J Biosci (2020)45:127 Ó Indian Academy of Sciences

DOI: 10.1007/s12038-020-00100-y (0123456789().,-volV)(0123456789().,-volV)

DNA replication and sister chromatid cohesion 1 promotes breast carcinoma progression by modulating the Wnt/b-catenin signaling and p53 protein

1 2 3 4 GUANGCHAO JIN ,WENSHENG WANG ,PENG CHENG ,YUNQI TIAN , 1 1 LUXIAO ZHANG and HU NIU * 1Department of Breast and Thyroid Surgery, Jinan Central Hospital Affiliated to Shandong First Medical University, Jinan 250013, Shandong, China 2Department of Emergency Medicine, Xintai People’s Hospital, Xintai 271200, Shandong, China 3Department of General Surgery, No.2 People’s Hospital of Xintai, Xintai 271219, Shandong, China 4Department of Gastroenterology Department 3, Jinan Central Hospital Affiliated to Shandong First Medical University, Jinan 250013, Shandong, China

*Corresponding author (Email, [email protected])

MS received 30 July 2020; accepted 21 September 2020

The objective of this study is to assess the prognostic and functional role of DSCC1 in breast carcinoma, as well as the potential mechanism. Based upon the TCGA data, the expression pattern and prognostic value of DSCC1 in breast carcinoma was evaluated. The mRNA and protein levels of molecules were determined using qRT-PCR and Western blot. In vitro functional role of DSCC1 in tumor cells was determined using cell counting kit 8, clone formation, and Transwell assays. Gene set enrichment analysis (GSEA) was conducted to determine DSCC1 related gene sets, which are further confirmed by Western blot. The results showed that DSCC1 is overexpressed in breast carcinoma tissues and its high expression was linked to shorter overall survival. Overexpression of DSCC1 facilitated the proliferation, invasion and migration of breast carcinoma cells, while knockdown of DSCC1 showed opposite outcomes. GSEA showed that high DSCC1 expression had a positive correlation with p53, and Wnt signaling-related molecules. Western blot showed that silencing DSCC1 increased the levels of p53 and p-b-catenin, whereas decreased p-GSK-3b and cyclin D1 expression. These observations illustrate that DSCC1 emerges a well value on the diagnosis and prognosis of breast carcinoma, and facilitates the progression of breast carcinoma partly by activating Wnt/b-catenin signaling and inhibiting p53.

Keywords. Cell viability; DSCC1; GSK-3b/b-catenin; migration and invasion

1. Introduction treatment (Hatami et al. 2012). In recent years, multi- disciplinary comprehensive treatment strategies, Worldwide, breast carcinoma ranks the first among including surgical treatment, systemic treatment and female malignancies with an incidence of 11.6% (Bray radiotherapy, have significantly improved the prognosis et al. 2018; Hong et al. 2018). According to the report of breast carcinoma patients and greatly reduced their ‘national cancer report in China 2018’ released by the mortality (Turner et al. 2017). Despite these advances national cancer center, in China, breast carcinoma is in treatment, large numbers of patients continue to characterized by high mortality and early onset age develop drug resistance, relapse, and overdose (Sledge compared with western developed countries. Breast et al. 2014). For women with distant metastasis breast carcinoma is a heterogeneous disease with complex carcinoma, the 5-year overall survival (OS) rate is only cytology, which is a challenge for diagnosis and 27%, while localized patients present 98% 5-year OS http://www.ias.ac.in/jbiosci 127 Page 2 of 11 Guangchao Jin et al. rate. Therefore, it is urgent to improve the prognosis, DSCC1 exerts a promoting effect on the proliferation, diagnosis and treatment for breast carcinoma patients. invasion and migration of breast carcinoma cells pos- In addition, the concepts of immunotherapy, individu- sibly by modulating P53 and Wnt/b-catenin signaling. alized treatment and precision medicine have brought more possibilities for the improvement of the prognosis of breast carcinoma patients (Wong et al. 2015). Thus, 2. Materials and methods identification of effective therapeutic targets and full elucidation of underlying mechanism are necessary. 2.1 Data acquisition and analysis The proliferating cell nuclear antigen (PCNA) directs the metabolic pathways of DNA at various levels RNA-Seq data containing 1109 breast carcinoma (Boehm et al. 2016). Replication factor C (RFC) is a samples and 113 matched non-cancerous samples were heteropolymer AAA? protein complex consisting of acquired from the public TCGA (https://cancergenome. RFC 1–5 subunits that attaches PCNA to DNA in an nih.gov) database for evaluating the level of DSCC1 in ATP-dependent manner at the template primer junction breast carcinoma and analyzing its prognostic value. A (Majka and Burgers 2004). This process requires mul- total of 1012 samples with complete clinical data were tiple stepwise binding events with the RFC. Chromo- divided into high and low groups based upon the some transmission-fidelity protein 18 (Ctf18) is a median DSCC1 expression value. Correlation between putative paralog of RFC1 and functions as a large DSCC1 expression and OS was determined by Kaplan- subunit of loader complex Ctf18-RFC that encodes Meier methods following log-rank tests. Cox univariate protein physically interacts with RFC 2–5 (Kim and and multivariate analyses were used to identify inde- MacNeill 2003). The loader complex Ctf18-RFC targets pendent predicators having a significant impact on OS. PCNA and contributes to the establishment of sister- Gene Set Enrichment Analysis (GSEA) was conducted chromatid cohesion and the activation of the replica- using GSEA 3.0 (http://www.broadinstitute.org/gsea/) tion-stress checkpoint (Mayer et al. 2001; Crabbe et al. to identify DSCC1 associated gene sets. 2010; Kubota et al. 2011; Wade et al. 2017). Unlike other RCFs, the loader complex Ctf18-RFC contains a Ctf18-DSCC1-Ctf8 module, wherein two non-RFC 2.2 Cell culture and transfection subunits including unique DNA replication and sister chromatid cohesion 1 (DSCC1) and CTF8 combine Human breast carcinoma cell lines MCF7 and MDA- (Pellegrini 2018). A study indicated that the Ctf18- MB-231 and normal cell line MCF-10A were acquired DSCC1-Ctf8 module binds stably to the polymerase from Type Culture Collection of Chinese Academy of and away from its other functional sites, demonstrating Sciences (Shanghai, China) and maintained in Roswell that Ctf18-RFC can be replicated as the leading strand Park Memorial Institute medium 1640 (RPMI-1640) clamp loader with Pol e, which completes with double- with 10% fetal calf serum (FBS) and penicillin/strep- stranded DNA to bind to the same winged-helix domain tomycin. Both cells were incubated in a 37°C incubator on DSCC1 (Grabarczyk et al. 2018). Together, these filled with 5% CO2. To construct DSCC1 downregu- observations illustrated that DSCC1 exerts a crucial role lated cell line, small interference (si) RNAs against in DNA replication, which advanced us to examine the DSCC1 (si-DSCC1#1: 50-TAGATGATTTACCTG role of DSCC1 in proliferation, especially in tumors. In AGGA-30; si-DSCC1#2: 50-CCTGTAAGATT fact, little research has been done on the role of DSCC1 GGAGGTTA-30) and a scrambled siRNA (si-con: 50- in cancers, except in colorectal cancer and hepatocel- AATTCTCCGAACGTGTCACGT -30) were trans- lular carcinoma. In these two cancers, DSCC1 was fected into MCF7 cells. The pcDNA3.1-DSCC1 vector found to be up-expressed in tumor tissues by contrast to was transfected into MDA-MB-231 cells to construct non-tumor tissues, and could facilitate tumor cell pro- DSCC1 overexpression cell line. pcDNA 3.1 empty liferation (Xie et al. 2018, Kim et al. 2019). However, vector was used as the control. All the si-RNAs and the role of DSCC1 in breast carcinoma is still unclear. plasmids were synthesized from Shanghai GeneChem Thus, we initially evaluated the aberrant expression Corporation (Shanghai, China). Transfection process of DSCC1 based on the public database The Cancer was conducted using Lipofectamine 2000 (Invitrogen, Genome Atlas (TCGA) and assessed its prognostic Carlsbad, CA, USA) as per manufacturers’ directions. values. Furthermore, the biological functions of After transfection for 24 h, cells were collected to DSCC1 in breast carcinoma and the possible mecha- measure transfection efficiency and conduct follow-up nisms were identified. The data demonstrate that experiments. Functional role of DSCC1 in breast carcinoma Page 3 of 11 127 2.3 RNA isolation and real-time qPCR (qRT-PCR) and 72h, 10 llcellcountingkit8(CCK8)reagent(Bey- otime) was added to per well and incubated for another Total RNA was isolated with Trizol (Takara Bio, Dalian, 1.5h. Absorbance was recorded at 450 nm wavelength China) following the manufacturer’s description and using Elx800 Reader (Bio-Tek, Winooski, VT, USA). cDNAwas synthesized using PrimeScipteTMRT-PCR Kit (Takara Bio). PCR reactions were conducted by a SYBR Premix Ex Taq Kit (TaKaRa) and an Applied Biosystem 2.6 Clone formation assay 7500 fast detection system (Thermo Fisher Scientific, Carlsbad, USA). DSCC1 expression was normalized to Transfected cells (400 per dish) were plated in 60-mm GAPDH. Primer sequences are shown below: dishes and incubated with complete medium at 37°C. Following 2 weeks, each dish was washed with PBS thrice. 0 DSCC1 F: 5 -CGCTGAGTTTCAAGAAGTGTGG Then, the cells were fixed using 4% paraformaldehyde for 0 C-3 ; 30 min and stained for 20 min using 0.1% crystal violet 0 DSCC1 R: 5 -CCTCAGGTAAATCATCTACTTTC solution. After air-dried, colonies in each dish were man- 0 AG-3 ; ually counted and images were captured. GAPDH F: 50-GTCTCCTCTGACTTCAACAGCG- 30; GAPDH R: 50-ACCACCCTGTTGCTGTAGCC 2.7 Cell invasion and migration assay AA-30. Transwell plates (24-well; Corning Inc., Corning, NY, 2.4 Western blot USA) were used to determine the role of DSCC1 in the invasion and migration of breast carcinoma cells with After transfection for 24 hours, cells were washed with (Migration assay) or without (Invasion assay) Matrigel ice-cold phosphate-buffered saline (PBS) and lysed in coating. For invasion, 19104 transfected cells (0.59104 ice-cold RIPA buffer (Thermo Fisher Scientific), with for migration assay) were incubated in 100 ll serum-free filled protease inhibitor (Sigma, St. Louis, MO, USA) for RPMI-1640 medium in the upper chamber and 500 ll cell lysate preparation. The BCA reagent (Thermo Fisher RPMI-1640 plus 10% FBS were added to the lower Scientific) was used to perform protein quantification of chamber. Upon incubation overnight, the cells that had cell lysate. Equal amounts of 20 lg protein sample were invaded or migrated through the 8-lm pores were washed separated with 10% SDS-PAGE. The proteins on the gels with PBS, fixed by paraformaldehyde and stained using were transferred onto PVDF membranes. After blocking crystal violet dye. Finally, five randomly selected fields with 5% skimmed milk powder for an hour, the blots were were captured and the number was counted. probed with primary antibodies anti-DSCC1 (1:1000, ab254752) (Abcam, Cambridge, MA, USA), anti-p53 (1:1000, AF1162), anti-Cyclin D (1:1000, AF0126), anti- 2.8 Statistics phospho (p)-GSK-3b (Ser9, 1:1000, AF5830), anti-GSK- 3b (1:1000, AG751), anti-p-b-catenin (Ser552, 1:1000, Statistical analysis was performed using GraphPad Prism AF5749), anti-b-catenin (1:1000, AF0066) and GAPDH 6.0 software (San Diegl, CA, USA) and SPSS 22.0 rabbit monoclonal antibody (1:1000, AF1186) (Bey- software (IBM SPSS, Armonk, NY,USA). Double-group otime, Nantong, China) at 4°C overnight. Upon washed was analyzed using unpaired Student’s t-test. Significance in TBST thrice, the samples were subjected to the cor- of multiple-group was analyzed using one-way analysis responding secondary antibodies for an hour. The labeled of variance (ANOVA) followed by post hoc test. All bands were subsequently measured by an enhanced in vitro experiments were performed in triplicate. P value chemiluminescence detection system (Thermo Fisher of 0.05 or less was regarded as statistically significant. Scientific) and quantified by Image J 1.44 software (NIH, Bethesda, MD, USA). 3. Results

2.5 Cell proliferation assay 3.1 DSCC1 was uncovered to be overexpressed and linked to prognosis in breast carcinoma To investigate cell proliferation, transfected MCF7 and MDA-MB-231 cells (0.19104)wereseededina96-well To evaluate DSCC1’s role in breast carcinoma, we plate and grown for 72 hours. At the points of 0h, 24h, 48h, firstly analyzed DSCC1 expression in a dataset derived 127 Page 4 of 11 Guangchao Jin et al. from TCGA database containing 1109 breast carci- Then we explored the prognostic value of DSCC1 in noma samples and 113 adjacent non-tumor tissues. The 1102 breast carcinoma samples from TCGA database data revealed that DSCC1 expression was notably which possess complete clinical information. Kaplan- upregulated in tumor samples in comparison with Meier method revealed that low DSCC1 expression normal samples (p\0.01, figure 1A). Furthermore, we appears a higher probability of a better OS rate com- expanded our investigation to assess the expression of paring to the high DSCC1 expression group (p\0.01, DSCC1 in 2 human breast carcinoma cells by qRT- figure 1C). Cox univariate and multivariate analyses PCR. Consistent with the results from bioinformatics suggested that DSCC1 expression was an independent analysis, DSCC1 expression was observed to be nota- prognosticator for OS of patients suffered from breast bly up-expressed in breast carcinoma cells as contrast carcinoma [p\0.01, hazard ratio (HR) = 1.713, to normal cells (p\0.01, figure 1B). These findings table 1]. Besides, the pathologic-stage (p\0.05, suggested that DSCC1 is upregulated in human breast HR=1.860), pathologic-metastasis (M) (p\0.05, carcinoma cells and may play a role in carcinogenesis. HR=2.400), and age (p\0.01, HR=2.324) were all found to be independent prognosticators for OS. All

Figure 1. DSCC1 expression and survival curve. (A) Relative DSCC1 expression based upon RNA-Seq dataset generated from TCGA research network. (B) Relative mRNA level of DSCC1 was measured in breast carcinoma cell lines MCF7 and MDA-MB-231 and normal cell line MCF-10A by qRT-PCR. **p\0.01, compared with MCF-10A. (C) Overall survival curve was generated by Kaplan-Meier methods according to the expression of DSCC1 in breast carcinoma patients recorded in the TCGA database.

Table 1. Cox univariate and multivariate analysis of clinical risk features in breast carcinoma patients in TCGA cohort

Univariate analysis Multivariate analysis

Variables P value HR 95%CI P value HR 95%CI DSCC1 expression 0.005* 1.675 1.167–2.404 0.004* 1.713 1.184–2.477 (high/low) Pathologic-stage 0.000* 2.652 1.858–3.783 0.032* 1.860 1.056–3.275 (I?II/III?IV) Pathologic-tumor 0.002* 1.840 1.246–2.718 0.897 0.967 0.583–1.604 (T1?T2/T3?T4) Pathologic-metastasis 0.000* 6.704 3.762–11.948 0.010* 2.400 1.235–4.661 (M0/M1) Pathologic-node 0.000* 2.038 1.409–2.946 0.077 1.513 0.957–2.392 (N0/N1?N2?N3) Age 0.000* 2.212 1.546–3.165 0.000* 2.324 1.602–3.372 (\60/C60) Gender (female/male) 0.894 0.875 0.122–6.274

HR: hazard ratio. *p\0.05. Functional role of DSCC1 in breast carcinoma Page 5 of 11 127

Figure 2. Detection of knockdown and overexpression of DSCC1 efficiency. (A-B) After transfected with con, si-con, si- DSCC1#1, and si-DSCC1#2, the expression of DSCC1 was measured by qRT-PCR (A) and Western blot (B) in MCF7 cells. **p\0.01, compared with con or si-con group. (C-D) After transfected with con, pcDNA3.1 empty vector, and pcDNA3.1- DSCC1, the expression of DSCC1 was measured by qRT-PCR (C) and Western blot (D) in MDA-MB-231 cells. **p\0.01, compared with con or si-con group. these results indicated that DSCC1 may be an effective following loss-of-function of DSCC1 test, which rep- biomarker for the diagnosis and prognosis of breast resented as si-DSCC1. The plasmid pcDNA3.1-DSCC1 carcinoma. was transfected into MDA-MB-231 cells to conduct DSCC1 overexpression cell line. The data showed that DSCC1 expression was remarkably elevated after 3.2 Detection of transfection efficiency transfected with pcDNA3.1-DSCC1 by contrast to pcDNA3.1 empty vector, illustrating that MDA-MB- MCF7 and MDA-MB-231 cells were chose to construct 231 cells with over-expressed DSCC1 was successfully DSCC1 knockdown and overexpression-cell lines, constructed (p\0.01, figure 2C and D). respectively, due to their high and low DSCC1 expression. The transfection efficiency was verified by qRT-PCR and Western blot. The si-DSCC1#1 and #2 3.3 DSCC1 facilitated breast carcinoma cell were transfected into MCF7 cells to construct DSCC1 proliferation knockdown cell line. It was shown that the expression of DSCC1 was markedly downregulated after treated To examine the potential role of DSCC1 in breast carci- with si-DSCC1#1 and #2 compared with si-con treat- noma carcinogenesis, we initially performed CCK8 assay ment, suggesting that MCF7 cells with depleted DSCC1 to evaluate the effect of DSCC1 on the cell proliferative were successfully established (p\0.01, figure 2A and ability in breast carcinoma. Data shown in figure 3A B). Since the expression of DSCC1 in si-DSCC1#2 indicated that the optical density (OD) value was signif- group is the lowest, si-DSCC1#2 was selected for the icantly reduced after down-regulation of DSCC1 by 127 Page 6 of 11 Guangchao Jin et al.

Figure 3. Effects of DSCC1 on the cell viability in breast carcinoma. (A-B) Cell proliferation was determined by CCK8 assays after transfection with si-con and si-DSCC1 in MCF7 cells (A), and transfection with pcDNA3.1 empty vector and pcDNA3.1-DSCC1 in MDA-MB-231 cells (B). (C-D) Colony numbers were determined by clone formation assays with different treatments. Representative colonies in dishes were shown on the left, and the right bar chart shows the number of colonies. **p\0.01, compared with si-con or vector group. contrast with si-con group in MCF7 cells (p\0.01). DSCC1 is linked to the proliferation of tumor cells in Oppositely, upregulation of DSCC1 in MDA-MB-231 breast carcinoma. cells led to a notable elevation of the OD value by contrast with that vector control group (p\0.01, figure 2B). Sig- nificant difference occurred after 48h of culture. 3.4 DSCC1 promoted breast carcinoma cell Next, we evaluated the effect of DSCC1 on the invasion and migration growth of breast carcinoma cell using clone formation assay. The cloning images were shown in figure 3C& The effect of DSCC1 on invasiveness and motility 3D. Statistically, knockdown of DSCC1 in MCF1 was examined by Transwell assay. The matrigel- cells reduced more than 50% of colony numbers as coated Transwell assays demonstrated that the number compared with the si-con group (p\0.01, figure 3C). of DSCC1 downregulated MCF7 cells in the bottom On the other hand, enforced expression of DSCC1 led well was remarkably reduced by contrast with control to an obvious increase on the colonies in comparison cells, whereas the number of invaded MDA-MB-231 with control in MDA-MB-231 cells (p\0.01, fig- cells with overexpressed DSCC1 was dramatically ure 3D). The data of these tests illustrated that increased in comparison with vector group (p\0.01, Functional role of DSCC1 in breast carcinoma Page 7 of 11 127

Figure 4. Effects of DSCC1 on the cell invasion and migration in breast carcinoma. (A) Transwell assays were implemented in MCF7 cells after knockdown of DSCC1. (B) Transwell assays were implemented in MDA-MB-231 cells after overexpression of DSCC1. Representative micrographs were shown on the left, and statistical analysis of the number of migrated and invaded cells was presented on the right. **p\0.01, compared with si-con or vector group.

figure 4A and B). Likewise, the matrigel-uncoated carcinoma may be accomplished with multiple path- Transwell assays indicated that knockdown of DSCC1 ways. Thereupon, we analyzed the association between presented a remarkable reduction on the number of these signaling related genes and DSCC1 by Western MCF7 cells as compared with si-con group, while blot. The outcomes showed that after silencing DSCC1, overexpression of DSCC1 enhanced the migratory the protein levels of anti-cancer gene p53 and p-b- capacity of MDA-MB-231 cells by a contrast with catenin were notably elevated, while the levels of vector group (p\0.01, figure 4A and B). Taken p-GSK-3b and b-catenin signaling downstream target together, these observations demonstrated that DSCC1 cyclin D1 were reduced in MCF7 cells (p\0.01, fig- could affect the invasion and migration of human ure 5B). Analysis of signaling molecules further breast carcinoma cells. showed that upregulation of DSCC1 significantly reduced the protein levels of p53 and p-b-catenin, accompanied by an increased expression of cyclin D1 3.5 DSCC1 activated Wnt/b-catenin pathway and p-GSK-3b in MDA-MB-231 cells (p\0.01, fig- and inhibited p53 protein level. ure 5C). These detections suggested that DSCC1 expression activated the Wnt/b-catenin pathway and Finally, we sought to examine the driving mechanisms decreased p53 protein level in breast carcinoma cells. behind the effect of DSCC1 on breast carcinoma cell viability, invasive and migratory abilities. By GSEA using RNA-Seq dataset, we found that p53, cell cycle, 4. Discussion and Wnt pathways related genes were dramatically enriched in the breast carcinoma patients with high Breast carcinoma, as a molecular heterogeneous dis- DSCC1 expression (figure 5A), suggesting that the ease, has been a major clinical obstacle and one of the potential pro-carcinogenic effect of DSCC1 in breast leading causes of cancer-related death worldwide (Kao 127 Page 8 of 11 Guangchao Jin et al.

Figure 5. DSCC1 was correlated with the Wnt/b-catenin pathway and p53. (A) GSEA analysis revealed the pathways involved in the DSCC1 high expression group in TCGA cohort. (B-C) The level of Wnt/b-catenin signaling key proteins and anti-cancer gene p53 in DSCC1 modified MCF7 and MDA-MB-231 cells were detected by Western blot and the quantitative analysis was shown. **p\0.01, compared with si-con or vector group. et al. 2009). Recently, increasing number of molecular and migration and its underlying mechanism, which is markers have been shown to contribute obviously to attempted to identify a new target for the breast carci- the prediction of the therapeutic response in breast noma treatment. carcinoma (Hamilton and Piccart 2000). Thus, this DSCC1 is known as a component of an alternative study set out to explore the expression pattern and clamp loader/unloader Ctf18-DSCC1-Ctf8-replication prognostic value of DSCC1 in breast carcinoma, as factor C (Ctf18-RFC) complex that contributes to DNA well as its role in modulating the proliferation, invasion replication and involves in DNA cohesion (Bermudez Functional role of DSCC1 in breast carcinoma Page 9 of 11 127 et al. 2003; Murakami et al. 2010). It is located at mechanisms. Using GSEA based on the public dataset chromosomal region 8q24. Multiple pro-tumor genes from TCGA of breast carcinoma samples, high DSCC1 located on this region has been demonstrated to exert expression was found to be positively correlated with import effect on the development of a considerable p53, cell cycle, and Wnt pathways. Thereupon, rela- proportion of primary breast carcinomas, especially tionships between these signaling related markers and those with aggressive histology (Yokota et al. 1999). It DSCC1 expression was detected by Western blot. P53 was reported that DSCC1 is frequently upregulated in is known as an inhibitory factor in tumors that regulates colorectal cancer cells (Yamaguchi et al. 2014). the cell cycle and proliferation in breast carcinoma Moreover, DSCC1 was also found to be amplified in (Allred et al. 1993; Friedrichs et al. 1993). This seems hepatocellular carcinoma tissues in comparison with to indicate that the expression of DSCC1 and p53 non-tumor tissues (Xie et al. 2018). Similar to these should be in an inverse relationship in breast carci- results, using bioinformatics tools and qRT-PCR anal- noma, which is indeed obtained by our experiments. ysis, DSCC1 was also observed to be highly expressed The Wnt signaling pathway is highly conserved in in breast carcinoma tissues and cells on the basis of the different species and controls cell fate (Moon 2005, public database and cell lines, respectively. Noticeably, Turashvili et al. 2006). Numerous studies have shown bioinformatics analysis illustrated that the high DSCC1 that it is often disordered in many diseases, including expression resulted in a worse prognosis, and it can be cancer (Heo et al. 2013). Additionally, the Wnt/b- regarded as an independent predictor for OS of breast catenin pathway also presented important role in breast carcinoma patients. This is consistent with the findings carcinoma (Krishnamurthy and Kurzrock 2018; Yang of DSCC1 in hepatocellular carcinoma, as it is reported et al. 2020). It consists of several key components, that DSCC1 is an independent prognosticator for including GSK-3b and b-catenin. b-catenin is a key patients and linked to bad prognosis (Xie et al. 2018). downstream molecular of the Wnt pathway and is one QRT-PCR and immunohistochemical analysis verified of the key proteins for breast carcinoma recurrence and that DSCC1 expression was increased in 60–70% of metastasis (Wang et al. 2016). GSK-3b is an important colon tumors by contrast with non-cancerous colonic component of b-catenin degradation complex and its mucosa (Yamaguchi, Yamaguchi et al. 2014). DSCC1 phosphorylation inactivates the b-catenin degradation was clarified as a putative hepatocellular carcinoma complex in tumor cells (Rubinfeld et al. 1996). driver factor that facilitates the proliferation of cells Besides, Cyclin D1 is an important downstream target (Xie et al. 2018). To examine the functional role of molecule of the Wnt/b-catenin pathway, which is DSCC1 in breast carcinoma, we implemented gain- tightly linked to b-catenin. We analyzed the protein and loss-of-function of DSCC1 assays by using MDA- level of these signaling related genes and found that MB-231 and MCF7 cells respectively. Our functional DSCC1 showed a positive correlation with p-GSK-3b, experiments demonstrated that DSCC1 could enhance b-catenin and cyclin D1 and a negatively correlation the cell viability, invasiveness and motility in breast with p-b-catenin. These data demonstrate that DSCC1 carcinoma, which is in agreement with the mentioned- activated the Wnt/b-catenin pathway and inhibited p53 above results. Additionally, based upon phenotype level, and then facilitating the progression in breast kinetics, DSCC1 was found to be a promising bio- carcinoma. However, the Wnt/b-catenin pathway target for neuroblastoma treatment (Batra et al. 2012). implicates multiple molecules, the specific mechanism All these detections indicate that DSCC1 plays a by which DSCC1 affects the Wnt/b-catenin pathway tumor-promoting role in the occurrence/development in remains to be further studied. breast carcinoma and may be a novel biomarker for All in all, this report revealed that DSCC1 is breast carcinoma therapeutic intervention. upregulated in breast carcinoma, and its high expres- DSCC1 is linked to DNA replication and sister sion resulted in a poor prognosis. Besides, the chromatid cohesion, with an important role during S expression of DSCC1 can be considered as an inde- phase of the cell cycle (Bermudez et al. 2003; Merkle pendent prognosticator for patients with breast carci- et al. 2003). The establishment of sister chromatids noma. Furthermore, with gene transfection technology, during the S phase is an important step in the chain of functional experiments demonstrated that DSCC1 events that leads to high-fidelity cell division. In could enhance breast cancer cell viability, invasiveness addition, DSCC1 was identified to be a vital gene in and motility in vitro possibly by activating the Wnt/b- mitosis and directly involved in cell cycle (Batra et al. catenin pathway and affecting p53 expression. All 2012). Moreover, consideration of its proliferative these data suggest that DSCC1 may be a considerable effect in cancers, we sought to examine the underlying biomarker for treatment of breast carcinoma, and 127 Page 10 of 11 Guangchao Jin et al. provide a solid scientific foundation for the further Heo SH, Jeong ES, Lee KS, Seo JH, Jeong DG, Won YS, study into targeting DSCC1 in breast carcinoma. Kwon HJ, Kim HC, Kim DY and Choi YK 2013 Canonical Wnt signaling pathway plays an essential role in N-methyl-N-nitrosurea induced gastric tumorigenesis Acknowledgements of mice. J Vet Med Sci 75 299–307 Hong D, Fritz AJ, Zaidi SK, Wijnen AJ, Nickerson JA, We thank for the support of Jinan Central Hospital Imbalzano AN, Lian JB, Stein JL and Stein GS 2018 Affiliated to Shandong First Medical University for this Epithelial-to-mesenchymal transition and cancer stem study. cells contribute to breast cancer heterogeneity. J. Cell. Physiol. 233 9136–9144 Kao J, Salari K, Bocanegra M, Choi YL, Girard L, Gandhi J, References Kwei KA, Hernandez-Boussard T, Wang P, Gazdar AF, Minna JD and Pollack JR 2009 Molecular profiling of Allred DC, Clark GM, Elledge R, Fuqua SA, Brown RW, breast cancer cell lines defines relevant tumor models and Chamness GC, Osborne CK and McGuire WL 1993 provides a resource for cancer gene discovery. PLoS One Association of p53 protein expression with tumor cell 4 e6146 proliferation rate and clinical outcome in node-negative Kim J and MacNeill SA 2003 Genome stability: a new breast cancer. J. Natl. Cancer Inst. 85 200–206 member of the RFC family. Curr. Biol. 13 R873–875 Batra R, Harder N, Gogolin S, Diessl N, Soons Z, Jager- Kim JT, Cho HJ, Park SY, Oh BM, Hwang YS, Baek KE, Schmidt C, Lawerenz C, Eils R, Rohr K, Westermann F Lee YH, Kim HC and Lee HG 2019 DNA replication and and Konig R 2012 Time-lapse imaging of neuroblastoma sister chromatid cohesion 1 (DSCC1) of the replication cells to determine cell fate upon gene knockdown. PLoS factor complex CTF18-RFC is critical for colon cancer One 7 e50988 cell growth. J. Cancer 10 6142–6153 Bermudez VP, Maniwa Y, Tappin I, Ozato K, Yokomori K Krishnamurthy N and Kurzrock R 2018 Targeting the and Hurwitz J 2003 The alternative Ctf18-Dcc1-Ctf8- Wnt/beta-catenin pathway in cancer: Update on effectors replication factor C complex required for sister chromatid and inhibitors. Cancer Treat. Rev. 62 50–60 cohesion loads proliferating cell nuclear antigen onto Kubota T, Hiraga S, Yamada K, Lamond AI and Donaldson DNA. Proc. Natl. Acad. Sci. USA 100 10237–10242 AD 2011 Quantitative proteomic analysis of chromatin Boehm EM, Gildenberg MS and Washington MT 2016 The reveals that Ctf18 acts in the DNA replication checkpoint. many roles of PCNA in eukaryotic DNA replication. Mol. Cell Proteomics 10 M110.005561 Enzymes 39 231–254 Majka J and Burgers PM 2004 The PCNA-RFC families of Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA and DNA clamps and clamp loaders. Prog. Nucleic Acid Res. Jemal A 2018 Global cancer statistics 2018: GLOBO- Mol. Biol. 78 227–260 CAN estimates of incidence and mortality worldwide for Mayer ML, Gygi SP, Aebersold R and Hieter P 2001 36 cancers in 185 countries. CA Cancer J. Clin. 68 Identification of RFC(Ctf18p, Ctf8p, Dcc1p): an alterna- 394–424 tive RFC complex required for sister chromatid cohesion Crabbe L, Thomas A, Pantesco V, De Vos J, Pasero P and in S. cerevisiae. Mol. Cell 7 959–970 Lengronne A 2010 Analysis of replication profiles reveals Merkle CJ, Karnitz LM, Henry-Sanchez JT and Chen J 2003 key role of RFC-Ctf18 in yeast replication stress response. Cloning and characterization of hCTF18, hCTF8, and Nat. Struct. Mol. Biol. 17 1391–1397 hDCC1. Human homologs of a Saccharomyces cerevisiae Friedrichs K, Gluba S, Eidtmann H and Jonat W 1993 complex involved in sister chromatid cohesion establish- Overexpression of p53 and prognosis in breast cancer. ment. J. Biol. Chem. 278 30051–30056 Cancer 72 3641–3647 Moon RT 2005 Wnt/beta-catenin pathway. Sci STKE 2005 Grabarczyk DB, Silkenat S and Kisker C 2018 Structural cm1 basis for the recruitment of Ctf18-RFC to the replisome. Murakami T, Takano R, Takeo S, Taniguchi R, Ogawa K, Structure 26 137–144 Ohashi E and Tsurimoto T 2010 Stable interaction Hamilton A and Piccart M 2000 The contribution of between the human proliferating cell nuclear antigen molecular markers to the prediction of response in the loader complex Ctf18-replication factor C (RFC) and treatment of breast cancer: a review of the literature on DNA polymerase {epsilon} is mediated by the cohesion- HER-2, p53 and BCL-2. Ann. Oncol. 11 647–663 specific subunits, Ctf18, Dcc1, and Ctf8. J. Biol. Chem. Hatami R, Ohlseen J, Izadmehr S, Sieuwerts AM and Narla 285 34608–34615 G 2012 Abstract 5314: An oncogenic splice variant of the Pellegrini L 2018 Dual roles of Ctf18-RFC: Loading the KLF6 tumor suppressor gene is associated with poor clamp and angling for the polymerase. Structure 26 1–2 survival and is a potent driver of breast cancer metastasis. Rubinfeld B, Albert I, Porfiri E, Fiol C, Munemitsu S and Cancer Res. 72 5314–5314 Polakis P 1996 Binding of GSK3beta to the APC-beta- Functional role of DSCC1 in breast carcinoma Page 11 of 11 127 catenin complex and regulation of complex assembly. transitioning Chinese population: current and future Science 272 1023–1026 trends. Brit. J. Cancer 112 167–170 Sledge GW, Mamounas EP, Hortobagyi GN, Burstein HJ, Xie XW, Wang XY, Liao WJ, Fei R, Cong X, Chen Q, Wei Goodwin PJ and Wolff AC 2014 Past, present, and future L, Chen HS and Wang Y 2018 Effect of upregulated DNA challenges in breast cancer treatment. J. Clin. Oncol. 32 replication and sister chromatid cohesion 1 expression on 1979–1986 proliferation and prognosis in hepatocellular carcinoma. Turashvili G, Bouchal J, Burkadze G and Kolar Z 2006 Wnt Chin. Med. J. 131 2827–2835 signaling pathway in mammary gland development and Yamaguchi K, Yamaguchi R, Takahashi N, Ikenoue T, carcinogenesis. Pathobiology 73 213–223 Fujii T, Shinozaki M, Tsurita G, Hata K, Niida A, Turner NC, Neven P, Loibl S and Andre F 2017 Advances in Imoto S, Miyano S, Nakamura Y and Furukawa Y 2014 the treatment of advanced oestrogen-receptor-positive Overexpression of cohesion establishment factor breast cancer. Lancet 389 2403–2414 DSCC1 through E2F in colorectal cancer. PLoS One Wade BO, Liu HW, Samora CP, Uhlmann F and Singleton 9 e85750 MR 2017 Structural studies of RFC(C)(tf18) reveal a Yang W, Cui G, Ding M, Yang M and Dai D 2020 novel chromatin recruitment role for Dcc1. EMBO Rep. MicroRNA-124-3p.1 promotes cell proliferation through 18 558–568 Axin1-dependent Wnt signaling pathway and predicts a Wang Z, Li B, Zhou L, Yu S, Su Z, Song J, Sun Q, Sha O, poor prognosis of triple-negative breast cancer. J. Clin. Wang X, Jiang W, Willert K, Wei L, Carson DA and Lu D Lab. Anal. 34 e23266 2016 Prodigiosin inhibits Wnt/beta-catenin signaling and Yokota T, Yoshimoto M, Akiyama F, Sakamoto G, Kasumi exerts anticancer activity in breast cancer cells. Proc. F, Nakamura Y and Emi M 1999 Frequent multiplication Natl. Acad. Sci. USA 113 13150–13155 of chromosomal region 8q24.1 associated with aggres- Wong IOL, Schooling CM, Cowling BJ and Leung GM sive histologic types of breast cancers. Cancer Lett. 139 2015 Breast cancer incidence and mortality in a 7–13

Corresponding editor: BJ RAO