on thermal tolerance (Dixon et al., 2015). In contrast, paternal effects were found for the morphology of natural interspecific hybrids of A. palmata and A. cervicornis from the Caribbean (Vollmer and
Palumbi, 2002). Additive effects have also been observed in experimentally produced intraspecific
156 hybrids of A. millepora from a higher and lower latitude cross, where survival of hybrids in the field was intermediate between the parental offspring (Oppen et al., 2014).
5.5.2 Gene expression was unaffected by long-term exposure to elevated temperature and pCO2 conditions
Although elevated temperature and pCO2 conditions negatively affected the survival and size of the corals used in this study (chapter 3), transcriptome-wide gene expression within an offspring group did not differ between ambient and elevated conditions. In contrast, gene expression changes in corals under short-term acute stress are commonly found. Examples include A. millepora recruits that were exposed to high pCO2 (i.e., 750, 1000ppm) for three days (Moya et al., 2012); adult A. hyacinthus that were exposed to ambient + ∼2.7 °C (i.e., ~31.9 °C) for 72 hours (Barshis et al., 2013); and adult A. hyacinthus that were subjected to a temperature spike of up to 31.5 °C during a natural tidal cycle (Ruiz-Jones and Palumbi, 2017). Short-term thermal stress in corals commonly involves the regulation of genes encoding heat shock proteins (Barshis et al., 2013;
Desalvo et al., 2008; Meyer et al., 2011; Ruiz-Jones and Palumbi, 2017), genes associated with ion transport (Desalvo et al., 2008; Dixon et al., 2015; Ruiz-Jones and Palumbi, 2017), apoptosis
(Barshis et al., 2013; Bellantuono et al., 2012; Desalvo et al., 2008), anti-oxidant capacity/oxidative stress (Barshis et al., 2013; Bellantuono et al., 2012; Desalvo et al., 2008; Dixon et al., 2015), as well as calcium ion binding and/or homeostasis (Desalvo et al., 2008; Dixon et al.,
2015; Ruiz-Jones and Palumbi, 2017). Short- to medium-term high pCO2 stress has been found to suppress metabolism in corals (Moya et al., 2012; Vidal-Dupiol et al., 2013), and to increase expression of ion-transport, energy-production proteins (Vidal-Dupiol et al., 2013) and extracellular organic matrix synthesis (Moya et al., 2012). Gene expression studies in corals using
157 combined temperature and pCO2 stress are scarce, but down regulation of genes involve in metabolism (Rocker et al., 2015) and cell-cell adhesion (Maor-Landaw et al., 2017) have been observed.
The absence of differential gene expression of corals under ambient versus elevated conditions in the present study was unexpected. Although the elevated conditions (i.e., ambient +1 °C, 685 ppm pCO2) of the present study are relatively mild compared to some of the longer-term studies (e.g. ambient +7 and + 12 ºC (Maor-Landaw et al., 2017), or 604-2553 ppm pCO2 (Davies et al., 2016), or 856-3880 ppm pCO2 (Vidal-Dupiol et al., 2013)), negative effects on recruit survival and size were observed (chapter 3). Overall, recruit survival was reduced by 6-10 % under elevated conditions (chapter 3). Stronger transcriptomic responses tend to occur as treatments further deviate from ambient conditions (Maor-Landaw et al., 2017), therefore the relatively mild treatment conditions in this study is expected to have triggered fewer or smaller extent of gene expression changes. Nevertheless, some changes might be expected and the absence of differential gene expression in the study may be explained in two ways.
Firstly, gene expression responses of corals under long-term stress have previously been shown to differ to those under short-term stress. Of the few long-term studies (i.e., 3-8 months, or chronic natural exposure in CO2 seep sites) that have examined coral gene expression, changes in regulation in metabolic processes (Davies et al., 2016; Kenkel et al., 2017; Maor-Landaw et al.,
2017)), molecular chaperones (Kenkel et al., 2017), protein catabolism and genes involved in responding to environmental stimuli (Davies et al., 2016) were observed. These results are distinct from the regulations of heat shock protein and apoptosis-related genes typically found in corals
158 under short-term stress. Despite significant differences in CO2 concentration under control and natural CO2 seep sites (i.e., ~355 ppm versus 998 ppm), a comparison of A. millepora transcriptome-wide gene expression from the two sites only found 61 differentially expressed genes (Kenkel et al., 2017). Similarly, the expression of calcification-related genes changed significantly in A. millepora subjected to short-term (i.e., 3 days) exposure to elevated pCO2 (Moya et al., 2012, 2015), but far fewer differentially expressed genes were found as exposure time increased (Moya et al., 2015; Rocker et al., 2015). Since cellular stress gene expression responses can be transient (Kültz, 2003), certain expression changes may only be detectable during the initial exposure and therefore less differentially expressed genes are found in long-term studies.
Nonetheless, some levels of gene expression changes are usually detected in long-term studies.
Secondly, other components that were not examined during this research may have differed between ambient and elevated conditions and been responsible for the phenotypic results.
Although the composition of bacterial and microalgal endosymbiont communities of these corals was the same under ambient and elevated conditions (chapter 4), they may have expressed different genes and have contributed to functional differences under the conditions tested. Other less known members of the coral holobiont, such as viruses and fungi (that were not examined in this thesis), may also have contributed to recruit survival and size differences. Although gene expression changes were absent between treatment conditions in this study, post-transcriptional regulation may have varied and resulted in phenotypic differences between treatment. Studies have found weak correlations between transcriptome and proteome changes (Cziesielski et al., 2018) or mRNA expression and protein levels (Nie et al., 2006; Vogel et al., 2011), suggesting gene expression data may not necessarily always represent an accurate proxy for phenotype. Epigenetic
159 regulations (e.g., DNA methylation), can also be affected by treatment conditions (Dimond et al.,
2017) and may explain phenotypic variance. Future studies will benefit from adopting a multi- omics approach and assessing rare components of the coral holobiont to cross-validate mechanisms that may have contributed to phenotypic observations.
5.6 Preparation for publication
Unfortunately, time constrains of a PhD candidature have meant that annotation of the differentially expressed genes is yet to be completed. For the next steps of this research, the additional BLASTx results (i.e., searches against NCBI’s nonredundant protein database) will be output to R studio, along with existing BLASTx results of the coral gene models and transcript abundance of the samples to re-run statistical analyses. Annotation of the contigs will be completed by assigning gene names and gene ontologies using BLASTx search against UniProt
Knowledgebase Swiss-Prot database (The UniProt Consortium, 2015). After differentially expressed genes are identified, Weighted Gene Co-expression Network Analysis will be carried out to identify groups of genes (i.e., ‘modules’) that are co-regulated. Function enrichment analyses will then be conducted on the gene modules to examine molecular pathways that may be related to fitness and maternal effects.
160
References
Barshis, D. J., Ladner, J. T., Oliver, T. A., Seneca, F. O., Traylor-Knowles, N., and Palumbi, S. R. (2013). Genomic basis for coral resilience to climate change. Proc. Natl. Acad. Sci. 110, 1387–1392. doi:10.1073/pnas.1210224110.
Bellantuono, A. J., Granados-Cifuentes, C., Miller, D. J., Hoegh-Guldberg, O., and Rodriguez- Lanetty, M. (2012). Coral thermal tolerance: tuning gene expression to resist thermal stress. PLOS ONE 7, e50685. doi:10.1371/journal.pone.0050685.
Benjamini, Y., and Hochberg, Y. (1995). Controlling the false discovery rate: a practical and powerful approach to multiple testing. J. R. Stat. Soc. Ser. B Methodol. 57, 289–300. doi:10.2307/2346101.
Blackall, L. L., Wilson, B., and van Oppen, M. J. H. (2015). Coral-the world’s most diverse symbiotic ecosystem. Mol. Ecol. 24, 5330–5347. doi:10.1111/mec.13400.
Chan, N. C. S., and Connolly, S. R. (2013). Sensitivity of coral calcification to ocean acidification: a meta-analysis. Glob. Change Biol. 19, 282–290. doi:10.1111/gcb.12011.
Chan, W. Y., Peplow, L. M., Menéndez, P., Hoffmann, A. A., and Van Oppen, M. J. H. (2018). Interspecific hybridization may provide novel opportunities for coral reef restoration. Front. Mar. Sci. 5. doi:10.3389/fmars.2018.00160.
Clark, S. L., Schlarbaum, S. E., Saxton, A. M., and Hebard, F. V. (2016). Establishment of American chestnuts (Castanea dentata) bred for blight (Cryphonectria parasitica) resistance: influence of breeding and nursery grading. New For. 47, 243–270. doi:10.1007/s11056-015-9512-6.
Cziesielski, M. J., Liew, Y. J., Cui, G., Schmidt-Roach, S., Campana, S., Marondedze, C., et al. (2018). Multi-omics analysis of thermal stress response in a zooxanthellate cnidarian reveals the importance of associating with thermotolerant symbionts. Proc. Biol. Sci. 285. doi:10.1098/rspb.2017.2654.
Davies, S. W., Marchetti, A., Ries, J. B., and Castillo, K. D. (2016). Thermal and pCO2 stress elicit divergent transcriptomic responses in a resilient coral. Front. Mar. Sci. 3. doi:10.3389/fmars.2016.00112.
DeBiasse, M. B., and Kelly, M. W. (2016). Plastic and evolved responses to global change: what can we learn from comparative transcriptomics? J. Hered. 107, 71–81. doi:10.1093/jhered/esv073.
Desalvo, M. K., Voolstra, C. R., Sunagawa, S., Schwarz, J. A., Stillman, J. H., Coffroth, M. A., et al. (2008). Differential gene expression during thermal stress and bleaching in the Caribbean coral Montastraea faveolata. Mol. Ecol. 17, 3952–3971. doi:10.1111/j.1365- 294X.2008.03879.x.
161
Dimond, J. L., Gamblewood, S. K., and Roberts, S. B. (2017). Genetic and epigenetic insight into morphospecies in a reef coral. Mol. Ecol. 26, 5031–5042. doi:10.1111/mec.14252.
Dixon, G. B., Davies, S. W., Aglyamova, G. V., Meyer, E., Bay, L. K., and Matz, M. V. (2015). Genomic determinants of coral heat tolerance across latitudes. Science 348, 1460–1462. doi:10.1126/science.1261224.
Doney, S. C., Fabry, V. J., Feely, R. A., and Kleypas, J. A. (2009). Ocean acidification: the other CO2 problem. Annu. Rev. Mar. Sci. 1, 169–192. doi:10.1146/annurev.marine.010908.163834.
Eakin, C., Liu, G., Gomez, A., William, J. L., Heron, S. F., Skirving, W. S., et al. (2016). Global coral bleaching 2014–2017: status and an appeal for observations. Reef Encounter, 20–26.
Grabherr, M. G., Haas, B. J., Yassour, M., Levin, J. Z., Thompson, D. A., Amit, I., et al. (2011). Trinity: reconstructing a full-length transcriptome without a genome from RNA-Seq data. Nat. Biotechnol. 29, 644–652. doi:10.1038/nbt.1883.
Heron, S. F., Maynard, J. A., van Hooidonk, R., and Eakin, C. M. (2016). Warming trends and bleaching stress of the world’s coral reefs 1985–2012. Sci. Rep. 6. doi:10.1038/srep38402.
Hoegh-Guldberg, O. (1988). A method for determining the surface area of corals. Coral Reefs 7, 113–116. doi:10.1007/BF00300970.
Hughes, T. P., Baird, A. H., Bellwood, D. R., Card, M., Connolly, S. R., Folke, C., et al. (2003). Climate change, human impacts, and the resilience of coral reefs. Science 301, 929–933. doi:10.1126/science.1085046.
Isomura, N., Iwao, K., and Fukami, H. (2013). Possible natural hybridization of two morphologically distinct species of Acropora (Cnidaria, Scleractinia) in the Pacific: fertilization and larval survival rates. PloS One 8, e56701. doi:10.1371/journal.pone.0056701.
Johnson, W. E., Onorato, D. P., Roelke, M. E., Land, E. D., Cunningham, M., Belden, R. C., et al. (2010). Genetic restoration of the Florida Panther. Science 329, 1641–1645. doi:10.1126/science.1192891.
Kendziorski, C. M., Zhang, Y., Lan, H., and Attie, A. D. (2003). The efficiency of pooling mRNA in microarray experiments. Biostatistics 4, 465–477. doi:10.1093/biostatistics/4.3.465.
Kenkel, C. D., and Bay, L. K. (2017). Novel transcriptome resources for three scleractinian coral species from the Indo-Pacific. GigaScience 6. doi:10.1093/gigascience/gix074.
Kenkel, C. D., Moya, A., Strahl, J., Humphrey, C., and Bay, L. K. (2017). Functional genomic analysis of corals from natural CO2-seeps reveals core molecular responses involved in acclimatization to ocean acidification. Glob. Change Biol. 24, 158–171. doi:10.1111/gcb.13833.
162
Kopylova, E., Noé, L., and Touzet, H. (2012). SortMeRNA: fast and accurate filtering of ribosomal RNAs in metatranscriptomic data. Bioinformatics 28, 3211–3217. doi:10.1093/bioinformatics/bts611.
Kültz, D. (2003). Evolution of the cellular stress proteome: from monophyletic origin to ubiquitous function. J. Exp. Biol. 206, 3119. doi:10.1242/jeb.00549.
Langdon, C., Takahashi, T., Sweeney, C., Chipman, D., Goddard, J., Marubini, F., et al. (2000). Effect of calcium carbonate saturation state on the calcification rate of an experimental coral reef. Glob. Biogeochem. Cycles 14, 639–654. doi:10.1029/1999GB001195.
Maor-Landaw, K., Ben-Asher, H. W., Karako-Lampert, S., Salmon-Divon, M., Prada, F., Caroselli, E., et al. (2017). Mediterranean versus Red sea corals facing climate change, a transcriptome analysis. Sci. Rep. 7, 42405. doi:10.1038/srep42405.
Marshall, P. A., and Baird, A. H. (2000). Bleaching of corals on the Great Barrier Reef: differential susceptibilities among taxa. Coral Reefs 19, 155–163. doi:10.1007/s003380000086.
Meyer, E., Aglyamova, G. V., and Matz, M. V. (2011). Profiling gene expression responses of coral larvae (Acropora millepora) to elevated temperature and settlement inducers using a novel RNA-Seq procedure. Mol. Ecol. 20, 3599–3616. doi:10.1111/j.1365- 294X.2011.05205.x.
Moya, A., Huisman, L., Ball, E. E., Hayward, D. C., Grasso, L. C., Chua, C. M., et al. (2012). Whole transcriptome analysis of the coral Acropora millepora reveals complex responses to CO2 -driven acidification during the initiation of calcification. Mol. Ecol. 21, 2440– 2454. doi:10.1111/j.1365-294X.2012.05554.x.
Moya, A., Huisman, L., Forêt, S., Gattuso, J.-P., Hayward, D. C., Ball, E. E., et al. (2015). Rapid acclimation of juvenile corals to CO2-mediated acidification by upregulation of heat shock protein and bcl-2 genes. Mol. Ecol. 24, 438–452. doi:10.1111/mec.13021.
Nie, L., Wu, G., and Zhang, W. (2006). Correlation of mRNA expression and protein abundance affected by multiple sequence features related to translational efficiency in Desulfovibrio vulgaris: a quantitative analysis. Genetics 174, 2229–2243. doi:10.1534/genetics.106.065862.
Oppen, V., H, M. J., Gates, R. D., Blackall, L. L., Cantin, N., Chakravarti, L. J., et al. (2017). Shifting paradigms in restoration of the world’s coral reefs. Glob. Change Biol. doi:10.1111/gcb.13647.
Oppen, M. J. H. van, Puill-Stephan, E., Lundgren, P., De’ath, G., and Bay, L. K. (2014). First- generation fitness consequences of interpopulational hybridisation in a Great Barrier Reef coral and its implications for assisted migration management. Coral Reefs 33, 607–611. doi:10.1007/s00338-014-1145-2.
163
Rau, G. H., McLeod, E. L., and Hoegh-Guldberg, O. (2012). The need for new ocean conservation strategies in a high-carbon dioxide world. Nat. Clim. Change 2, 720–724. doi:10.1038/nclimate1555.
Rocker, M. M., Noonan, S., Humphrey, C., Moya, A., Willis, B. L., and Bay, L. K. (2015). Expression of calcification and metabolism-related genes in response to elevated pCO2 and temperature in the reef-building coral Acropora millepora. Mar. Genomics 24 Pt 3, 313– 318. doi:10.1016/j.margen.2015.08.001.
Rosenberg, E., Koren, O., Reshef, L., Efrony, R., and Zilber-Rosenberg, I. (2007). The role of microorganisms in coral health, disease and evolution. Nat Rev Micro 5, 355–362. doi:10.1038/nrmicro1635.
Ruiz-Jones, L. J., and Palumbi, S. R. (2017). Tidal heat pulses on a reef trigger a fine-tuned transcriptional response in corals to maintain homeostasis. Sci. Adv. 3, e1601298. doi:10.1126/sciadv.1601298.
Shoguchi, E., Beedessee, G., Tada, I., Hisata, K., Kawashima, T., Takeuchi, T., et al. (2018). Two divergent Symbiodinium genomes reveal conservation of a gene cluster for sunscreen biosynthesis and recently lost genes. BMC Genomics 19, 458. doi:10.1186/s12864-018- 4857-9.
Souter, P., Bay, L. K., Andreakis, N., Császár, N., Seneca, F. O., and Oppen, M. J. H. V. (2011). A multilocus, temperature stress-related gene expression profile assay in Acropora millepora, a dominant reef-building coral. Mol. Ecol. Resour. 11, 328–334. doi:10.1111/j.1755-0998.2010.02923.x.
The Ocean Agency (2018). 50 Reefs. Ocean Agency. Available at: https://theocean.agency/50- reefs/ [Accessed October 17, 2018].
The UniProt Consortium (2015). UniProt: a hub for protein information. Nucleic Acids Res. 43, D204–D212. doi:10.1093/nar/gku989. van Oppen, M. J. H., Catmull, J., McDonald, B. J., Hislop, N. R., Hagerman, P. J., and Miller, D. J. (2002). The mitochondrial genome of Acropora tenuis (cnidaria; scleractinia) contains a large group i intron and a candidate control region. J. Mol. Evol. 55, 1–13. doi:10.1007/s00239-001-0075-0. van Oppen, M. J. H., Oliver, J. K., Putnam, H. M., and Gates, R. D. (2015). Building coral reef resilience through assisted evolution. Proc. Natl. Acad. Sci. 112, 2307–2313. doi:10.1073/pnas.1422301112.
Vidal-Dupiol, J., Zoccola, D., Tambutté, E., Grunau, C., Cosseau, C., Smith, K. M., et al. (2013). Genes related to ion-transport and energy production are upregulated in response to CO2- driven ph decrease in corals: new insights from transcriptome analysis. PLOS ONE 8, e58652. doi:10.1371/journal.pone.0058652.
164
Vogel, C., Silva, G. M., and Marcotte, E. M. (2011). Protein expression regulation under oxidative stress. Mol. Cell. Proteomics MCP 10, M111.009217. doi:10.1074/mcp.M111.009217.
Vollmer, S. V., and Palumbi, S. R. (2002). Hybridization and the evolution of reef coral diversity. Science 296, 2023–2025. doi:10.1126/science.1069524.
Voolstra, C. R., Schnetzer, J., Peshkin, L., Randall, C. J., Szmant, A. M., and Medina, M. (2009). Effects of temperature on gene expression in embryos of the coral Montastraea faveolata. BMC Genomics 10, 627. doi:10.1186/1471-2164-10-627.
Weeks, A., Moro, D., Thavornkanlapachai, R., R Taylor, H., E White, N., Weiser, E., et al. (2015). “Conserving and enhancing genetic diversity in translocation programs.,” in Advances in Reintroduction Biology of Australian and New Zealand Fauna (Clayton South, Australia: CSIRO Publishing), 127–140.
Willis, B. L., Oppen, M. J. H. van, Miller, D. J., Vollmer, S. V., and Ayre, D. J. (2006). The role of hybridization in the evolution of reef corals. Annu. Rev. Ecol. Evol. Syst. 37, 489–517.
Acknowledgement
The research was funded by the Paul G. Allen Philanthropies and the Australian Institute of Marine
Science (AIMS). Sample RNA extraction of this study was carried out by L. Peplow. I thank J.
Chung for bioinformatics and statistics advice, C. Kenkel and P. Laffy for fruitful discussions, and support from the National Sea Simulator staffs of AIMS.
165
Chapter 6
General discussion
This thesis has demonstrated the potential of interspecific hybridization as a management option for reef restoration and conservation. While I recommend this approach to be considered in future coral reef restoration initiatives, a few knowledge gaps need to be filled to ensure the intervention can be safely implemented across a diversity of coral species and in different geographic regions.
These areas for future research are briefly discussed below.
6.1 Cross fertility in coral genera other than Acropora
The genus Acropora is by far the best studied genus in terms of cross fertility. Other than the four
Acropora species pairs tested in this study, numerous other Acropora species pairs have been examined (Fogarty et al., 2012; Hatta et al., 1999; Isomura et al., 2013; Márquez et al., 2002; Willis et al., 1997), with mean fertilization rates ranging from 0 to 95%. However, coral reefs are diverse ecosystems home to many coral genera. The Great Barrier Reef, for example, harbours ~405 scleractinian coral species in 78 genera (DeVantier et al., 2006). Little is known about cross fertility in genera other than Acropora, such as slow-growing massive corals like Porites, or brooding corals like Pocillopora. Hybridization trials have previously been conducted in several
Platygyra species pairs (massive corals) and mean fertilization rates were found between 0 to 73%
(Miller, 1994; Miller and Babcock, 1997; Willis et al., 1997). Successful hybridization was also observed in one species pair of Montipora (branching or encrusting corals) (Willis et al., 1997) and in one species pair of Orbicella (massive or encrusting corals) (Levitan et al., 2004). In contrast, species from the genus Ctenactis (solitary coral) were not cross fertile (Baird et al., 2013).
166
A hybridization test was also conducted between Favites colemani and Favites abdita (massive corals) from the Philippines during this PhD, and between 5 and 10% fertilization was observed
(Chan WY, unpubl.). These data suggest that hybridization is possible in other coral genera, and future studies in this area will help assess whether hybridization can be a feasible conservation approach for multiple coral genera.
6.2 Reproductive potential of F1 hybrids and fitness of advanced generation hybrids and backcrosses
Although this study has demonstrated that interspecific hybrid larvae (chapter 2) and recruits
(chapter 3) were as fit as, or more fit than parental purebred offspring under ambient and elevated conditions, the reproductive potential of these F1 hybrids and fitness of later generation hybrids and backcrosses are important outstanding questions to address. Rearing laboratory produced corals to reproductive maturity is a challenging, multi-year task. For example, Isomura et al. (2016) used ~12,400 larvae (F1 hybrid of one direction from an A. intermedia x A. florida cross) for settlement, but only one colony survived to sexual maturity after seven years. Only one study so far has examined reproductive potential of F1 hybrid coral, but the assessment was based on one
F1 hybrid colony from each direction (Isomura et al., 2016). Nonetheless, the study showed that these F1 hybrids were fertile and able to produce F2 hybrids and backcrosses with high fertilization rates (Isomura et al., 2016). Further, unidirectional gene flow from A. palmata into A. cervicornis has been revealed by molecular studies, suggesting that their natural hybrid A. prolifera is fertile and able to backcross with at least one parental species in the Caribbean (Vollmer and Palumbi,
2002, 2006). These findings provide confidence that other F1 Acropora hybrid corals are likely
167 also fertile. The F1 hybrids produced in this study (chapter 3) are currently three years of age, and a total of 51 hybrids (among the different offspring groups) have survived.
Assessing the reproductive potential of these F1 hybrids when they reach maturity will provide invaluable information based on a much larger sample size than previously reported. If F2 hybrids and backcrosses can be successfully produced, fitness comparisons of these offspring groups will allow the effects of segregation and recombination (e.g., the possibility of outbreeding depression) to be assessed. Hybrid breakdown has been showed to be related to cytonuclear incompatibilities in several cases as hybridization brings together allelic combination previously untested (Koevoets et al., 2011; Burton et al., 2013). Hybridization may also disturb mitonuclear interactions (i.e., interactions between the mitochondrial RNA polymerase and the co-evolved regulatory sites in the mtDNA), resulting in hybrid incompatibilities (Ellison and Burton, 2010). Hybrid breakdown can be due to cytonuclear incompatibilities as hybridization creates previously untested allelic combination (Koevoets et al., 2011; Burton et al., 2013). The presence/absence or extent of cytonuclear incompatibility in F2 hybrids and backcrosses will depend on the direction of the F1 hybrid cross and who they hybridize/backcross to. Cytonuclear incompatibilities can affect the viability and fertility of F2 offspring and backcrosses and should be assessed before deciding whether interspecific hybridization is beneficial to coral resilience and reef restoration in the long- term
6.3 Field performance of hybrid and purebred corals
Assessments of larval and recruit fitness in this PhD project was conducted in the laboratory with simulated elevated temperature or combined elevated temperature and pCO2. Although
168 laboratories provide ideal conditions to tease apart the effects of one or two stressor(s) on phenotypes, organisms are subjected to many environmental factors in nature (Fitzpatrick et al.,
2016). The next important step of this research is to outplant hybrid and purebred corals to the field and assess their relative fitness in their natural environment. Only two studies to date have conducted such a comparison. Survival of hybrid recruits (A. prolifera) was same as that of purebred recruits (A. palmata, A. cervicornis) after six weeks on the reef (Fogarty, 2012). Similar results were found for survival and growth of interspecific hybrids of A. millepora and A. pulchra after three months deployment on the reef, although hybrids grew faster than purebred A. millepora on the reef flat. For controlled field tests in the future, caution should be exercised to avoid accidental release of hybrids or genetic admixture with the wild populations. Nevertheless, such risks are low when coral recruits that are not yet reproductively mature are used (i.e., under ~three years of age for fast-growing species such as Acropora). Coral recruits are sessile and confined to the substrate they settle onto. These substrates can be kept inside underwater cages (Isomura et al.,
2016) or attached to stainless steel posts fixed onto the reef (dela Cruz and Harrison, 2017) to avoid the possibility of losing them during a storm.
6.4 Mechanisms underpinning phenotypic performance
Although the microbial community compositions and gene expression of the coral hosts were assessed in this study, other factors and mechanisms that were not examined may also have contributed to the observed holobiont fitness differences. These factors and mechanisms include other microbial members of the coral holobiont, differential gene expression of the microbial communities under ambient versus elevated conditions, and host post-transcriptional and epigenetic regulations. For microbiome studies, future research will benefit from adopting a
169 metagenomic approach, where less known members of the coral holobiont (e.g., viruses, fungi) can be evaluated. In addition, corals associated with the same microbial communities may differ in holobiont phenotypes if these communities express different genes under treatment. Future studies on microbiome gene expression along with community composition will provide insight into this question. Further, since transcriptomic level changes are not necessarily being converted into protein level changes (Cziesielski et al., 2018), gene expression studies that are combined with proteomics and metabolomics will facilitate a more holistic understanding of coral genomic stress responses. Nevertheless, the strong correlation between patterns in host transcriptomics and holobiont phenotypes in offspring groups from the A. loripes x A. tenuis cross indicates that the main drivers behind the stress tolerance phenotypes in this cross were likely due to maternal host- related factors.
6.5 Concluding remarks
Before hybrid corals can be released to assist the recovery and restoration of damaged reefs, the fitness and fertility of advanced generation hybrids and backcrosses must be evaluated in the laboratory and in the field. Future studies on factors that can contribute to coral holobiont fitness
(e.g., less known members of the holobiont, gene expression of the microbial communities, post- transcriptional regulation, etc.) that were not explored in this study will be invaluable. In addition, future studies on the mechanisms underlying hybrid breakdown (e.g., cytonuclear incompatibilities, disruption of mitonuclear interactions) will provide further insights into the possible risks of hybridization as a conservation tool.
170
Although scientific research can provide evidence on whether interspecific hybridization will likely benefit coral reef restoration efforts, its implementation depends on regulatory approval and whether a social license to operate can be gained. Other than a few exceptions, interspecific hybrids are currently not being recognized as entities of protection in the US, Australia, or other countries.
However, positive outcomes have been achieved in the few cases where interspecific hybridization was applied in biodiversity conservation. Given the recent rapid loss of species and populations, a change in attitude and revision of legislation regarding hybrids and hybridization will be an important step forward in the field of biodiversity conservation.
References
Baird, A. H., Cumbo, V. R., Figueiredo, J., and Harii, S. (2013). A pre-zygotic barrier to hybridization in two con-generic species of scleractinian corals. F1000Res 2. doi:10.12688/f1000research.2-193.v2.
Burton, R. S., Pereira, R. J., and Barreto, F. S. (2013). Cytonuclear Genomic Interactions and Hybrid Breakdown. Annual Review of Ecology, Evolution, and Systematics 44, 281–302. doi:10.1146/annurev-ecolsys-110512-135758.
Cziesielski, M. J., Liew, Y. J., Cui, G., Schmidt-Roach, S., Campana, S., Marondedze, C., et al. (2018). Multi-omics analysis of thermal stress response in a zooxanthellate cnidarian reveals the importance of associating with thermotolerant symbionts. Proc. Biol. Sci. 285. doi:10.1098/rspb.2017.2654. dela Cruz, D. W., and Harrison, P. L. (2017). Enhanced larval supply and recruitment can replenish reef corals on degraded reefs. Scientific Reports 7, 13985. doi:10.1038/s41598-017-14546- y.
DeVantier, L. M., De’ath, G., Turak, E., Done, T. J., and Fabricius, K. E. (2006). Species richness and community structure of reef-building corals on the nearshore Great Barrier Reef. Coral Reefs 25, 329–340. doi:10.1007/s00338-006-0115-8.
Ellison, C. K., and Burton, R. S. (2010). Cytonuclear conflict in interpopulation hybrids: the role of RNA polymerase in mtDNA transcription and replication. Journal of Evolutionary Biology 23, 528–538. doi:10.1111/j.1420-9101.2009.01917.x.
Fitzpatrick, S. W., Gerberich, J. C., Angeloni, L. M., Bailey, L. L., Broder, E. D., Torres‐Dowdall, J., et al. (2016). Gene flow from an adaptively divergent source causes rescue through
171
genetic and demographic factors in two wild populations of Trinidadian guppies. Evolutionary Applications 9, 879–891. doi:10.1111/eva.12356.
Fogarty, N. D. (2012). Caribbean acroporid coral hybrids are viable across life history stages. Mar Ecol Prog Ser 446, 145–159. doi:10.3354/meps09469.
Fogarty, N. D., Vollmer, S. V., and Levitan, D. R. (2012). Weak prezygotic isolating mechanisms in threatened Caribbean Acropora corals. PLOS ONE 7, e30486. doi:10.1371/journal.pone.0030486.
Hatta, M., Fukami, H., Wang, W., Omori, M., Shimoike, K., Hayashibara, T., et al. (1999). Reproductive and genetic evidence for a reticulate evolutionary history of mass-spawning corals. Mol Biol Evol 16, 1607–1613. doi:10.1093/oxfordjournals.molbev.a026073.
Isomura, N., Iwao, K., and Fukami, H. (2013). Possible natural hybridization of two morphologically distinct species of Acropora (Cnidaria, Scleractinia) in the Pacific: fertilization and larval survival rates. PLoS ONE 8, e56701. doi:10.1371/journal.pone.0056701.
Isomura, N., Iwao, K., Morita, M., and Fukami, H. (2016). Spawning and fertility of F1 hybrids of the coral genus Acropora in the Indo-pacific. Coral Reefs 35, 851–855. doi:10.1007/s00338-016-1461-9.
Koevoets, T., Zande, L. V. D., and Beukeboom, L. W. (2012). Temperature stress increases hybrid incompatibilities in the parasitic wasp genus Nasonia. Journal of Evolutionary Biology 25, 304–316. doi:10.1111/j.1420-9101.2011.02424.x.
Levitan, D. R., Fukami, H., Jara, J., Kline, D., McGovern, T. M., McGhee, K. E., et al. (2004). Mechanisms of reproductive isolation among sympatric broadcast-spawning corals of the Montastraea annularis species complex. Evolution 58, 308–323. doi:10.1554/02-700.
Márquez, L. M., Van Oppen, M. J. H., Willis, B. L., Reyes, A., and Miller, D. J. (2002). The highly cross-fertile coral species, Acropora hyacinthus and Acropora cytherea, constitute statistically distinguishable lineages. Molecular Ecology 11, 1339–1349. doi:10.1046/j.1365-294X.2002.01526.x.
Miller, K., and Babcock, R. (1997). Conflicting morphological and reproductive species boundaries in the coral genus Platygyra. The Biological Bulletin 192, 98-.
Miller, K. J. (1994). The Platygyra species complex: implications for coral taxonomy and evolution.
Vollmer, S. V., and Palumbi, S. R. (2002). Hybridization and the evolution of reef coral diversity. Science 296, 2023–2025. doi:10.1126/science.1069524.
Vollmer, S. V., and Palumbi, S. R. (2006). Restricted gene flow in the Caribbean staghorn coral Acropora cervicornis: implications for the recovery of endangered reefs. J Hered 98, 40– 50. doi:10.1093/jhered/esl057.
172
Willis, B. L., Babcock, R. C., Harrison, P. L., and Wallace, C. C. (1997). Experimental hybridization and breeding incompatibilities within the mating systems of mass spawning reef corals. Coral Reefs 16, S53–S65. doi:10.1007/s003380050242.
Supplementary information: chapter 2
Interspecific gamete compatibility and hybrid larval fitness in reef-building corals:
Implications for coral reef restoration
Supplementary Table S2.1. Spawning date and time of the seven Acropora spp. from Trunk Reef, central GBR. Date Species Days after No. of Setting time Spawning full moon colonies time 17/11/2016 A. tenuis 3 4/11 18:30 19:30 18/11/2016 A. tenuis 4 6/11 18:30 19:30 19/11/2016 A. tenuis 5 11/11 18:30 19:30 20/11/2016 A. tenuis 6 4/11 18:15 19:10-19:30 21/11/2016 A. tenuis 7 1/11 18:00 19:30
18/11/2016 A. loripes 4 1/11 20:20 No spawning 19/11/2016 A. loripes 5 2/11 20:20 No spawning 20/11/2016 A. loripes 6 5/11 19:30 21:35 21/11/2016 A. loripes 7 11/11 19:15 21:40 22/11/2016 A. loripes 8 4/11 19:30 21:40
19/11/2016 A. sarmentosa 5 5/8 19:30 20:30 20/11/2016 A. sarmentosa 6 5/8 19:00 20:45 21/11/2016 A. sarmentosa 7 5/8 19:00 20:30
19/11/2016 A. florida 5 2/8 21:00 No spawning 20/11/2016 A. florida 6 2/8 19:50 No spawning 21/11/2016 A. florida 7 3/8 21:30 No spawning 22/11/2016 A. florida 8 2/8 21:00 21:35 23/11/2016 A. florida 9 8/8 19:50 21:45 24/11/2016 A. florida 10 3/8 21:00 21:45
22/11/2016 A. hyacinthus 8 3/8 19:50 22:00 24/11/2016 A. hyacinthus 10 4/8 20:00-21:00 22:00 25/11/2016 A. hyacinthus 11 2/8 20:30 22:00
173
23/11/2016 A. nobilis 9 5/5 20:00-20:30 22:00
23/11/2016 A. cytherea 9 1/8 No setting 22:15 24/11/2016 A. cytherea 10 4/8 20:30-21:30 22:15 25/11/2016 A. cytherea 11 3/8 20:45 22:15
Supplementary Table S2.2. Tukey’s pairwise comparisons on the effect of offspring group (i.e., TT, TL and LL) and treatment (i.e., 28 ºC, 29 ºC and 31 ºC) on larval survival of the A. tenuis (T) x A. loripes (L) cross. The first letter in the abbreviation of the offspring groups represents the origin of the egg and the second letter the origin of sperm. An odds ratio of > 1 indicates higher survival, and < 1 indicates lower survival of the first offspring group/ treatment in comparison. Comparison Log odds ratio Std. error z-value p-value Odds ratio TL.28 - TT.28 -0.76 0.32 -2.35 0.644 0.47 LL.28 - TT.28 -0.63 0.33 -1.92 0.655 0.53 LL.28 - TL.28 0.13 0.30 0.45 0.842 1.14 TL.29.5 - TT.29.5 0.21 0.33 0.66 0.842 1.24 LL.29.5 - TT.29.5 -0.15 0.31 -0.47 0.842 0.86 LL.29.5 - TL.29.5 -0.36 0.32 -1.12 0.842 0.70 TL.31 - TT.31 -0.51 0.34 -1.51 0.792 0.60 LL.31 - TT.31 -0.70 0.33 -2.10 0.644 0.50 LL.31 - TL.31 -0.19 0.31 -0.62 0.842 0.83
TT.29.5 - TT.28 -0.39 0.48 -0.81 0.842 0.68 TT.31 - TT.28 0.09 0.50 0.18 0.915 1.09 TT.31 - TT.29.5 0.48 0.48 0.99 0.842 1.61 TL.29.5 - TL.28 0.59 0.46 1.27 0.818 1.80 TL.31 - TL.28 0.34 0.46 0.75 0.842 1.40 TL.31 - TL.29.5 -0.25 0.47 -0.53 0.842 0.78 LL.29.5 - LL.28 0.10 0.46 0.21 0.915 1.10 LL.31 - LL.28 0.02 0.45 0.04 0.967 1.02 LL.31 - LL.29.5 -0.08 0.45 -0.17 0.915 0.93 * indicates significant difference in this comparison.
174
Supplementary Table S2.3. Tukey’s pairwise comparisons on the effect of offspring group (i.e., FF, FN and NN) and treatment (i.e., 28 ºC, 29 ºC and 31 ºC) on larval survival of the A. florida (F) x A. nobilis (N) cross. The first letter in the abbreviation of the offspring groups represents the maternal parent species and the second letter the paternal parent species. An odds ratio of > 1 indicates higher survival, and < 1 indicates lower survival of the first offspring group/ treatment in comparison. Comparison Log odds ratio Std. error z-value p-value Odds ratio FN.28 - FF.28* -0.73 0.30 -2.46 0.030 0.48 NN.28 - FF.28* -0.73 0.30 -2.46 0.030 0.48 NN.28 - FN.28 0.00 0.27 0.00 1.000 1.00 FN.29.5 - FF.29.5 -0.20 0.37 -0.55 0.676 0.82 NN.29.5 - FF.29.5* -1.34 0.33 -4.05 < 0.001 0.26 NN.29.5 - FN.29.5* -1.13 0.31 -3.60 0.002 0.32 FN.31 - FF.31 -0.50 0.32 -1.57 0.175 0.61 NN.31 - FF.31* -1.57 0.30 -5.17 < 0.001 0.21 NN.31 - FN.31* -1.07 0.28 -3.83 < 0.001 0.34
FF.29.5 - FF.28 0.49 0.39 1.28 0.273 1.64 FF.31 - FF.28 0.18 0.37 0.49 0.704 1.20 FF.31 - FF.29.5 -0.31 0.39 -0.80 0.523 0.73 FN.29.5 - FN.28* 1.03 0.35 2.91 0.011 2.79 FN.31 - FN.28 0.41 0.32 1.27 0.273 1.51 FN.31 - FN.29.5 -0.61 0.36 -1.70 0.147 0.54 NN.29.5 - NN.28 -0.11 0.31 -0.35 0.772 0.90 NN.31 - NN.28 -0.66 0.31 -2.14 0.058 0.52 NN.31 - NN.29.5 -0.55 0.31 -1.80 0.123 0.58 * indicates significant difference in this comparison.
175
Supplementary Table S2.4. Tukey’s pairwise comparisons on the effect of offspring group (i.e., HH, HC and CC) and treatment (i.e., 28 ºC, 29 ºC and 31 ºC) on larval survival of the A. hyacinthus (H) x A. cytherea (C) cross. The first letter in the abbreviation of the offspring groups represents the origin of the egg and the second letter the origin of sperm. An odds ratio of > 1 indicates higher survival, and < 1 indicates lower survival of the first offspring group/ treatment in comparison. Comparison Log odds ratio Std. error z-value p-value Odds ratio HC.28 - HH.28* 0.79 0.32 2.46 0.028 2.20 CC.28 - HH.28* -1.31 0.29 -4.61 < 0.001 0.27 CC.28 - HC.28* -2.10 0.32 -6.60 < 0.001 0.12 HC.29.5 - HH.29.5 0.06 0.33 0.17 0.867 1.06 CC.29.5 - HH.29.5* -1.76 0.30 -5.85 < 0.001 0.17 CC.29.5 - HC.29.5* -1.82 0.30 -5.97 < 0.001 0.16 CC.31 - HH.31* -2.21 0.30 -7.26 < 0.001 0.11 CC.31 - HC.31* -1.61 0.29 -5.55 < 0.001 0.20 HC.31 - HH.31 -0.60 0.29 -2.11 0.058 0.55
HH.29.5 - HH.28 0.61 0.47 1.31 0.253 1.84 HH.31 - HH.28 0.23 0.46 0.51 0.686 1.26 HH.31 - HH.29.5 -0.38 0.47 -0.81 0.487 0.68 HC.29.5 - HC.28 -0.12 0.49 -0.25 0.828 0.89 HC.31 - HC.28* -1.16 0.47 -2.48 0.028 0.31 HC.31 - HC.29.5* -1.04 0.46 -2.25 0.047 0.35 CC.29.5 - CC.28 0.16 0.44 0.37 0.759 1.18 CC.31 - CC.28 -0.66 0.45 -1.47 0.203 0.52 CC.31 - CC.29.5 -0.83 0.45 -1.85 0.101 0.44 * indicates significant difference in this comparison.
176
Supplementary Table S2.5. Tukey’s pairwise comparisons on the effect of offspring group (i.e., TT, TL and LL) and treatment (i.e., 28 ºC, 29 ºC and 31 ºC) on larval settlement of the Acropora tenuis (T) x Acropora loripes (L) cross. The first letter in the abbreviation of the offspring groups represents the origin of the egg and the second letter the origin of sperm. An odds ratio of > 1 indicates higher survival, and < 1 indicates lower survival of the first offspring group/ treatment in comparison. Comparison Log odds ratio Std. error z-value p-value Odds ratio TL.28 - TT.28 -0.50 0.28 -1.79 0.481 0.61 LL.28 - TT.28 0.14 0.26 0.53 0.767 1.15 LL.28 - TL.28 0.64 0.28 2.31 0.481 1.90 TL.29.5 - TT.29.5 -0.19 0.28 -0.69 0.767 0.83 LL.29.5 - TT.29.5 0.07 0.27 0.27 0.792 1.08 LL.29.5 - TL.29.5 0.26 0.28 0.96 0.685 1.30 TL.31 - TT.31 -0.49 0.28 -1.77 0.481 0.61 LL.31 - TT.31 -0.33 0.27 -1.21 0.579 0.72 LL.31 - TL.31 0.16 0.28 0.56 0.767 1.17
TT.29.5 - TT.28 -0.15 0.27 -0.54 0.767 0.86 TT.31 - TT.28 0.07 0.27 0.27 0.792 1.07 TT.31 - TT.29.5 0.22 0.27 0.80 0.730 1.24 TL.29.5 - TL.28 0.16 0.29 0.57 0.767 1.18 TL.31 - TL.28 0.08 0.29 0.29 0.792 1.09 TL.31 - TL.29.5 -0.08 0.28 -0.28 0.792 0.92 LL.29.5 - LL.28 -0.21 0.27 -0.80 0.730 0.81 LL.31 - LL.28 -0.40 0.27 -1.47 0.506 0.67 LL.31 - LL.29.5 -0.19 0.27 -0.68 0.767 0.83 * indicates significant difference in this comparison.
177
Supplementary Table S2.6. Tukey’s pairwise comparisons on the effect of offspring group (i.e., FF, FN and NN) and treatment (i.e., 28 ºC, 29 ºC and 31 ºC) on larval settlement of the A. florida (F) x A. nobilis (N) cross. The first letter in the abbreviation of the offspring groups represents their maternal parent species and the second letter their paternal parent species. An odds ratio of > 1 indicates higher survival, and < 1 indicates lower survival of the first offspring group/ treatment in comparison. Comparison Log odds ratio Std. error z-value p-value Odds ratio FN.28 - FF.28* -1.04 0.28 -3.71 < 0.001 0.35 NN.28 - FF.28* -1.12 0.28 -3.98 < 0.001 0.33 NN.28 - FN.28 -0.09 0.29 -0.29 0.838 0.92 FN.29.5 - FF.29.5* -1.00 0.27 -3.73 < 0.001 0.37 NN.29.5 - FF.29.5* -1.94 0.30 -6.36 < 0.001 0.14 NN.29.5 - FN.29.5* -0.94 0.31 -3.05 0.005 0.39 FN.31 - FF.31* -1.40 0.28 -5.01 < 0.001 0.25 NN.31 - FF.31* -2.39 0.34 -7.12 < 0.001 0.09 NN.31 - FN.31* -0.99 0.35 -2.87 0.008 0.37
FF.29.5 - FF.28 0.30 0.35 0.88 0.429 1.36 FF.31 - FF.28 0.34 0.35 0.99 0.401 1.41 FF.31 - FF.29.5 0.04 0.35 0.11 0.935 1.04 FN.29.5 - FN.28 0.34 0.36 0.94 0.401 1.41 FN.31 - FN.28 -0.02 0.37 -0.06 0.953 0.98 FN.31 - FN.29.5 -0.36 0.36 -1.01 0.401 0.70 NN.29.5 - NN.28 -0.51 0.39 -1.30 0.268 0.60 NN.31 - NN.28* -0.93 0.42 -2.23 0.043 0.40 NN.31 - NN.29.5 -0.41 0.43 -0.96 0.401 0.66 * indicates significant difference in this comparison.
178
Supplementary Table S2.7. Tukey’s pairwise comparisons on the effect of offspring group (i.e., HH, HC and CC) and treatment (i.e., 28 ºC, 29 ºC and 31 ºC) on larval settlement of the A. hyacinthus (H) x A. cytherea (C) cross. The first letter in the abbreviation of the offspring groups represents the origin of the egg and the second letter the origin of sperm. An odds ratio of > 1 indicates higher survival, and < 1 indicates lower survival of the first offspring group/ treatment in comparison. Comparison Log odds ratio Std. error z-value p-value Odds ratio HC.28 - HH.28 0.05 0.32 0.16 0.984 1.05 CC.28 - HH.28 -0.61 0.36 -1.72 0.166 0.54 CC.28 - HC.28 -0.66 0.35 -1.87 0.149 0.52 HC.29.5 - HH.29.5 0.05 0.32 0.16 0.984 1.05 CC.29.5 - HH.29.5 -0.54 0.35 -1.53 0.196 0.58 CC.29.5 - HC.29.5 -0.59 0.35 -1.69 0.166 0.56 HC.31 - HH.31 0.69 0.36 1.90 0.149 1.99 CC.31 - HH.31 -1.09 0.54 -2.02 0.149 0.34 CC.31 - HC.31* -1.77 0.51 -3.48 0.004 0.17
HH.29.5 - HH.28 0.00 0.32 0.00 1.000 1.00 HH.31 - HH.28 -0.69 0.36 -1.90 0.149 0.50 HH.31 - HH.29.5 -0.69 0.36 -1.90 0.149 0.50 HC.29.5 - HC.28 0.00 0.31 0.00 1.000 1.00 HC.31 - HC.28 -0.05 0.32 -0.16 0.984 0.95 HC.31 - HC.29.5 -0.05 0.32 -0.16 0.984 0.95 CC.29.5 - CC.28 0.07 0.39 0.19 0.984 1.08 CC.31 - CC.28 -1.16 0.53 -2.18 0.149 0.31 CC.31 - CC.29.5 -1.24 0.53 -2.33 0.118 0.29 * indicates significant difference in this comparison.
179
Supplementary Table S2.8. Overall comparisons of hybrid vs. purebred larval survival and settlement across temperatures. An odds ratio of > 1 indicates higher survival of purebreds, and < 1 indicates lower survival of purebreds compared to hybrids. Due to the extreme low survival and settlement of offspring group CC, the analyses were tested with and without incorporating offspring group CC.
Trait Comparison Log odds ratio Std. error z-value p-value Odds ratio Survival Purebreds - Hybrids* -0.36 0.09 -4.25 <0.001 0.70 Survival# Purebreds - Hybrids -0.04 0.09 -0.44 0.661 0.93 Settlement Purebreds - Hybrids 0.14 0.08 1.68 0.094 1.15 Settlement# Purebreds - Hybrids* 0.32 0.09 3.75 <0.001 1.38 * indicates significant difference in this comparison. # Offspring group CC was removed from this analysis.
180
Supplementary information: chapter 3
Interspecific hybridization may provide novel opportunities for coral reef restoration
Figure S3.1. Timeline showing the major steps of the experiment and the timing when each measurement was conducted.
Figure S3.2. Embryomic development of the offspring groups from (A) the Acropora tenuis (T) x
Acropora loripes (L) cross, and (B) the Acropora sarmentosa (S) x Acropora florida (F) cross at
9, 15, 21, 33, 45, 57, and 93 h since fertilization. The abbreviation of the offspring groups is that
181 the first letter represents the origin of the eggs and the second letter the origin of sperm. Samples of LL for the 57 h time point were lost.
Figure S3.3. Overall survival of the Acropora purebred offspring groups vs. hybrid offspring groups under ambient and elevated conditions in the 28-week experiment. Lines represent the estimates of the longitudinal generalized linear models.
182
Figure S3.4. Median sized juveniles at two years of age from the (A) Acropora tenuis (T) x
Acropora loripes (L) cross and the (B) Acropora sarmentosa (S) x Acropora florida (F) cross.
Empty plug indicate no survivor in this cross. Survivors that were previously under ambient and elevated conditions are combined, and the total number of survivors of each cross is indicated in the bracket. The first letter of the offspring groups’ abbreviation represents the origin of the eggs and the second letter the origin of sperm.
183
Figure S3.5. Symbiodinium uptake rates of the offspring groups from (A) the Acropora tenuis (T) x Acropora loripes (L) cross, and (B) the Acropora sarmentosa (S) x Acropora florida (F) cross.
The first letter of the offspring groups’ abbreviation represents the origin of the eggs and the second letter the origin of sperm. Values are mean and error bars represent 95% CI calculated using the angular transformed data back-transformed into percentages.
184
Figure S3.6. Photochemical efficiency of the offspring groups from (A) the Acropora tenuis (T) x
Acropora loripes (L) cross, and (B) the Acropora sarmentosa (S) x Acropora florida (F) cross at the 28-week time point. The first letter of the offspring groups’ abbreviation represents the origin of the eggs and the second letter the origin of sperm. The horizontal bars represent median values, box length indicates the interquartile range, and the small circles indicate unusual points.
185
Supplementary Methods and Results
Cox proportional hazards regression
Survival data were analyzed using Cox proportional hazards regression as a comparison to the generalized linear mixed models. Analyses were conducted separately for the offspring groups of the A. tenuis x A. loripes cross and the offspring groups of the A. sarmentosa x A. florida cross, under ambient and elevated conditions. Each individual coral was followed throughout the 10 time points (up to 28 weeks) and counted as either dead (uncensored) or alive (censored). Tukey pairwise comparisons were then used to compare the survival (i.e., hazard ratio) between the different offspring groups. Negative estimates indicate the cross was associated with a decreased risk of mortality and vice versa for positive estimates. Model fitting was performed using the survival package in R (R Core Team, 2017). The results of the cox regression agree with that of the GLMM and the two analyses gave comparable results.
The A. tenuis x A. loripes cross
Under ambient conditions, there was a significant difference among the offspring groups (Cox regression, G = 65.0, df = 3, p < 0.001). Tukey pairwise comparisons (Table 2) indicate that the survival of the hybrids was similar to that of the purebreds of their maternal parents. Survival of both LT and LL was greater than survival of TT and TL (p < 0.001 for all pairs). Under elevated conditions, there was also a significant difference among the offspring groups (Cox regression, G
= 121.0, df = 3, p < 0.001). Tukey pairwise comparisons (Table 2) show that hybrid LT had similar survival as purebred LL (i.e., its maternal parent species), and its survival was higher than survival of both TT and TL (p < 0.001 for all pairs). Survival of hybrid TL was intermediate between that
186 of purebreds of its parents species i.e., lower than LL (p < 0.001) yet higher than TT (p < 0.001)
(Table 2).
The A. sarmentosa x A. florida cross
Under ambient conditions, there was a significant difference among the offspring groups (Cox regression, G = 13.2, df = 3, p = 0.004). Tukey pairwise comparisons (Table 2) show that survival of both F1 hybrids (SF and FS) was higher than survival of purebred FF (p = 0.009, 0.023 respectively) but not higher than that of SS (p = 0.190, 0.408 respectively). There was also a significant difference among the offspring groups under elevated conditions (Cox regression, G =
10.7, df = 3, p = 0.013). Survival of the hybrid FS was higher than that of the purebred SS (p =
0.014), while survival of the other pairs was not significantly different from each other based on
Tukey pairwise comparisons (Table 2).
187
Supplementary Table S3.1. Tukey’s pairwise comparisons of offspring groups following Cox proportional hazards regression in the Acropora tenuis (T) x Acropora loripes (L) cross and the Acropora sarmentosa (S) x Acropora florida (F) cross. The abbreviation of the offspring groups is that the first letter represents the origin of the eggs and the second letter the origin of sperm. A negative value of hazard ratio indicates an increased probability of survival associated with the first cross in the comparison. Treatment Offspring group Hazard ratio Std. Error z-value p-value Ambient LT - LL -0.072 0.150 -0.482 0.962 TT - TL -0.144 0.103 -1.399 0.496 TT - LT* 0.650 0.121 5.383 < 0.001 TL - LT* 0.795 0.120 6.632 < 0.001 TT - LL* 0.578 0.137 4.215 < 0.001 TL - LL* 0.722 0.136 5.302 < 0.001
Elevated LT - LL -0.026 0.121 -0.211 0.997 TT - TL* 0.447 0.090 4.960 < 0.001 TT - LT* 0.960 0.098 9.810 < 0.001 TL - LT* 0.514 0.100 5.133 < 0.001 TT - LL* 0.935 0.114 8.188 < 0.001 TL - LL* 0.488 0.116 4.208 < 0.001
Ambient SF - FF* -0.590 0.189 -3.119 0.009 FS - FF* -0.475 0.168 -2.838 0.023 SS - FS 0.236 0.153 1.540 0.408 SS - SF 0.350 0.176 1.984 0.190 SF - FS -0.115 0.200 -0.573 0.939 SS - FF -0.240 0.138 -1.733 0.302
Elevated FS - FF -0.139 0.150 -0.929 0.787 SF - FF 0.012 0.155 0.076 1.000 SS - FS * 0.382 0.127 3.001 0.014 SS - SF 0.231 0.134 1.725 0.307 SF - FS 0.151 0.157 0.963 0.768 SS - FF 0.243 0.126 1.934 0.211 * indicates significant difference in survival between this offspring group pair.
188
Supplementary Information-chapter 4
The roles of age, parentage and environment on bacterial and algal endosymbiont
communities in Acropora corals
Supplementary Table S4.1. The total number of two years old juvenile survivors that were reared under ambient vs. elevated temperature and pCO2 conditions during the first seven months of their life, and the total number of juveniles sampled from each offspring group in the two rearing tanks. Brackets indicate the previous treatment conditions for recruit exposure (i.e. A = ambient, E = elevated temperature and pCO2). Cross Offspring Total survivors: Total survivors: Total Total group Once Ambient Once Elevated sampled: sampled: Tank 1 Tank 2 A. tenuis TT 0 0 0 0 x A. loripes TL 3 0 3 (A) 0 LT 31 19 3 (A) 3 (A), 3 (E) LL 34 17 3 (A) 3 (A), 3 (E) A. sarmentosa SS 2 0 2 (A) 0 x A. florida SF 2 0 2 (A) 0 FS 4 3 3 (A) 3 (E) FF 1 1 1 (A) 1 (E)
Supplementary Table S4.2. A comparison of the observed and expected bacterial genera relative abundance in the 16S rRNA mock community sample. Observed Expected Accession Observed relative Expected relative bacterial genus bacterial genus Number abundance (%) abundance (%) Acinetobacter Acinetobacter MH744724 13 14.3 Bacterioplanes Bacterioplanes MH744725 15 14.3 Marinobacter Marinobacter MK088251 16 14.3 Paracoccus Paracoccus MH744726 16 14.3 Pseudoalteromonas Pseudoalteromonas MK088250 13 14.3 Pseudovibri Pseudovibri KX198136 14 14.3 Vibrio Vibrio X5657 13 14.3
189
Supplementary Table S4.3. A comparison of the observed and expected Symbiodiniaceae sequence types and abundance in the ITS mock community sample. Note that sequence type A had lower relative abundance than expected, which may be a consequence of intragenomic variance. Observed Expected Accession Number Observed relative Expected relative sequence type sequence type abundance (%) abundance (%) A2 A2 MK007324 8 10 A3 A3 MK007259, MK007296 26 20 FREE(A) A MK007295, MK007303 10 20 Cspc C1 MK007304 14 10 D1+D1a D1a MH229352 13 10 F1 F1 AF427462 11 10 F5.1 F5.1 MK007305 11 10 G3 G3 MH229354 6 10
190
Supplementary Figure S4.1. Relationships between read depths and alpha-diversity of the bacterial
16S rRNA gene data. Note that alpha-diversity has plateaued at the selected rarefaction level of
1830. Read depths are shown up to 10 000 reads for illustration purposes.
Supplementary Figure S4.2. Relationship between read depths and alpha-diversity of the
Symbiodiniaceae data. Note that alpha-diversity has plateaued at the selected rarefaction level of
1719 and the sample with particularly high alpha-diversity is the mock community. Read depths are shown up to 10 000 reads for illustration purposes. 191
Supplementary Figure S4.3. nMDS plots showing the clustering of bacterial communities of the adult parents, seven months old recruits and two years old juveniles for the A. tenuis x A. loripes and A. sarmentosa x A. florida cross based on an analysis of Bray-Curtis dissimilarity matrices.
Supplementary Figure S4.4. nMDS plots based on an analysis of Bray-Curtis dissimilarity matrices of the bacterial communities of parental colonies for the A. tenuis x A. loripes and A. sarmentosa x A. florida cross.
192
Supplementary Figure S4.5. nMDS plots based on an analysis of Bray-Curtis dissimilarity matrices of the bacterial communities for two years old juveniles of the A. tenuis x A. loripes and A. sarmentosa x A. florida cross.
Supplementary Figure S4.6. nMDS plots of the Symbiodiniaceae communities for the parents, seven months old recruits and two years old juveniles of the A. tenuis x A. loripes and A. sarmentosa x A. florida cross based on an analysis of Bray-Curtis dissimilarity matrices.
193
Supplementary Figure S4.7. nMDS plots of the bacterial communities in hybrid vs. purebred juveniles at two years of age for the A. tenuis x A. loripes and A. sarmentosa x A. florida cross based on an analysis of Bray-Curtis dissimilarity matrices.
Supplementary Figure S4.8. nMDS plots of the Symbiodiniaceae communities in hybrid vs. purebred juveniles at two years of age for the A. tenuis x A. loripes and A. sarmentosa x A. florida cross based on an analysis of Bray-Curtis dissimilarity matrices.
194
Supplementary Figure S4.9. nMDS plots based on an analysis of Bray-Curtis dissimilarity matrices of the bacterial communities of seven months old recruits reared under ambient vs. elevated temperature and pCO2 conditions
Supplementary Figure S4.10. The top 10 bacterial taxa at family level that were significantly different in abundance in seven months old recruits reared under ambient vs. elevated temperature and pCO2 conditions.
195
Supplementary Figure S4.11. Compositional plots showing the averaged relative abundances of different Symbiodiniaceae sequence types of the offspring groups under ambient or elevated temperature and pCO2 conditions.
Supplementary Figure S4.13. nMDS plots based on an analysis of Bray-Curtis dissimilarity matrices showing the bacterial communities of two years old juveniles that were reared under
196 ambient (once ambient) vs. elevated temperature and pCO2 conditions (once elevated) during the first seven months of their life.
Supplementary Figure S4.14. nMDS plots based on an analysis of Bray-Curtis dissimilarity matrices showing the Symbiodiniaceae communities of two years old juveniles that were reared under ambient (once ambient) vs. elevated temperature and pCO2 conditions (once elevated) during the first seven months of their life.
197
DNA extraction, PCR amplification and library preparation
DNA extraction
DNA was extracted from either the entire coral recruit or 20 mg tissue fragments from the adult and two years old juveniles. Prior to extraction the tissue was air-dried to remove traces of EtOH.
The DNA was extracted using a salting-out method with bead beating for mechanical cell lysis and additional enzymatic digestion steps with Lysozyme and Proteinase K to ensure complete lysis of the microbial cells. A tissue-free extraction was also conducted as a contamination control.
Coral tissue was added to 1.5 mL microfuge tubes containing approximately 30 x 710-1180 µm acid washed glass beads (Sigma, St Louis, Missouri, USA) and 750 µL homogenization buffer supplemented with 5µL of 10 mg/mL lysozyme (Sigma), and then subjected to 2 x 40 second cycles of bead beating at 4/s in a fast Prep-245G (MP Biomedicals, Solon, Ohio, USA). Tissue homogenate was incubated at 37ºC for 30 min for lysozyme digestion. Immediately 20 µL of
Proteinase K at a concentration of 20 mg/mL was added to each sample, which then underwent a second incubation at 65ºC for 60 min. After incubation, 187.5 µL 5M potassium acetate was added to each sample to precipitate proteins and extracellular material. The samples were left on wet ice for 30 min before undergoing centrifugation at 20000 rcf for 15 min. 800 µL of supernatant was transferred to fresh 1.5 mL microfuge tubes and 640 µL isopropanol was added to the supernatant.
Samples were mixed gently and left at room temperature for 15 min prior to centrifugation at
20,000 rcf for 12 min to pellet the DNA. The DNA was then washed with 70% EtOH and air- dried at room temperature for 30 min. DNA was resuspended in 35 µL Milli Q water and kept at
4oC overnight. There was no RNase treatment of the DNA.
Metagenomic library preparation
198
Gene Amplicon PCR
Triplicate Amplicon PCR reactions were set up for each coral and mock community samples.
Bacterial 16S rRNA gene:
For the bacterial 16S rRNA gene, a reference mock community was constructed using equal quantities of PCR-amplified cell lysate of pure cultures of Acinetobacter (MH744724),
Bacterioplanes (MH744725), Marinobacter (MK088251), Paracoccus (MH744726),
Pseudoalteromonas (MK088250), Pseudovibrio (KX198136) and Vibrio (X56578). Material from glycerol stocks was streaked onto Marine agar plates and grown overnight at 37ºC. A small amount of bacterial cells, less than 1 mm3, was scraped from the surface of the culture plate, put in solution with 500 µL 1 x TE buffer (Sigma) and heated to 95ºC for 5 min to lyse the cells. The undiluted cell lysate was used as template for the Amplicon PCR. The library preparation proceeded as for the coral samples. For coral and mock community samples, the Primers 515fB [5’-
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGYCAGCMGCCGCGGTAA-3’]
(Apprill et al. 2015) and 806rB [5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA
GGGACTACNVGGGTWTCTAAT-3’] (Parada, Needham, & Fuhrman, 2016), with Illumina adapter sequences (underlined) (Illumina, San Diego, CA, USA) added at the 5-prime ends were used to amplify the hypervariable V4 region of the bacterial16S rRNA gene. Each 15 µL PCR reaction consisted of 7.5 µL of 2 x AmpliTaq Gold® 360 PCR buffer (Applied Biosystems, Foster
City, Califonia, USA) which is complete with Taq polymerase and dNTPs, 8 pmol each primer and 1 µL 1/20 diluted coral DNA or 1 µL undiluted bacterial lysate. The reaction volume was made up to 15 µL with sterile MilliQ water.
199
Symbiodiniaceae nuclear DNA ribosomal ITS2:
A reference mock community was also established for Symbiodiniaceae ITS2 amplicon sequencing using equal quantities of PCR products from 10 Symbiodiniaceae cultures, representing eight sequence types: A (MK007295, MK007303), A2 (MK007324), A3
(MK007259, MK007296), C1 (MK007304), D1a (MH229352), F1(AF427462) and
F5.1(MK007305), G3(MH229354), where A and A3 had twice the concentration than other types.
The DNA was extracted following the method above. Symbiodiniaceae ITS2 primers itsD [5′-
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATTGCAGAACTCCGTG-3'] and Its2rev2 [5′ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCTCCGCTTAC
TTATATGCTT-3 (Pochon, Pawlowski, Zaninetti, & Rowan, 2001) with Illumina adapter sequences (underlined) added at the 5-prime ends were used to amplify the partial 5.8S, entire
ITS2 and partial 28S rDNA genes. PCR reactions contained 7.5 µL of 2x Qiagen (Hilden,
Germany) Multiplex PCR Mastermix (with dNTPs and Taq polymerase included), 4 pmoL each primer and 1 µL of 1/10 diluted coral or cultured Symbiodiniaceae DNA, with sterile MilliQ water added to bring the total reaction volume to 15 µL.
PCR for both loci was carried out in Applied Biosystems 2720 thermal cyclers under the following conditions; an initial denaturation at 95ºC for 10 min followed by 28 cycles at 95ºC for 30 s, 55ºC for 30 s, and 72ºC for 30 s; and a final extension at 72ºC for 10 min. For each locus, the triplicate
PCR products for each sample were pooled and then visualized on 1% agarose, 0.5xTBE gels alongside GeneRuler 100bp Plus DNA ladder (Thermo Fisher Scientific, Waltham, Massachusetts,
USA) to confirm amplicon size and PCR success. Each PCR pool was purified using the bead clean up method described in Illumina’s 16S Metagenomic Sequencing Library Preparation
200 protocols except that SpeedBead Magnetic Carboxylate modified particles (GE Healthcare,
Chicago, Illinois, USA) were used in place of Agencourt AMpure XP beads (Beckman Coulter,
Brea, California, USA)), and were added to the pooled PCR products at a 1:1 ratio to exclude non- target amplicons and PCR artefacts less than 300 bp in size.
Index PCR
A single indexing PCR reaction was carried out on each purified coral and mock community sample amplicon PCR pool. The PCR reactions were set up following the method in the Illumina
Metagenome Sequencing library preparation guide with some exceptions. Briefly the PCR reaction volume was downscaled from 50 µL to 35 µL. Each PCR was comprised of 17.5 µL 2 x
AmpliTaq gold® 360, 5 pmol of each Nextera XT index primer 1(N7XX) and index primer
2(S5XX) (Illumina), 3.5 µL of purified amplicon PCR and sterile MilliQ water to bring the reaction volume to a total of 35 µL. Mock community samples for each locus were amplified with the same pair of index primers. PCR cycling conditions were as described in the Illumina guide except the number of PCR cycles were increased from 8 to 10. All index PCR products were bead purified and visualized on 1% agarose 0.5 x TBE agarose gel. The quality and quantity of the purified index
PCR products were assessed. The purity of the index PCR products was determined with sample
A260/A280 ratios measured with a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific).
PCR product concentration was measured using the Invitrogen Quant-iT PicoGreen dsDNA Assay
(Thermo Fisher Scientific), following the manufacturer’s instructions. Fluorescence was measured and sample concentrations were calculated with a Cytation 3 Image Reader (BioTek,
Winooski, Vermont, USA) and the associated software. Concentrations of coral and mock community samples were normalized to 25 nM and 3 µL of each was visualized on a gel to check
201 consistency of band intensity. Mock community samples were combined prior to adding to the sample library pool. 10 µL of each normalized sample library, and pooled mock community library were transferred to a 1.5 mL microfuge tube and sent to Ramaciotti Centre for Genomics
(UNSW, Sydney, Australia) for MiSeq v3 sequencing.
Supplementary references
Apprill, A., McNally, S., Parsons, R., & Weber, L. (2015). Minor revision to V4 region SSU rRNA 806R gene primer greatly increases detection of SAR11 bacterioplankton. Aquatic Microbial Ecology, 75, 129–137. Parada, A. E., Needham, D. M., & Fuhrman, J. A. (2016). Every base matters: assessing small subunit rRNA primers for marine microbiomes with mock communities, time series and global field samples. Environmental Microbiology, 18, 1403–1414. Pochon, X., Pawlowski, J., Zaninetti, L., & Rowan, R. (2001). High genetic diversity and relative specificity among Symbiodinium-like endosymbiotic dinoflagellates in soritid foraminiferans. Marine Biology, 139, 1069–1078.
202
Minerva Access is the Institutional Repository of The University of Melbourne
Author/s: Chan, Wing Yan
Title: Interspecific hybridization as a tool for enhancing climate resilience of reef-building corals
Date: 2018
Persistent Link: http://hdl.handle.net/11343/221910
File Description: Interspecific hybridization as a tool for enhancing climate resilience of reef-building corals
Terms and Conditions: Terms and Conditions: Copyright in works deposited in Minerva Access is retained by the copyright owner. The work may not be altered without permission from the copyright owner. Readers may only download, print and save electronic copies of whole works for their own personal non-commercial use. Any use that exceeds these limits requires permission from the copyright owner. Attribution is essential when quoting or paraphrasing from these works.