Evolution and Taxonomy of the Wild Species of the Genus Ovis (Mammalia, Artiodactyla, Bovidae)

Home , Argali, European mouflon, Mouflon, Urial

Molecular Phylogenetics and Evolution 54 (2010) 315–326

Contents lists available at ScienceDirect

Molecular Phylogenetics and Evolution

journal homepage: www.elsevier.com/locate/ympev

Evolution and taxonomy of the wild species of the genus Ovis (Mammalia, Artiodactyla, Bovidae)

Hamid Reza Rezaei a,b, Saeid Naderi a,c, Ioana Cristina Chintauan-Marquier a, Pierre Taberlet a, Amjad Tahir Virk d, Hamid Reza Naghash a, Delphine Rioux a, Mohammad Kaboli e, François Pompanon a,* a Laboratoire d’Ecologie Alpine, CNRS UMR 5553, Université Joseph Fourier, B.P. 53, F-38041 Grenoble Cedex 9, France b Environmental Sciences Department, Gorgan University of Agriculture and Natural Resources, Beheshti St., 49138-15749 Gorgan, Iran c Natural Resources Faculty, University of Guilan, Guilan, Iran d Sustainable Land Management Project, Ministry of Environment, Government of Pakistan, 40 Bazar Road, G-6/4 Islamabad, Pakistan e Department of the Fishery and Environment, Faculty of Natural Resources, Tehran University, Tehran, Iran article info abstract

Article history: New insights for the systematic and evolution of the wild sheep are provided by molecular phylogenies Received 24 April 2007 inferred from Maximum parsimony, Bayesian, Maximum likelihood, and Neighbor-Joining methods. The Revised 19 October 2009 phylogeny of the wild sheep was based on cytochrome b sequences of 290 samples representative of Accepted 29 October 2009 most of the sub-species described in the genus Ovis. The result was confirmed by a combined tree based Available online 6 November 2009 on cytochrome b and nuclear sequences for 79 Ovis samples representative of the robust clades established with mitochondrial data. Urial and mouflon, which are either considered as a single or two sepa- Keywords: rate species, form two monophyletic groups (O. orientalis and O. vignei). Their hybrids appear in one or the Combined Phylogeny other group, independently from their geographic origin. The European mouflon O. musimon is clearly in Cytochrome b IL4 the O. orientalis clade. The others species, O. dalli, O. canadensis, O. nivicola, and O. ammon are monophy- CSN3 letic. The results support an Asiatic origin of the genus Ovis, followed by a migration to North America KAP13 through North-Eastern Asia and the Bering Strait and a diversification of the genus in Eurasia less than IL16 3 million years ago. Our results show that the evolution of the genus Ovis is a striking example of succes- Ovis sive speciation events occurring along the migration routes propagating from the ancestral area. Urial Ó 2009 Elsevier Inc. All rights reserved. Mouflon

1. Introduction Urial (O. vignei Blyth 1841, 2n = 58) is widely distributed in Asia Minor. The Dall Sheep or Thin-horn (O. dalli Nelson 1884, The genus Ovis is one of the more complex mammalian genera 2n = 54) lives in the mountainous regions of Western Canada and with regard to its evolution and systematics. Based on morpholog- USA, the Big-horn (O. Canadensis Shaw 1804, 2n = 54) is found in ical criteria and geographic distribution, several classifications and the Rocky Mountains from Canada to Colorado and south to Mex- revisions have been proposed during the last two centuries (sum- ico. The Snow Sheep (O. nivicola Eschscholtz 1829, 2n = 52) is marized in Hiendleder et al., 2002; Table 1). Haltenorth (1963) pro- mainly found in the North East of Asia. The situation is even more posed that all wild sheep were polymorphic populations of a single complex given that different Ovis taxa with overlapping distribu- species, but up to seven species have been recognized (Nadler tions hybridize and produce fertile offspring considered as sub- et al., 1973). They differ in morphological traits such as body size, species (Nadler et al., 1971; Valdez et al., 1978). This occurs in horn morphology, color and pattern of the coat (Fedosenko and the central part of Iran where Ovis orientalis vignei hybrids Blank, 2005), in chromosome diploid number (Nadler et al., display intermediate chromosome numbers between 54 and 58 1973; Bunch et al., 2006) and in their geographic distribution (Valdez et al., 1978). This supports the existence of a single ‘mouf- (Fig. 1). The European mouflon (O. musimon Pallas 1762, 2n = 54) loniform’ species (O. orientalis) composed of the Asiatic mouflon, and the Asiatic mouflon (O. orientalis Gmelin 1774, 2n = 54) are the Urial and their hybrids (Valdez, 1982; Valdez et al., 1978). This found in the west of Asia and Europe, the Argali (O. ammon L. classification following Valdez (1982) has been adopted as the cur- 1758, 2n = 56) lives in mountainous areas in central Asia, and the rent reference by the International Union for the Conservation of Nature and Natural Resources (IUCN) (Shackleton and Lovari, 1997). However, for clarity, we will follow in this paper the classi- * Corresponding author. Fax: +33 4 76 51 42 79. E-mail addresses: [email protected] (H.R. Rezaei), francois.pompanon@ fication of Nadler et al. (1973), because it distinguishes the greatest ujf-grenoble.fr (F. Pompanon). number of taxonomic entities (Table 1).

Table 1 The different classiﬁcations of the genus Ovis.

Authors Tsalkin (1951) Haltenorth (1963) Nadler et al. (1973) Valdez (1982) Wilson and Reeder (1993) Festa-Bianchet (2000) Shackleton and Lovari (1997) Dall Sheep O. canadensis/O. nivicola O. ammon O. dalli O. dalli O. dalli Bighorn O. canadensis/O. nivicola O. ammon O. canadensis O. canadensis O. canadensis Snow Sheep O. canadensis/O. nivicola O. ammon O. nivicola O. nivicola O. nivicola Argali O. ammon O. ammon O. ammon O. ammon O. ammon Asiatic Mouﬂon O. ammon O. ammon O. orientalis O. orientalis O. gmelinii Urial O. ammon O. ammon O. vignei O. orientalis O. vignei European Mouﬂon O. ammon O. ammon O. musimon O. orientalis musimon O. orientalis musimon

Fig. 1. Phylogeography of the wild Ovis species. The map shows the geographic distribution of the seven wild Ovis species according to the classiﬁcation of Nadler et al. (1973). The Chronogram presented is from a Bayesian dating analysis of the Cyt b data. Divergence times are given ±95% CI. The chromosome numbers are given for each taxon. The O. orientalis vignei hybrids, which have a ploidy between 2n = 54 and 2n = 58, are not presented. The chromosome numbers given in italic refer to the hypothetical ancestral states according to the most parsimonious evolutionary scenario with regards to the Cyt b phylogeny.

Molecular studies have brought about new insights for under- available data call for a molecular phylogeny based on a large sam- standing the evolution and taxonomy of the wild Ovis. Molecular pling that represents the diversity of Ovis taxa. The present study phylogenies (Ropiquet and Hassanin, 2005a, 2005b) and phyloge- provides a phylogeny of the wild species of the genus Ovis based nies based on molecular, ethological and morphological data (Her- on cytochrome b (Cyt b) and nuclear data (Interleukin 4, Kappa nandez Fernandez and Vrba, 2005) show that the genus Ovis is Casein, Keratin Associated Protein 1.3 and Interleukin 16). The monophyletic, and diverged from the other Caprinae around 2–3 aim is to infer the evolutionary history of this genus and to check million years ago (MYA) (Bunch et al., 2006; Ropiquet and Hassa- if the molecular phylogeny is congruent with the biogeographic, nin, 2005a) probably in Asia according to paleontologists (Vrba morphological and karyotypic criteria used for establishing the and Schaller, 2000). However, only partial information is available taxonomy of wild Ovis. from these studies. The most detailed studies have dealt with sub- species of O. canadensis (Boyce et al., 1999; Ramey, 1995) and O. ammon (Tserenbataa et al., 2004; Wu et al., 2003) or with the rela- 2. Materials and methods tionships between O. dalli and O. canadensis (Loehr et al., 2006). Up to now, the most complete study considering the wild species of 2.1. Taxon sampling and DNA extraction the genus Ovis (Bunch et al., 2006) was based on a sampling with several taxa represented by only a few individuals. The lack of glo- Samples from 290 Ovis were collected from 43 localities in bal molecular studies and the absence of concordance between Eurasia and North America (Table 2). Most of the samples were Table 2 origin of wild Ovis samples and references for DNA sequences. The taxa have been determined based on morphological criteria. Latitude and Longitude coordinates are in decimal degrees (: approximate coordinates).

Taxon Sampling locality mt DNA nuc DNA

Country Latitude– Individual Number of Accession Numbers Individuals Accession Numbers longitude ID haplotypes ID IL4 IL16 KAP13 CSN3 Ovis ammon O. a. collium (Severtzov, 1873) Kazakhstan 49.75° N, 78.61°E OAC1 1 EU366039 OAC1 FJ936317 FJ936397 FJ936477 FJ936237 O. a. severtzovi (Nasonov, 1914) Uzbekistan 41.25° N, 69.56°E OAS1–2 2 EU366057–8 OAS2 FJ936318 FJ936398 FJ936478 FJ936238 Ovis canadensis EU366063–67 O. c. Canadensis (Shaw, 1804) USA, Alberta 51.01 °N, 115.31°E OCC1–8 6 EU365985 OCC2–4, 6–8 FJ936319–24 FJ936399–04 FJ936479–84 FJ936239–44 FJ936176–77 O. c. nelsoni (Merriam, 1879) USA, 33.30°N, OCN1–8 7 EU366060–1 OCN1–8 FJ936325–32 FJ936405–12 FJ936485–92 FJ936245–52 California 115.12°E* FJ936178–83 315–326 (2010) 54 Evolution and Phylogenetics Molecular / al. et Rezaei H.R. Ovis dalli Canada 63.91° N, OD1–2 1 EU365992 OD1–2 FJ936333–34 FJ936413–14 FJ936493–94 FJ936253–54 128.94°W FJ936184 Ovis musimon France 41.81° N, 09.22°E OM1–2 2 EU365977, 90 — ———— Ovis orientalis EU365973 O. o. anatolica (Valenciennes, Turkey 38.04 °N, 32.27°E OOA1–3 3 EU365987 OOA3 FJ936335 FJ936415 FJ936495 FJ936255 1856) FJ936185 O. o. gmelinii (Blyth, 1856) Armenia 39.01 °N, 46.29°E OOG1 1 EU366040 OOG1 FJ936336 FJ936416 FJ936496 FJ936256 Iran 38.83°N, 46.50°E OOG2,3 2 FJ936190, 96 — ———— Iran 33.35°N, 46.08°E OOG4,5 2 FJ936200–01 — ———— Iran 37.75°N, 46.43°E OOG6–8 3 EU365979–80 — ———— FJ936202 Iran 36.07°N, 47.51°E OOG9–13 4 EU365996–97 FJ936203 OOG12 FJ936337 FJ936417 FJ936497 FJ936257 FJ936186–88 Iran 34.20°N, 48.95°E OOG14,15 2 EU366015 OOG14,15 FJ936338–39 FJ936418–19 FJ936498–99 FJ936258–59 FJ936189 Iran 38.85°N, 45.24°E OOG16–23 7 EU365975, 89 EU365998–6000 EU366070 OOG19,21– FJ936340–43 FJ936420–23 FJ936500–03 FJ936260–63 23 FJ936191–92 Iran 36.66°N, 47.67°E OOG24–27 4 EU366002 OOG27 FJ936344 FJ936424 FJ936504 FJ936264 FJ936193–95 Iran 36.12°N, 49.56°E OOG28–31 4 EU366003,53, 73 OOG28–30 FJ936345–47 FJ936425–27 FJ936505–07 FJ936265–67 FJ936197 Turkey 38.69° N, 44.14°E OOG32,33 1 FJ936198–9 OOG32,33 FJ936348–49 FJ936428–29 FJ936508–09 FJ936268–69 O. o. isphahanica (Nasonov, 1910) Iran 33.45°N, 49.36°E OOI1–3 2 EU366016 EU365976 OOI1–4 FJ936350–53 FJ936430–33 FJ936510–13 FJ936270–73 FJ936204 Iran 32.85°N, 51.21°E OOI5,6 1 FJ936205–6 OOI5,6 FJ936354–55 FJ936434–35 FJ936514–15 FJ936274–75 O. o. laristanica (Nasonov, 1909) Iran 27.68°N, 54.33°E OOL1,2 2 FJ936209–10 — ———— O. orientalis population Sh Iran 32.10°N, 50.08°E OOS1 1 FJ936211 — ———— O. orientalis population Ko Iran 34.80°N, 46.47°E OOKo1,2 2 FJ936207–8 — ———— Ovis orientalis vignei

(continued on next page) 317 318 Table 2 (continued)

Taxon Sampling locality mt DNA nuc DNA

Country Latitude– Individual Number of Accession Numbers Individuals Accession Numbers longitude ID haplotypes ID IL4 IL16 KAP13 CSN3 Iran 35.63°N, 51.72°E OxV1–3 3 EU365991 OxV1–3 FJ936380,85,88 FJ936460,65,68 FJ936540,45,48 FJ936300, 05, 08 EU366009, 68 Iran 29.71°N, 52.70°E OxV4–8 4 EU365978, 82 OxV7,8 FJ936394–95 FJ936474–75 FJ936554–55 FJ936314–15 FJ936233–35 Iran 35.97°N, 53.51°E OxV9–14 5 EU366019–21 OxV12–14 FJ936381–83 FJ936461–63 FJ936541–43 FJ936301–03 FJ936222–24 Iran 35.77°N, 55.83°E OxV15–17 3 EU366005–07 — ———— Iran 28.86°N, 56.45°E OxV18–25 7 EU366026–30, 35 OxV19,23,25 FJ936384 FJ936464 FJ936544 FJ936304 FJ936225–6 FJ936386–87 FJ936466–67 FJ936546–47 FJ936306–67

Iran 31.60°N, 55.71°E OxV26,27 2 EU366031–32 — ———— 315–326 (2010) 54 Evolution and Phylogenetics Molecular / al. et Rezaei H.R. Iran 34.71°N, 52.19°E OxV28–32 4 EU3660232–5 OxV31,32 FJ936389–90 FJ936469–70 FJ936549–50 FJ936309–10 FJ936227 Iran 36.70°N, 55.43°E OxV33–37 4 FJ936228–32 OxV34,36,37 FJ936391–93 FJ936471–73 FJ936551–53 FJ936311–13 Ovis vignei O. v. arkal (Eversmann, 1850) Iran 56.14°N, 37.43°E OVA1–3 3 EU365993–95 — ———— Kazakhstan 44.30 °N, 51.33°E OVA4 1 FJ936215 OVA4–6 FJ936362–64 FJ936442–44 FJ936522–24 FJ936282–84 Iran 37.22°N, 57.26°E OVA7–10 4 EU366011–14 — ———— Iran 37.39°N, 58.87°E OVA11,12 2 EU366054 OVA11,12 FJ936356–57 FJ936436–37 FJ936516–17 FJ936276–77 FJ936212 Iran 36.93°N, 57.76°E OVA13–15 2 EU365983–84 — ———— EU366069 Turkmenistan 36.24° N, 63.71°E OVA16–18 3 EU366041 OVA16–18 FJ936358–60 FJ936438–40 FJ936518–20 FJ936278–80 FJ936213–14 Tajikistan 38.20 °N, 69.08°E OVA19 1 EU366072 OVA19 FJ936361 FJ936441 FJ936521 FJ936281 O. v. blanfordi (Hutton, 1842) Pakistan 25.48° N, 67.62°E OVBL1–3 3 EU366045–46, 50 OVBL1–3 FJ936365–67 FJ936445–47 FJ936525–27 FJ936285–87 O. v. bocharensis (Nasonov, 1914) Tajikistan 38.06 °N, 68.99°E OVBO1,2 1 EU366042, 52 OVBO1,2 FJ936368–69 FJ936448–49 FJ936528–29 FJ936288–89 O. v. cycloceros (Hutton, 1842) Pakistan 31.11° N, 68.27°E OVC1–4 3 EU366043–44, 51 OVC1, 2, 4 FJ936370–72 FJ936450–52 FJ936530–32 FJ936290–92 FJ936216 O. v. punjabensis (Lyddekker, Pakistan 33.02 °N, 71.06°E OVP1–4 4 EU366047–48, OVP1–3 FJ936375–77 FJ936455–57 FJ936535–37 FJ936295–97 1913) 74FJ936218 O. v. vignei (Blyth, 1841) Pakistan 35.18° N, 75.39°E OVV1–4 3 EU366049 OVV1,4 FJ936378–79 FJ936458–59 FJ936538–39 FJ936298–99 FJ936219–21 O. v. population No Iran 29.68°N, 60.88°E OVNo1–4 3 EU366018,56,71 OvNo3, 6 FJ936373–74 FJ936453–(4 FJ936533–34 FJ936293–94 FJ936217 Outgroup Capra aegagrus Iran 7.45°N, 56.12°E Capra 1 FJ936175 Capra FJ936316 FJ936396 FJ936476 FJ936236 H.R. Rezaei et al. / Molecular Phylogenetics and Evolution 54 (2010) 315–326 319 obtained using a non-invasive method (Taberlet et al., 1999). Fresh duced after PCR amplification (Avise et al., 1994; Ropiquet and faeces where collected in the field, after having observed the ani- Hassanin, 2005b). Sequences were also retrieved for Bos taurus mal from a distance to ensure its species identification. This and Budorcas taxicolor that were used as outgroups (Table 3). avoided capturing the animals and thus reduced the risk of injuries and of disturbing the social group. For each individual two samples 2.3. PCR amplification and sequencing were collected and preserved using two methods (silica gel and ethanol 96%). Some other samples consisted of skin and muscles We sequenced the Cyt b gene that is useful for inferring Bovidae obtained from winter hunter kills and did not concern species un- phylogenies (e.g., Janecek et al., 1996; Hassanin and Douzery, der CITES regulation. Because of a possible hybridization in captiv- 1999; Pidancier et al., 2006). The total mitochondrial Cyt b ity, we did not sample individuals from zoos. The collected samples (1140 bp) was successfully amplified with two pairs of primers represented six species according to the Nadler’s classification:O. (Pedrosa et al., 2005) for 290 wild Ovis. In addition 4 nuclear loci vignei, O. orientalis, O. musimon, O. ammon, O. dalli, and O. canaden- were studied: Interleukin 4 (IL4), Kappa Casein (CSN3), Keratin sis (Table 1). One Capra aegagrus was sampled in Iran to be used as Associated Protein 1.3 (KAP13) and Interleukin 16 (IL16). All prim- an outgroup (Table 2). ers are given in Table 4. These nuclear loci were sequenced for 79 The whole genomic DNA was extracted from fecal samples after Ovis samples for which we had samples with good DNA quality, 20 min in washing buffer (Tris–HCl 0.1 M, EDTA 0.1 M, NaCl and represented up to 1941 bp. They were also sequenced for the 0.01 M, N-lauroyl sarcosine 1%, pH 7.5–8.0), using DNAeasy extrac- Capra aegagrus sample that was used as outgroup. tion blood kit (Qiagen, Hilden, Germany) following the manufac- The PCR reactions were performed in a final volume of 25 ll turer’s protocol for animal blood except for the incubation with containing 2 ll of DNA, 1 lM of each primer, 1 PCR buffer, protease (2 h at 56 °C with 55 ll of protease). For tissue samples, 200 lM of each dNTP, 1.5 mM MgCl2, and 1 unit of AmpliTaq Gold total DNA was extracted using the tissue extraction kit QIAamp polymerase (Applied Biosystems, Foster City, California). PCR were Animal Tissue kit (Qiagen) following the manufacturer’s performed according to the following protocol: initial denatur- instructions. ation, 95 °C, 10 min; then for 35–40 cycles, denaturation, 95 °C, 30 s; annealing, 50–60 °C (see Table 4), 30 s; extension, 72 °C, 1 min; a final extension, 7 min, 72 °C. PCR products were purified 2.2. Complementary data retrieved from GenBank using the Qiaquick kit (Qiagen) following the manufacturer’s instructions. Purified PCR products were used as the template in The data set was completed with the Cyt b sequences present in 20 ll BigDye Terminator Cycle Sequencing kit version 3.1 (Applied GenBank for the genus Ovis. After having discarded 13 sequences Biosystems) and analyzed on an ABI Prism 3100 automated se- corresponding to partial sequences, sequences with a high number quencer (Applied Biosystems). SeqScape 2.5 (Applied Biosystems) of unknown bases and sequences that have been shown to be chi- was used to reconcile chromatograms of complementary frag- meric, it remained 17 sequences for O. ammon, O. orientalis, O. dalli, ments and to align sequences across taxa. The alignment of the and O. nivicola (Table 3). The following method allowed identifying Cyt b sequences was unambiguous without any gaps. The se- the chimeric sequences present in GenBank. Haplotypes that quences produced were deposited in GenBank under Accession showed an abnormally high divergence with the other haplotypes Numbers EU365973–EU366074 and FJ936175–FJ936235 for Cyt b of the same species were aligned and compared to the other se- and FJ936236-FJ936555 for nuclear data (Table 2). quences of Ovis. It appeared that each problematic sequence could be divided in two or three regions according to the level of divergence with the other Ovis sequences. The most similar sequence 2.4. Alignments to each of these regions was searched in GenBank using BLAST. The 30 and 50 regions of the haplotypes AJ867258 and AJ867259 All Cyt b sequences were of the same length. Nuclear sequences were from O. ammon but the central region were from Pseudois that were very similar were aligned by eye. sp. and Muntiacus sp., respectively. The 30 and 50 regions of the haplotype AJ867265 were from O. nivicola and the central region was 2.5. Phylogenetic analysis of nuclear and mitochondrial data from O. ammon. The 30 region of the haplotypes AJ867274 corresponded to Lepus tolai, while the 50 region was from O. ammon. This Phylogenetic analyses were performed on mitochondrial and was not the first time that such chimeric sequences have been pro- combined (i.e., nuclear and mitochondrial) data. Preliminary

Table 3 mtDNA sequences retrieved from GenBank.

Taxon References Individual ID #Haplotypes Accession Numbers Ovis ammon Bunch et al., 2006 OA1–3 3 AJ867266–68 OA4–6 3 AJ867276, AJ867275, AJ867272, AJ867273 OA7–9 3 AJ867269, AJ867260, AJ867257 O. a. ammon Unpublished OAA 1 AF242349 O. a. darwini Unpublished OAD1 1 AF242350 Hassanin et al., 1998 OAD2 1 AF034727 Ovis dalli O. d. dalli Hassanin et al., 1998 ODD1 1 AF034728 Ovis nivicola Bunch et al., 2006 ON1–3 3 AJ867262–64 Ovis orientalis Bunch et al., 2006 OO1 1 AJ867261 Outgroups Bos taurus Cai et al., 2007 Bos 1 DQ186288 Budorcas taxicolor Ropiquet and Hassanin, 2005b Budorcas 1 AY669320 320 H.R. Rezaei et al. / Molecular Phylogenetics and Evolution 54 (2010) 315–326

Table 4 Primers used for PCR and sequencing.

Locus Primer name Primer sequence (50–30) Maximum fragment Tm(°C) length (base pair) Cytochrome b (Part 1) CYTB_F CCCCACAAAACCTATCACAAA 741 55 CYTB_IN_R CCTGTTTCGTGGAGGAAGAG Cytochrome b (Part 2) CYTB_IN_F ACCTCCTTTCAGCAATTCCA 765 60 CYTB_R AGGGAGGTTGGTTGTTCTCC Kappa casein Kcas-X4F AGAAATAATACCATTCTGCAT 498 50 Kcas-X4R TTGTCTTCTTTGATGTCTCCTTAGAG Interleukin 16 IL16-F CCAGGCAAGCTGTGATCGT 423 58 IL16-R GAAGATCCTGTTAACTGTCAGAGG Keratin Associated Protein 1.3 KAP1–3F GGGTGGAACAAGCAGACCAAACTC 584 58 KAP1–3R AAGTTTGTTGGGACTGTACACTGGC Interleukin 4 IL4-X1R TCACATTGTCAGTGCAAATAGAG 436 55 IL4-X1F TTTGGGGCAGCAAAGACGT

analyses on nuclear data (not presented) gave results in accor- TBR branch swapping, 100 replicates and all parameter values dance with those of combined analyses but were less robust due estimated. to the low number of variable and informative sites in nuclear sequences (see Section 3). We obtained Cyt b sequences for 290 indi- 2.5.4. Bayesian analyses viduals, corresponding to 125 different haplotypes. Because we Bayesian Markov chain Monte Carlo (MCMC) analyses were per- analyzed low quantities of DNA extracted from faeces it has been formed with MrBayes 3.0 (Ronquist and Huelsenbeck, 2003). To as- difficult to obtain nuclear data, and only 79 individuals had reliable sess the coverage of tree space, we performed two simultaneous sequences for the 4 nuclear genes studied. Selecting the individuals independent Metropolis-coupled MCMC runs, started from differ- that corresponded to different haplotypes within each sampling ent random points in parameter space (Ronquist and Huelsenbeck, locality and those that gave successful nuclear sequences, gave a 2003). We set each run to have one cold and three heated chains to dataset of 161 individuals (plus the Capra outgroup) for mtDNA allow better mixing of the MCMC chain and minimize the chance analyses. The combined analyses were performed on the 79 indi- of being trapped in local optima (Pereira et al., 2007). We per- viduals (plus the Capra outgroup) for which nuclear data were ob- formed runs with two millions generations each assuming the tained. These individuals represented the more robust clades model of DNA evolution as chosen by AIC in ModelTest 3.06 (Posa- obtained on the mitochondrial phylogenies. Mitochondrial and da and Crandall, 1998). MCMC samples were taken in every 100th combined data were analyzed using NJ, MP, ML and Bayesian cycle. We plotted the log-likelihood of sampled topologies to methods. determine the burn-in period (Huelsenbeck and Ronquist, 2001) in which the MCMC had reached a stationary status. Post-burn-in 2.5.1. Neighbor-Joining samples from the independent runs were used to construct a 50% NJ (Saitou and Nei, 1987) trees were constructed with PAUP 4.0 majority rule consensus trees. The proportion of trees in which (Swofford, 2002) with a GTR+C+I model of sequence evolution. The nodes were recovered after the burn-in period is interpreted as robustness of each branch was determined by a nonparametric the posterior probability (PP) of that node, or the probability that bootstrap test with 1000 replicates and a TBR branch swapping node is true (Ronquist and Huelsenbeck, 2003). algorithm. 2.5.5. Node support 2.5.2. Maximum parsimony Support for internal branches was assessed in PAUP* by non- Heuristic searches under the MP criteria, on separate and com- parametric bootstrapping (nBT) with 1000 pseudoreplicates, using bined data, were implemented in PAUP 4.0 with accelerated trans- full heuristic searches with ten random addition sequence repli- formation (ACCTRAN) option to optimize the state of unordered cates, TBR branch swapping and one tree held at each step during (Fitch) characters, 1000 random sequence addition replicates, a stepwise addition. Posterior probabilities (PP) for individual nodes tree bisection reconnection (TBR) branch swapping and gaps trea- were estimated in a Bayesian MCMC framework with the charac- ted as a fifth character. Unweighted MP (uMP) methods do not al- teristics of the runs presented above. Divergence among mitochon- ways take full advantage of the information contained in DNA drial haplotypes. The divergence among Cyt b haplotypes within sequences due to the presence of the homoplasious characters. and between species were estimated by the average number of To deal with this phenomenon, step-matrix weighted parsimony pairwise differences (pi with 100 permutations) using ARLEQUIN (wMP) analyses were conducted using the rescaled consistency in- 3.1 (Excoffier et al., 2005). dex (RCI) on an initial tree in successive approximations of character weighting (i.e., successive weighting method, the reweight 2.6. Estimation of divergence time character option in PAUP). Strict consensus trees were then constructed. The estimation of divergence time was based on the Cyt b bayesian tree. Since the likelihood ratio test rejected a global 2.5.3. Maximun Likelihood molecular clock (P < 0.05), estimates of divergence times were ob- ML analyses were performed using the most appropriate likeli- tained with the Bayesian relaxed molecular clock approach with hood models as determined by the Akaike Information Criterion in the MULTIDISTRIBUTE program package, including ESTBRANCHES Model Test 3.07 (Posada and Crandall, 1998). The NJ tree using a and MULTIDIVTIME (Thorne and Kishino, 2002). ESTBRANCHES GTR+C+I model of sequence evolution was used as starting tree, was used to estimate the branch lengths of the constrained topol- and heuristic ML searches were conducted in PAUP 4.0, with a ogies and the corresponding variance–covariance matrices. A H.R. Rezaei et al. / Molecular Phylogenetics and Evolution 54 (2010) 315–326 321

F84+C model was used with the maximum likelihood parameters 3.2. Phylogenies previously estimated by PAML (Yang, 1997). Then, with MULTIDIV- TIME, the variance–covariance matrices produced were used to run For the mtDNA data, the three independent Bayesian analyses a Markov chain Monte Carlo analysis to estimate the mean poster- converged on similar log-likelihood scores and reached stationarity ior divergence times on nodes with associated standard deviation before 50,000 generations (plot not shown). The consensus topolo- and 95% credibility interval. The Markov chain was sampled gies of the three runs were identical (Fig. 2). The other methods 10,000 times every 100 cycles and the burn-in stage was set to (MP, ML, and NJ) gave the same topology (data not shown, boot- 100,000 cycles. The analysis was repeated three times with the fol- strap values given in Fig. 2 on the consensus Bayesian tree). Similar lowing priors: a substitution rate of 2% per site per million years results were obtained when reconstructing trees using the com- for the rate at root node, an expected number of time units be- bined dataset with MB, ML, NJ and MP methods. The consensus tween tip and root of 2.5, and a highest possible number of time Bayesian tree with posterior probabilities and bootstrap values ob- units between tip and root of 100. The time separating the in- tained for other phylogenetic methods are presented on Fig. 3. The group root from the present (rttm in MULTIDIVTIME) was fixed combined data set confirmed the major monophyletic clades ob- at 2.42 MYA according to fossil data (Mead and Taylor, 2005). Lim- tained with the Cyt b data, even if the MP method provided less itations of the MULTIDIVTIME program imposed to estimate the resolution in this case. Several monophyletic groups supported divergence time with a sub-sample of 80 haplotypes representing by high bootstrap values (94–100%) are distinguished on both the whole diversity of our dataset. mitochondrial and combined phylogenies (Fig. 2 and Fig. 3). A first Pachyceriform group is composed of the Snow Sheep (O. nivicola) 2.7. Reconstruction of ancestral states for chromosome numbers and the two American sheep (O. canadensis and O. dalli). The other Eurasian sheep are divided into the Argaliform group Argali (O. am- Because nuclear data were not available for O. nivicola and the mon) and the Moufloniform group. This last group is subdivided outgroup species used in previous study (i.e., Capra aegagrus, Bos into two monophyletic taxa, the Urial (O. vignei) and the mouflons taurus and Budorcas taxicolor; Bunch et al., 2006), the Cyt b bayes- (O. orientalis), if we put aside the individual OO1 that fall within ian tree (including 2–7 haplotypes representative of each in-group) the O. vignei clade. The European mouflon (O. musimon) is clearly was used for reconstructing the ancestral numbers of chromo- included in the O. orientalis clade (Fig. 2 and Fig. 3). According to somes. The chromosome number was scored as a five-state cate- combined and mitochondrial data, O. orientalis vignei hybrids gorical character (52, 54, 56, 58 and 60), and the ancestral, states split in the O. orientalis and O. vignei groups, whatever their popu- were reconstructed using the parsimony method implemented in lation of origin. Mesquite 2.5 (Maddison and Maddison, 2008). 3.3. Estimations of divergence times

3. Results The divergence times were estimated under a relaxed molecular clock approach by calibrating the Bayesian tree with an age of 3.1. Sequence composition 2.42 ± 0.05 MYA for the in-group of the genus Ovis. The divergence between the American wild sheep (O. dalli and O. canadensis) from For the Cyt b sequence, the 290 Ovis individuals genotyped in O. nivicola occurred about 1.57 ± 0.43 MYA. At about the same time this study corresponded to 125 distinct haplotypes (Table 2) and (1.72 ± 0.36 MYA) the Argali (O. ammon) diverged from the other the 17 individuals from GenBank corresponded to 17 other haplo- Eurasian groups. Then the Mouﬂon (O. orientalis) and the Urial types. A total of 161 individuals representing all these haplotypes (O. vignei) diverged about 1.26 ± 0.36 MYA. The two American have been used in order to represent all the sampling localities species began to diverge around 0.95 ± 0.37 MYA (Fig. 1). in the phylogenetic analysis of the mitochondrial data. Over the 1140 nucleotide sites (nt) studied, 226 nt were variable and 161 nt were phylogenetically informative. The nucleotide frequencies 3.4. Ancestral states for chromosome numbers were 31.6% A, 28.3% C, 12.9% G, and 27.2% T. The Transition/Trans- version ratio (TS/TV) was equal to 4 (196/49). The MP tree had a The reconstruction of ancestral state for chromosome numbers consistency index (CI) of 0.84. The average numbers of pairwise using the Cyt b Bayesian tree showed that several ancestral states differences between and within species of the genus Ovis are given (i.e., 2n = 52/56/60) involve equally parsimonious evolution in Table 5. The lowest differences were observed between O. dalli scenarios (Fig. 1). and O. canadensis, and also between O. vignei, O. orientalis and their hybrids. Nuclear DNA was less variable than mtDNA. For the 4 nu- 4. Discussion clear genes studied, the 79 wild Ovis showed 27 variable sites, from which 14 were informative. The nucleotide frequencies were 24.1% The use of morphological characters alone (e.g., horn morphol- A, 28.9% C, 23.0% G, and 24.0% T. The Transition/Transversion ratio ogy and coat pattern, Fedosenko and Blank, 2005) is not adequate (TS/TV) was 1.03. For the combined (i.e., nuclear and mitochon- for inferring the evolutionary history and classiﬁcation of the wild drial) dataset, the MP tree had a CI of 0.77. Ovis, and genetic data such as chromosome number (Nadler et al.,

Table 5 Differences among Cyt b haplotypes within and between Ovis species. Values above the diagonal give the average pairwise differences between species. Diagonal values give the pairwise difference within each group.

O. orientalis n =35 O. orientalis O. vignei n =24 O. vignei n =49 O. canadensis n =16 O. dall n =3 O. ammon n =15 O. nivicola n =3 O. orientalis 9.41 19.29 23.95 72.76 68.20 36.57 66.61 O. orientalis O. vignei 16.29 15.63 75.14 71.67 40.46 68.40 O. vignei 11.67 74.48 71.69 40.96 68.05 O. canadensis 4.85 14.29 70.71 28.83 O. dalli 1.33 68.60 29.00 O. ammon 15.14 64.91 O. nivicola 5.33 322 H.R. Rezaei et al. / Molecular Phylogenetics and Evolution 54 (2010) 315–326

Fig. 2. Phylogram of the genus Ovis based on complete cytochrome b sequences. The tree presented result from the Bayesian analysis. Nodes supports are given as the posterior probability (MB) and bootstrap values (ML/NJ/MP), respectively. For ﬁgure clarity, supports for terminal branches are only provided for monophyletic sub-species. The codes referring to each individual refer to the sub-species, as given in Tables 2 and 3. H.R. Rezaei et al. / Molecular Phylogenetics and Evolution 54 (2010) 315–326 323

Fig. 3. Phylogram of the genus Ovis based on combined nuclear and mitochondrial data. The tree presented result from the Bayesian analysis of mitochondrial and nuclear data. Nodes supports are given as the posterior probability (MB) and bootstrap values (ML/NJ/MP), respectively. For ﬁgure clarity, supports for terminal branches are only provided for monophyletic sub-species. The codes referring to each individual refer to the sub-species, as given in Tables 2 and 3. 324 H.R. Rezaei et al. / Molecular Phylogenetics and Evolution 54 (2010) 315–326

1973; Bunch et al., 2006) did not suffice to solve all the problems. on molecular phylogenies the evolution of Ovis karyotypes would The concomitant use of molecular phylogenies is thus necessary. have been polyphyletic (Bunch et al., 2006) involving several acro- Although the molecular tool has been commonly used for phyloge- centric fusions and at least one fission (i.e., for 2n =58inO. vignei, netic studies for more than two decades, there has been no study of Fig. 1). wild sheep based on large samples from their entire distribution area until now. The present study gives new insights into Ovis evo- 4.2. Classification of the wild sheep lution and classification. The Asiatic mouflon and the Urial are either classified as a single 4.1. Evolutionary history of the genus Ovis species (Ovis orientalis) or as two separate species (O. orientalis and O. vignei). Differences in horn morphology and coat (presence of a The monophyly of the genus Ovis has been established in phy- throat bib in the Urial and not in the mouflon), and mainly in chro- logenies based on molecular data (Hassanin and Douzery, 1999; mosomes number (2n = 58 in the Urial and 2n = 54 in the mouflon) Lalueza-Fox et al., 2005; Ropiquet and Hassanin, 2005a,b), karyo- support the existence of two species (Nadler et al., 1973). The type (Huang et al., 2005) or combining morphological, ethological occurrence of hybrid populations with intermediate morphologies and molecular information (Hernandez Fernandez and Vrba, 2005). and chromosomes numbers (all possibilities between 2n = 54 and They support the existence of an Eurasiatic sheep ancestor. This is 58) would support the existence of a single species (Valdez, in accordance with the fossil record and karyotypic studies that 1982). The Cyt b and combined phylogenies show that the individ- support a Eurasian origin of the genus (Bunch et al., 2000, 2006). uals identified as mouflon and Urial form two strongly supported The American sheep (O. canadensis and O. dalli) are monophyletic monophyletic groups. Only one O. orientalis (OO1, Table 3) fell and form a monophyletic group with the Siberian Snow Sheep within the O. vignei clade. This specimen originated in Turkey, (O. nivicola). This supports the hypothesis of the migration of the i.e., outside the hybrid zone, and had a typical O. orientalis diploid Asiatic sheep to North America through North-Eastern Asia and number of 2n = 54 (T. Bunch, pers. com.). Its Cyt b haplotype did the Bering Strait. This came with a differentiation of the American not appear to be chimeric like other sequences from the same data- sheep from O. nivicola about 1.6 MYA and a divergence times be- set (Bunch et al., 2006; see Section 2), but it had 11 autapomor- tween O. dalli and O. canadensis of about 1 MYA. In Asia, the diver- phies that make it really different from all studied Asiatic gence between O. ammon and the O. orientalis/vignei group mouflons. Thus, a confirmation of the sequence obtained may occurred about 1.7 MYA and O. vignei diverged from O. orientalis come before further interpretation. about 1.3 MYA. These values are concordant with those of Bunch Individuals sampled from hybrids’ populations appear either in et al. (2006) from a Cyt b phylogeny with a similar calibration date. the clade of O. vignei or in that of O. orientalis, independently of The only significant difference concerns the divergence between O. their geographic origin and of their morphology. Because the nu- ammon from O. orientalis and O. vignei that has been estimated to clear sequences provide low resolution for distinguishing O. vignei be less than one MYA. This difference may result from an underes- and O. orientalis in the hybrid zone (data not shown), the position timation due to the low sample size in the previous study, where of each hybrid should depend on the origin of its mitochondrial only one sequence of O. orientalis and one of O. vignei were used DNA. The fact that the hybrids bear either O. vignei or O. orientalis (Bunch et al., 2006). Moreover, the O. orientalis sequence used (also haplotype explains their low average pairwise difference with the integrated in our study as sample OO1, Fig. 2 and Table 3) is not parental species (Table 5). Thus, O. orientalis and O. vignei clearly representative of the O. orientalis clade (see below). Obviously, form two distinct evolutionary lineages that are hybridizing in the dates strongly depend on the age of the genus Ovis used for cal- their contact zone. Considering these two taxa as distinct species ibration (i.e., 2.42 MYA), which is based on fossil records (Mead would be more coherent with the morphological and genetic dif- and Taylor, 2005). This age is similar to the values widely admitted ferences between them, their past evolutionary divergence, and in previous studies (Bunch et al., 2006; Ropiquet and Hassanin, the occurrence of a restricted hybrid zone. 2005a). However, a lack of good fossil records has been already no- Our sampling allows testing the monophyly of several taxa con- ticed, because of the bad conditions for fossilization in the moun- sidered as sub-species of O. vignei and O. orientalis (Shackleton and tain regions that wild sheep inhabit (Bunch et al., 2006). Other Lovari, 1997; Valdez et al., 1978). The Severtzov’s Urial from Uzbe- calibrations combining fossil and molecular data were based on kistan (O. ammon severtzovi, see Table 2), which has been recog- an Ovis in-group of 5–7 MYA (Hartl et al., 1990; Hernandez Fernan- nized as a sub-species of O. orientalis (Shackleton and Lovari, dez and Vrba, 2005). Obviously, they lead to more ancient diver- 1997), clearly appears to be a sub-species of O. ammon. This is in gent dates between the Ovis taxa (data not shown). accordance with previous results, which classified this sub-species O. ammon, O. nivicola, O. dalli and O. canadensis form robust in the Argali group on the basis of morphological and karyotypic monophyletic groups. Thus the Cyt b and combined phylogenies criteria (Bunch et al., 1998). At least five of the other sub-species are concordant with their species status that has been approved (i.e., O. orientalis orientalis, O. orientalis isphahanica, O. vignei blanf- by all recent classifications (Nadler et al., 1973; Shackleton and ordi, O. vignei arkal and O. vignei punjabensis; see Table 2) are not Lovari, 1997; Valdez, 1982). A previous Cyt b phylogeny found O. monophyletic. Considering the overlap in the geographic distribu- nivicola polyphyletic (Bunch et al., 2006), but this was due to the tion of these sub-species, this may result from recent introgres- fact that 4 haplotypes (3 O. ammon and 1 O. nivicola) were actually sions but it could also result from an ancestral polymorphism. chimeric (see Section 2). Our mtDNA phylogeny, which includes We cannot exclude that the other sub-species, which appear to data from this previous study with the exception of these chimeric be monophyletic with the present samples, are actually polyphy- haplotypes, supports the monophyly of O. nivicola. These changes letic. Population genetic studies based on a wider sampling are together with the position in the phylogeny of the many new O. needed for measuring gene flows and understanding these vignei and O. orientalis individuals added in this study do not bring phenomena. new insight into the evolution of diploid number. According to our According to the Cyt b and combined phylogenies, O. musimon results the ancestral state remains equivocal (2n = 52, 56 or 60) clearly appears to be within the O. orientalis clade. This supports leading to several equally parsimonious scenarios (Fig. 1), such as previous studies that considered the European mouflon as a sub- the detailed scenario proposed by Bunch et al. (2006) that is based species of O. orientalis (Valdez, 1982; Wilson and Reeder, 1993). on cytogenetic data and a mtDNA phylogeny. Whatever the sce- O. orientalis musimon represents the only European wild Ovis, and nario, our mtDNA and combined phylogenies confirm that based should now be considered as a wild remnant of the first domestic H.R. Rezaei et al. / Molecular Phylogenetics and Evolution 54 (2010) 315–326 325 sheep that entered Europe based on archaeological (Poplin, 1979; Hassanin, A., Pasquet, E., Vigne, J.D., 1998. Molecular systematics of the subfamily Vigne, 1988) and genetic evidence (Bruford and Townsend, 2006). Caprinae (Artiodactyla, Bovidae) as determined from cytochrome b sequences. Journal of Mammalian Evolution V5, 217. To conclude, the phylogeography of the genus Ovis based on Hernandez Fernandez, M., Vrba, E.S., 2005. A complete estimate of the phylogenetic mitochondrial and nuclear data shows that the evolution of this relationships in Ruminantia: a dated species-level supertree of the extant genus is a striking example of successive speciation events that ruminants. Biological Reviews 80, 269–302. Hiendleder, S., Kaupe, B., Wassmuth, R., Janke, A., 2002. Molecular analysis of wild have occurred during migrations from the ancestral area (central and domestic sheep questions current nomenclature and provides evidence for Asia, see Fig. 1). All species defined on morphological criteria by domestication from two different subspecies. Proceeding of the Royal Society of Nadler et al. (1973) are confirmed by molecular data, except O. London Series B-Biological Sciences 269, 893–904. Huang, L., Nie, W., Wang, J., Su, W., Yang, F., 2005. Phylogenomic study of the musimon that is a sub-species of O. orientalis. The polyphyly of subfamily Caprinae by cross-species chromosome painting with Chinese most of the sub-species previously defined on morphological and muntjac paints. Chromosome Research 13, 389–399. geographical criteria questions the use of these sub-species as con- Huelsenbeck, J.P., Ronquist, F., 2001. MrBayes: Bayesian inference of phylogeny. Bioinformatics 17, 754–755. servation units. This is especially true for the hybrid populations IUCN, 2009. IUCN Red list of threatened species. Version 2009.1 between O. vignei and O. orientalis in Iran. By pointing out the high (www.iucnrelist.org). Downloaded on 01 October 2009. diversity of wild sheep and the phylogenetic relationships between Janecek, L.L., Honeycutt, R.L., Adkins, R.M., Davis, S.K., 1996. Mitochondrial gene taxa, this study also has implications in the conservation biology of sequences and the molecular systematics of the artiodactyl subfamily bovinae. Molecular Phylogenetics and Evolution 6, 107–119. a genus with 13 vulnerable sub-species, 7 endangered and 3 criti- Lalueza-Fox, C., Castresana, J., Sampietro, L., Marques-Bonet, T., Alcover, J.A., cally endangered sub-species in the IUCN red list (IUCN, 2009). Bertranpetit, J., 2005. Molecular dating of caprines using ancient DNA sequences of Myotragus balearicus, an extinct endemic Balearic mammal. BMC Evolutionary Biology 5, 70. Loehr, J., Worley, K., Grapputo, A., Carey, A., Veitch, J., Coltman, D.W., 2006. Evidence Acknowledgments for cryptic glacial refugia from North American mountain sheep mitochondrial DNA. Journal of Evolutionary Biology 19, 19–2071. Maddison, W.P., Maddison, D.R., 2008. Mesquite: a modular system for evolutionary We are grateful to Gordon Luikart, Aykut Kence, Deniz Ozut, analysis. Version 2.5. Available at http://mesquiteproject.org. Paul Weinberg for providing Ovis samples and to the Iran Depart- Mead, J.I., Taylor, L.H., 2005. New species of Sinocapra (Bovidae, Caprinae) from the ment of Environment for sampling authorizations (Nb 13/1- lower Pliocene Panaca formation, Nevada, USA. Palaeontologia Electronica, 8. 36694-1383). We thank Jessica Scriven for help with the English. Nadler, C.F., Hoffmann, R.S., Woolf, A., 1973. G-band patterns as chromosomal markers, and the interpretation of chromosomal evolution in wild sheep (Ovis). S. Naderi and H.R. Rezaei were supported by PhD scholarships from Experientia 29, 117–119. the Iranian Ministry of Science, Research, and Technology (Number Nadler, C.F., Lay, D.M., Hassinger, J.D., 1971. Cytogenetic analyses of wild sheep 800125 and, 791135, respectively). F. Pompanon was supported by populations in northern Iran. Cytogenetics 10, 137–152. Pedrosa, S., Uzun, M., Arranz, J.J., Gutierrez-Gil, B., San Primitivo, F., Bayon, Y., 2005. the Institut National de la Recherche Agronomique. This study has Evidence of three maternal lineages in Near Eastern sheep supporting multiple been partially supported by a grant from the French Agence Natio- domestication events. Proceeding of the Royal Society of London Series B- nale de la Recherche (Project Chronobos, ANR 05-GANI-004-02). Biological Sciences 272, 2211–2217. Pereira, S.L., Johnson, K.P., Clayton, D.H., Baker, A.J., 2007. Mitochondrial and nuclear SN and ICCM equally contributed to this work. We would like to DNA sequences support a Cretaceous origin of Columbiformes and a dispersal- acknowledge anonymous reviewers for constructive comments driven radiation in the Paleogene. Systematic Biology 56 (4), 656–672. on the paper. Pidancier, N., Jordan, S., Luikart, G., Taberlet, P., 2006. Evolutionary history of the genus Capra (Mammalia, Artiodactyla): Discordance between mitochondrial DNA and Y-chromosome phylogenies. Molecular Phylogenetics and Evolution 40, 739–749. References Poplin, F., 1979. Origine du mouflon de Corse dans une novelle perspective perspective paleontologique: par marronnage. Annales de Génétique et de Sélection Animale 11, 133–143. Avise, J.C., Nelson, W.S., Sibley, C.G., 1994. DNA sequence support for a close Posada, D., Crandall, K., 1998. Modeltest: testing the model of DNA substitution. phylogenetic relationship between some storks and New World vultures. Bioinformatics 14, 817–818. Proceeding of the National Academy of Sciences of the United State of America Ramey 2nd, R.R., 1995. Mitochondrial DNA variation, population structure, and 91, 5173–5177. evolution of mountain sheep in the south-western United States and Mexico. Boyce, W.M., Ramey 2nd, R.R., Rodwell, T.C., Rubin, E.S., Singer, R.S., 1999. Molecular Ecology 4, 429–439. Population subdivision among desert bighorn sheep (Ovis canadensis) ewes Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: Bayesian phylogenetic inference revealed by mitochondrial DNA analysis. Molecular Ecology 8, 99–106. under mixed models. Bioinformatics 19, 1572–1574. Bruford, M.W., Townsend, S.J., 2006. Mitochondrial DNA diversity in modern sheep: Ropiquet, A., Hassanin, A., 2005a. Molecular evidence for the polyphyly of the genus implications for domestication. In: Zeder, M.A., Bradley, D.G., Emshwiller, E., Hemitragus (Mammalia, Bovidae). Molecular Phylogenetics and Evolution 36, Smith, B.D. (Eds.), Documenting Domestication. New Genetics and 154–168. Archaeological Paradigms. University of California Press, Ltd., Berkeley, CA, Ropiquet, A., Hassanin, A., 2005b. Molecular phylogeny of caprines (Bovidae, pp. 306–316. Antilopinae): the question of their origin and diversification during the Bunch, T.D., Vorontsov, N.N., Lyapunova, E.A., Hoffmann, R.S., 1998. Chromosome Miocene. Journal of Zoological Systematics and Evolutionary Research 43, 49– number of Severtzov’s sheep (Ovis ammon severtzovi): G-banded karyotype 60. comparisons within Ovis. Journal of Heredity 89, 266–269. Saitou, N., Nei, M., 1987. The Neighbor-Joining method: a new method for Bunch, T.D., Wang, S., Zhang, Y., Liu, A., Lin, S., 2000. Chromosome evolution of the reconstructing phylogenetic trees. Molecular Biology and Evolution 4, 406– blue sheep/bharal (Pseudois nayaur). Journal of Heredity 91, 168–170. 425. Bunch, T.D., Wu, C., Zhang, Y.-P., Wang, S., 2006. Phylogenetic analysis of snow Shackleton, D.M., Lovari, S., 1997. Classification Adopted for the Caprinae Survey. In: sheep (Ovis nivicola) and closely related taxa. Journal of Heredity 97, 21–30. Shackleton, D.M. (Ed.), Wild Sheep and Goats and their Relatives. Status survey Cai, X., Chen, H., Lei, C., Wang, S., Xue, K., Zhang, B., 2007. MtDNA diversity and and conservation action plan for Caprinae, IUCN, Gland, Switzerland, pp. 9–14. genetic lineages of eighteen cattle breeds from Bos taurus and Bos indicus in Swofford, D., 2002. PAUP*: phylogenetic analysis using parsimony (*and other China. Genetica 130, 175–183. methods), Version 4.0. Sinauer Associates, Sunderland, Massachusetts. Excoffier, L., Laval, G., Schneider, S., 2005. Arlequin ver. 3.0: an integrated software Taberlet, P., Waits, L.P., Luikart, G., 1999. Noninvasive genetic sampling: look before package for population genetics data analysis. Evolutionary Bioinformatics you leap. Trends in Ecology and Evolution 14, 323–327. Online 1, 47–50. Thorne, J.L., Kishino, H., 2002. Divergence time and evolutionary rate estimation Fedosenko, A., Blank, D., 2005. Ovis ammon. Mammalian Species 773, 1–15. with multilocus data. Systematic Biology 51, 689–702. Festa-Bianchet, M., 2000. A summary of discussion on the taxonomy of mountain Tsalkin, V.I., 1951. European and Asian mountain sheep (Gornje barany evropy i ungulates and its conservation implications. Workshop on Caprinae taxonomy, asii). Moskovskoe Obshchest. Iss. Privody., Moscow Society of Naturalists Zool. Ankara, Turkey. Sect.(Moskovskoe Obshchest. Isp. Prirody) Materials for the recognition of the Haltenorth, T., 1963. Klassification der Saugethiere: Artiodactyla. Handbuch der fauna and flora of the USSR 27. Moscow. Zoologie, vol. 8(32). Walter de Gruyter, Berlin, Germany. Tserenbataa, T., Ramey, R.R., Ryder, O.A., Quinn, T.W., Reading, R.P., 2004. A Hartl, G.B., Burger, H., Willing, R., Suchentrunk, F., 1990. On the biochemical population genetic comparison of argali sheep (Ovis ammon) in Mongolia using systematics of the Caprini and the Rupicaprini. Biochemical Systematics and the ND5 gene of mitochondrial DNA; implications for conservation. Molecular Ecology 18, 175–182. Ecology 13, 1333–1339. Hassanin, A., Douzery, E.J., 1999. The tribal radiation of the family Bovidae Valdez, R., 1982. The Wild Sheep of the World. Wild Sheep and Goat International, (Artiodactyla) and the evolution of the mitochondrial cytochrome b gene. Mesilla, New Mexico. Molecular Phylogenetics and Evolution 13, 227–243. 326 H.R. Rezaei et al. / Molecular Phylogenetics and Evolution 54 (2010) 315–326

Valdez, R., Nadler, C.F., Bunch, T.D., 1978. Evolution of wild sheep in Iran. Evolution Wilson, D.E., Reeder, D.M., 1993. Mammal Species of the World: A Taxonomic and 32, 56–72. Geographic Reference. Smithsonian Institution Press, Washington, D.C. Vigne, J.D., 1988. Les Mammiferes post-glaciaires de Corse, etude Archeozoologique Wu, C.H., Zhang, Y.P., Bunch, T.D., Wang, S., Wang, W., 2003. Mitochondrial control (XXVIe suppl. a Gallia Prehistoire). CNRS ed., p. 337. region sequence variation within the Argali wild sheep (Ovis ammon): evolution Vrba, E.S., Schaller, G.B., 2000. Phylogeny of Bovidae Based on Behavior, Glands, and conservation relevance. Mammalia 67, 109–118. Skulls, and Postcrania. In Antelopes, Deer, and Relatives. Yale University Press, Yang, Z., 1997. PAML: a program package for phylogenetic analysis by maximum New Haven. likelihood. Computer Applications for the Biosciences 13, 555–556.