Induced T Lymphocyte Role of Regulator of G Protein Signaling 16 In

Role of Regulator of G Protein Signaling 16 in Inflammation- Induced T Lymphocyte Migration and Activation

This information is current as Eric Lippert, David L. Yowe, Jose-Angel Gonzalo, J. Paul of September 25, 2021. Justice, Jeremy M. Webster, Eric R. Fedyk, Martin Hodge, Cheryl Miller, Jose-Carlos Gutierrez-Ramos, Francisco Borrego, Andrea Keane-Myers and Kirk M. Druey J Immunol 2003; 171:1542-1555; ; doi: 10.4049/jimmunol.171.3.1542 http://www.jimmunol.org/content/171/3/1542 Downloaded from

References This article cites 60 articles, 30 of which you can access for free at:

http://www.jimmunol.org/content/171/3/1542.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 25, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2003 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Role of Regulator of G Protein Signaling 16 in Inﬂammation- Induced T Lymphocyte Migration and Activation

Eric Lippert,* David L. Yowe,§ Jose-Angel Gonzalo,§ J. Paul Justice,‡ Jeremy M. Webster,§ Eric R. Fedyk,§ Martin Hodge,§ Cheryl Miller,§ Jose-Carlos Gutierrez-Ramos,§ Francisco Borrego,† Andrea Keane-Myers,‡ and Kirk M. Druey1*

Chemokine-induced T lymphocyte recruitment to the lung is critical for allergic inflammation, but chemokine signaling pathways are incompletely understood. Regulator of G protein signaling (RGS)16, a GTPase accelerator (GTPase-activating protein) for G␣ subunits, attenuates signaling by chemokine receptors in T lymphocytes, suggesting a role in the regulation of lymphocyte trafficking. To explore the role of RGS16 in T lymphocyte-dependent immune responses in a whole-organism model, we generated transgenic (Tg) mice expressing RGS16 in CD4؉ and CD8؉ cells. rgs16 Tg T lymphocytes migrated to CC chemokine ligand 21 or CC chemokine ligand 12 injection sites in the peritoneum, but not to CXC chemokine ligand 12. In a Th2-dependent model of Downloaded from allergic pulmonary inflammation, CD4؉ lymphocytes bearing CCR3, CCR5, and CXCR4 trafficked in reduced numbers to the lung after acute inhalation challenge with allergen (OVA). In contrast, spleens of sensitized and challenged Tg mice contained increased numbers of CD4؉CCR3؉ cells producing more Th2-type cytokines (IL-4, IL-5, and IL-13), which were associated with increased airway hyperreactivity. Migration of Tg lymphocytes to the lung parenchyma after adoptive transfer was significantly reduced compared with wild-type lymphocytes. Naive lymphocytes displayed normal CCR3 and CXCR4 expression and cytokine http://www.jimmunol.org/ responses, and compartmentation in secondary lymphoid organs was normal without allergen challenge. These results suggest that RGS16 may regulate T lymphocyte activation in response to inflammatory stimuli and migration induced by CXCR4, CCR3, and CCR5, but not CCR2 or CCR7. The Journal of Immunology, 2003, 171: 1542–1555.

hemokines orchestrate coordinated movement of T lym- (16), transendothelial migration of lymphocytes into lymph nodes phocytes through lymphoid organs and promote their mi- (1, 17), and Ag-induced recruitment of lymphocytes to the lung gration to sites of inﬂammation. Distinct patterns of che- (18) are blocked by pertussis toxin (PTX),2 which inactivates G␣ / C i ␣ ␣ mokine receptors are expressed in naive and activated T cell G o proteins. Consistent with a role for G i signaling in T cell

␣ by guest on September 25, 2021 populations, and gene-targeting experiments have implicated a role activation, G i2-deficient T lymphocytes produce higher levels of for specific chemokines and their receptors in T cell activation, proinflammatory cytokines in the gut, which is associated with differentiation into Th1 or Th2 subtypes, and inflammatory re- inflammatory colitis (19, 20). Whether this abnormality is related ␣ sponses mediated by either of these subpopulations (1–5). Asthma directly to G i function in T lymphocytes is unknown. is a Th2-mediated disease in which CD4ϩ lymphocytes migrate to Recently, endogenous molecules poised to regulate chemokine the lung parenchyma upon allergen exposure and secrete proin- responses have been described: the regulator of G protein signaling flammatory cytokines (IL-4, -5, and -13), which leads to recruit- (RGS) proteins, which are GTPase-activating proteins (GAPs) for ␣ ␣ ment and activation of eosinophils and mast cells and subsequent G i and G q subunits of heterotrimeric G proteins (21, 22). RGS lung inflammation and injury (4–7). In murine asthma models, GAP activity is predicted to attenuate G-protein-coupled receptor Th2 migration to the lung may be dependent on, among others, (GPCR) responses including chemotaxis, and RGS overexpression CCR3, CCR4, CCR5, CCR6, CCR8, and CXCR4 (8–13). inhibits chemotactic and proadhesive responses in lymphocyte cell The signaling pathways that mediate chemokine-induced traf- lines in vitro (23, 24). T lymphocytes express several RGS pro- ficking are not well understood. Although chemokine receptors teins, including RGS2 (25), RGS3 (26), RGS4 (27), RGS14 (28), ␣ ␣ couple to G i and G q, chemotaxis is not evoked by receptors and RGS16 (29, 30). rgs16 mRNA is increased in T cells after IL-2 ␣ coupled exclusively to G q (14). However, despite the necessity stimulation, whereas rgs2 mRNA is down-regulated by IL-2 (29). ␣ ␣ foraGi-coupled receptor, G i activation is not required for che- Deficiency of RGS2, which, like RGS16, modulates G i (31) and ␤␥ ␣ motaxis, suggesting that G may initiate the cascade that induces G q (32) pathways, results in impaired T lymphocyte proliferation directed cell migration (14, 15). Nonetheless, thymic emigration and IL-2 production in response to TCR or PMA stimulation (33). rgs2Ϫ/Ϫ mice also exhibit delayed and reduced responses to lym- *Molecular Signal Transduction Section, †Receptor Cell Biology Section, and ‡Al- phocytic choriomeningitis virus infection, which is a model of lergic Inflammation Section, Laboratory of Allergic Diseases, National Institute of Th1-dependent inflammation. Allergy and Infectious Diseases, National Institutes of Health, Rockville, MD 20852; and §Millennium Pharmaceuticals, Cambridge, MA 02139 Received for publication December 20, 2002. Accepted for publication May 27, 2003. 2 Abbreviations used in this paper: PTX, pertussis toxin; RGS, regulator of G protein The costs of publication of this article were defrayed in part by the payment of page signaling; GAP, GTPase-activating protein; GPCR, G-protein-coupled receptor; charges. This article must therefore be hereby marked advertisement in accordance AHR, airway hyperreactivity; RT-QPCR, reverse transcriptase-quantitative PCR; C , with 18 U.S.C. Section 1734 solely to indicate this fact. T threshold cycle; ORF, open reading frame; MAP, mitogen-activated protein; HA, 1 Address correspondence and reprint requests to Dr. Kirk M. Druey, Molecular Sig- hemagglutinin; CCL, CC chemokine ligand; CXCL, CXC chemokine ligand; PE- nal Transduction Section, Laboratory of Allergic Diseases, National Institute of Al- CAM, platelet endothelial cell adhesion molecule; BAL, bronchoalveolar lavage; lergy and Infectious Diseases, National Institutes of Health, 12441 Parklawn Drive, BALF, BAL fluid; rag, recombinase-activating gene; AC, adenylyl cyclase; WT, wild Rockville, MD 20852. E-mail address: [email protected] type; Tg, transgenic.

␣ Although RGS16 and RGS2 display similar GAP activity in ford, IL). Antiserum against G i2 (AS/7) was the kind gift of A. Spiegel vitro, it is unclear whether RGS16 plays an equivalent immuno- (National Institute of Diabetes and Digestive and Kidney Diseases, Na- regulatory role in T cells. Few in vivo models of RGS biology tional Institutes of Health). exist, and a primary physiological function has been established only for one RGS protein, RGS9-1, which regulates phototrans- Generation of rgs16 Tg mice and genotyping duction in the retina (34). To explore the role of RGS16 in T A SalI/XhoI fragment of the murine rgs16 cDNA was inserted into a Tg cell-mediated immune responses, we generated transgenic (Tg) expression vector containing the murine CD4 enhancer and promoter lack- mice expressing RGS16 in CD4ϩ and CD8ϩ lymphocytes. Al- ing the CD8 silencer (p37.1; the kind gift of D. Littman (New York Uni- versity School of Medicine, New York, NY) (37). Tg mice were generated though lymphocyte distribution in thymus and lymphoid organs in by pronuclear injection of linearized plasmid into FVB (Taconic Farms, the absence of inflammation was normal in Tg mice, T lympho- Germantown, NY) or BALB/cByJ (The Jackson Laboratory, Bar Harbor, cytes migrated aberrantly to a site of i.p. injection of select che- ME) oocytes using standard protocols. Transgene-carrying mice were iden- mokines. In addition, while Th2 recruitment to the lung in re- tified by Southern blotting of genomic DNA purified from mouse tails sponse to allergen challenge was impaired, rgs16 Tg T cells using a SalI/EcoRI fragment of the rgs16 cDNA (covering the first 300 bp of the rgs16 open reading frame (ORF), which is highly specific to rgs16 displayed an enhanced activation phenotype, including increased as opposed to other RGS family members) or by PCR using the following proliferation and cytokine production, which correlated with in- primers specific for the transgene: Tg16-1, GGGTTTTGGGTCGACCCA creased serum eotaxin levels and airway hyperreactivity (AHR). CGCGTCCGCCACGAC; and Tg16-2, TTCCCACCCTCGAGTCCAC These results suggest that RGS16 modulates T cell activation and CTCTCTTCCCGATGGC. The following primers specific for endogenous rgs16 were used as a control for the PCR: En16-1, GAAGCTTCTCA migration to an inflammatory stimulus in vivo by regulating sig- GAAGATGTAC; and En16-2, ACCTCTTTAGGGGCTTCGC. Double Tg naling through specific chemokine receptors. mice were obtained by crossing rgs16 Tgs with mice carrying the transgene Downloaded from for the DO11.10 TCR ␣␤, which recognizes residues 323–339 of chicken OVA in association with 1-Ad (Taconic Farms). All research involving the Materials and Methods use of mice was performed in accordance with protocols approved by Mil- RGS16 expression analysis and Abs lennium Pharmaceuticals and/or the National Institutes of Health Institu- tional Animal Care and Use Committees. Male or female mice (6–20 wk Th1 and Th2 cells were differentiated as described elsewhere (35). In brief, of age) were used for all experiments. human peripheral blood CD4ϩCD45RAϩ cells were cultured in plates con- For Northern blotting, total RNA was isolated using the RNeasy kit http://www.jimmunol.org/ taining immobilized anti-CD3 (10 ␮g/ml), JY cells, and exogenous cyto- (Qiagen, Valencia, CA), and 20 ␮g per sample was fractionated on a 1% kines. For Th1 cells, cultures were grown in the presence of IL-1␤ (5 formaldehyde denaturing gel. RNA was transferred to nitrocellulose and ng/ml), IL-6 (5 ng/ml), IL-12 (20 ng/ml), and anti-IL-4 (5 ␮g/ml). Th2 hybridized with the aforementioned rgs16-specific probe at 60°C using cells were differentiated by culturing T cells in the presence of IL-1␤ (5 Rapid-Hyb buffer (Amersham Pharmacia Biotech, Piscataway, NJ). ng/ml), IL-6 (5 ng/ml), IL-4 (20 ng/ml), and anti-IL-12 (5 ␮g/ml). At weekly intervals, cultures were centrifuged in Ficoll-Hypaque (Amersham Biosciences, Piscataway, NJ) to remove dead accessory cells and subse- Mitogen-activated protein (MAP) kinase assays and quently cultured with the above cytokines and Abs. Activated Th1 and Th2 measurement of adenylyl cyclase (AC) activity cells were maintained in this manner for three cycles and then reactivated using the cytokine combinations described above for the desired period of These assays were conducted exactly as described previously (38). Abs against p-Erk, hemagglutinin (HA), and Erk1 were purchased from Santa time. ELISA (Endogen, Woburn, MA; R&D Systems, Minneapolis, MN) by guest on September 25, 2021 was used to quantitate cytokine (IFN-␥, IL-5, and IL-13) production by Cruz Biotechnology (Santa Cruz, CA). Jurkat cells were transfected with Th1 and Th2 cultures. either pcDNA3 or pcDNA3-HA-RGS16 (29) using Superfect (Qiagen), Real-time reverse transcriptase-quantitative PCR (RT-QPCR) was per- and stable transfectants were selected with G418. formed using the TaqMan strategy (PerkinElmer, Wellesley, MA). Total RNA was isolated using RNA STAT-60 (Tel-Test, Friendswood, TX), In situ hybridization DNase I treatment, and phenol extraction. cDNA was synthesized from 5 ␮g of total RNA using the Superscript kit and oligo(dT) (Life Technolo- Frozen 6-␮m sections of normal and Tg mouse lymph nodes, spleens, and gies, Rockville, MD). A no-amplification control containing RNA without thymuses were fixed in 4% paraformaldehyde, washed in PBS, acetylated reverse transcriptase was prepared to ensure the DNase I treatment was in 0.1 M triethanolamine-HCl and 0.25% acetic anhydride (Sigma-Aldrich, complete. No-tissue controls that contained buffer and enzyme only were St. Louis, MO) for 10 min, washed in 2ϫ SSC, dehydrated with ethanol, 35 also included. The expression level of rgs16 and the internal reference and air dried. Slides were hybridized overnight at 55°C with S-labeled ␤ human agmatinase riboprobes at 2.5 ϫ 106 cpm/slide. Slides were subse- 2-microglobulin were measured by multiplex PCR using probes labeled with FAM or VIC (PerkinElmer), respectively. The primers (forward, TT quently washed and dipped in photographic emulsion (Kodak, Rochester, TGCCTGTTGCTCAGTTGACT, and reverse, CCCTTCCGTGCCCA NY) and exposed for 6 wk at 4°C before autoradiography. Slides were then GAA) and FAM probe (TGATTGCATCCTGTTTTCCTAATTCCCAGA) counterstained with H&E to assess histology. The following primers were were designed using Primer Express software (PerkinElmer). The simul- used to generate the rgs16 riboprobe: T3, AATTAACCCTCACTAAA ␤ GGGTGGGCCAGTAAGCATAACAAA, and T7, TAATACGACTCAC taneous measurement of rgs16-FAM and 2-microglobulin-VIC allowed for normalization of the amount of cDNA added per sample. Duplicate TATAGGGTCAATGTGCGGGTCTTCC. The platelet endothelial cell ad- PCRs were performed using the TaqMan Universal PCR Master Mix and hesion molecule (PECAM) probe consisted of a PCR fragment comprising the ABI PRISM 7700 sequence detection system (PerkinElmer) using the nt 1246–1983 (GenBank accession number M37780). following thermal cycle routine: 50°C for 2 min, 95°C for 10 min, and then 40 cycles of 95°C for 15 s, followed by 60°C for 1 min. A comparative In vivo chemotaxis assays threshold cycle (CT) method (User Bulletin no. 2; PerkinElmer) was used to determine gene expression relative to the no-tissue control (calibrator). Peritoneal recruitment assays were performed as previously described (39). Hence, steady-state mRNA levels were expressed as an n-fold difference Briefly, mice were injected i.p. with CXC chemokine ligand (CXCL)12 or ␮ ␮ relative to the calibrator. For each sample, the rgs16 CT value was nor- CC chemokine ligand (CCL)12 (R&D Systems) (200 lofa5 g/ml ⌬ ϭ Ϫ malized using the following formula: CT CT RGS16 CT ␤2-microglobulin. solution) or PBS. At different time points after injection, peritoneal leuko- To determine relative expression levels, we used the following formula: cytes were collected by lavage and enumerated. To determine the percent- ⌬⌬ ϭ⌬ Ϫ⌬ ϫ 5 CT CT sample CT calibrator, and the value used to graph relative age of each leukocyte subtype, we pelleted cells (5 10 ) onto glass slides rgs16 expression was calculated using the following formula: 2Ϫ⌬⌬CT. by cytocentrifugation and stained with Wright-Giemsa. The number of For immunoblotting, cells were lysed in radioimmunoprecipitation anal- each leukocyte subtype was counted in eight high-power fields (magnifi- ysis buffer, subjected to SDS-PAGE (12% Tris-glycine gels), and trans- cation, ϫ40; total area, 0.5 mm2) per area and divided by the total number ferred to polyvinylidene difluoride membranes. RGS16 was detected using of cells per high-power field. To obtain the absolute number of each leukocyte

polyclonal antiserum raised against His6RGS16, purified by protein A af- subtype in lavage, these percentages were multiplied by the total number of finity chromatography, or with an anti-RGS16 antiserum that has been cells recovered from the peritoneal fluid. Immunophenotyping of migrated described previously (CT265) (36). Signal was revealed using goat anti- cells was determined by flow cytometry using fluorochrome-conjugated anti- rabbit IgG-HRP and ECL according to standard methods (Pierce, Rock- CD4, -CD8, and -CXCR4 (BD PharMingen, San Diego, CA). 1544 RGS16 REGULATES T LYMPHOCYTE FUNCTION

OVA sensitization and challenge and measurement of AHR acterize rgs16 expression in T cells, we performed quantitative ␮ PCR analysis of RNA isolated from human peripheral blood Mice were sensitized by an i.p. injection of 100 g of OVA (Sigma- ϩ Aldrich) in 200 ␮l of 50% Imject Alum (Pierce). After 7–10 days, mice CD4 T cells polarized ex vivo to either a Th1 or Th2 phenotype were subjected to a 30-min nebulization of 1% OVA in PBS daily for three and restimulated with cytokines for various time periods. In both consecutive days. Seventy-two hours after the last challenge, airway resis- CD4ϩ subpopulations, rgs16 RNA was detected at low levels in tance was evaluated using an intubated plethysmography system (Flex- resting cells but was rapidly induced as early as 1 h after stim- ivent; SCIREQ, Montreal, Quebec, Canada). Bronchoalveolar lavage (BAL) was performed by injecting 500 ␮l of PBS containing 1% BSA, and ulation (Fig. 1A). To determine whether murine RGS16 protein a 50-␮l aliquot was removed and subjected to cytocentrifugation for cell displayed a similar pattern of expression, we stimulated freshly quantitation. After centrifugation at 500 ϫ g, supernatants were stored at isolated mouse splenocytes with anti-CD3 for various time pe- Ϫ 80°C for measurement of cytokines. riods and immunoblotted cell extracts with anti-RGS16. We did Immunophenotyping not detect RGS16 in unstimulated T cells, but identified the Lungs from sensitized and challenged mice were dissected en bloc and appropriately sized band (23 kDa) beginning 2 h after TCR ground into single-cell suspensions using a Medimachine (BD Biosciences, stimulation, which was still detectable 24 h after receptor cross- Mountain View, CA) according to the manufacturer’s instructions. Spleno- linking (Fig. 1B). cyte suspensions were generated using standard methods. T lymphocytes To determine whether RGS16 regulated chemokine signaling were negatively selected by labeling spleen or lung cells at 4°C with a mixture of Abs in PBS/1% FCS, followed by incubation with biotinylated pathways, we first measured MAP kinase activation induced by secondary Abs coupled to magnetic beads and magnetic sorting using an stimulation of endogenous CXCR4 receptors in Jurkat T cells sta- auto-MACS machine (pan T cell isolation kit; Miltenyi Biotec, Auburn, bly expressing RGS16. Activation of endogenous Erk by CXCL12 CA). T lymphocyte-enriched populations were then fixed in 4% parafor- was significantly reduced in RGS16-expressing cells (Fig. 1C). To Downloaded from Ϫ maldehyde (Sigma-Aldrich) and frozen at 80°C until use. Fixed cells confirm the ability of RGS16 to modulate CXCR4-mediated sig- were stained with FITC-conjugated CD4 or CD8, and biotinylated anti- ␣ CCR5 followed by PE-conjugated streptavidin (BD PharMingen) or with naling, we examined inhibition of AC by CXCL12, a G i-depen- PE-conjugated anti-CCR3 (R&D Systems) and analyzed for cell surface dent response. Because decreases in baseline AC activity are dif- marker expression using a FACSCalibur flow cytometer and CellQuest ficult to detect, we stimulated cells with forskolin, a direct software (BD Biosciences). activator of this enzyme, in the presence or absence of CXCL12, Measurement of cytokines and measured inhibition of the forskolin response in vector- or http://www.jimmunol.org/ For ELISPOT analysis, multiscreen Immobilon P sterile plates (Millipore, RGS16-transfected cells. In control transfectants, we observed a Bedford, MA) were coated overnight with a dilution of capture anti-IL-2 ϳ60% inhibition of forskolin-stimulated AC activation by (1/167), IL-4 (1/250), or IL-5 (1/100) in PBS. All Ab pairs were from CXCL12, whereas in RGS16 transfectants, the response was in- OptiEIA sets (BD PharMingen). After three washes with PBS, plates were Ͻ hibited 40% (Fig. 1D). These results indicate that Gi-coupled saturated by a 90-min incubation in PBS containing 1% BSA (PBS-B) at MAP kinase activation and AC inhibition evoked by CXCR4 stim- room temperature followed by three more washes in PBS. Splenocytes (5 ϫ 105) were then added either in medium alone (AIM V; Life Tech- ulation are blunted in T cells overexpressing RGS16. nologies), in medium containing Con A (2.5 ␮g/ml; Sigma-Aldrich) as a positive control or in medium plus OVA at 2 or 20 ␮g/ml. After a 48-h by guest on September 25, 2021 (IL-2) or 72-h (IL-4 and IL-5) incubation at 37°C, plates were washed three Generation of rgs16 T cell Tg mice times with PBS and four times with PBS containing 0.025% Tween 20 (PBS-T). Secondary biotinylated Ab was then added (all Abs were diluted Because of its expression in activated T lymphocytes and regula- 1/250 in PBS containing 1% BSA and 0.025% Tween 20 (PBS-BT)). The tion of chemokine signaling, we hypothesized that RGS16 could plates were incubated overnight at 4°C, washed three times in PBS-T, and incubated for 90 min at room temperature with a 1/250 dilution of HRP- play a role in T cell migration and activation in vivo. To explore streptavidin in PBS-BT. After four more washes in PBS, peroxidase ac- this hypothesis in a whole organism model, we generated rgs16 Tg tivity was revealed by 3-amino 9-ethyl-carbazol in the presence of H2O2. mice in which rgs16 transcription is driven by the CD4 enhancer/ The reaction was stopped with distilled water. The plates were dried and an- promoter lacking the CD8 intronic silencer, allowing expression in alyzed on a Zeiss microscope using KS-ELISPOT software. Cytokines in se- CD4ϩ and CD8ϩ lymphocytes, but not in B cells, macrophages, rum or splenocyte supernatants were quantitated by OptiEIA or Quantikine ELISA kits (R&D Systems) or from BAL fluid (BALF) using mouse Th1/Th2 NK cells, or monocytes (Fig. 2A) (37). Southern blotting con- CBA kits (BD Biosciences) according to the manufacturer’s instructions. firmed the presence of the transgene (Fig. 2B). Consistent with T Adoptive lymphocyte transfer lineage expression, we observed the Tg RNA species in thymus, spleen, and lymph nodes from Tg, but not WT mice (Fig. 2C). To Donor mice (rgs16 Tg or wild-type (WT) littermates) and recipient mice Ϫ/Ϫ examine RGS16 protein expression in Tg T lymphocytes, we (gender-matched BALB/c or recombinase-activating gene (rag)2 ϩ ϩ Ϫ Ϫ BALB/c; Taconic Farms) were sensitized by an i.p. injection of 100 ␮gof sorted CD4 , CD8 , and CD4 CD8 populations from freshly OVA. After 1 wk, splenocytes were isolated from donors and incubated isolated splenocytes by flow cytometry and immunoblotted cell with 8 ␮M CFSE (Molecular Probes, Eugene, OR) in HBSS for 30 min at lysates with anti-RGS16 Abs. In Tg mice, RGS16 was expressed 37°C and for an additional 20 min in HBSS containing 10% FCS (Life ϩ ϩ 7 constitutively in both CD4 and CD8 populations, but not in Technologies). After two washes in HBSS, 4 ϫ 10 cells were injected into ϩ ϩ Ϫ Ϫ the tail vein of recipient mice. Recipients were challenged with a 1% OVA resting CD4 or CD8 cells from WT mice nor in CD4 CD8 nebulization for 30 min daily for three consecutive days. Forty-eight hours cells from either WT or Tg mice (Fig. 2D). In contrast, levels of ␣ ϩ after the last challenge, AHR was assessed using the Flexivent apparatus G i2 in CD4 cell membranes were similar in WT and Tg mice. before collection of lung, spleen, and cervical lymph nodes. Tissues were Two Tg founder lines were generated in either the FVB or BALB/c passed through a metal mesh to obtain single-cell suspensions. Cells were strains, which expressed broadly comparable levels of RGS16 and fixed in 1% paraformaldehyde and labeled with PE-conjugated anti-CD3 or -CD4 in PBS containing 1% BSA for 30 min at 4°C. Cells were analyzed virtually indistinguishable phenotypes (our unpublished data). on a FACSCalibur flow cytometer (BD Biosciences). To confirm that RGS16 overexpression modulates chemokine signaling in primary murine T cells, we isolated splenocytes from Results WT or Tg mice and measured MAP kinase activation evoked by RGS16 is expressed in activated T lymphocytes and inhibits CXCR4 stimulation. We observed reduced phosphorylation of chemokine receptor signaling Erk1 in Tg splenocytes stimulated with CXCL12, indicating that We showed previously that RGS16 was up-regulated in primary constitutive RGS16 expression inhibits MAP kinase activation me- human T lymphocytes after IL-2 stimulation (29). To further char- diated by CXCR4 in murine splenocytes (Fig. 2E). The Journal of Immunology 1545 Downloaded from http://www.jimmunol.org/

FIGURE 1. RGS16 expression in T lymphocytes and inhibition of chemokine signaling. A, RT-QPCR analysis of mRNA isolated from human Th1/2 cells originating from differentiated CD4ϩCD45RAϩ lymphocytes ex vivo. Cultures were incubated with polarizing cytokines and Abs as described in Materials and Methods. Activated Th1/2 cells were maintained for three cycles, then reactivated using the cytokine combinations for 1, 6, or 48 h. The Ϯ ␤ average expression ( SD) of duplicate RT-QPCR is shown. The simultaneous ampliﬁcation of human rgs16-FAM and 2-microglobin-VIC-labeled products allowed for normalization of the amount of cDNA added. B, Immunoblot analysis of RGS16 protein expression in freshly isolated murine

splenocytes treated with anti-CD3 for various time periods. C, Jurkat T cells stably expressing empty vector or HA-RGS16 were stimulated medium alone by guest on September 25, 2021 or with CXCL12 (50 ng/ml) for the indicated times. MAP kinase activity was determined by immunoblotting cell lysates with phospho-speciﬁc Erk (top). Erk activity was normalized to total Erk levels (middle), and RGS16 was detected with anti-HA (bottom). D, RGS16 inhibits CXCR4-induced AC activity. Jurkat transfectants were stimulated with forskolin (1 ␮M) for 15 min at 37°C to induce AC activation in the presence or absence of CXCL12, which inhibits ␣ Ϯ AC by activating G i. Results are expressed as the percentage of inhibition of the forskolin response (mean SEM of ﬁve independent experiments) by .(p Ͻ 0.05, paired Student’s t test ,ء) CXCL12 in vector or RGS16-expressing cells

RGS16 expression does not impair T cell development or by transfected CXCR1 receptor stimulation of these G proteins in ␣ homeostatic trafficking to secondary lymphoid organs HEK 293 cells (29). Because of RGS16 G i GAP activity, we rgs16 Tg mice were fertile, and no overall difference in mortality hypothesized that rgs16 Tg lymphocytes would migrate abnor- compared with that of WT mice was observed. No significant changes mally to chemokine stimuli in vivo. To assess chemokine-induced in the number of circulating CD3ϩ, CD4ϩ, CD8ϩ, or B cells were homing of naive, circulating lymphocytes in the absence of im- observed in mice carrying the transgene (our unpublished data). To mune provocation, we injected chemokines directly into the peri- ascertain whether RGS16 affected basal lymphocyte trafficking, we toneum of WT or Tg mice, harvested cells by peritoneal lavage, performed histological examination of spleen, thymus, and lymph and quantitated the number of recruited cells. Although there was nodes from Tg mice, which revealed no abnormalities (Fig. 3). In situ no difference in the quantity of WT or Tg lymphocytes recruited to hybridization revealed normal expression of PECAM-1 (CD31) in the peritoneum by sham (PBS) injection, the number of lympho- vascular endothelium (Fig. 3A, thymus) and in high endothelial cytes migrating from 1–6 h after CXCL12 injection was dramat- venules (B, lymph nodes; C, spleen), suggesting normal organ archi- ically reduced in Tg mice (Fig. 4, A and B). There was no signif- tecture. Furthermore, analysis of rgs16 mRNA expression in these icant difference between Tg and WT mice in numbers of tissues demonstrated a normal distribution of T lymphocytes. These eosinophils, macrophages, or neutrophils in the peritoneum after data indicate that compartmental homing of naive lymphocytes to CXCL12 injection (Fig. 4A). To characterize the phenotype of mi- secondary lymphoid organs in the absence of inflammatory or patho- grated cells, we measured cell surface marker expression by flow genic stimuli was normal in Tg mice. Finally, no colon pathology was cytometry. In the lymphocyte-gated population, the percentage of observed in Tg animals, in contrast to the inflammatory colitis seen in CD4ϩ cells in peritoneal lavage fluid was reduced from 23.6 Ϯ ␣ Ϯ Ϯ G i2-deficient mice (our unpublished data). 2.4% in WT mice to 15.2 2.7% in Tg animals (mean SEM of two independent experiments of three to five mice in each group), and Selectively impaired lymphocyte chemotaxis/homing in rgs16 the percentage of CD8ϩ cells was 9.6 Ϯ 4% in WT compared with Tg mice 3.2 Ϯ 1.3% in Tg mice. In addition, the number of CD4ϩCXCR4ϩ ϩ ϩ Our previous studies showed that RGS16 interacts with AlF4-ac- and CD8 CXCR4 cells was reduced in peritoneal fluid obtained ␣ ␣ tivated G i and G q in Jurkat cells and inhibits signaling induced from Tg mice in comparison with those of WT (Fig. 4C). 1546 RGS16 REGULATES T LYMPHOCYTE FUNCTION

To determine whether the impaired migration of Tg lymphocytes was speciﬁc to CXCL12, we injected CCL12, which acts on CCR2. Neutralizing Abs to CCL12 have been shown to reduce AHR in mouse asthma models by affecting eosinophil trafﬁcking within the lung (40). There was no change in CCR2-mediated recruitment of peritoneal lymphocytes/monocytes or eosinophils in Tg mice compared with WT (Fig. 4D). These results suggest that RGS16 expression in T lymphocytes attenuates migration selectively evoked by the chemokine ligand for CXCR4, but not CCR2.

Tg lymphocyte migration in acute T cell-dependent inflammation To determine whether RGS16 expression affected T cell migration and/or activation in response to an inflammatory stimulus, we characterized pulmonary responses induced by OVA challenge. In this model, OVA-specific CD4ϩ Th2 cells are recruited to the lung, where their secreted cytokines act directly on airways to attract and activate primary effector cells in the allergic response

such as epithelial cells, mast cells, basophils, and eosinophils. Downloaded from These cells, in turn, secrete proinﬂammatory mediators such as chemokines, histamine, leukotrienes, and TNF-␣, which cause bronchoconstriction, submucosal edema, epithelial sloughing, and increased mucus production (4, 5, 13, 41, 42). Histological lung changes result in AHR to inhaled stimuli such as methacholine, an

agonist of airway smooth muscle m3 muscarinic receptors. Mice http://www.jimmunol.org/ were sensitized once with an i.p. injection of OVA, followed by three challenges with nebulized OVA solution (Fig. 5A). We assessed AHR by determining airway resistance in response to methacholine and lung cellularity by counting cells in BALF. However, in this model, we observed essentially no difference between WT and Tg mice in the number of lymphocytes, neutrophils, eosinophils, or macrophages recruited to the lung (Fig. 5B). We hypothesized that, although overall BALF lymphocyte numbers were similar in WT and Tg mice, the migration of discrete by guest on September 25, 2021 chemokine receptor-bearing T cell populations could be affected specifically by RGS16 expression. To explore this possibility further, we analyzed cell surface expression of CD4, CD8, CCR3 (expressed on Th2 but not Th1 cells), CCR5 (preferentially expressed on Th1 cells), and CXCR4 (expressed mainly on Th2 cells) (1, 13, 18, 40, 42, 43) in T cell-enriched preparations derived from lung single-cell suspensions. There was no significant decrease in the percentage of CD4ϩ or CD8ϩ cells in T lymphocyte suspensions from Tg lungs compared with WT (Table I). Because CD4ϩ cells are thought to be the predominant effector T cells mediating allergic inflammation in the lung (42), we characterized chemokine receptor expression on this subpopulation. Strikingly, the percentages of CD4ϩCCR3ϩ, CD4ϩCCR5ϩ, and CD4ϩ CXCR4ϩ cells were reduced in lungs of Tg mice (Table I), as was FIGURE 2. Generation and characterization of rgs16 Tg mice. A, The ϩ rgs16 ORF was cloned downstream of the murine CD4 promoter and in- the level of CCR3 and CCR5 expression on CD4 lymphocytes jected into oocytes to generate mice expressing RGS16 in CD4ϩ and CD8ϩ (Fig. 5C). These results suggest that RGS16 expression affects cells. B, Southern blot analysis of HindIII-digested genomic DNA from CCR3-, CCR5-, and CXCR4-dependent trafficking patterns of rgs16/ϩ or WT mice hybridized with a SalI/EcoRI fragment comprising lymphocytes in response to OVA challenge. the first 300 bp of the rgs16 ORF. C, Northern blot analysis of tissues To assess chemokine receptor expression under basal conditions isolated from an rgs16/ϩ mouse hybridized with an rgs16-specific probe. and to determine whether OVA-induced lymphocyte trafficking to ␤-Actin was used to normalize for RNA loading (data not shown). D, other lymphoid compartments might be altered, we measured Analysis of RGS16 protein expression in Tg mice. Whole splenocytes from CCR3 expression on splenic T cells before and after OVA chal- WT or Tg mice were isolated and then sorted into the indicated sub- lenge. Naive spleens from Tg mice contained similar (or slightly populations by flow cytometry using anti-CD4 and anti-CD8 Abs. ϩ ϩ ϩ Whole-cell extracts were immunoblotted with anti-RGS16 (top panel), decreased) percentages of CD4 , CD8 , and CCR3 T lympho- ␣ cytes compared with those of WT (Fig. 5D). In OVA-challenged and membranes were immunoblotted with anti-G i2 (bottom). E, MAP ϩ ϩ kinase activity was determined in splenocytes isolated from WT or and -sensitized Tg mice, the overall number of CD4 and CD8 rgs16 Tg mice (5 ϫ 106 cells/point) as in Fig. 1. Blot is representative lymphocytes was either unchanged or decreased compared with ϩ ϩ of three mice in each group. those of WT. However, percentages of CD4 CCR3 and CD8ϩCCR3ϩ cells were increased 2- to 3-fold (Fig. 5E). These data suggest that sensitized and challenged Tg spleens contain The Journal of Immunology 1547 Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 3. Normal homeostatic lymphoid organ compartmentation in rgs16 Tg mice. In situ hybridization was performed on sections from WT (i, iii, and v)orTg(ii, iv, and vi) thymuses (A), lymph nodes (B), and spleens (C). Dark-field images (ϫ100) are shown for sections hybridized with rgs16 antisense (iii and iv), rgs16 sense (vi), or PECAM antisense (v) riboprobes. Bright-field images (i and ii) are shown for each organ after H&E staining. more Th2 lymphocytes than do WT controls, in contrast to the OVA challenge compared with WT mice (Fig. 5F). Thus, the de- makeup of lung lymphocyte populations. crease in numbers of relevant proinflammatory T lymphocytes in Because this analysis implied that differentiated Tg Th2 cells are the lung is offset by increased airway reactivity in rgs16 Tg mice. restricted from infiltrating the lung parenchyma in response to allergen, we expected decreased AHR in Tg mice. Surprisingly, RGS16 expression is associated with enhanced T cell cytokine however, although there were no significant differences in baseline secretion airway reactivity between the two groups, Tg mice exhibited a Although adoptive transfer of PTX-treated Th2 lymphocytes im- significant increase in airway resistance to methacholine after pairs their migration to OVA-challenged lungs, the lymphocytes 1548 RGS16 REGULATES T LYMPHOCYTE FUNCTION

FIGURE 4. RGS16 inhibits lymphocyte chemotaxis to the peritoneum in response to select chemokines. A,WTor Tg mice were injected with PBS or Downloaded from CXCL12. Two hours later, cells were harvested by peritoneal lavage, and lymphocytes/monocytes were enumerated by Giemsa staining. Left graph represents mean Ϯ SEM from six mice in each group stimulated with PBS and nine WT ءء

or Tg mice injected with CXCL12. ( , http://www.jimmunol.org/ p ϭ 0.001, repeated measures ANOVA with Tukey-Kramer posthoc test). Right graph represents numbers of each cell type in a count of 400 cells from peritoneal lavage fluid after cytocentrifugation and H&E staining (mean Ϯ SEM of two independent experiments of three to five -p ϭ 0.009 be ,ءءء ;mice in each group tween WT and Tg lymphocytes, standard t test). C, Experiment as in A, except that by guest on September 25, 2021 cells were harvested at 1, 2, and 6 h after chemokine injection and quantitated as above. The zero time point represents mice injected with PBS. Values are mean Ϯ SEM from two to three mice in each group. D, Immunophenotype of peritoneal cells. Cells from peritoneal lavage after CXCL12 stimulation were fixed and analyzed for CD4, CD8, and CXCR4 expression by flow cytometry. Numbers represent percentages of double-positive cells (CD4 or CD8 and CXCR4) from two pooled mice representative of six mice in each group. E, Mice were injected with CCL12, and after 2 h, peritoneal lymphocytes/monocytes and eosinophils were quantitated as above. The Journal of Immunology 1549 are still functional and able to induce AHR when instilled directly cells to CFSEϩCD3Ϫ cells, which corrects for inequities in total into the airway (18). Thus, the apparent discrepancy between AHR numbers of labeled cells injected into recipient mice. Although and T cell lung infiltration in rgs16 Tg mice led us to examine the there was no difference in the quantity of Tg and WT lymphocytes activation status of Tg T cells directly. We hypothesized that, be- in the spleen, there were ϳ20% fewer CD3ϩ cells in lungs and ␣ cause loss of G i2 function results in accentuated T cell responses 35% fewer T lymphocytes in draining lymph nodes of recipients of (19, 20), RGS16 overexpression could augment activation, be- rgs16 Tg splenocytes after allergen challenge (Fig. 7B). Similarly, ␣ ϩ cause RGS16 inhibits G i function. In turn, enhanced cytokine numbers of injected CD4 cells were reduced in both lung (by secretion might cause direct lung injury and AHR independent of 25%) and lymph nodes (40%) in recipients of Tg splenocytes com- cellular infiltration, which has been demonstrated in previous stud- pared with WT. ies (8, 44–48). Surprisingly, the number of CD4ϩCD25ϩ cells in To assess the activation of injected, sensitized T lymphocytes lung was decreased in Tg mice compared with that of WT (Table after injection into recipient mice, we first measured cytokine lev- I). These cells could represent either activated cells or regulatory els in BALF after OVA challenge. Although BALF IL-2 levels T cells with a suppressive phenotype (49). To analyze T cell ac- were comparable in recipients injected with either WT or Tg tivation further, we measured cytokine production by splenocytes splenocytes, IL-5 levels were substantially increased (ϳ2.5-fold) in recall assays after in vivo OVA sensitization. Although we de- in BALF from recipients of rgs16 Tg cells (Fig. 7C). These data tected no differences in IL-2 production, rgs16 Tg T lymphocytes support the hypothesis that adoptively transferred rgs16 Tg lym- secreted significantly more IL-4 and IL-5 in response to OVA (Fig. phocytes display both impaired migration to a site of inflammation 6A). Alternatively, elevated cytokine levels could reflect the in- as well as increased cytokine secretion in response to allergen creased population of Th2-differentiated cells in the spleen of exposure. Downloaded from OVA-exposed Tg animals (see Fig. 5E). Despite these abnormalities, we observed no significant differ- To further clarify the role of RGS16 in T cell activation, we ences in AHR between recipients injected with lymphocytes from generated mice Tg for both rgs16 and a TCR specific for the OVA WT or Tg mice. We hypothesized that, because the majority of the peptide DO11.10. We cultured naive splenocytes and measured inflammation in recipients was likely mediated by endogenous cytokine production in response to anti-CD3 plus anti-CD28 or host lymphocytes, differences in AHR would be discounted. To

OVA peptide. In contrast to primed T lymphocytes, naive Tg T minimize the host response, we injected sensitized, CFSE-labeled http://www.jimmunol.org/ cells produced similar amounts of IL-2, IL-5, and IFN-␥ in re- WT or rgs16 Tg splenocytes into rag2Ϫ/Ϫ mice, which lack en- sponse to either of these stimuli (Fig. 6B). However, when double dogenous lymphocytes. We then quantitated lymphocytes in Tg mice were sensitized with OVA before splenocyte recall with spleen and lung after OVA challenge. Similar to the previous OVA peptide ex vivo, lymphocytes produced slightly less IFN-␥ transfer experiments, there were nearly identical numbers of T but increased IL-5. There was a significant difference in the ratio cells in the spleens of recipients. In contrast, lungs from rgs16 Tg of IL-5/IFN-␥ between WT and Tg mice (Fig. 6C). Production of lymphocyte recipients contained ϳ40% less CD3ϩ lymphocytes IL-13 by Tg lymphocytes was also increased ϳ2-fold compared after allergen exposure than lungs from recipients of WT lympho- with WT in response to anti-CD3 plus anti-CD28. Collectively, cytes (Fig. 7D). This result supports the idea that homing of rgs16 these data suggest that RGS16 expression is associated with in- Tg lymphocytes to a site of OVA-induced inflammation is im- by guest on September 25, 2021 creased production of Th2 cytokines in CD4ϩ cells that have been paired. To determine whether the reduction in lymphocyte infil- primed with allergen in vivo. Whether these findings represent tration in the lung correlated with AHR, we measured airway re- increased general activation or skewing toward a Th2 response sponses to methacholine. Recipient mice injected with rgs16 Tg will require assessment of lymphocyte responses to a pathogen that splenocytes exhibited enhanced responses to methacholine, indi- evokes a Th1 response. cating increased AHR (Fig. 7E). To assess whether altered lym- Another cytokine implicated in allergic responses is eotaxin, phocyte activation contributed to this abnormality, we measured which enhances recruitment and activation of eosinophils. Serum BALF cytokine levels. Although there was a trend toward in- eotaxin levels correlate with impairment of lung function in human creased IL-5 in recipients of rgs16 Tg lymphocytes, this result was asthmatics (13). Although eotaxin (as well as IL-4 and -13) levels not significant (our unpublished data). We attribute this result to in BALF or supernatants from activated splenocytes were too low the fact that overall BALF cytokine levels at this time point were to measure in our model, serum eotaxin was increased ϳ2-fold in very low or undetectable, most likely due to the low overall num- challenged Tg mice compared with WT. Taken together, the in- bers of lymphocytes recruited to the lung in recipient mice. As an creased IL-4, -5, -13, and eotaxin levels in Tg mice indicate a more alternative measure of activation, we assessed cell proliferation by pronounced Th2 microenvironment, which could contribute to en- measuring CFSE content. Because of the lag between allergen hanced airway responses. challenge and cell harvest, divided cells will contain less CFSE fluorescence than when first injected. Thus, the ratio of CFSEhigh Abnormal allergen-induced migration and cytokine secretion by to CFSElowCD3ϩ cells provides an estimate of cell division. This adoptively transferred Tg lymphocytes analysis revealed a significantly higher ratio of divided/nondivided To confirm that rgs16 Tg lymphocytes traffic aberrantly in re- Tg lymphocytes compared with WT controls in spleen and pul- sponse to allergen, we passively transferred sensitized Tg lympho- monary lymph nodes from recipient mice (Fig. 7F). Collectively, cytes into an OVA-challenged recipient. We sensitized donor WT these experiments demonstrate that, despite the fact that injected or Tg mice and recipient mice with OVA. Spleens were harvested Tg lymphocytes proliferate more and produce more cytokines from donors, and whole splenocytes were fluorescently labeled compared with WT, they are prevented from migrating to the lung with CFSE. Equal numbers of labeled cells were then systemically after allergen challenge. injected into recipient WT mice. After three subsequent OVA challenges, we collected BALF, followed by harvest of lungs, spleen, and cervical lymph nodes of recipient mice. We then quantified Discussion ϩ ϩ ␣ numbers of CFSE CD3 -positive lymphocytes in each organ by G i signaling is critical for T cell function from the time the lym- flow cytometry (Fig. 7A). To measure the effect of the rgs16 trans- phocyte leaves the thymus to the point at which it migrates to a site gene on cell recruitment, we determined the ratio of CFSEϩCD3ϩ of inflammation as evidenced by the dramatic blockade of these 1550 RGS16 REGULATES T LYMPHOCYTE FUNCTION Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 5. Lymphocyte migration and airway responsiveness after acute allergen challenge in Tg mice. A, Protocol for OVA sensitization and challenge. Mice were subjected to an i.p. injection of OVA followed by three daily nebulizations of 1% OVA beginning 7–10 days after sensitization. On the fourth day after the initial challenge, airway reactivity was assessed by Flexivent plethysmography. B, BALF lymphocyte counts from sensitized and challenged mice. BAL was performed, and cell differential counts were determined by counting 400 total cells in a cytocentrifugation preparation stained with H&E. Bar graph represents mean Ϯ SEM of two independent experiments of six WT and six Tg mice sensitized and challenged with OVA. There was no difference in BALF cell numbers in sham (PBS)-challenged Tg mice in comparison with WT (not shown). C, Immunophenotype of lung lymphocytes after OVA challenge. T cells were enriched from lung single-cell suspensions by negative Ab selection and magnetic bead sorting. Cells were ﬁxed and stained with FITC-conjugated Abs to CD4 and PE-conjugated CCR3 or CCR5 before analysis by ﬂow cytometry. (Figure legend continues) The Journal of Immunology 1551

Table I. Receptor expression on lung T lymphocytes in OVA- implying that RGS16 inhibits migration induced by CXCR4, but challenged micea not CCR2. Furthermore, increased expression of RGS16 was associated with impaired recruitment of T cells bearing CXCR4, Lung WT Tg p Value CCR3, and CCR5 to a site of pulmonary inflammation, supporting CD4ϩ 62.3 Ϯ 2.9 67.9 Ϯ 1.3 NS the hypothesis that these chemokine receptors could be molecular CD8ϩ 7.8 Ϯ 4 6.6 Ϯ 1NS targets of native RGS16. CD4ϩCCR3ϩ 20.8 Ϯ 7.2 5 Ϯ 3.1 0.05 The regulation of specific chemokine receptors by RGS16 can ϩ ϩ b Ϯ Ϯ (CD4 CCR3 ) 11.3 1 3.6 1.3 0.009 also be inferred by the phenotype of Tg mice under normal and CD4ϩCCR5ϩ 93.3 Ϯ 1.3 67.9 Ϯ 6.2 0.05 (CD4ϩCD8)ϩCXCR4ϩ 80.9 Ϯ 3.6 65.5 Ϯ 4 0.01 pathological conditions. That RGS16 expression had no effect on (CD4ϩCD25ϩ)b 6.8 Ϯ 0.1 5.2 Ϯ 0.3 0.009 T cell development, thymic architecture, and homeostatic lymphoid organ compartmentation suggests that RGS16 might be an a T lymphocytes were enriched from lung single-cell suspensions by magnetic bead sorting using an Ab mixture to deplete non-T cells. Cells were fixed and ana- ineffective regulator of CCR7 signaling (53, 54). In support of this lyzed for lymphocyte marker and chemokine receptor expression by flow cytometry. concept, preliminary studies indicate that adoptively transferred Values represent percentage of CD4ϩ or CD8ϩ cells that express CCR3, CCR5, or CXCR4 (mean Ϯ SEM of six mice in each group). The p values were derived by the rgs16 Tg T lymphocytes traffic normally to lymph nodes injected standard Student’s t test. with CCL21 (the principal ligand of CCR7) in plt mice, which lack b Percentage of total cells in lymphocyte-gated population positive for both endogenous CCL21 (secondary lymphoid chemokine) (our un- markers. published data). Similarly, although we were unable to com- prehensively measure chemokine receptor expression on lung Downloaded from processes by PTX (2, 16–18). Although the contribution of spe- lymphocytes due to a lack of sufficient cells, the reduced mi- cific chemokine receptor(s) to these events remains uncertain, it is gration of RGS16-expressing, sensitized T lymphocytes to the clear that distinct temporal and spatial receptor expression partially lung after adoptive transfer and allergen challenge also implies determines where lymphocytes of a certain phenotype will traffic a role for RGS16 in the regulation of CCR4- and CCR8-medi- (2, 50). For example, two principal chemokines, CCL19 (macroph- ated trafficking. Both of these receptors are expressed on Th2 ␤ lymphocytes, and deficiencies in either receptor are associated age-inflammatory protein-3 ), which binds the Gi-coupled receptor CCR7, and CXCL12, acting on CXCR4, trigger naive lympho- with impaired T cell recruitment to the lung in mouse asthma http://www.jimmunol.org/ cyte emigration out of the thymus and across lymph node high models (13, 50). endothelial venules into lymphoid compartments (1). Upon Ag Our results suggest that RGS16, like RGS2, may play a role in exposure, activated but undifferentiated T cells lose CCR7 on their T cell activation. rgs16 Tg T cells produced more Th2 cytokines surface and express primarily CCR5, CXCR3, and CXCR5. Even- (IL-4, -5, and -13) in response to allergen or TCR stimulation, tually, differentiated Th2 cells express CCR3, CCR4, CCR8, and whereas naive cells exhibited normal cytokine secretion. Several CXCR4, which mediate migration to an inflammatory site. How- studies have indicated a positive role for chemokines in T cell ever, receptor expression does not tell the whole story. Human responses, such as CXCL8 (55) and CXCL12 (56), which augment ϩ expression of anti-CD3-induced T cell activation markers and cy- memory CD4 cells respond much more efficiently to CCR1 li- by guest on September 25, 2021 gands than do naive cells, despite equal expression of receptors. A tokine production. Because these responses are inhibited by PTX, recent study linked this difference to a downstream signaling event one might predict that RGS expression would similarly attenuate T ␣ and demonstrated expression of both RGS3 and RGS4 only in cell responsiveness, because RGS proteins block G i signaling. Ϫ Ϫ naive cells, suggesting that down-regulation of CCR1 signaling by However, rgs2 / T cells exhibited reduced cytokine production these RGS proteins may partially determine hyporesponsiveness of and proliferation evoked by anti-CD3 (33), suggesting that RGS16 this cell population (27). Thus, the expression of specific RGS overexpression could result in the opposite phenotype. Our studies proteins in various T cell subsets could partially determine their also imply that in vivo sensitization is a prerequisite for the effect responsiveness to chemokines. of RGS16 on cytokine production. Differential chemokine receptor The regulation of chemokine signaling by RGS16 may be de- expression in naive vs polarized, sensitized cells might partially termined not only by the pattern of RGS16 expression in various explain these results, and indeed, we observed a striking increase ϩ T cell populations but also by its selective activity toward partic- in the number of Th2-like, CCR3 T cells in spleens of Tg mice ular G proteins or GPCRs. That an individual RGS protein dis- after allergen exposure. criminates between receptors coupled to the same G protein has a It is unclear whether the overall increases in cytokine secretion basis in recent biochemical studies. In pancreatic acinar cells, are due to enhanced activation and/or differentiation of Tg T cells RGS4 blocks m1 muscarinic but not cholecystokinin receptor- or are a result of increased numbers of cells in lung or spleen that evoked calcium flux despite the fact that both receptors couple to are dividing rather than migrating. Indeed, cell trafficking has been ␣ G q (51). Similarly, RGS3 and RGS5 selectively inhibit MAP linked to the cell cycle. Cells in G0/G1 migrate more efficiently ϩ kinase activation by distinct receptors in rat smooth muscle cells than cells in S G2M (57–59). CFSE labeling did not allow us to (52). Our study is the first to provide evidence that receptor-spe- determine whether adoptively transferred cells divided before or cific regulation of G protein pathways by an RGS protein occurs in after migration to the lung. However, the fact that RGS16 over- a whole-organism model. RGS16 effectively blocked lymphocyte expression was associated with enhanced cytokine synthesis by migration to a site of i.p. injection of CXCL12 but not CCL12, sensitized cells in in vitro recall assays supports the idea that

Histogram represents the mean ﬂuorescence intensity of CD4ϩ lymphocyte chemokine receptor expression on pooled cells from two mice representative of six to seven mice in each group (p ϭ 0.03 for both CCR3 and CCR5, paired t test). D and E, CCR3 expression on splenic lymphocytes from naive (D) and OVA-challenged (E) mice were analyzed by ﬂow cytometry. Numbers in each quadrant are the percentages of total pooled cells from two mice staining positive for CD4- or CD8-FITC and CCR3-PE (representative of six mice in each group; p ϭ 0.002 for CD4ϩCCR3ϩ or CD8ϩCCR3ϩ between WT and Tg challenged mice, Student’s t test). F, AHR in challenged mice. Airway resistance was measured in anesthetized, mechanically ventilated mice after nebulization of the indicated concentrations of methacholine intratracheally. Graph represents the percentage increase over baseline resistance (mean Ϯ SEM of six WT and seven Tg mice). 1552 RGS16 REGULATES T LYMPHOCYTE FUNCTION

FIGURE 6. RGS16 expression is associated with enhanced cytokine production by activated lymphocytes. A, Whole splenocytes from sensitized and challenged mice were isolated and cultured in the presence of adjuvant alone (control) or OVA for 48 h. The number of IL- 2-, IL-4-, or IL-5-producing cells was then de- ,p Ͻ 0.05 ,ء) termined by ELISPOT analysis two-factor ANOVA). B, Splenocytes from naive mice carrying the transgene for an OVA- specific TCR (DO11.10) with or without the transgene for rgs16 were cultured in the presence of anti-CD3 plus anti-CD28 or OVA peptide. IL-2 and IL-5 were quantitated from cul- Downloaded from ture supernatants by ELISA after a 24-h (IL-2) or 72-h (IL-5) incubation (mean Ϯ SEM, five mice in each group). C, DO11.10/WT (f)or DO11.10/rgs16 Tg (o) mice were sensitized with OVA. Whole splenocytes were then isolated and cultured with OVA peptide. IFN-␥ http://www.jimmunol.org/ and IL-5 levels were quantitated by ELISA, ,ء) and the ratio of IL-5/IFN-␥ was determined p ϭ 0.04, two-factor ANOVA). For measurement of IL-13, splenocytes (2.5 ϫ 105) were cultured in the presence of plate-bound anti- CD3 (10 ␮g/ml) plus soluble anti-CD28 (1 ␮g/ ml) for 72 h before quantification in superna- .(p ϭ 0.04, paired t test ,ء) tants by ELISA Eotaxin was measured in serum of sensitized and challenged mice by ELISA (mean Ϯ SEM by guest on September 25, 2021 of two independent experiments, five to seven p ϭ 0.01, standard ,ءء ;mice in each group t test).

RGS16 may have a primary effect on T cell activation pathways. cytokines, such as IL-4, -5, and -13, could be produced by Tg Further biochemical studies may clarify whether TCR-induced sig- lymphocytes retained in the spleen, or could be elaborated by either T naling is directly affected by RGS16 expression. lymphocytes or resident lung cells such as mast cells, basophils, or Despite reduced lymphocyte numbers in lungs of Tg mice, AHR epithelial cells. In particular, CD4ϪCD8Ϫ NKT cells, which produce was increased after allergen challenge in Tg mice and in rag2Ϫ/Ϫ IL-4 and -13, have recently been shown to be required for eosinophilia recipients of sensitized Tg T cells. Elevated levels of systemic and AHR in a mouse asthma model (60). Conceivably, these cells cytokines might partially explain this phenotype, because Th2 cy- could migrate to the lung in increased numbers in Tg mice to com- tokines may cause direct pathological airway changes in asthma. pensate for the missing T cell population. Adoptive transfer of Stat6Ϫ/Ϫ-sensitized Th2 cells results in AHR In summary, RGS16 expression in T lymphocytes, in contrast to independent of airway eosinophilia (48). Similarly, elevated IL-4, PTX (18), results in selective blockade of T cell migration to cer- -5, and -13 may have direct effects on airway pathology that en- tain chemokines and enhancement of T cell cytokine synthesis in hance AHR. Both IL-5 and IL-13 induce changes in the asthmatic response to a complex inflammatory stimulus. Whether these find- airway independently of inflammatory cells (41, 44–48). Instilla- ings reflect true specificity of RGS16 toward particular GPCRs or tion of rIL-13 directly into the airways induces increased mucus G proteins will require examination of the biochemical responses production, airway smooth muscle contraction, and AHR without of T cells lacking RGS16 to chemokine and other GPCR ligand a concurrent influx of eosinophils (44, 45). stimulation. To better define the molecular GPCR and G protein Indeed, we found increased serum eotaxin in Tg mice, which targets of RGS16 and their role in T cell immune responses, we are might also partially explain the normal numbers of eosinophils in generating conditional knockout mice lacking RGS16 in T lym- lungs of Tg mice despite the decrease in Th2 cell numbers. Other phocytes. Nonetheless, the current study suggests that therapeutic The Journal of Immunology 1553 Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 7. Reduced allergen-induced lung recruitment of Tg lymphocytes after adoptive transfer. A, Donor WT or Tg mice and WT BALB/c recipient mice were sensitized with 100 ␮g of OVA. One week later, whole splenocytes were extracted from donor mice and labeled with CFSE before tail vein injection into recipients. Mice were then subjected to three daily challenges of nebulized OVA solution before measurement of AHR and quantitation of cell numbers in lung, spleen, and lymph nodes by flow cytometry. B, Cell counts from organs of mice receiving either WT (f)orTg(o) splenocytes after allergen challenge. Spleen, lymph nodes, and lungs were dissected from recipient mice and ground into single-cell suspensions. CFSEϩ T lymphocytes were identified by flow cytometry after ,ء) staining with anti-CD3. Bar graph represents the ratio of CD3ϩ lymphocytes identified by dual fluorescence normalized to the number of CFSEϩCD3Ϫ cells p ϭ 0.02, two-factor ANOVA). C, BAL was performed on mechanically ventilated mice after challenge and assessment of AHR. IL-2 and IL-5 in BALF were p Ͻ 0.05, two-factor ANOVA). D, Sensitized rag2Ϫ/Ϫ recipients were injected with donor ,ء ;measured by ELISA (mean Ϯ SEM from five mice in each group WT (f)orTg(o) lymphocytes and challenged with OVA as in A.(Figure legend continues)Organs were harvested and analyzed as in B. Bar graph represents mean Ϯ p ϭ 0.04, two-factor ANOVA). E, AHR was assessed in OVA-sensitized and -challenged rag2Ϫ/Ϫ recipients by measuring airway ,ء) .SEM of four mice in each group resistance by plethysmography after exposure to the indicated concentrations of methacholine. Graph represents percentage increase over baseline resistance (mean Ϯ SEM of seven mice in each group). F, Cell proliferation was assessed by determining the ratio of CD3ϩ lymphocytes from spleens or draining lymph nodes with high vs low .(p ϭ 0.04, two-factor ANOVA ,ء) .CFSE fluorescence by flow cytometry. Bar graph represents the mean Ϯ SEM of seven mice in each group 1554 RGS16 REGULATES T LYMPHOCYTE FUNCTION agents that mimic or antagonize specific RGS proteins such as 26. Scheschonka, A., C. W. Dessauer, S. Sinnarajah, P. Chidiac, C. S. Shi, and RGS16 might selectively affect distinct T cell trafficking and T J. H. Kehrl. 2000. RGS3 is a GTPase-activating protein for Gi␣ and Gq␣ and a potent inhibitor of signaling by GTPase-deficient forms of Gq␣ and G11␣. Mol. cell-dependent immune responses. Pharmacol. 58:719. 27. Sato, K., H. Kawasaki, C. Morimoto, N. Yamashima, and T. Matsuyama. 2002. An abortive ligand-induced activation of CCR1-mediated downstream signaling Acknowledgments event and a deficiency of CCR5 expression are associated with the hyporrespon- We thank Dr. Virgilio Bundoc for expert technical assistance and Dean siveness of human naive CD4ϩ T cells to CCL3 and CCL5. J. Immunol. 168: Metcalfe for continued support. 6263. 28. Cho, H., T. Kozasa, K. Takekoshi, J. de Gunzberg, and J. H. Kehrl. 2000. RGS14,

a GTPase activating protein for Gi␣, attenuates Gi␣ and G13␣-mediated signaling References pathways. Mol. Pharmacol. 58:569. 1. Cyster, J. G. 1999. Chemokines and cell migration in secondary lymphoid organs. 29. Beadling, C. A., K. M. Druey, G. Richter, J. H. Kehrl, and K. A. Smith. 1999. Science 286:2098. Regulators of G protein signaling exhibit distinct patterns of gene expression and 2. Luther, S. A., and J. G. Cyster. 2001. Chemokines as regulators of T cell differ- target G protein specificity in human lymphocytes. J. Immunol. 162:2677. entiation. Nat. Immunol. 2:102. 3. Chiu, B. C., X. Z. Shang, V. R. Stolberg, E. Komuniecki, and S. W. Chensue. 30. Wong, C. W., Y. Zhang, S. Y. Neo, and S. C. Lin. 2000. Specific induction of 2002. Population analysis of CD4ϩ T cell chemokine receptor transcript expres- RGS16 mRNA by protein kinase C in CEM leukemia cells is mediated by tumour ␣ sion during in vivo type-1 (mycobacterial) and type-2 (schistosomal) immune necrosis factor- in a calcium-sensitive manner. Biochem. J. 352:747. responses. J. Leukocyte Biol. 72:363. 31. Ingi, T., A. M. Krumins, P. Chidiac, G. M. Brothers, S. Chung, B. E. Snow, 4. Lloyd, C. 2002. Chemokines in allergic lung inflammation. Immunology 105:144. C. A. Barnes, A. A. Lanahan, D. P. Siderovski, E. M. Ross, et al. 1998. Dynamic 5. Lukacs, N. W. 2001. Role of chemokines in the pathogenesis of asthma. Nat. Rev. regulation of RGS2 suggests a novel mechanism in G-protein signaling and neu- Immunol. 1:108. ronal plasticity. J. Neurosci. 18:7178. 6. Blease, K., N. W. Lukacs, C. M. Hogaboam, and S. L. Kunkel. 2000. Chemo- 32. Heximer, S., S. P. Srinivasa, L. S. Bernstein, J. L. Bernard, M. E. Linder,

kines and their role in airway hyper-reactivity. Respir. Res. 1:54. J. R. Hepler, and K. J. Blumer. 1999. G protein selectivity is a determinant of Downloaded from 7. Busse, W. W., and R. F. Lemanske. 2001. Asthma. N. Engl. J. Med. 244:350. RGS2 function. J. Biol. Chem. 274:34253. 8. Humbles, A. A., B. Lu, D. S. Friend, S. Okinaga, J. Lora, A. Al-Garawi, 33. Oliviera-dos-Santos, A., G. Matsumoto, B. E. Snow, D. Bai, F. P. Houston, T. R. Martin, N. P. Gerard, and C. Gerard. 2001. The murine CCR3 receptor I. Q. Whishaw, S. Mariathasan, T. Sasaki, A. Wakeham, P. S. Ohashi, et al. 2000. regulates both the role of eosinophils and mast cells in allergen-induced air- Regulation of T cell activation, anxiety, and male aggression by RGS2. Proc. way inflammation and hyperresponsiveness. Proc. Natl. Acad. Sci. USA 99: Natl. Acad. Sci. USA 97:12272. 1479. 9. Schuh, J. M., K. Blease, and C. M. Hogaboam. 2002. The role of CC chemokine 34. Chen, C. K., M. E. Burns, W. He, T. G. Wensel, D. A. Baylor, and M. I. Simon. receptor 5 (CCR5) and RANTES/CCL5 during chronic fungal asthma in mice. 2001. Slowed recovery of rod photoresponse in mice lacking the GTPase accel- FASEB J. 16:228. erating protein RGS9–1. Nature 403:557. http://www.jimmunol.org/ 10. Lloyd, C. A., T. Delaney, T. Nguyen, J. Tian, C. Martinez-A, A. J. Coyle, and 35. Palmer, E. M., and G. A. van Seventer. 1997. Human T helper cell differentiation J. C. Gutierrez-Ramos. 2000. CC chemokine receptor (CCR)3/eotaxin is followed is regulated by the combined action of cytokines and accessory cell-dependent by CCR4/monocyte-derived chemokine in mediating pulmonary T helper lym- costimulatory signals. J. Immunol. 158:2654. phocyte type 2 recruitment after serial antigen challenge in vivo. J. Exp. Med. 36. Chen, C. K., T. Wieland, and M. I. Simon. 1996. RGS-r, a retinal specific RGS 191:265. protein, binds an intermediate conformation of transducin and enhances recy- 11. Chensue, S. W., N. W. Lukacs, T. Y. Yang, X. Shang, K. A. Frait, S. L. Kunkel, cling. Proc. Natl. Acad. Sci. USA 93:12885. T. Kung, M. T. Wiekowski, J. A. Hedrick, D. N. Cook, et al. 2001. Aberrant in 37. Manjunath, N., P. Shankar, B. Stockton, P. D. Dubey, J. Lieberman, and vivo T helper type 2 cell response and impaired eosinophil recruitment in CC U. H. von Andrian. 1999. A transgenic mouse model to analyze CD8ϩ effector chemokine receptor 8 knockout mice. J. Exp. Med. 193:573. cell differentiation in vivo. Proc. Natl. Acad. Sci. USA 96:13932. 12. Gonzalo, J. A., C. M. Lloyd, D. Wen, J. P. Albar, T. N. C. Wells, A. Proudfoot, C. Martinez-A, M. Dorf, T. Bjerke, A. J. Coyle, and J. C. Gutierrez-Ramos. 2000. 38. Derrien, A., and K. M. Druey. 2001. RGS16 function is regulated by epidermal by guest on September 25, 2021 Critical involvement of the chemotactic axis CXCR4/stromal cell-derived fac- growth factor receptor-mediated tyrosine phosphorylation. J. Biol. Chem. 276: tor-1␣ in the inflammatory component of allergic airway disease J. Immunol. 48532. 165:499. 39. Gonzalo, J. A., Y. Pan, C. M. Lloyd, G. Q. Jia, G. Yu, B. Dussaul, C. A. Powers, 13. Zimmerman, N., G. K. Hershey, P. S. Foster, and M. E. Rothenberg. 2003. Che- A. E. Proudfoot, A. J. Coyle, D. Gearing, and J. C. Gutierrez-Ramos. 1999. mokines in asthma: cooperative interaction between chemokines and IL-13. Mouse monocyte-derived chemokine is involved in airway hyperreactivity and J. Allergy Clin. Immunol. 111:227. lung inflammation. J. Immunol. 163:403. 14. Arai, H., C. L. Tsou, and I. F. Charo. 1997. Chemotaxis in a lymphocyte cell line 40. Gonzalo, J. A., C. M. Lloyd, D. Wen, J. P. Albar, T. N. C. Wells, A. Proudfoot, transfected with C-C chemokine receptor 2B: evidence that directed migration is C. Martinez-A, M. Dorf, T. Bjerke, A. J. Coyle, and J. C. Gutierrez-Ramos. 1998. ␤␥ ␣ mediated by dimers released by activation of G i-coupled receptors. Proc. The coordinated action of CC chemokines in the lung orchestrates allergic in- Natl. Acad. Sci. USA 94:14495. flammation and airway hyperresponsiveness. J. Exp. Med. 188:157. 15. Neptune, E. R., T. Iiri, and H. R. Bourne. 1999. G␣ is not required for chemo- i 41. Isenberg-Feig, H., J. P. Justice, and A. Keane-Myers. 2003. Animal models of taxis mediated by Gi-coupled receptors. J. Biol. Chem. 274:2824. 16. Chaffin, K. E., and R. M. Perlmutter. 1991. A pertussis toxin-sensitive process allergic asthma. Curr. Allergy Asthma Rep. 3:70. controls thymocyte emigration. Eur. J. Immunol. 21:2565. 42. Larche, M., D. G. Robinson, and A. B. Kay. 2003. The role of T lymphocytes in 17. Phillips, R., and A. Ager. 2002. Activation of pertussis toxin-sensitive CXCL12 the pathogenesis of asthma. J. Allergy Clin. Immunol. 111:450. (SDF-1) receptors mediates trans-endothelial migration of T lymphocytes across 43. Mackay, C. R. 2001. Chemokines: immunology’s high impact factors. Nat. Im- lymph node high endothelial cells. Eur. J. Immunol. 32:837. munol. 2:95. 18. Mathew, A., B. D. Medoff, A. D. Carafone, and A. D. Luster. 2002. Th2 cell 44. Wills-Karp, M., J. Luyimbazi, X. Xu, B. Schofield, T. Y. Neben, C. L. Karp, and trafficking into the allergic lung is dependent on chemoattractant receptor signal- D. D. Donaldson. 1998. Interleukin 13: central mediator of allergic asthma. Sci- ing. J. Immunol. 169:651. ence 282:2258. 19. Rudolph, U., M. J. Finegold, S. S. Rich, G. R. Harriman, Y. Srinivasan, P. Brabet, G. Boulay, A. Bradley, and L. Birnbaumer. 1995. Ulcerative colitis and adeno- 45. Kuperman, D. A., X. Huang, L. L. Koth, G. H. Chang, G. M. Dolganov, Z. Zhou, ␣ J. A. Elias, D. Sheppard, and D. J. Erle. 2002. Direct effects of interleukin-13 on carcinoma of the colon in G i2-deficient mice. Nat. Genet. 2:143. 20. Hornquist, C. E., X. Lu, P. M. Rogers-Fani, U. Rudolph, S. Shappell, epithelial cells cause airway hyperreactivity and mucus overproduction in ␣ asthma. Nat. Med. 8:885. L. Birnbaumer, and G. R. Harriman. 1997. G i2-deficient mice with colitis exhibit a local increase in memory CD4ϩ T cells and proinflammatory Th1-type 46. Borchers, M. T., J. Crosby, P. Justice, S. Farmer, E. Hines, J. J. Lee, and ϩ cytokines. J. Immunol. 158:1068. N. A. Lee. 2001. Intrinsic AHR in IL-5 transgenic mice is dependent on CD4 21. De Vries, L., B. Zheng, T. Fischer, E. Elenko, and M. G. Farquhar. 2000. The cells and CD49d-mediated signaling. Am. J. Physiol. 281:L653. regulator of G protein signaling family. Annu. Rev. Pharmacol. Toxicol. 40:235. 47. Justice, J. P., J. Crosby, M. T. Borchers, A. Tomkinson, J. J. Lee, and N. A. Lee. 22. Hollinger, S., and J. R. Hepler. 2002. Cellular regulation of RGS proteins: mod- 2002. CD4ϩ T cell-dependent airway mucus production occurs in response to ulators and integrators of G protein signaling. Pharmacol. Rev. 54:527. IL-5 expression in lung. Am. J. Physiol. 282:L1066. 23. Bowman, E. P., J. J. Campbell, K. M. Druey, A. Scheschonka, J. H. Kehrl, 48. Tomkinson, A., C. Duez, M. Lahn, and E. W. Gelfand. 2002. Adoptive transfer and E. C. Butcher. 1998. Inhibition of chemotactic and proadhesive responses of T cells induces airway hyperresponsiveness independently of airway eosino- to chemoattractant receptors by RGS family members. J. Biol. Chem. 273: philia but in a signal transducer and activator of transcription 6-dependent man- 28040. ner. J. Allergy Clin. Immunol. 109:810. 24. Reif, K., and J. G. Cyster. 2000. RGS molecule expression in B lymphocytes and ability to down-regulate chemotaxis to lymphoid chemokines. J. Immunol. 164: 49. McHugh, R. S., and E. M. Shevach. 2002. The role of suppressor T cells in 4720. regulation of immune responses. J. Allergy Clin. Immunol. 110:693. 25. Siderovski, D. P., S. Heximer, and D. R. Forsdyke. 1994. A human gene 50. Gutierrez-Ramos, J. C., C. Lloyd, M. L. Kapsenberg, J. A. Gonzalo, and encoding a putative basic helix-loop-helix phosphoprotein whose mRNA in- A. J. Coyle. 2000. Non-redundant functional groups of chemokines operate in a creases rapidly in cycloheximide-treated blood mononuclear cells. DNA Cell coordinate manner during the inflammatory response in the lung. Immunol. Rev. Biol. 13:125. 177:31. The Journal of Immunology 1555

51. Xu, X., W. Zeng, S. Popov, D. M. Berman, I. Davignon, K. Yu, D. Yowe, 56. Nanki, T., and P. E. Lipsky. 2001. Stimulation of T-cell activation by CXCL12/ S. Offermanns, S. Muallem, and T. M. Wilkie. 1999. RGS proteins determine stromal cell derived factor-1 involves a G-protein-mediated signaling pathway. signaling speciﬁcity of Gq-coupled receptors. J. Biol. Chem. 274:3549. Cell. Immunol. 214:145. 52. Wang, Q., M. Liu, W. Mullah, D. P. Siderovski, and R. R. Neubig. 2002. Re- 57. Vasseur, F., A. Le Campion, J. H. Pavlovitch, and C. L. Penit. 1999. Distribution ceptor-selective effects of endogenous RGS3 and RGS5 to regulate mitogen- of cycling T lymphocytes in blood and lymphoid organs during immune reactivated protein kinase activation in rat vascular smooth muscle cells. J. Biol. sponses. J. Immunol. 162:5164. Chem. 277:24949. 58. Weninger, W., M. A. Crowley, N. Manjunath, and U. H. von Andrian. 2001. 53. Ueno, T., K. Hata, M. S. Willis, M. A. Malin, U. E. Hoepken, D. H. D. Gray, Migratory properties of naı¨ve, effector, and memory CD8ϩ T cells. J. Exp. Med. K. Matsushima, M. Lipp, T. A. Springer, R. L. Boyd, et al. 2002. Role for CCR7 194:953. ligands in the emigration of newly generated T lymphocytes from neonatal thy- 59. Yong, K. L., A. Fahey, A. Pizzey, and D. C. Linch. 2002. Inﬂuence of cell cycling mus. Immunity 16:205. and cell division on transendothelial migration of CD34ϩ cells. Br. J. Haematol. 54. Mueller, G., U. E. Hoepken, H. Stein, and M. Lipp. 2002. Systemic immuno- 119:500. regulatory and pathogenic functions of homeostatic chemokine receptors. J. Leu- 60. Akbari, O., P. Stock, E. Meyer, M. Kronenberg, S. Sidobre, T. Nakayama, kocyte Biol. 72:1. M. Taniguchi, M. J. Grusby, R. H. DeKruyff, and D. T. Umetsu. 2003. Essential 55. Lippert, E., Y. Jacques, and S. Hermouet. 2000. Positive regulation of human T role of NKT cells producing IL-4 and IL-13 in the development of allergen- cell activation by Gi2 proteins and interleukin 8. J. Leukocyte Biol. 67:742. induced airway hyperreactivity. Nat. Med. 9:582. Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021