DOCSLIB.ORG

بررسی تنوع ژنتیکی ماهی گورخری زاگرس Aphanius Vladykovi

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
بررسی تنوع ژنتیکی ماهی گورخری زاگرس Aphanius Vladykovi Arshive of SID ژنتيک نوين دوره يازدهم، شماره 1، بهار 1315 صفحه 11-11 بررسی تنوع ژنتیکی ماهی گورخری زاگرس )Aphanius vladykovi( در چشمه مادر و دختر و چشمه چهلگزی در استان چهارمحال و بختیاری با استفاده از نشانگرهای ریزماهواره Genetic diversity of zagros zebrafish (Aphanius vladykovi) in Madar-o-dokhtar spring and Chehelgazi spring in the Chaharmahall-o-Bakhtiari Province by using microsatellite markers * سیدهآمنه حسینی ، علی شعبانی ، حمیدرضا رضایی 1- بهترتیب کارشناس ارشد، دانشیار، استادیار دانشگاه علوم کشاورزی و منابع طبیعی،گرگان، ایران Hosseini SA*1, Shabani A1, Rezaei HR1 1- MSc Student, Associate Professor, Assistant Professor, Gorgan University of Agriculture Science and Natural Resources, Iran * نویسنده مسئول مکاتبات، پست الکترونیکی:[email protected] )تاریخ دریافت: 1/11/29 - تاریخ پذیرش: 29/9/11( چکیده مطالعه حاضر با هدف بررسی تنوع ژنتيکی ماهی گورخری زاگرس )Aphanius vladykovi( که ماهی کوچکی از خانواده کپور دندانداران و بومی استان چهارمحالوبختياری است، با استفاده از نشانگرهای ريزماهواره صورت گرفت. بدينمنظور تعداد 64 قطعه ماهی در پاييز 19 از چشمه چهلگزی و چشمه مادر و دختر جمعآوری شد. در اين بررسی از 4 جايگاه ريزماهواره چندشکل واژههای کلیدی استفاده شد. تعداد آلل مشاهده شده در جمعيتها به طور ميانگين 61/11 و هتروزيگوسيتی مشاهدهشده در چشمه چهلگزی 113/9 و در چشمه مادر و دختر 159/9 محاسبه شد که نشان می- Aphanius vladykovi دهد دوره توليدمثلی طوﻻنی آفانيوس دليلی بر موفقيت توليدمثلی و افزايش هتروزيگوسيتی تنوع ژنتیکی است. نتايج حاصل از Fst )923/9( و Rst )912/9( تمايز ژنتيکی پايينی را ميان مناطق نشان دادند. چهارمحال و بختیاری تجزيه واريانس ملکولی تنها دو درصد تنوع بين جمعيتها نشان داد و فاصله ژنتيکی بين جمعيتها ریزماهواره 322/9 محاسبه شد. جريان ژنی بين دو منطقه 919/11، نسبتاً باﻻ بوده و میتواند متأثر از نحوه محاسبه آماری جريان ژنی باشد. در بررسی تعادل هاردی- واينبرگ پس از اعمال ضريب تصحيح بونفرونی از بين 12 تست جايگاه ژنی، در سه تست پيروی از تعادل مشاهده شد. اين بررسی دﻻيل و نتايج اوليه را برای وجود جمعيتهای متمايز ماهی گورخری زاگرس نشان میدهد، بنابراين توجه و اقدامات جدی برای حفظ ذخاير ژنتيکی آن ضروری است. www.SID.ir Arshive of SID بررسی تنوع ژنتيکی ماهی گورخری زاگرس... سیدآمنه حسینی و همکاران مقدمه آفانیوسها ماهیان با ارزش بیولوژیکی هستند که در مبارزه با بیماری ماﻻریا )با خوردن ﻻرو پشه آنوفل( نقش دارند و از لحاظ ظاهری برای اهداف زینتی بهکار میروند. اغلب یوریترم، یوری- هالین و مقاوم به کمبود اکسیژن بوده اما آبهای خنثی و پر اکسیژن را ترجیح میدهند )Keivany and Soofiani 2004(. این ماهیان دارای دوره تولید مثلی طوﻻنی هستند که نوعی سازگاری Aphanius vladykovi با شرایط محیطی برای ماهیان کوچک با دوره زیستی کوتاه شکل 1- ماهی گورخری زاگرس ) ( محسوب میشود و زمان آن در جنسهای مختلف آفانیوس از DNA اواخر اسفند تا اول مهر با غالبیت در فروردین تا مرداد مشاهده عدم ترمیم میشوند، میتوانند پایداری ژنوم و در نتیجه Jewell 2006 شده است )Hossaini and Golzar 2012(. این ماهیان دارای دو- ریزماهوارهها را تحت تأثیر قرار دهند ) (، لذا تنوع شکلی جنسی بوده و بلوغ جنسی زود هنگام را نشان میدهند و از ریزماهوارهها ابزار بسیار حساسی را برای اندازهگیری تفاوتهای چند ماه پس از تولد، توانایی تولیدمثل دارند. Aphanius ژنتیکی جزئی بین جمعیتها فراهم میآورد. vladykovi در چشمهها و رودخانههای استان چهارمحال و عوامل تهدیدآمیزی برای زندگی آفانیوس زاگرس مطرح بوده که بختیاری که اغلب از سرچشمههای رودخانه کارون هستند، از آنجمله خشک شدن برخی زیستگاهها، آلوده شدن منابع آبی، زندگی میکند. نظر به کاهش ساﻻنه جمعیتهای این ماهی در فرار ماهیان قزل آﻻ از استخرها و ورود به تاﻻبها مانند تاﻻب استان چهارمحال و بختیاری و با توجه به ارزش زیستشناختی و چغاخور که از زیستگاههای مناسب آفانیوس است، همچنین زینتی Aphanius vladykovi، بررسی تنوع ژنتیکی این موجود احداث استخرهای قزلآﻻ در مسیر چشمه و رودخانه، که جهت درک میزان ذخایر و حفاظت از آن امری ضروری به شمار شکارچیان قدری برای آفانیوس هستند و سبب کاهش قابل توجه میآید. تنوع ژنتیکی یکی از سه سطح تنوع زیستی پیشنهاد شده جمعیتهای این گونه آبزی شدهاند، اشاره میشود. از جهتی توسط سازمان جهانی حفاظت از منابع طبیعی )IUCN( برای آفانیوس زاگرس در اکثر حوزههای آبی با بیماریهای انگلی برنامههای حفاظت ذخایر است )Lucentini et al. 2009(. بنابراین مخصوصاً بیماری ایک مواجه و بسیار مستعد برای این بیماری حفظ بقای هر جامعه، از اهداف اساسی در زیستشناسی حفاظت است و آنگونه که در بررسیهای پیاپی مشاهده شد و با توجه به است. پژوهشهای پیشین، دچار تلفات قابل توجهی در اثر ابتﻻ به ایک Raissy et al. 2008; Fattollahi 2013 ریزماهوارهها یکی از مهمترین نشانگرهای ژنتیکی به شمار می- میشود ) (. Aphanius آیند، زیرا دارای پتانسیل تخمین مهاجرت و قدرت تفکیک برای پژوهشهای محدودی در زمینه ژنتیکی بر روی جنس تشخیص نسبت باﻻی خویشاوندی میباشند ) .Kimberly et al صورت گرفتهاست. در خط ساحلی اطلس جنوبی تنوع ژنتیکی A.baeticus 2006(. از آنجا که برای یک جایگاه که آغازگر ریزماهواره بر با استفاده از نشانگرهای میتوکندریایی و هستهای اساس آن طراحی می شود، آللهای متعددی یافت میشود، این بررسی شد و تنوع ژنتیکی بسیار پایین و تمایز ژنتیکی ضعیفی نشانگر برای بررسی تنوع ژنتیکی قابلیت باﻻیی دارد. پایداری شناسایی شد. در این خصوص توزیع پراکنده این گونه که از ریزماهوارهها احتماﻻً از طریق پایداری ژنوم در کلیه سطوح کنترل دورههای میان دو یخبندان آغاز شده و همراهی آن با حوادث می شود، بهطوری که برخی جهشها نظیر جهشهایی که موجب خلفی انقراض و مهاجرت ناشی از چرخههای ادواری حاصل از جاری شدن سیل توانسته عدم وجود روابط فیلوژنیک میان جمعیت را به خوبی بیان کند )Gonzales et al. 2014(. بررسی 1 International union for conservation of nature 19 ژنتیک نوین/ دوره یازدهم/ شماره 1/ بهار 1315 www.SID.ir Arshive of SID بررسی تنوع ژنتيکی ماهی گورخری زاگرس... سیدآمنه حسینی و همکاران تنوع ژنتیکی A. Fasciatus نیز تنوع ژنتیکی کم و جمعیت همگن گندمان با موقعیت جغرافیایی N ″46/14ˊ19˚21 و E از نظر ژنتیکی را نشان داد و همچنین نشان داد ریزماهواره نسبت ″91/21ˊ92˚11 و چشمه چهلگزی در نزدیکی روستای باستانی به آلوزایم سطح کم تنوع ژنتیکی را نشان داد ) ;Maltagliati 1998 بیژگرد با موقعیت جغرافیایی N ″99/99ˊ94˚21 و E 29/92″ Cimmaruta et al. 2010(. در بررسی کروموزومی ماهی ˊ19˚ 11 در پاییز سال 1229 صورت گرفت )شکل 9(. باله پشتی گورخری زاگرس مشخص شد که تعداد نمایی کروموزومها )9n( در اتانول مطلق فیکس شده و برای مطالعات ژنتیکی به آزمایشگاه برابر 94 بوده که مشابه دیگر گونههای این جنس از جمله بیوتکنولوژی دانشگاه کشاورزی و منابع طبیعی گرگان منتقل شد. A.persicus ،A. dispar ،A.ginaonis است که تاکنون بررسی استخراج DNA و واکنش زنجیرهای پلیمراز شدهاند ) Esmaeili et al. 2007; Amini and Hemmatzadeh استخراج DNA با استفاده از روش فنل-کلروفرم ) .Hillis et al 2012(. همچنین بررسی نواربندیهای گوناگون بر روی 1996( صورت گرفت. DNA استخراج شده در 199 میکرولیتر کروموزومهای Aphanius vladykovi که برای نخستین بار در آب مقطر دو بار تقطیر حل شده و تا زمان انجام آزمایشات در ایران بر روی یک گونه آبزی انجام شد، نشان داد ژنوم این گونه فریزر 99- درجه سانتیگراد نگهداری شد. کمیت و کیفیت DNA دارای نواحی غنی از بازهای C و G بوده در حالی که بخشهای استخراجی با الکتروفورز ژل آگارز یک درصد و روش غنی از بازهای A و T در آن کم است ) Hemmatzade and اسپکتروفتومتری تعیین شد. شش جفت آغازگر ریزماهواره شامل BL2-114 ،)Strecker 2006( GATA2 ،CmD1 ،AC4 ،BA9 .)Amini 2012 از آنجا که تاکنون اطﻻعاتی در مورد تنوع ژنتیکی Dubut et al. 2009( Aphanius( و Matura et al. 2012( GGM024( مورد vladykovi منتشر نشده و از طرفی دانستن تنوع ژنتیکی برای تجزیه و تحلیل قرار گرفت. واکنش زنجیرهای پلیمراز )PCR( حفظ ذخایر با ارزش این گونه ضروری است، در این مطالعه به برای هر یک از آغازگرها انجام شد و دمای بهینه برای هر یک به بررسی تنوع ژنتیکی درون و بین جمعیتهای آن در دو منطقه با دست آمد )جدول 1(. محصول واکنش زنجیرهای پلیمراز روی 6 جفت آغازگر ریزماهواره پرداخته شد. ژل پلیاکریلآمید 4 درصد جداسازی شده و در نهایت ژلها به Sambrok et al. 1989 روش نیترات نقره رنگآمیزی شدند ) (. Gel Doc مواد و روشها عکسبرداری از ژلها توسط دستگاه مستندساز ژل ) Gel-Pro Analyzer 6.0 XR, BIO-RAD بررسی مناطق و نمونهبرداری ( انجام شد و از نرمافزار نمونهبرداری در استان چهار محال و بختیاری از 92 عدد ماهی برای محاسبه طول قطعات استفاده شد. آفانیوس زاگرس در هر منطقه، چشمه مادر و دختر در شهرستان جدول 1- خصوصیات جایگاههای ژنی مورد استفاده در جمعیتهای کپوردندان زاگرس bp ˚C ´ ´ جایگاه توالی آغازگر) 2- 1( دمای اتصال) ( وزن ) ( F:CACGCTCCTTTGGGGAAGCCTA BA9(F) 919-262 69 R:GCCGTCTGCCTGTTTGCCTTTATC F:AATGGATGGTGTGAATGGC CmD1(F) 164-991 11 R:GGATGGATACAGAGCAGCAC F:TCGGATGCTCAGTCAGTACG GATA2(F) 129-921 19 R:ATGAACAACGAGTCACACGC F:CTGCTGCAGTCTGCAC AC4(T) 129-169 99 R:TCACCTCCAAGGTTAGTCAT F:ATCACTGCCATTTTATTA BL2-114 944-249 19 R:CTGCTCCGCTCTGTTCCA F:TCCCTCTTTTTGGTCTCAGG GGM024 199-149 11 R:TAGGTGAACAAATGGCATGG ژنتیک نوین/ دوره یازدهم/ شماره 1/ بهار 1315 13 www.SID.ir Arshive of SID سیدآمنه حسینی و همکاران بررسی تنوع ژنتيکی ماهی گورخری زاگرس... جدول 9- تنوع ژنتیکی 6 جایگاه ژنی مورد مطالعه در جمعیتهای آفانیوس زاگرس GGM024 BL2-114 AC4(T) GATA2(F) CmD1(F) BA9(F) Na 4 11 4 19 4 14 Ne چشمه چهلگزی 12/229 2/221 6/261 6/116 19/299 1/292 Ho 1 1 9/214 1 1 1 He 9/412 9/212 9/426 9/416 9/491 9/291 Fis -9/929 -9/944 -9/199 -9/164 -9/914 -9/941 Na 19 11 4 4 12 14 Ne چشمه مادر و دختر 19/299 2/444 1/299 1/444 11/124 6/619 Ho 1 1 1 9/422 1 1 He 9/419 9/219 9/429 9/429 9/422 9/299 Fis -9/144 -9/922 -9/991 9/111 -9/112 -9/949 تجزیه آماری بین جایگاه دارای اندازه آللی 149 تا BL2 ،999 دارای اندازه آللی تجزیههای مربوط به ساختار ذخایر ژنتیکی شامل تعداد آلل 294 تا GATA2 ،249 دارای اندازه آللی 129 تا 929 و مشاهده شده )Na(، تعداد آلل موثر )Ne(، هتروزیگوسیتی مشاهده GGM024 دارای اندازه آللی 199 تا 149 جفت باز بودند.
Load more

Recommended publications
  • Identification of Parasites of Aphanius Vladykovi from Shalamzar and Salm Lakes, Chaharmahal Va Bakhtiari Province, Iran
    مجله علمی شیﻻت ایران DOI): 10.22092/ISFJ.2018.117720) سال بیست و هفت/ شماره 4 شناسائی انگلهای ماهی گورخری (Aphanius vladykovi) دریاچههای شلمزار و سلم استان چهارمحال و بختیاری 3 2* 1 مهدی رئیسی ، اسماعیل پیرعلی خیرآبادی ، پروین محسنی *[email protected] 1- گروه بهداشت و بیماریهای آبزیان، دانشکده دامپزشکی، واحد شهرکرد، دانشگاه آزاد اسﻻمی، شهرکرد، ایران 2- گروه شیﻻت، دانشکده منابع طبیعی و علوم زمین، دانشگاه شهرکرد، شهرکرد، ایران 3- گروه بهداشت و بیماریهای آبزیان، دانشکده دامپزشکی، دانشگاه شهرکرد، شهرکرد، ایران تاریخ دریافت: فروردین 1397 تاریخ پذیرش: خرداد 1397 لغات کلیدی: کپور دندان دار زاگرس )Aphanius vladykovi(، ماهی گورخری، انگلهای ماهی، Ornithodiplostomum گونههای جنس Aphanius در نقاط مختلف جهان از 1380؛ Raissy et al., 2011(. در سالهای اخیر بهدﻻیل جمله حوزه مدیترانه، جنوب شرق آسیا، نواحی شمالی مختلف از جمله کم آبی، آلودگی منابع آبی، رها شدن هند، سومالی و ایران یافت می شوند. از بین 23 گونه بخشی از ماهیان قزل آﻻی پرورشی به رودخانهها و ... شناخته شده، تاکنون 7 گونه و زیر گونه در ایران شناسائی جمعیت این ماهی با کاهش چشمگیری روبرو شده است شده است. جنس Aphanius متعلق به خانواده )فتح اللهی، Raissy .)1392 و همکاران )2011( کپورماهیان دنداندار1 از راسته کپوردندان ماهی شکﻻن2 آلودگیهای انگلی را نیز به عنوان یکی از علل مهم در میباشد و تنها جنس این خانواده است که به طور طبیعی کاهش جمعیت این گونه در تاﻻب گندمان ذکر کرد هاند. در آبهای ایران یافت میشود ) ,Coad and Keivany این امر با توجه به اینکه ماهی کپور دندان دار زاگرس در Keivany and Soofiani, 2004 ;2000(. در این میان فهرست گونههای در حال انقراض و محافظت شده قرار گونه کپور دنداندار زاگرس3 از اهمیت خاصی برخوردار دارد اهمیت دوچندانی مییابد )Downloaded from isfj.ir at 7:25 +0330 on Thursday September 30th 2021 [ DOI: 10.22092/ISFJ.2018.117720 ] .)Raissy et al., 2011 است.
    [Show full text]
  • Re-Validation and Re-Description of an Endemic and Threatened Species, Aphanius Pluristriatus (Jenkins, 1910) (Teleostei, Cyprinodontidae), from Southern Iran
    Zootaxa 3208: 58–67 (2012) ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2012 · Magnolia Press ISSN 1175-5334 (online edition) Re-validation and re-description of an endemic and threatened species, Aphanius pluristriatus (Jenkins, 1910) (Teleostei, Cyprinodontidae), from southern Iran HAMID REZA ESMAEILI1,4, AZAD TEIMORI2,3, ZEINAB GHOLAMI3, NEDA ZAREI1 & BETTINA REICHENBACHER3,4 1Department of Biology, College of Sciences, Shiraz University, Shiraz 71454, Iran. 2Department of Biology, Faculty of Sciences, Shahid-Bahonar University of Kerman 22 Bahman Blvd. Kerman, 76169-14111 Iran 3Department of Earth- and Environmental Sciences, Palaeontology & Geobiology & GeoBio-CenterLMU, Ludwig-Maximilians-Univer- sity, Richard-Wagner-Strasse 10, D-80333 Munich, Germany 4Corresponding authors. E-mails: [email protected]; [email protected] Abstract Aphanius pluristriatus (Jenkins, 1910) (Cyprinodontidae) is a poorly known species from Fasa, located in the Mond River drainage system, east of Shiraz, southern Iran. It has not been investigated since its first description, its validity has been questioned and a synonymy with A. sophiae (Heckel, 1849) has been suggested. In this study, we describe a new collection of Aphanius specimens from the Zarjan spring system, which is probably the same spring system from where Jenkins (1910) collected the type specimens of A. pluristriatus. The morphological characters of our new series of specimens are consistent with those of A. pluristriatus as originally described by Jenkins (1910). We emend the original description of A. pluristriatus and add morphometric and meristic data. A comparison with the related taxa A. sophiae, A. farsicus (for- mer A. persicus) and A.
    [Show full text]
  • An Updated List of Taxonomy, Distribution and Conservation Status (Teleostei: Cyprinodontoidea)
    Iran. J. Ichthyol. (March 2018), 5(1): 1–29 Received: January 5, 2018 © 2018 Iranian Society of Ichthyology Accepted: March 1, 2018 P-ISSN: 2383-1561; E-ISSN: 2383-0964 doi: 10.22034/iji.v5i1.267 http://www.ijichthyol.org Review Article Cyprinodontid fishes of the world: an updated list of taxonomy, distribution and conservation status (Teleostei: Cyprinodontoidea) Hamid Reza ESMAEILI1*, Tayebeh ASRAR1, Ali GHOLAMIFARD2 1Ichthyology and Molecular Systematics Research Laboratory, Zoology Section, Department of Biology, College of Sciences, Shiraz University, Shiraz, Iran. 2Department of Biology, Faculty of Sciences, Lorestan University, 6815144316 Khorramabad, Iran. Email: [email protected] Abstract: This checklist aims to list all the reported cyprinodontid fishes (superfamily Cyprinodontoidea/pupfishes) of the world. It lists 141 species in 8 genera and 4 families. The most diverse family is Cyprinodontidae (54 species, 38%), followed by Orestiidae (45 species, 32%), Aphaniidae (39 species, 28%), and Cubanichthyidae (3 species, 2%). Among 141 listed species, 73 (51.8%) species are Not Evaluated (NE), 15 (10.6%) Least Concern (LC), 9 (6.4%) Vulnerable (VU), 3 (2.1%) Data Deficient (DD), 11 (7.8%) Critically Endangered (CR), 4 (2.8%) Near Threatened (NT), 18 (12.8%) Endangered (EN), 3 (2.1%) Extinct in the Wild (EW) and 5 (3.5%) Extinct of the Red List of IUCN. They inhabit in the fresh, brackish and marine waters of the United States, Middle America, the West Indies, parts of northern South America, North Africa, the Mediterranean Anatolian region, coastal areas of the Persian Gulf and Makran Sea (Oman Sea), the northern Arabian Sea east to Gujarat in India, and some endorheic basins of Iran, Pakistan and the Arabian Peninsula.
    [Show full text]
  • Karyological Analysis of Two Endemic Tooth-Carps, Aphanius
    TurkJZool 31(2007)69-74 ©TÜB‹TAK KaryologicalAnalysisofTwoEndemicTooth-Carps, Aphaniuspersicus and Aphaniussophiae (Pisces:Cyprinodontidae),fromSouthwestIran H.R.ESMAEILI*,Z.PIRAVARandA.H.SHIVA DepartmentofBiology,CollegeofSciences,ShirazUniversity,Shiraz-IRAN Received:16.01.2006 Abstract: Thekaryotypesof2endemictooth-carpsofIran,Aphaniuspersicus (Jenkis,1910)andAphaniussophiae (Heckel,1849), wereinvestigatedbyexaminingmetaphasechromosomesspreadsobtainedfromgillepithelialandkidneycells.Thediploid chromosomenumbersofbothspecieswere2n=48.Thekaryotypesconsistedof11pairsofsubmetacentricand13pairsof subtelocentricchromosomesin A.persicus and14submetacentricand10subtelocentricchromosomesin A.sophiae .Thearm numbersin A.persicus and A.sophiae wereNF=70andNF=76,respectively.Sexchromosomeswerecytologically indistinguishableinbothtooth-carps. KeyWords: Aphaniuspersicus,Aphaniussophiae,karyotype,chromosome,idiogram Introduction cytogeneticstudiesmayprovideacomplementarydata TheCyprinodontidaearerepresentedinIranby6 sourceformoreaccurateandpreciseidentificationof species(Coad,1988,1995,1996;Scheel,1990): thesefishes.Applicationofthistypeofstudyhasreceived Aphaniusginaonis (Holly,1929); A.mento (Heckel, considerableattentioninrecentyears(Ozouf-Costazand 1843); A.dispar (Rüppell,1828); A.vladykovi Coad, Foresti,1992;Galettietal.,2000).Fishchromosome 1988; A.sophiae (Heckel,1849);and A.persicus datahavegreatimportanceinstudiesconcerning (Jenkins,1910).Theyareverycolorfulfishandcanbe evolutionarysystematics,aquaculture,mutagenesis, keptinaquaria;hence,theymaybecomepartofthe
    [Show full text]
  • T. C. Uludağ Üniversitesi Fen Bilimleri Enstitüsü Türkiye Endemiği Siraz Baliği Capoeta Baliki (Turan, Kotte
    T. C. ULUDAĞ ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ TÜRKİYE ENDEMİĞİ SİRAZ BALIĞI CAPOETA BALİKİ (TURAN, KOTTELAT, EKMEKÇİ & İMAMOĞLU, 2006) (CYPRINIFORMES: CYPRINIDAE) 'NİN HELMİNT FAUNASI MCEBO EMMANUEL MNISI TÜRKİYE ENDEMİĞİ SİRAZ BALIĞI CAPOETA BALİKİ (TURAN, KOTTELAT, EKMEKÇİ & İMAMOĞLU, 2006) (CYPRINIFORMES: CYPRINIDAE) 'NİN HELMİNT FAUNASI MCEBO EMMANUEL MNISI T. C. ULUDAĞ ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ TÜRKİYE ENDEMİĞİ SİRAZ BALIĞI CAPOETA BALIKİ (TURAN, KOTTELAT, EKMEKÇİ & İMAMOĞLU, 2006) (CYPRINIFORMES: CYPRINIDAE) 'NİN HELMİNT FAUNASI MCEBO EMMANUEL MNİSİ Prof. Dr. Hikmet S. YILDIRIMHAN (Danışman) YÜKSEK LİSANS TEZİ BİYOLOJİ ANABİLİM DALI BURSA- 2017 Her hakkı saklıdır ÖZET Yüksek Lisans Tezi TÜRKİYE ENDEMİĞİ SİRAZ BALIĞI, CAPOETA BALIKİ (TURAN, KOTTELAT, EKMEKÇİ & İMAMOĞLU, 2006) (CYPRINIFORMES: CYPRINIDAE) 'NİN HELMİNT FAUNASI MCEBO EMMANUEL MNİSİ Uludağ Üniversitesi Fen Bilimleri Enstitüsü Biyoloji Anabilim Dalı Danışman: Prof. Dr. Hikmet Sami YILDIRIMHAN Şubat, Mart ve Nisan 2017 Ayları sırasında, 65 Siraz Balığı Capoeta baliki, Eskişehir'de Seydi Nehri'nden helmint parazitleri incelenmek üzere toplantı. Bu balıklardan 24’ünde helmint parazit raslanmıştır ve toplam 65 parazit gözlenmiştir. Kaydedilen bu parazitler 1 Digeanea; Allocreadium isoporomu ve 3 nematod türü; Contracaecum sp, Eustrongylides excisus ve Rabdochona denutata'dan oluşmaktadır. Allocreadium isoporom 12 balıkta (% 18.46) bulunmuştur. Balıkların% 12.31'ini oluşturan sekiz balık, Contracaecum sp., Eustrongylides excisus ve Rabdochona denutata ile enfekte
    [Show full text]
  • (Cyprinidae), in Bibi-Sayyedan River, Tigris Basin
    NORTH-WESTERN JOURNAL OF ZOOLOGY 11 (1): 163-170 ©NwjZ, Oradea, Romania, 2015 Article No.: 141402 http://biozoojournals.ro/nwjz/index.html Reproductive biology and gonad histology of the Kura Barbel, Barbus lacerta (Cyprinidae), in Bibi-Sayyedan River, Tigris basin Hakimeh DOPEIKAR1, Yazdan KEIVANY1,* and Mohammad SHADKHAST2 1. Department of Natural Resources (Fisheries Division), Isfahan University of Technology, Isfahan 84156-83111, Iran. 2. Department of Basic Science, Faculty of Veterinary, Shahrekord University, Shahrekord, Iran. *Corresponding author, Y. Keivany, Phone: +98 (31) 3391-3572, Fax: +98 (31) 3391-2840, E-mail: [email protected] Received: 06. June 2014 / Accepted: 10. October 2014 / Available online: 17. January 2015 / Printed: June 2015 Abstract. Maturity age, spawning period, fecundity and gonad histology of the Kura Barbel in Bibi-Sayyedan River of Semirom (Tigris basin) were determined. A total of 445 specimens were captured by monthly collections from August 2010 to July 2011. Specimens were caught by electrofishing, seine net and cast net and transported to the laboratory on ice for further examination. The sex ratio was determined as 1.8M:1F, a ratio significantly different from the expected ratio. Males and females become sexually mature in their first year. Gonadosomatic Index (GSI) value was the highest in April for both sexes. Mean ± SE of absolute fecundity was 8249 ± 997 eggs and also, the relative fecundity was 140 egg/g body weight. Based on the results of GSI, egg diameter and histological studies, spawning period of this fish occur from late March to August with a peak in April. Key words: Cypriniformes, gonad development, egg diameter, gonadosomatic index, reproduction.
    [Show full text]
  • Karyosystematics of an Endemic Tooth-Carp, Aphanius Shirini (Teleostei: Cyprinodontidae) from Iran
    Journal of Cell and Molecular Research (2017) 9 (2), 54-58 DOI: 10.22067/jcmr.v9i2.67315 Research Article Karyosystematics of an Endemic tooth-carp, Aphanius shirini (Teleostei: cyprinodontidae) from Iran Azam Mansoori1, Mehregan Ebrahimi1,2, Ali Gholamhosseini1, Hamid Reza Esmaeili1,* 1 Department of Biology, College of Sciences, Shiraz University, Shiraz, Iran 2School of Biological Sciences, Flinders University, Adelaide, SA, Australia Received 8 Septamber 2017 Accepted 15 October 2017 Abstract The karyological and cytological characteristics of an endemic cyprinodont fish of Iran, Aphanius shirini have been investigated for the first time by examining metaphase chromosomes spreads obtained from gill epithelial and kidney cells. The diploid chromosome number of this species is 48. The karyotype consisted of one submetacentric and 23 subtelocentric pairs of chromosomes (2Sm + 46St). The chromosome arm number (NF) is 50. Sex chromosomes were cytologically indistinguishable in this tooth-carp. Based on the present and previous reported diploid chromosome number for other cyprinodont species, it can be suggested that the diploid chromosome number of 2n = 48 is the modal number of the cyprinodont fish. Keywords: Cyprinodontiformes, Chromosome, Cytogenetical analysis, Idiogram Introduction Cyprinodontiformes order comprises 10 families been reported from Iran consisted of A. dispar and and about 1326 species (Eschmeyer and Fong, 1998) A. ginaonis (Esmaeili et al., 2008a), A. farsicus and of mostly small, fresh and brackish water fish A. sophiae (Esmaeili et al., 2007), A. isfahanensis inhabiting harsh environments, such as saline or very (Esmaeili et al., 2008b), A. mento (Arai, 2011) and warm waters, water of poor quality, or isolated Aphanius vladykovi (Esmaeili et al., 2009).
    [Show full text]
  • Comparison of the Body Shape of Aphanius Vladykovi Populations (Teleostei: Aphaniidae) Using Geometric Morphometric Method
    Iranian Journal of Animal Biosystematics (IJAB) Vol.16, No.2, 145-154, 2020 IJAB DOI: 10.22067/ijab.v16i2.85507 ISSN: 1735-434X (print); 2423-4222 (online) RESEARCH ARTICLE Open access Comparison of the body shape of Aphanius vladykovi populations (Teleostei: Aphaniidae) using geometric morphometric method Abolhasani Koupaie, F.1, Heydarnejad, M.S.1, Tabatabaei, S.N.2, Bakhtiarifar, A.3 and Hashemzadeh Segherloo, I.3* 1Department of Animal Sciences, Faculty of Basic Sciences, Shahrekord University, Shahrekord, Iran 2Department of Biodiversity and Ecosystem management, Environmental Sciences Research Center, Shahid Beheshti University, Tehran, Iran 3Department of Fisheries and Environmental sciences, Faculty of Natural Resources and Earth Sciences, Shahrekord University, Shahrekord, Iran (Received: 8 February 2020; Accepted: 8 July 2020) Abstract The main purpose of this study was to investigate the morphological changes and body shape variations of the Zagros Tooth-carp Aphanius vladykovi populations in six water bodies located in Chaharmahal and Bakhtiari province, Iran. For this purpose, 240 specimens were collected from the Choghakhor and Gandoman wetlands, the Shalamzar, Balagholi, and Brovi springs, and the Beheshtabad River. Twelve landmark points were digitized on the right side of the fish. Statistical analyses including Principal Component Analysis (PCA), Discriminant Function Analysis (DFA), and Cluster Analysis (CA) were performed using TPS package, SYSTAT 9, and PAST Software. Discriminant function analysis revealed that female fish in different localities show more pronounced body shape differences compared to males from different localities (P<0.001). In addition, in clustering analysis performed among males and among females, two clusters were resolved, which were fairly similar for males and females.
    [Show full text]
  • Aphanius Vladykovi) Ecological Risk Screening Summary
    Zagros Tooth-carp (Aphanius vladykovi) Ecological Risk Screening Summary U.S. Fish & Wildlife Service, July 2017 Revised, August 2017 Web Version, 11/29/2017 1 Native Range and Status in the United States Native Range From Froese and Pauly (2017): “Asia: Iran.” Status in the United States This species has not been reported as introduced or established in the United States. Means of Introductions in the United States This species has not been reported as introduced or established in the United States. 2 Biology and Ecology Taxonomic Hierarchy and Taxonomic Standing From ITIS (2017): “Kingdom Animalia Subkingdom Bilateria Infrakingdom Deuterostomia 1 Phylum Chordata Subphylum Vertebrata Infraphylum Gnathostomata Superclass Actinopterygii Class Teleostei Superorder Acanthopterygii Order Cyprinodontiformes Suborder Cyprinodontoidei Family Cyprinodontidae Subfamily Cyprinodontinae Tribe Orestiini Genus Aphanius Species Aphanius vladykovi Coad, 1988” “Current Standing: valid” Size, Weight, and Age Range From Froese and Pauly (2017): “Max length : 6.1 cm TL male/unsexed; [Alavi-Yeganeh et al. 2011]; 7.6 cm TL (female); common length : 4.0 cm TL male/unsexed; [Huber 1996]; max. published weight: 3.70 g [Keivany and Soofiani 2004]; max. published weight: 3.70 g” Environment From Froese and Pauly (2017): “Freshwater; benthopelagic; pH range: 6.2 - 6.5; non-migratory.” From Keivany and Soofiani (2004): “Aphanius vladykovi is commonly found in fresh water with a conductivity of 240–280 μS (in aquaria they survived salinities up to 30 ppt). […] The habitat bottom is generally muddy, interspersed with pebbles. The water is clear in the Modar-Dokhtar spring and running slowly, but cloudy in the river.” “The species is euryhaline and eurythermal and mostly found in neutral to basic waters.
    [Show full text]
  • Review Article Review of Aphanius Farsicus: a Critically Endangered Species (Teleostei: Cyprinodontidae) in Iran
    Iran. J. Ichthyol. (March 2016), 3(1): 1–18 Received: December 7, 2015 © 2015 Iranian Society of Ichthyology Accepted: February 5, 2016 P-ISSN: 2383-1561; E-ISSN: 2383-0964 doi: 10.7508/iji.2016.01.001 http://www.ijichthyol.org Review Article Review of Aphanius farsicus: a critically endangered species (Teleostei: Cyprinodontidae) in Iran Hamid Reza ESMAEILI1*, Mojtaba MASOUDI1, Mehregan EBRAHIMI2,3, Amir ELMI4 1Ichthyology and Molecular Systematics Lab., Department of Biology, College of Sciences, Shiraz University, Shiraz, 71454 Iran. 2Behavioural Ecology Lab., Department of Biology, College of Sciences, Shiraz University, Shiraz, 71454 Iran. 3School of Biological Sciences, Flinders University, Adelaide, South Australia 5001, Australia. 4Department of Environment, Tehran, Iran. * Email: [email protected] Abstract: The systematics, morphology, phylogeny, distribution, biology, economic importance and conservation of the Fars tooth-carp, Aphanius farsicus of Iran are described, the species is illustrated, and a bibliography on this endemic, critically endangered species is provided. Iran and central Anatolia show the highest diversity of Aphanius, and 14 extant (including Aphanius farsicus, an endemic species in the endorheic Lake Maharlu basin, South-western Iran) and one fossil species are known to occur in Iran based on data derived from fish morphometry and meristics, otoliths, scales and mtDNA sequences. Human-induced disturbance or anthropogenic activities, including hydrological alteration, introduction of exotic species, intensive aquaculture industry, water pollution, rapid sedimentation, natural disturbance (climate change and drought) and also limited distribution, have forced Aphanius farsicus populations to the edge of extinction. Aphanius farsicus can benefit from a combination of reintroduction, assisted colonization and capture release which potentially increase success rate of a conservation management plan.
    [Show full text]
  • (Cyprinodontidae) Et Gambusia (Poeciliidae) En Algérie: Statut Écologique Et Variabilité Biologique
    N° d’ordre : 09/2011-M/S.B République Algérienne démocratique et populaire Ministère de l’Enseignement Supérieur et de la Recherche Scientifique Université des Sciences et de la Technologie Houari Boumediene Faculté des Sciences Biologiques MEMOIRE Présenté pour l’obtention du diplôme de MAGISTER En : Sciences BIOLOGIQUES Spécialité : Biologie des populations animales Par : Melle HASSEN Anissa Sujet : Les genres Aphanius (Cyprinodontidae) et Gambusia (Poeciliidae) en Algérie: statut écologique et variabilité biologique Soutenu publiquement le : 19 / 09 / 2011 devant le jury composé de : M HARCHOUCHE K. Maître de Conférences à l’USTHB Président M BOUHADAD R. Professeur à l’USTHB Directeur de thèse M LOUNACI A. Professeur à l’université de TIZI OUZOU Examinateur M ZOUAKH D. Maitre de Conférence/A à l’ENSSMAL/Alger Examinateur M ALILI D. Maître Assistant/A à l’USTHB Invité 1 Dédicaces 2 Je dédie ce travail à la mémoire d’une personne qui m’est très chère « Mon grand père Djoudi Bouzid » qui nous a quitté le 3 mai 2010, que ton âme repose en paix , (au seigneur nous appartenons et à lui nous revenons). Mon grand père qui m’a toujours encouragé et soutenu dans mes choix et dans mes études, et qui nous manquera à jamais. Je dédie également ce travail à mon père Mouloud, ma mère Djoudi Nadjia, et à mon frère Yacine, qui ont toujours été présents et qui m’ont soutenu et aidé. Je le dédie également : à mes grands parents : mémé, mamie, papi, mes tantes, mes oncles ainsi qu’a mes cousines et cousins. toutes mes copines : Malika Dahmani, Ilham Sahki , Yasmine Belabbas Nabi à toutes les personnes qui comptent à mes yeux, et qui ont contribué d’une manière ou d’une autre a changer ma vie.
    [Show full text]
  • Download (6MB)
    République Algérienne Démocratique et Populaire Ministère de l’Enseignement Supérieur et de la Recherche Scientifique Université Mohamed Khider –Biskra – ﺟﺎﻣﻌﺔ ﻣﺤﻤﺪ ﺧﻴﻀﺮ ﺑﺴﻜﺮﺓ Faculté des sciences exactes et des sciences de la nature et de la vie Département de Biologie Réf :………………… Thèse Présentée en vue de l’obtention du diplôme de Doctorat es.Sciences Spécialité : Biologie Thème Présenté par : CHAIBI Rachid Devant le jury : Président : Dr. BELHAMRA Mohamed Prof. Université de Biskra Directeur de thèse : Dr. SI BACHIR Abdelkrim Prof. Université de Batna Co-Directeur de thèse : Dr. Frédéric SANTOUL, M.C. (HDR), Université Paul Sabatier Toulouse (France) Examinateurs : Dr. HOUHAMDI Moussa, Prof. Université de Guelma Dr. OUAKID Mohamed, Prof. Université d’Annaba Dr. TARAI Nacer MC ‘A’, Université de Biskra Soutenu publiquement le :06 février 2014 Cette thèse doit beaucoup aux nombreuses personnes qui m’ont encouragé, soutenu et conforté au long de toutes ces années. Qu’elles trouvent dans ce travail l’expression de mes plus sincères remerciements pour leur aide, leurs conseils et disponibilité, tout en leur exprimant ma profonde gratitude Je renouvèle mes vifs remerciements à Monsieur SI BACHIR Abdelkrim Professeur. Université de Batna, Encadreur et Directeur de thèse de m'avoir encadré durant ces années de doctorat en étant toujours disponible et encourageant, pour son aide et conseils et pour ses grandes valeurs humaines. Monsieur Frédéric SANTOUL , M.C. (HDR), Université Paul Sabatier Toulouse (France), Co- directeur de thèse, pour
    [Show full text]