Coordinated Regulation of Gene Expression by E.Coli Chromatin Proteins FIS and H-NS

Home , Allantoinase, Altronate dehydratase, Cyanase, Cyanide hydratase, DCTP deaminase, DNA adenine methylase

Coordinated regulation of gene expression by E.coli chromatin proteins FIS and H-NS

A Dissertation Presented

Ramesh Mavathur Nanjundaiah

A thesis Submitted in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

in Biochemistry

School of Engineering and Science Jacobs University Bremen

Coordinated regulation of gene expression by E.coli chromatin proteins FIS and H-NS

Ramesh Mavathur Nanjundaiah

A thesis Submitted in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY in Biochemistry

Approved as to style and content by:

______Prof. Dr.Georgi Muskhelishvili

______Prof. Dr. Albert Jeltsch

______Prof. Dr. Sebastian Springer

______Prof. Dr. Andrew Travers

Date of Defense: August 29th 2007 School of Engineering and Science

Parts of this work has been published in:

Auner, H., Buckle, M., Deufel, A., Kutateladze, T., Lazarus, L., Mavathur, R., Muskhelishvili, G., Pemberton, I., Schneider, R., and Travers, A. (2003) Mechanism of transcriptional activation by FIS: role of core promoter structure and DNA topology. J Mol Biol 331: 331-344.

Blot, N., Mavathur, R., Geertz, M., Travers, A., and Muskhelishvili, G. (2006) Homeostatic regulation of supercoiling sensitivity coordinates transcription of the bacterial genome. EMBO Rep 7: 710-715.

Lang, B., Madan Babu, M., Blot, N., Bouffartigues, E., Buckle, M., Geertz, M., Gualerzi, C., Mavathur, R., Muskhelshvili, G., Pon, C., Rimsky, S., Stella, S., Travers, A., (2007) High affinity DNA binding sites for H-NS provide a molecular basis for selective silencing within proteobacterial genomes. Nucleic Acids Res: 35(18): 6330-7.

Geertz, M., Mavathur, R., Travers, A., Shimamoto, N., Muskhelishvili, G. RNA polymerase composition is homeostatically coupled with DNA topology in E. coli Submitted to EMBO reports.

ABSTRACT

Abstract

Bacteria are omnipresent small organisms that posses impressive ability to adapt to their environment. Adaptation, a universal phenomenon seen at all different levels of organizational complexity of life, is accomplished mainly by adjustment of the gene expression pattern. Studies using microarray-mediated transcript profiling in E.coli demonstrated the existence of direct correlations between the global gene expression patterns and different phases [Tao, 1999; Weber, 2005; Wei, 2001]. Previous work from our and other laboratories indicated that in E.coli the cellular transcription is under the control of a global regulatory network whose main components are - DNA topoisomerases, chromatin proteins modulating the supercoil dynamics of DNA and, the RNA polymerase. The aim of this project was to understand the basic structural mechanism of interaction of two of the components (DNA supercoiling and chromatin proteins) and the underlying functional coordination of gene expression in E.coli. To understand the coordination of the components, the problem was approached at two levels of complexity, (1) global – for this purpose we developed a novel DNA microarray-based approach combining mutations in the genes of chromatin proteins with directional changes of DNA superhelicity and (2)local - at the level of individual gene promoter, using as a model tyrT promoter system, to understand the molecular mechanism of the interplay between supercoiling and transcriptional regulators. The study has led us to propose that the global transcription regulation is spatiotemporally coordinated by the differential distribution of two types of information, ‘analog’ and ‘digital’. The digital or discontinous property of an information is manifest in the pattern of expressed genes at all times depending on the distribution of the analog component - DNA supercoiling - distribution of supercoiling in different parts of the genome. The analog component is continuously converted in the pattern of expressed genes and vice versa, thereby modulates the physiology to a dynamic equilibrium, which can be readjusted in response to changes in both the digital (mutation) and analog (growth phase or stress induced changes of supercoiling) information. On the example of tyrT promoter we demonstrate how the sequence organization of the

ABSTRACT

promoter region determines the supercoiling sensitivity of the promoters. Our data indicate that the transcription from a strong promoter, like tyrT, is a consequence of two phenomena, the local effect of binding of chromatin protein FIS at the promoter region and the general effect of FIS on the average superhelical density of the DNA.

ACKNOWLEDGEMENTS

Acknowledgements

I would like to express my appreciation, gratitude and thanks to the following people

who have supported this work in many ways.

I am indepted to Prof. Dr. Georgi Muskhelishvili not just for guiding my PhD work but

for inspiring scientific temper in me, for being a mentor to whom I always looked up to during predicament and have very rarely been not satisfied by his suggestions and opinions to problems both scientific and general.

Sincere thanks to Jacobs University Bremen (formerely International University

Bremen) and Max Planck Institute for Terrestrial Microbiology at Marburg for giving me an opportunity to pursue my PhD work.

I thank my doctoral examination committee, Prof. AndrewTravers, Prof. Albert Jeltsch and Prof. Sebastian Springer for support and motivation during my time at Jacobs

University and for their thorough appraisal of this dissertation.

I also take this opportunity to thank my family: my father, my mother, my sister Rohini, my borther-in-law Prakash, my nephew Varun, my niece Varsha, my brother Prasad, my sister-in-law Shvetha and my twin nieces Anagha and Anusha. The love showered by these people has always provided inspiration and motivation for me.

A special thanks to my group members Marci, Michi, Sebastian, Nico and Claudia who made working in the lab an enjoyable experience. I will always cherish the time I spent with these intelligent people. And also thanks to Sissi for inducing and offering creative inputs on improving the appearance of my thesis and presentation beside being a good friend. Thanks also to all my friends in Marburg all of whom gave a very nice

ACKNOWLEDGEMENTS

first impression of Germany, so much so that I feel Marburg as my home town in

Germany.

The time at the university was pleasant because of my friends all of whom I wish to

thank. And friends from IGC, Sanjay, Arun, Abhishek (more popularly known as

‘Badiya’) and Nandu for organizing and participating in the weekend parties.

TABLE OF CONTENTS

1 Introduction ………………………………………………………………….. 1

1.1 Is there a common coordinating factor? ………………………………... 2 1.1.1 Is there a common coordinating mechanism? ………………………… 3

1.2 Global transcription coordination - current knowledge …………….. 4 1.2.1 Gene promoters ………………………………………………………. 5 1.2.2’Gene promoters respond distinctly to changes of supercoiling ………… 7 1.2.3 DNA Supercoiling and mechanisms regulating it ……………………. 9 1.2.4 Supercoiling and growth transitions …………………………………. 11 1.2.5 The nucleoid associated proteins – major players in global gene expression regulation …………………………………………………………….. 12 1.2.6 Composition of RNAP also changes with growth …………………… 14

1.3 Organisation of global transcription - coordinated view …………… 15

2 Materials and methods ……………………………………………………… 18

2.1 Materials ……………………………………………………………….. 18 2.1.1 Enzymes & chemicals ………………………………………………… 18 2.1.2 Antibiotics ……………………………………………………………. 19 2.1.3 Media …………………………………………………………………. 19 2.1.4 Buffers and stock solutions …………………………………………… 20 2.1.5 Bacterial strains ………………………………………………………. 21 2.1.6 Plasmids ……………………………………………………………… 22 2.1.7 Primers ……………………………………………………………….. 23

2.2 Methods ………………………………………………………………… 24 2.2.1 Agarose gel electrophoresis ………………………………………….. 24 2.2.2 Small and medium scale isolation of plasmid DNA using Qiagen kit … 24 2.2.3 Restriction Digestion ………………………………………………… 25 2.2.4 Polymerase chain reaction …………………………………………… 25

I TABLE OF CONTENTS

2.2.5 Preparation of competent E.coli cells using calcium chloride ……….. 25 2.2.6 Transformation of E.coli cells ………………………………………… 25 2.2.7 Purification of nucleic acids by Phenol:Chloroform extraction ……… 26 2.2.8 Concentrating and quantification of nucleic acids …………………… 26 2.2.9 Polyacrylamide sequencing gels ……………………………………… 26 2.2.10 Growth curves and norfloxacin treatment ……………………………. 27 2.2.11 Extraction and quality check of total RNA …………………………… 27 2.2.12 Microarray hybridization …………………………………………….. 28 2.2.13 Microarray analysis …………………………………………………… 29 2.2.14 Real-time PCR ……………………………………………………….. 30 2.2.15 High resolution agarose gel electrophoresis and determination of sigma (σ) ……………………………………………………………………….. 30 2.2.16 In vitro transcription …………………………………………………. 31 2.2.17 Primer extension ……………………………………………………… 32 2.2.18 Potassium permanganate footpriniting ……………………………….. 32 2.2.19 β-galactosidase assay ………………………………………………… 33

3 Results ……………………………………………………………………….. 34

3.1 Growth phase dependent global transcriptional regulation ………… 34 3.1.1 Growth of CSH50 and LZ strains ……………………………………. 34 3.1.2 A novel microarray based approach to derive growth phase-specific transcript profiles organized by supercoiling and chromatin proteins ………………………………………………………………………….. 36 3.1.3 Changes of supercoiling during growth ……………………………… 38 3.1.4 Genomic wheels of supercoiling sensitivity …………………………. 39 3.1.5 Variations of supercoiling-associated transcripts …………………….. 42 3.1.6 Supercoiling sensitivity of biosynthesis and degradation pathways …. 45 3.1.7 Coordination of metabolic pathways by supercoiling sensitivity …….. 45

3.2 Role of supercoiling and chromatin protein FIS in transcriptional regulation of an individual promoter ………………………………… 49 3.2.1 Mechanism of transcriptional regulation by FIS & supercoiling: tyrT promoter paradigm …………….…………………………………………………………… 49

II TABLE OF CONTENTS

3.2.2 In vivo expression of tyrT in CSH50 Wt & fis mutant ………………. 50 3.2.3 Dependence of promoter activity on superhelical density in vivo …… 51 3.2.4 Dependence of promoter activity on superhelical density in vitro …... 53 3.2.5 Effects of promoter mutations on the function ………………………. 54

4 Discussion …………………………………………………………………… 58

4.1 Interdependency of supercoiling and NAPs …………………………. 59

4.2 Supercoiling coordinates metabolic functions ……………………….. 61

4.3 Activity of tyrT promoter - Interaction of supercoiling and FIS at the promoter level …………………………………………………………. 63 4.3.1 Promoter structure and function ……………………………………… 64 4.3.2 Mechanism of transcriptional activation of the tyrT promoter ………. 66

5 Conclusion …………………………………………………………………… 68

6 References ……………………………………………………………………. 69

7 Appendix I - Supplementary data: Gene lists from microarray experiments. .. 81

III LIST OF TABLES

List of tables

Table 1 Bacterial strains used …………………………………………. 21

Table 2 Number of single and double-coded transcripts in fis and hns transcript profiles ……………………………………………… 43

Table 3 Supercoiling sensitivity of genes of biosynthesis and degradation pathways ..………………………………………………………. 45

Table 4 RT-PCR analysis of some of the genes from TCA cycle and purine biosynthesis ..……………………………………………………. 48

Supplementary table I CSH50 wild-type Vs CSH50 ∆fis, Mid- exponential phase ….……………………….. 81

Supplementary table II CSH50 wild-type Vs CSH50 ∆fis, Transition to stationary phase ...……………………….. 89

Supplementary table III CSH50 wild-type Vs CSH50 ∆fis, Late stationary phase ………………………………………. 92

Supplementary table IV CSH50 wild-type Vs CSH50 ∆hns, Mid- exponential phase …………………….. 97

Supplementary table V CSH50 wild-type Vs CSH50 ∆hns, Transition to stationary phase ………………....………….. 104

Supplementary table VI CSH50 wild-type Vs CSH50 ∆hns, Late stationary phase …………………………….. 107

Supplementary table VII : LZ41 wild-type Vs LZ54 wild-type .……….. 110

Supplementary table VIII LZ41 ∆fis Vs LZ54 ∆fis ……...…………….. 123

Supplementary table IX LZ41 ∆hns Vs LZ54 ∆hns ..…………...... 136

Supplementary table X LZ41 wild-type Vs LZ41 ∆fis …..…………. 150

IV LIST OF TABLES

Supplementary table XI LZ54 wild-type Vs LZ54 ∆fis …...…………. 160

Supplementary table XII LZ41 wild-type Vs LZ41 ∆hns ……….. .….. 167

Supplementary table XIII LZ54 wild-type Vs LZ54 ∆hns ……….. .….. 179

V LIST OF FIGURES

List of Figures

Figure 1: Schematic illustration of operation of the genetic system involving an

alternation of the digital (discontinuous) and analog (continuous) information. ... 4

Figure 2: Structure of consensus Eσ70 promoter showing functionally important

region. ……………………………………………………………………………… 6

Figure 3: Structural profiles of Sigma70 and Sigma54 promoter regions. …….. 7

Figure 4: In vitro transcription from fis & bla promoters at different superhelical

densities …………………………………………………………………………….. 8

Figure 5: Schematic representation of core promoters with different spacer

length. ……………………………………………………………...………………... 9

Figure 6: Graphical representation of global DNA topology changing with growth

...... 12

Figure 7: Abundance of NAPs during different phases of growth ...... 13

Figure 8: Growth phase-dependent change in the level of different forms of the

RNA polymerase...... 15

Figure 9: Overview of comparative gene expression of wild-type & fis (example) analysis using microarrays...... 29

Figure 10: Growth curves of CSH50 wild-type and the mutants...... 35

Figure 11: Design of DNA microarray experiments...... 37

VI LIST OF FIGURES

Figure 12: Topoisomer distributions of plasmids (pUC18) isolated from growing

cells...... 39

Figure 13: Genomic wheels showing spatiotemporal distribution of supercoiling

associated transcripts...... 41

Figure 14: Changes of supercoiling associated genes during growth in fis & hns mutants compared to wild-type ...... 44

Figure 15: Coordination of essential metabolic pathways by supercoiling sensitivity.

...... 47

Figure 16: Schematic representation of tyrT promoter...... 50

Figure 17: The relative β-galactosidase activity from different ptyrT derivatives. 51

Figure 18: In vivo expression of tyrT promoter constructs...... 52

Figure 19: In vitro transcription of ∆61 constructs of wild type and derivatives. . 54

Figure 20: in vitro transcription from tyrTwild-type and tyrTD at different supercoiling...... 55

Figure 21: Pottassium permanganate footprinting of ptyrT and its derivatives. .. 56

VII ABBREVIATIONS

Abbreviations

Promoter constructs with upstream sequence beyond

∆61 position -61 deleted.

∆fis strain with mutation in fis gene

∆hns strain with mutation in hns gene

Act genes activated under a stated condition bp base-pairs

CTP cytidine triphosphate

Cy3 Cyanine 3 dye

Cy5 Cyanine 5 dye o C degree Celsius dCTP deoxycytidine triphosphate dNTP deoxynucleoside triphosphate

DTT Dithiothreitol

EDTA ethylenediamine tetraacetic acid

E.coli Escherichia coli

RNAP polymerase holoeenzyme with sigma 70 70 Eσ subunit

GTP guanosine triphosphate

VIII ABBREVIATIONS

Hyp hypernegative supercoiling associated genes kbp kilo base-pairs

LS late sationary growth phase

Mbp million base-pairs

ME mid-exponential growth phase mg Milligram ml Mililitre mM Milimolar

μM Micromolar

μg Microgram

NAP nucleoid associated protein

NTP nucleoside tri-phosphae

PCR polymerase chain reaction ppGpp guanosine-3’,5’(bis)pyrophosphate

Rel relaxation associated genes

Rep genes repressed under a stated condition

RNAP RNA polymerase

RT-PCR Real-time PCR

SDS Sodium dodecyl sulphate

TAE Tris-acetate EDTA

IX ABBREVIATIONS

TBE Tris-borate EDTA

Tris Tris-(hydroxymethyl)-aminomethane

TS transition to stationary growth phase tyrT35U tyrT plasmid with a mutation in the -35 hexamer tyrTD tyrT plasmid with a mutation in the discriminator tyrTS tyrT plasmid with a mutation in the spacer tyrTWt plasmid with wild-type tyrT prmoter

UAS upstream activating sequence

V/cm volts per centimeter

ω omega subunit of RNAP

μg Microgram

μl Microlitre

σ sigma subunit of RNAP

X INTRODUCTION

1 Introduction

Cellular division, differentiation and development implicate gene expression programs, which are coordinated in time and space both in prokaryotes and eukaryotes. In prokaryotes, control of transcriptional initiation is the most pervasive form of gene regulation whereby recent development of high-throughput technologies allow to analyze simultaneously the activities of thousands of genes. Prokaryotes like E.coli K12 (non-pathogenic laboratory strain) give us in addition a possibility to study genetic regulation under wide range of variation in external physical and chemical parameters such as temperature, pH, barometric pressure, osmolarity, oxygen availability, nutrient supply and presence of toxic substances. Furthermore in this classical model organism a large amount of genetic information has already been accumulated, providing a unique opportunity for genome-wide analyses of global gene expression patterns.

E.coli is a facultative anaerobic, gram-negative bacterium growing at rates varying from 20 minutes to 24 hours depending on the environment. This organism thus shows an impressive ability to grow and divide rapidly but can grow slowly for prolonged times as well. E.coli growing in rich medium reproduces fast and does so primarily by elevating the expression levels of genes for ribosomal proteins and stable RNA, and other translation machinery factors. In contrast, in minimal medium expression levels of genes involved in biosynthesis of building blocks, notably amino acid biosynthesis are elevated [Wei et al., 2001; Tao et al., 1999; Weber et al., 2005]. Both these conditions are also associated with numerous subtle changes like redirection of intermediary metabolism, changes in electron transport chain composition and concentration of different metabolic enzymes [Murray et al., 1996; Neidhardt et al., 1987). During the growth, also a number of morphological and physiological attributes change. Investigation of gene expression patterns under different growth conditions reveals a distinct arrangement of expressed functions, indicating that E.coli possess proprietary over a multitude of gene expression programs. Heterogeneity of E.coli’s response is exemplified as follows in the classical book Escherichia coli and 1

INTRODUCTION

Salmonella: “In more than just a figurative sense, bacteria invented gene regulation, and the bacterial cell’s style of growth uniquely involves second-by-second adjustment in the flow of information from the genome to ribosomes. Individual mRNA molecules function for only a few minutes before being destroyed and replaced by newer, more timely information”.

The fundamental problem addressed is not so much the understanding particular gene expression programs but rather the mechanistic basis of the concerted rearrangements of these programs. One incentive of this work therefore is to reveal the mechanism coordinating the growth phase-dependent transcription in E.coli. for this we have developed a holistic approach, using microarrays and a combination of other in vitro and in vivo techniques, to demonstrate how differential spatio-temporal distributions of supercoiling sensitivity in the genome effected by NAPs coordinate growth phase dependent transcription patterns.

1.1 Is there a common coordinating factor?

A typical growth cycle of E.coli growing in batch culture when plotted against time describes a sigmoidal curve with three clearly discernible stages. Correlations have been observed between different stages along the sigmoidal curve, called phases of growth, and the global gene expression patterns [Wei et al., 2001; Tao et al., 1999; Weber et al., 2005]. To better understand this correlation it is essential to identify those factors which have global impact on the transcription process. In E.coli the transitions between the different growth phases are associated with remarkable alterations of three parameters that can affect cellular transcription: the protein composition of the nucleoid, the global supercoiling level of DNA and the composition of transcriptional machinery.

The two predominant RNA polymerase (RNAP) holoenzyme forms (based on number of genes they are known to transcribe) operating in E.coli, Eσ70 and Eσs (RNAP holoenzyme associated with sigma subunit 70 and sigma s) differ in their DNA topology requirements. The topological state of cellular promoters depends on the partitioning of unconstrained (i.e. free) and constrained (i.e. fixed by interactions with 2

INTRODUCTION

binding proteins) DNA supercoils and thus, on the composition of DNA-constraining nucleoid proteins (also termed Nucleoid Associated Proteins, NAPs). This composition substantially changes with the growth phase and affects the availability of gene promoters [Ali Azam et al., and Ishihama et al., 1999; McLeod et al., 2001]. Some of the nucleoid-associated proteins modulate the activities of cellular topoisomerases and can therefore also exert indirect effects on the growth phase-dependent gene transcription [Dorman et al., 2003; Muskhelishvili and Travers, 2003; Browning et al., 2004].

Alterations of global DNA topology are known to strongly affect the transcription initiation [Travers et al., 2001; Hatfield et al., 2002]. Experimentally induced changes of global DNA superhelicity in E.coli revealed that at least 300 genes are explicitly sensitive to these changes [Peter et al., 2004]. The alterations of global DNA superhelicity have been observed both during growth phase transitions and also in response to environmental challenges, thus implicating DNA supercoiling in coordination of gene expression with physiological demands [Balke and Gralla, 1987; Dorman et al., 1996; Tse-Dinh et al., 1997; Cheung et al., 2003; Travers and Muskhelishvili, 2005b]. Another switch of the growth phase-dependent gene expression pattern is accomplished by the growth phase-dependent modulation of RNAP by increased concentration of “stringent factor” ppGpp (guanosine-3',5'- (bis)pyrophosphate) and the competition between initiation sigma (σ) subunits, which confer different promoter specificities on the RNAP holoenzyme [Heinemann et al., 1997; Ishihama, 1999 and 2000]. Recently it was also proposed that the composition of the RNAP core is also subject to growth related changes [Geertz et al., 2007]

1.1.1 Is there a common coordinating mechanism?

Almost five decades ago, John von Neumann proposed that the flow of genetic information is coordinated by an alternation between the ‘digital’ (discontinuous) properties of unique genes and ‘analog’ (continuous) properties of the gene products [von Neumann, 1958].

INTRODUCTION

Figure 1: Schematic illustration of operation of the genetic system involving an alternation of the digital (discontinuous) and analog (continuous) information.

Global transcriptional response, represented as a corsstalk between ‘analog’ and ‘digital’ signals points towards a mechanism in which regulation of the gene expression does not function as an on-off switch but rather is the result of interdependent actions of several partially redundant pathways translating into varying analog output. This mode of transcriptional response is termed ‘Rheostatic control’ [Travers and Muskhelishvili, 2005b]. The inter-conversions between digital and analog properties offer multiple possibilities for cellular response, which can explain the dynamism manifest in the transcriptome of E.coli. Though the interplay of coordinating factors (superhelicity of DNA, NAPs & RNAP composition) has been uncovered for some gene promoters, the mechanistic basis for explaining the spatial and temporal coordination of transcription in the genome still remains elusive.

1.2 Global transcription coordination - current knowledge

In this section, the current knowledge of transcriptional regulation is briefly outlined to elucidate mechanisms that form the basis of the hypothesis explaining global coordination of transcription in the genome. Starting from individual gene promoter 4

INTRODUCTION

characteristics, the amount of variability in response that can be brought about by factors like NAPs and DNA supercoiling is described, and a brief introduction into how the factors themselves are modulated during growth is outlined.

1.2.1 Gene promoters

Transcription initiation is the predominant step in the gene regulation and promoter regions provide binding sites for the different regulatory factors to interact and initiate or repress transcription. The amount of gene product synthesized is primarily determined by the rate of productive initiation. The initiation rates can vary between 1.5X103 transcripts per generation to as low as 1 transcript per generation [McClure et al., 1985]. What determines the heterogeneity in the rate of transcription initiation? One of the principal determinants is the promoter sequence itself.

Important elements of the promoter sequence are the positions where a change in sequence affects the rate of initiation of transcription from the specified start site. Sequences recognized by Eσ70, the most abundant form of RNA polymerase holoenzyme, are shown in Figure 2. There are at least three features within the “core” region of the promoter DNA: two conserved 6-bp (base pair) DNA sequences centered approximately 10 and 33 bp upstream from the start site of transcription (+1), called the “–10” and “–35” hexamers; and the sequence of DNA that separates them, called the “spacer” region, which is most commonly 17 bp in length but can vary from 15 to 21 bp. Figure 2 summarizes the primary structure of the core promoter, specified by convention in the 5’ to 3’ direction as the sequence of the non-transcribed strand, which corresponds to the transcript sequence. When optimally aligned, the sequences of most promoters match at least 7 of the 12 bp in the consensus –35 (TTGACA) and –10 (TATAAT) hexamers [Lisser et al., 1993]. At many promoters, the primary start site (+1; specified by the same convention) is an A and the flanking bases are C(–1) and T(+2).

INTRODUCTION

+1 start -35 -10

UP element Spacer Discriminator 17bp

Core promoter

Figure 2: Structure of consensus Eσ70 promoter showing functionally important regions.

It is now generally accepted that promoter structure and geometry is used by bacteria as a key regulatory element [Perez-Martin et al., 1997]. Computational studies on promoter sequences have corroborated the experimental findings that the promoter regions are more curved and less stable than the average genomic DNA. Observation by Ozoline et al., of the positioning of the highly deformable TA dinucleotide approximately every 5.6 bp, also indicate the distinct flexibility of the promoters [Ozoline et al., 1999]. Analysis of curvature and deformability of the promoters based on their predicted sigma (σ) factor preference also demonstrate variability. From Figure 3, it is evident that the σ54 class promoters are less deformable compared to σ70 class. Sigma 54 protein is known to be structurally unrelated to σ70, and it also utilizes a different pathway to form open complexes during transcription initiation, which in the case of σ54 requires ATP [Gruber et al., 2003]. It is thought, that the core promoter -35 & -10 hexamer sequences, the discriminator sequence and the spacer region also have evolved to posses regulatory potential. Molecular genetic examinations of stable RNA promoters in E.coli have attributed some of the important regulatory events, like stringent regulation and growth-phase regulation to the core promoter elements [Travers et al., 1980; Josaitis et al., 1995; Auner et al., 2003].

INTRODUCTION

Figure 3: Structural profiles of sigma70 and sigma54 promoter regions. Comparison of sigma70 specific promoter regions with sigma54 regions show that sigma70 promoters have more intrinsic curvature and are also more easily deformable than sigma54 promoters [Pedersen, 2000 ].

1.2.2 Gene promoters respond distinctly to changes of supercoiling

One of the extrinsic determinants of the promoter activity is the superhelical density of the DNA. Negative supercoiling of the DNA provides the thermodynamic driving force that is required for unwinding the DNA double helix during the initiation process and it

INTRODUCTION

can also influence elongation and termination [Lim et al., 2003]. Variations in promoter’s core sequence combined with a range of negative supercoiling bring in an opportunity for a very wide transcriptional response.

Promoters respond distinctly to supercoiling changes. The in vitro response of promoters of fis (encoding chromatin protein FIS) and bla (beta lactamase) genes to varying supercoiling is shown in Figure 4. The two promoters are quite different in their architecture. The fis promoter has a non-consensus -35 hexamer sequence and a GC rich discriminator which makes it more strictly dependent on supercoiling. Even promoters that are quite similar, for example, ‘stringent’ promoters of fis and tyrT (tyrosyl tRNA) genes deviate in their response to supercoiling. The core promoter sequences of tyrT also comprise a non-consensus -35 hexamer and a GC rich discriminator, but the distinction is due to the requirement of UP element and the upstream activating sequence (UAS) in the case of tyrT promoter [Auner et al., 2003]. The activating protein binding at the UAS (FIS in the case of tyrT) essentially wraps the DNA around itself to buffer the promoter against any variations in the global superhelical density [Maurer et al., 2006]. This superhelical density that is fostered at the local promoter region through binding of protein is described as ‘effective supercoiling’ [Travers, 2005b], which is a local parameter that is recognized by the polymerase. Effective supercoiling can be considerably different from the ‘global supercoiling’ prevailing at a particular instant.

Figure 4: In vitro transcription from fis & bla promoters at different superhelical densities [Modified with permission from Schneider, 2000].

INTRODUCTION

Unwinding of the -10 hexamer and downstream sequences towards the start point is strongly facilitated by negative supercoiling. Furthermore, the necessity for supercoiling is seen in the geometry of arrangement of -10 & -35 hexamer sequences, the principal recognition elements for RNAP holoenzyme. The consensus spacer length of 17bp aligns the two hexamer sequences in an optimal orientation for RNAP binding. Variations in the spacer length would require changes of twist (Figure 5) for optimal alignment of the –10 and –35 elements.

Figure 5: Schematic representation of core promoters with different spacer length.

1.2.3 DNA Supercoiling and mechanisms regulating it

The DNA inside the cell adopts many different structural forms to suit differenet processes like transcription, replication, recombination etc. All the different processes pose a challenge to maintain the lengthy polymer (DNA) intact and compact. Since the movements of individual nucleotides in the polymer have only certain degrees of freedom, the compensatory adjustments to relieve the helical tension are realized by coiling of one double helix over the other, at which the DNA is said to be ‘supercoiled’. The supercoiling can either be positive or negative. The supercoiling is said to be negative when the DNA strands are under-wound, that is, each 360o twist of DNA will 9

INTRODUCTION

have more base-pairs than there would be in a relaxed molecule of DNA (10.4 bp/turn). The superhelical tension can be relieved by nicking one of the strands of DNA, rotating and re-ligating the strands. The other option would be to convert the helical tension of the twist into writhe, by which the DNA attains the supercoiled form. The writhe in the case of negative supercoiling will be right-handed. The DNA is said to be positively supercoiled when there are fewer base-pairs per helical turn compared to a relaxed molecule. The superhelical tension of twist in this case can be relieved by introducing left-handed writhe.

The supercoiling of the DNA can be described using three parameters: [1] Linking number (Lk) – an integer value which refers to the number of times the two strands make a 360o turn [2] Twist (Tw) – a real number denoting the winding of strands around the helical axis [3] Writhe (Wr) – a real number which denotes the supercoils in the DNA. The three parameters are related as follows: Linking number = Twist + Writhe (Lk = Tw + Wr). As said before, most DNA in vivo is negatively supercoiled. The relative degree to which a molecule is supercoiled can be expressed as the specific linking difference or superhelical density (σ). This quantity gives a length- independent measure of the level of supercoiling, σ = (Lk - Lko)/Lko.

According to ‘twin supercoiled domain’ model, transcription generates positive supercoils in front of the transcribing RNAP complex and negative supercoiling behind it [Liu and Wang, 1987; Wu et al., 1988]. Topoisomerases are the enzymes which take care of these two domains of superhelical tension. There are four topoisomerases in E.coli. Topoisomerase II (gyrase, product of gyrA and gyrB genes) introduces negative supercoils while the other three topoisomerases, topoisomerase I (topA gene product), III (topB gene product) and IV (parC and parE gene product) relax negative supercoils. Gyrase, topoisomerase I & IV are held responsible for maintaining the supercoiled state of the DNA while topoisomerases III mainly manages decatenation reactions [Hiasa and Marians, 1994].

The negatively supercoiled DNA inside the cell is maintained at a steady state level by the actions of gyrase, topoisomerases I and topoisomerase IV [ Menzel et al., 1983; Zechiedrich et al., 2000] within + 15% range of normal mean value [Drlica et al., 1992]. The feedback mechanisms involved in the expression of gyrA, gyrB (active at 10

INTRODUCTION

low negative supercoiling) [Menzel et al., 1983] and topA (active at high supercoiling levels) [Tse-Dinh, 1985] and the requirement of ATP for gyrase activity can be considered as two mechanisms by which homeostasis is conferred. Among these two mechanisms, activity of the enzyme as compared to expression of the enzyme was shown to be more decisive for homeostatic control of supercoiling [Snoep et al., 2002].

The discussed control primarily pertains to regulation of the unrestrained supercoiling inside the cell which engages about 50% of the total DNA. The other half is restrained by chromatin proteins and RNAP. Most of our understanding of the physiology of supercoiling comes from modulation of activity or mutational studies of topoisomerases, which predominantly work with unrestrained fraction of the DNA supercoils. A proper understanding of the role of supercoiling in global gene expression requires the understanding of mechanisms that determine the partitioning between constrained and unconstrained supercoils.

1.2.4 Supercoiling and growth transitions

In E.coli different growth phases are characterized by different global supercoiling levels of DNA, whereby the unconstrained supercoiling levels are maintained at a constant level by the topoisomerases during a particular growth phase. The transitions between growth phases, accompanied by changes in metabolism modulate supercoiling levels to a new equilibrium. Also conspicuous in modulating the supercoiling changes is the binding of abundant chromatin proteins [Balke et al., 1987; Schneider et al., 1997]. Chromatin proteins acting as transcriptional regulators are also implicated in regulating the transcription of topoisomerase genes [Schneider et al., 1999; Gomez- Eichelmann & Camacho-Carranza, 1995]. Notably, stressful stimuli like osmotic or temperature shifts in the external environment are also known to elicit rapid changes in the superhelical density of DNA within the cell [Cheung et al., 2003; Tse-Dinh et al., 1997].

INTRODUCTION

Figure 6: Graphical representation of global DNA topology changing with growth. The dotted line traces the typical growth curve of E.coli in batch culture. Electron microscopy pictures of plasmids with different supercoiling are shown. ME, TS and LS stands for phases of growth - mid exponential, transition to stationary and late stationary phase respectively.

1.2.5 The nucleoid associated proteins – major players in global gene expression regulation

Histones are the predominant structural proteins of the eukaryotic chromatin, while in E.coli there are a dozen so-called “histone-like” proteins involved in spatial organization of the nucleoid. About half of them are considered to be important in shaping the nucleoid based on their abundance. The difference between the core group of NAPs and the other proteins that bind to DNA is in the lack of clear consensus binding sequence for the NAPs. Some of the NAPs do have a reasonable consensus binding sequence, while binding of the others is dependent on inexplicit sequence organization combined with topological parameter, like bent/curved DNA. In addition to providing spatial organization of the nucleoid, NAPs also contribute to DNA transactions such as replication, recombination and transcription.

The regulatory roles of nucleoid proteins in DNA functions thus include modulation of the genome conformation as a whole but also more direct effect on the local conformation of specific DNA regions or even direct interaction with other protein components. For instance, the three FIS dimers binding at the tyrT promoter, may act as 12

INTRODUCTION

a trap for the bound RNAP directing it to the transcription start site [Muskhelishvili et al., 1995]. In addition, FIS directly interacts with the α subunit of polymerase [Bokal et al., 1995].

Figure 7: Abundance of NAP during different phases of growth [Ali Azam et al., 1999].

Growth phase-dependent change in the NAP composition of the nucleoid translates into alterations in the chromatin structure and corresponding growth phase- specific gene expression. About 50 thousand FIS molecules present in the exponential phase bind throughout the genome. By wrapping the DNA around it [Maurer et al., 2006] FIS mimics high negative superhelicity, thereby redirecting the DNA tension to individual gene promoters. FIS can also indirectly modulate the activity of gyrase [Muskhelishvili & Travers, 2003] which introduces hypernegative supercoiling depending on the ATP/ADP ratio which is highest during exponential growth [Lockshon & Morris, 1983; Balke et al., 1987]. FIS also stimulates chromosome replication form oriC [Gille et al., 1991] and transcription from rRNA and tRNA (stable RNA) promoters [Nachaliel et al., 1989]. H-NS is another well-charecterised chromatin protein whose overproduction leads to condensation of chromosome and decreases the availability of supercoils to RNAP [Dame et al., 2001] by binding to curved DNA sequences and thereby effectively repressing gene transcription. Ali Azam et al., have 13

INTRODUCTION

shown that H-NS reaches a maximum of 20,000 molecules per cell during exponential phase of growth and thereafter decreases to 40% of the maximum at the late stationary phase. Another NAP, HU, considered as prokaryotic counterpart of HMG box proteins of eukaryotes is comparable in abundance to FIS during early exponential growth. HU bends DNA substantially and it has been proposed that replacing of H-NS by HU on a plectonemic DNA would change it to more untwisted form, making the DNA more transcriptionally active [Travers & Muskhelishvili, 2007].

Changing of the concentration of NAPs represents one of the mechanisms to regulate the growth transitions. It also brings in more versatility by virtue of its coordination with other global mechanisms modulating the growth.

1.2.6 Composition of RNAP also changes with growth

The major enzyme for E.coli gene expression, DNA dependent RNA polymerase is one of the functionally best studied enzymes. The core enzyme contains five subunits: β’ (1407 amino acids), β (1342 amino acids), a dimer of α (329 amino acids each) and an ω subunit (91 amino acids). The β’ & β subunits appear to be responsible for the catalytic function of the enzyme. The two α subunits are involved in the stabilization of promoter binding and the ω subunit is implicated in the core enzyme assembly [Burgess et al., 1969]. Though the core enzyme is catalytically proficient, initiation is only possible when the core associates with one of the 7 specificity factors, the sigma (σ) subunit, to form the holoenzyme.

The association of different σ subunits is modulated by concentration of growth dependent regulatory nucleotide ppGpp and production of anti-sigma factors. While Eσ70 predominate the transcription during exponential phase of growth, EσS transcribes most of the genes during stationary phase. The differences in gene selection by different holoenzymes can be attributed to the templates topology [Kusano et al., 1996], Eσ70 preferring more supercoiled templates than EσS [Bordes et al., 2003]. Also, the expression of different sigma factors depends on supercoiling [Peter et al., 2004].

INTRODUCTION

Furthermore, expression of a σ factor (σ70) can in turn affect the global topology of DNA [Geertz et al., 2007].

Figure 8: Growth phase-coupled change in the level of different forms of the RNA polymerase. (RpoD: sigma70; RpoN: sigma54; RpoS: sigma35; RpoH: sigma32 ; RpoF: sigma28; RpoE: sigma24; FecI: sigma19)[Ishihama et al., 1999].

1.3 Organization of global transcription - coordinated view

The previous sections addressed the growth dependent alterations in factors having a global influence including DNA superhelical density, abundant DNA binding proteins and the transcription machinery. The present section describes interactions between these global regulators under variety of conditions where they exert their control.

The E.coli genome compacted ~1000 times inside the cell manages to coordinate gene expression with growth phase by forming spatially differentiated domains. Domains, defined as topological barriers preventing diffusion of supercoiling, are dynamic entities. Reported domain sizes vary from 10 to 100 kb (kilo base-pairs) per domain [Postow et al., 2004; Sinden & Pettijohn, 1981]. The topological barriers

INTRODUCTION

formed as a repercussion of active transcription from highly transcribed gene by removing any previously established DNA attachments would generate barriers near the transcription terminus [Deng et al., 2005]. Barrier formation is also altered by abnormal activities of gyrase and topoisomerase IV enzymes [Staczek & Higgins, 1998]. Scattered binding sites for NAPs in the genome may also act as regions where proteins bind to prevent the diffusion of supercoiling.

DNA supercoiling itself might act as a principal coordinator of global gene expression [Balke & Gralla, 1987; Dorman, 1996; Tse-Dinh et al., 1997; Cheung et al., 2003; Travers & Muskhelishvili, 2005b]. Recent enumeration of number of supercoiling sensitive genes in the E.coli genome found only 8% of the total genes to be associated with supercoiling [Peter et al., 2004]. However the observed role of supercoiling in many distinct processes such as sigma factor recognition, transcription termination, sensing of stress and nutritional status appeal to a much wider influence of supercoiling. Furthermore, recent study of the experimental evolution of E.coli populations identified supercoiling as a key target for evolution and mutations in topA & fis genes were found to conferred increased fitness [Crozat et al., 2005].

The supercoiling transitions during growth are tightly coupled to the changing NAP composition and abundance. During early exponential phase the nucleoid is composed of FIS, HUα2 and H-NS proteins, to be succeeded by HUαβ and H-NS in the transition between exponential and stationary phase, and finally by IHF and Dps in late stationary phase. Among these FIS, HU, HNS constrain different amounts of supercoiling [Travers & Muskhelishvili, 2005a], resulting in a change of plasmid DNA supercoiling when the constraining proteins are eliminated [Schneider et al., 1997; Berger M et al., unpublished; Blot et al., 2006]. FIS binds to the DNA as a dimer and can bend DNA by 50-90o [Pan et al., 1996]. Low amount of FIS binding has a distinct effect on the architecture of DNA compared to multiple FIS binding. Low amounts of FIS lead to the formation of branches on the supercoiled DNA, while binding in large amounts it compacts the DNA [Schneider et al., 2001]. HU present in comparable amounts to FIS binds non-specifically to supercoiled DNA and to structurally distorted DNA [Pontiggia et al., 1993]. H-NS present in 20,000 copies binds patches of DNA with a preference for A/T rich tracts and functions as a general repressor of transcription 16

INTRODUCTION

[Rimsky et al., 2001]. At similar superhelical density HU and H-NS can exert opposite effect on the transcription. HU binds and bends DNA resulting in a decrease in pitch angle (the angle between two adjacent major grooves), while H-NS binding leads to an increase in pitch angle. Replacing HU by H-NS on a plectonemic DNA would lead to over twisting of the DNA rendering it less transcriptionally active [Travers & Muskhelishvili, 2007].

The transcription of stable RNA genes is one of the determining elements of growth rate. The promoters of tyrT and rrnA P1 (exemplary stable RNA promoters) are an excellent model systems to fathom the intricacies of the interactions among the global regulators on a miniaturized location. The unique promoter architecture involving a GC rich discriminator confers ‘stringent response’ and ‘growth-rate control’ [Travers, 1980] imposing a need for negative superhelicity for promoter activity [Pemberton et al., 2000]. During stringent response, a result of amino acid starvation, the regulatory nucleotide ppGpp accumulates and inhibits the synthesis of rRNA operons by blocking the RNAP at the initiation step. Growth-rate control is essentially a phenomenon of balanced exponential growth controlled by a combination of promoter elements (a suboptimal spacer region and -35 hexamer sequences) and a need for UAS bound by activator protein, FIS. Binding of H-NS counteracts activation by FIS [Tippner et al., 1994]. Thus it appears that the NAPs on binding DNA exert both global and local effects. It was of interest therefore to investigate, whether the growth phase- dependent patterns of transcription are associated with NAP-dependent changes in distributions of effective superhelicity.

MATERIALS AND METHODS

2 Materials and methods

2.1 Materials

2.1.1 Enzymes & chemicals

Unless otherwise stated, chemicals were procured from Applichem GmbH and Sigma- Aldrich.

Lysozyme (100 000 U/mg) Merck

Restriction & nicking enzymes New England Biolabs

Taq polymerase New England Biolabs

Reverse transcriptase: Superscript II & MLV-RT Invitrogen

Random primers (3 μg/μl) Invitrogen

DNase I Qiagen & Ambion

Vaccinia Topoisomerase I EPICENTRE® Biotechnologies

RNA polymerase Bohreinger Manhein & Purified in house (Geertz, M)

Cyanine 3 and Cyanine 5 dyes Cy™3-dCTP and Cy™5-dCTP from GE healthcare UK limited.

CyDye™3 dCTP and CyDye™5 dCTP from Amersham Biosciences UK limited.

18 MATERIALS AND METHODS

dNTPs (25 μmol) Roche

NTPs Roche

Agarose Roti®garose from Carl Roth GmbH, Germany.

2.1.2 Antibiotics

The following antibiotics were prepared as described by Sambrook et al. [Sambrook and Russell 2001]. The concentration of their stock solution and final working concentrations used are indicated below.

Stock solution Working concentration

Ampicillin 50 mg/ml in water 20 μg/ml

Chloremphinicol 34 mg/ml in ethanol 25 μg/ml

Tetracyclin 5 mg/ml in ethanol 10 μg/ml

Kanamycin 10 mg/ml in water 10 μg/ml

2.1.3 Media

The media were prepared as described by Sambrook et al. Composition to prepare one liter of media is given below.

2x YT medium:

Tryptone 16 gm Yeast extract 10 gm NaCl 5 gm

LB medium: Tryptone 10 gm Yeast extract 5 gm

19 MATERIALS AND METHODS

NaCl 10 gm

YT agar plates:

Tryptone 8 gm Yeast extract 5 gm NaCl 5 gm Agar 15 gm

2.1.4 Buffers and stock solutions

TE buffer (pH 8.0):

10mM Tris/HCl 1mM EDTA

TAE buffer (50X):

242 gm of Tris base 57.1 ml of glacial acetic acid 100 ml of 0.5M EDTA (pH 8.0)

TBE buffer (5X):

54 gm of Tris base 27.5 gm of boric acid 20 ml of 0.5M EDTA (pH 8.0)

Killing buffer:

20 mM Tris-Cl (pH 7.5) 5 mM MgCl2 20 mM Sodium azide

10X in vitro transcription buffer:

100 mM Tris-HCl (pH 8.0) 2 M NaCl 100 mM MgCl2 10 mM DTT

20 MATERIALS AND METHODS

1X in vitro transcription stop solution:

1 mM EDTA 50 mM sodium acetate 0.2% SDS

1X primer extension stop solution:

50% (v/v) glycerol 10 mM EDTA (pH 8.0) 0.25% (w/v) bromophenol blue 0.25% (w/v) xylene cyanol FF

Lysozyme:

10 mg/ml in 10 mM Tris-Cl (pH 8.0)

6X gel loading solution:

0.25% (w/v) bromophenol blue 0.25% (w/v) xylene cyanol FF 40% (w/v) sucrose in water

Norfloxacin:

20 mg/ml stock prepared in 0.5M sodium hydroxide solution.

2.1.5 Bacterial strains

Table 1: Bacterial strains used

Strain Genotype Reference

CSH50 1 ara ∆(lac pro) thi Miller, JH (1972), cold spring hrbr prs.

CSH50 ∆fis CSH50 fis::kan (rpsL) Koch et al., 1988

CSH50 ∆hns CSH50 hns-205::Tn10 P1 transduction of CSH50 with hns- 205::Tn10 from MC41002 hns-205::Tn10

21 MATERIALS AND METHODS

LZ41 3 pyrF287 nirA trpR72 iclR7 gal25 Zechiedrich et al., 2000 rpsL195 top10 ∆ (P80 xis1 cI857) parCK84 KanR

LZ54 3 pyrF287 nirA trpR72 iclR7 gal25 Zechiedrich et al., 2000 rpsL195 top10 ∆ (P80 xis1 cI857) gyrAL83 zei-723::Tn10Kan

LZ23 4 F- thr-1 leu-6 thi-1 lacY1 supE44 Khodursky et al., 1995 L83 tonA21 gyrA zei-723::Tn10Tet KanR

LZ41 ∆fis LZ41 ∆fis::Cm P1 transduction of LZ41 with ∆fis::Cm from CSH50 ∆fis::Cm

LZ54 ∆fis LZ54 ∆fis::Cm P1 transduction of LZ54 with ∆fis::Cm from CSH50 ∆fis::Cm

LZ23 ∆fis LZ23 ∆fis::Cm P1 transduction of LZ23 with ∆fis::Cm from CSH50 ∆fis::Cm

LZ41 ∆hns LZ41 hns-205::Tn10 P1 transduction of LZ41 with hns-205::Tn10 from MC4100 hns-205::Tn10

LZ54 ∆hns LZ54 hns-205::Tn10 P1 transduction of LZ54 with hns-205::Tn10 from MC4100 hns-205::Tn10

1 E.coli K12 derivative 2 F- araD139 D (argF-lac) U169 deoC1 rpsL150 ralA1 flbB5301 ptsF25 rbsR 3 Derivative of RS2λ (pyrF287 nirA trpR72 iclR7 gal25 rpsL195 top10 ∆ (P80 xis1 cI857)) 4 Derivative of C600 (F- thr-1 leu-6 thi-1 lacY1 supE44 tonA21)

2.1.6 Plasmids ptyrTlac [Lazarus & Travers, 1993] ptyrTD [Lazarus & Travers, 1993] ptyrT35U [Lazarus & Travers, 1993]

22 MATERIALS AND METHODS ptyrTS [Schneider et al., 2000b]

∆61 constructs of ptyrTlac, ptyrTD, ptyrT35U, ptyrTS [Auner et al., 2003] pUC18 [Yanisch-Perron et al., 1985]

2.1.7 Primers

Primers for RT-PCR:

Forward Reverse aceB CGAGCAGGAGAAGCAAATTC GCGCTGCCAGAAGTTTATTG glcB TATACGGCAGCGACATCATC CAGCGGTAGAGATTCATCGAG purC TGATCGCAAAGGTATGGTGA AGCAGACGCTCCATTTGAGT purF ATGCCTTAACGGTGCTTCAG GGCGAGCTTCAAATACATCG purK AAAGCGTGATTACCGCTGAG GGTCAGCAATAATCGGGAAC sdhD CGTTCACCAAAGTGTTCACC CCAGCGGTTTAACGTAGTCG sucC CAAAGTGAAAGCCGTTCTGG AACACCCACTTCTGCTACCG

Primers for primer extension:

Ex103 GGAATGTGTAAGAGCGGGG

G11 GAGCAGTGCCGCTTCGC bla CAGGAAGGCAAAATGCCCC

23 MATERIALS AND METHODS

2.2 Methods

2.2.1 Agarose gel electrophoresis

Electrophoretic separation of DNA was carried out using 0.8-1.5% (w/v) agarose gels prepared in 1X Tris-borate (TBE) or Tris-acetate buffer (TAE). The gel buffer and running buffer are identical. For all applications (except for topology gels) ethidium bromide (0.3 μg/ml) was mixed with the gel before casting. Various size of gel chambers (8 X 10 to 19.5 X 19.5 cm) were used to cast the gel and the DNA to be separated was mixed with 1/6th the volume of loading dye, with size markers (λ pst, see below) when necessary. Separation was carried out at 0.5 V/cm for topology gels and at 1-5 V/cm for other purposes. Subsequently gels were observed under UV light in gel documentation equipment (Biodoc analyze from Biometra®) and photographed when necessary.

DNA ladder for size marker was obtained by digesting overnight 25 μg of λ DNA (New England Biolabs) with PstI restriction enzyme in an appropriate buffer at 37oC.

2.2.2 Small and medium scale isolation of plasmid DNA using Qiagen kit

Small and medium scale plasmid isolation was performed using QIAprep Spin Miniprep Kit and QIAGEN Plasmid Maxi Kit respectively by following the manufacturer’s instruction. The E.coli cultured in 2X YT and LB has been used for extracting plasmid.

24 MATERIALS AND METHODS

2.2.3 Restriction Digestion

Digestions of DNA with restriction enzymes were performed according to manufacturer’s instructions using recommended buffer systems and at the appropriate reaction temperatures. Generally, 2-10 units of enzymes were used per μg of DNA. Plasmid DNA was usually digested for 1-3 hours and the completion of the reaction monitored by gel electrophoresis.

2.2.4 Polymerase chain reaction

PCR was primarily employed to extend the labeled primer (2 pmol) from a footprinted DNA template (around 1 μg). In a reaction volume of 20 μl, using Taq polymerase and 1mM final concentration of dNTP mix, the reaction was performed for 6-9 cycles. The reaction conditions were as follows: Denaturation at 94oC for 30 seconds, annealing at 52oC for 1 minute, elongation at 72oC for 1 minute.

2.2.5 Preparation of competent E.coli cells using calcium chloride

Calcium chloride competent cells used for transforming plasmids into E.coli were prepared following the protocol described by Sambrook et al. [Sambrook and Russell 2001]. The competent cells prepared was stored at -80oC in aliquots of 100 μl.

2.2.6 Transformation of E.coli cells

Transformation of plasmids into E.coli was performed as described by Sambrook et al. [Sambrook and Russell 2001] using calcium chloride competent cells. The standard protocol was followed except for different heat shock temperature. Heat shock was

25 MATERIALS AND METHODS

given using a heating block (Eppendorf® Thermomixer Compact T1442) at 37oC for LZ strains and at 42oC for CSH50 strains.

2.2.7 Purification of nucleic acids by Phenol: Chloroform extraction

Purification of nucleic acids by phenol: chloroform was performed as described in Sambrook et al [Sambrook and Russell 2001].

2.2.8 Concentrating and quantification of nucleic acids

The DNA and RNA were concentrated by ethanol precipitation method as described by Sambrook et al., [Sambrook and Russell 2001] differing from the standard protocol in the salts used and the final drying step. When concentrating DNA the salt solution used was 1/10th volume of sodium acetate (pH 5.2) and in the case of RNA 1/5th the volume of ammonium acetate was used. Finally the pellet of nucleic acid was either air dried by keeping the tube open at room temperature or dried using a speedvac (Eppendorf® Vacufuge concentrator 5301). Quantification of the nucleic acids was done using Nanodrop (ND-1000 Spectrophotometer).

2.2.9 Polyacrylamide sequencing gels

The preparation and resolving, of DNA probes and sequencing reaction products, was performed as described by Sambrook et al., using 6% polyacrylamide gels (composition for 500 ml: 210 gm urea, 50 ml 5X TBE, 74 ml Rotiphorex 40 (Carl Roth GmbH).

26 MATERIALS AND METHODS

2.2.10 Growth curves and norfloxacin treatment

The growth curves for CSH50 and LZ strains were generated from two overnight cultures; the first one was in LB and the second in 2X YT medium. The second overnight culture was diluted 1:200 times in appropriate volume of 2X YT and incubated at 37oC in the case of CSH50 strains and at 30oC for LZ strains, with shaking at 150rpm. The optical density measurements (OD) were recorded at 600nm wavelength (using Eppendorf® Biophotometer). Sampling of cultures was carried out by pipetting the required volume of culture into frozen falcon tubes pre-filled with 1/3 volume of killing buffer in it. The tubes were centrifuged at 5000 rpm for 5 minutes to obtain the pellets of bacteria which was immediately frozen using liquid nitrogen and subsequently stored in -80oC until further use.

Norfloxacin treatment of LZ strains was performed as described below. Norfloxacin at a final concentration of 20 μg/ml was added to mid exponentially growing cells at OD600 around 0.6 to induce the supercoiling changes. After addition of norfloxacin the cultures were incubated for another 5 minutes at 30oC with shaking, before being sampled as described above.

2.2.11 Extraction and quality check of total RNA

Total RNA from E.coli cells, used here mainly for synthesis of cDNA for various applications such as microarray hybridization, PCR and for primer extension experiments, was extracted using RNeasy Mini kit following the manufacturers instruction. To eliminate even small DNA contamination from RNA preparations, DNase treatment was performed twice. The first DNase treatment was done on the RNeasy column (part of the RNeasy kit protocol) and once after the final elution from the column, using DNA-free™ from Ambion. Handling of RNA was done using nuclease free tips and tubes from Ambion. All the buffers and water used were RNase free procured either as a part of the kit or from Ambion (Buffer kit, catalog number 9010). After the second DNase treatment, the RNA solution was extracted once by

27 MATERIALS AND METHODS

phenol: chloroform method as described above to get rid of DNase removal reagent. The RNA was then quantified and precipitated by ethanol precipitation and then re- dissolved in appropriate volume of nuclease free water so as to obtain a RNA concentration appropriate for the application (for microarrays the concentration was maintained at around 6 μg/ml and for all other applications at 1 μg/ml). The quality of the RNA was checked by agarose gel electrophoresis and Agilent 2100 Bioanalyzer.

2.2.12 Microarray hybridization

Whole genome E.coli K12 cDNA microarrays used in this study were purchased from MWG biotech (E.coli K12 arrays) & Ocimum biosolutions (E.coli K12 OciChip™). The cDNA synthesis was performed as described in the MWG/Ocimum’s standardized protocols. After cDNA synthesis, the hybridization was performed in a moist chamber, at a temperature of 42oC and with a mild shaking (40 rpm) for 16 to 18 hours. After hybridization the microarray slides are subjected to three consecutive washing steps as describe in the manual. Then the slides were dried and scanned at two wavelengths, 550nm for Cy3 and 640nm for Cy5, using ScanExpress confocal laser scanner (PerkinElmer). The scanner generates TIFF images of the microarray with individual spots showing relative amounts of Cy3 and Cy5 in each spot. Images were quantified using freely available Spotfinder software from TIGR [Saeed et al., 2003]. Figure 9 shows a schematic representation of the microarray experiment.

The experiment was always carried out with two biological and technical replicates. The wild-type and the fis comparison shown below when repeated by interchanging the Cy3 to fis mutant and Cy5 to wild-type forms a technical replicate while a biological replicate is when the whole microarray experiment is repeated anew staring from the bacterial culture. Each biological replicate consists of at least one technical replicate.

28 MATERIALS AND METHODS

Figure 9: Overview of comparative gene expression of wild-type & fis (example) analysis using microarrays.

2.2.13 Microarray analysis

The scanned images of the spots on the arrays after quantification have to be subjected to normalization before any comparison of the gene expression is possible. Normalization of the spot intensity for a particular dye (Cy3 or Cy5) to the combined total intensity of that dye in all the spots of the array has to be performed for several reasons. It allows for comparison between microarray slides & between experiments and is necessary to eliminate the inherent difference in the intensities of Cy3 & Cy5 fluorophores.

Scanned array images were analyzed using the TM4 software package from TIGR [Saeed et al., 2003]. The first step in the analysis, to quantify the spots and to do a quality check on the spots, was carried out using TIGR spotfinder software. Briefly, spot intensities were quantified and quality of each spot was verified by calculating a quality control (QC) score depending on signal-to-noise ratio of both Cy3 and Cy5 channels in the spot and shape quality of the spot. Then the p-values were calculated for each channel as result of a t-test comparing the spot pixel set and surrounding background pixel set still using the TIGR Spotfinder software.

29 MATERIALS AND METHODS

Filtered (by spot intensity and spot quality) data was normalized by locally weighted linear regression [Cleveland and Devlin, 1988] and, a one-class t-test [Pan et al., 2002] was applied to the mean ratios (of wild-type to mutant or relaxed to hypernegative) from replicated experiments to obtain differentially regulated genes with significant p-values (p < 0.05) using the TIGR MIDAS software.

Representation of regulated genes in the form of genome wheels was accomplished using a web-based visualization tool called the Genome viewer. The web- based program can be accessed at the web site- http://www.cmbi.ru.nl/MGV/ [Kerkhoven, 2004].

2.2.14 Real-time PCR

Each RT-PCR reaction was carried out in triplicates from the purified total RNA using QantiTect® SYBR® Green one-step Real-Time PCR reactions (Qiagen GmbH, Hilden, Germany) following the manual of manufacturer, using the instrument Mx3000P Real- Time cycler (Stratagene®, La jolla, CA, USA).

2.2.15 High resolution agarose gel electrophoresis and determination of sigma (σ)

Separation of the pUC18 plasmid topoisomers and their supercoiling (σ) determination, by comparing with a plasmid topoisomer ladder, was performed using high-resolution agarose gel electrophoresis. Electrophoresis was carried out in 1% agarose gel with 1X TBE buffer and chloroquine in both the gel and the buffer. Different amount of chloroquine (0.5μg/ml to 20μg/ml) was used for resolution of different topoisomers. The electrophoresis was performed at 4oC for 24 hours at 40V. After electrophoresis, the gels were stained in ethidium bromide (0.5 μg/ml in water) and photographed.

For the determination of sigma (σ), a ladder of plasmids with overlapping topoisomer distribution was generated by nicking the pUC18 plasmid DNA and then re-

30 MATERIALS AND METHODS

ligating them in the presence of different amount of ethidium bromide. Initially the plasmid was nicked using 20 units of Nt.BstNBI, for every 20μg of DNA in a reaction volume of 50μl according to manufacturers specification The nicked plasmids (2.5μg for each reaction) were then ligated using T4 DNA ligase in the presence of different amount of ethidium bromide (concentrations ranging from 800μg/ml to 2.5μg/ml were used) in an overnight reaction. The reaction products were then extracted twice with phenol: chloroform mixture, the DNA precipitated, pelleted and re-dissolved in 10μl of TE pH 8.0. The σ values of the generated topoisomers were quantified by band counting method [Keller et al., 1975]. Briefly, mid-point of a completely relaxed plasmid (nicked and ligated without ethidium bromide) population was taken as a σ value of zero. Then by determining the mid-point of other plasmid topoisomers (ladder) and comparing it with the relaxed gives the linking number difference (∆Lk). From this the σ is

calculated using the formula σ = ∆Lk / ∆Lko, where ∆Lko for pUC18 = 2686 bp / (10.4 bp / turn) = 258. The σ values of the plasmids from different growth phase and LZ strains were determined by comparing with the ladder.

2.2.16 In vitro transcription

In vitro transcription was performed from supercoiled plasmids with distinct σ (ptyrT & ptyrTD) and linearized (∆61tyrT) plasmids. Linearized plasmids were obtained by cutting the plasmid with 10 units of BamHI for every microgram of DNA for 1 hr. The different topoisomer of ptyrT & ptyrTD were obtained by incubating 20μg of supercoiled plasmid with 25 units Vaccinia topoisomerase I in the presence of different ethidium bromide concentrations in topoisomerase buffer (10mM Tris (pH 8.0), 100mM NaCl, 20mM EDTA) for two hours at 37oC.

After obtaining the template, in vitro transcription was performed as described before [Lazarus & Travers, 1993] with 1μg of plasmid DNA, 1μl of 1 unit/μl RNAP (Bohreinger), 44nM FIS when indicated and 2.0mM NTP mix in a 50μl reaction volume. After the reaction, the RNA synthesized was extracted with phenol: chloroform and precipitated as described above. The pellet is dissolved in 10 or 20 μl of nuclease

31 MATERIALS AND METHODS free water (Ambion) for subsequent use in the primer extension reaction (10 μl for each primer).

2.2.17 Primer extension

The mRNA from in vitro transcription of ∆61 tyrT constructs and from tyrT with different supercoiling was divided into two 10 μl parts to be used for primer extension with Ex103 (for tyrT transcript) and bla primers. Primer extension from total RNA from LZ strains transformed with different tyrT plasmids was performed with Ex103 and a collective primer for chromosomal rrn operon’s P1 promoter, G11, as described by Nasser et al.,[Nasser et al., 2001].

The primers (200 pmol) to be extended were radioactively labeled using 50 μci of P32 γ-ATP (Amersham Biosciences now a part of GE Healthcare) and T4 polynucleotide kinase (PNK) (Invitrogen) in a reaction volume of 20μl and the labeled primer purified using G25 spin columns (GE healthcare, formerly Amersham Biosciences). Primer extension reaction was performed from 3 μg of total RNA or mRNA from in vitro transcription both in a volume of 10 μl, 2 mM final concentration of dNTP mix, 2 pmol of labeled primer, 2 μl of 0.1M DTT, 4 μl of 5X reverse transcriptase buffer and 1 μl of LMV-reverse transcriptase. The primer extension products were separated on a 6% polyacrylamide gel and visualized by phosphorimaging (FUJI film FLA-3000 phosphorimager).

2.2.18 Potassium permanganate footprinting

The components of the footprinting reaction are the same as the in vitro transcription reaction. The footprinting was carried out as described earlier [Nasser et al., 2001]. The addition of potassium permanganate (KMnO4), which oxidize preferentially the thymine nucleotide (cytosine can also be oxidized) of an open double helix, gives a

32 MATERIALS AND METHODS

measure of opening of the two strands of DNA during processes such as initiation of transcription.

All the components (except KMnO4) are mixed on ice and equilibrated at 37oC for 5 minutes before adding 2 μl of 100 mM KMnO4. After exactly 30 seconds, the footprint is stopped by the addition of 2 μl of β-mercaptoethanol (14M). To this 100 μl of TE (pH 8.0) is added and then the DNA is extracted with phenol: chloroform and precipitated as described above. The pellet of footprinted DNA is dissolved in 15 μl of water and is subjected to primer extension with labeled primer using Taq polymerase and 1 mM final concentration of dNTP mix for six cycles in a PCR machine (Peltier Thermal Cycler PTC 100™ & PTC 200 from MJ research). The product is resolved on a 6% polyacrylamide gel along with a sequencing reaction and visualized by phosphorimaging. The di-deoxynucleotide termination sequencing reaction of the plasmid DNA and the primer used for footprinting and PCR was performed using commercially available sequencing kit from USB (Sequenase™ Version 2.0 DNA Sequencing Kit) following the manufacturers instruction.

2.2.19 β-Galactosidase assay

Beta-galactosidase assay was performed following the protocol of Sadler & Novick [Sadler & Novick, 1965]. The β-Galactosidase assay was performed on freshly diluted (1:30) overnight cultures after one hour of dilution cultures in exponential phase. β- Galactosidase activity is calculated as a function of, colorless ONPG substrate turning to yellow nitro phenol product (measured at OD420) and the time it takes to turn yellow by using the formula:

β-Galactosidase activity = OD420 X 8.5 X 100 OD600 X time (minutes)

33 RESULTS

3 Results

Growth phase-dependent transcription regulation has been studied in the current work at two levels of complexity, global and the local. Global regulation, explained in the first section details the effects of DNA supercoiling and chromatin proteins FIS and H-NS in coordinating the growth phase dependent transcription. In the second section the mechanism of transcriptional regulation by chromatin protein FIS and supercoiling is studied at the molecular level in a model system of a stable RNA promoter.

3.1 Growth phase dependent global transcriptional regulation

Regulation of growth is managed by the interplay of chromatin proteins, topology of the DNA and the transcription machinery. Using DNA microarrays we have tried to address the relationship between the organization of chromosomal supercoiling and growth phase dependent gene expression patterns. Since chromosomal supercoiling is tightly connected to the function of abundant chromatin proteins, we used mutants of fis and hns genes known as global transcriptional regulators. We compared the expression profiles of wild-type with each mutant separately during three different phases of growth and at different superhelicities induced by addition of a topoisomerase poison. Our experimental design enabled us to reveal the relationships between the effects of chromatin proteins and supercoiling in global transcriptional regulation.

3.1.1 Growth of CSH50 and LZ strains

All the strains, CSH50 wild-type, CSH50 fis::kan and CSH50 hns-205::Tn10 mutants and LZ41, LZ54 and their fis::cm and hns-205::Tn10 derivatives were grown in double YT medium. The CSH50 strains were grown for 24 hours during which three time 34

RESULTS

points were sampled based on the optical density (OD) whereby the mid-exponential phase sample corresponds to an OD of 0.6 (Figure 10)

The LZ strains which harbor drug resistant alleles of topoisomerases, gyrase (gyrAL83) and topoisomerase IV (parCK84) genes were treated with quinolone norfloxacin during mid-exponential growth before sampling. Norfloxacin used at sub- lethal concentration in LZ41 and LZ54 strains selectively inhibits DNA gyrase or topoisomerase IV activity thereby inducing relaxation or hypernegative supercoiling respectively. In these strains, the cells are exposed to norfloxacin for 5 minutes and RNA is then extracted [Rochman et al., 2002]. This allows the variation of transcription with overall superhelical density to be monitored from almost fully relaxed (σ = - 0.015, strain LZ41) to near physiological (σ = - 0.073, strain LZ23) to hypernegatively supercoiled (σ = - 0.095, strain LZ54) state [Zechiedrich et al., 1997].

Figure 10: Growth curves of CSH50 wild-type and the mutants. The three phases sampled for the microarray- based comparison of differential gene expression. (A) Growth curves of wild-type and fis mutant. (B) Growth curves of wild-type and hns mutant. The dots indicate the time of sampling. 35

RESULTS

Neither the fis nor the hns mutations in the CSH50 or in the LZ strains affected the overall growth pattern but the growth rates of the fis and hns mutants of CSH50 were slightly different from the wild-type (data not shown). The growth rate comparisons showed differences during exponential growth stage and early stages of stationary phase. In comparison to wild-type cells the fis mutants had lower and hns mutants had higher growth rates during exponential phase. These differences are not clearly understood but correspond to the global repressing effect of H-NS and general growth-stimulatory effect of FIS (due to activation of stable RNA promoters).

3.1.2 A novel microarray based approach to derive growth phase- specific transcript profiles organized by supercoiling and chromatin proteins

Two sets of microarray experiments were performed, the design of which is schematically represented in figure 11. Briefly, in set A, comparison of the transcript profiles of wild type and mutant at each growth phase allowed the identification of FIS and H-NS regulated genes during the three phases of growth (ME, TS and LS). In the second set (set B) of microarray experiments combinations of LZ strains were used to derive supercoiling associated genes (Exp.1 in Figure 11) and genes modulated by FIS and H-NS at different supercoiling (Exp.2 in Figure 11). Comparison of LZ41, LZ54 and their mutants in different combinations was performed during the mid-exponential phase, when effect of the topoisomerase inhibitory drug norfloxacin was most pervading.

In set B the transcript profiles of LZ41 (norfloxacin-induced DNA relaxation), LZ54 (norfloxacin-induced hypernegative DNA) and their fis and hns mutants were compared in different combination, which is divided into experiment 1 and experiment 2 for the sake of clarity in Figure 11. Experiment 1 compares LZ41 with LZ54 and mutant (either fis or hns) of LZ41 with mutant (either fis or hns) of LZ54. The genes upregulated in LZ41 background (compared to LZ54) and mutant LZ41 background

RESULTS

(compared to mutant LZ54) are those that are associated with DNA relaxation. Similarly genes upregulated in LZ54 and mutant LZ54 background are those that are associated with hypernegatively supercoiled DNA. In the experiment 2 of set B, the wild-type transcript profile of LZ41 and LZ54 was compared to their respective mutant (either fis or hns). In this comparison the upregulated genes in wild-type LZ41 background are those that are activated by DNA relaxation in the presence of FIS/H- NS. And the upregulated genes in LZ41 mutant are those that are otherwise repressed by FIS/H-NS under relaxed DNA conditions. Similarly, comparisons of LZ54 with mutants identified genes that are activated and repressed under hypernegative DNA supercoiling conditions. The differentially expressed genes derived from the microarray experiments are those that appear consistently in at least two biological replicates and three technical replicates of the microarray experiment (see section 2.2.12 for details of biological & technical replicates).

Set A Set B CSH50 CSH50mut Exp.1 Exp.2 ME ME ME ME ME ME TS TS LZ41LZ54 LZ41 LZ41mut LS LS LZ41mut LZ54mut LZ54 LZ54mut

Growth Rel Hyp Act Rep phase- regulated genes

Figure 11: Design of DNA microarray experiments. Set A defines the regulated genes during three phases of growth. ME, TS and LS stand for mid- exponential, transition to stationary and late stationary phase of growth respectively. From experiment 1 of set B, the genes associated with relaxation (Rel) and hypernegative (Hyp) supercoiling were derived, while experiment 2 was used to derive genes either activated (Act) or repressed (Rep) by FIS & H-NS under both relaxation (LZ41) and hypernegative superhelicities (LZ54).

The novelty of this experimental design is in the identification of growth phase regulated genes (from set A) and simultaneous derivation of supercoiling sensitivity of 37

RESULTS

these identified genes (by mapping the set B gene pools on set A). The repertoire of reported supercoiling associated genes [Peter et al., 2004] was increased 5 fold by including fis & hns mutants in addition to wild-type. This experimental setup also allows the estimation of the role of chromatin proteins in distributions of effective superhelicity and organization of supercoiling-sensitive transcription.

3.1.3 Changes of supercoiling during growth

In parallel to microarray experiments, high-resolution agarose gel electrophoresis was used to keep track of supercoiling changes during different growth phases of CSH50 strains and also after norfloxacin treatment in LZ strains. The global supercoiling level of DNA was determined using pUC18 reporter plasmid (Figure 12) by band counting method as previously described [Keller et al., 1975]. The mean σ values (+/- 15%) were calculated using a range of chloroquine concentrations from 0.5 to 20 μg/ml in 1% agarose gels. In the LZ strains, the relaxed topoisomers of the samples isolated from LZ41 and its derivatives demonstrated a complex pattern making it difficult to define precisely the superhelical density. During growth cycle the plasmids showed a decrease in negative supercoiling with time, consistent with the previous finding [Balke and Gralla, 1987]. The reason for such a decrease in supercoiling is attributed to the decrease in [ATP/ADP] ratio which influences the gyrase activity directly. Also consistent with the earlier reports is the increased supercoiling in hns mutant [Mojica et al., 1997] during mid-exponential phase compared to the wild-type CSH50.

RESULTS

Figure 12: Topoisomer distributions of plasmids (pUC18) isolated from growing cells. (A) Topoisomer distributions in LZ54 and LZ41 strains and their mutant derivatives (as indicated) 5 min after norfloxacin addition. (B) and (C) Topoisomer distributions of plasmids isolated from CSH50 strains and its mutant derivatives during the growth cycle. In (C) all topoisomers migrate as negatively supercoiled species except for the late stationary (LS) phase samples, which migrate as positively supercoiled species The σ values for each population (except for transition stage where no significant differences were observed) are indicated. High-resolution gel-electrophoresis was carried out in presence of 1.0μg/ml (A), 0.5μg/ml (B) and 2μg/ml (C) of chloroquine.

3.1.4 Genomic wheels of supercoiling sensitivity

The differentially regulated genes were deduced from the relative intensities of Cy3 and Cy5 incorporated in cDNA after hybridization to spotted genes on a microarray. After quantification, any gene can be classified as up or down regulated (activated or repressed) in relation to the other hybridizing partner. The genomic wheels in figure 13 represent the up-regulated genes in the wild-type (outer circles) or the mutant background (inner circles), marked as lines by their position in the genome. The three layers show the three phases of growth (ME, TS, LS). Furthermore the colour of the lines indicate the supercoiling sensitivity and the inducibility by the presence (Act) or absence (Rep) of FIS (circle A) or H-NS (circle B) (see the figure legend for the colour codes). For example, a gene upregulated in wild-type background during ME phase is represented by a line in the outer circle (wild-type) of outermost layer (ME phase) and 39

RESULTS

furthermore the colour of the line shows the mode of regulation (activated / repressed and sensitive to hypernegative / relaxed DNA conditions) of the particular gene. A line coloured by two colours is a gene (will be referred to as ‘double coded’) which was associated with more than one regulatory condition (for example, a gene repressed at hypernegative supercoiling can be seen as line coloured yellow and blue).

The genomic wheel representation allows visualization of growth phase dependent transcription of genes together with corresponding supercoiling sensitivity. Figure 13 A and B, show respectively the effect of fis and hns on the spatiotemporal organization of transcription throughout the growth cycle (compare the outer circle to inner circle for differences between wild-type & mutant during each growth phase). The fis mutation most clearly affects the distribution of transcripts in the domains of the origin and terminus of replication during the exponential and stationary phases. Effect of hns as a global repressor is evident from the high proportion of repressed genes throughout the growth (see below). Both FIS & H-NS are proteins most abundant during early exponential growth [Ali Azam et al., 1999]. Afterwards the FIS concentration drops sharply, whereas H-NS is present at relatively high levels throughout the growth cycle. From the genomic wheels it can be seen that strong effects of FIS and H-NS on transcription are observed even in stationary phase. It is important to note that FIS is capable of exerting an effect on transcription either by direct binding to the promoters or by modulating the global topology of DNA. The latter effect could be the basis for regulation by FIS during the later stages of growth. About 50% of the fis and hns regulated genes were found to be sensitive to supercoiling (see below), suggesting a central role of supercoiling in organizing the growth phase dependent transcription. The observed changing genomic patterns of supercoiling sensitivity (seen as cluster of blue [Hyp] or red [Rel]coloured lines) agree with the previous findings of fluid short range [Postow et al., 2004; Stein et al., 2005] and long range domains of transcription [Jeong et al., 2004].

RESULTS

Figure 13: Genomic wheels showing spatiotemporal distribution of supercoiling associated transcripts. Rel (red), Hyp (blue), Act (green) and Rep (yellow) transcripts among the growth-phase-dependent genes (grey) in CSH50 wild-type (outer wheels) and fis (A) or hns (B) (inner wheels). ME- mid-exponential phase; TS-transition phase; LS-late stationary phase; Ori-origin of replication; Ter-terminus of replication. 41

RESULTS

During the entire growth cycle, 820 genes were found to be regulated by fis and 611 by hns. From the former, 371 genes were activated (up-regulated in the wild- type background) and 475 repressed (up-regulated in the mutant background) by fis. The corresponding numbers for hns are 292 activated and 327 repressed genes. From experiment 1 of set B, 1,596 genes were identified to be associated with supercoiling (either hypernegative or relaxed DNA), exceeding by five times the number identified previously [Peter et al., 2004]. Out of 1,596 Hyp and Rel transcripts identified, only 145 were common to wild-type, fis and hns backgrounds indicating that the supercoiling response depends on genetic context and explaining the expanded repertoire of supercoiling sensitive genes identified. The growth phase dependent genes were then mapped on the supercoiling associated genes (see Figure 11). Among all the growth phase dependent genes, 397 out of 820 (fis experiment) and 329 out of 611 (hns experiment) were found by mapping to be associated with either Rel or Hyp condition. The dependence of supercoiling response on genetic context and high proportion (almost 50%) of supercoiling sensitive genes in each genetic background indicate that regulation involves a cross talk between the chromatin proteins and supercoiling, wherein both change in an interdependent manner.

3.1.5 Variations of supercoiling-associated transcripts

The growth phase dependent genes were further analyzed based on their distribution in four classes of supercoiling associated genes. Out of total of 302 unique genes upregulated from all the 3 growth phases in hns mutant, 210 could be mapped as supercoiling associated genes. From the table 2 we can see that, among these 70% (148 genes) were associated with the Rep group, while the corresponding number in fis mutant is 39% only (94 out of total 239 mapped). The wild-type strain compared to fis had similar proportion of Act & Rep genes while the fis mutant from the same experiment had approximately three times more Rep than Act genes. In the hns experiment the distribution of growth phase dependent genes is different compared to

RESULTS fis experiment. The wild-type from this experiment shows three times more Act genes and in the mutant the Rep genes are about nine times more abundant than the Act genes.

Table 2: Numbers of transcripts in four classes and double-coded transcripts in fis and hns transcript profiles. Also indicated inside the parentheses is the corresponding percentage taking total mapped genes as 100%. The double-coded transcripts are those responding to specific combinations of supercoiling and genetic background.

Single-coded Double-coded

Fis Total Rel/ Rel/ Hyp/ Hyp/ Rel Hyp Act Rep experiment mapped Act Rep Act Rep

more in 62 69 38 38 6 5 12 8 175 CSH50 (35) (39) (21) (21) (3) (2) (6) (4)

more in 74 94 35 95 11 13 9 24 239 CSH50 fis (30) (39) (14) (39) (4) (5) (3) (10)

129 158 71 125 16 17 21 29 total unique 397 (32) (39) (17) (31) (4) (4) (5) (7)

hns

experiment

more in 42 33 55 18 12 5 6 2 123 CSH50 (34) (26) (44) (14) (9) (4) (4) (1)

more in 48 68 15 148 1 25 4 38 210 CSH50 hns (22) (32) (7) (70) (0.4) (11) (1) (18)

89 100 68 165 13 30 9 40 total unique 329 (27) (30) (20) (50) (3) (9) (2) (12)

The presented numbers indicate that the effect of hns is predominantly repressive while also activating certain genes, whereas fis is acting, as expected as a dual regulator.

Figure 14 represents the distributions of supercoiling associated genes according to the growth phase. The sums of total mapped Hyp+Rel or Act+Rep

RESULTS

transcripts of a growth phase and cell type (wild-type or mutant) were set at 100%. While in the case of double-coded, the sum of total mapped double-coded transcripts for the entire growth cycle was set at 100%. The exponentially growing fis mutant showed

Figure 14: Changes of supercoiling associated genes during growth in fis (A) & hns (B) mutants compared to their wild-types. Phase wise distributions of Hyp (blue), Rel (red), Act (green) and Rep (yellow) gene transcripts are shown. The distinct ‘double-coded’ transcripts—Hyp/Act, Hyp/Rep, Rel/Act and Rel/Rep—are ordered from left to right for each bar. The number of genes is indicated within the bars. fis- CSH50 fis; hns- CSH50 hns; ME- mid-exponential phase; TS- transition phase; LS- late stationary phase.

an increase of both the Hyp and Rel transcripts compared with those in wild-type (69 and 47 compared with 36 and 24 of wild-type respectively), whereas in the hns mutant the relative proportion of Hyp transcripts increased, in keeping with the observed increase of global negative superhelicity (Figure 12 B,C). Furthermore, on transition to the stationary phase, a lower proportion of Rel genes were observed in the fis mutant than in the wild-type, but not in the stationary phase itself. As expected, the effect of hns mutation was most pronounced for Rep genes. In the fis mutant, the Rep genes increased only during the exponential phase, whereas in the hns mutant, the Rep genes predominated during the entire growth cycle. Also the ‘double-coded’ transcripts responding to specific combination of supercoiling and genetic background were enriched for Rep/Hyp and Rep/Rel genes, especially in hns cells. Taken together, these

RESULTS

observations are in excellent agreement with different abundance of FIS and H-NS during the growth cycle and the general repressor role of H-NS [Ball et al., 1992; Dorman, 2004].

3.1.6 Supercoiling sensitivity of biosynthesis and degradation pathways

Interestingly the analysis of the distribution of Hyp and Rel genes among the functional groups involved in essential cellular metabolism demonstrated a substantially higher proportion of Hyp genes in anabolic than in catabolic pathways, which was especially remarkable in wild-type cells (Table 3). It was therefore of interest to investigate some essential metabolic pathways in more detail.

Table 3: Supercoiling sensitivity of genes of biosynthesis and degradation pathways. The metabolic pathways comprising 421 genes for biosynthesis and 233 genes from degradation were derived from http://EcoCyc.org. The Hyp to Rel transcript ratios are derived from the data set B for 148, 111 and 134 metabolic genes expressed in the wild-type, fis and hns mutants, respectively.

Biosynthesis (Hyp/Rel) Degradation (Hyp/Rel)

Wild type 4.29 0.54

fis 2.07 0.87

hns 1.91 1.0

3.1.7 Coordination of metabolic pathways by supercoiling sensitivity

Analysis of a pathway of exceptional importance for vitality – the citric acid cycle – demonstrated that the crucial steps producing combustible fuel in the form of reducing equivalents NADH and FADH2, which are required for generation of ATP by oxidative 45

RESULTS phosphorylation, are associated with DNA relaxation. In contrast, the glyoxylate bypass, which is predominantly utilized in aerobically growing cultures where most of the energy is derived by glycolysis is activated by negative superhelicity (Figure 15 A and Table 3). This suggests that high ATP/ADP ratios favouring supercoiling of DNA by gyrase would facilitate glyoxylate bypass and plastic substrate synthesis, whereas DNA relaxation would favour the production of ATP required to maintain gyrase activity. Furthermore we found that the de novo pathway of nucleotide biosynthesis explicitly involves the Hyp genes (Figure 15 B). Purine nucleotides are required during fast growth and the dependence of this pathway on supercoiling levels is in keeping with the prevailing conditions during fast growth. The data presented here thus shows that supercoiling has a role not only in regulation of important individual genes but also in coordinating the activity of metabolic pathways.

RESULTS

Figure 15: Coordination of essential metabolic pathways by supercoiling sensitivity. The Rel (red) or Hyp (blue) preference of the genes in the regulation of oxaloacetate production and glyoxylate bypass in citric acid cycle (A) and coordination of de novo biosynthesis of purine nucleotides (B) are indicated.

Certain relevant genes which were missing in the microarray data like aceB, glcB, sucC and sdhD were investigated by performing Real-time PCR (RT-PCR) (Table 3). In addition randomly selected genes of purine biosynthesis pathway were investigated to validate the quality of the microarray results. These results are in keeping with the inferences from the analyses of microarray data.

RESULTS

Table 4: RT-PCR analysis of some of the genes from TCA cycle and purine biosynthesis. The numbers indicate significant (p<0.05) mean of ratios (as indicated) from experiments performed in triplicates.

LZ41/LZ54 LZ41fis/LZ54fis LZ41hns/LZ54hns

Gene QPCR array QPCR array QPCR array Function

aceB 0.29 0.18 malate synthase A

glcB 0.75 0.79 0.81 malate synthase G

phosphoribosylaminoimida purC 0.07 0.15 0.06 0.20 0.06 0.16 zole-succinocarboxamide synthase

amidophosphoribosyl purF 0.24 0.22 0.07 0.15 0.25 0.24 transferase

N5- purK 0.06 0.26 0.02 0.18 0.08 carboxyaminoimidazole ribonucleotide synthase monomer

sdhD 1.64 1.85 1.33 1.94 succinate dehydrogenase

sucC 1.89 1.41 1.43 succinyl-CoA synthetase,

Taken together all these data suggest that the growth phase dependent transcript profiles are coordinated by genomic distributions of the effective superhelicity.

RESULTS

3.2 Role of supercoiling and chromatin protein FIS in transcriptional regulation of an individual promoter

The current section describes the role of supercoiling and FIS in activation of the promoter of one of the stable RNA promoters, tyrT. The obtained results give an insight into the mechanistic basis of interplay of these regulators at the molecular level.

3.2.1 Mechanism of transcriptional regulation by FIS & supercoiling: tyrT promoter paradigm

It is known that the tyrT and other stable RNA promoters are regulated by FIS and negative supercoiling [Lazarus & Travers, 1993; Muskhelishvili et al., 1995 and 1997; Free & Dorman, 1994; Bowater et al., 1994]. Figure 16A shows the sequence organization of tyrT promoter. To address the role of the core promoter structure in the response of the tyrT promoter to activation by FIS and regulation by supercoiling, three different “up” mutations were introduced in the tyrT core promoter region: a -35 “up” mutation (35U), a discriminator mutation (D), and an A-T base-pair insertion at position -22 in the spacer region between the -10 and -35 elements (S) (Figure 16B). The mutations in the -35 region and in the spacer (35U and S) increase the homology of the promoter to the consensus polymerase binding sequence and the discriminator mutation (D) relieves the block imposed by the G/C-rich discriminator. Both the wild-type and truncated promoter constructs lacking sequences beyond position -61 and thus devoid of UAS with all three FIS binding sites were used for the study. These latter promoter constructs are designated ∆61 promoters.

RESULTS

Figure 16: Schematic representation of tyrT promoter. (A) Shows the position of three upstream FIS binding sites (I, II & III) and the other core promoter elements. (B) The Sequences of core regions of tyrT and its derivatives are shown. The spacer region and the – 35 and – 10 and discriminator elements are indicated. The substitutions in the discriminator and – 35 hexamer regions and the insertion in the spacer region are highlighted in bold. The consensus – 35 and – 10 elements are shown for reference below.

3.2.2 In vivo expression of tyrT in CSH50 Wt & fis mutant

The in vivo activity of tyrT promoter was investigated by transforming the tyrT promoter – lacZ fusion construct ptyrT (Wt) and its derivatives ptyrTD (D), ptyrTS (S), ptyrT35U (35U) into CSH50 wild-type and CSH50 fis::kan cells. The corresponding

UAS truncated versions (∆61 constructs) of all the core promoter mutants and the wild- type were also investigated to distinguish the effects of core promoter from those of FIS and the UAS region. Figure 17 shows the averaged β-Galactosidase activities from two independent experiments normalized to the activity of full length wild-type promoter set at 100%. The higher activities of the mutant promoters compared to both the full length and ∆61 wild-type constructs can be explained by the introduced up mutations. The observed absence of difference between wild-type and fis cells in the case of full length promoters is consistent with previous finding which suggests a de-repression mechanism of stable RNA promoters operating in fis cells [Lazarus & Travers, 1993].

RESULTS

Figure 17: The relative β-Galactosidase activity from different ptyrT derivatives. The relative (activity of full length ptyrT Wt taken as 100%) activities of ptyrT derivatives transformed into CSH50 Wt (Wt) & CSH50 fis::kan (fis) from full length and UAS truncated (∆61) promoters is shown.

Increased global superhelicity in the fis cells [Schneider et al., 1997] could be one of the reasons of de-repression of stable RNA promoters, while in wild-type cells, suboptimal supercoiling at the stable RNA promoters has been shown to be compensated by binding of FIS at the UAS [Rochman et al., 2002]. The lack of this compensatory mechanism is clearly seen only in the wild-type ∆61 promoter expressed in wild type cells (Figure 17). These results confirm the findings that regulatability of tyrT promoter is inherent in its core promoter [Travers et al., 1980; Lamond & Travers, 1985] and that FIS plays compensatory role [Lazarus & Travers, 1993].

3.2.3 Dependence of promoter activity on superhelical density in vivo

To test whether the mutations in the core promoter altered the transcriptional response to supercoiling in vivo we used LZ strains LZ41, LZ54 and LZ23. LZ23 harbors drug resistant gyrase gene (gyrAL83) with the wild-type topoisomerase I & IV genes (topA &

RESULTS

parC) which allows the supercoiling in this strain to be maintained after norfloxacin treatment at near physiological levels (σ = - 0.073) [Zechiedrich et al., 1997]. In contrast, the same treatment induces DNA relaxation in LZ41 and hypernegative supercoiling in LZ54 (Figure 12A). Under these conditions the response of the rrnA P1 promoter is dependent on the fis genotype, implying that there are no significant variations in FIS levels during the norfloxacin treatment [Rochman et al., 2002]. All the strains used in the experiment shown in Figure 18 contain FIS. In this genetic background the activities of ∆61 derivatives of the wild-type and discriminator mutant promoters both exhibited a strong dependence on superhelical density (Figure 18).

Figure 18: In vivo expression of tyrT promoter constructs. (A) In vivo expression from tyrT promoter at different superhelical densities. Primer extension product of transcription from genomic total ribosomal RNA P1 promoters (rrn P1), used as a control, is also shown. (B) Graphical representation of tyrT transcript intensities. 52

RESULTS

Both ∆61 wild-type and ∆61 D constructs had low activity at low superhelical density, about tenfold higher activity at near physiological density and a lower, but intermediate, activity on hypernegatively supercoiled plasmid. However the two promoters differed in their response to varying superhelicity in the presence of the UAS. The wild-type promoter had an enhanced response to superhelicity. Again the promoter lacked significant activity at low superhelicity but was strongly activated at near- physiological superhelical density and notably, activity was further increased with the hypernegatively supercoiled plasmid, similar to the effect observed by Bowater et al [Bowater et al., 1994]. However, with the discriminator mutant the presence UAS substantially increased promoter activity at all superhelical densities tested but did not alter the profile of the response. In sharp contrast the activities of the tyrTS and tyrT35U mutant promoters lacking the UAS were much less dependent on variations in superhelicity with both of these promoters exhibiting high activity in vivo at low superhelical density. Thus the loss of dependence on supercoiling was accompanied by a comparable loss of dependence on the UAS containing FIS binding sites. The relative activities of the promoters in this genetic background differ somewhat from those observed in CSH50 as also did the dependence of the activity of the discriminator mutant on the UAS.

3.2.4 Dependence of promoter activity on superhelical density in vitro

The in vivo results on the supercoiling sensitivity of promoter constructs were verified by in vitro transcription assays with truncated wild-type and mutant promoter constructs. Transcription was performed using supercoiled and linearized templates. We observed higher levels of transcription from mutants compared to the wild-type on linearized template, while transcription of supercoiled template is comparable between the wild-type and the mutants (Figure 19). Of all the mutants, 35U shows highest activity on the linear template and is also least sensitive to changes of supercoiling as seen in the in vivo experiments (Figure 18).

RESULTS

Figure 19: In vitro transcription of ∆61 constructs of wild type and derivatives. In vitro transcription assay was performed from supercoiled (σ = -0.075) and linearized templates. Transcripts originating from bla gene on the same plasmid is also shown. SC – supercoiled templates; lin – linear templates.

The tyrT wild-type and tyrTD promoter constructs, which clearly showed sensitivity to supercoiling, were investigated in more detail to elucidate the extent of activation by FIS at different superhelical densities. The activity of the wild-type promoter showed a more strict dependence on supercoiling level for its activity, while tyrTD was active under a broader range of superhelical densities (Figure 20A). Presence of FIS was seen to activate the transcription at all supercoiling levels in both wild-type and the discriminator mutant, but the activation of the wild-type was more significant under non-optimal supercoiling levels (σ = - 0.036 & -0.068) (Figure 20B).

3.2.5 Effects of promoter mutations on the function

Since the data obtained implicated the mutations in the core promoter region in the altered sensitivity to both supercoiling and FIS we next investigated the effects of these mutations on promoter function by using potassium permanganate footprinting

RESULTS

techniques. Potassium permanganate reacts with bases, especially thymine, where the base-stacking in the DNA duplex is disrupted [Gralla et al., 1993]. In these experiments

Figure 20: in vitro transcription from tyrTwild-type and tyrTD at different supercoiling. (A) In vitro transcription at different superhelical densities from tyrT wild-type, tyrTD and reference bla promoters is shown. (B) Fold activation of transcription by FIS from tyrT wild-type and tyrT D at different superhelical densities. RNA polymerase was used in large excess to promoter DNA and the complexes were equilibrated for 30 minutes prior to a short exposure to permanganate ion. Figure 21A (lanes 1 and 2) shows that addition of RNA polymerase to the wild-type promoter did not alter the reactivity pattern on native supercoiled plasmid DNA (σ = −0.068). By 55

RESULTS

contrast the tyrTD promoter mutant showed significantly increased reactivity within the −10 region at positions T-8, A-10, T-11 and A-12 (lanes 4, 5). In addition bases T-3 and T-4 within the discriminator as well as bases T+3 and T+4 were reactive suggesting that DNA unwinding had extended from the −10 region to the start point in this mutant. No enhanced signals were observed in the other mutants in these positions (C-3, C-4). For both the tyrTS and tyrT35U increased reactivity was observed within the −10 region at positions T-8, A-10, T-11 and A-12 (lanes 7, 8 and 10, 11) although the effect was much for the former mutant. Unlike the tyrTD mutant neither of the tyrTS nor the tyrT35U mutant promoters exhibited increased reactivity at positions T+3, T+4.

Figure 21: Potassium permanganate footprinting of ptyrT and its derivatives. (A) Footprinting performed in the absence of nucleoside triphosphates. The positions of permanganate reactive thymine bases are indicated. (B) Footprinting performed in the presence of initiating nucleoside triphosphates GTP and CTP. FIS and RNAP when added is indicated by a ‘+’. Wt, D, S and 35U are the wild-type and mutants of ptyrT.

RESULTS

Addition of FIS increased the reactivity of bases T-8 and T-11 at the wild-type promoter (lanes 1–3). Also, in the presence of FIS the permanganate reactivity for all promoter derivatives was further increased, the tyrTS and tyrT35 mutants exhibiting a greater response than tyrTD. These observations show that at all promoters, albeit to varying degrees, FIS enhances the interaction with the −10 region. The formation of initiation (open) complex at the wild-type tyrT promoter requires the presence of GTP and CTP to allow the synthesis of the dinucleotide pppGpC [Muskhelishvili et al., 1997]. Figure 21B shows that under these conditions enhanced permanganate reactivity was observed at the wild-type promoter principally at positions T+3, T+4, T+10, T+26 and addition of FIS had very small, if any, effect (lanes 1–3). The reactivity at positions +3 and +4, and possibly that at +10, corresponds to the transcription “bubble” in the DNA. The cleavage patterns observed in the mutant promoters differ from the wild-type in one major respect, permanganate cleavage being apparent in all of them in the −10 and/or discriminator regions. For all the mutant promoters FIS enhances cleavage significantly suggesting that in these cases FIS can facilitate initiation complex formation. A similar effect of FIS on the wild-type promoter has previously been observed on a linear DNA template [Muskhelishvili et al., 1997].

DISCUSSION

4 Discussion

The idea of this work was to integrate the effects of fis and hns genes, representing the ‘digital’ components of genetic information, and variations in DNA superhelicity forming the ‘analog’ component in order to understand the logics of concerted rearrangement of global transcription. In a review by Travers and Muskhelishvili [Travers & Muskhelishvili, 2005b], it is argued that the transcription initiation is predominantly determined by the topology of the initiation complex and the intrinsic twist of the DNA, which strongly depends on the mode of DNA packaging. This later property of the DNA is determined by the chromatin proteins. A high amount of variability is seen in DNA packaging by different chromatin proteins. FIS has been shown to stabilize both the toroidal and plectonemic forms of DNA, while H-NS stabilizes a tight plectoneme [Maurer et al., 2006; Schneider et al., 2001]. Further, repression or activation of individual gene promoters can also be a result of differential binding of chromatin proteins. H-NS is known to be a global repressor of transcription [Dorman, 2004] and manages to do so by occluding the polymerase binding site or by trapping the polymerase in abortive cycle [Schroder & Wagner, 2000]. H-NS can also silence a gene by DNA oligomerization of two intrinsically bent, AT rich, remotely placed upstream and downstream binding sites as observed in the case of bgl operon [Ueguchi & Mizuno, 1993]. FIS also represses promoters by promoter occlusion (gyrA promoter) and polymerase trapping (gyrB promoter) [Schneider et al., 1999]. Activation by FIS, a more widely studied phenomenon, is accomplished by direct interaction with RNAP and also by trapping the supercoils and directing them to facilitate promoter opening. The ability of FIS in regulating multiple steps of transcription is evident from the study of different tyrT promoter mutants in the current work, a detailed discussion of which will follow in the subsequent sections. The effects exerted by global regulators like FIS and H-NS are complex and require investigation on both global (genome) and local (single promoter) levels. However, both of these phenomena are associated with

DISCUSSION

topological deformation of DNA, underscoring the importance of understanding the relationships between DNA topology and DNA architectural proteins.

4.1 Interdependency of supercoiling and NAPs

Supercoiling in E.coli is predominantly controlled by gene products of gyrA, gyrB and topA. While gyrA & gyrB promoters are repressed by FIS [Schneider et al., 1999], in vitro studies on binding of FIS at topA promoter has been shown to activate its expression depending on the concentration of FIS [Weinstein-Fischer & Altuvia, 2007]. Since supercoiling in vivo is maintained by the opposing actions of these enzymes [DiNardo et al., and Pruss et al., 1982], their relative activities could be regulated to produce various levels of supercoiling which also has been shown to be modulated by FIS [Schneider et al., 1997]. Thus FIS affects both the activity and the expression of topoisomerases and helps in maintaining a constant superhelical energy during exponential growth in E.coli. Part of this homeostatic control is also due to the regulation of topoisomerase expression in response to supercoiling [Menzel et al., 1983; Tse-Dinh et al., 1985]. H-NS mutant has been reported to show an increase in unconstrained supercoiling [Mojica & Higgins, 1997].

Homeostatic control of supercoiling is exerted by topoisomerases responding to a change in the number of unrestrained supercoils, which is a consequence of change in binding of NAPs or change in external environment. The only known effector for DNA gyrase to sense the nutritional richness of the environment is the in vivo ATP level. The ATP level has been implicated in the recovery of supercoils after starvation, but the relaxation of DNA was seen to be not directly correlated with the cellular ATP levels [Balke and Gralla, 1987]. Transcription and RNAP binding also change the dynamics of supercoiling [Gamper & Hearst, 1982]. In spite of different perturbations, the bacteria during steady-state growth strive to maintain a constant level of superhelical energy. Hence a fundamental question that arises is how the cell determines the level of supercoiling that is appropriate to each physiological situation?

DISCUSSION

In a study by Balke & Gralla, the changes in supercoiling has been shown to be dependent on the growth phase rather than on the growth rate [Balke & Gralla, 1987]. In the current work, though there are differences in the growth rates of wild-type, fis (lower growth rate compared to wild-type) & hns (higher growth rate compared to wild- type) mutants the supercoiling does not differ much (Figure 12). Since it is known that in slower-growing cells, transcription from stable RNA promoters is decreased relative to that in fast-growing cells, the decrease in growth rate in the fis mutant or the increase in the growth rate of hns mutant can be a direct effect of these proteins on the stable RNA transcription. The molecular basis of this type of growth control and the role of FIS will be discussed later. H-NS, the other NAP studied here forms a filament like structure bridging two DNA duplexes and acting as a zipper [Dame, 2005]. The increase in negative supercoiling shown here is consistent with the previous reports [Mojica et al., 1997]. The reason for this increase is not clearly understood. The role de- repression of transcription in hns mutant leading to an increased global supercoiling (according to twin-domain model of supercoiling distribution) has been ruled out [Mojica et al., 1997]. Our recent study identified a 10bp AT-rich consensus recognized by H-NS and serving as a nucleation site to restrain negative supercoiling [Lang et al., 2007].

FIS protein (1 FIS molecule per 450bp of E.coli genome) is more abundant than H-NS (1 H-NS dimer per 1400bp) during exponential growth. These two proteins are known to compete for binding to DNA and their binding also depends on the supercoiling. FIS is known to preferentially bind DNA with intermediate superhelical density and it also has been shown to protect DNA of intermediate superhelical density from relaxation by topoisomerases I [Schneider et al., 1997]. Most of the effect of FIS is in fine tuning of transcription according to the prevailing situation, as it can both activate and repress the expression of a certain gene based on the growth phase. An example for this phenomenon can been seen in a work with osmE promoter by Bordes et al., [Bordes et al., 2002]. The effect of H-NS on transcription is more straightforward, it mainly acts as global repressor. In hns mutant 70% of the regulated genes are associated with Rep group while in fis mutant the Rep genes increased transiently only during exponential phase (Table 1 & Figure 14). Double-coded genes (Figure 14) from

DISCUSSION fis experiment show both activation and repression by FIS especially under conditions of relaxation. Whilst, as expected the effect of hns mutation was most pronounced for the Rep genes, these Rep genes predominated the entire growth cycle and were equally enriched under both hypernegative and relaxed conditions.

In summary variable distribution of supercoiling sensitivity of transcripts as seen from the genomic wheels (Figure 13) reflect a compound effect of several cooperating factors, including chromatin proteins FIS and H-NS. The genomic wheel picture of transcript profile gives an idea of (1) the supercoiling distribution during different growth phases throughout the genome (2) the effect of different chromatin proteins on such distribution, and (3) also can help in defining the domain boundaries, formation of which is probably a result of differential supercoiling sensitivity or differential NAPs binding in the genome. The data so far supports the idea that transcription is governed by “effective” superhelicity – a parameter reflecting the dynamic nature of competition between topoisomerases, NAPs and also the transcription machinery itself [Travers & Muskhelishvili, 2005b; Geertz et al., 2007].

4.2 Supercoiling coordinates metabolic functions

The changes of supercoiling levels inside the cell not only affect global genome structure and the formation of supercoiling domains with the help of NAPs, but also mediate the change of metabolic preferences. Supercoiling is known to act as a sensor of external environment, whereby the supercoiling level changes in response to nutrition, stress, temperature and ionic content [Balke & Gralla, 1987; Cheung et al., 2003; Dorman, 1996; Travers & Muskhelishvili, 2005a]. It is feasible to imagine the bacterial cell accumulating the energy during exponential growth when nutrition is freely available and storing it in the form of increased torsional tension in the DNA. Put other way, an increase in nutrition leading to increase in ATP/ADP ratio will increase gyrase activity making the DNA more negatively supercoiled. Also increased cell division during exponential growth will have to match with increased requirement for biosynthesis functions. During unfavourable conditions when the nutrition is sparse the

DISCUSSION

cells maintain viability by deriving energy from degradation of macromolecules. The current work provides evidence for the first time of a relation between the genes involved in biosynthetic and degradation pathways and supercoiling preference of gene activities. Table 2 illustrates that the biosynthetic pathways are made up predominantly of Hyp genes while the degradation pathways prefer Rel genes, implicating the supercoiling as global regulator of metabolic functions. A more detailed analysis of the gene promoters with respect to their sequence organization, their topological properties, their preference of sigma factors and any NAP binding can help to better understand the mechanistic basis of the functional switch from biosynthesis to degradation.

The tricaboxylic acid (TCA) cycle and the glyoxylate bypass provide an example for coupling of supercoiling sensitivity to metabolic function. The TCA cycle (Figure 15A) plays two essential roles in metabolism. First, the cycle is responsible for the total oxidation of acetyl coenzyme A (CoA), derived mainly from the pyruvate produced by glycolysis. Second, TCA cycle intermediates are required in the biosynthesis of several amino acids. For long the TCA cycle was considered as housekeeping pathway, but of lately evidences show that it is an inducible pathway [Iuchi & lin, 1988; Iuchi et al., 1989; Guest & Russell, 1992]. The full TCA cycle in E.coli is seen only during aerobic growth on acetate or fatty acid and under anaerobic conditions the cycle is not used for energy production but used more as a biosynthetic pathway. The growth on acetate or fatty acids also results in the induction of the glyoxylate shunt, which is the biosynthetic pathway to replenish the intermediates for amino acid biosynthesis. The gene icdA which codes for IDH (isocitrate dehydogenase) plays a key role in partition of carbon between TCA cycle and glyoxylate shunt. The switch is controlled by phosphorylation of IDH which inactivates IDH and activates the glyoxylate bypass. The genes in the bypass show preference for hypernegative supercoiling while the suc and sdh genes of the TCA cycle are more active under relaxation of DNA. Thus hypernegative supercoiling reflecting increased gyrase activity resulting from a high ATP/ADP ratio favours the glyoxylate bypass and substrate synthesis. Activation of the suc and sdh gene operons under conditions of DNA relaxation (low ATP/ADP ratio) helps in capturing the energy released by carbon metabolism. The switching gene icdA itself is also sensitive to hypernegative

DISCUSSION supercoiling, and so is the gene for its phosporylation (aceK) in the same ace operon of the bypass genes. Interestingly the icdA mutants can be readily isolated by selecting for nalidixic acid resistance (gyrase inhibitor) [Helling & Kukora, 1971].

Furthermore, we found that the de novo pathway of nucleotide biosynthesis explicitly involves the Hyp genes (Figure 15B). Most of these genes have promoters with a GC-rich ‘discriminator’ sequence, which confers sensitivity to both high negative supercoiling and the regulatory nucleotide ppGpp [Neidhardt, F.C. et al., 1987; Nygaard et al., 1996]. Notably, both the superhelicity and ppGpp concentration are elevated in fis cells [Travers & Muskhelishvili, 2005b], indicating a homeostatic regulation mechanism. The observed coupling of distinct supercoiling sensitivities to essential metabolic pathways provides new insights into the mechanisms that coordinate central metabolism, and also sheds light on the puzzling observation that mutations in metabolic genes can affect DNA topology [Hardy & Cozzarelli, 2005].

4.3 Activity of tyrT promoter - Interaction of supercoiling and FIS at the promoter level

We also investigated the molecular mechanism of regulation of an individual gene transcription and an interplay between supercoiling and transcriptional regulator FIS using the tyrT promoter system as a model.

The promoters of stable RNA operons are subject to a complex regulatory network which coordinates the activity of translation machinery with the metabolic demands of the cell. Our data indicate that the effects of fis on tyrT transcription in vivo are a consequence of at least two phenomena, one local and one global: a direct activation by binding of FIS to UAS and interaction with RNA polymerase at the promoter [Bokal et al., 1995; Muskhelishvili et al., 1995] and general FIS dependent reduction in the average superhelical density of the DNA template [this work and Schneider et al., 1997]. These effects would be expected, respectively, to increase and decrease tyrT transcription consistent with the homeostatic mode of regulation. Recently Rochman et al. [Rochman et al., 2002] have shown that stabilization of local 63

DISCUSSION

writhe in the UAS by FIS protects rrnA P1 promoters from inactivation at sub-optimal superhelical densities. This compensatory effect is also apparent with wild-type tyrT in vivo when expressed from hyperhegatively supercoiled plasmid DNA. We see here that the mutations in the core promoter that alter the sensitivity to supercoiling also alter the response to FIS, although the UAS region containing the FIS binding sites remain intact. Also the increased supercoiling of the wild-type promoter template in the fis cells [Auner et al., 2003] may, in principle compensate for the absence of FIS. The distinct roles of core promoter and UAS in sensing the supercoiling and FIS revealed in this work, together describe the extent of regulatability built into the stringently controlled tyrT promoter.

4.3.1 Promoter structure and function

We have studied the effects of the three mutations of tyrT core promoter: a change in the -35 region to the consensus sequence TTGACA, an increase in the spacing between the –10 and –35 hexamers from a suboptimal 16bp to the consensus 17bp [Lisser et al., 1993], and a 4bp substitution in the discriminator region (TTAA in place of CCCC, Figure 16B). The mutations towards the consensus exhibit substantially increased activity in vivo (Figure 17).

The permanganate reactivity of promoter mutants’ show that all the core promoter mutants studied in the absence of FIS and NTPs have enhanced interactions with polymerase relative to the wild-type promoter in the TG of the extended –10 region and the –10 region itself (Figure 21A). The mutation in the spacer and –35 hexamer also result in the loss of dependence on negative superhelicity, showing that the sensitivity of the tyrT promoter to this parameter is determined by more than one aspect of sequence organization. A further similarity is that both these mutations act in vitro to enhance interactions with the –10 region (Figure 21). Notably, neither of these mutations enhanced permanganate reactivity in the vicinity of the transcription start point in the absence of NTPs. We infer that a major effect of these mutations is to promote untwisting of DNA within the –10 hexamer. The inference we draw is that a

DISCUSSION primary effect of negative superhelicity on the tyrT promoter is to drive the untwisting of the –10 region.

The discriminator region has previously been implicated as an important determinant of transcriptional response to negative supercoiling at hisR and tyrT promoters [Figueroa-Bossi et al., 1998; Pemberton et al., 2000]. In the experiments described here we have shown that in the absence of the initiating NTPs a discriminator mutation enhances contacts around – 10 region and the transcription start point, implying that the mutation relieves a discriminator-dependent block on open complex formation. Also, the tyrTD mutation reduces the optimum superhelical density for transcription in vitro. However, in the LZ strains the discriminator mutant is still strongly activated by negative superhelicity and is less active at hypernegative sigma values (Figure 18). Taken together these observations suggest that an intact discriminator enhances the response of a promoter to a negative superhelicity and that overall its mutation attenuates, but does not abolish, the response.

We found that mutation of the –35 region or the spacer region to the consensus abolishes dependence of expression on negative superhelicity in vivo while mutation of the discriminator does not. We infer that the response to superhelicity is modulated by the primary promoter elements (-35 hexamer, spacer, -10 hexamer). These elements individually or together, determine the torque available for nucleation, the polymerase- dependent untwisting of the –10 region. The role of the discriminator element is different. This element blocks the subsequent propagation of untwisting from the –10 region to the transcription start point and hence constitutes a barrier to open complex formation. Even when nucleation was promoted by mutation of the spacer or the –35 region no further progression of the untwisted region to the start point was observed (Figure 21A) presumably because these variant promoters still contained an intact discriminator. One explanation for the partial alleviation of the response to supercoiling by the tyrTD mutation would be lowering of the activation energy for untwisting of the –10 region by virtue of its proximity [Drew et al., 1985].

DISCUSSION

4.3.2 Mechanism of transcriptional activation of the tyrT promoter

Stable RNA promoters in E. coli are both highly regulated and show a high maximal rate of transcription initiation. The tyrT UAS is necessary for optimal expression in vivo [Lamond & Travers, 1983] and can activate transcription in both FIS-dependent and independent modes. In vitro the tyrT UAS increases the affinity of the polymerase for the promoter [Sander et al., 1993] and has been inferred to make a contact with RNA polymerase at positions around -120 to -130 on a negatively supercoiled DNA template [Pemberton et al., 2002]. We note that using conditions where we would expect this contact to be formed efficiently we do not observe untwisting of the -10 region in the wild-type promoter (Figure 21A), although the -10 hexamer is contacted prior to the formation of the upstream contact [Pemberton et al., 2002]. However, untwisting does occur in the presence of FIS (Figure 21A). This is consistent with both previous observation that FIS facilitates DNA untwisting in the -10 region in the presence of the initiating NTPs [Muskhelishvili et al., 1997] and also with other observations that FIS can rescue the impaired activity of a promoter with down mutation in the -10 region [Lazarus & Travers, 1993] and of a mutant RNA polymerase whose binding to the rrnB P1 promoter is destabilized [Bartlett et al., 2000]. The finding that the -35U and spacer mutants simultaneously lose the dependence on negative superhelicity and the requirement for the UAS in vivo suggests that these mutations overcome wholly or partially the barrier imposed by the wild-type promoter organization and hence abolish the requirement for activation by the UAS alone or by FIS bound to the UAS. The UAS thus acts primarily as a regulatory region with a distinct DNA geometry that is sensitive to the superhelical density of the DNA template [Travers & Muskhelishvili, 1998]. Stabilization of this geometry by FIS buffers polymerase function against variations in negative superhelicity. Provision of such a buffer by FIS operates both for the tyrT promoter (this work) and also for the rrnA P1 promoter [Rochman et al., 2002]. We would expect this mechanism to be common to all promoters of similar organization. From the data here we infer that the regulated step in transcription initiation at the tyrT and possibly other stable RNA promoters is the untwisting of the -10 region, a step 66

DISCUSSION which both stabilizes the polymerase–promoter interaction and provides a nucleation point for strand separation during promoter opening. At the tyrT promoter contacts in the -10 region are facilitated by negative supercoiling [Pemberton et al., 2002] and untwisting by FIS binding to the UAS [Muskhelishvili et al., 1997 and this work]. FIS can also alleviate the inhibitory effect of ppGpp on transcription from the wild-type tyrT promoter in vitro [Lazarus & Travers, 1993]. One, at least, of the mutations tested, tyrTD, is insensitive to inhibition by ppGpp in vivo and in vitro [Lamond & Travers, 1985; Travers, 1980]. Taken as a whole these observations imply that for transcription initiation at stable RNA promoters there is a mechanistic connection involving not only high negative superhelicity and ppGpp levels, as previously suggested by Ohlsen & Gralla [Ohlsen and Gralla, 1992] and by Figueroa-Bossi et al. [Figueroa-Bossi et al., 1998] but also FIS. Together these parameters act to maintain tightly controlled levels of transcription.

CONCLUSION

5 Conclusion

Regulation of cellular growth involves coordinated gene expression programs. An essential question is, how during growth the global transcription is organized in the genome. We demonstrate in unicellular organism E.coli that the coordination of growth phase-dependent transcription involves spatiotemporal organization of supercoiling sensitivity in the genome. On the example of tyrT promoter we demonstrate how the sequence organization of a promoter can determine supercoiling sensitivity. We show that the distributions of supercoiling sensitivity are modulated by chromatin proteins - both at global and local promoter levels - involved in organizing cellular metabolism during successive stages of growth. More compellingly, our approach identifies a tight coupling between unique genes and the ubiquitous torsional properties of the genomic DNA in coordinating essential metabolic functions. Global regulation thus appears to act as a genuine device converting the “analog” information of torsional energy distributions into “digital” patterns of genomic activity (and vice versa). This work thus not only validates the John von Neumann notion on the coordination of genetic information at a most basic level, but also offers a novel strategy for further investigations. Notably, it is now evident that DNA supercoiling plays an increasingly important role in regulation of eukaryotic transcription [Dunaway & Ostrander, 1993], suggesting that this type of approach may facilitate the understanding of fundamental mechanisms coordinating the gene expression.

REFERENCES

6 References

Ali Azam, T., Iwata, A., Nishimura, A., Ueda, S., and Ishihama, A. (1999) Growth phase-dependent variation in protein composition of the Escherichia coli nucleoid. J Bacteriol 181: 6361-6370.

Azam, T.A., and Ishihama, A. (1999) Twelve species of the nucleoid-associated protein from Escherichia coli. Sequence recognition specificity and DNA binding affinity. J Biol Chem 274: 33105-33113.

Balke, V.L., and Gralla, J.D. (1987) Changes in the linking number of supercoiled DNA accompany growth transitions in Escherichia coli. J Bacteriol 169: 4499-4506.

Ball, C.A., Osuna, R., Ferguson, K.C., and Johnson, R.C. (1992) Dramatic changes in Fis levels upon nutrient upshift in Escherichia coli. J Bacteriol 174: 8043-8056.

Bartlett, M.S., Gaal, T., Ross, W., and Gourse, R.L. (2000) Regulation of rRNA transcription is remarkably robust: FIS compensates for altered nucleoside triphosphate sensing by mutant RNA polymerases at Escherichia coli rrn P1 promoters. J Bacteriol 182: 1969-1977.

Bokal, A.J.t., Ross, W., and Gourse, R.L. (1995) The transcriptional activator protein FIS: DNA interactions and cooperative interactions with RNA polymerase at the Escherichia coli rrnB P1 promoter. J Mol Biol 245: 197-207.

REFERENCES

Bordes, P., Conter, A., Morales, V., Bouvier, J., Kolb, A., and Gutierrez, C. (2003) DNA supercoiling contributes to disconnect sigmaS accumulation from sigmaS- dependent transcription in Escherichia coli. Mol Microbiol 48: 561-571.

Bowater, R.P., Chen, D., and Lilley, D.M. (1994) Modulation of tyrT promoter activity by template supercoiling in vivo. Embo J 13: 5647-5655.

Browning, D.F., and Busby, S.J. (2004) The regulation of bacterial transcription initiation. Nat Rev Microbiol 2: 57-65.

Burgess, R.R. (1969) Separation and characterization of the subunits of ribonucleic acid polymerase. J Biol Chem 244: 6168-6176.

Cheung, K.J., Badarinarayana, V., Selinger, D.W., Janse, D., and Church, G.M. (2003) A microarray-based antibiotic screen identifies a regulatory role for supercoiling in the osmotic stress response of Escherichia coli. Genome Res 13: 206-215.

Crozat, E., Philippe, N., Lenski, R.E., Geiselmann, J., and Schneider, D. (2005) Long- term experimental evolution in Escherichia coli. XII. DNA topology as a key target of selection. Genetics 169: 523-532.

Dame, R.T., Wyman, C., and Goosen, N. (2001) Structural basis for preferential binding of H-NS to curved DNA. Biochimie 83: 231-234.

Dame, R.T. (2005) The role of nucleoid-associated proteins in the organization and compaction of bacterial chromatin. Mol Microbiol 56: 858-870.

Deng, S., Stein, R.A., and Higgins, N.P. (2005) Organization of supercoil domains and their reorganization by transcription. Mol Microbiol 57: 1511-1521.

DiNardo, S., Voelkel, K.A., Sternglanz, R., Reynolds, A.E., and Wright, A. (1982) Escherichia coli DNA topoisomerase I mutants have compensatory mutations in DNA gyrase genes. Cell 31: 43-51.

Dorman, C.J. (1996) Flexible response: DNA supercoiling, transcription and bacterial adaptation to environmental stress. Trends Microbiol 4: 214-216.

Dorman, C.J., and Deighan, P. (2003) Regulation of gene expression by histone-like proteins in bacteria. Curr Opin Genet Dev 13: 179-184.

REFERENCES

Dorman, C.J. (2004) H-NS: a universal regulator for a dynamic genome. Nat Rev Microbiol 2: 391-400.

Drew, H.R., Weeks, J.R., and Travers, A.A. (1985) Negative supercoiling induces spontaneous unwinding of a bacterial promoter. Embo J 4: 1025-1032.

Drlica, K. (1992) Control of bacterial DNA supercoiling. Mol Microbiol 6: 425-433.

Dunaway, M., and Ostrander, E.A. (1993) Local domains of supercoiling activate a eukaryotic promoter in vivo. Nature 361: 746-748.

Figueroa-Bossi, N., Guerin, M., Rahmouni, R., Leng, M., and Bossi, L. (1998) The supercoiling sensitivity of a bacterial tRNA promoter parallels its responsiveness to stringent control. Embo J 17: 2359-2367.

Free, A., and Dorman, C.J. (1994) Escherichia coli tyrT gene transcription is sensitive to DNA supercoiling in its native chromosomal context: effect of DNA topoisomerase IV overexpression on tyrT promoter function. Mol Microbiol 14: 151-161.

Gamper, H.B., and Hearst, J.E. (1982) A topological model for transcription based on unwinding angle analysis of E. coli RNA polymerase binary, initiation and ternary complexes. Cell 29: 81-90.

Geertz, M., Mavathur, R., Travers, A., Muskhelishvili, G. (2007) RNA polymerase composition is homeostatically coupled with DNA topology in E. coli. Submitted to EMBO reports.

Gille, H., Egan, J.B., Roth, A. and Messer, W. (1991) The FIS protein binds and bends the origin of chromosomal DNA replication, oriC, of Escherichia coli. Nucleic Acids Res, 19, 4167-4172.

Gomez-Eichelmann, M.C., and Camacho-Carranza, R. (1995) [DNA supercoiling and topoisomerases in Escherichia coli]. Rev Latinoam Microbiol 37: 291-304.

Gralla, J.D., Hsieh, M. & Wong, C. (1993) Permanganate probing. In Footprinting Techniques for Studying Nucleic Acid-Protein complexes (Revzin, A., ed.) pp.107-128, Academic Press, Orlando, FL.

REFERENCES

Gruber, T.M., and Gross, C.A. (2003) Multiple sigma subunits and the partitioning of bacterial transcription space. Annu Rev Microbiol 57: 441-466.

Guest, J.R., and Russell, G.C. (1992) Complexes and complexities of the citric acid cycle in Escherichia coli. Curr Top Cell Regul 33: 231-247.

Hardy, C.D., and Cozzarelli, N.R. (2005) A genetic selection for supercoiling mutants of Escherichia coli reveals proteins implicated in chromosome structure. Mol Microbiol 57: 1636-1652.

Hatfield, G.W., and Benham, C.J. (2002) DNA topology-mediated control of global gene expression in Escherichia coli. Annu Rev Genet 36: 175-203.

Heinemann, M., and Wagner, R. (1997) Guanosine 3',5'-bis(diphosphate) (ppGpp)- dependent inhibition of transcription from stringently controlled Escherichia coli promoters can be explained by an altered initiation pathway that traps RNA polymerase. Eur J Biochem 247: 990-999.

Helling, R.B., and Kukora, J.S. (1971) Nalidixic Acid-Resistant Mutants of Escherichia coli Deficient in Isocitrate Dehydrogenase. J. Bacteriol. 105: 1224-1226.

Hengge-Aronis, R. (2002) Recent insights into the general stress response regulatory network in Escherichia coli. J Mol Microbiol Biotechnol 4: 341-346.

Hiasa, H., and Marians, K.J. (1994) Topoisomerase III, but not topoisomerase I, can support nascent chain elongation during theta-type DNA replication. J Biol Chem 269: 32655-32659.

Ishihama, A. (1999) Modulation of the nucleoid, the transcription apparatus, and the translation machinery in bacteria for stationary phase survival. Genes Cells 4: 135-143.

Ishihama, A. (2000) Functional modulation of Escherichia coli RNA polymerase. Annu Rev Microbiol 54: 499-518.

Iuchi, S., and Lin, E.C. (1988) arcA (dye), a global regulatory gene in Escherichia coli mediating repression of enzymes in aerobic pathways. Proc Natl Acad Sci U S A 85: 1888-1892.

REFERENCES

Iuchi, S., Cameron, D.C., and Lin, E.C. (1989) A second global regulator gene (arcB) mediating repression of enzymes in aerobic pathways of Escherichia coli. J Bacteriol 171: 868-873.

Jeong, K.S., Ahn, J., and Khodursky, A.B. (2004) Spatial patterns of transcriptional activity in the chromosome of Escherichia coli. Genome Biol 5: R86.

Josaitis, C.A., Gaal, T., and Gourse, R.L. (1995) Stringent control and growth-rate- dependent control have nonidentical promoter sequence requirements. Proc Natl Acad Sci U S A 92: 1117-1121.

Keller, W. (1975) Determination of the number of superhelical turns in simian virus 40 DNA by gel electrophoresis. Proc Natl Acad Sci U S A 72: 4876-4880.

Kerkhoven, R., van Enckevort, F.H., Boekhorst, J., Molenaar, D., and Siezen, R.J. (2004) Visualization for genomics: the Microbial Genome Viewer. Bioinformatics 20: 1812-1814.

Khodursky, A.B., Zechiedrich, E.L., and Cozzarelli, N.R. (1995) Topoisomerase IV is a target of quinolones in Escherichia coli. Proc Natl Acad Sci U S A 92: 11801- 11805.

Koch, C., Vandekerckhove, J., and Kahmann, R. (1988) Escherichia coli host factor for site-specific DNA inversion: cloning and characterization of the fis gene. Proc Natl Acad Sci U S A 85: 4237-4241.

Kusano, S., Ding, Q., Fujita, N., and Ishihama, A. (1996) Promoter selectivity of Escherichia coli RNA polymerase E sigma 70 and E sigma 38 holoenzymes. Effect of DNA supercoiling. J Biol Chem 271: 1998-2004.

Lamond, A.I., and Travers, A.A. (1983) Requirement for an upstream element for optimal transcription of a bacterial tRNA gene. Nature 305: 248-250.

Lamond, A.I., and Travers, A.A. (1985) Stringent control of bacterial transcription. Cell 41: 6-8.

REFERENCES

molecular basis for selective silencing within proteobacterial genomes. Submitted to PNAS.

Lazarus, L.R., and Travers, A.A. (1993) The Escherichia coli FIS protein is not required for the activation of tyrT transcription on entry into exponential growth. Embo J 12: 2483-2494.

Lim, H.M., Lewis, D.E., Lee, H.J., Liu, M., and Adhya, S. (2003) Effect of varying the supercoiling of DNA on transcription and its regulation. Biochemistry 42: 10718- 10725.

Lisser, S., and Margalit, H. (1993) Compilation of E. coli mRNA promoter sequences. Nucleic Acids Res 21: 1507-1516.

Liu, L.F., and Wang, J.C. (1987) Supercoiling of the DNA template during transcription. Proc Natl Acad Sci U S A 84: 7024-7027.

Lockshon, D., and Morris, D.R. (1983) Positively supercoiled plasmid DNA is produced by treatment of Escherichia coli with DNA gyrase inhibitors. Nucleic Acids Res 11: 2999-3017.

Maurer, S., Fritz, J., Muskhelishvili, G., and Travers, A. (2006) RNA polymerase and an activator form discrete subcomplexes in a transcription initiation complex. Embo J 25: 3784-3790.

McClure, W.R. (1985) Mechanism and control of transcription initiation in prokaryotes. Annu Rev Biochem 54: 171-204.

McLeod, S.M., and Johnson, R.C. (2001) Control of transcription by nucleoid proteins. Curr Opin Microbiol 4: 152-159.

Menzel, R., and Gellert, M. (1983) Regulation of the genes for E. coli DNA gyrase: homeostatic control of DNA supercoiling. Cell 34: 105-113.

Mojica, F.J., and Higgins, C.F. (1997) In vivo supercoiling of plasmid and chromosomal DNA in an Escherichia coli hns mutant. J Bacteriol 179: 3528- 3533.

REFERENCES

Murray, K.D., and Bremer, H. (1996) Control of spoT-dependent ppGpp synthesis and degradation in Escherichia coli. J Mol Biol 259: 41-57.

Muskhelishvili, G., Travers, A.A., Heumann, H., and Kahmann, R. (1995) FIS and RNA polymerase holoenzyme form a specific nucleoprotein complex at a stable RNA promoter. Embo J 14: 1446-1452.

Muskhelishvili, G., Buckle, M., Heumann, H., Kahmann, R., and Travers, A.A. (1997) FIS activates sequential steps during transcription initiation at a stable RNA promoter. Embo J 16: 3655-3665.

Muskhelishvili, G., and Travers, A. (2003) Transcription factor as a topological homeostat. Front Biosci 8: d279-285.

Nachaliel, N., Melnick, J., Gafny, R. and Glaser, G. (1989) Ribosome associated protein(s) specifically bind(s) to the upstream activator sequence of the E. coli rrnA P1 promoter. Nucl. Acids Res., 17, 9811-9822.

Nasser, W., Schneider, R., Travers, A., and Muskhelishvili, G. (2001) CRP modulates fis transcription by alternate formation of activating and repressing nucleoprotein complexes. J Biol Chem 276: 17878-17886.

Neidhardt, F.C. et al. (1987) Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology Vol. 2. American Society for Microbiology.

Nygaard, P., Duckert, P., and Saxild, H.H. (1996) Role of adenine deaminase in purine salvage and nitrogen metabolism and characterization of the ade gene in Bacillus subtilis. J Bacteriol 178: 846-853.

Nystrom, T. (2004) Stationary-phase physiology. Annu Rev Microbiol 58: 161-181.

Ohlsen, K.L., and Gralla, J.D. (1992) DNA melting within stable closed complexes at the Escherichia coli rrnB P1 promoter. J Biol Chem 267: 19813-19818.

Ozoline, O.N., Deev, A.A., and Trifonov, E.N. (1999) DNA bendability--a novel feature in E. coli promoter recognition. J Biomol Struct Dyn 16: 825-831.

REFERENCES

Pan, C.Q., Finkel, S.E., Cramton, S.E., Feng, J.A., Sigman, D.S., and Johnson, R.C. (1996) Variable structures of Fis-DNA complexes determined by flanking DNA- protein contacts. J Mol Biol 264: 675-695.

Pan, W. (2002) A comparative review of statistical methods for discovering differentially expressed genes in replicated microarray experiments. Bioinformatics 18: 546-554.

Pedersen, A.G., Jensen, L.J., Brunak, S., Staerfeldt, H.H., and Ussery, D.W. (2000) A DNA structural atlas for Escherichia coli. J Mol Biol 299: 907-930.

Pemberton, I.K., Muskhelishvili, G., Travers, A.A., and Buckle, M. (2000) The G+C- rich discriminator region of the tyrT promoter antagonises the formation of stable preinitiation complexes. J Mol Biol 299: 859-864.

Pemberton, I.K., Muskhelishvili, G., Travers, A.A., and Buckle, M. (2002) FIS modulates the kinetics of successive interactions of RNA polymerase with the core and upstream regions of the tyrT promoter. J Mol Biol 318: 651-663.

Perez-Martin, J., and de Lorenzo, V. (1997) Clues and consequences of DNA bending in transcription. Annu Rev Microbiol 51: 593-628.

Peter, B.J., Arsuaga, J., Breier, A.M., Khodursky, A.B., Brown, P.O., and Cozzarelli, N.R. (2004) Genomic transcriptional response to loss of chromosomal supercoiling in Escherichia coli. Genome Biol 5: R87.

Pontiggia, A., Negri, A., Beltrame, M., and Bianchi, M.E. (1993) Protein HU binds specifically to kinked DNA. Mol Microbiol 7: 343-350.

Postow, L., Hardy, C.D., Arsuaga, J., and Cozzarelli, N.R. (2004) Topological domain structure of the Escherichia coli chromosome. Genes Dev 18: 1766-1779.

Pruss, G.J., Manes, S.H., and Drlica, K. (1982) Escherichia coli DNA topoisomerase I mutants: increased supercoiling is corrected by mutations near gyrase genes. Cell 31: 35-42.

Rimsky, S., Zuber, F., Buckle, M., and Buc, H. (2001) A molecular mechanism for the repression of transcription by the H-NS protein. Mol Microbiol 42: 1311-1323.

REFERENCES

Rochman, M., Aviv, M., Glaser, G., and Muskhelishvili, G. (2002) Promoter protection by a transcription factor acting as a local topological homeostat. EMBO Rep 3: 355-360.

Ryals, J., Little, R., and Bremer, H. (1982) Control of rRNA and tRNA syntheses in Escherichia coli by guanosine tetraphosphate. J Bacteriol 151: 1261-1268.

Sadler, J.R., and Novick, A. (1965) The Properties of Repressor and the Kinetics of Its Action. J Mol Biol 12: 305-327.

Saeed, A.I., Sharov, V., White, J., Li, J., Liang, W., Bhagabati, N., Braisted, J., Klapa, M., Currier, T., Thiagarajan, M., Sturn, A., Snuffin, M., Rezantsev, A., Popov, D., Ryltsov, A., Kostukovich, E., Borisovsky, I., Liu, Z., Vinsavich, A., Trush, V., and Quackenbush, J. (2003) TM4: a free, open-source system for microarray data management and analysis. Biotechniques 34: 374-378.

Sambrook, J. and Russell, D.W. (2001) Molecular cloning : a laboratory manual. Third edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

Sander, P., Langert, W., and Mueller, K. (1993) Mechanisms of upstream activation of the rrnD promoter P1 of Escherichia coli. J Biol Chem 268: 16907-16916.

Schneider, R., Travers, A., and Muskhelishvili, G. (1997) FIS modulates growth phase- dependent topological transitions of DNA in Escherichia coli. Mol Microbiol 26: 519-530.

Schneider, R., Travers, A., Kutateladze, T., and Muskhelishvili, G. (1999) A DNA architectural protein couples cellular physiology and DNA topology in Escherichia coli. Mol Microbiol 34: 953-964.

Schneider, R., Travers, A., and Muskhelishvili, G. (2000) The expression of the Escherichia coli fis gene is strongly dependent on the superhelical density of DNA. Mol Microbiol 38: 167-175.

Schneider, R., Lurz, R., Luder, G., Tolksdorf, C., Travers, A., and Muskhelishvili, G. (2001) An architectural role of the Escherichia coli chromatin protein FIS in organising DNA. Nucleic Acids Res 29: 5107-5114.

REFERENCES

Schroder, O., and Wagner, R. (2000) The bacterial DNA-binding protein H-NS represses ribosomal RNA transcription by trapping RNA polymerase in the initiation complex. J Mol Biol 298: 737-748.

Sinden, R.R., and Pettijohn, D.E. (1981) Chromosomes in living Escherichia coli cells are segregated into domains of supercoiling. Proc Natl Acad Sci U S A 78: 224- 228.

Snoep, J.L., van der Weijden, C.C., Andersen, H.W., Westerhoff, H.V., and Jensen, P.R. (2002) DNA supercoiling in Escherichia coli is under tight and subtle homeostatic control, involving gene-expression and metabolic regulation of both topoisomerase I and DNA gyrase. Eur J Biochem 269: 1662-1669.

Staczek, P., and Higgins, N.P. (1998) Gyrase and Topo IV modulate chromosome domain size in vivo. Mol Microbiol 29: 1435-1448.

Stein, R.A., Deng, S., and Higgins, N.P. (2005) Measuring chromosome dynamics on different time scales using resolvases with varying half-lives. Mol Microbiol 56: 1049-1061.

Tao, H., Bausch, C., Richmond, C., Blattner, F.R., and Conway, T. (1999) Functional genomics: expression analysis of Escherichia coli growing on minimal and rich media. J Bacteriol 181: 6425-6440.

Thanbichler, M., Viollier, P.H., and Shapiro, L. (2005) The structure and function of the bacterial chromosome. Curr Opin Genet Dev 15: 153-162.

Tippner, D., Afflerbach, H., Bradaczek, C., and Wagner, R. (1994) Evidence for a regulatory function of the histone-like Escherichia coli protein H-NS in ribosomal RNA synthesis. Mol Microbiol 11: 589-604.

Travers, A.A. (1980) Promoter sequence for stringent control of bacterial ribonucleic acid synthesis. J Bacteriol 141: 973-976.

Travers, A., and Muskhelishvili, G. (1998) DNA microloops and microdomains: a general mechanism for transcription activation by torsional transmission. J Mol Biol 279: 1027-1043.

REFERENCES

Travers, A., Schneider, R., and Muskhelishvili, G. (2001) DNA supercoiling and transcription in Escherichia coli: The FIS connection. Biochimie 83: 213-217.

Travers, A., and Muskhelishvili, G. (2005) Bacterial chromatin. Curr Opin Genet Dev 15: 507-514.

Travers, A., and Muskhelishvili, G. (2005) DNA supercoiling - a global transcriptional regulator for enterobacterial growth? Nat Rev Microbiol 3: 157-169.

Travers, A., and Muskhelishvili, G. (2007) A common topology for bacterial and eukaryotic transcription initiation? EMBO Rep 8: 147-151.

Tse-Dinh, Y.C. (1985) Regulation of the Escherichia coli DNA topoisomerase I gene by DNA supercoiling. Nucleic Acids Res 13: 4751-4763.

Tse-Dinh, Y.C., Qi, H., and Menzel, R. (1997) DNA supercoiling and bacterial adaptation: thermotolerance and thermoresistance. Trends Microbiol 5: 323-326.

Ueguchi, C., and Mizuno, T. (1993) The Escherichia coli nucleoid protein H-NS functions directly as a transcriptional repressor. Embo J 12: 1039-1046.

Valens, M., Penaud, S., Rossignol, M., Cornet, F., and Boccard, F. (2004) Macrodomain organization of the Escherichia coli chromosome. Embo J 23: 4330- 4341. von Neumann, J., (1958) The Computer and the Brain. New Haven, CT, USA: Yale University Press

Weber, H., Polen, T., Heuveling, J., Wendisch, V.F., and Hengge, R. (2005) Genome- wide analysis of the general stress response network in Escherichia coli: sigmaS- dependent genes, promoters, and sigma factor selectivity. J Bacteriol 187: 1591- 1603.

Wei, Y., Lee, J.M., Richmond, C., Blattner, F.R., Rafalski, J.A., and LaRossa, R.A. (2001) High-density microarray-mediated gene expression profiling of Escherichia coli. J Bacteriol 183: 545-556.

Weinstein-Fischer, D., and Altuvia, S. (2007) Differential regulation of Escherichia coli topoisomerase I by Fis. Mol Microbiol 63: 1131-1144.

REFERENCES

Willenbrock, H., and Ussery, D.W. (2004) Chromatin architecture and gene expression in Escherichia coli. Genome Biol 5: 252.

Wu, H.Y., Shyy, S.H., Wang, J.C., and Liu, L.F. (1988) Transcription generates positively and negatively supercoiled domains in the template. Cell 53: 433-440.

Yanisch-Perron, C., Vieira, J., and Messing, J. (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33: 103-119.

Zechiedrich, E.L., Khodursky, A.B., and Cozzarelli, N.R. (1997) Topoisomerase IV, not gyrase, decatenates products of site-specific recombination in Escherichia coli. Genes Dev 11: 2580-2592.

Zechiedrich, E.L., Khodursky, A.B., Bachellier, S., Schneider, R., Chen, D., Lilley, D.M., and Cozzarelli, N.R. (2000) Roles of topoisomerases in maintaining steady- state DNA supercoiling in Escherichia coli. J Biol Chem 275: 8103-8113.

APPENDIX I

7 Appendix I - Supplementary data: Gene lists from microarray experiments.

Supplementary table -I: CSH50 wild-type (A) Vs CSH50 fis::kan (B), Mid-exponential phase

gene blattner ratio p-value Function A/B aceA b4015 0.4993 0.0399 isocitrate lyase monomer acnA b1276 0.5979 0.0220 aconitase add b1623 0.7825 0.0299 deoxyadenosine deaminase / adenosine deaminase adhP b1478 0.5912 0.0138 ethanol dehydrogenase adk b0474 0.7212 0.0042 adenylate kinase allR b0506 0.5111 0.0224 AllR transcriptional regulator ansA b1767 0.5233 0.0335 asparaginase I araC b0064 0.6958 0.0157 AraC transcriptional dual regulator argC b3958 1.8029 0.0027 N-acetylglutamylphosphate reductase argR b3237 0.5625 0.0105 ArgR transcriptional dual regulator argS b1876 0.6906 0.0296 arginyl-tRNA synthetase aroG b0754 2.9967 0.0372 2-dehydro-3-deoxyphosphoheptonate aldolase arsB b3502 0.4948 0.0219 arsenite Ars transporter artP b0864 1.7795 0.0024 arginine ABC transporter atoS b2219 2.3222 0.0346 AtoS-Phis b0259 b0259 1.7818 0.0203 IS5 protein b0538 b0538 0.4888 0.0102 putative sensory transduction regulator b1146 b1146 0.4913 0.0184 hypothetical protein b3044 b3044 1.8424 0.0245 IS21 protein bax b3570 2.0569 0.0470 putative ATP-binding protein bcsC b3530 1.9134 0.0035 oxidase involved in cellulose synthesis bcsE b3536 2.7434 0.0002 putative protease bcsF b3537 2.2031 0.0199 hypothetical protein bdm b1481 0.4743 0.0212 hypothetical protein bfd b3337 3.4231 0.0057 bacterioferritin-associated ferredoxin blc b4149 1.5094 0.0488 Blc outer membrane lipoprotein (lipocalin) bolA b0435 3.8179 0.0135 BolA transcriptional regulator caiB b0038 0.5712 0.0445 CaiB monomer carB b0033 2.0837 0.0268 carbamoyl phosphate synthetase chaC b1218 0.5220 0.0378 cation transport regulator cls b1249 2.0209 0.0254 cardiolipin synthase cmk b0910 0.5068 0.0341 cytidylate kinase codB b0336 0.4890 0.0263 CodB cytosine NCS1 transporter corA b3816 0.6579 0.0224 CorA magnesium ion MIT transporter csgA b1042 0.4427 0.0472 curlin, major subunit cspD b0880 0.5276 0.0343 DNA replication inhibitor cspF b1558 0.4512 0.0391 cold shock protein CspF cusF b0573 1.4877 0.0197 periplasmic copper-binding protein cusS b0570 0.5047 0.0393 putative 2-component sensor protein cyoB b0431 1.9982 0.0279 cytochrome bo terminal oxidase subunit I dcp b1538 0.7555 0.0449 dipeptidyl carboxypeptidase II dcuA b4138 1.7199 0.0185 DcuA dicarboxylate Dcu transporter dcuR b4124 2.1501 0.0059 DcuR-Pasp56 dcuS b4125 2.3146 0.0461 DcuS-Phis349 deoC b4381 3.0453 0.0075 deoxyribose-phosphate aldolase deoD b4384 1.9030 0.0058 purine nucleoside phosphorylase 81

APPENDIX I

gene blattner ratio p-value Function A/B dgkA b4042 1.3606 0.0128 diacylglycerol kinase dgoA 3871635-3871018 : '2-dehydro-3-deoxyphosphogalactonate aldolase / dgoD dgoA b3692 0.1024 0.0302 3871021-3869873 : galactonate dehydratase dgoR b3694 0.2442 0.0306 regulator protein for dgo operon dhaL b1199 2.4480 0.0354 dihydroxyacetone kinase subunit L dinB b0231 0.5647 0.0273 DNA polymerase IV (Y-family DNA polymerase; translesion DNA synthesis) dinI b1061 0.5985 0.0137 damage-inducible protein I dld b2133 0.4244 0.0262 D-lactate:Quinone Oxidoreductase dmsA b0894 3.0559 0.0473 dimethyl sulfoxide reductase, chain A dnaC b4361 0.6833 0.0209 chromosome replication; initiation and chain elongation dnaN b3701 0.4388 0.0203 DNA polymerase III, beta-subunit dos b1489 0.4681 0.0009 heme-regulated phosphodiesterase monomer dpiB b0619 0.6938 0.0436 DpiB dppA b3544 2.6873 0.0270 dipeptide ABC transporter dusB b3260 0.1200 0.0055 tRNA dihydrouridine synthase ecfL b3095 1.4210 0.0186 putative integral membrane protein with possible extracytoplasmic function eco b2209 0.5356 0.0195 ecotin monomer; serine protease inhibitor efp b4147 1.6592 0.0497 elongation factor P (EF-P) emrD b3673 0.6508 0.0203 EmrD multidrug MFS transporter eutD b2458 0.4733 0.0002 putative phosphate acetyltransferase, ethanolamine utilization eutK b2438 0.4006 0.0142 hypothetical protein exbB b3006 3.7552 0.0314 ExbB protein; uptake of enterochelin; tonB-dependent uptake of B colicins exbD b3005 3.8008 0.0007 ExbD uptake of enterochelin; tonB-dependent uptake of B colicins fadL b2344 0.1834 0.0089 transport of long-chain fatty acids; sensitivity to phage T2 fbaB b2097 0.1653 0.0131 fructose bisphosphate aldolase monomer fbp b4232 0.5580 0.0352 fructose 1,6 bisphosphatase monomer fdx b2525 0.5482 0.0090 oxidized ferredoxin fecB b4290 8.6991 0.0075 ferric dicitrate uptake system fepD b0590 8.7158 0.0041 Ferric Enterobactin Transport System fhuF b4367 4.4704 0.0311 acts in reduction of ferrioxamine B iron fimC b4316 0.4695 0.0364 periplasmic chaperone, required for type 1 fimbriae fimI b4315 0.4942 0.0141 fimbrial protein flgJ b1081 3.8116 0.0170 FlgJ flgK b1082 2.4424 0.0026 flagellar biosynthesis, hook-filament junction protein 1 flagellar motor switch protein FliM; component of motor switch and energizing, fliM b1945 19.0270 0.0382 enabling rotation and determining its direction fliQ b1949 8.8017 0.0425 flagellar biosynthesis protein FliQ fliS b1925 9.2416 0.0232 flagellar biosynthesis protein FliS fnr b1334 0.4432 0.0445 FNR transcriptional dual regulator methyleneTHF enzyme / methenyltetrahydrofolate cyclohydrolase / folD b0529 0.6351 0.0380 methylenetetrahydrofolate dehydrogenase-(NADP+) folK b0142 0.7061 0.0168 6-hydroxymethyl-7,8-dihydropterin pyrophosphokinase folP b3177 0.3301 0.0096 dihydropteroate synthase fpr b3924 1.3795 0.0274 flavodoxin NADP+ reductase frdC b4152 2.7825 0.0397 fumarate reductase membrane protein frlC b3373 0.5854 0.0174 fructoselysine and psicoselysine degradation ftnA b1905 0.2818 0.0240 cytoplasmic ferritin, an iron storage protein) ftsY b3464 1.3557 0.0167 SRP receptor fucR b2805 1.7855 0.0380 FucR transcriptional activator gadC b1492 0.3529 0.0477 XasA GABA APC transporter galK b0757 0.5451 0.0491 Galactokinase galR b2837 4.4098 0.0315 GalR-galactose garK b3124 2.4698 0.0490 glycerate kinase I gatD b2091 0.7554 0.0174 galactitol-1-phosphate dehydrogenase gatY b2096 1.6866 0.0090 tagatose-1,6-bisphosphate aldolase 2 gcvH b2904 4.5473 0.0091 dihydrolipoyl-GcvH-protein gcvT b2905 5.7601 0.0109 Aminomethyltransferase 82

APPENDIX I

gene blattner ratio p-value Function A/B gidB b3740 0.4856 0.0237 protein with a methyltransferase fold; possible role in chromosome replication glcB b2976 0.6190 0.0452 malate synthase G N-acetylglucosamine-1-phosphate uridyltransferase / glucosamine-1-phosphate glmU b3730 1.6033 0.0469 acetyltransferase glnH b0811 0.4352 0.0140 glutamine ABC transporter gloB b0212 3.5188 0.0181 glyoxalase II glpA b2241 1.9558 0.0214 glycerol-3-phosphate-dehydrogenase, anaerobic gnsA b0991 4.7811 0.0050 YmcE predicted membrane-bound protein that is involved in high-affinity gluconate gntY b3414 0.5552 0.0419 transport gspF b3327 1.6223 0.0056 putative protein secretion protein for export gssA b2988 0.6968 0.0024 glutathionylspermidine synthetase / glutathionylspermidine amidase guaA b2507 0.3639 0.0040 GMP synthase / GMP synthase (ammonia dependent) gutQ b2708 2.2100 0.0352 protein with a sugar isomerase domain hcaR b2537 0.7416 0.0402 HcaR transcriptional activator hchA b1967 0.5528 0.0128 heat shock protein (Hsp) 31 hdhA b1619 2.5786 0.0216 7-alpha-hydroxysteroid dehydrogenase helD b0962 0.5183 0.0290 DNA helicase IV hepA b0059 0.3051 0.0412 RNA Polymerase (RNAP)-binding ATPase and RNAP recycling factor hflD b1132 0.3468 0.0048 membrane protein in operon with purB hisC b2021 0.3221 0.0144 histidine-phosphate aminotransferase hisD b2020 0.3608 0.0326 histidinal dehydrogenase / histidinol dehydrogenase hisF b2025 0.6098 0.0314 imidazole glycerol phosphate synthase, HisF subunit hns b1237 2.0288 0.0189 H-NS transcriptional dual regulator holB b1099 0.7617 0.0287 DNA polymerase III, delta prime subunit holD b4372 0.6747 0.0191 DNA polymerase III, psi subunit holE b1842 0.5413 0.0155 DNA polymerase III, theta subunit hslR b3400 0.4968 0.0137 heat shock protein Hsp15 hslU b3931 0.6792 0.0167 ATPase component of the HslVU protease hslV b3932 0.6182 0.0469 peptidase component of the HslVU protease hupA b4000 2.5232 0.0026 DNA-binding protein HU-alpha (HU-2) hybO b2997 1.6217 0.0148 Hyb0 hycF b2720 0.4798 0.0143 formate hydrogenlyase complex guanine-nucleotide binding protein, functions as nickel donor for large subunit of hypB b2727 1.4176 0.0207 hydrogenase 3 hypC b2728 1.8523 0.0443 pleiotrophic effects on 3 hydrogenase isozymes ibpA b3687 0.2895 0.0047 small heat shock protein IbpA intA b2622 0.3133 0.0364 prophage CP4-57 integrase intB b4271 1.5659 0.0241 prophage P4 integrase intD b0537 2.1932 0.0097 prophage DLP12 integrase iscA b2528 0.4418 0.0028 iron-sulfur cluster assembly protein iscS b2530 0.3669 0.0026 cysteine desulfurase monomer iscU b2529 0.4176 0.0013 scaffold protein involved in iron-sulfur cluster assembly iscX b2524 0.6472 0.0250 protein with possible role in iron-sulfur cluster biogenesis ispB b3187 0.6536 0.0347 octaprenyl diphosphate synthase ispE b1208 0.4973 0.0499 4-diphosphocytidyl-2C-methyl-D-erythritol kinase ivy b0220 0.4552 0.0028 YkfE kch b1250 6.5771 0.0023 potassium VIC channel kdgK b3526 2.9680 0.0423 2-dehydro-3-deoxygluconokinase kdgR b1827 1.3175 0.0072 putative ICLR-type transcriptional regulator kduD b2842 1.7440 0.0252 2-deoxy-D-gluconate 3-dehydrogenase kduI b2843 1.5739 0.0360 homolog of pectin degrading enzyme 5-keto 4-deoxyuronate isomerase lepA b2569 0.4578 0.0106 GTP-binding elongation factor, may be inner membrane protein leuA b0074 0.4198 0.0265 2-isopropylmalate synthase leuC b0072 0.7154 0.0284 isopropylmalate isomerase lspA b0027 0.5391 0.0442 prolipoprotein signal peptidase (SPase II) lsrB b1516 0.5142 0.0288 YneA 83

APPENDIX I

gene blattner ratio p-value Function A/B malP b3417 5.2986 0.0307 maltodextrin phosphorylase monomer malX b1621 0.4991 0.0496 EIIBCMalX manA b1613 0.5555 0.0306 mannose-6-phosphate isomerase mcrB b4346 2.7084 0.0157 MrcB subunit of 5-methylcytosine restriction system putative 2-hydroxyglutarate synthase / SHCHC synthase / 2-oxoglutarate menD b2264 0.7410 0.0203 decarboxylase metA b4013 0.2076 0.0209 homoserine O-succinyltransferase metG b2114 0.2830 0.0418 methionyl-tRNA synthetase mgsA b0963 2.1172 0.0134 methylglyoxal synthase mhpB b0348 0.4036 0.0047 3-(2,3-dihydroxyphenyl)propionate dioxygenase mhpC b0349 0.4068 0.0080 2-hydroxy-6-ketonona-2,4-dienedioate hydrolase mhpD b0350 0.4575 0.0138 2-keto-4-pentenoate hydratase mhpE b0352 0.4565 0.0376 4-hydroxy-2-ketovalerate aldolase mhpF b0351 0.3457 0.0134 acetaldehyde dehydrogenase 2 mhpT b0353 0.5565 0.0186 MhpT MFS transporter miaB b0661 0.2939 0.0013 hypothetical protein mltA b2813 0.6359 0.0136 membrane-bound lytic murein transglycosylase A mltB b2701 0.4337 0.0025 membrane-bound lytic murein transglycosylase B mltD b0211 0.3196 0.0035 membrane-bound lytic murein transglycosylase D motB b1889 6.4289 0.0485 MotB protein, enables flagellar motor rotation, linking torque machinery to cell wall mppA b1329 4.3955 0.0068 periplasmic murein tripeptide binding protein mrcA b3396 0.3396 0.0054 peptidoglycan synthetase; penicillin-binding protein 1A methionine sulfoxide reductase B / protein-methionine-S-oxide reductase / msrB b1778 0.3349 0.0304 methionine sulfoxide reductase mtn b0159 0.5806 0.0469 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase monomer mtr b3161 0.7656 0.0287 Mtr tryptophan ArAAP transporter mug b3068 0.4290 0.0023 stationary phase mismatch/uracil DNA glycosylase mukE b0923 1.6643 0.0073 protein involved in chromosome partitioning murP b2429 2.5027 0.0181 MurP mutH b2831 0.5136 0.0241 MutHLS complex, methyl-directed mismatch repair mutS b2733 0.4971 0.0195 MutHLS complex, methyl-directed mismatch repair mutY b2961 0.6703 0.0423 adenine glycosylase; G.C --> T.A transversions nadE b1740 1.4861 0.0474 NAD+ synthase, glutamine dependent / NAD+ synthase, NH3-dependent napD b2207 9.3356 0.0037 NapD protein napF b2208 9.2025 0.0031 ferredoxin-type protein nfi b3998 0.5850 0.0224 endonuclease V (deoxyinosine 3'endoduclease) nfrA b0568 0.3170 0.0069 bacteriophage N4 receptor, outer membrane protein nfrB b0569 0.2637 0.0048 bacteriophage N4 receptor, outer membrane protein nlpB b2477 0.6974 0.0180 lipoprotein-34 nlpD b2742 0.5841 0.0371 NlpD putative outer membrane lipoprotein nmpC b0553 5.5836 0.0159 outer membrane porin protein; locus of qsr prophage nrfA b4070 34.1708 0.0111 cytochrome C552 nudC b3996 0.7120 0.0330 putative NAD+ diphosphatase nupG b2964 3.7936 0.0032 NupG nucleoside MFS transporter nusB b0416 0.4621 0.0462 transcription termination; L factor obgE b3183 0.6444 0.0244 GTPase involved in chromosomal partitioning ogrK b2082 0.7617 0.0475 OgrK transcriptional regulator ompN b1377 0.6915 0.0136 putative outer membrane protein ompT b0565 3.4380 0.0014 outer membrane protein 3b (a), protease VII osmB b1283 0.2709 0.0014 OsmB osmotically inducible lipoprotein paaB b1389 0.3814 0.0222 putative subunit of phenylacetate-CoA oxygenase paaJ b1397 0.4901 0.0419 putative beta-keto-thiolase of phenylacetate degradation paaX b1399 0.6229 0.0058 PaaX transcriptional regulator paaY b1400 0.4875 0.0220 putative transferase pabA b3360 0.4832 0.0070 para-aminobenzoate synthase multi-enzyme complex / para-aminobenzoate synthase pcnB b0143 0.6447 0.0227 poly(A) polymerase I pflA b0902 0.5773 0.0124 pyruvate formate-lyase activating enzyme 84

APPENDIX I

gene blattner ratio p-value Function A/B pgl b0767 3.8773 0.0103 6-phosphogluconolactonase phnK b4097 1.4585 0.0490 PhnK pldA b3821 0.4974 0.0146 phospholipase A1 pldB b3825 0.5697 0.0157 lysophospholipase L(2) ppsA b1702 0.4317 0.0283 phosphoenolpyruvate synthase prmB b2330 0.5513 0.0253 protein-(glutamine-N5) methyltransferase prmC b1212 0.4252 0.0039 protein-(glutamine-N5) methyltransferase proP b4111 1.6762 0.0033 ProP proline/betaine MFS transporter proQ b1831 0.8210 0.0472 protein that affects osmoregulation of ProP transporter prsA b1207 0.6550 0.0030 ribose-phosphate diphosphokinase pstS b3728 0.7215 0.0114 phosphate ABC transporter ptrA b2821 0.2729 0.0069 protease III ptsG b1101 0.6082 0.0302 EIIGlc ptsP b2829 1.9101 0.0202 PTS system, enzyme I, transcriptional regulator (with NPR and NTR proteins) 5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole lyase / purB b1131 0.3871 0.0008 adenylosuccinate lyase purU b1232 1.8188 0.0292 formyltetrahydrofolate deformylase puuD b1298 0.6260 0.0406 probable amidotransferase subunit pyrF b1281 0.5616 0.0387 orotidine-5'-phosphate-decarboxylase pyrI b4244 1.8211 0.0362 aspartate carbamoyltransferase, PyrI subunit rbn b3886 2.4777 0.0058 tRNA processing exoribonuclease BN rbsC b3750 0.4430 0.0301 ribose ABC transporter rbsD b3748 0.3530 0.0401 D-ribose utilization rcsD b2216 0.8244 0.0460 putative 2-component sensor protein RecB; DNA helicase, ATP-dependent dsDNA/ssDNA exonuclease V subunit, recB b2820 0.2328 0.0023 ssDNA endonuclease DNA helicase, ATP-dependent dsDNA/ssDNA exonuclease V subunit, ssDNA recD b2819 0.4974 0.0325 endonuclease recJ b2892 0.6227 0.0299 RecJ recN b2616 0.5404 0.0348 protein used in recombination and DNA repair recT b1349 0.6541 0.0142 recombinase, DNA renaturation relE b1563 0.9013 0.0436 toxin of the RelE-RelB toxin-antitoxin system; cleaves mRNA in ribosome rep b3778 0.5157 0.0285 rep helicase, a single-stranded DNA dependent ATPase rfaC b3621 1.7935 0.0235 lipopolysaccharide core biosynthesis; heptosyl transferase I rfaL b3622 1.6061 0.0258 lipopolysaccharide core biosynthesis; O-antigen ligase rfe b3784 3.5759 0.0000 undecaprenyl-phosphate α-N-acetylglucosaminyl transferase ribD b0414 0.6197 0.0299 pyrimidine reductase / pyrimidine deaminase rihA b0651 1.3869 0.0492 ribonucleoside hydrolase 1 (pyrimidine-specific) acetylates N-terminal alanine of 30S ribosomal subunit protein S18 / ribosomal- rimI b4373 0.6086 0.0452 protein-alanine N-acetyltransferase rlmB b4180 2.2471 0.0024 23S rRNA methyltransferase monomer rluA b0058 0.1900 0.0293 23S rRNA and tRNA pseudouridine synthase rnhB b0183 0.6624 0.0303 RNAse HII, degrades RNA of DNA-RNA hybrids rnk b0610 0.5074 0.0130 regulator of nucleoside diphosphate kinase rplP b3313 1.4719 0.0001 50S ribosomal subunit protein L16 rplV b3315 1.9726 0.0393 50S ribosomal subunit protein L22 rpoE b2573 0.7058 0.0079 sigmaE rpsE b3303 1.4454 0.0390 30S ribosomal subunit protein S5 rsmB b3289 0.6882 0.0279 16S rRNA m5C967 methyltransferase ruvA b1861 0.5638 0.0057 branch migration of Holliday structures; repair sbcD b0398 0.6260 0.0422 ATP-dependent dsDNA exonuclease sdaA b1814 0.5675 0.0065 L-threonine deaminase I / L-serine ammonia-lyase sdaB b2797 0.2485 0.0242 L-threonine deaminase II / L-serine deaminase 2 sdaC b2796 0.2639 0.0054 SdaC serine STP transporter selA b3591 2.5277 0.0308 selenocysteine synthase monomer seqA b0687 1.4974 0.0332 SeqA, negative modulator of initiation of replication setB b2170 0.5500 0.0214 YeiO MFS transporter setC b3659 1.3277 0.0467 YicK MFS Transporter 85

APPENDIX I

gene blattner ratio p-value Function A/B shiA b1981 2.3089 0.0071 ShiA shikimate MFS transporter smtA b0921 1.8104 0.0156 S-adenosylmethionine-dependent methyltransferase sodA b3908 2.2699 0.0356 superoxide dismutase (Mn) soxS b4062 4.6091 0.0238 SoxS transcriptional activator speC b2965 0.2222 0.0023 ornithine decarboxylase, biosynthetic speD b0120 0.2969 0.0050 adenosylmethionine decarboxylase, proenzyme speE b0121 0.2562 0.0023 spermidine synthase speG b1584 0.7323 0.0129 spermidine acetyltransferase spr b2175 1.9225 0.0066 putative lipoprotein srmB b2576 0.5873 0.0118 SrmB, DEAD-box RNA helicase ssuD b0935 0.5883 0.0008 alkanesulfonate monooxygenase sufA b1684 2.7742 0.0160 scaffold protein for iron-sulfur cluster assembly sufB b1683 2.7088 0.0255 component of SufB-SufC-SufD cysteine desulfurase (SufS) activator complex sulA b0958 0.5115 0.0067 suppressor of lon; inhibits cell division and ftsZ ring formation tdcB b3117 5.9813 0.0139 threonine dehydratase (catabolic) thiG b3991 0.8279 0.0346 ThiG thiI b0423 0.7960 0.0033 ThiI protein thrC b0004 4.5667 0.0131 threonine synthase protease involved in Microcin B17 maturation and in sensitivity to the DNA gyrase tldD b3244 1.4990 0.0262 inhibitor LetD tolC b3035 0.7151 0.0164 TolC outer membrane channel tra5-5 b2089 1.7159 0.0251 IS3 element protein InsF trpA b1260 1.4667 0.0156 tryptophan synthase, alpha subunit / indoleglycerol phosphate aldolase trpS b3384 1.4491 0.0196 tryptophanyl-tRNA synthetase tsgA b3364 0.4974 0.0401 YhfC MFS transporter tsr b4355 2.1465 0.0180 MCP-I ttk b3641 0.6578 0.0296 Ttk transcriptional regulator typA b3871 0.5679 0.0271 protein possibly involved in LPS biosynthesis and host colonization tyrR b1323 1.8233 0.0206 TyrR-Phenylalanine transcriptional repressor ubiX b2311 0.4366 0.0267 3-octaprenyl-4-hydroxybenzoate decarboxylase 2 udk b2066 0.6047 0.0102 uridine kinase / cytidine kinase udp b3831 2.1987 0.0472 uridine phosphorylase ugpC b3450 1.9691 0.0027 glycerol-3-P ABC transporter / tranport ulaB b4194 0.8937 0.0050 eiisga ulaD b4196 0.5940 0.0354 3-keto-L-gulonate 6-phosphate decarboxylase ulaF b4198 0.7134 0.0268 L-ribulose 5-phosphate 4-epimerase uvrC b1913 2.5330 0.0055 excinuclease ABC, subunit C; repair of UV damage to DNA wbbK b2032 1.1787 0.0066 putative transferase wrbA b1004 1.8606 0.0149 WrbA wzxE b3792 1.6853 0.0279 lipid III flippase xthA b1749 0.4507 0.0112 exonuclease III xylR b3569 2.2681 0.0011 XylR-Xylose transcriptional activator conserved protein; in enteroaggregative E. coli, YafK is required for development of yafK b0224 0.6195 0.0023 biofilms yagN b0280 0.6952 0.0146 hypothetical protein yagT b0286 1.7860 0.0035 putative oxidoreductase, Fe-S subunit yagV b0289 1.9412 0.0102 conserved hypothetical protein yaiV b0375 0.5910 0.0075 putative outer membrane protein, cAMP-binding ybaD b0413 0.6397 0.0464 conserved protein ybaE b0445 2.2337 0.0166 hypothetical protein ybaN b0468 2.0803 0.0260 hypothetical protein ybeB b0637 0.7033 0.0126 conserved hypothetical protein ybeD b0631 0.2523 0.0005 conserved hypothetical protein ybeH b0625 0.5572 0.0439 hypothetical protein ybfD b0706 0.3122 0.0215 conserved protein ybhH b0769 0.4829 0.0154 conserved hypothetical protein ybiJ b0802 0.4837 0.0237 conserved hypothetical protein 86

APPENDIX I

gene blattner ratio p-value Function A/B ybiM b0806 0.3863 0.0240 conserved hypothetical protein ybjI b0844 1.9181 0.0193 conserved protein with a phophatase-like domain ycaM b0899 0.3822 0.0104 YcaM APC amino acid transporter ycaO b0905 0.5753 0.0151 conserved hypothetical protein ycbJ b0919 0.5051 0.0363 conserved hypothetical protein ycbX b0947 2.2239 0.0044 putative Fe-S protein yccK b0969 0.5751 0.0496 putative sulfite reductase (EC 1.8.-.-) yccS b0960 0.5639 0.0338 hypothetical protein yccV b0966 0.5070 0.0014 hemimethylated DNA-binding protein yceP b1060 2.4225 0.0246 conserved hypothetical protein ycfD b1128 0.5605 0.0362 putative enzyme ycgK b1178 1.8393 0.0309 hypothetical protein ycgV b1202 0.3754 0.0210 putative adhesion and penetration protein ychE b1242 0.6093 0.0360 putative membrane protein yciB b1254 0.5700 0.0437 hypothetical protein yciC b1255 0.6624 0.0484 hypothetical protein yciS b1279 0.6175 0.0026 conserved hypothetical protein ydbK b1378 0.6806 0.0083 putative pyruvate synthase ydcF b1414 0.2689 0.0238 conserved hypothetical protein ydcP b1435 0.2487 0.0276 putative collagenase ydgK b1626 0.4982 0.0446 putative oxidoreductase ydhF b1647 2.1014 0.0131 putative oxidoreductase, NAD(P)-linked ydiA b1703 0.4022 0.0020 conserved protein ydiH b1685 0.0411 0.0002 hypothetical protein ydiI b1686 0.6335 0.0373 conserved hypothetical protein ydiO b1695 0.4899 0.0220 putative acyl-CoA dehydrogenase ydiU b1706 0.7123 0.0018 conserved protein ydiY b1722 0.2336 0.0097 conserved hypothetical protein yeaC b1777 0.2907 0.0234 conserved hypothetical protein yeaD b1780 0.8053 0.0485 conserved hypothetical protein yeaK b1787 0.4458 0.0020 conserved hypothetical protein yeaL b1789 0.4155 0.0189 hypothetical protein yeaT b1799 3.0720 0.0141 putative transcriptional regulator LYSR-type yebE b1846 0.6028 0.0479 conserved hypothetical protein yebR b1832 3.1582 0.0092 conserved hypothetical protein yebU b1835 0.5220 0.0183 hypothetical protein yecN b1869 0.3001 0.0013 putative membrane protein yecP b1871 0.4509 0.0069 putative enzyme yedE b1929 0.5180 0.0037 putative transport system permease protein yedF b1930 0.6433 0.0118 conserved hypothetical protein; might bind RNA yedL b1932 0.7679 0.0407 putative acyl-CoA N-acyltransferase yeeZ b2016 0.7112 0.0403 putative enzyme of sugar metabolism yehU b2126 1.3634 0.0204 putative 2-component sensor protein yeiC b2166 0.5199 0.0069 putative kinase yeiH b2158 0.5810 0.0329 putative membrane protein yeiN b2165 0.6223 0.0224 conserved protein yeiP b2171 0.4453 0.0110 putative elongation factor yeiQ b2172 1.6577 0.0089 putative oxidoreductase yejE b2179 1.2788 0.0062 YejA/YejB/YejE/YejF ABC transporter yejM b2188 0.6919 0.0221 putative sulfatase yfbV b2295 0.1983 0.0066 conserved hypothetical protein yfcE b2300 0.5028 0.0272 putative metallo-dependent phosphatase yfeC b2398 3.6524 0.0085 hypothetical protein yfeD b2399 4.6195 0.0073 hypothetical protein yfeU b2428 2.5545 0.0178 putative regulator yfeZ b2433 0.8288 0.0423 putative membrane protein 87

APPENDIX I

gene blattner ratio p-value Function A/B yfgD b2495 1.3436 0.0280 putative oxidoreductase yfhQ b2532 0.7396 0.0351 putative ATP synthase beta subunit yfiD b2579 2.1520 0.0130 stress-induced alternate pyruvate formate-lyase subunit yfiF b2581 0.7263 0.0437 hypothetical protein yfjD b4461 0.6709 0.0382 putative membrane protein, hemolysin-like yfjF b2618 0.8164 0.0194 conserved hypothetical protein yfjK b2627 1.8469 0.0067 hypothetical protein yfjW b2642 2.9798 0.0025 hypothetical protein ygaH b2683 2.3469 0.0029 putative transport protein ygaW b2670 0.2097 0.0395 putative membrane protein ygbT b2755 1.5803 0.0209 conserved hypothetical protein ygcE b2776 0.6769 0.0395 putative kinase ygcO b2767 2.1793 0.0250 putative ferredoxin ygeY b2872 0.3333 0.0367 putative deacetylase yggE b2922 0.7072 0.0229 putative actin-like protein glutathione transferase-like protein possibly involved in glutathionylspermidine yghU b2989 0.6145 0.0305 metabolism ygiR b3015 0.1712 0.0020 conserved protein yhaI b3104 1.8901 0.0167 putative cytochrome yhbG b3201 0.7306 0.0489 YhbG/YhbN ABC transporter yhbW b3160 2.5842 0.0205 putative enzyme yhcE b3217 1.8476 0.0321 hypothetical protein yhcH b3221 1.4134 0.0166 conserved hypothetical protein; gene is in sialic acid catabolic operon yhdE b3248 1.4099 0.0332 conserved hypothetical protein yhdN b3293 0.3490 0.0092 conserved hypothetical protein yhfG b3362 2.0525 0.0319 conserved hypothetical protein yhfT b3377 0.5275 0.0096 putative transport protein yhfX b3381 0.8420 0.0430 conserved protein yhjK b3529 0.8141 0.0360 conserved protein yhjR b3535 3.3058 0.0027 hypothetical protein yhjV b3539 0.4101 0.0312 YhjV STP transporter yiaJ b3574 0.4842 0.0009 YiaJ transcriptional repressor yibG b3596 0.9825 0.0318 conserved hypothetical protein yibI b3598 1.7891 0.0258 hypothetical protein yidI b3677 3.0250 0.0389 hypothetical protein yidZ b3711 0.5369 0.0092 putative transcriptional regulator LysR-type yifE b3764 1.9633 0.0245 hypothetical protein yifK b3795 2.3518 0.0138 YifK APC transporter yjcG b4067 0.7076 0.0091 YjcG SSS transporter yjcZ b4110 1.5987 0.0010 hypothetical protein yjdF b4121 1.6223 0.0050 putative membrane protein yjeI b4144 1.6231 0.0306 conserved protein yjeO b4158 0.7234 0.0164 conserved hypothetical protein yjgM b4256 1.3106 0.0028 putative acyltransferase yjhB b4279 0.2981 0.0096 YjhB MFS transporter yjhC b4280 0.3673 0.0052 KpLE2 phage-like element; putative NAD(P)-binding dehydrogenase yjhP b4306 0.6759 0.0413 putative methyltransferase yjhT b4310 0.4662 0.0446 putative enzyme contains galactose oxidase-like domain yjiA b4352 1.7339 0.0199 P-loop guanosine triphosphatase yjiG b4329 0.5318 0.0394 putative membrane protein yjiT b4342 10.7703 0.0111 conserved protein yjiX b4353 1.7994 0.0423 hypothetical protein yjiY b4354 15.2032 0.0105 putative carbon starvation protein yjjI b4380 1.3283 0.0003 conserved hypothetical protein yjjK b4391 0.6653 0.0186 YjjK yjjM b4357 2.3936 0.0179 hypothetical protein

APPENDIX I

gene blattner ratio p-value Function A/B ykiA b0392 1.7064 0.0390 hypothetical protein ylaB b0457 1.5530 0.0301 conserved protein yliC b0831 1.4983 0.0007 YliA/YliB/YliC/YliD ABC transporter yliH b0836 0.1439 0.0035 putative receptor; induced in stationary phase ymcD b0987 1.7643 0.0439 hypothetical protein ymfE b1138 0.1571 0.0060 hypothetical protein ymgA b1165 0.1361 0.0148 hypothetical protein ymjA b1295 0.5853 0.0312 hypothetical protein yoaA b1808 0.6334 0.0318 putative enzyme yoaB b1809 0.5757 0.0165 conserved protein yoaG b1796 2.4294 0.0346 hypothetical protein ypfJ b2475 1.4938 0.0049 conserved protein yphF b2548 0.4557 0.0415 YphD/YphE/YphF ABC transporter yqaB b2690 0.6835 0.0377 putative phosphoglucomutase that contains a phophatase-like domain yqcD b2794 0.6211 0.0481 conserved hypothetical protein yqeH b2846 0.8070 0.0380 conserved protein yqgE b2948 0.6944 0.0062 conserved protein yqiI b3048 0.9092 0.0276 conserved protein yraN b3148 0.6869 0.0193 conserved hypothetical protein yrbA b3190 0.6820 0.0270 hypothetical protein yrfG b3399 0.4865 0.0216 putative hydrolase with a phophatase-like domain ytfL b4218 0.4845 0.0258 putative transport protein ytfN b4221 0.7948 0.0361 conserved protein ytjB b4387 0.7147 0.0043 membrane protein zwf b1852 1.3295 0.0490 glucose 6-phosphate-1-dehydrogenase b3837 0.6879 0.0253 b0322 0.8183 0.0423 b2391 0.5201 0.0434 b3948 0.7383 0.0244

Supplementary table - II: CSH50 wild-type (A) Vs CSH50 fis::kan (B), Transition to stationary phase

gene blattner ratio p-value Function A/B aat b0885 1.5610 0.0387 leucyl, phenylalanyl-tRNA-protein transferase abrB b0715 0.4795 0.0092 putative transport protein; mutation affects aidB expression ampH b0376 0.6790 0.0417 putative enzyme aphA b4055 0.4046 0.0303 acid phosphatase/phosphotransferase apt b0469 0.8461 0.0496 adenine phosphoribosyltransferase arcA b4401 1.1326 0.0030 ArcA-Phosphorylated transcriptional dual regulator argB b3959 0.7534 0.0093 N-acetylglutamate kinase asr b1597 0.6179 0.0119 acid shock protein astD b1746 0.7371 0.0469 succinylglutamic semialdehyde dehydrogenase btuF b0158 0.5590 0.0133 periplasmic vitamin B12 binding protein chaA b1216 1.5703 0.0273 ChaA calcium CaCA transporter cls b1249 1.8397 0.0135 cardiolipin synthase csgF b1038 2.6963 0.0232 curli assembly component csiD b2659 0.7824 0.0300 hypothetical protein; gene expression is induced by carbon starvation cyaY b3807 1.1582 0.0458 iron-binding frataxin homolog dctR b3507 3.5342 0.0231 protein involved in metabolism of C4-dicarboxylates ddlA b0381 1.3455 0.0452 D-alanine-D-alanine ligase A ddpB b1486 0.7867 0.0321 YddR 89

APPENDIX I

gene blattner ratio p-value Function A/B dicA b1570 1.5452 0.0082 DicA transcriptional regulator dmsA b0894 1.3291 0.0290 dimethyl sulfoxide reductase, chain A dnaQ b0215 1.5304 0.0205 DNA polymerase III, epsilon subunit dpiA b0620 0.7592 0.0156 CitB transcriptional regulator dsbA b3860 1.3750 0.0408 disulfide oxidoreductase dusB b3260 0.3858 0.0382 tRNA dihydrouridine synthase entA b0596 4.4954 0.0362 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase envY b0566 1.7235 0.0175 EnvY transcriptional activator eutL b2439 0.6545 0.0455 hypothetical protein eutM b2457 0.6548 0.0414 putative detox protein, ethanolamine utilization exuT b3093 0.7604 0.0156 ExuT hexuronate MFS transporter fliK b1943 0.7529 0.0246 flagellar hook-length control protein FliK frlC b3372 1.6858 0.0348 fructoselysine and psicoselysine degradation fruB b2169 3.2743 0.0351 EIIFru fruK b2168 1.4091 0.0251 1-phosphofructokinase monomer fsaA b0825 1.2606 0.0464 Fsa gadC b1492 22.0335 0.0374 XasA GABA APC transporter gadE b3512 14.1482 0.0012 GadE transcriptional activator gadW b3515 5.4482 0.0241 GadWtranscriptional repressor negative DNA-binding transcriptional regulator of galactitol metabolism, subunit of gatR_1 b2087 1.2194 0.0338 GatR transcriptional repressor glpF b3927 0.4719 0.0301 GlpF - glycerol MIP channel hchA b1967 1.3473 0.0385 heat shock protein (Hsp) 31 hdeD b3511 8.1344 0.0428 protein involved in acid resistance hemY b3802 0.6097 0.0422 a late step of protoheme IX synthesis hisC b2021 0.3625 0.0199 histidine-phosphate aminotransferase hisD b2020 0.6774 0.0110 histidinal dehydrogenase / histidinol dehydrogenase htrA b0161 0.3838 0.0164 DegP hyi b0508 0.5405 0.0469 hydroxypyruvate isomerase guanine-nucleotide binding protein, functions as nickel donor for large subunit of hypB b2727 1.4330 0.0072 hydrogenase 3 inaA b2237 1.1707 0.0448 pH-inducible protein involved in stress response lplA b4386 0.5894 0.0042 lipoyl-protein ligase A mcrB b4346 3.7015 0.0154 MrcB subunit of 5-methylcytosine restriction system mdtG b1053 2.7845 0.0406 YceE drug MFS transporter protein encoded by an operon involved in formation of the cell envelope and cell mraZ b0081 0.6347 0.0132 division mtlA b3599 1.6503 0.0315 EIIMtl nanA b3225 1.2989 0.0251 N-acetylneuraminate lyase nikD b3479 1.4297 0.0492 nickel ABC transporter norR b2709 1.2152 0.0376 transcriptional regulator of the anaerobic response to reactive nitrogen species nudE b3397 1.3014 0.0258 ADP-ribose diphosphatase obgE b3183 0.6501 0.0090 GTPase involved in chromosomal partitioning ogrK b2082 1.3568 0.0499 OgrK transcriptional regulator ompF b0929 0.4480 0.0442 outer membrane porin OmpF orn b4162 1.8637 0.0289 oligoribonuclease monomer pdhR b0113 0.7167 0.0089 PdhR-pyruvate polB b0060 1.7041 0.0257 DNA polymerase II proW b2678 0.8448 0.0427 proline ABC transporter prpD b0334 0.4135 0.0183 2-methylcitrate dehydratase purC b2476 1.4330 0.0212 phosphoribosylaminoimidazole-succinocarboxamide synthase purH b4006 1.1431 0.0481 AICAR transformylase / IMP cyclohydrolase puuA b1297 3.7881 0.0276 putative glutamine synthetase (EC 6.3.1.2) qor b4051 1.4220 0.0378 quinone oxidoreductase qseB b3025 0.6844 0.0099 putative 2-component transcriptional regulator rbsA b3749 0.3311 0.0281 ribose ABC transporter rbsC b3750 0.2093 0.0265 ribose ABC transporter 90

APPENDIX I

gene blattner ratio p-value Function A/B rbsD b3748 0.2205 0.0061 D-ribose utilization rem b1561 1.8185 0.0457 hypothetical protein rhaS b3905 0.7904 0.0441 RhaS transcriptional activator rhaT b3907 1.2690 0.0108 rhamnose RhaT transporter rihB b2162 1.7911 0.0339 ribonuceloside hydrolase 2 (pyrimidine-specific) rof b0189 1.8022 0.0294 Rho-binding antiterminator rplT b1716 1.7302 0.0078 50S ribosomal subunit protein L20, and regulator rpsQ b3311 0.5968 0.0243 30S ribosomal subunit protein S17 rrmA b1822 1.4094 0.0108 23S rRNA m1G745 methyltransferase rseA b2572 0.5825 0.0476 anti-sigma factor that inhibits sigmaE negative regulator of sigmaE; interacts with RseA and stimulates binding of RseA to rseB b2571 0.6315 0.0494 sigmaE rseC b2570 0.7732 0.0251 protein involved in reduction of the SoxR iron-sulfur cluster ruvB b1860 0.6261 0.0271 branch migration of Holliday structures; repair helicase sapB b1293 1.8571 0.0076 peptide uptake ABC transporter setC b3659 2.8429 0.0171 YicK MFS Transporter slp b3506 6.4852 0.0424 outer membrane protein induced after carbon starvation sohB b1272 1.1729 0.0025 putative protease sufB b1683 2.3472 0.0139 component of SufB-SufC-SufD cysteine desulfurase (SufS) activator complex sufC b1682 2.0037 0.0305 ATPase component of SufB-SufC-SufD cysteine desulfurase (SufS) activator complex sufS b1680 2.0407 0.0269 L-selenocysteine lyase (and L-cysteine desulfurase) monomer suhB b2533 0.4978 0.0185 inositol monophosphatase thiI b0423 1.5919 0.0034 ThiI protein thiL b0417 1.2963 0.0475 thiamine phosphate kinase trg b1421 0.6236 0.0473 MCP-III ugpE b3451 1.9577 0.0269 glycerol-3-P ABC transporter / tranport upp b2498 1.5767 0.0345 uracil phosphoribosyltransferase uvrB b0779 1.9383 0.0152 DNA repair; excision nuclease subunit B uvrY b1914 1.6618 0.0311 UvrY- Phosphorylated transcriptional regulator xapR b2405 1.7821 0.0157 XapR transcriptional activator yafU b0218 0.6355 0.0350 conserved hypothetical protein ybaP b0482 1.8267 0.0130 putative ligase ybaT b0486 2.9386 0.0011 YbaT APC transporter ybbA b0495 0.4183 0.0451 YbbA/YbbP ABC transporter ybcH b0567 1.8118 0.0067 conserved hypothetical protein ybcM b0546 1.8831 0.0318 putative ARAC-type regulatory protein ybcN b0547 0.6267 0.0456 hypothetical protein ybeF b0629 0.7562 0.0180 putative transcriptional regulator LYSR-type ybgA b0707 1.6805 0.0206 conserved protein ybgH b0709 0.5997 0.0112 YbgH peptide POT Transporter ybhF b0794 1.3972 0.0497 YbhF/YbhR/YbhS ABC transporter ybiH b0796 1.5534 0.0028 hypothetical protein ycbB b0925 1.9207 0.0065 putative amidase yceP b1060 2.1087 0.0460 conserved hypothetical protein ycfR b1112 1.2233 0.0181 conserved hypothetical protein ycgJ b1177 1.4740 0.0088 hypothetical protein ycgX b1161 1.4886 0.0341 hypothetical protein ydeI b1536 4.9897 0.0403 conserved hypothetical protein ydeU b1509 0.6562 0.0419 conserved protein ydhS b1668 2.5603 0.0370 putative oxidoreductase ydjK b1775 1.7556 0.0281 YdjK yebW b1837 1.9443 0.0270 hypothetical protein yedR b1963 1.6135 0.0135 hypothetical protein yedW b1969 2.2168 0.0108 putative 2-component transcriptional response regulator yeeO b1985 1.1961 0.0398 YeeO MATE Transporter yfbN b2273 0.5362 0.0182 conserved hypothetical protein yfeC b2398 1.9649 0.0396 hypothetical protein 91

APPENDIX I

gene blattner ratio p-value Function A/B yfgH b2505 1.5726 0.0020 putative outer membrane lipoprotein yfiE b2577 1.2464 0.0464 putative transcriptional regulator LYSR-type yfjP b2632 0.7520 0.0345 putative GTP-binding protein yfjS b2636 1.7083 0.0099 inner membrane lipoprotein YfjS ygcU b2772 1.4215 0.0019 hypothetical protein ygdQ b2832 0.6766 0.0377 putative transport protein ygjG b3073 2.1750 0.0476 putrescine:2-oxoglutaric acid aminotransferase yhdX b3269 0.7823 0.0343 YhdW/YhdX/YhdY/YhdZ ABC transporter yibA b3594 5.6513 0.0212 putative lyase yieP b3755 1.9745 0.0106 hypothetical protein yjgG b4247 0.5699 0.0215 hypothetical protein yjhE b4282 1.3314 0.0382 KpLE2 phage-like element yjhF b4296 1.7197 0.0391 YjhF Gnt tranporter ykfB b0250 0.5364 0.0047 hypothetical protein ynaI b1330 1.3820 0.0261 YnaI yneE b1520 2.2054 0.0150 conserved hypothetical protein yneK b1527 1.7412 0.0171 conserved protein yphF b2548 0.4656 0.0111 YphD/YphE/YphF ABC transporter yqiJ b3050 1.6472 0.0159 putative oxidoreductase ytfL b4218 0.6187 0.0431 putative transport protein ytfM b4220 0.6059 0.0406 hypothetical protein

Supplementary table - III: CSH50 wild-type (A) Vs CSH50 fis::kan (B), Late stationary phase

gene blattner ratio p-value Function A/B aaeX b3242 0.1162 0.0119 hypothetical protein aceK b4016 0.7802 0.0399 isocitrate dehydrogenase phosphatase / isocitrate dehydrogenase kinase ada b2213 0.5369 0.0145 Ada transcriptional dual regulator / O-6-methylguanine-DNA methyltransferase alaS b2697 0.7352 0.0016 alanyl-tRNA synthetase alr b4053 1.8816 0.0448 alanine racemase, minor amiC b2817 3.3668 0.0494 N-acetylmuramyl-L-alanine amidase ampC b4150 1.4236 0.0158 beta-lactamase; penicillin resistance amtB b0451 0.9258 0.0243 AmtB ammonium Amt transporter araJ b0396 0.5228 0.0297 AraJ MFS transporter argG b3172 0.5972 0.0146 argininosuccinate synthase argH b3960 3.5282 0.0064 argininosuccinate lyase aroK b3390 0.5174 0.0094 shikimate kinase I asnA b3744 0.8519 0.0127 aspartate-ammonia ligase astC b1748 9.1016 0.0329 acetylornithine transaminase, catabolic / succinylornithine transaminase b1578 b1578 3.2990 0.0187 hypothetical protein b2191 b2191 3.0472 0.0497 hypothetical protein betA b0311 0.6126 0.0046 choline dehydrogenase betT b0314 0.5842 0.0485 BetT choline BCCT transporter borD b0557 1.2137 0.0192 bacteriophage lambda Bor protein homolog citT b0612 1.4968 0.0388 CitT citrate DASS Transporter clcA b0155 2.5182 0.0325 EriC chloride ion ClC channel clcB b1592 0.7312 0.0360 YnfJ chloride ion ClC transporter clpB b2592 0.3280 0.0079 ClpB chaperone cobS b1992 0.7962 0.0307 cobalamin 5'-phosphate synthase / cobalamin synthase codB b0336 0.3742 0.0051 CodB cytosine NCS1 transporter regulator of the Cpx response and possible chaperone involved in resistance to cpxP b3913 0.2235 0.0170 extracytoplasmic stress 92

APPENDIX I

gene blattner ratio p-value Function A/B creB b4398 0.4846 0.0434 CreB- Phosphorylated transcriptional regulator creC b4399 0.3937 0.0326 CreC-Phis csdA b2810 0.5874 0.0365 cysteine sulfinate desulfinase csgC b1043 1.2044 0.0112 putative curli production protein cspD b0880 16.0799 0.0280 DNA replication inhibitor cspE b0623 8.6680 0.0365 CspE transcriptional repressor cspG b0990 0.6140 0.0016 cold shock protein CspG carbon storage regulator; controls glycogen synthesis, gluconeogenesis, cell size and csrA b2696 3.9886 0.0476 surface properties cusF b0573 0.7829 0.0248 periplasmic copper-binding protein cynS b0340 0.3529 0.0120 cyanase monomer cysW b2423 0.6881 0.0280 sulfate ABC transporter cysZ b2413 0.4629 0.0035 required for sulfate transport ddpX b1488 0.5345 0.0362 D-Ala-D-Ala dipeptidase deoC b4381 9.0692 0.0321 deoxyribose-phosphate aldolase dhaR b1201 0.6436 0.0124 putative 2-component regulator dksA b0145 1.6863 0.0313 DksA dnaE b0184 0.5435 0.0106 DNA polymerase III, alpha subunit dnaG b3066 0.4222 0.0495 DNA biosynthesis; DNA primase dppA b3544 1.7303 0.0446 dipeptide ABC transporter dsbA b3860 1.1918 0.0084 disulfide oxidoreductase ecpD b0140 0.4814 0.0137 probable pilin chaperone similar to PapD elbB b3209 1.9231 0.0350 sigma cross-reacting protein 27A (SCRP-27A) eutL b2439 0.6724 0.0490 hypothetical protein exuR b3094 0.8492 0.0144 ExuR transcriptional repressor fabF b1095 0.6295 0.0460 beta-ketoacyl-ACP synthase II involved in protein transport; multicopy suppressor of dominant negative ftsH fdrA b0518 0.5497 0.0092 mutants fecA b4291 0.8222 0.0069 outer membrane receptor; citrate-dependent iron transport, outer membrane receptor fimC b4316 0.4900 0.0315 periplasmic chaperone, required for type 1 fimbriae flgB b1073 0.5473 0.0051 flagellar basal-body rod protein FlgB fliD b1924 0.5664 0.0104 flagellar cap protein FliD; filament capping protein; enables filament assembly fliK b1943 2.0042 0.0318 flagellar hook-length control protein FliK periplasmic cystine-binding protein; member of extracellular bacterial solute-binding fliY b1920 4.1059 0.0296 protein family III frlC b3372 1.1884 0.0410 fructoselysine and psicoselysine degradation fruA b2167 1.6009 0.0416 EIIFru frvX b3898 0.6284 0.0373 frv operon protein fsaB b3946 0.5115 0.0025 fructose 6-phosphate aldolase 2 ftsW b0089 1.6371 0.0330 essential cell division protein FtsW fumB b4122 1.4742 0.0092 fumarase B monomer fumC b1611 4.5730 0.0410 fumarase C monomer fusA b3340 7.4644 0.0072 elongation factor G g30K b1088 4.4609 0.0486 hypothetical protein gatY b2096 7.4188 0.0456 tagatose-1,6-bisphosphate aldolase 2 glgS b3049 12.4340 0.0183 glycogen biosynthesis, rpoS dependent glk b2388 2.4011 0.0080 glucokinase glnA b3870 0.6508 0.0408 adenylyl-[glutamine synthetase] gloB b0212 0.7455 0.0328 glyoxalase II glpA b2241 1.8004 0.0339 glycerol-3-phosphate-dehydrogenase, anaerobic gntU b4476 0.6904 0.0450 GntU gluconate Gnt transporter transcription elongation factor; stimulates the mRNA cleavage activity of RNA greA b3181 0.5847 0.0466 polymerase groL b4143 0.1600 0.0302 GroEL, chaperone Hsp60, peptide-dependent ATPase, heat shock protein grxB b1064 3.0152 0.0423 oxidized glutaredoxin 2 gyrA b2231 1.2523 0.0381 DNA gyrase, subunit A hemC b3805 0.7502 0.0425 hydroxymethylbilane synthase hemH b0475 1.2367 0.0211 ferrochelatase 93

APPENDIX I

gene blattner ratio p-value Function A/B hflX b4173 1.1608 0.0414 putative GTPase; possible regulator of HflKC htrA b0161 0.3477 0.0251 DegP htrL b3618 0.4161 0.0089 involved in lipopolysaccharide biosynthesis hyfI b2489 0.6981 0.0143 hydrogenase 4, small subunit ibpB b3686 0.1277 0.0168 small heat shock protein IbpB iscU b2529 4.5133 0.0350 scaffold protein involved in iron-sulfur cluster assembly kch b1250 0.6951 0.0255 potassium VIC channel kgtP b2587 2.2993 0.0011 KgtP α-ketoglutarate MFS transporter lpxC b0096 2.7942 0.0029 UDP-3-O-acyl-N-acetylglucosamine deacetylase lrhA b2289 0.3796 0.0348 LrhA transcriptional repressor lsrB b1516 0.7399 0.0208 YneA lysC b4024 0.8123 0.0155 aspartate kinase III lyxK b3580 0.6681 0.0402 L-xylulose kinase macB b0879 0.1409 0.0120 MacAB macrolide efflux transporter complex manZ b1819 2.2877 0.0294 EIIMan mdtA b2074 1.2909 0.0336 MdtABC RND-type Drug Exporter metI b0198 0.8178 0.0151 L- and D-methionine uptake ABC permease modF b0760 0.8025 0.0038 ModF mqo b2210 0.6329 0.0302 malate dehydrogenase mutT b0099 0.7175 0.0241 dGTP pyrophosphohydrolase mviM b1068 2.0452 0.0053 putative virulence factor napG b2205 1.8609 0.0363 ferredoxin-type protein narG b1224 2.2871 0.0317 nitrate reductase A, α subunit narJ b1226 0.6000 0.0278 NarJ, private chaperone for NarG nitrate reductase subunit nlpA b3661 0.6811 0.0025 lipoprotein-28 nlpD b2742 4.4441 0.0000 NlpD putative outer membrane lipoprotein nrdI b2674 0.5413 0.0160 stimulates ribonucleotide reduction nuoE b2285 0.9495 0.0379 NADH dehydrogenase I nuoM b2277 1.8342 0.0080 NADH dehydrogenase I ompA b0957 10.3993 0.0496 outer membrane protein 3a (II*;G;d) osmY b4376 4.2860 0.0255 hyperosmotically inducible periplasmic protein pbpC b2519 5.9984 0.0419 putative peptidoglycan enzyme pckA b3403 2.7797 0.0438 phosphoenolpyruvate carboxykinase (ATP) pepD b0237 0.5596 0.0476 peptidase D pgaB b1023 0.3651 0.0064 putative membrane protein pgpA b0418 0.3457 0.0195 phosphatidylglycerophosphatase A pheT b1713 16.3765 0.0495 phenylalanyl-tRNA synthetase β-chain phnP b4092 0.7634 0.0242 phosphonate metabolism polB b0060 0.6608 0.0120 DNA polymerase II ppa b4226 2.0727 0.0063 inorganic pyrophosphatase proY b0402 0.6754 0.0227 ProY cryptic proline APC transporter pspA b1304 0.3241 0.0349 negative transcriptional regulator of the psp operon pstB b3725 0.9267 0.0131 phosphate ABC transporter ptsI b2416 5.6371 0.0485 PTS enzyme I pykA b1854 0.8489 0.0169 pyruvate kinase II monomer rfaI b3627 0.4462 0.0388 UDP-D-galactose:(glucosyl)lipopolysaccharide-alpha-1,3-D-galactosyltransferase rhsD b0497 1.6558 0.0321 RhsD protein in rhs element rhsE b1456 1.1728 0.0329 RhsE protein in rhs element ribD b0414 0.6515 0.0084 pyrimidine reductase / pyrimidine deaminase acetylates N-terminal alanine of 30S ribosomal subunit protein S5 / ribosomal- rimJ b1066 1.7516 0.0255 protein-alanine N-acetyltransferase rimM b2608 3.7205 0.0153 protein required for wild-type 16S rRNA processing rluA b0058 0.4039 0.0494 23S rRNA and tRNA pseudouridine synthase rnhB b0183 0.4660 0.0478 RNAse HII, degrades RNA of DNA-RNA hybrids rplE b3308 5.5781 0.0305 50S ribosomal subunit protein L5 rplI b4203 2.4184 0.0300 50S ribosomal subunit protein L9 rplR b3304 7.8773 0.0179 50S ribosomal subunit protein L18 94

APPENDIX I

gene blattner ratio p-value Function A/B rplX b3309 3.5468 0.0478 50S ribosomal subunit protein L24 rpmA b3185 0.4113 0.0210 50S ribosomal subunit protein L27 rpmI b1717 6.8633 0.0383 50S ribosomal subunit protein A rpoA b3295 2.8507 0.0294 RNA polymerase, alpha subunit rpsD b3296 5.2826 0.0441 30S ribosomal subunit protein S4 rpsE b3303 12.4222 0.0115 30S ribosomal subunit protein S5 rpsH b3306 4.2597 0.0254 30S ribosomal subunit protein S8, and regulator rpsN b3307 6.6163 0.0259 30S ribosomal subunit protein S14 rpsR b4202 1.8126 0.0017 30S ribosomal subunit protein S18 rsd b3995 0.6020 0.0268 regulator of sigma D negative regulator of sigmaE; interacts with RseA and stimulates binding of RseA to rseB b2571 0.2066 0.0278 sigmaE rusA b0550 0.6409 0.0385 endodeoxyribonuclease RUS (Holliday junction resolvase) sdhB b0724 1.7743 0.0237 succinate dehydrogenase iron-sulfur protein sfsA b0146 3.3885 0.0017 SfsA sgrR b0069 0.5711 0.0195 SgrR transcriptional regulator slp b3506 1.8331 0.0144 outer membrane protein induced after carbon starvation slyA b1642 4.5810 0.0274 SlyA transcriptional activator smf b4473 1.0372 0.0064 hypothetical protein sohB b1272 0.5393 0.0272 putative protease somA b0877 0.7299 0.0121 putative enzyme speD b0120 0.5703 0.0350 adenosylmethionine decarboxylase, proenzyme speE b0121 1.3579 0.0421 spermidine synthase speG b1584 0.4922 0.0388 spermidine acetyltransferase spoT b3650 0.4810 0.0407 GDP diphosphokinase / guanosine-3',5'-bis(diphosphate) 3'-diphosphatase sucA b0726 8.0970 0.0066 subunit of E1(0) component of 2-oxoglutarate dehydrogenase surE b2744 1.5675 0.0023 phosphatase with broad substrate specificity / 3'-nucleotidase / 5'-nucleotidase talA b2464 7.9764 0.0051 transaldolase A tauA b0365 1.1408 0.0442 TauA/TauB/TauC ABC transporter tfaQ b1546 4.3804 0.0443 hypothetical protein trkA b3290 0.8203 0.0039 TrkA trmD b2607 8.9475 0.0351 tRNA (guanine-1-)-methyltransferase trmU b1133 0.5271 0.0381 catalyzes 2-thiouridine modification of tRNA ttk b3641 3.3439 0.0494 Ttk transcriptional regulator S-adenosylmethionine:2-DMK methyltransferase / 2-octaprenyl-6-methoxy-1,4- ubiE b3833 0.8435 0.0494 benzoquinone methylase upp b2498 0.5649 0.0007 uracil phosphoribosyltransferase uspG b0607 2.9614 0.0340 universal stress protein of the UspA family uxuA b4322 0.8406 0.0459 mannonate dehydratase uxuR b4324 0.7367 0.0352 UxuR transcriptional regulator wrbA b1004 4.9428 0.0377 WrbA xapA b2407 0.7936 0.0468 xanthosine phosphorylase xylA b3565 2.0099 0.0081 xylose isomerase xylB b3564 0.5746 0.0049 xylulokinase xylF b3566 0.7195 0.0419 xylose ABC transporter yaaH b0010 0.6869 0.0271 putative transport protein yabI b0065 1.8964 0.0149 putative integral membrane protein yadH b0128 3.3596 0.0418 YadG/YadH ABC transporter yadR b0156 2.8838 0.0285 conserved hypothetical protein yafS b0213 0.6999 0.0147 putative methyltransferase yahC b0317 0.8078 0.0212 putative membrane protein yahK b0325 1.3928 0.0045 putative oxidoreductase ybbP b0496 0.7792 0.0036 YbbA/YbbP ABC transporter ybcO b0549 0.6231 0.0253 hypothetical protein ybdL b0600 0.4618 0.0229 methionine aminotransferase ybeB b0637 1.7480 0.0389 conserved hypothetical protein ybeR b0645 0.5813 0.0326 conserved hypothetical protein 95

APPENDIX I

gene blattner ratio p-value Function A/B ybhA b0766 0.7300 0.0055 putative phosphatase ybhL b0786 2.1462 0.0351 putative transport protein ybhN b0788 0.7033 0.0260 hypothetical protein ycbU b0942 0.7402 0.0421 putative fimbrial-like protein yccJ b1003 5.6972 0.0370 hypothetical protein ycdF b1005 3.8775 0.0307 hypothetical protein ycdJ b1009 2.2829 0.0227 putative acetyltransferase ycdN b1016 1.7264 0.0325 hypothetical protein of the OFeT transport family yceK b1050 0.9386 0.0468 hypothetical protein ycjF b1322 2.8255 0.0176 putative membrane protein ycjO b1311 0.5416 0.0001 YcjN/YcjO/YcjP ABC transporter yddL b1472 0.6258 0.0181 putative outer membrane porin protein ydeI b1536 3.2270 0.0014 conserved hypothetical protein ydfJ b1543 0.2900 0.0231 YdfJ yeaK b1787 1.5080 0.0319 conserved hypothetical protein yebQ b1828 0.8734 0.0441 YebQ yebS b1833 0.8160 0.0391 putative membrane protein yecC b1917 0.7788 0.0141 putative ATP-binding component of a transport system yeeA b2008 0.6257 0.0087 putative membrane protein, transport yeeL_2 b1979 0.6176 0.0176 putative transport protein yeeO b1985 0.5128 0.0485 YeeO MATE Transporter yeeT b2003 0.5966 0.0348 hypothetical protein yejB b2178 1.2896 0.0364 YejA/YejB/YejE/YejF ABC transporter yfbE b2253 0.5801 0.0012 UDP-L-Ara4O C-4" transaminase yfeC b2398 0.3352 0.0137 hypothetical protein yfeK b2419 0.6148 0.0371 conserved protein yfgM b2513 0.4685 0.0406 conserved protein yfhG b2555 0.9007 0.0264 conserved protein yfhR b2534 0.8297 0.0101 putative methylase or hydrolase yfiP b2583 1.7964 0.0494 conserved hypothetical protein yfjX b2643 0.7308 0.0082 hypothetical protein ygdQ b2832 0.6379 0.0085 putative transport protein ygeF b2850 0.8063 0.0120 conserved hypothetical protein yggC b2928 6.2501 0.0187 putative kinase yggN b2958 0.7475 0.0321 conserved hypothetical protein yghJ b2974 1.1108 0.0216 predicted inner membrane lipoprotein glutathione transferase-like protein possibly involved in glutathionylspermidine yghU b2989 1.1448 0.0338 metabolism ygiH b3059 0.6438 0.0454 putative membrane protein ygiU b3022 3.8905 0.0267 putative cyanide hydratase ygjJ b3079 0.9097 0.0041 hypothetical protein yhaK b3106 2.4963 0.0437 conserved hypothetical protein yhbN b3200 0.6192 0.0050 YhbG/YhbN ABC transporter yhfX b3381 1.2679 0.0037 conserved protein yhhX b3440 0.7634 0.0300 putative galactose 1-dehydrogenase yhjD b3522 2.7084 0.0452 putative membrane protein yiaD b3552 2.3769 0.0160 putative outer membrane protein yiaV b3586 0.5516 0.0468 putative membrane protein yicH b3655 1.5065 0.0436 conserved protein yifN b3777 0.5132 0.0378 conserved hypothetical protein yigF b3817 0.4341 0.0171 conserved hypothetical protein yiiX b3937 0.6653 0.0054 conserved hypothetical protein of the NlpC/P60 peptidase superfamily yjdK b4128 0.6048 0.0143 hypothetical protein yjeQ b4161 0.9234 0.0275 GTPase and putative translation factor / GTPase yjgR b4263 0.7614 0.0369 putative enzyme with P-loop containing nucleotide triphosphate hydrolase domain yjhB b4279 4.7570 0.0247 YjhB MFS transporter yjhT b4310 0.8659 0.0460 putative enzyme contains galactose oxidase-like domain 96

APPENDIX I

gene blattner ratio p-value Function A/B ykgJ b0288 0.5411 0.0198 putative ferredoxin ymgA b1165 1.8693 0.0273 hypothetical protein ymgC b1167 13.1366 0.0366 hypothetical protein ymgD b1171 0.3867 0.0100 hypothetical protein ynaA b1368 0.9570 0.0079 putative alpha helix protein yncA b1448 1.1679 0.0391 putative N-acetyltransferase yneG b1523 1.1135 0.0464 conserved hypothetical protein ynfA b1582 5.9471 0.0110 inner membrane protein yniB b1726 3.4656 0.0443 hypothetical protein yoaG b1796 0.5357 0.0394 hypothetical protein yobB b1843 0.7096 0.0410 conserved hypothetical protein yohC b2135 3.0037 0.0304 putative transport protein yohD b2136 0.6268 0.0385 hypothetical protein yohJ b2141 0.8408 0.0481 putative transmembrane protein yphA b2543 2.8374 0.0476 hypothetical protein yqjE b3099 1.9245 0.0368 conserved protein yraM b3147 0.8763 0.0122 putative glycosylase yrbD b3193 1.2481 0.0359 YrbD yrdA b3279 0.4732 0.0240 putative transferase yrfG b3399 0.5282 0.0267 putative hydrolase with a phophatase-like domain ytfF b4210 0.4613 0.0484 putative transmembrane subunit ytfK b4217 11.1610 0.0296 hypothetical protein ytjB b4387 0.5306 0.0382 membrane protein znuA b1857 0.4613 0.0187 ZnuA/ZnuB/ZnuC ABC transporter zraP b4002 0.2157 0.0093 zinc homeostasis protein b0395 2.2058 0.0439 b0322 1.4431 0.0208 b3948 0.7342 0.0285

Supplementary table - IV: CSH50 wild-type (A) Vs CSH50 hns-205::Tn10 (B), Mid-exponential phase

gene blattner ratio p-value Function A/B acrE b3265 0.4232 0.0319 transmembrane protein affects septum formation and cell membrane permeability ade b3665 0.0880 0.0027 cryptic adenine deaminase monomer agaB b3138 0.5821 0.0060 EIIAga agaC b3139 0.5600 0.0258 EIIAga allD b0517 0.3467 0.0295 ureidoglycolate dehydrogenase alsA b4087 1.4648 0.0056 YjcW alsK b4084 1.6686 0.0186 putative D-allose kinase aniC b4115 0.1952 0.0013 AdiC Arginine:Agmatine Antiporter artJ b0860 1.3014 0.0092 arginine ABC transporter asnA b3744 4.5645 0.0110 aspartate-ammonia ligase azoR b1412 1.7670 0.0328 acyl carrier protein phosphodiesterase b0501 b0501 0.3204 0.0148 hypothetical protein b1172 b1172 0.3230 0.0046 conserved hypothetical protein b1364 b1364 1.7953 0.0104 hypothetical protein b1437 b1437 2.0579 0.0149 hypothetical protein b2084 b2084 0.2573 0.0018 hypothetical protein b2680 b2680 0.2973 0.0151 YgaY MFS transporter b4283 b4283 0.7779 0.0431 IS911 protein basR b4113 0.5152 0.0269 BasR-Phosphorylated transcriptional regulator bcsE b3536 0.7416 0.0435 putative protease 97

APPENDIX I

gene blattner ratio p-value Function A/B bglG b3723 0.3084 0.0458 BglG monomer bioF b0776 0.5910 0.0182 8-amino-7-oxononanoate synthase cadA b4131 0.4186 0.0251 lysine decarboxylase cfa b1661 1.7766 0.0466 cyclopropane fatty acid synthase chaC b1218 0.6361 0.0124 cation transport regulator chbB b1738 0.7761 0.0260 EIIChb chbR b1735 0.6426 0.0292 ChbR transcriptional regulator citC b0618 0.4542 0.0028 citrate lyase ligase citD b0617 0.4617 0.0403 subunit of acyl carrier protein clpA b0882 2.1712 0.0279 ATP-binding component of serine protease clpB b2592 1.8746 0.0335 ClpB chaperone copA b0484 2.0211 0.0020 YbaR csgA b1042 0.3262 0.0123 curlin, major subunit csgB b1041 0.3223 0.0205 curlin, minor subunit precursor csgD b1040 0.2580 0.0060 CsgD transcriptional activator csgF b1038 0.3660 0.0143 curli assembly component csiE b2535 2.3439 0.0459 hypothetical protein cspC b1823 0.5094 0.0463 cold shock protein CspC cspI b1552 0.1583 0.0104 cold shock protein CspI cutC b1874 0.6803 0.0402 copper homeostasis protein cysH b2762 1.3960 0.0442 3'-phospho-adenylylsulfate reductase cysP b2425 1.7696 0.0110 thiosulfate ABC transporter dcrB b3472 1.7334 0.0438 conserved protein involved in bacteriophage adsorption dctR b3507 0.4226 0.0328 protein involved in metabolism of C4-dicarboxylates dcuS b4125 1.6044 0.0224 DcuS-Phis349 ddpC b1485 1.3826 0.0444 YddQ dgoR b3694 1.6453 0.0106 regulator protein for dgo operon djlC b0649 0.6688 0.0445 Hsc56; a DnaJ-like protein that activates ATPase activity of Hsc62 dmsB b0895 1.5182 0.0340 dimethyl sulfoxide reductase, chain B dmsC b0896 1.4176 0.0279 dimethyl sulfoxide reductase, chain C dmsD b1591 1.3281 0.0123 DMS reductase maturation protein dpiA b0620 0.2993 0.0020 CitB transcriptional regulator dpiB b0619 0.2370 0.0054 DpiB dsbC b2893 0.3743 0.0137 DsbC_oxidized elaD b2269 0.7119 0.0344 putative sulfatase / phosphatase entA b0596 1.8924 0.0444 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase exbB b3006 3.9960 0.0236 ExbB protein; uptake of enterochelin; tonB-dependent uptake of B colicins exbD b3005 3.9950 0.0076 ExbD uptake of enterochelin; tonB-dependent uptake of B colicins fdoG b3894 1.9381 0.0090 formate dehydrogenase-O, α subunit fecR b4292 3.3052 0.0019 regulator for fec operon, periplasmic feoB b3409 8.1963 0.0108 FeoB ferrous iron transporter fepC b0588 2.0669 0.0123 Ferric Enterobactin Transport System FhuA outer membrane protein receptor for ferrichrome, colicin M, and phages T1, fhuA b0150 3.0188 0.0173 T5, and phi80 fhuB b0153 1.7527 0.0468 ferrichrome uptake system fhuC b0151 2.1582 0.0127 ferrichrome uptake system fic b3361 1.3570 0.0403 stationary-phase protein with possible role in p-aminobenzoate or folate biosynthesis fimB b4312 0.1579 0.0019 regulator for fimA fimC b4316 0.2925 0.0204 periplasmic chaperone, required for type 1 fimbriae fimD b4317 0.2625 0.0115 outer membrane protein; export and assembly of type 1 fimbriae, interrupted fimE b4313 0.4518 0.0341 regulator for fimA fimF b4318 0.1795 0.0195 fimbrial morphology fimG b4319 0.3289 0.0425 fimbrial morphology fimH b4320 0.3630 0.0420 minor fimbrial subunit, D-mannose specific adhesin fixA b0041 0.2419 0.0368 probable flavoprotein subunit required for anaerobic carnitine metabolism flgA b1072 5.3030 0.0410 flagellar biosynthesis; assembly of basal-body periplasmic P ring flgC b1074 13.7652 0.0406 flagellar basal-body rod protein FlgC 98

APPENDIX I

gene blattner ratio p-value Function A/B flgD b1075 11.0115 0.0367 flagellar biosynthesis, initiation of hook assembly flgG b1078 5.4828 0.0333 flagellar basal-body rod protein FlgG flgI b1080 2.4887 0.0470 flagellar P-ring protein FlgI fliE b1937 1.6564 0.0329 flagellar basal-body protein FliE fliH b1940 1.5432 0.0196 flagellar biosynthesis protein FliH fliL b1944 5.3308 0.0268 flagellar biosynthesis flagellar motor switch protein FliN; component of motor switch and energizing, fliN b1946 4.7917 0.0295 enabling rotation and determining its direction fliZ b1921 4.2696 0.0330 possible cell-density responsive regulator of sigmaF folC b2315 0.7311 0.0443 folylpoly-γ-glutamate synthetase / dihydrofolate synthetase fpr b3924 2.5348 0.0149 flavodoxin NADP+ reductase frdD b4151 1.6186 0.0382 fumarate reductase membrane protein frlB b3371 2.2009 0.0184 fructoselysine 6-phosphate deglycase monomer fruB b2169 0.3434 0.0332 EIIFru fruK b2168 0.4896 0.0376 1-phosphofructokinase monomer fsaA b0825 7.7628 0.0036 Fsa ftnA b1905 0.5763 0.0388 cytoplasmic ferritin, an iron storage protein) gadA b3517 0.0773 0.0039 glutamate decarboxylase A subunit gadC b1492 0.1005 0.0061 XasA GABA APC transporter gadE b3512 0.1805 0.0075 GadE transcriptional activator gadW b3515 0.2415 0.0112 GadWtranscriptional repressor gadX b3516 0.2187 0.0018 GadX transcriptional activator gcl b0507 1.3668 0.0281 glyoxylate carboligase glf b2036 0.8672 0.0128 UDP-galactopyranose mutase glk b2388 1.8333 0.0429 glucokinase glnB b2553 1.3692 0.0068 PII-UMP glnQ b0809 1.7145 0.0305 glutamine ABC transporter glpK b3926 1.4158 0.0147 glycerol kinase gltF b3214 0.3892 0.0017 regulator of gltBDF operon, induction of Ntr enzymes gltJ b0654 1.5962 0.0062 glutamate ABC transporter gor b3500 1.5677 0.0412 glutathione reductase (NADPH) GroES, 10 Kd chaperone binds to Hsp60 in pres. Mg-ATP, suppressing its ATPase groE b4142 1.7003 0.0104 activity groL b4143 1.6506 0.0412 GroEL, chaperone Hsp60, peptide-dependent ATPase, heat shock protein grpE b2614 2.1870 0.0236 phage lambda replication; host DNA synthesis; heat shock protein; protein repair hdeD b3511 0.1890 0.0048 protein involved in acid resistance hemA b1210 0.5195 0.0126 glutamyl-tRNA reductase hlyE b1182 0.1049 0.0060 hemolysin E hofB b0107 1.8089 0.0424 protein involved in plasmid replication hsdS b4348 1.3534 0.0115 specificity determinant for hsdM and hsdR htrL b3618 0.3544 0.0428 involved in lipopolysaccharide biosynthesis hycF b2720 1.3712 0.0000 formate hydrogenlyase complex hyfA b2481 1.4088 0.0450 hydrogenase 4, component A hyfI b2489 1.2438 0.0144 hydrogenase 4, small subunit guanine-nucleotide binding protein, functions as nickel donor for large subunit of hypB b2727 1.7286 0.0223 hydrogenase 3 iaaA b0828 1.6736 0.0020 beta cleavage product of IaaA idnD b4267 0.5169 0.0436 L-idonate 5-dehydrogenase idnR b4264 1.1480 0.0279 IdnR-5-ketogluconate ilvC b3774 1.6530 0.0410 acetohydroxy acid isomeroreductase ilvY b3773 1.7029 0.0090 IlvY transcriptional dual regulator infB b3168 0.8211 0.0337 protein chain initiation factor IF-2 intG b1936 0.3431 0.0453 hypothetical protein katG b3942 1.3880 0.0202 hydroperoxidase I kdsB b0918 1.5677 0.0297 3-deoxy-D-manno-octulosonate-cytidylyltransferase ldhA b1380 2.9107 0.0129 D-lactate dehydrogenase lrhA b2289 0.4409 0.0449 LrhA transcriptional repressor 99

APPENDIX I

gene blattner ratio p-value Function A/B mak b0394 1.4938 0.0390 manno(fructo)kinase malQ b3416 1.2649 0.0206 maltose degrading enzyme 2 / maltose degrading enzyme / amylomaltase map b0168 2.1116 0.0092 methionine aminopeptidase mcrC b4345 0.7384 0.0462 MrcC subunit of 5-methylcytosine restriction system mdtC b2076 0.7845 0.0383 MdtABC RND-type Drug Exporter mdtF b3514 0.4998 0.0195 YhiV mdtM b4337 0.6514 0.0140 YjiO drug MFS transporter menF b2265 0.6845 0.0468 isochorismate synthase, menaquinone-specific menG b3929 1.4163 0.0172 inhibitor of ribonuclease E (RNase E) activity mfd b1114 1.2470 0.0009 transcription-repair coupling factor; mutation frequency decline mntH b2392 2.1445 0.0446 MntH manganese ion NRAMP transporter mobA b3857 2.0022 0.0164 molybdopterin guanine dinucleotide synthase molR_1 b2115 0.5716 0.0391 molybdate metabolism regulator, interrupted mppA b1329 0.3284 0.0002 periplasmic murein tripeptide binding protein msbA b0914 0.7297 0.0302 ATP-binding transport protein; multicopy suppressor of htrB mtlA b3599 1.2772 0.0244 EIIMtl murA b3189 0.6703 0.0265 UDP-N-acetylglucosamine enolpyruvoyl transferase mutS b2733 0.7424 0.0275 MutHLS complex, methyl-directed mismatch repair nrdH b2673 4.4358 0.0460 glutaredoxin-like protein; hydrogen donor nrdI b2674 2.8928 0.0050 stimulates ribonucleotide reduction nuoB b2287 1.3211 0.0440 NADH dehydrogenase I ompF b0929 2.0493 0.0041 outer membrane porin OmpF ompR b3405 1.5638 0.0031 OmpR transcriptional dual regulator ompW b1256 1.5536 0.0299 OmpW, outer membrane protein osmC b1482 0.3366 0.0477 osmotically inducible peroxidase OsmC paaH b1395 1.6745 0.0471 putative 3-hydroxy-acyl-CoA dehydrogenase of phenylacetate degradation paaI b1396 1.5659 0.0497 hypothetical protein with some similarity to thioesterases pagP b0622 0.2030 0.0037 PagP monomer pfkA b3916 2.4655 0.0114 6-phosphofructokinase-1 monomer / putative NAD+ kinase pflB b0903 2.0318 0.0371 pyruvate formate-lyase (inactive) pflD b3951 1.4252 0.0361 formate acetyltransferase 2 pflE b0824 4.1008 0.0376 putative pyruvate formate-lyase 2 activating enzyme pgaA b1024 1.9171 0.0243 putative outer membrane protein pgaB b1023 0.5469 0.0305 putative membrane protein pgk b2926 1.3537 0.0305 phosphoglycerate kinase pinR b1374 0.2637 0.0145 putative transposon resolvase pmrF b2254 0.3626 0.0319 undecaprenyl phosphate-L-Ara4FN transferase pptA b1461 0.5373 0.0206 probable 4-oxalocrotonate tautomerase (4-OT) monomer prlC b3498 1.6015 0.0034 oligopeptidase A proV b2677 0.1318 0.0010 proline ABC transporter proW b2678 0.1876 0.0048 proline ABC transporter pspF b1303 1.5821 0.0168 PspF transcriptional activator pspG b4050 0.7424 0.0314 phage shock protein PspG pta b2297 1.5264 0.0118 phosphate acetyltransferase pyrB b4245 2.0111 0.0261 aspartate carbamoyltransferase, PyrB subunit rdgC b0393 0.7189 0.0182 nonspecific DNA binding protein; nucleoid component DNA strand exchange and renaturation, DNA-dependent ATPase, DNA- and ATP- recA b2699 0.7639 0.0133 dependent coprotease recN b2616 0.2723 0.0087 protein used in recombination and DNA repair recX b2698 0.4849 0.0425 inhibitor of RecA relE b1563 0.7927 0.0031 toxin of the RelE-RelB toxin-antitoxin system; cleaves mRNA in ribosome rfaG b3631 0.6527 0.0257 lipopolysaccharide core biosynthesis; glucosyltransferase I rfaQ b3632 0.5460 0.0077 lipopolysaccharide core biosynthesis rhsA b3593 0.4066 0.0429 RhsA protein in rhs element rhsD b0497 0.1528 0.0099 RhsD protein in rhs element rihB b2162 0.4066 0.0069 ribonuceloside hydrolase 2 (pyrimidine-specific) rihC b0030 2.2156 0.0351 ribonucleoside hydrolase 3 100

APPENDIX I

gene blattner ratio p-value Function A/B rna b0611 1.9534 0.0081 RNase I, cleaves phosphodiester bond between any two nucleotides rnhA b0214 0.8180 0.0094 RNase HI, degrades RNA of DNA-RNA hybrids, participates in DNA replication rpmH b3703 0.5985 0.0307 50S ribosomal subunit protein L34 rsmC b4371 0.6908 0.0180 putative enzyme rsxB b1628 0.4784 0.0272 member of SoxR-reducing complex ruvA b1861 0.5930 0.0118 branch migration of Holliday structures; repair secA b0098 1.7377 0.0270 Sec Protein Secretion Complex selA b3591 1.4733 0.0470 selenocysteine synthase monomer sfmA b0530 1.3127 0.0420 putative fimbrial-like protein sgcR b4300 1.3635 0.0167 SgcR transcriptional regulator slp b3506 0.2034 0.0108 outer membrane protein induced after carbon starvation soxS b4062 7.4619 0.0398 SoxS transcriptional activator stpA b2669 0.2808 0.0208 DNA-binding protein; H-NS-like protein; chaperone activity; RNA splicing? sufA b1684 2.0899 0.0341 scaffold protein for iron-sulfur cluster assembly ATPase component of SufB-SufC-SufD cysteine desulfurase (SufS) activator sufC b1682 1.4335 0.0368 complex suhB b2533 0.7121 0.0469 inositol monophosphatase tdcR b3119 1.3440 0.0327 TdcR transcriptional activator tdk b1238 0.2845 0.0028 thymidine kinase / deoxyuridine kinase torT b0994 1.5195 0.0473 TorT-unknown inducer torZ b1872 0.4520 0.0239 trimethylamine N-oxide reductase III, TorZ subunit treB b4240 1.3851 0.0394 EIITre treC b4239 1.5854 0.0202 trehalose-6-phosphate hydrolase trpD b1263 1.4240 0.0122 anthranilate synthase component II trpE b1264 1.3868 0.0296 anthranilate synthase component I ubiD b3843 1.3999 0.0173 3-octaprenyl-4-hydroxybenzoate decarboxylase monomer ugd b2028 0.5278 0.0277 UDP-glucose 6-dehydrogenase ulaG b4192 1.1945 0.0340 putative L-ascorbate 6-phosphate lactonase uspA b3495 2.2175 0.0364 universal stress protein; broad regulatory function? wcaD b2056 0.2374 0.0250 putative colanic acid polymerase wzyE b3793 1.4246 0.0304 4-α-fucosyltransferase xapR b2405 0.1865 0.0024 XapR transcriptional activator site-specific recombinase, acts on cer sequence of ColE1, effects chromosome xerC b3811 1.3838 0.0440 segregation at cell division yabP b0056 0.4273 0.0003 conserved hypothetical protein yacH b0117 1.3658 0.0346 putative membrane protein yadK b0136 0.2247 0.0062 putative adhesin-like protein yadL b0137 0.4099 0.0151 putative adhesin-like protein yafD b0209 1.4773 0.0349 conserved hypothetical protein yafW b0246 1.8615 0.0241 antitoxin of the YkfI-YafW toxin-antitoxin pair yaiB b0382 0.5256 0.0360 conserved hypothetical protein yaiW b0378 0.8394 0.0355 conserved hypothetical protein yajD b0410 1.3406 0.0194 conserved hypothetical protein ybaD b0413 1.5654 0.0479 conserved protein ybaK b0481 1.3718 0.0213 conserved hypothetical protein ybaW b0443 1.1589 0.0085 conserved hypothetical protein ybbD b0500 0.3702 0.0301 conserved hypothetical protein ybcM b0546 0.2015 0.0007 putative ARAC-type regulatory protein ybdG b0577 0.5999 0.0390 putative transport protein ybfH b0691 0.8192 0.0421 conserved hypothetical protein ybgO b0716 1.2872 0.0428 conserved hypothetical protein ybiF b0813 0.3984 0.0307 Threonine and Homoserine Exporter ybiW b0823 4.0177 0.0341 putative formate acetyltransferase ybjL b0847 0.7609 0.0095 putative transport protein ycaK b0901 0.6234 0.0102 YcaK ycaL b0909 1.2929 0.0439 putative heat shock protein ycaM b0899 0.3732 0.0035 YcaM APC amino acid transporter 101

APPENDIX I

gene blattner ratio p-value Function A/B ycbQ b0938 0.2233 0.0046 putative fimbrial-like protein ycbS b0940 0.4473 0.0081 putative outer membrane protein ycbT b0941 0.5092 0.0133 homolog of Salmonella FimH protein yccU b0965 1.4442 0.0412 putative NAD(P)-binding enzyme ycdN b1016 1.2686 0.0288 hypothetical protein of the OFeT transport family ycdU b1029 0.3114 0.0236 putative enzyme yceI b1056 0.6004 0.0350 periplasmic protein; possibly secreted ycfR b1112 0.3049 0.0045 conserved hypothetical protein ycgH_1 b1169 0.2603 0.0228 conserved protein; member of the Autotransporter family ycgV b1202 0.1758 0.0031 putative adhesion and penetration protein yciE b1257 0.5250 0.0110 conserved protein ycjN b1310 0.4274 0.0070 YcjN/YcjO/YcjP ABC transporter ycjO b1311 1.4055 0.0364 YcjN/YcjO/YcjP ABC transporter ycjP b1312 0.5766 0.0237 YcjN/YcjO/YcjP ABC transporter ycjQ b1313 0.5545 0.0251 putative oxidoreductase ydbH b1381 1.4568 0.0176 conserved protein ydcA b1419 0.7482 0.0460 hypothetical protein yddJ b1470 0.7674 0.0421 hypothetical protein yddV b1490 0.4204 0.0091 conserved protein ydeH b1535 0.2575 0.0002 hypothetical protein ydeI b1536 0.3455 0.0164 conserved hypothetical protein ydeM b1497 0.7525 0.0152 putative enzyme ydeO b1499 0.3105 0.0065 putative ARAC-type regulatory protein ydeP b1501 0.5015 0.0287 acid resistance protein ydeS b1504 0.4386 0.0418 putative fimbrial-like protein ydeT b1505 0.5607 0.0195 putative outer membrane protein ydfJ b1543 1.4099 0.0448 YdfJ YdgE b1599 0.1355 0.0016 YdgE SMR Protein YdgF b1600 0.0941 0.0008 YdgF SMR protein; toxin of a putative toxin-antitoxin pair ydgK b1626 0.5783 0.0429 putative oxidoreductase ydgT b1625 0.3754 0.0341 conserved hypothetical protein ydhT b1669 0.6822 0.0135 conserved protein ydhY b1674 0.5117 0.0365 putative oxidoreductase, Fe-S subunit ydiA b1703 0.4514 0.0302 conserved protein ydiT b1700 0.5051 0.0079 putative ferredoxin ydjI b1773 0.5134 0.0380 putative aldolase ydjJ b1774 0.5684 0.0403 putative oxidoreductase yeaD b1780 2.3475 0.0375 conserved hypothetical protein yeaJ b1786 0.3536 0.0274 putative membrane protein yeaU b1800 0.6621 0.0455 putative tartrate dehydrogenase yebN b1821 0.3605 0.0299 putative membrane protein, terpenoid synthase-like yecT b1877 0.7868 0.0119 hypothetical protein yedL b1932 0.7234 0.0377 putative acyl-CoA N-acyltransferase yedW b1969 0.2224 0.0277 putative 2-component transcriptional response regulator yeeP b1999 1.5217 0.0256 putative histone yeeR b2001 3.3879 0.0270 hypothetical protein yegI b2070 0.5059 0.0139 putative chaperonin yegJ b2071 0.4400 0.0002 hypothetical protein yegZ b2083 0.4459 0.0458 hypothetical protein yehD b2111 1.2074 0.0153 putative fimbrial-like protein yehZ b2131 1.4371 0.0308 YehW/YehX/YehY/YehZ ABC transporter yeiC b2166 0.1058 0.0054 putative kinase yeiL b2163 0.2356 0.0045 yeiL transcriptional activator yeiS b2145 0.3579 0.0009 hypothetical protein yfaO b2251 0.6774 0.0483 putative enzyme (Nudix hydrolase) yfbE b2253 0.5011 0.0326 UDP-L-Ara4O C-4" transaminase 102

APPENDIX I

gene blattner ratio p-value Function A/B yfbT b2293 1.7768 0.0251 putative phosphatase, contains a phophatase-like domain yfcV b2339 0.2396 0.0363 putative fimbrial-like protein yfcZ b2343 1.9842 0.0309 conserved hypothetical protein yfdY b2377 1.9172 0.0152 hypothetical protein yfeH b2410 2.5659 0.0020 putative cytochrome oxidase yfeO b2389 1.3810 0.0219 hypothetical protein yfgH b2505 0.3998 0.0112 putative outer membrane lipoprotein yfgI b2506 0.3691 0.0138 putative membrane protein yfiC b2575 0.5114 0.0115 putative enzyme yfiR b2603 0.4214 0.0315 conserved protein yfjT b2637 1.2855 0.0166 hypothetical protein ygaD b2700 1.5905 0.0380 conserved protein ygaQ b2654 0.5771 0.0145 hypothetical protein ygcG b2778 0.5541 0.0426 putative membrane protein ygcI b2757 0.2705 0.0485 hypothetical protein ygcK b2759 0.1525 0.0146 hypothetical protein ygeH b2852 1.2703 0.0166 putative invasion protein ygfJ b2877 0.5915 0.0145 conserved protein ygiD b3039 1.7851 0.0438 putative enzyme with dioxygenase domain ygiL b3043 0.1979 0.0050 putative fimbrial-like protein ygiP b3060 0.3869 0.0138 putative transcriptional regulator LYSR-type ygjG b3073 0.7150 0.0032 putrescine:2-oxoglutaric acid aminotransferase ygjR b3087 1.7341 0.0151 putative NAD(P)-binding dehydrogenase yhaC b3121 0.7029 0.0259 conserved protein yhaH b3103 1.4810 0.0409 putative cytochrome yheT b3353 0.9395 0.0476 putative hydrolase with an alpha/beta-hydrolase domain yhgG b3410 8.7789 0.0083 putative transcriptional regulator yhhS b3473 1.9023 0.0214 YhhS MFS transporter yhiM b3491 0.3980 0.0150 conserved inner membrane protein yhiS b3504 0.4148 0.0135 conserved protein yhjB b3520 1.6281 0.0425 putative regulator yhjD b3522 1.3548 0.0218 putative membrane protein yhjH b3525 1.9821 0.0096 protein involved in flagellar function yhjX b3547 2.3356 0.0409 YhjX MFS transporter yiaU b3585 0.4160 0.0154 putative transcriptional regulator LYSR-type yibA b3594 0.2851 0.0477 putative lyase putative membrane protein with possible relationship to novobiocin and yicO b3664 0.2533 0.0165 deoxycholate resistance yieI b3716 1.7977 0.0144 putative membrane protein yigF b3817 0.4178 0.0439 conserved hypothetical protein yigL b3826 1.3312 0.0472 conserved protein with a phosphatase-like domain yigZ b3848 1.4946 0.0135 putative elongation factor yihF b3861 0.6315 0.0205 conserved protein yjaG b3999 1.5544 0.0152 conserved protein yjbB b4020 1.4828 0.0113 putative alpha helix protein yjbM b4048 0.5829 0.0309 conserved hypothetical protein yjcZ b4110 0.6510 0.0102 hypothetical protein yjdA b4109 0.3357 0.0151 hypothetical protein yjdL b4130 0.7255 0.0483 YjdL peptide POT transporter yjeJ b4145 0.5658 0.0365 conserved protein yjeN b4157 0.4976 0.0199 conserved hypothetical protein yjeS b4166 1.9051 0.0114 conserved ferredoxin-like protein yjfM b4185 1.4600 0.0495 conserved hypothetical protein yjgK b4252 1.5575 0.0381 conserved hypothetical protein yjgN b4257 0.6494 0.0031 putative membrane protein possible involved in transport yjhE b4282 0.6011 0.0270 KpLE2 phage-like element yjhH b4298 0.2791 0.0089 putative lyase/synthase 103

APPENDIX I

gene blattner ratio p-value Function A/B yjhI b4299 0.3015 0.0021 putative regulator yjiP b4338 0.2074 0.0198 hypothetical protein yjiW b4347 0.3864 0.0124 hypothetical protein yjjI b4380 1.2300 0.0003 conserved hypothetical protein yjjN b4358 0.7146 0.0214 putative oxidoreductase yliH b0836 1.4511 0.0323 putative receptor; induced in stationary phase ymdA b1044 1.3743 0.0405 conserved hypothetical protein ymdE b1028 1.2439 0.0093 putative malonyl-CoA:Acyl carrier protein transacylase ymfM b1148 1.3536 0.0483 hypothetical protein ymgD b1171 0.4644 0.0021 hypothetical protein ynaE b1375 0.2665 0.0186 hypothetical protein ynaI b1330 0.5285 0.0218 YnaI ynbD b1411 1.4997 0.0330 putative enzyme yncC b1450 0.6862 0.0367 hypothetical protein yncD b1451 1.5934 0.0332 Probable TonB-dependent receptor yncI b1458 0.1672 0.0266 conserved protein yneI b1525 3.7228 0.0368 putative aldehyde dehydrogenase yneK b1527 0.9040 0.0285 conserved protein ynfN b1551 0.2403 0.0063 hypothetical protein yohJ b2141 2.9847 0.0353 putative transmembrane protein yohN b2107 0.6686 0.0265 hypothetical protein ypfJ b2475 1.4122 0.0100 conserved protein ypjF b2646 1.6516 0.0435 member of the YeeV, YkfI, YpjF family of toxin proteins yqaC b2657 0.3850 0.0243 putative enzyme yqeC b2876 0.6850 0.0170 conserved protein yqeI b2847 0.3106 0.0215 putative sensory transducer yqeJ b2848 0.3761 0.0379 conserved hypothetical protein yqgA b2966 2.0839 0.0160 putative transport protein yrhA b3443 0.7276 0.0181 conserved hypothetical protein ytfR b4485 1.7393 0.0402 subunit of YtfQ/YtfR/YtfS/YtfT/YjfF ABC transporter ytfT b4230 1.5937 0.0012 YtfQ/YtfR/YtfS/YtfT/YjfF ABC transporter zraS b4003 2.0921 0.0305 ZraS-Phis

Supplementary table – V: CSH50 wild-type (A) Vs CSH50 hns-205::Tn10 (B), Transition to stationary phase

gene blattner ratio p-value Function A/B aaeB b3240 1.1872 0.0075 hypothetical protein aceE b0114 0.2646 0.0654 subunit of E1p component of pyruvate dehydrogenase complex acrD b2470 1.3042 0.1589 AcrD ade b3665 0.0725 0.0088 cryptic adenine deaminase monomer adiA b4117 0.9019 0.0328 Adi agaB b3138 1.1736 0.1822 EIIAga alsC b4086 1.2567 0.1129 YjcV ansB b2957 0.2992 0.0537 asparaginase II arpB_2 b1721 0.9159 0.1043 hypothetical protein artJ b0860 0.8070 0.0643 arginine ABC transporter b1367 b1367 1.2731 0.0856 hypothetical protein b1567 b1567 0.7688 0.1747 hypothetical protein b3808 b3808 1.2642 0.0697 hypothetical protein b4103 b4103 1.4344 0.0818 putative C terminus of split phnE gene product betA b0311 1.2923 0.0890 choline dehydrogenase 104

APPENDIX I

gene blattner ratio p-value Function A/B caiF b0034 0.2262 0.0374 CaiF transcriptional activator cheY b1882 1.4371 0.1824 CheY-Pasp csgD b1040 0.6260 0.1715 CsgD transcriptional activator cusB b0574 1.8915 0.0232 membrane fusion protein of the CusCFBA copper efflux system cydA b0733 0.4010 0.0979 cytochrome bd-I terminal oxidase subunit I cysS b0526 0.8028 0.2224 cysteinyl-tRNA synthetase dapB b0031 0.5764 0.1246 dihydrodipicolinate reductase inner membrane serine protease required for the extracytoplasmic stress response degS b3235 1.4438 0.2115 mediated by sigmaE ebgC b3077 1.1456 0.1104 evolved beta-D-galactosidase, beta subunit; cryptic gene entA b0596 1.2670 0.1112 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase entC b0593 0.7369 0.0692 isochorismate synthase, enterobactin specific eutJ b2454 0.8315 0.0043 putative ethanolamine utilization protein fabB b2323 0.4887 0.0554 beta-ketoacyl-ACP synthase I / malonyl-ACP decarboxylase fadI b2342 1.5169 0.2349 FadI monomer involved in protein transport; multicopy suppressor of dominant negative ftsH fdrA b0518 0.8147 0.1193 mutants fhuB b0153 1.3218 0.2319 ferrichrome uptake system fimD b4317 0.5627 0.2047 outer membrane protein; export and assembly of type 1 fimbriae, interrupted fixA b0041 0.0756 0.1450 probable flavoprotein subunit required for anaerobic carnitine metabolism flavoprotein (electron transport), possibly involved in anaerobic carnitine fixC b0043 0.2155 0.2179 metabolism flgB b1073 0.8033 0.0745 flagellar basal-body rod protein FlgB folC b2315 1.3627 0.0775 folylpoly-γ-glutamate synthetase / dihydrofolate synthetase folP b3177 1.2314 0.1694 dihydropteroate synthase frlB b3371 2.0432 0.0360 fructoselysine 6-phosphate deglycase monomer frlC b3372 1.2382 0.2287 fructoselysine and psicoselysine degradation frmA b0356 1.3302 0.0420 formaldehyde dehydrogenase, glutathione-dependent fucA b2800 0.2508 0.0258 L-fuculose-phosphate aldolase garD b3128 0.3928 0.2088 galactarate dehydratase gloA b1651 1.3030 0.0348 glyoxalase I gltJ b0654 1.2726 0.0202 glutamate ABC transporter gnd b2029 0.2673 0.1255 6-phosphogluconate dehydrogenase (decarboxylating) gspF b3327 1.1553 0.2132 putative protein secretion protein for export hemG b3850 1.3439 0.1949 protoporphyrinogen oxidase insB b0264 1.2537 0.0298 IS1 protein InsB (B0264) iscA b2528 1.4368 0.0689 iron-sulfur cluster assembly protein iscS b2530 2.5506 0.1524 cysteine desulfurase monomer kdsB b0918 0.6326 0.0429 3-deoxy-D-manno-octulosonate-cytidylyltransferase kdtA b3633 1.3532 0.1040 KDO transferase kefG b3351 1.3412 0.1984 KefG lepB b2568 1.1466 0.0947 leader peptidase (signal peptidase I) mdtF b3514 0.2922 0.2011 YhiV putative 2-hydroxyglutarate synthase / SHCHC synthase / 2-oxoglutarate menD b2264 0.5481 0.0119 decarboxylase moaC b0783 0.7275 0.0123 molybdopterin biosynthesis, protein C nanA b3225 1.7915 0.0363 N-acetylneuraminate lyase nfnB b0578 0.6237 0.0070 dihydropteridine reductase nrdH b2673 1.4711 0.2098 glutaredoxin-like protein; hydrogen donor ompF b0929 1.7917 0.1439 outer membrane porin OmpF oppF b1247 0.8461 0.0600 oligopeptide ABC transporter osmC b1482 0.6061 0.1300 osmotically inducible peroxidase OsmC paaE b1392 1.6951 0.1043 putative oxygenase reductase of phenylacetate degradation paaY b1400 1.4811 0.0096 putative transferase pgaC b1022 0.6851 0.0781 predicted N-glycosyltransferase potH b0856 1.3620 0.0482 putrescine ABC transporter ppsA b1702 0.6429 0.1319 phosphoenolpyruvate synthase proP b4111 1.3631 0.1790 ProP proline/betaine MFS transporter 105

APPENDIX I

gene blattner ratio p-value Function A/B proV b2677 0.4218 0.1799 proline ABC transporter puuC b1300 1.6935 0.1184 aldehyde dehydrogenase pykA b1854 0.7604 0.0838 pyruvate kinase II monomer pyrB b4245 1.1503 0.1874 aspartate carbamoyltransferase, PyrB subunit rbsC b3750 0.6695 0.0468 ribose ABC transporter DNA strand exchange and renaturation, DNA-dependent ATPase, DNA- and ATP- recA b2699 0.3452 0.1832 dependent coprotease relA b2784 1.2742 0.1110 GDP pyrophosphokinase / GTP pyrophosphokinase rfe b3784 1.3370 0.2082 undecaprenyl-phosphate α-N-acetylglucosaminyl transferase rluF b4022 1.3140 0.1201 23S rRNA pseudouridine synthase rusA b0550 1.4113 0.1436 endodeoxyribonuclease RUS (Holliday junction resolvase) serB b4388 0.7904 0.0773 phosphoserine phosphatase sieB b1353 0.8383 0.1178 phage superinfection exclusion protein slp b3506 0.4025 0.1450 outer membrane protein induced after carbon starvation 30S ribosomal subunit protein S22; sub-stoichiometric stationary phase ribosomal sra b1480 1.6764 0.1726 component srlB b2704 1.2552 0.1276 GutB tdcD b3115 0.1894 0.1458 propionate kinase / acetate kinase C tfaS b2353 1.2824 0.0709 hypothetical protein thiC b3994 0.9357 0.1591 thiC protein thiE b3993 1.2669 0.1306 thiamine phosphate synthase thiL b0417 1.2068 0.0179 thiamine phosphate kinase torY b1873 0.4910 0.1241 trimethylamine N-oxide reductase III, c-type cytochrome subunit torZ b1872 0.5350 0.0783 trimethylamine N-oxide reductase III, TorZ subunit trmE b3706 1.3641 0.0940 GTP-binding protein with a role in modification of tRNA udk b2066 1.1984 0.1082 uridine kinase / cytidine kinase uppP b3057 0.9220 0.0886 undecaprenyl diphosphatase; bacitracin resistance uxuA b4322 1.5879 0.1280 mannonate dehydratase xapB b2406 0.7826 0.0813 XapB xanthosine MFS transporter xylH b3568 0.2488 0.1621 xylose ABC transporter xylR b3569 0.5185 0.1010 XylR-Xylose transcriptional activator ybbV b0510 0.8643 0.0029 hypothetical protein ybgH b0709 1.2353 0.1593 YbgH peptide POT Transporter ycbY b0948 1.4626 0.2285 putative methyltransferase putative carrier/transport protein; substrate or modulator of FtsH-mediated yccA b0970 0.8900 0.1984 proteolysis yccU b0965 1.6297 0.1818 putative NAD(P)-binding enzyme yceH b1067 0.7620 0.2327 conserved hypothetical protein ycgH_1 b1169 0.3656 0.1003 conserved protein; member of the Autotransporter family ycgV b1202 0.5050 0.0863 putative adhesion and penetration protein yciQ b1268 1.0958 0.0693 putative membrane protein ycjS b1315 1.2033 0.2091 putative galactose 1-dehydrogenase ycjX b1321 0.8771 0.2180 putative EC 2.1 enzyme ydaV b1360 1.2315 0.1919 putative DNA replication factor ydcF b1414 1.3872 0.0086 conserved hypothetical protein ydcL b1431 1.3586 0.0134 conserved hypothetical protein YdgF b1600 0.4729 0.0174 YdgF SMR protein; toxin of a putative toxin-antitoxin pair ydgR b1634 1.3701 0.0111 YdgR putative peptide POT Transporter ydiQ b1697 0.7378 0.0072 putative subunit of YdiQ-YdiR flavoprotein ydjI b1773 0.6874 0.0303 putative aldolase yeaC b1777 1.2788 0.0410 conserved hypothetical protein yegK b2072 0.7214 0.0032 conserved hypothetical protein yegS b2086 1.2631 0.0064 conserved protein yeiC b2166 0.3541 0.2324 putative kinase yfdT b2363 1.1129 0.0883 hypothetical protein yfeX b2431 0.7909 0.0108 conserved protein yfiP b2583 0.7684 0.0969 conserved hypothetical protein 106

APPENDIX I

gene blattner ratio p-value Function A/B yfiR b2603 0.6636 0.1282 conserved protein yfjP b2632 1.3077 0.1930 putative GTP-binding protein ygcB b2761 0.4844 0.2032 putative enzyme ygcI b2757 0.2748 0.2013 hypothetical protein ygcS b2771 0.7026 0.1397 YgcS MFS transporter ygeG b2851 0.5939 0.1993 conserved hypothetical protein yhbG b3201 1.0641 0.0935 YhbG/YhbN ABC transporter yhbW b3160 1.4346 0.0533 putative enzyme yhdX b3269 0.8973 0.1366 YhdW/YhdX/YhdY/YhdZ ABC transporter yhgE b3402 1.3316 0.1019 putative transport yhhA b3448 1.3377 0.1710 conserved protein yhhJ b3485 1.1309 0.1809 YhiH/YhhJ ABC transporter yhhW b3439 1.1799 0.2435 conserved hypothetical protein yhiM b3491 0.1095 0.0552 conserved inner membrane protein yhiP b3496 1.1708 0.1262 YhiP peptide POT transporter yhjD b3522 1.4333 0.0321 putative membrane protein yicI b3656 1.8297 0.1437 putative alpha-xylosidase yidC b3705 1.4704 0.1123 inner-membrane protein insertion factor yihW b3884 0.8220 0.0407 putative DEOR-type transcriptional regulator yjeM b4156 0.7016 0.1081 YjeM APC transporter yjhC b4280 0.5790 0.1944 KpLE2 phage-like element; putative NAD(P)-binding dehydrogenase yjhE b4282 1.2886 0.0221 KpLE2 phage-like element yjhI b4299 0.5334 0.0761 putative regulator yjhS b4309 1.2490 0.1765 conserved protein yjiP b4338 0.2190 0.0587 hypothetical protein ymfL b1147 1.2231 0.1027 hypothetical protein ynaI b1330 0.3691 0.1029 YnaI yneK b1527 1.2307 0.0945 conserved protein ynjH b1760 1.2650 0.1545 conserved hypothetical protein yphF b2548 0.8131 0.1404 YphD/YphE/YphF ABC transporter yqaA b2689 1.5094 0.1026 putative integral membrane protein yqcE b2775 0.3813 0.0410 YqcE MFS transporter yqeA b2874 0.6119 0.2140 putative carbamate kinase yqgF b2949 1.1217 0.0662 possible Holliday junction resolvase yraR b3152 0.8804 0.0477 putative NADH dehydrogenase yrbD b3193 1.2804 0.0766 YrbD yrhA b3443 1.4004 0.1317 conserved hypothetical protein ytfL b4218 0.6807 0.0752 putative transport protein

Supplementary table – VI: CSH50 wild-type (A) Vs CSH50 hns-205::Tn10 (B), Late stationary phase

gene blattner ratio p-value Function A/B aas b2836 0.8153 0.0200 2-acylglycerophosphoethanolamine acyltransferase / acyl-ACP synthetase accA b0185 0.6328 0.0126 acetyl CoA carboxylase asnC b3743 2.7539 0.0441 AsnC transcriptional dual regulator astA b1747 0.3481 0.0052 arginine succinyltransferase astC b1748 0.6661 0.0099 acetylornithine transaminase, catabolic / succinylornithine transaminase b1567 b1567 0.7803 0.0356 hypothetical protein b3975 b3975 1.3034 0.0341 hypothetical protein bdm b1481 0.2891 0.0268 hypothetical protein ccmA b2201 1.4349 0.0053 CcmABCDEFGH cytochrome c biogenesis system clpS b0881 1.4414 0.0407 specificity factor for ClpA-ClpP chaperone-protease complex 107

APPENDIX I

gene blattner ratio p-value Function A/B csgG b1037 0.6187 0.0112 curli production component cspI b1552 0.2912 0.0302 cold shock protein CspI cutC b1874 0.7767 0.0309 copper homeostasis protein dcm b1961 0.6512 0.0238 DNA cytosine methylase ddlA b0381 0.7805 0.0467 D-alanine-D-alanine ligase A inner membrane serine protease required for the extracytoplasmic stress response degS b3235 2.0142 0.0342 mediated by sigmaE dkgA b3012 0.6653 0.0108 beta-keto ester reductase / 2,5-diketo-D-gluconate reductase A ebgC b3077 1.2066 0.0412 evolved beta-D-galactosidase, beta subunit; cryptic gene essQ b1556 1.3096 0.0194 hypothetical protein fabZ b0180 1.3977 0.0405 beta-hydroxyacyl-ACP dehydratase fdnI b1476 0.8282 0.0127 formate dehydrogenase N, γ subunit fimI b4315 0.6913 0.0188 fimbrial protein fiu b0805 0.7727 0.0214 putative outer membrane receptor for iron transport fixX b0044 0.8813 0.0500 putative ferredoxin possibly involved in anaerobic carnitine metabolism folK b0142 0.7003 0.0449 6-hydroxymethyl-7,8-dihydropterin pyrophosphokinase fruR b0080 1.5732 0.0110 FruR transcriptional dual regulator frwD b3953 1.3246 0.0112 PTS system fructose-like IIB component 2 gadA b3517 0.1073 0.0024 glutamate decarboxylase A subunit gadC b1492 0.2366 0.0330 XasA GABA APC transporter galU b1236 0.5670 0.0482 UTP-glucose-1-phosphate uridylyltransferase glgP b3428 0.7249 0.0159 glycogen phosphorylase / glycogen-maltotetraose phosphorylase gntX b3413 1.4099 0.0310 gluconate periplasmic binding protein grxA b0849 0.5770 0.0229 oxidized glutaredoxin hcaT b2536 1.3120 0.0486 HcaT MFS transporter hdeA b3510 0.0575 0.0020 acid-resistance protein, possible chaperone hdeB b3509 0.0572 0.0013 10K-L protein, related to acid resistance protein of Shigella flexneri hflC b4175 1.6656 0.0464 regulator of FtsH protease hlyE b1182 0.4334 0.0228 hemolysin E hpt b0125 1.4604 0.0051 guanine phosphoribosyltransferase / hypoxanthine phosphoribosyltransferase hybE b2992 1.5741 0.0491 chaperone in Tat protein export ibpA b3687 4.8015 0.0454 small heat shock protein IbpA ibpB b3686 27.0211 0.0196 small heat shock protein IbpB ilvG_1 b3767 0.6880 0.0458 IlvG_1 intB b4271 1.1609 0.0338 prophage P4 integrase intZ b2442 0.6336 0.0499 putative prophage integrase kefF b0046 0.7476 0.0460 regulator of KefC-mediated potassium transport lexA b4043 1.2491 0.0064 LexA transcriptional repressor mdtD b2077 0.7885 0.0485 YegB metR b3828 1.2459 0.0091 MetR-Homocysteine transcriptional activator mntH b2392 1.3722 0.0434 MntH manganese ion NRAMP transporter mtn b0159 1.8303 0.0211 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase monomer mviN b1069 1.2873 0.0435 putative virulence factor nudC b3996 0.8052 0.0060 putative NAD+ diphosphatase osmC b1482 0.7078 0.0028 osmotically inducible peroxidase OsmC pdxB b2320 1.2874 0.0306 erythronate-4-phosphate dehydrogenase pepD b0237 0.8060 0.0340 peptidase D phnI b4099 0.8943 0.0064 phosphonate metabolism phoA b0383 0.5971 0.0243 alkaline phosphatase proY b0402 0.7097 0.0303 ProY cryptic proline APC transporter positive DNA-binding transcriptional regulator of capsular polysaccharide rcsA b1951 0.6183 0.0022 synthesis, activates its own expression rfbA b2039 1.4182 0.0327 dTDP-glucose pyrophosphorylase rhaD b3902 1.1347 0.0373 rhamnulose-1-phosphate aldolase monomer rsxG b1631 1.0943 0.0407 member of SoxR-reducing complex rzpD b0556 1.2441 0.0411 bacteriophage lambda endopeptidase homolog serB b4388 0.6533 0.0326 phosphoserine phosphatase 108

APPENDIX I

gene blattner ratio p-value Function A/B srmB b2576 0.6931 0.0163 SrmB, DEAD-box RNA helicase sufB b1683 0.7379 0.0307 component of SufB-SufC-SufD cysteine desulfurase (SufS) activator complex tdcC b3116 0.5550 0.0418 TdcC threonine STP transporter thiQ b0066 1.1434 0.0110 SfuC trpS b3384 0.7488 0.0006 tryptophanyl-tRNA synthetase 3-demethylubiquinone 3-methyltransferase / 2-octaprenyl-6-hydroxyphenol ubiG b2232 0.7729 0.0299 methylase ulaA b4193 0.8742 0.0352 eiisga wcaF b2054 1.2259 0.0176 putative transferase Wza Outer Membrane Auxiliary (OMA) Protein, putative polysaccharide export wza b2062 0.7309 0.0460 protein xapR b2405 0.3692 0.0027 XapR transcriptional activator xylA b3565 0.8740 0.0471 xylose isomerase yaiY b0379 0.5364 0.0026 putative membrane protein ybbJ b0488 2.0666 0.0366 conserved protein ybdJ b0580 0.7815 0.0459 conserved hypothetical protein ybdO b0603 0.6554 0.0450 putative transcriptional regulator LYSR-type ybfC b0704 0.8179 0.0148 hypothetical protein ybfD b0706 0.4459 0.0407 conserved protein ybfH b0691 1.2496 0.0152 conserved hypothetical protein ybhA b0766 0.8134 0.0431 putative phosphatase yccV b0966 2.5767 0.0377 hemimethylated DNA-binding protein ycfL b1104 1.3666 0.0057 conserved hypothetical protein ycfR b1112 3.1414 0.0148 conserved hypothetical protein ycfZ b1121 0.6103 0.0092 homolog of virulence factor ydcL b1431 1.4454 0.0141 conserved hypothetical protein ydcT b1441 2.1704 0.0408 YdcS/YdcT/YdcV/YdcU ABC transporter yddE b1464 1.6330 0.0327 conserved protein yddL b1472 0.6888 0.0412 putative outer membrane porin protein ydeI b1536 0.2094 0.0105 conserved hypothetical protein ydiE b1705 1.3842 0.0087 conserved hypothetical protein ydiN b1691 0.7914 0.0208 YdiN MFS transporter yeaU b1800 0.8373 0.0483 putative tartrate dehydrogenase yeaY b1806 1.6602 0.0487 YeaY-outer membrane lipoprotein yeiC b2166 0.6387 0.0344 putative kinase yeiN b2165 0.7083 0.0244 conserved protein yejH b2184 0.6928 0.0353 putative ATP-dependent helicase yfdM b2356 0.8862 0.0233 hypothetical protein yfdN b2357 0.5394 0.0352 hypothetical protein yfdP b2359 0.8135 0.0108 hypothetical protein ygaZ b2682 1.2508 0.0420 hypothetical protein ygbE b2749 0.6796 0.0222 putative cytochrome oxidase subunit ygdQ b2832 0.6987 0.0374 putative transport protein ygdR b2833 1.8619 0.0313 conserved hypothetical protein ygjJ b3079 0.8702 0.0362 hypothetical protein yhdX b3269 0.8459 0.0481 YhdW/YhdX/YhdY/YhdZ ABC transporter yhhH b3483 1.2967 0.0413 hypothetical protein yhhJ b3485 1.4754 0.0452 YhiH/YhhJ ABC transporter yhiK b3489 0.7613 0.0013 hypothetical protein yhiM b3491 0.7525 0.0431 conserved inner membrane protein yijP b3955 0.8397 0.0421 hypothetical protein; related to invasion protein of pathogenic E. coli yjjX b4394 1.2584 0.0451 conserved hypothetical protein ypfI b2474 0.6593 0.0264 putative acyl-CoA N-acyltransferase yqeA b2874 0.6229 0.0368 putative carbamate kinase yqjI b3071 0.5697 0.0445 conserved hypothetical protein ytfM b4220 2.1209 0.0146 hypothetical protein b0671 1.2936 0.0166 109

APPENDIX I

Supplementary table – VII: LZ41 wild-type (A) Vs LZ54 wild-type (B)

gene blattner ratio p-value Function A/B acrA b0463 0.6308 0.0443 AcrA Membrane Fusion Protein adiA b4117 1.5642 0.0083 Adi adk b0474 0.5809 0.0178 adenylate kinase agn43 b2000 1.4617 0.0017 outer membrane fluffing protein, sim. to adhesin apaH b0049 2.1825 0.0030 diadenosine tetraphosphatase appC b0978 1.6125 0.0146 cytochrome bd-II terminal oxidase subunit I apt b0469 0.3410 0.0071 adenine phosphoribosyltransferase argO b2923 0.5996 0.0187 arginine export protein argR b3237 0.8031 0.0265 ArgR transcriptional dual regulator aroA b0908 0.5593 0.0075 3-phosphoshikimate-1-carboxyvinyltransferase aroH b1704 0.3961 0.0044 2-dehydro-3-deoxyphosphoheptonate aldolase aroK b3390 0.7329 0.0170 shikimate kinase I aroL b0388 0.5122 0.0004 shikimate kinase II arsR b3501 1.5818 0.0001 ArsR transcriptional regulator artQ b0862 2.3631 0.0195 arginine ABC transporter asd b3433 0.4470 0.0376 aspartate semialdehyde dehydrogenase asnC b3743 2.1877 0.0338 AsnC transcriptional dual regulator aspC b0928 0.7245 0.0228 aspartate transaminase aspS b1866 1.7817 0.0499 aspartyl-tRNA synthetase astD b1746 1.3761 0.0106 succinylglutamic semialdehyde dehydrogenase astE b1744 1.5726 0.0411 succinylglutamate desuccinylase atoA b2222 1.7283 0.0293 AtoA / putative acetate CoA-transferase atpC b3731 1.4794 0.0280 ATP synthase, F1 complex, epsilon subunit atpI b3739 0.5296 0.0433 AtpI b0165 b0165 0.5418 0.0021 hypothetical protein b0373 b0373 0.5146 0.0463 hypothetical protein b0501 b0501 1.1869 0.0303 hypothetical protein b1354 b1354 1.2688 0.0397 hypothetical protein b1402 b1402 0.4643 0.0317 IS22 protein b1500 b1500 0.6253 0.0088 hypothetical protein; gene is in an operon associated with acid resistance b1578 b1578 0.4580 0.0067 hypothetical protein b2651 b2651 1.4453 0.0116 hypothetical protein b3007 b3007 0.6589 0.0484 hypothetical protein b3044 b3044 0.4584 0.0042 IS21 protein basS b4112 1.3828 0.0283 BasS-Phis bcp b2480 0.5107 0.0453 thiol peroxidase bcsC b3530 0.7130 0.0351 oxidase involved in cellulose synthesis betI b0313 0.5288 0.0174 BetI-choline bglF b3722 1.3763 0.0041 EIIBgl bglH b3720 1.9505 0.0053 putative receptor protein caiE b0035 1.6717 0.0488 caiE protein carB b0033 0.4703 0.0049 carbamoyl phosphate synthetase ccmB b2200 0.8787 0.0430 CcmABCDEFGH cytochrome c biogenesis system cdd b2143 1.7025 0.0128 cytidine deaminase cheR b1884 1.5095 0.0383 chemotaxis protein methyltransferase cheW b1887 1.5265 0.0097 MCP-II cheY b1882 1.5736 0.0050 CheY-Pasp chiA b3338 1.7647 0.0006 Endochitinase citC b0618 1.5867 0.0360 citrate lyase ligase clcA b0155 0.5353 0.0200 EriC chloride ion ClC channel clpB b2592 3.6839 0.0280 ClpB chaperone 110

APPENDIX I

cmr b0842 0.3146 0.0056 MdfA/Cmr MFS multidrug transporter coaE b0103 0.4061 0.0235 dephospho-CoA kinase cobS b1992 0.7606 0.0094 cobalamin 5'-phosphate synthase / cobalamin synthase codA b0337 0.2755 0.0046 cytosine deaminase codB b0336 0.1651 0.0003 CodB cytosine NCS1 transporter corA b3816 0.2820 0.0025 CorA magnesium ion MIT transporter cpdA b3032 0.5229 0.0466 cAMP phosphodiesterase creB b4398 0.3404 0.0081 CreB- Phosphorylated transcriptional regulator crl b0240 0.3345 0.0017 Crl transcriptional regulator crr b2417 1.2769 0.0161 EIIBCMalX csgF b1038 0.5393 0.0369 curli assembly component cspB b1557 0.2269 0.0473 cold shock protein CspB cspF b1558 0.2144 0.0418 cold shock protein CspF cspG b0990 0.0764 0.0004 cold shock protein CspG cstA b0598 0.5763 0.0340 peptide transporter induced by carbon starvation cusC b0572 1.5999 0.0057 outer membrane factor of the CusCFBA copper efflux system cybB b1418 0.4129 0.0035 cytochrome b561 cynR b0338 1.4489 0.0241 CynR-Cyanate transcriptional activator cysA b2422 1.4211 0.0004 sulfate ABC transporter uroporphyrinogen methyltransferase / 1,3-dimethyluroporphyrinogen III cysG b3368 1.5439 0.0416 dehydrogenase / siroheme ferrochelatase cysM b2421 0.5164 0.0458 O-acetylserine (thiol)-lyase B cysP b2425 0.6509 0.0424 thiosulfate ABC transporter cysS b0526 0.5991 0.0153 cysteinyl-tRNA synthetase cytR b3934 0.5115 0.0315 CytR-cytidine dapA b2478 0.3715 0.0309 dihydrodipicolinate synthase dapF b3809 0.5113 0.0165 diaminopimelate epimerase ddpX b1488 1.7864 0.0151 D-Ala-D-Ala dipeptidase deaD b3162 0.4180 0.0153 CsdA, DEAD-box RNA helicase inner membrane serine protease required for the extracytoplasmic stress response degS b3235 0.4224 0.0416 mediated by sigmaE deoA b4382 2.2452 0.0294 thymidine phosphorylase / uracil phosphorylase deoC b4381 2.9812 0.0289 deoxyribose-phosphate aldolase purine nucleoside phosphorylase / guanosine phosphorylase / deoxyguanosine phosphorylase / inosine phosphorylase / deoxyinosine phosphorylase / adenine deoD b4384 1.5761 0.0146 phosphorylase / deoxyadenosine phosphorylase dgkA b4042 0.7702 0.0459 diacylglycerol kinase dnaB b4052 0.1732 0.0010 chromosome replication; chain elongation; part of primosome dnaJ b0015 2.4637 0.0141 chaperone with DnaK; heat shock protein dnaK b0014 2.8269 0.0266 chaperone Hsp70; DNA biosynthesis; autoregulated heat shock proteins dpiB b0619 0.6511 0.0237 DpiB dsbC b2893 0.4949 0.0056 DsbC_oxidized dusA b4049 0.4059 0.0115 tRNA dihydrouridine synthase dusB b3260 0.8122 0.0209 tRNA dihydrouridine synthase dusC b2140 0.5406 0.0092 tRNA dihydrouridine synthase ecfB b2969 0.7627 0.0191 putative protein exporter (General Secretory Pathway) ecpD b0140 2.2895 0.0056 probable pilin chaperone similar to PapD edd b1851 1.2374 0.0468 phosphogluconate dehydratase elaC b2268 0.5434 0.0212 binuclear zinc phosphodiesterase monomer endA b2945 1.2107 0.0482 DNA-specific endonuclease I eno b2779 1.5546 0.0318 enolase entC b0593 1.4434 0.0295 isochorismate synthase, enterobactin specific entS b0591 0.4444 0.0291 YbdA MFS transporter era b2566 0.4194 0.0021 GTP-binding protein eutD b2458 1.7723 0.0307 putative phosphate acetyltransferase, ethanolamine utilization eutN b2456 1.2249 0.0189 putative detox protein, ethanolamine utilization evgA b2369 2.8597 0.0440 EvgA-Phosphorylated transcriptional regulator exbB b3006 0.4761 0.0222 ExbB protein; uptake of enterochelin; tonB-dependent uptake of B colicins exuR b3094 0.5125 0.0127 ExuR transcriptional repressor 111

APPENDIX I

fabB b2323 0.6336 0.0043 beta-ketoacyl-ACP synthase I / malonyl-ACP decarboxylase fadA b3845 1.7143 0.0296 3-ketoacyl-CoA thiolase fbaA b2925 1.6290 0.0164 fructose bisphosphate aldolase monomer fdhE b3891 0.5586 0.0161 protein that affects formate dehydrogenase-N activity fdnG b1474 1.3249 0.0138 formate dehydrogenase N, α subunit fdnI b1476 1.2886 0.0205 formate dehydrogenase N, γ subunit fdx b2525 1.7242 0.0044 oxidized ferredoxin outer membrane receptor; citrate-dependent iron transport, outer membrane fecA b4291 1.5609 0.0011 receptor fecB b4290 1.3416 0.0287 ferric dicitrate uptake system fecE b4287 1.6438 0.0310 ferric dicitrate uptake system ffh b2610 1.2699 0.0362 protein component of the signal recognition particle (SRP) FhuA outer membrane protein receptor for ferrichrome, colicin M, and phages T1, fhuA b0150 0.3657 0.0280 T5, and phi80 fhuE b1102 1.2073 0.0239 outer membrane receptor for ferric iron uptake fis b3261 0.6869 0.0371 Fis transcriptional dual regulator fixB b0042 1.4473 0.0371 probable flavoprotein subunit required for anaerobic carnitine metabolism fkpB b0028 0.6004 0.0250 peptidylprolyl isomerase fldA b0684 1.4242 0.0442 oxidized flavodoxin 1 flgA b1072 4.8974 0.0024 flagellar biosynthesis; assembly of basal-body periplasmic P ring flgB b1073 3.8020 0.0007 flagellar basal-body rod protein FlgB flgC b1074 3.0031 0.0070 flagellar basal-body rod protein FlgC flgD b1075 2.2868 0.0061 flagellar biosynthesis, initiation of hook assembly flgE b1076 2.0251 0.0033 flagellar hook protein FlgE flgF b1077 3.8985 0.0053 flagellar basal-body rod protein FlgF flgG b1078 4.7678 0.0097 flagellar basal-body rod protein FlgG flagellar L-ring protein FlgH; basal-body outer-membrane L (lipopolysaccharide flgH b1079 4.1712 0.0007 layer) ring protein flgI b1080 3.1896 0.0062 flagellar P-ring protein FlgI flgJ b1081 2.6426 0.0051 FlgJ flgM b1071 3.2776 0.0167 anti-FliA (anti-sigma) factor; also known as RflB protein flhD b1892 0.3694 0.0068 FlhD transcriptional dual regulator fliJ b1942 3.5076 0.0196 flagellar biosynthesis protein FliJ periplasmic cystine-binding protein; member of extracellular bacterial solute- fliY b1920 1.4499 0.0446 binding protein family III folA b0048 0.2448 0.0312 dihydrofolate reductase, type I methyleneTHF enzyme / methenyltetrahydrofolate cyclohydrolase / folD b0529 0.6301 0.0126 methylenetetrahydrofolate dehydrogenase-(NADP+) folE b2153 0.7792 0.0323 GTP cyclohydrolase I fre b3844 1.6941 0.0218 FMN reductase frlD b3374 1.3997 0.0269 fructoselysine 6-kinase frmA b0356 1.4216 0.0269 formaldehyde dehydrogenase, glutathione-dependent frsA b0239 0.3476 0.0375 fermentation/respiration switch protein fruA b2167 1.9402 0.0169 EIIFru fruB b2169 3.0732 0.0052 EIIFru fruK b2168 2.8047 0.0036 1-phosphofructokinase monomer frvA b3900 1.6136 0.0067 EIIABCFrv ftsL b0083 0.6861 0.0288 essential cell division protein FtsL ftsY b3464 1.3341 0.0141 SRP receptor ftsZ b0095 1.2673 0.0362 essential cell division protein FtsZ fumB b4122 1.5703 0.0144 fumarase B monomer fxsA b4140 1.7993 0.0107 inner membrane protein; overproduction inhibits F exclusion of bacteriophage T7 gabT b2662 1.3938 0.0210 4-aminobutyrate aminotransferase monomer galM b0756 0.4417 0.0141 aldose-1-epimerase galU b1236 0.9245 0.0435 UTP-glucose-1-phosphate uridylyltransferase gapA b1779 1.5277 0.0455 glyceraldehyde 3-phosphate dehydrogenase-A monomer gapC_1 b1417 0.3207 0.0054 split glyceraldehyde 3-phosphate dehydrogenase C gapC_2 b1416 0.3808 0.0072 glyceraldehyde 3-phosphate dehydrogenase C, interrupted gatA b2094 1.8580 0.0319 EIIGat gcvA b2808 0.6508 0.0371 GcvA transcriptional dual regulator 112

APPENDIX I

gcvH b2904 0.3188 0.0137 dihydrolipoyl-GcvH-protein gcvR b2479 0.2239 0.0056 GcvR-gly gcvT b2905 0.3352 0.0343 aminomethyltransferase gidA b3741 1.8465 0.0137 protein involved in a tRNA modification pathway protein with a methyltransferase fold and a possible role in chromosome gidB b3740 1.4613 0.0164 replication glgS b3049 1.4156 0.0496 glycogen biosynthesis, rpoS dependent glmS b3729 0.4371 0.0445 L-glutamine:D-fructose-6-phosphate aminotransferase N-acetylglucosamine-1-phosphate uridyltransferase / glucosamine-1-phosphate glmU b3730 0.2036 0.0015 acetyltransferase glnD b0167 1.5034 0.0024 uridylyltransferase / uridylyl-removing enzyme glnH b0811 3.3975 0.0027 glutamine ABC transporter glnL b3869 0.6764 0.0331 NtrB glnP b0810 2.5879 0.0108 glutamine ABC transporter glnQ b0809 2.8329 0.0290 glutamine ABC transporter glpD b3426 0.5911 0.0107 glycerol 3-phosphate dehydrogenase, aerobic glpG b3424 0.4628 0.0143 inner membrane-associated protein of glp regulon gltJ b0654 1.6394 0.0293 glutamate ABC transporter gltS b3653 0.4306 0.0171 glutamate GltS transporter glvB b3682 0.6799 0.0498 subunit of EIIBCGlv glyA b2551 0.4848 0.0252 glycine hydroxymethyltransferase gnd b2029 1.3868 0.0122 6-phosphogluconate dehydrogenase (decarboxylating) gntR b3438 1.6774 0.0056 GntR-gluconate predicted membrane-bound protein that is involved in high-affinity gluconate gntY b3414 2.1327 0.0397 transport gph b3385 2.2255 0.0008 phosphoglycolate phosphatase xanthine phosphoribosyltransferase / guanine phosphoribosyltransferase / gpt b0238 0.2560 0.0022 hypoxanthine phosphoribosyltransferase groL b4143 4.0315 0.0048 GroEL, chaperone Hsp60, peptide-dependent ATPase, heat shock protein grpE b2614 2.5774 0.0005 phage lambda replication; host DNA synthesis; heat shock protein; protein repair gshB b2947 0.5455 0.0014 glutathione synthetase subunit gspL b3333 1.6779 0.0357 putative protein secretion protein for export gssA b2988 1.2719 0.0207 glutathionylspermidine synthetase / glutathionylspermidine amidase guaB b2508 0.4094 0.0161 IMP dehydrogenase gutQ b2708 0.8036 0.0386 protein with a sugar isomerase domain gyrA b2231 2.0736 0.0147 DNA gyrase, subunit A gyrB b3699 2.3694 0.0125 DNA gyrase, subunit B hdeA b3510 1.5879 0.0430 acid-resistance protein, possible chaperone hdeB b3509 1.4411 0.0245 10K-L protein, related to acid resistance protein of Shigella flexneri hemC b3805 0.2280 0.0041 hydroxymethylbilane synthase hemD b3804 0.3594 0.0026 uroporphyrinogen III synthase hemN b3867 0.5050 0.0222 coproporphyrinogen III oxidase, anaerobic hisC b2021 0.4224 0.0011 histidine-phosphate aminotransferase hisD b2020 0.2929 0.0068 histidinal dehydrogenase / histidinol dehydrogenase hisS b2514 0.4605 0.0043 histidyl-tRNA synthetase holA b0640 1.5856 0.0127 DNA polymerase III, delta subunit holC b4259 0.3684 0.0138 DNA polymerase III, chi subunit holD b4372 1.2748 0.0169 DNA polymerase III, psi subunit holE b1842 0.3028 0.0133 DNA polymerase III, theta subunit hscA b2526 1.3123 0.0271 chaperone, member of Hsp70 protein family hslO b3401 2.2344 0.0459 molecular chaperone Hsp33 hslR b3400 2.1711 0.0238 heat shock protein Hsp15 hslU b3931 2.3896 0.0292 ATPase component of the HslVU protease htrA b0161 1.4630 0.0500 DegP htrL b3618 6.3708 0.0079 involved in lipopolysaccharide biosynthesis hupA b4000 1.7633 0.0170 DNA-binding protein HU-alpha (HU-2) hyaA b0972 3.0036 0.0427 hydrogenase I, HyaA subunit hycC b2723 1.5122 0.0284 HycC hypF b2712 1.3499 0.0196 hydrogenase maturation protein 113

APPENDIX I

ibpA b3687 2.4960 0.0181 small heat shock protein IbpA icdA b1136 0.4590 0.0372 Icd ilvB b3671 0.2982 0.0162 IlvB / putative 2-hydroxyglutarate synthase ilvD b3771 0.4038 0.0384 dihydroxy-acid dehydratase ilvE b3770 0.6301 0.0172 branched chain amino acid aminotransferase ilvG_1 b3767 0.1723 0.0016 IlvG_1 ilvM b3769 0.2445 0.0021 acetohydroxybutanoate synthase II / acetolactate synthase II imp b0054 0.4662 0.0012 organic solvent tolerance inaA b2237 0.3959 0.0046 pH-inducible protein involved in stress response intR b1345 0.2726 0.0058 putative transposase iscA b2528 1.4419 0.0027 iron-sulfur cluster assembly protein iscR b2531 1.4496 0.0114 IscR transcriptional regulator iscS b2530 1.4231 0.0277 cysteine desulfurase monomer iscX b2524 1.5162 0.0325 protein with possible role in iron-sulfur cluster biogenesis ispA b0421 0.1884 0.0089 geranyl diphosphate synthase / farnesyl diphosphate synthase ispB b3187 0.5571 0.0115 octaprenyl diphosphate synthase ispD b2747 0.5815 0.0136 4-diphosphocytidyl-2C-methyl-D-erythritol synthetase monomer ispG b2515 0.3474 0.0431 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate synthase kdgT b3909 0.3451 0.0140 KdgT 2-keto-3-deoxygluconate transporter kdpA b0698 1.6937 0.0216 potassium ion P-type ATPase transporter kdpB b0697 0.8031 0.0119 potassium ion P-type ATPase transporter kdpD b0695 1.5142 0.0271 KdpD-Phis kdsC b3198 0.4227 0.0092 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase monomer kdtA b3633 0.4096 0.0361 KDO transferase lamB b4036 2.1449 0.0483 phage lambda receptor protein; maltose high-affinity receptor ldcA b1192 0.6533 0.0323 L,D-carboxypeptidase A lepA b2569 0.3884 0.0089 GTP-binding elongation factor, may be inner membrane protein leuA b0074 0.5502 0.0232 2-isopropylmalate synthase leuD b0071 0.8324 0.0343 isopropylmalate isomerase leuO b0076 0.4671 0.0383 LeuO transcriptional activator ligT b0147 0.3612 0.0043 hypothetical protein lipB b0630 1.8242 0.0342 lipoyl-protein ligase lolB b1209 0.4537 0.0046 outer membrane lipoprotein, localization of lipoproteins in the outer membrane lolC b1116 0.4315 0.0356 LolCDE ABC lipoprotein transporter lolD b1117 0.6023 0.0038 LolCDE ABC lipoprotein transporter lolE b1118 0.4199 0.0393 LolCDE ABC lipoprotein transporter lon b0439 2.0180 0.0071 DNA-binding, ATP-dependent protease La lpcA b0222 0.3721 0.0282 lipopolysaccharide core biosynthesis; phosphoheptose isomerase lpxK b0915 1.3126 0.0035 tetraacyldisaccharide 4'-kinase lrhA b2289 0.7251 0.0129 LrhA transcriptional repressor lspA b0027 0.5579 0.0203 prolipoprotein signal peptidase (SPase II) maa b0459 0.6307 0.0483 maltose acetyltransferase macB b0879 1.5831 0.0121 MacAB macrolide efflux transporter complex manA b1613 0.5844 0.0131 mannose-6-phosphate isomerase mdtK b1663 0.4735 0.0183 NorE multidrug efflux MATE transporter putative 2-hydroxyglutarate synthase / SHCHC synthase / 2-oxoglutarate menD b2264 0.4174 0.0067 decarboxylase menF b2265 0.2973 0.0031 isochorismate synthase, menaquinone-specific mepA b2328 1.3493 0.0164 murein DD-endopeptidase, penicillin-insensitive metB b3939 0.4626 0.0078 O-succinylhomoserine lyase / O-succinylhomoserine(thiol)-lyase metL b3940 1.7369 0.0443 aspartate kinase II / homoserine dehydrogenase II mfd b1114 0.8365 0.0468 transcription-repair coupling factor; mutation frequency decline mhpD b0350 1.8046 0.0472 2-keto-4-pentenoate hydratase mhpE b0352 1.4561 0.0483 4-hydroxy-2-ketovalerate aldolase miaA b4171 0.7647 0.0368 delta(2)-isopentenylpyrophosphate tRNA-adenosine transferase cell division inhibitor of the MinC-MinD-MinE and DicB-MinC systems that minC b1176 0.2576 0.0099 regulate septum placement membrane ATPase of the MinC-MinD-MinE system that regulates septum minD b1175 0.3669 0.0070 placement 114

APPENDIX I

cell division topological specificity factor and inhibitory component of the MinC- minE b1174 0.3218 0.0180 MinD-MinE system that regulates septum placement mioC b3742 2.8032 0.0061 flavoprotein involved in biotin synthesis mltC b2963 0.3174 0.0208 membrane-bound lytic murein transglycosylase C mngB b0732 1.4808 0.0136 alpha-mannosidase moaA b0781 0.3113 0.0250 molybdopterin biosynthesis, protein A modE b0761 0.5883 0.0400 Molybdate-responsive transcription factor monomer mokC b0018 1.6023 0.0201 regulatory peptide whose translation enables hokC (gef) expression mraW b0082 0.6100 0.0309 S-adenosyl-dependent methyltransferase mrdB b0634 0.6931 0.0113 rod shape-determining membrane protein; sensitivity to radiation and drugs mreB b3251 0.4151 0.0130 rod shape-determining protein mreC b3250 0.5547 0.0187 rod shape-determining protein mreD b3249 0.4030 0.0041 rod shape-determining protein msbB b1855 0.2631 0.0138 myristoyl acyltransferase mukE b0923 0.2778 0.0005 protein involved in chromosome partitioning mukF b0922 0.2472 0.0062 Ca2+-binding protein involved in chromosome partitioning mutY b2961 0.2826 0.0046 adenine glycosylase; G.C --> T.A transversions nadA b0750 1.2867 0.0026 quinolinate synthetase A nagZ b1107 0.3709 0.0144 β-N-acetylglucosaminidase nanR b3226 0.6046 0.0191 NanR transcriptional regulator narG b1224 1.4419 0.0422 nitrate reductase A, α subunit narP b2193 0.4244 0.0046 NarP-Phosphorylated transcriptional regulator ndh b1109 0.2794 0.0021 NADH cupric reductase / NADH dehydrogenase II nucleoside diphosphate kinase / UDP kinase / CDP kinase / dUDP kinase / dCDP ndk b2518 0.5490 0.0297 kinase / dTDP kinase / dADP kinase / dGDP kinase / GDP kinase nhaA b0019 2.7531 0.0189 sodium/proton NhaA transporter nhaR b0020 1.8006 0.0051 NhaR-Na+ transcriptional activator nirD b3366 1.2750 0.0385 nitrite reductase, small subunit nlpB b2477 0.3204 0.0188 lipoprotein-34 nlpC b1708 0.8276 0.0132 NlpC-putative lipoprotein hydrolase nlpD b2742 0.4725 0.0091 NlpD putative outer membrane lipoprotein phosphocarrier protein HPr-like NPr, nitrogen related, exchanges phosphate with npr b3206 1.1115 0.0239 Enzyme I, Hpr nth b1633 2.1070 0.0198 endonuclease III; specific for apurinic and/or apyrimidinic sites nudF b3034 0.4112 0.0010 hypothetical protein nudG b1759 0.6794 0.0394 CTP pyrophosphohydrolase nudH b2830 0.4781 0.0025 putative invasion protein nuoA b2288 1.6603 0.0436 NADH dehydrogenase I nuoB b2287 2.1552 0.0017 NADH dehydrogenase I nuoC b2286 1.5429 0.0056 NADH dehydrogenase I nuoE b2285 1.4073 0.0195 NADH dehydrogenase I nuoF b2284 1.6783 0.0075 NADH dehydrogenase I nusB b0416 0.5649 0.0227 transcription termination; L factor nusG b3982 0.1716 0.0023 component in transcription antitermination ogrK b2082 1.8738 0.0121 OgrK transcriptional regulator ompX b0814 1.3900 0.0297 outer membrane protein X osmB b1283 1.9992 0.0416 OsmB osmotically inducible lipoprotein oxyR b3961 3.1506 0.0058 OxyR transcriptional dual regulator paaJ b1397 1.4298 0.0499 putative beta-keto-thiolase of phenylacetate degradation para-aminobenzoate synthase multi-enzyme complex / para-aminobenzoate pabA b3360 1.4655 0.0359 synthase para-aminobenzoate synthase multi-enzyme complex / para-aminobenzoate pabC b1096 0.3015 0.0413 synthase pagP b0622 2.7254 0.0221 PagP monomer panB b0134 0.5034 0.0001 3-methyl-2-oxobutanoate hydroxymethyltransferase monomer panF b3258 0.6070 0.0178 PanF sodium/pantothenate SSS transporter parC b3019 0.3991 0.0037 Topoisomerase IV subunit A pcnB b0143 0.5626 0.0040 poly(A) polymerase I pdxH b1638 0.5820 0.0297 pyridoxine 5'-phosphate oxidase / pyridoxamine 5'-phosphate oxidase pepB b2523 1.8383 0.0128 aminopeptidase (AP) 115

APPENDIX I

pepP b2908 1.2182 0.0368 proline aminopeptidase P II pepQ b3847 2.4602 0.0335 proline dipeptidase pfkB b1723 1.4328 0.0085 6-phosphofructokinase-2 monomer pflA b0902 2.1225 0.0090 pyruvate formate-lyase activating enzyme pgaC b1022 1.4003 0.0250 predicted N-glycosyltransferase pgi b4025 0.7116 0.0462 phosphoglucose isomerase pgpA b0418 0.5727 0.0094 phosphatidylglycerophosphatase A pheP b0576 0.4252 0.0250 PheP phenylalanine APC transporter phoE b0241 1.3013 0.0094 PhoE PhoB-dependent, ATP-binding pho regulon component; may be helicase; induced phoH b1020 1.4888 0.0191 by P starvation phoP b1130 0.4417 0.0115 PhoP-Phosphorylated transcriptional dual regulator phoQ b1129 0.6685 0.0013 PhoQ-Phis pitB b2987 1.3798 0.0445 PitB plsC b3018 0.3763 0.0024 1-acylglycerol-3-phosphate acyltransferase protease involved in Microcin B17 maturation and in sensitivity to the DNA pmbA b4235 0.5564 0.0213 gyrase inhibitor LetD pmrD b2259 0.4652 0.0050 polymyxin resistance protein pncB b0931 0.2923 0.0110 nicotinate phosphoribosyltransferase pnp b3164 0.2968 0.0110 polynucleotide phosphorylase polB b0060 4.3621 0.0499 DNA polymerase II potB b1125 0.5130 0.0375 putrescine/spermidine ABC transporter potC b1124 0.5813 0.0046 putrescine/spermidine ABC transporter poxA b4155 0.5427 0.0338 putative regulator of pyruvate oxidase ppiD b0441 0.6513 0.0198 peptidyl-prolyl cis-trans isomerase ppk b2501 0.3301 0.0114 polyphosphate kinase ppsA b1702 0.7593 0.0328 phosphoenolpyruvate synthase priC b0467 0.5875 0.0232 primosomal replication protein N'' prmC b1212 0.7663 0.0275 protein-(glutamine-N5) methyltransferase proP b4111 0.4204 0.0214 ProP proline/betaine MFS transporter proQ b1831 0.5181 0.0394 protein that affects osmoregulation of ProP transporter proV b2677 0.3005 0.0108 proline ABC transporter proW b2678 0.3934 0.0291 proline ABC transporter psd b4160 0.5710 0.0213 phosphatidylserine decarboxylase, proenzyme stimulates PspC-mediated transcriptional activation of the psp operon; antitoxin of pspB b1305 1.6459 0.0420 a PspC-PspB toxin-antitoxin pair pssA b2585 0.1873 0.0040 phosphatidylserine synthase purA b4177 0.5024 0.0178 adenylosuccinate synthase 5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole lyase / purB b1131 0.6679 0.0119 adenylosuccinate lyase purC b2476 0.1510 0.0007 phosphoribosylaminoimidazole-succinocarboxamide synthase purE b0523 0.3132 0.0136 N5-carboxyaminoimidazole ribonucleotide mutase purF b2312 0.2208 0.0011 amidophosphoribosyl transferase purK b0522 0.2617 0.0039 N5-carboxyaminoimidazole ribonucleotide synthase monomer purM b2499 0.0976 0.0007 phosphoribosylformylglycinamide cyclo-ligase purN b2500 0.3565 0.0063 phosphoribosylglycinamide formyltransferase purR b1658 0.1999 0.0032 PurR transcriptional repressor purT b1849 0.5923 0.0436 GAR transformylase 2 purU b1232 0.4050 0.0031 formyltetrahydrofolate deformylase puuD b1298 0.6547 0.0166 probable amidotransferase subunit pyrB b4245 0.4134 0.0108 aspartate carbamoyltransferase, PyrB subunit pyrC b1062 0.6009 0.0278 dihydroorotase pyrD b0945 0.3694 0.0012 dihydroorotate oxidase radA b4389 0.5088 0.0089 DNA recombination protein rbfA b3167 0.7704 0.0239 ribosome-binding factor A rbsB b3751 2.1321 0.0323 ribose ABC transporter rcsB b2217 0.5589 0.0202 RcsB transcriptional activator rcsC b2218 0.6588 0.0017 RcsC-Phis rdgC b0393 0.4658 0.0035 nonspecific DNA binding protein; nucleoid component 116

APPENDIX I

DNA strand exchange and renaturation, DNA-dependent ATPase, DNA- and recA b2699 6.1477 0.0006 ATP-dependent coprotease recF b3700 1.5026 0.0018 ssDNA and dsDNA binding, ATP binding recN b2616 5.2322 0.0003 protein used in recombination and DNA repair recX b2698 3.3785 0.0128 inhibitor of RecA relA b2784 0.6144 0.0009 GDP pyrophosphokinase / GTP pyrophosphokinase rfaE b3052 1.6731 0.0393 putative kinase rfaH b3842 0.6886 0.0257 RfaH transcriptional regulator rfaI b3627 3.7837 0.0015 UDP-D-galactose:(glucosyl)lipopolysaccharide-alpha-1,3-D-galactosyltransferase rfaJ b3626 3.0420 0.0174 UDP-D-glucose:(galactosyl)lipopolysaccharide glucosyltransferase rfaK b3623 3.1584 0.0170 lipopolysaccharide core biosynthesis; probably hexose transferase rfaS b3629 2.8794 0.0068 lipopolysaccharide core biosynthesis rfaZ b3624 3.4532 0.0385 protein involved in KdoIII attachment during lipopolysaccharide core biosynthesis rfbB b2041 0.7441 0.0376 RmlB rhlB b3780 0.5316 0.0049 ATP-dependent RNA helicase of the RNA degradosome rhlE b0797 0.2790 0.0010 DEAD-box-containing ATP-dependent RNA helicase family member rhsD b0497 0.5670 0.0166 RhsD protein in rhs element ribB b3041 0.4644 0.0229 3,4-dihydroxy-2-butanone 4-phosphate synthase ribC b1662 0.6318 0.0401 riboflavin synthase ribF b0025 0.1259 0.0103 riboflavin kinase / FMN adenylyltransferase rihA b0651 1.8484 0.0409 ribonucleoside hydrolase 1 (pyrimidine-specific) acetylates N-terminal alanine of 30S ribosomal subunit protein S5 / ribosomal- rimJ b1066 0.4103 0.0066 protein-alanine N-acetyltransferase rluC b1086 0.3153 0.0041 23S rRNA pseudouridine synthase rluD b2594 0.7043 0.0136 23S rRNA pseudouridine synthase rluE b1135 1.6545 0.0240 23S rRNA pseudouridine synthase rnc b2567 0.2112 0.0002 RNase III, ds RNA rng b3247 0.7647 0.0261 ribonuclease G (RNAse G) monomer rnhA b0214 0.3725 0.0125 RNase HI, degrades RNA of DNA-RNA hybrids, participates in DNA replication rnr b4179 0.5088 0.0147 RNAse R rplY b2185 1.4198 0.0156 50S ribosomal subunit protein L25 rpmE b3936 1.9883 0.0287 50S ribosomal subunit protein L31 rpoA b3295 1.7187 0.0281 RNA polymerase, alpha subunit rpoH b3461 1.5408 0.0047 sigma32 factor rpsJ b3321 1.7179 0.0451 30S ribosomal subunit protein S10 rpsL b3342 1.3159 0.0319 30S ribosomal subunit protein S12 rpsU b3065 2.0799 0.0248 30S ribosomal subunit protein S21 rspA b1581 2.2521 0.0444 starvation sensing protein RspA rspB b1580 1.2583 0.0486 putative dehydrogenase RspB rssA b1234 0.2763 0.0088 hypothetical protein rsuA b2183 0.3324 0.0011 16S rRNA pseudouridine synthase rsxE b1632 1.6861 0.0192 integral membrane protein of SoxR-reducing complex sdaC b2796 0.5269 0.0174 SdaC serine STP transporter sdhA b0723 1.8472 0.0183 succinate dehydrogenase flavoprotein sdhB b0724 2.4021 0.0348 succinate dehydrogenase iron-sulfur protein secE b3981 0.1598 0.0033 Sec Protein Secretion Complex secF b0409 0.8540 0.0394 Sec Protein Secretion Complex secG b3175 0.3039 0.0132 Sec Protein Secretion Complex selA b3591 0.7449 0.0144 selenocysteine synthase monomer sgbH b3581 1.2423 0.0155 3-keto-L-gulonate 6-phosphate decarboxylase sieB b1353 0.8425 0.0185 phage superinfection exclusion protein slt b4392 0.6966 0.0171 soluble lytic murein transglycosylase slyA b1642 0.4284 0.0138 SlyA transcriptional activator slyB b1641 0.4100 0.0358 putative outer membrane protein slyD b3349 1.3580 0.0393 FKBP-type rotamase, peptidyl prolyl cis-trans isomerase smf b4473 0.6389 0.0144 hypothetical protein smg b3284 0.3104 0.0016 hypothetical protein smpA b2617 3.0746 0.0330 SmpA small membrane protein A smtA b0921 0.1732 0.0009 S-adenosylmethionine-dependent methyltransferase 117

APPENDIX I

speG b1584 0.4151 0.0001 spermidine acetyltransferase spr b2175 0.1856 0.0008 putative lipoprotein spy b1743 1.8051 0.0064 periplasmic protein related to spheroblast formation srmB b2576 0.1828 0.0018 SrmB, DEAD-box RNA helicase sscR b2765 0.2846 0.0014 putative 6-pyruvoyl tetrahydrobiopterin synthase sspA b3229 1.7853 0.0360 regulator of transcription; stringent starvation protein A sspB b3228 1.6995 0.0121 SspB monomer sthA b3962 1.9483 0.0152 soluble pyridine nucleotide transhydrogenase sucA b0726 1.7723 0.0282 subunit of E1(0) component of 2-oxoglutarate dehydrogenase suhB b2533 0.6030 0.0333 inositol monophosphatase sulA b0958 0.4776 0.0294 suppressor of lon; inhibits cell division and ftsZ ring formation syd b2793 0.7172 0.0401 interacts with secY tdcD b3115 1.3690 0.0028 propionate kinase / acetate kinase C tdcE b3114 1.8820 0.0225 2-ketobutyrate formate-lyase / pyruvate formate-lyase 4 tdh b3616 1.6683 0.0198 threonine dehydrogenase tesA b0494 0.4861 0.0342 lysophospholipase L₁ / thioesterase I thiI b0423 0.3635 0.0002 ThiI protein thyA b2827 1.6662 0.0186 thymidylate synthase tpiA b3919 1.1555 0.0049 triose phosphate isomerase monomer tra5-5 b2089 0.5946 0.0481 treB b4240 1.9360 0.0274 EIITre treC b4239 1.8400 0.0022 trehalose-6-phosphate hydrolase trkA b3290 1.6751 0.0358 TrkA trkG b1363 1.7115 0.0118 TrkG potassium ion Trk Transporter trmD b2607 1.4999 0.0322 tRNA (guanine-1-)-methyltransferase trpB b1261 0.8425 0.0438 tryptophan synthase, beta subunit trpD b1263 0.5060 0.0140 anthranilate synthase component II trpE b1264 0.4037 0.0115 anthranilate synthase component I trpL b1265 0.7864 0.0299 trp operon leader peptide trpR b4393 1.7569 0.0049 TrpR transcriptional repressor trpS b3384 2.1106 0.0124 tryptophanyl-tRNA synthetase tsgA b3364 0.6442 0.0017 YhfC MFS transporter tsr b4355 0.6068 0.0399 MCP-I tsx b0411 0.1946 0.0016 nucleoside channel; receptor of phage T6 and colicin K ttk b3641 0.4174 0.0019 Ttk transcriptional regulator ubiC b4039 0.2098 0.0001 chorismate pyruvate lyase ubiF b0662 1.5458 0.0334 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinone hydroxylase 3-demethylubiquinone 3-methyltransferase / 2-octaprenyl-6-hydroxyphenol ubiG b2232 0.7780 0.0016 methylase uhpB b3668 0.5983 0.0403 UhpB-Phis uidA b1617 1.2711 0.0362 beta-glucuronidase ulaE b4197 0.7571 0.0368 L-xylulose 5-phosphate 3-epimerase ulaF b4198 0.7998 0.0198 L-ribulose 5-phosphate 4-epimerase ung b2580 0.6029 0.0221 uracil-DNA-glycosylase upp b2498 0.4553 0.0208 uracil phosphoribosyltransferase uvrB b0779 1.9034 0.0153 DNA repair; excision nuclease subunit B vacJ b2346 0.6153 0.0168 putative lipoprotein visC b2906 1.7240 0.0071 hypothetical protein waaP b3630 1.9894 0.0370 lipopolysaccharide core biosynthesis; phosphorylation of core heptose wbbI b2034 1.6114 0.0023 hypothetical protein; not required for colanic acid biosynthesis wbbK b2032 1.3531 0.0045 putative transferase wcaA b2059 1.5321 0.0226 putative regulator wcaB b2058 1.4575 0.0374 putative transferase wcaD b2056 1.6890 0.0022 putative colanic acid polymerase wcaJ b2047 1.6790 0.0013 putative colanic acid biosynthsis UDP-glucose lipid carrier transferase Wza Outer Membrane Auxiliary (OMA) Protein, putative polysaccharide export wza b2062 1.3425 0.0424 protein xapR b2405 0.7902 0.0250 XapR transcriptional activator xerD b2894 0.4150 0.0016 site-specific recombinase 118

APPENDIX I

xseB b0422 0.1805 0.0061 exonuclease VII, small subunit xylR b3569 0.5246 0.0295 XylR-Xylose transcriptional activator yabP b0056 0.4221 0.0292 conserved hypothetical protein conserved protein; in enteroaggregative E. coli, YafK is required for development yafK b0224 0.1376 0.0369 of biofilms yagA b0267 1.6600 0.0302 hypothetical protein yagI b0272 0.3762 0.0042 putative regulator yagT b0286 1.5660 0.0376 putative oxidoreductase, Fe-S subunit yagU b0287 1.2317 0.0268 conserved protein ybaJ b0461 0.2544 0.0048 conserved hypothetical protein ybaN b0468 0.3530 0.0019 hypothetical protein ybaO b0447 1.2709 0.0229 putative LRP-like transcriptional regulator ybaV b0442 0.5407 0.0434 conserved hypothetical protein ybbO b0493 0.6285 0.0137 putative oxidoreductase ybcJ b0528 0.5730 0.0490 putative RNA-binding protein ybcK b0544 1.1512 0.0052 hypothetical protein ybeA b0636 0.4138 0.0056 conserved hypothetical protein ybeB b0637 0.4743 0.0070 conserved hypothetical protein ybeD b0631 2.5488 0.0424 conserved hypothetical protein ybeY b0659 3.2204 0.0213 conserved hypothetical protein ybeZ b0660 3.8440 0.0151 putative ATP-binding protein ybfF b0686 0.4315 0.0108 putative enzyme ybhK b0780 0.2522 0.0010 putative structural protein ybhO b0789 1.6209 0.0479 cardiolipin synthase 2 ybiR b0818 0.5665 0.0479 YbiR ybjC b0850 0.5750 0.0491 conserved hypothetical protein; gene is within soxRS regulon ycaL b0909 0.5299 0.0354 putative heat shock protein ycbG b0956 0.5827 0.0116 putative dehydrogenase ycbK b0926 0.4469 0.0152 conserved hypothetical protein ycbQ b0938 1.9263 0.0170 putative fimbrial-like protein ycbR b0939 1.8020 0.0084 putative chaperone putative carrier/transport protein; substrate or modulator of FtsH-mediated yccA b0970 0.4983 0.0427 proteolysis yccF b0961 0.5456 0.0466 conserved hypothetical protein yccJ b1003 1.1693 0.0345 hypothetical protein ycdF b1005 0.5798 0.0023 hypothetical protein ycdZ b1036 0.8246 0.0257 putative transport protein yceB b1063 1.4666 0.0413 conserved hypothetical protein yceG b1097 0.2704 0.0009 putative thymidylate kinase (EC 2.7.4.9) yceH b1067 0.4580 0.0122 conserved hypothetical protein yceO b1058 0.6506 0.0348 hypothetical protein ycfJ b1110 0.4082 0.0338 hypothetical protein ycfP b1108 0.4708 0.0147 putative hydrolase ycfR b1112 0.3787 0.0147 conserved hypothetical protein ycfT b1115 1.5947 0.0302 putative transport protein ycgH_2 b1170 1.9107 0.0317 conserved protein; member of the Autotransporter family ycgL b1179 0.3430 0.0036 conserved hypothetical protein ycgM b1180 0.4324 0.0364 putative isomerase ycgN b1181 0.2587 0.0108 conserved hypothetical protein ycgR b1194 1.3756 0.0420 protein involved in flagellar function ycgZ b1164 0.4255 0.0168 hypothetical protein ychF b1203 1.6270 0.0442 putative GTP-binding protein ychJ b1233 0.3905 0.0170 conserved hypothetical protein ychQ b1213 0.6472 0.0161 hypothetical protein yciS b1279 0.4349 0.0229 conserved hypothetical protein ycjD b1289 1.2011 0.0454 conserved hypothetical protein ycjG b1325 0.4835 0.0125 L-Ala-D/L-Glu epimerase, a muconate lactonizing enzyme ycjR b1314 1.8315 0.0473 putative epimerase/isomerase ycjT b1316 1.1203 0.0476 putative enzyme 119

APPENDIX I

ycjX b1321 4.0841 0.0141 putative EC 2.1 enzyme ydaO b1344 0.2434 0.0148 conserved protein ydbA_1 b1401 0.7691 0.0006 hypothetical protein product of fragment 1 of a split CDS ydbA_2 b1405 0.7077 0.0491 hypothetical protein product of fragment 2 of a split CDS ydcT b1441 0.4358 0.0233 YdcS/YdcT/YdcV/YdcU ABC transporter ydcX b1445 2.3184 0.0377 hypothetical protein yddE b1464 0.7336 0.0245 conserved protein ydeA b1528 0.2041 0.0058 YdeA MFS transporter ydeJ b1537 1.4392 0.0057 conserved protein ydeK b1510 0.4875 0.0351 YdeK ydfN b1547 1.3671 0.0077 hypothetical protein ydfT b1559 1.3152 0.0336 hypothetical protein ydfX b1568 1.3846 0.0254 hypothetical protein ydgH b1604 0.4280 0.0237 conserved hypothetical protein ydgT b1625 0.1702 0.0097 conserved hypothetical protein ydhA b1639 0.6550 0.0304 conserved hypothetical protein ydhH b1640 0.4726 0.0304 conserved hypothetical protein ydhI b1643 0.3978 0.0137 hypothetical protein ydiA b1703 0.3178 0.0056 conserved protein ydiO b1695 1.6655 0.0206 putative acyl-CoA dehydrogenase ydiR b1698 1.8979 0.0320 putative subunit of YdiQ-YdiR flavoprotein ydjG b1771 1.3397 0.0169 putative oxidoreductase yeaD b1780 1.7584 0.0268 conserved hypothetical protein yeaE b1781 0.4205 0.0018 putative oxidoreductase, NAD(P)-linked yeaZ b1807 0.4660 0.0019 hypothetical protein yebC b1864 1.6986 0.0245 conserved protein yebF b1847 2.0516 0.0108 conserved hypothetical protein yebG b1848 2.3442 0.0088 hypothetical protein; gene is part of SOS regulon yebK b1853 0.5355 0.0044 hypothetical protein yebN b1821 0.4945 0.0468 putative membrane protein, terpenoid synthase-like yebR b1832 0.2435 0.0027 conserved hypothetical protein yebY b1839 0.4488 0.0070 conserved hypothetical protein yebZ b1840 0.5229 0.0048 putative resistance protein yecD b1867 0.4582 0.0236 putative enzyme yecN b1869 0.1959 0.0051 putative membrane protein yecO b1870 0.2973 0.0060 putative methyltransferase yecP b1871 0.4271 0.0274 putative enzyme yedF b1930 1.6425 0.0395 conserved hypothetical protein; might bind RNA yedI b1958 0.5069 0.0041 hypothetical protein yedK b1931 1.5169 0.0377 conserved hypothetical protein yedR b1963 0.5416 0.0326 hypothetical protein yedS_2 b1965 1.4927 0.0201 putative outer membrane protein yeeE b2013 0.2863 0.0317 putative transport system permease protein yeeN b1983 9.6166 0.0005 conserved protein yeeP b1999 0.6937 0.0431 putative histone yeeT b2003 1.9457 0.0049 hypothetical protein yeeZ b2016 0.8883 0.0272 putative enzyme of sugar metabolism yegD b2069 0.2637 0.0019 actin family protein yegR b2085 1.5686 0.0058 hypothetical protein yegW b2101 0.6534 0.0191 putative transcriptional regulator yegX b2102 0.4954 0.0096 putative hydrolase yegZ b2083 1.3932 0.0173 hypothetical protein yehM b2120 1.2804 0.0220 conserved hypothetical protein yeiG b2154 1.0945 0.0217 putative esterase (EC 3.1.1.-). yeiR b2173 0.5560 0.0087 putative enzyme yeiU b2174 0.2626 0.0007 putative permease yfaD b2244 1.4122 0.0462 hypothetical protein yfaH b2238 1.2445 0.0457 hypothetical protein 120

APPENDIX I

yfaV b2246 1.1332 0.0162 YfaV yfbP b2275 1.5584 0.0337 hypothetical protein yfcE b2300 1.5089 0.0198 putative metallo-dependent phosphatase yfcF b2301 1.2969 0.0213 putative glutathione S-transferase yfdK b2354 1.7437 0.0090 hypothetical protein yfdS b2362 1.4456 0.0350 hypothetical protein yfeA b2395 0.4562 0.0281 putative membrane protein yfeR b2409 0.9066 0.0367 putative transcriptional regulator LYSR-type yfgA b2516 0.3313 0.0004 putative membrane protein yfgB b2517 0.5090 0.0150 putative pyruvate formate lyase activating enzyme 2 yfgM b2513 0.5801 0.0186 conserved protein yfhG b2555 0.2721 0.0038 conserved protein yfhL b2562 0.2394 0.0380 putative ferredoxin yfiC b2575 0.0971 0.0043 putative enzyme yfiF b2581 0.3560 0.0086 hypothetical protein yfiH b2593 0.6179 0.0045 conserved hypothetical protein yfjG b2619 1.8649 0.0277 toxin of a putative toxin-antitoxin pair yfjH b2623 0.8041 0.0238 putative histone yfjM b2629 0.7850 0.0144 hypothetical protein ygaH b2683 0.2149 0.0002 putative transport protein ygaZ b2682 0.2232 0.0059 hypothetical protein ygcG b2778 1.3701 0.0023 putative membrane protein hypothetical protein with possible relationship to novobiocin and deoxycholate ygcL b2760 1.1770 0.0296 resistance ygdD b2807 0.3655 0.0005 conserved hypothetical protein ygdK b2811 0.5579 0.0386 conserved hypothetical protein ygeA b2840 0.6668 0.0082 putative resistance protein ygeW b2870 1.5976 0.0306 putative carbamoyl transferase ygfS b2886 1.6634 0.0453 putative oxidoreductase, Fe-S subunit ygfZ b2898 0.4766 0.0063 conserved protein yggD b2929 0.6247 0.0483 putative transcriptional regulator yggH b2960 0.3658 0.0154 tRNA (m7G46) methyltransferase yggJ b2946 0.5829 0.0022 conserved hypothetical protein yggL b2959 0.3754 0.0018 conserved hypothetical protein yggN b2958 0.4816 0.0155 conserved hypothetical protein yggR b2950 1.3249 0.0011 putative protein transport yggT b2952 0.6371 0.0193 putative resistance protein yggU b2953 0.6630 0.0123 conserved hypothetical protein conserved hypothetical protein with role in oxidation-resistance of iron-sulfur yggX b2962 0.2253 0.0002 clusters yghQ b2983 1.1911 0.0240 putative serine protease ygiD b3039 1.3052 0.0295 putative enzyme with dioxygenase domain ygiR b3015 0.5716 0.0207 ygjD b3064 0.5170 0.0195 putative O-sialoglycoprotein endopeptidase ygjK b3080 1.6347 0.0393 putative isomerase ygjO b3084 0.2990 0.0067 hypothetical methyltransferase ygjR b3087 0.7899 0.0217 putative NAD(P)-binding dehydrogenase yhaC b3121 1.3252 0.0082 conserved protein yhaL b3107 1.5740 0.0103 hypothetical protein yhbY b3180 1.3778 0.0003 possible RNA-binding protein yhcB b3233 0.3045 0.0076 conserved hypothetical protein yhcD b3216 1.2268 0.0167 putative outer membrane protein yhcM b3232 0.5048 0.0277 hypothetical protein yhdA b3252 0.2359 0.0129 conserved protein yhdJ b3262 1.4149 0.0321 cell cycle-regulated methyltransferase yheN b3345 0.7700 0.0372 conserved hypothetical protein yheO b3346 0.6517 0.0156 hypothetical protein yhfK b3358 1.2451 0.0042 hypothetical protein yhfP b3372 1.6321 0.0166 121

APPENDIX I

yhfY b3382 1.4063 0.0453 conserved protein yhhF b3465 0.5337 0.0473 putative methyltransferase yhhQ b3471 0.5279 0.0413 hypothetical protein; gene is a predicted member of the purine regulon yhhW b3439 1.2975 0.0352 conserved hypothetical protein yhiQ b3497 1.2301 0.0328 putative methyltransferase yhjE b3523 1.3547 0.0178 YhjE MFS transporter yhjW b3546 0.4600 0.0499 putative transmembrane protein yhjY b3548 1.4042 0.0366 putative lipase yiaU b3585 1.7518 0.0059 putative transcriptional regulator LYSR-type yibJ b3595 1.6482 0.0413 hypothetical protein yibK b3606 0.6207 0.0426 hypothetical protein yicE b3654 0.1109 0.0096 YicE NCS2 tranporter yidB b3698 0.6946 0.0443 conserved hypothetical protein yieG b3714 0.1975 0.0106 putative membrane / transport protein yieH b3715 0.3625 0.0303 putative enzyme with a phophatase-like domain yieK b3718 1.6885 0.0200 putative 6-phosphogluconolactonase yifK b3795 0.5430 0.0211 YifK APC transporter yihI b3866 0.2921 0.0024 conserved protein yihL b3872 1.4923 0.0255 YihL transcriptional regulator yihO b3876 1.6352 0.0233 YihO GPH transporter yihU b3882 1.3139 0.0204 putative dehydrogenase yjaH b4001 0.7337 0.0240 conserved protein yjbE b4026 1.7450 0.0047 conserved hypothetical protein yjdA b4109 0.1906 0.0022 hypothetical protein yjeB b4178 0.2074 0.0020 conserved protein with a Winged helix domain yjeH b4141 0.5607 0.0389 YjeH APC transporter yjeK b4146 0.3898 0.0150 hypothetical protein yjgA b4234 0.4405 0.0253 putative transport protein (ABC superfamily, atp_bind) yjgP b4261 0.3739 0.0266 putative transmembrane protein possibly involved in transport yjiA b4352 1.5128 0.0062 P-loop guanosine triphosphatase yjjW b4379 1.3791 0.0400 putative activating enzyme ykfG b0247 1.6946 0.0353 putative DNA repair protein ykgE b0306 0.7957 0.0470 putative dehydrogenase subunit ykgH b0310 1.6076 0.0086 conserved protein ylaC b0458 3.0304 0.0296 putative membrane protein ylbE b0519 1.2920 0.0327 conserved protein yliI b0837 1.4805 0.0023 putative dehydrogenase ymcD b0987 1.4309 0.0262 hypothetical protein ymjA b1295 0.3256 0.0039 hypothetical protein yncD b1451 1.8939 0.0328 Probable TonB-dependent receptor yneG b1523 1.1789 0.0050 conserved hypothetical protein ynfB b1583 0.3934 0.0061 conserved hypothetical protein ynfD b1586 2.2054 0.0346 conserved hypothetical protein ynfN b1551 0.8465 0.0196 hypothetical protein ynhG b1678 1.3503 0.0343 putative ATP synthase subunit yoaB b1809 0.6240 0.0129 conserved protein yobA b1841 0.3019 0.0058 hypothetical protein yobF b1824 2.0754 0.0274 hypothetical protein ypdF b2385 1.4856 0.0415 putative peptidase ypfJ b2475 0.2824 0.0036 conserved protein ypjC b2650 1.8240 0.0458 hypothetical protein ypjE b2613 1.5857 0.0110 yqaA b2689 0.4979 0.0431 putative integral membrane protein yqaB b2690 0.4069 0.0160 putative phosphoglucomutase that contains a phophatase-like domain yqcD b2794 0.6900 0.0288 conserved hypothetical protein yqfA b2899 0.6159 0.0239 putative oxidoreductase yqfB b2900 0.4738 0.0088 conserved hypothetical protein yqiA b3031 0.5976 0.0359 putative hydrolase 122

APPENDIX I

yqiB b3033 0.4189 0.0462 putative enzyme yqiH b3047 2.4661 0.0276 putative membrane protein yqjC b3097 1.5209 0.0227 conserved protein yqjD b3098 1.5220 0.0102 conserved hypothetical protein yraI b3143 1.3222 0.0262 putative chaperone yraM b3147 0.5303 0.0388 putative glycosylase yrbH b3197 0.5469 0.0155 arabinose 5-phosphate isomerase monomer yrbL b3207 0.2776 0.0169 conserved hypothetical protein; transcription is regulated by Mg2+ yrdD b3283 0.4003 0.0038 putative DNA topoisomerase ytfK b4217 0.6795 0.0081 hypothetical protein zipA b2412 0.3991 0.0357 essential cell division protein ZipA zitB b0752 1.9751 0.0090 ZitB zinc CDF transporter znuA b1857 0.5007 0.0149 ZnuA/ZnuB/ZnuC ABC transporter znuC b1858 1.5621 0.0156 ZnuA/ZnuB/ZnuC ABC transporter

Supplementary table – VIII: LZ41 fis::cm (A) Vs LZ54 fis::cm (B)

gene blattner ratio p-value Function A/B aaeB b3240 1.2701 0.0129 hypothetical protein adk b0474 0.5852 0.0267 adenylate kinase adrA b0385 1.5751 0.0281 putative membrane protein agaB b3138 1.6067 0.0201 EIIAga agaD b3140 2.4760 0.0490 EIIAga agn43 b2000 1.9466 0.0365 outer membrane fluffing protein, sim. to adhesin allC b0516 2.6899 0.0373 allantoate amidohydrolase alpA b2624 0.5764 0.0288 AlpA transcriptional activator alr b4053 0.2726 0.0082 alanine racemase, minor alsK b4084 1.8614 0.0254 putative D-allose kinase apaH b0049 1.3196 0.0053 diadenosine tetraphosphatase appC b0978 1.8506 0.0232 cytochrome bd-II terminal oxidase subunit I aqpZ b0875 0.4831 0.0077 AqpZ - water MIP channel aroA b0908 0.6666 0.0280 3-phosphoshikimate-1-carboxyvinyltransferase aroB b3389 0.6970 0.0352 3-dehydroquinate synthase arsR b3501 2.0062 0.0043 ArsR transcriptional regulator artI b0863 2.0420 0.0102 arginine ABC transporter artP b0864 1.6630 0.0391 arginine ABC transporter ascB b2716 0.4567 0.0314 6-phospho-beta-glucosidase; cryptic ascF b2715 0.3701 0.0083 EIIAsc ascG b2714 0.2203 0.0292 AscG transcriptional regulator asd b3433 0.3109 0.0249 aspartate semialdehyde dehydrogenase astE b1744 1.9337 0.0209 succinylglutamate desuccinylase atpB b3738 0.5641 0.0218 ATP synthase, F0 complex, a subunit atpC b3731 1.8372 0.0366 ATP synthase, F1 complex, epsilon subunit atpI b3739 0.5233 0.0310 AtpI b0165 b0165 0.4909 0.0269 hypothetical protein b0255 b0255 0.3208 0.0410 hypothetical protein b1172 b1172 2.5087 0.0177 conserved hypothetical protein b1364 b1364 1.8486 0.0389 hypothetical protein b1402 b1402 0.6370 0.0207 IS22 protein b2084 b2084 2.3089 0.0387 hypothetical protein b2680 b2680 0.6069 0.0111 YgaY MFS transporter b3808 b3808 0.4513 0.0034 hypothetical protein b4283 b4283 0.3477 0.0343 IS911 protein b4339 b4339 0.4301 0.0234 hypothetical protein

123

APPENDIX I

gene blattner ratio p-value Function A/B bax b3570 0.4668 0.0105 putative ATP-binding protein bcp b2480 0.3972 0.0258 thiol peroxidase bcsG b3538 1.5125 0.0251 putative membrane protein bdm b1481 0.4571 0.0254 hypothetical protein betI b0313 0.4422 0.0145 BetI-choline bglF b3722 2.3222 0.0326 EIIBgl btuD b1709 0.4855 0.0190 vitamin B12 transport system caiC b0037 2.6932 0.0083 carnitine-CoA ligase / crotonobetaine-CoA ligase caiT b0040 1.9407 0.0255 CaiT carnitine BCCT transporter carA b0032 0.1987 0.0003 carbamoyl phosphate synthetase carB b0033 0.5195 0.0297 carbamoyl phosphate synthetase cbpM b0999 0.7011 0.0474 chaperone-modulator protein CbpM cdaR b0162 0.2974 0.0285 SdaR transcriptional regulator chaA b1216 1.8253 0.0435 ChaA calcium CaCA transporter cheW b1887 1.4429 0.0031 MCP-II cheY b1882 1.4736 0.0153 CheY-Pasp citD b0617 2.1690 0.0098 subunit of acyl carrier protein citE b0616 1.3927 0.0367 subunit of citryl-ACP lyase citF b0615 1.5300 0.0418 subunit of citrate-ACP transferase clcA b0155 0.5515 0.0298 EriC chloride ion ClC channel clpB b2592 1.6744 0.0098 ClpB chaperone clpS b0881 0.5757 0.0045 specificity factor for ClpA-ClpP chaperone-protease complex cmr b0842 0.3828 0.0352 MdfA/Cmr MFS multidrug transporter coaA b3974 0.2063 0.0077 pantothenate kinase monomer cobC b0638 2.5183 0.0233 alpha-ribazole-5'-P phosphatase cobT b1991 0.6766 0.0163 dimethylbenzimidazole phosphoribosyltransferase cpsG b2048 1.7548 0.0421 phosphomannomutase cpxR b3912 0.3442 0.0296 CpxR-Phosphorylated transcriptional dual regulator creA b4397 0.2676 0.0054 hypothetical protein creB b4398 0.1607 0.0018 CreB- Phosphorylated transcriptional regulator creC b4399 0.4234 0.0038 CreC-Phis crl b0240 0.2018 0.0046 Crl transcriptional regulator csgA b1042 1.4150 0.0203 curlin, major subunit csgC b1043 0.4527 0.0035 putative curli production protein csgD b1040 0.5255 0.0417 CsgD transcriptional activator csiE b2535 0.1601 0.0201 hypothetical protein cspA b3556 0.1189 0.0043 cold shock protein CspA cspB b1557 0.0902 0.0121 cold shock protein CspB cspF b1558 0.0878 0.0007 cold shock protein CspF cspG b0990 0.1566 0.0211 cold shock protein CspG cusR b0571 0.2240 0.0067 CusR transcriptional activator cusS b0570 0.3579 0.0313 putative 2-component sensor protein cutE b0657 2.6030 0.0037 apolipoprotein N-acyltransferase cvpA b2313 0.1480 0.0030 membrane protein required for colicin V production cyaY b3807 0.6324 0.0031 iron-binding frataxin homolog cysE b3607 0.5219 0.0143 cysteine synthase cysM b2421 0.3365 0.0109 O-acetylserine (thiol)-lyase B cytR b3934 0.2132 0.0070 CytR-cytidine dam b3387 1.5263 0.0296 DNA adenine methylase dapF b3809 0.3456 0.0309 diaminopimelate epimerase dcm b1961 0.3666 0.0421 DNA cytosine methylase dcuS b4125 0.5027 0.0194 DcuS-Phis349 degQ b3234 0.4658 0.0158 serine endoprotease inner membrane serine protease required for the extracytoplasmic stress response degS b3235 0.3105 0.0028 mediated by sigmaE deoR b0840 0.2578 0.0132 DeoR transcriptional repressor dgkA b4042 0.4758 0.0169 diacylglycerol kinase 124

APPENDIX I

gene blattner ratio p-value Function A/B dgoA 3871635-3871018 : '2-dehydro-3-deoxyphosphogalactonate aldolase / dgoD dgoA b3692 1.8315 0.0260 3871021-3869873 : galactonate dehydratase dgt b0160 0.1774 0.0119 deoxyguanosinetriphosphate triphosphohydrolase dhaK b1200 0.4352 0.0455 dihydroxyacetone kinase subunit K dhaR b1201 0.2678 0.0011 putative 2-component regulator diaA b3149 0.2334 0.0190 DiaA protein dinB b0231 1.7171 0.0272 DNA polymerase IV (Y-family DNA polymerase; translesion DNA synthesis) dmsA b0894 2.2635 0.0076 dimethyl sulfoxide reductase, chain A dnaB b4052 0.1982 0.0057 chromosome replication; chain elongation; part of primosome dnaG b3066 2.1643 0.0067 DNA biosynthesis; DNA primase dnaJ b0015 2.9351 0.0192 chaperone with DnaK; heat shock protein dsbC b2893 0.4666 0.0342 DsbC_oxidized dusB b3260 0.2969 0.0469 tRNA dihydrouridine synthase dxr b0173 1.4221 0.0086 DXP reductoisomerase dxs b0420 0.3652 0.0190 1-deoxyxylulose-5-phosphate synthase ecfB b2969 0.5313 0.0451 putative protein exporter (General Secretory Pathway) ecfI b3688 0.3510 0.0497 conserved hypothetical protein with possible extracytoplasmic function oxaloacetate decarboxylase / 2-keto-3-deoxy-6-phosphogluconate aldolase / 2- eda b1850 1.7908 0.0038 keto-4-hydroxyglutarate aldolase elaC b2268 0.6163 0.0010 binuclear zinc phosphodiesterase monomer emrE b0543 1.6186 0.0068 EmrE SMR transporter epd b2927 0.5294 0.0315 erythrose 4-phosphate dehydrogenase eutB b2441 1.2809 0.0329 ethanolamine ammonia-lyase, probable regulatory subunit eutH b2452 1.4972 0.0336 putative transport protein, ethanolamine utilization eutT b2459 1.3095 0.0136 putative cobalamine adenosyltransferase, ethanolamine utilization evgA b2369 0.3168 0.0144 EvgA-Phosphorylated transcriptional regulator exoX b1844 0.5678 0.0038 exonuclease X exuR b3094 0.3228 0.0132 ExuR transcriptional repressor enoyl-ACP reductase (NAD[P]H) / enoyl-ACP reductase (NADPH) / enoyl-ACP fabI b1288 1.6863 0.0303 reductase (NADH) fadJ b2341 0.3121 0.0367 FadJ monomer fdnI b1476 1.7767 0.0053 formate dehydrogenase N, γ subunit fhiA b0229 1.5449 0.0317 flagellar biosynthesis fhuB b0153 2.1649 0.0409 ferrichrome uptake system fhuF b4367 1.7515 0.0482 acts in reduction of ferrioxamine B iron stationary-phase protein with possible role in p-aminobenzoate or folate fic b3361 1.4568 0.0439 biosynthesis fimE b4313 1.7756 0.0279 regulator for fimA fixB b0042 2.0297 0.0368 probable flavoprotein subunit required for anaerobic carnitine metabolism flgF b1077 2.2351 0.0239 flagellar basal-body rod protein FlgF flgG b1078 1.9647 0.0136 flagellar basal-body rod protein FlgG flgI b1080 1.7273 0.0119 flagellar P-ring protein FlgI flgJ b1081 2.1703 0.0020 FlgJ flgN b1070 2.3245 0.0287 flagellar biosynthesis protein FlgN flhB b1880 1.8348 0.0063 flagellar biosynthesis protein FlhB flhC b1891 0.1181 0.0079 FlhC transcriptional regulator flhD b1892 0.0774 0.0260 FlhD transcriptional dual regulator fliC b1923 0.5536 0.0223 flagellar biosynthesis; flagellin, filament structural protein fliD b1924 0.3745 0.0118 flagellar cap protein FliD; filament capping protein; enables filament assembly flagellar motor switch protein FliG; component of motor switching and fliG b1939 1.9682 0.0326 energizing, enabling rotation and determining its direction fliI b1941 2.4306 0.0107 flagellum-specific ATP synthase FliI fliK b1943 2.1579 0.0307 flagellar hook-length control protein FliK fliR b1950 5.8099 0.0221 flagellar biosynthesis protein FliR fliS b1925 0.5073 0.0341 flagellar biosynthesis protein FliS fnr b1334 3.9209 0.0118 FNR transcriptional dual regulator focA b0904 0.6551 0.0243 FocA formate FNT transporter focB b2492 0.2494 0.0129 FocB formate FNT transporter 125

APPENDIX I

gene blattner ratio p-value Function A/B folA b0048 0.2106 0.0098 dihydrofolate reductase, type I frdD b4151 2.4605 0.0058 fumarate reductase membrane protein frlA b3370 1.6878 0.0011 YhfM methione APC transporter frlB b3371 1.7603 0.0228 fructoselysine 6-phosphate deglycase monomer frlR b3375 0.5910 0.0107 putative transcriptional regulator frmA b0356 1.7397 0.0295 formaldehyde dehydrogenase, glutathione-dependent frmB b0355 2.7771 0.0194 putative S-formylglutathione hydrolase frsA b0239 0.3854 0.0052 fermentation/respiration switch protein fruR b0080 0.2985 0.0085 FruR transcriptional dual regulator frwD b3953 1.4822 0.0450 PTS system fructose-like IIB component 2 fryA b2383 1.3141 0.0080 putative PTS system enzyme IIA component, enzyme I fsaB b3946 1.4734 0.0059 fructose 6-phosphate aldolase 2 ftsB b2748 0.2075 0.0061 essential cell division protein FtsB ftsQ b0093 1.2917 0.0493 essential cell division protein FtsQ ftsW b0089 1.9956 0.0151 essential cell division protein FtsW fxsA b4140 1.9361 0.0366 inner membrane protein; overproduction inhibits F exclusion of bacteriophage T7 gadE b3512 1.2316 0.0070 GadE transcriptional activator gadW b3515 1.9617 0.0376 GadWtranscriptional repressor gadX b3516 2.3498 0.0110 GadX transcriptional activator galE b0759 1.3965 0.0349 UDP-glucose 4-epimerase monomer galM b0756 0.5556 0.0412 aldose-1-epimerase galR b2837 0.3381 0.0120 GalR-galactose gatY b2096 0.2247 0.0190 tagatose-1,6-bisphosphate aldolase 2 gcvH b2904 0.1838 0.0232 dihydrolipoyl-GcvH-protein gcvR b2479 0.2803 0.0150 GcvR-gly gcvT b2905 0.1397 0.0379 aminomethyltransferase glcD b2979 1.4604 0.0131 glycolate oxidase subunit D glf b2036 1.4061 0.0231 UDP-galactopyranose mutase glgA b3429 2.0868 0.0462 glycogen synthase glmS b3729 0.6548 0.0257 L-glutamine:D-fructose-6-phosphate aminotransferase glnD b0167 1.4223 0.0065 uridylyltransferase / uridylyl-removing enzyme glutamine synthetase adenylyltransferase / glutamine synthetase deadenylylating glnE b3053 0.7644 0.0097 enzyme gloA b1651 1.7203 0.0236 glyoxalase I glpD b3426 0.6000 0.0106 glycerol 3-phosphate dehydrogenase, aerobic glpE b3425 0.3290 0.0046 thiosulfate sulfurtransferase glpF b3927 0.5645 0.0474 GlpF - glycerol MIP channel glpG b3424 0.2077 0.0184 inner membrane-associated protein of glp regulon gltF b3214 1.8806 0.0235 regulator of gltBDF operon, induction of Ntr enzymes gltL b0652 1.8842 0.0056 glutamate ABC transporter gltP b4077 0.7136 0.0418 GltP glutamate/aspartate DAACS transporter glyA b2551 0.3875 0.0034 glycine hydroxymethyltransferase predicted membrane-bound protein that is involved in high-affinity gluconate gntY b3414 2.7979 0.0384 transport gpp b3779 0.4360 0.0260 guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase groL b4143 2.3507 0.0471 GroEL, chaperone Hsp60, peptide-dependent ATPase, heat shock protein grpE b2614 2.3641 0.0303 phage lambda replication; host DNA synthesis; heat shock protein; protein repair grxC b3610 0.4843 0.0071 oxidized glutaredoxin 3 gshB b2947 0.5134 0.0198 glutathione synthetase subunit gspE b3326 1.8012 0.0127 putative protein secretion protein for export gspH b3329 1.2960 0.0067 putative protein secretion protein for export gspI b3330 1.3340 0.0008 putative protein secretion protein for export gspJ b3331 2.1075 0.0087 putative protein secretion protein for export gssA b2988 1.7232 0.0036 glutathionylspermidine synthetase / glutathionylspermidine amidase guaA b2507 0.7222 0.0199 GMP synthase / GMP synthase (ammonia dependent) gyrB b3699 2.5880 0.0017 DNA gyrase, subunit B hcaB b2541 1.2806 0.0246 3-phenylpropionate-2',3'-dihydrodiol dehydrogenase 126

APPENDIX I

gene blattner ratio p-value Function A/B hcaD b2542 1.6383 0.0207 ferredoxin NAD+ reductase hcaE b2538 0.5174 0.0278 3-phenylpropionate dioxygenase, alpha subunit hcr b0872 2.8116 0.0329 NADH oxidoreductase hdeD b3511 2.0630 0.0226 protein involved in acid resistance hdfR b4480 0.3225 0.0184 transcriptional regulator hemC b3805 0.4388 0.0311 hydroxymethylbilane synthase hemG b3850 0.4767 0.0075 protoporphyrinogen oxidase hemH b0475 1.6086 0.0151 ferrochelatase hemN b3867 0.4698 0.0211 coproporphyrinogen III oxidase, anaerobic hflD b1132 0.4773 0.0130 membrane protein in operon with purB hha b0460 0.3786 0.0126 haemolysin expression modulating protein hipB b1508 0.0870 0.0061 HipB transcriptional activator hmp b2552 1.8564 0.0046 nitric oxide dioxygenase / dihydropteridine reductase 2 hofN b3394 0.3123 0.0307 conserved protein holA b0640 2.0348 0.0021 DNA polymerase III, delta subunit holB b1099 1.5205 0.0029 DNA polymerase III, delta prime subunit holC b4259 0.5840 0.0321 DNA polymerase III, chi subunit holE b1842 0.2431 0.0003 DNA polymerase III, theta subunit Hsc62; an Hsp70-family ATPase that negatively regulates sigma70 / non- hscC b0650 1.6203 0.0217 chaperonin molecular chaperone ATPase hslU b3931 4.1300 0.0123 ATPase component of the HslVU protease htpG b0473 1.8306 0.0130 HtpG monomer htrL b3618 6.9782 0.0063 involved in lipopolysaccharide biosynthesis hyaA b0972 2.2684 0.0027 hydrogenase I, HyaA subunit hybF b2991 1.6921 0.0285 protein involved with the maturation of hydrogenases 1 and 2 hycE b2721 2.0488 0.0454 formate hydrogenlyase complex iaaA b0828 0.1133 0.0019 beta cleavage product of IaaA ibpA b3687 4.2244 0.0016 small heat shock protein IbpA ibpB b3686 7.6875 0.0014 small heat shock protein IbpB icdA b1136 0.3462 0.0100 Icd iclR b4018 0.2325 0.0125 IclR-PEP idnR b4264 0.2909 0.0338 IdnR-5-ketogluconate idnT b4265 0.3169 0.0249 IdnT idonate Gnt tranporter ihfB b0912 1.9863 0.0061 IHF transcriptional dual regulator ilvA b3772 0.4362 0.0424 threonine dehydratase (biosynthetic) inaA b2237 0.2907 0.0071 pH-inducible protein involved in stress response insA_5 1977239-1976964 : IS1 protein InsA / insA_1 20508-20233 : IS1 protein insA_5 b1894 0.3935 0.0446 InsA / insA_6 3581506-3581781 : IS1 protein InsA intR b1345 0.2551 0.0239 putative transposase intS b2349 1.9457 0.0169 putative prophage Sf6-like integrase iscU b2529 1.8083 0.0053 scaffold protein involved in iron-sulfur cluster assembly ispA b0421 0.1813 0.0151 geranyl diphosphate synthase / farnesyl diphosphate synthase ispD b2747 0.4908 0.0411 4-diphosphocytidyl-2C-methyl-D-erythritol synthetase monomer katE b1732 1.7021 0.0305 hydroperoxidase II kdtA b3633 0.3601 0.0028 KDO transferase kduD b2842 1.5255 0.0331 2-deoxy-D-gluconate 3-dehydrogenase kefG b3351 1.3584 0.0057 KefG ldcA b1192 1.7002 0.0372 L,D-carboxypeptidase A leuB b0073 1.7972 0.0055 3-isopropylmalate dehydrogenase leuC b0072 1.6773 0.0000 isopropylmalate isomerase leuD b0071 2.0207 0.0112 isopropylmalate isomerase ligT b0147 0.1852 0.0026 hypothetical protein lipB b0630 2.1877 0.0000 lipoyl-protein ligase livH b3457 1.9033 0.0131 leucine ABC transporter livM b3456 1.6094 0.0498 leucine ABC transporter periplasmic chaperone, effects translocation of lipoproteins from inner membrane lolA b0891 0.7885 0.0361 to outer 127

APPENDIX I

gene blattner ratio p-value Function A/B lolB b1209 0.4806 0.0227 outer membrane lipoprotein, localization of lipoproteins in the outer membrane lolE b1118 0.4575 0.0420 LolCDE ABC lipoprotein transporter lon b0439 2.6981 0.0091 DNA-binding, ATP-dependent protease La lpcA b0222 0.2400 0.0125 lipopolysaccharide core biosynthesis; phosphoheptose isomerase lrp b0889 0.4179 0.0402 Lrp-Leucine transcriptional activator lsrG b1518 1.4543 0.0022 conserved hypothetical protein lysA b2838 1.7920 0.0487 diaminopimelate decarboxylase macB b0879 2.0724 0.0127 MacAB macrolide efflux transporter complex malT b3418 0.1905 0.0107 MalT-MalK malY b1622 0.4203 0.0185 bifunctional: repressor of maltose regulon / cystathionine beta-lyase mdl b0449 2.7100 0.0423 MdlB mdoC b1047 0.1432 0.0145 protein required for succinyl modification of osmoregulated periplasmic glucans membrane glycosyltransferase; synthesis of membrane-derived oligosaccharide mdoH b1049 1.6043 0.0230 (MDO) mdtF b3514 1.8716 0.0244 YhiV mdtN b4082 2.2488 0.0020 putative membrane protein mdtO b4081 1.5951 0.0435 YjcQ putative 2-hydroxyglutarate synthase / SHCHC synthase / 2-oxoglutarate menD b2264 0.3726 0.0138 decarboxylase menF b2265 0.3477 0.0276 isochorismate synthase, menaquinone-specific mfd b1114 0.5650 0.0126 transcription-repair coupling factor; mutation frequency decline mhpF b0351 1.8446 0.0238 acetaldehyde dehydrogenase 2 cell division inhibitor of the MinC-MinD-MinE and DicB-MinC systems that minC b1176 0.2414 0.0115 regulate septum placement membrane ATPase of the MinC-MinD-MinE system that regulates septum minD b1175 0.4152 0.0065 placement cell division topological specificity factor and inhibitory component of the MinC- minE b1174 0.3703 0.0160 MinD-MinE system that regulates septum placement mioC b3742 1.6938 0.0341 flavoprotein involved in biotin synthesis mltC b2963 0.4421 0.0091 membrane-bound lytic murein transglycosylase C mmuP b0260 0.3741 0.0038 MmuP APC transporter mnmC b2324 0.5136 0.0357 bifunctional enzyme catalyzing the formation of mnm5s2U in tRNA mntH b2392 0.3161 0.0066 MntH manganese ion NRAMP transporter moaA b0781 0.2797 0.0039 molybdopterin biosynthesis, protein A mobA b3857 0.2268 0.0063 molybdopterin guanine dinucleotide synthase mobB b3856 0.7633 0.0125 molybdopterin-guanine dinucleotide biosynthesis protein B modE b0761 0.3788 0.0052 Molybdate-responsive transcription factor monomer moeB b0826 2.0014 0.0025 molybdopterin biosynthesis mpaA b1326 0.4207 0.0207 murein peptide amidase A mrr b4351 0.4108 0.0084 restriction of methylated adenine msbB b1855 0.2154 0.0023 myristoyl acyltransferase mtlD b3600 0.3066 0.0272 mannitol-1-phosphate 5-dehydrogenase mukE b0923 0.3600 0.0166 protein involved in chromosome partitioning mukF b0922 0.2126 0.0048 Ca2+-binding protein involved in chromosome partitioning murI b3967 2.6898 0.0094 glutamate racemase murP b2429 0.3862 0.0083 MurP mutY b2961 0.3526 0.0252 adenine glycosylase; G.C --> T.A transversions mviM b1068 0.7293 0.0284 putative virulence factor nadD b0639 2.8386 0.0006 nicotinate-mononucleotide adenylyltransferase nadR b4390 0.5652 0.0094 NadR transcriptional repressor / NMN adenylyltransferase nanR b3226 0.2529 0.0184 NanR transcriptional regulator narQ b2469 1.8665 0.0482 NarQ-Phis narV b1465 1.9002 0.0087 nitrate reductase Z, γ subunit nfnB b0578 0.7030 0.0451 dihydropteridine reductase nfrB b0569 0.4153 0.0012 bacteriophage N4 receptor, outer membrane protein nhaA b0019 1.9281 0.0447 sodium/proton NhaA transporter nhaR b0020 2.4259 0.0270 NhaR-Na+ transcriptional activator nikA b3476 2.3805 0.0063 nickel ABC transporter 128

APPENDIX I

gene blattner ratio p-value Function A/B nikR b3481 1.4287 0.0386 NikR-Ni nirB b3365 1.6021 0.0034 nitrite reductase, large subunit nth b1633 2.2184 0.0022 endonuclease III; specific for apurinic and/or apyrimidinic sites nudD b2051 1.8515 0.0395 GDP-mannose mannosyl hydrolase nudF b3034 0.3009 0.0092 hypothetical protein nuoL b2278 2.3112 0.0467 NADH dehydrogenase I osmC b1482 1.9756 0.0398 osmotically inducible peroxidase OsmC osmE b1739 1.3600 0.0369 OsmE-osmotically inducible protein para-aminobenzoate synthase multi-enzyme complex / para-aminobenzoate pabB b1812 0.1391 0.0082 synthase panE b0425 0.4718 0.0353 2-dehydropantoate reductase parC b3019 0.5366 0.0439 Topoisomerase IV subunit A pbpG b2134 0.2733 0.0252 penicillin-binding protein 7 pepB b2523 2.0445 0.0308 aminopeptidase (AP) pflA b0902 2.2414 0.0213 pyruvate formate-lyase activating enzyme pgsA b1912 0.5084 0.0407 phosphatidylglycerophosphate synthase phnE b4104 1.3120 0.0044 alkylphosphonate ABC transporter phnG b4101 2.1147 0.0227 phosphonate metabolism phnK b4097 1.6222 0.0319 PhnK PhoB-dependent, ATP-binding pho regulon component; may be helicase; induced phoH b1020 1.3684 0.0361 by P starvation pitA b3493 0.6222 0.0296 PitA pitB b2987 1.2746 0.0137 PitB plsB b4041 1.6234 0.0168 glycerol-3-phosphate acyltransferase plsC b3018 0.3811 0.0229 1-acylglycerol-3-phosphate acyltransferase plsX b1090 0.3719 0.0337 glycerolphosphate auxotrophy in plsB background pmrF b2254 1.6010 0.0321 undecaprenyl phosphate-L-Ara4FN transferase pncB b0931 0.2520 0.0142 nicotinate phosphoribosyltransferase polB b0060 3.1483 0.0221 DNA polymerase II ppk b2501 0.2034 0.0093 polyphosphate kinase prmC b1212 1.4586 0.0477 protein-(glutamine-N5) methyltransferase proS b0194 1.7249 0.0261 prolyl-tRNA synthetase proV b2677 0.4042 0.0250 proline ABC transporter pspF b1303 0.1755 0.0002 PspF transcriptional activator pstB b3725 0.6518 0.0392 phosphate ABC transporter ptsA b3947 1.8352 0.0003 PEP-protein phosphotransferase system enzyme I 5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole lyase / purB b1131 0.7366 0.0390 adenylosuccinate lyase purC b2476 0.2064 0.0057 phosphoribosylaminoimidazole-succinocarboxamide synthase purE b0523 0.1169 0.0008 N5-carboxyaminoimidazole ribonucleotide mutase purF b2312 0.1474 0.0009 amidophosphoribosyl transferase purH b4006 0.4496 0.0475 AICAR transformylase / IMP cyclohydrolase purK b0522 0.1805 0.0075 N5-carboxyaminoimidazole ribonucleotide synthase monomer purM b2499 0.2023 0.0208 phosphoribosylformylglycinamide cyclo-ligase purN b2500 0.3009 0.0412 phosphoribosylglycinamide formyltransferase purR b1658 0.2390 0.0090 PurR transcriptional repressor purT b1849 0.1801 0.0082 GAR transformylase 2 puuA b1297 0.1427 0.0155 putative glutamine synthetase (EC 6.3.1.2) pykA b1854 1.4726 0.0128 pyruvate kinase II monomer pykF b1676 1.2394 0.0301 pyruvate kinase I monomer pyrB b4245 0.4807 0.0207 aspartate carbamoyltransferase, PyrB subunit pyrI b4244 0.6993 0.0415 aspartate carbamoyltransferase, PyrI subunit qseB b3025 0.2860 0.0050 putative 2-component transcriptional regulator racR b1356 0.3752 0.0040 hypothetical protein rbsK b3752 0.7165 0.0029 ribokinase positive DNA-binding transcriptional regulator of capsular polysaccharide rcsA b1951 3.6667 0.0186 synthesis, activates its own expression rcsD b2216 0.4726 0.0181 putative 2-component sensor protein 129

APPENDIX I

gene blattner ratio p-value Function A/B rdoA b3859 0.5228 0.0406 cytoplasmic protein of low abundance DNA strand exchange and renaturation, DNA-dependent ATPase, DNA- and recA b2699 3.2066 0.0263 ATP-dependent coprotease DNA helicase, ATP-dependent dsDNA/ssDNA exonuclease V subunit, ssDNA recD b2819 2.0842 0.0351 endonuclease recE b1350 1.9766 0.0078 exonuclease VIII, ds DNA exonuclease, 5' --> 3' specific recN b2616 5.3559 0.0008 protein used in recombination and DNA repair recT b1349 1.3586 0.0348 recombinase, DNA renaturation rfaB b3628 2.5413 0.0011 UDP-D-galactose:(glucosyl)lipopolysaccharide-1,6-D-galactosyltransferase rfaG b3631 3.0643 0.0002 lipopolysaccharide core biosynthesis; glucosyltransferase I rfaI b3627 4.1170 0.0163 UDP-D-galactose:(glucosyl)lipopolysaccharide-alpha-1,3-D-galactosyltransferase rfaJ b3626 4.3983 0.0081 UDP-D-glucose:(galactosyl)lipopolysaccharide glucosyltransferase rfaK b3623 3.1484 0.0132 lipopolysaccharide core biosynthesis; probably hexose transferase rfaQ b3632 2.4984 0.0107 lipopolysaccharide core biosynthesis rfaS b3629 3.0101 0.0025 lipopolysaccharide core biosynthesis rfaY b3625 4.7308 0.0194 lipopolysaccharide core biosynthesis rfaZ b3624 4.3286 0.0096 protein involved in KdoIII attachment during lipopolysaccharide core biosynthesis rfc b2035 1.8291 0.0009 O-antigen polymerase rfe b3784 0.2683 0.0097 undecaprenyl-phosphate α-N-acetylglucosaminyl transferase rffA b3791 1.6016 0.0227 TDP-4-oxo-6-deoxy-D-glucose transaminase rffT b3792.1 2.4442 0.0046 4-acetamido-4,6-dideoxy-D-galactose transferase rhaA b3903 2.4561 0.0417 L-rhamnose isomerase / L-lyxose isomerase rho b3783 0.5828 0.0440 transcription termination factor Rho monomer; polarity suppressor rhsD b0497 0.1966 0.0113 RhsD protein in rhs element rhtC b3823 0.4390 0.0253 RhtC threonine Rht Transporter ribB b3041 0.6220 0.0498 3,4-dihydroxy-2-butanone 4-phosphate synthase ribF b0025 0.1784 0.0073 riboflavin kinase / FMN adenylyltransferase acetylates N-terminal alanine of 30S ribosomal subunit protein S5 / ribosomal- rimJ b1066 0.4039 0.0138 protein-alanine N-acetyltransferase rimK b0852 1.5209 0.0253 ribosomal protein S6 modification protein acetylation of N-terminal serine of 30S ribosomal subunit protein L7; acetyl rimL b1427 0.5475 0.0053 transferase rlmB b4180 1.7133 0.0062 23S rRNA methyltransferase monomer rlpB b0641 1.9134 0.0175 rare lipoprotein RlpB rmuC b3832 0.4993 0.0038 conserved protein rph b3643 1.1124 0.0148 RNase PH monomer rplS b2606 2.4571 0.0178 50S ribosomal subunit protein L19 rplT b1716 2.5117 0.0282 50S ribosomal subunit protein L20, and regulator rpoD b3067 3.0416 0.0132 sigma70 factor rpoE b2573 0.6493 0.0378 sigmaE rpoZ b3649 0.5481 0.0118 RNA polymerase, omega subunit rpsQ b3311 1.9759 0.0388 30S ribosomal subunit protein S17 rrmJ b3179 1.3369 0.0240 23S rRNA m2U2552 methyltransferase rseA b2572 0.3836 0.0167 anti-sigma factor that inhibits sigmaE negative regulator of sigmaE; interacts with RseA and stimulates binding of RseA rseB b2571 0.5258 0.0112 to sigmaE rseC b2570 0.4367 0.0061 protein involved in reduction of the SoxR iron-sulfur cluster rspA b1581 1.7883 0.0421 starvation sensing protein RspA rspB b1580 1.8606 0.0395 putative dehydrogenase RspB rsxD b1630 1.4943 0.0285 integral membrane protein of SoxR-reducing complex rsxE b1632 2.6850 0.0103 integral membrane protein of SoxR-reducing complex rsxG b1631 3.0731 0.0067 member of SoxR-reducing complex sapB b1293 1.7823 0.0146 peptide uptake ABC transporter secG b3175 0.5156 0.0209 Sec Protein Secretion Complex seqA b0687 0.3340 0.0283 SeqA, negative modulator of initiation of replication serB b4388 0.3970 0.0271 phosphoserine phosphatase setC b3659 1.3102 0.0144 YicK MFS Transporter sfmC b0531 2.1401 0.0045 putative chaperone 130

APPENDIX I

gene blattner ratio p-value Function A/B sgcE b4301 1.6837 0.0317 putative epimerase sgcX b4305 0.3168 0.0116 SgcB slt b4392 0.5759 0.0147 soluble lytic murein transglycosylase slyA b1642 0.4451 0.0416 SlyA transcriptional activator smf b4473 0.3130 0.0254 hypothetical protein smg b3284 0.1539 0.0006 hypothetical protein smpA b2617 1.8755 0.0132 SmpA small membrane protein A smtA b0921 0.1256 0.0007 S-adenosylmethionine-dependent methyltransferase sohB b1272 1.8038 0.0119 putative protease speA b2938 2.2897 0.0138 arginine decarboxylase, biosynthetic speD b0120 1.2622 0.0360 adenosylmethionine decarboxylase, proenzyme spr b2175 0.1527 0.0041 putative lipoprotein spy b1743 1.6568 0.0122 periplasmic protein related to spheroblast formation srmB b2576 0.3930 0.0324 SrmB, DEAD-box RNA helicase sscR b2765 0.3470 0.0259 putative 6-pyruvoyl tetrahydrobiopterin synthase sspA b3229 1.7662 0.0298 regulator of transcription; stringent starvation protein A ssuD b0935 2.1101 0.0410 alkanesulfonate monooxygenase sucB b0727 1.7606 0.0413 SucB-lipoate sucD b0729 2.0786 0.0326 succinyl-CoA synthetase, alpha subunit sufE b1679 1.4500 0.0180 sulfur acceptor that activates SufS cysteine desulfurase sufS b1680 1.9117 0.0189 L-selenocysteine lyase (and L-cysteine desulfurase) monomer sulA b0958 0.4846 0.0244 suppressor of lon; inhibits cell division and ftsZ ring formation surE b2744 0.6982 0.0147 phosphatase with broad substrate specificity / 3'-nucleotidase / 5'-nucleotidase talB b0008 0.7356 0.0361 transaldolase B tatE b0627 1.3041 0.0170 TatABCE protein export complex tdcF b3113 2.0890 0.0324 hypothetical protein thyA b2827 1.5495 0.0232 thymidylate synthase tolC b3035 0.4953 0.0287 TolC outer membrane channel torZ b1872 0.5113 0.0085 trimethylamine N-oxide reductase III, TorZ subunit trmE b3706 1.6715 0.0450 GTP-binding protein with a role in modification of tRNA trpE b1264 0.2196 0.0041 anthranilate synthase component I trpH b1266 1.2995 0.0096 putative enzyme trpR b4393 1.8827 0.0116 TrpR transcriptional repressor truD b2745 0.5425 0.0108 tRNA pseudouridine 13 synthase trxA b3781 0.6949 0.0406 oxidized thioredoxin ubiC b4039 0.1951 0.0166 chorismate pyruvate lyase ugpC b3450 1.3303 0.0342 glycerol-3-P ABC transporter / tranport ulaB b4194 1.8991 0.0096 eiisga umuC b1184 1.4019 0.0198 SOS mutagenesis and repair uup b0949 1.5046 0.0356 Uup uvrA b4058 3.2580 0.0017 excision nuclease subunit A uvrB b0779 1.5440 0.0191 DNA repair; excision nuclease subunit B valS b4258 1.3789 0.0229 valyl-tRNA synthetase DNA mismatch endonuclease of the very short patch (VSP) mismatch repair vsr b1960 0.4472 0.0407 pathway waaP b3630 2.8880 0.0034 lipopolysaccharide core biosynthesis; phosphorylation of core heptose wbbI b2034 2.0928 0.0325 hypothetical protein; not required for colanic acid biosynthesis wbbK b2032 1.5888 0.0445 putative transferase wcaI b2050 1.4786 0.0422 putative colanic biosynthesis glycosyl transferase wecB b3786 1.9582 0.0212 UDP-N-acetylglucosamine-2-epimerase xerD b2894 0.2913 0.0334 site-specific recombinase xseB b0422 0.1745 0.0055 exonuclease VII, small subunit yabP b0056 0.5265 0.0390 conserved hypothetical protein yacC b0122 0.1421 0.0092 conserved hypothetical protein yadE b0130 1.9353 0.0038 conserved hypothetical protein yadF b0126 0.5334 0.0299 carbonic anhydrase yadH b0128 0.5583 0.0088 YadG/YadH ABC transporter 131

APPENDIX I

gene blattner ratio p-value Function A/B yadL b0137 2.6672 0.0200 putative adhesin-like protein yaeI b0164 1.6713 0.0162 conserved protein yaeR b0187 0.3976 0.0325 putative enzyme yafJ b0223 0.1911 0.0015 putative amidotransferase conserved protein; in enteroaggregative E. coli, YafK is required for development yafK b0224 0.2183 0.0034 of biofilms yafQ b0225 0.3068 0.0158 conserved hypothetical protein yafS b0213 1.5738 0.0014 putative methyltransferase yagB b0266 0.1046 0.0003 hypothetical protein yagN b0280 0.2692 0.0237 hypothetical protein yahF b0320 1.8661 0.0118 putative oxidoreductase subunit yahJ b0324 1.4514 0.0167 putative deaminase yajC b0407 0.5517 0.0123 Sec Protein Secretion Complex yajI b0412 0.6979 0.0356 conserved hypothetical protein ybaJ b0461 0.1803 0.0125 conserved hypothetical protein ybaK b0481 1.4925 0.0073 conserved hypothetical protein ybaN b0468 0.4393 0.0017 hypothetical protein ybaQ b0483 0.1888 0.0099 conserved protein with a DNA-binding domain ybaY b0453 2.1228 0.0458 glycoprotein/polysaccharide metabolism ybbB b0503 0.6974 0.0351 tRNA 2-selenouridine synthase ybdJ b0580 0.3651 0.0026 conserved hypothetical protein ybeD b0631 3.2155 0.0247 conserved hypothetical protein ybeX b0658 2.4451 0.0016 putative transport protein ybeY b0659 3.1107 0.0068 conserved hypothetical protein ybeZ b0660 3.0813 0.0018 putative ATP-binding protein ybfF b0686 0.4851 0.0234 putative enzyme ybfH b0691 2.0652 0.0161 conserved hypothetical protein ybgA b0707 1.5050 0.0370 conserved protein ybgC b0736 0.5182 0.0269 Tol-Pal Cell Envelope Complex ybgI b0710 0.5520 0.0236 conserved protein, putative hydrolase-oxidase monomer ybgS b0753 1.6386 0.0415 putative homeobox protein ybhI b0770 1.6162 0.0084 YbhI DASS Transporter ybiF b0813 0.4910 0.0351 Threonine and Homoserine Exporter ybiH b0796 0.1350 0.0012 hypothetical protein ybjJ b0845 1.8338 0.0024 putative DEOR-type transcriptional regulator ybjN b0853 0.4973 0.0357 putative sensory transduction regulator ybjO b0858 0.7793 0.0239 putative membrane protein ybjS b0868 0.5267 0.0068 putative nucleotide di-P-sugar epimerase or dehydratase ycaK b0901 2.4091 0.0338 YcaK ycaL b0909 0.4133 0.0127 putative heat shock protein ycbB b0925 0.4752 0.0426 putative amidase ycbK b0926 0.2670 0.0090 conserved hypothetical protein ycbQ b0938 1.6913 0.0497 putative fimbrial-like protein ycbW b0946 0.8124 0.0000 conserved hypothetical protein yccM b0992 1.6258 0.0274 hypothetical protein yccR b0959 0.4415 0.0330 conserved protein yccV b0966 1.9670 0.0301 hemimethylated DNA-binding protein yceA b1055 0.5663 0.0415 hypothetical protein yceH b1067 0.5404 0.0358 conserved hypothetical protein ycfH b1100 2.0582 0.0168 putative hydrolase ycfJ b1110 0.6676 0.0447 hypothetical protein ycfP b1108 0.5438 0.0176 putative hydrolase ycfQ b1111 2.2543 0.0293 hypothetical protein ycfX b1119 0.5776 0.0347 putative sugar kinase, ROK family protein ycgG b1168 2.7312 0.0499 conserved protein ycgL b1179 0.3957 0.0211 conserved hypothetical protein ycgM b1180 0.3111 0.0120 putative isomerase 132

APPENDIX I

gene blattner ratio p-value Function A/B ycgN b1181 0.2615 0.0009 conserved hypothetical protein ycgZ b1164 0.3437 0.0011 hypothetical protein ychH b1205 0.3360 0.0075 conserved hypothetical protein yciI b1251 1.8595 0.0266 conserved hypothetical protein yciQ b1268 2.0023 0.0382 putative membrane protein ycjD b1289 1.8598 0.0220 conserved hypothetical protein ycjF b1322 4.5462 0.0002 putative membrane protein ycjR b1314 2.8426 0.0026 putative epimerase/isomerase ycjX b1321 5.2223 0.0078 putative EC 2.1 enzyme ycjZ b1328 0.3330 0.0288 putative transcriptional regulator LYSR-type ydaC b1347 2.1926 0.0196 hypothetical protein ydaL b1340 0.4087 0.0084 hypothetical protein ydaO b1344 0.3090 0.0329 conserved protein ydbK b1378 1.5381 0.0088 putative pyruvate synthase ydcD b1457 0.2425 0.0233 hypothetical protein ydcF b1414 0.3249 0.0248 conserved hypothetical protein ydcP b1435 0.5182 0.0437 putative collagenase ydcQ b1438 0.6588 0.0380 hypothetical protein ydcV b1443 2.3103 0.0430 YdcS/YdcT/YdcV/YdcU ABC transporter ydcX b1445 1.7926 0.0407 hypothetical protein ydcZ b1447 0.6629 0.0339 putative transport protein ydeI b1536 1.4337 0.0167 conserved hypothetical protein ydeK b1510 0.5430 0.0356 YdeK ydeP b1501 1.2063 0.0190 acid resistance protein ydfH b1540 0.4468 0.0056 hypothetical protein ydfX b1568 1.9527 0.0006 hypothetical protein ydgK b1626 0.2396 0.0104 putative oxidoreductase ydgT b1625 0.1619 0.0070 conserved hypothetical protein ydhA b1639 0.3471 0.0143 conserved hypothetical protein ydhC b1660 0.5332 0.0469 YdhC drug MFS transporter ydhF b1647 0.6866 0.0318 putative oxidoreductase, NAD(P)-linked ydhH b1640 0.5178 0.0331 conserved hypothetical protein ydhI b1643 0.3395 0.0016 hypothetical protein ydhX b1671 1.4069 0.0177 putative oxidoreductase, Fe-S subunit ydiA b1703 0.4230 0.0097 conserved protein ydiF b1694 2.3786 0.0350 putative enzyme / putative acetate CoA-transferase ydiU b1706 0.3937 0.0051 conserved protein ydjA b1765 0.2828 0.0032 conserved protein ydjE b1769 1.5337 0.0078 YdjE MFS transporter ydjG b1771 1.5063 0.0105 putative oxidoreductase ydjI b1773 1.8655 0.0163 putative aldolase yeaB b1813 0.3894 0.0148 conserved hypothetical protein, MutT-like yeaD b1780 1.6695 0.0155 conserved hypothetical protein yeaN b1791 1.5049 0.0207 YeaN yeaQ b1795 2.2111 0.0082 conserved hypothetical protein yebF b1847 1.6698 0.0283 conserved hypothetical protein yebK b1853 0.2495 0.0033 hypothetical protein yebQ b1828 1.8190 0.0400 YebQ yebR b1832 0.3530 0.0270 conserved hypothetical protein yebW b1837 0.4682 0.0099 hypothetical protein yecD b1867 0.2234 0.0222 putative enzyme yecN b1869 0.3102 0.0188 putative membrane protein yecP b1871 0.3399 0.0218 putative enzyme yecT b1877 1.0931 0.0431 hypothetical protein yedA b1959 0.5288 0.0316 putative transmembrane subunit yedR b1963 1.5955 0.0146 hypothetical protein 133

APPENDIX I

gene blattner ratio p-value Function A/B yedS_1 b1964 2.2882 0.0042 putative outer membrane protein yedS_2 b1965 1.7587 0.0236 putative outer membrane protein yedV b1968 1.8495 0.0385 putative 2-component sensor protein yeeI b1976 0.0966 0.0010 conserved hypothetical protein yeeN b1983 4.9594 0.0148 conserved protein yeeR b2001 2.6686 0.0487 hypothetical protein yeeT b2003 2.3201 0.0034 hypothetical protein yeeV b2005 1.3165 0.0457 toxin of the YeeV-YeeU toxin-antitoxin pair yegK b2072 1.7271 0.0442 conserved hypothetical protein yegS b2086 2.0901 0.0070 conserved protein yegZ b2083 2.2403 0.0450 hypothetical protein yeiB b2152 0.3697 0.0315 putative flavoprotein yeiE b2157 0.3697 0.0245 LYSR-type transcriptional regulator yeiH b2158 0.4992 0.0227 putative membrane protein yeiS b2145 0.4582 0.0020 hypothetical protein yeiU b2174 0.4647 0.0046 putative permease yejO b2190 0.7784 0.0168 putative outer membrane protein yfbE b2253 2.0569 0.0265 UDP-L-Ara4O C-4" transaminase yfbN b2273 2.3173 0.0063 conserved hypothetical protein yfbP b2275 1.8398 0.0323 hypothetical protein yfbS b2292 1.5779 0.0333 putative transport protein yfdG b2350 0.2271 0.0070 hypothetical protein yfdT b2363 1.6042 0.0163 hypothetical protein yfdY b2377 0.3177 0.0340 hypothetical protein yfdZ b2379 0.4370 0.0356 putative aminotransferase yfeT b2427 0.3878 0.0370 conserved protein yffP b2447 0.5387 0.0462 hypothetical protein yfgA b2516 0.3806 0.0060 putative membrane protein yfgB b2517 0.5726 0.0383 putative pyruvate formate lyase activating enzyme 2 yfgC b2494 0.5296 0.0021 conserved protein yfgJ b2510 2.4079 0.0095 putative cytochrome yfhG b2555 0.2458 0.0032 conserved protein yfhL b2562 0.2615 0.0411 putative ferredoxin yfhR b2534 1.6968 0.0195 putative methylase or hydrolase yfiC b2575 0.1195 0.0045 putative enzyme yfiR b2603 0.4114 0.0278 conserved protein yfjD b4461 1.6322 0.0139 putative membrane protein, hemolysin-like yfjG b2619 1.8502 0.0087 toxin of a putative toxin-antitoxin pair yfjL b2628 0.1625 0.0098 hypothetical protein yfjO b2631 0.5072 0.0379 hypothetical protein yfjS b2636 1.9190 0.0123 inner membrane lipoprotein YfjS yfjU b2638 0.5267 0.0020 hypothetical protein ygaD b2700 0.4320 0.0264 conserved protein ygaH b2683 0.4552 0.0216 putative transport protein ygbE b2749 0.1583 0.0105 putative cytochrome oxidase subunit ygcF b2777 2.5383 0.0021 hypothetical protein ygdI b2809 2.2634 0.0305 hypothetical protein ygdK b2811 0.3282 0.0174 conserved hypothetical protein ygdR b2833 0.4614 0.0075 conserved hypothetical protein ygeG b2851 1.7509 0.0180 conserved hypothetical protein ygeK b2855 2.0910 0.0188 putative 2-component transcriptional regulator ygeW b2870 1.8672 0.0031 putative carbamoyl transferase ygfH b2920 1.5120 0.0087 propionyl-CoA:succinate CoA transferase ygfS b2886 1.9879 0.0229 putative oxidoreductase, Fe-S subunit yggH b2960 0.4393 0.0186 tRNA (m7G46) methyltransferase yggJ b2946 0.5103 0.0052 conserved hypothetical protein 134

APPENDIX I

gene blattner ratio p-value Function A/B conserved hypothetical protein with role in oxidation-resistance of iron-sulfur yggX b2962 0.2130 0.0026 clusters yghQ b2983 1.5927 0.0325 putative serine protease yghS b2985 2.5090 0.0044 conserved protein ygiA b3036 0.4378 0.0239 hypothetical protein ygiF b3054 0.4550 0.0096 conserved hypothetical protein ygiH b3059 0.3702 0.0081 putative membrane protein ygiU b3022 0.2603 0.0069 putative cyanide hydratase ygjG b3073 1.9440 0.0152 putrescine:2-oxoglutaric acid aminotransferase ygjN b3083 0.4759 0.0137 conserved hypothetical protein ygjR b3087 0.4817 0.0398 putative NAD(P)-binding dehydrogenase yhaK b3106 0.6327 0.0013 conserved hypothetical protein yhbP b3154 0.2861 0.0046 conserved protein yhcA b3215 1.7828 0.0096 putative chaperone yhcB b3233 0.4240 0.0252 conserved hypothetical protein yhcD b3216 2.5320 0.0410 putative outer membrane protein yhcM b3232 0.2725 0.0003 hypothetical protein yhdA b3252 0.1678 0.0074 conserved protein yhdJ b3262 1.4106 0.0325 cell cycle-regulated methyltransferase yheN b3345 0.6302 0.0272 conserved hypothetical protein yheO b3346 0.5020 0.0092 hypothetical protein yhfG b3362 1.9518 0.0284 conserved hypothetical protein yhfX b3381 1.9848 0.0205 conserved protein yhhK b3459 0.4123 0.0018 putative acyltransferase yhhM b3467 0.3265 0.0159 putative receptor yhhN b3468 0.4588 0.0073 putative enzyme yhhS b3473 0.3667 0.0188 YhhS MFS transporter yhhT b3474 0.5527 0.0461 hypothetical protein yhiL b3490 2.2476 0.0051 hypothetical protein yhiP b3496 1.3365 0.0190 YhiP peptide POT transporter yhiS b3504 1.6910 0.0222 conserved protein yhjA b3518 2.6298 0.0076 putative cytochrome C peroxidase (EC 1.11.1) yhjC b3521 0.2139 0.0092 putative transcriptional regulator LYSR-type yhjR b3535 0.2767 0.0243 hypothetical protein yiaJ b3574 0.3464 0.0228 YiaJ transcriptional repressor yiaV b3586 2.4422 0.0226 putative membrane protein yibA b3594 2.4261 0.0343 putative lyase yicE b3654 0.0934 0.0007 YicE NCS2 tranporter yidI b3677 0.5721 0.0151 hypothetical protein yieO b3754 0.5670 0.0417 YieO drug MFS transporter yifE b3764 1.7605 0.0381 hypothetical protein yigA b3810 0.4061 0.0291 conserved hypothetical protein yigL b3826 1.9789 0.0325 conserved protein with a phosphatase-like domain yihI b3866 0.3969 0.0382 conserved protein yihN b3874 1.3163 0.0362 YihN MFS transporter yihW b3884 0.5544 0.0009 putative DEOR-type transcriptional regulator yihX b3885 0.1479 0.0070 putative phosphatase yjbE b4026 2.1742 0.0103 conserved hypothetical protein yjbJ b4045 0.8546 0.0153 highly abundant nonessential protein yjbQ b4056 0.3680 0.0272 conserved hypothetical protein yjdA b4109 0.1308 0.0055 hypothetical protein yjeB b4178 0.1691 0.0045 conserved protein with a Winged helix domain yjeK b4146 0.2195 0.0017 hypothetical protein yjeS b4166 5.5584 0.0055 conserved ferredoxin-like protein yjfY b4199 2.3690 0.0232 conserved hypothetical protein yjfZ b4204 1.7639 0.0428 hypothetical protein yjgK b4252 0.7295 0.0143 conserved hypothetical protein 135

APPENDIX I

gene blattner ratio p-value Function A/B yjhQ b4307 1.4246 0.0099 hypothetical protein yjiP b4338 2.4980 0.0122 hypothetical protein yjjK b4391 1.7150 0.0293 YjjK yjjV b4378 0.5588 0.0453 putative hydrolase ykfA b0253 0.6499 0.0241 putative GTP-binding protein ykfI b0245 1.4478 0.0135 toxin of the YkfI-YafW toxin-antitoxin pair ymdB b1045 0.3716 0.0228 conserved protein ymfE b1138 0.3125 0.0102 hypothetical protein ymfL b1147 2.2281 0.0426 hypothetical protein ymjA b1295 0.2117 0.0004 hypothetical protein ynaE b1375 0.3494 0.0151 hypothetical protein ynaI b1330 2.3789 0.0357 YnaI yncA b1448 0.2369 0.0176 putative N-acetyltransferase yncI b1458 0.3663 0.0269 conserved protein yneE b1520 0.3459 0.0204 conserved hypothetical protein yneH b1524 0.2425 0.0072 putative glutaminase yoaB b1809 0.7879 0.0038 conserved protein yoaG b1796 1.8050 0.0152 hypothetical protein yoaH b1811 0.4847 0.0212 conserved hypothetical protein yobA b1841 0.4374 0.0151 hypothetical protein yodA b1973 1.4017 0.0256 cadmium-induced metal binding protein ypdA b2380 0.4128 0.0202 putative sensor protein yphA b2543 0.5045 0.0317 hypothetical protein ypjA b2647 1.4597 0.0449 putative outer membrane protein ypjF b2646 2.1806 0.0102 member of the YeeV, YkfI, YpjF family of toxin proteins yqaA b2689 0.3480 0.0062 putative integral membrane protein yqeI b2847 0.2786 0.0052 putative sensory transducer yqgE b2948 0.4450 0.0370 conserved protein yqgF b2949 0.3997 0.0078 possible Holliday junction resolvase yqiA b3031 0.4262 0.0079 putative hydrolase yqiB b3033 0.3117 0.0078 putative enzyme yqiJ b3050 1.4637 0.0242 putative oxidoreductase yqjC b3097 1.4751 0.0229 conserved protein yqjK b3100 1.6055 0.0133 conserved hypothetical protein yraM b3147 0.3549 0.0084 putative glycosylase yraN b3148 0.3605 0.0169 conserved hypothetical protein yrbL b3207 0.3337 0.0259 conserved hypothetical protein; transcription is regulated by Mg2+ yrdD b3283 0.1449 0.0047 putative DNA topoisomerase ytfA b4205 0.8018 0.0308 hypothetical protein ytfG b4211 1.9267 0.0219 putative oxidoreductase ytfN b4221 0.6361 0.0427 conserved protein ytfP b4222 0.5980 0.0212 conserved hypothetical protein ytjB b4387 0.5868 0.0341 membrane protein zapA b2910 0.1619 0.0022 ZapA protein, localizes to the cytokinetic ring zipA b2412 0.2297 0.0272 essential cell division protein ZipA zitB b0752 2.0419 0.0407 ZitB zinc CDF transporter znuA b1857 0.4717 0.0485 ZnuA/ZnuB/ZnuC ABC transporter zur b4046 0.3387 0.0049 Zur transcriptional regulator

Supplementary table – IX: LZ41 hns-205::Tn10 (A) Vs LZ54 hns-205::Tn10 (B)

gene blattner ratio p-value Function A/B acpS b2563 1.5407 0.0218 holo-[acyl-carrier-protein] synthase 136

APPENDIX I

gene blattner ratio p-value Function A/B acrE b3265 0.1990 0.0005 transmembrane protein affects septum formation and cell membrane permeability acrF b3266 0.4401 0.0079 AcrEF-TolC Drug Efflux Transport System ade b3665 0.4857 0.0346 cryptic adenine deaminase monomer agaA b3135 1.3368 0.0175 AgaA agp b1002 1.7053 0.0169 3-phytase / glucose-1-phosphatase allD b0517 0.8448 0.0140 ureidoglycolate dehydrogenase alsK b4084 2.0491 0.0034 putative D-allose kinase amn b1982 0.6066 0.0233 AMP nucleosidase ampH b0376 0.6290 0.0473 putative enzyme apt b0469 0.4031 0.0012 adenine phosphoribosyltransferase arcB b3210 1.3746 0.0005 ArcB-Phis292 argE b3957 0.4469 0.0206 acetylornithine deacetylase argP b2916 1.8354 0.0114 ArgP transcriptional activator argR b3237 0.8272 0.0077 ArgR transcriptional dual regulator aroG b0754 0.4066 0.0018 2-dehydro-3-deoxyphosphoheptonate aldolase aroL b0388 0.6991 0.0407 shikimate kinase II aroM b0390 1.2587 0.0066 protein of aro operon, regulated by aroR arsR b3501 2.1332 0.0342 ArsR transcriptional regulator artJ b0860 1.4705 0.0115 arginine ABC transporter ascF b2715 0.6756 0.0021 EIIAsc asd b3433 0.3715 0.0107 aspartate semialdehyde dehydrogenase asr b1597 1.4676 0.0477 acid shock protein atoC b2220 1.4762 0.0173 AtoC-Pasp b0165 b0165 0.5609 0.0062 hypothetical protein b0255 b0255 0.4577 0.0292 hypothetical protein b0501 b0501 1.7323 0.0252 hypothetical protein b0582 b0582 1.6254 0.0305 IS186 protein b0609 b0609 1.7352 0.0238 hypothetical protein b1052 b1052 0.6634 0.0425 hypothetical protein b1144 b1144 2.3356 0.0306 hypothetical protein b1371 b1371 1.3289 0.0228 hypothetical protein b1402 b1402 0.5199 0.0099 IS22 protein b1578 b1578 0.3596 0.0018 hypothetical protein b3004 b3004 1.5667 0.0459 hypothetical protein b3044 b3044 0.4341 0.0020 IS21 protein b3975 b3975 0.6083 0.0012 hypothetical protein bcp b2480 0.4248 0.0031 thiol peroxidase bcsB b3532 1.3097 0.0175 cellulose biosynthesis protein bcsZ b3531 1.5108 0.0233 endo-1,4-D-glucanase bfd b3337 1.5485 0.0247 bacterioferritin-associated ferredoxin bglJ b4366 0.6250 0.0347 BglJ transcriptional regulator bisC b3551 0.7735 0.0310 biotin sulfoxide reductase / methionine-S-sulfoxide reductase bolA b0435 1.2797 0.0184 BolA transcriptional regulator borD b0557 0.3304 0.0257 bacteriophage lambda Bor protein homolog outer membrane receptor for transport of vitamin B12, E colicins, and btuB b3966 2.9792 0.0085 bacteriophage BF23 btuF b0158 1.6355 0.0409 periplasmic vitamin B12 binding protein cadA b4131 1.5715 0.0317 lysine decarboxylase caiD b0036 1.4534 0.0482 crotonobetainyl-CoA hydratase / carnitine racemase carA b0032 0.2101 0.0070 carbamoyl phosphate synthetase ccmA b2201 1.6431 0.0142 CcmABCDEFGH cytochrome c biogenesis system cfa b1661 0.6266 0.0211 cyclopropane fatty acid synthase cheY b1882 1.3741 0.0165 CheY-Pasp citX b0614 1.6215 0.0232 holo-ACP synthase clpA b0882 1.3076 0.0196 ATP-binding component of serine protease clpB b2592 1.7953 0.0255 ClpB chaperone cmr b0842 0.6968 0.0355 MdfA/Cmr MFS multidrug transporter 137

APPENDIX I

gene blattner ratio p-value Function A/B cobC b0638 2.3925 0.0065 alpha-ribazole-5'-P phosphatase codA b0337 0.3324 0.0112 cytosine deaminase codB b0336 0.3778 0.0284 CodB cytosine NCS1 transporter corA b3816 0.6187 0.0409 CorA magnesium ion MIT transporter cpdA b3032 0.6411 0.0141 cAMP phosphodiesterase cpsB b2049 4.1414 0.0042 mannose-1-phosphate guanylyltransferase-(GDP) cpsG b2048 3.9546 0.0014 phosphomannomutase regulator of the Cpx response and possible chaperone involved in resistance to cpxP b3913 2.3448 0.0199 extracytoplasmic stress creB b4398 0.3912 0.0063 CreB- Phosphorylated transcriptional regulator crl b0240 0.3398 0.0058 Crl transcriptional regulator csgA b1042 1.1757 0.0491 curlin, major subunit csgD b1040 0.3335 0.0298 CsgD transcriptional activator csgE b1039 0.3294 0.0116 curli production assembly/transport component csgG b1037 0.6373 0.0467 curli production component cspA b3556 0.1595 0.0272 cold shock protein CspA cspB b1557 0.0804 0.0020 cold shock protein CspB cspF b1558 0.1563 0.0010 cold shock protein CspF cspI b1552 0.4222 0.0364 cold shock protein CspI cvpA b2313 0.4563 0.0323 membrane protein required for colicin V production cyaY b3807 0.7207 0.0274 iron-binding frataxin homolog cybB b1418 0.4149 0.0121 cytochrome b561 cybC b4236 0.5877 0.0172 cytochrome b562 (soluble) cynR b0338 1.4730 0.0246 CynR-Cyanate transcriptional activator cyoA b0432 1.6203 0.0356 cytochrome bo terminal oxidase subunit II cyoD b0429 1.2541 0.0388 cytochrome bo terminal oxidase subunit IV cyoE b0428 1.7729 0.0214 heme O synthase cysJ b2764 0.8120 0.0324 sulfite reductase flavoprotein subunit cysM b2421 0.7167 0.0338 O-acetylserine (thiol)-lyase B cytR b3934 0.3074 0.0076 CytR-cytidine dapA b2478 0.5629 0.0328 dihydrodipicolinate synthase dapF b3809 0.5061 0.0428 diaminopimelate epimerase dcm b1961 0.8273 0.0436 DNA cytosine methylase dcrB b3472 2.0849 0.0233 conserved protein involved in bacteriophage adsorption ddpA b1487 1.5696 0.0361 YddS ddpC b1485 2.0675 0.0310 YddQ inner membrane serine protease required for the extracytoplasmic stress response degS b3235 0.4723 0.0130 mediated by sigmaE dfp b3639 0.4912 0.0038 P-pantothenate cysteine ligase / P-pantothenoylcysteine decarboxylase dnaB b4052 0.2288 0.0030 chromosome replication; chain elongation; part of primosome dnaG b3066 2.0680 0.0024 DNA biosynthesis; DNA primase dppC b3542 1.7014 0.0194 dipeptide ABC transporter dppF b3540 1.6050 0.0225 dipeptide ABC transporter dsbB b1185 0.7021 0.0043 dsbB protein dsbC b2893 0.5304 0.0070 DsbC_oxidized dtd b3887 0.6855 0.0317 D-Tyr-tRNATyr deacylase dxr b0173 1.5005 0.0195 DXP reductoisomerase oxaloacetate decarboxylase / 2-keto-3-deoxy-6-phosphogluconate aldolase / 2- eda b1850 1.6768 0.0060 keto-4-hydroxyglutarate aldolase elaA b2267 0.7645 0.0471 hypothetical protein elaC b2268 0.6841 0.0220 binuclear zinc phosphodiesterase monomer emrE b0543 1.4396 0.0395 EmrE SMR transporter entD b0583 0.7069 0.0132 phosphopantetheinyl transferase entE b0594 0.5193 0.0155 enterobactin synthase multienzyme complex envR b3264 0.6510 0.0447 EnvR transcriptional regulator epd b2927 0.4460 0.0015 erythrose 4-phosphate dehydrogenase eutN b2456 1.0929 0.0134 putative detox protein, ethanolamine utilization 138

APPENDIX I

gene blattner ratio p-value Function A/B beta-hydroxyacyl-ACP dehydrase / beta-hydroxydecanoyl-ACP dehydrase / trans- fabA b0954 1.3210 0.0488 2-decenoyl-ACP isomerase fabB b2323 0.5971 0.0302 beta-ketoacyl-ACP synthase I / malonyl-ACP decarboxylase fadE b0221 1.6673 0.0495 acyl-CoA dehydrogenase fdnI b1476 1.9523 0.0061 formate dehydrogenase N, γ subunit involved in protein transport; multicopy suppressor of dominant negative ftsH fdrA b0518 1.2709 0.0284 mutants outer membrane receptor; citrate-dependent iron transport, outer membrane fecA b4291 1.7276 0.0273 receptor fecI b4293 3.0790 0.0101 sigma19 factor fhuC b0151 0.5705 0.0007 ferrichrome uptake system fldA b0684 1.1793 0.0126 oxidized flavodoxin 1 flgJ b1081 1.5509 0.0122 FlgJ flhD b1892 0.3498 0.0204 FlhD transcriptional dual regulator fliK b1943 1.5668 0.0293 flagellar hook-length control protein FliK periplasmic cystine-binding protein; member of extracellular bacterial solute- fliY b1920 0.5595 0.0124 binding protein family III fmt b3288 1.4785 0.0271 10-formyltetrahydrofolate:L-methionyl-tRNA(fMet) N-formyltransferase fnr b1334 2.6607 0.0164 FNR transcriptional dual regulator folB b3058 0.5634 0.0051 dihydroneopterin aldolase methyleneTHF enzyme / methenyltetrahydrofolate cyclohydrolase / folD b0529 0.6659 0.0470 methylenetetrahydrofolate dehydrogenase-(NADP+) fre b3844 1.6805 0.0020 FMN reductase frlR b3375 0.7577 0.0058 putative transcriptional regulator frmA b0356 1.5071 0.0219 formaldehyde dehydrogenase, glutathione-dependent frsA b0239 0.4360 0.0232 fermentation/respiration switch protein fruR b0080 0.6025 0.0156 FruR transcriptional dual regulator frvA b3900 1.5012 0.0441 EIIABCFrv frwB b3950 2.0264 0.0163 EIIBCFrw frwC b3949 1.7660 0.0430 EIIBCFrw ftsB b2748 0.3995 0.0032 essential cell division protein FtsB fumB b4122 1.5288 0.0433 fumarase B monomer fur b0683 1.5727 0.0358 Fur transcriptional dual regulator gadX b3516 0.5996 0.0010 GadX transcriptional activator UDP-glucose-hexose-1-phosphate uridylyltransferase / galactose-1-phosphate galT b0758 1.5496 0.0183 uridylyltransferase galU b1236 1.1283 0.0373 UTP-glucose-1-phosphate uridylyltransferase gapC_1 b1417 0.6328 0.0268 split glyceraldehyde 3-phosphate dehydrogenase C gapC_2 b1416 0.7832 0.0228 glyceraldehyde 3-phosphate dehydrogenase C, interrupted gatC b2092 0.5533 0.0229 EIIGat gatD b2091 0.5303 0.0482 galactitol-1-phosphate dehydrogenase gatY b2096 0.2303 0.0083 tagatose-1,6-bisphosphate aldolase 2 gatZ b2095 0.3772 0.0024 tagatose-1,6-bisphosphate aldolase 2 gcvH b2904 0.1767 0.0186 dihydrolipoyl-GcvH-protein gcvR b2479 0.2386 0.0003 GcvR-gly glcA b2975 1.2470 0.0468 YghK transporter glf b2036 1.4291 0.0266 UDP-galactopyranose mutase N-acetylglucosamine-1-phosphate uridyltransferase / glucosamine-1-phosphate glmU b3730 0.2684 0.0006 acetyltransferase glnD b0167 1.5254 0.0066 uridylyltransferase / uridylyl-removing enzyme glpB b2242 1.6094 0.0343 glycerol-3-phosphate-dehydrogenase, anaerobic glpD b3426 0.6947 0.0391 glycerol 3-phosphate dehydrogenase, aerobic gltI b0655 2.1460 0.0238 putative periplasmic binding transport protein gltJ b0654 1.8439 0.0084 glutamate ABC transporter gltL b0652 2.3251 0.0499 glutamate ABC transporter glyA b2551 0.6522 0.0151 glycine hydroxymethyltransferase glyQ b3560 0.7048 0.0451 glycine-tRNA synthetase, alpha subunit gntU b4476 1.5662 0.0354 GntU gluconate Gnt transporter gntY b3414 2.5638 0.0235 predicted membrane-bound protein that is involved in high-affinity gluconate 139

APPENDIX I

gene blattner ratio p-value Function A/B transport xanthine phosphoribosyltransferase / guanine phosphoribosyltransferase / gpt b0238 0.6101 0.0011 hypoxanthine phosphoribosyltransferase transcription elongation factor; stimulates the mRNA cleavage activity of RNA greA b3181 2.0067 0.0017 polymerase grxA b0849 1.5161 0.0008 oxidized glutaredoxin grxB b1064 0.6716 0.0024 oxidized glutaredoxin 2 gspC b3324 0.6446 0.0495 putative protein secretion protein for export gspD b3325 0.6169 0.0078 putative protein secretion protein for export gspG b3328 1.3373 0.0380 putative protein secretion protein for export gspJ b3331 1.5637 0.0307 putative protein secretion protein for export gspM b3334 1.6029 0.0266 putative protein secretion protein gst b1635 0.4622 0.0007 glutathione transferase guaB b2508 0.4105 0.0135 IMP dehydrogenase gudX b2788 2.0225 0.0315 putative glucarate dehydratase gyrB b3699 2.0935 0.0014 DNA gyrase, subunit B hcaC b2540 0.6918 0.0184 ferredoxin, 3-phenylpropionate dioxygenase system hcaT b2536 0.7188 0.0131 HcaT MFS transporter hcr b0872 1.7460 0.0357 NADH oxidoreductase hdeA b3510 0.6336 0.0024 acid-resistance protein, possible chaperone hdfR b4480 0.5965 0.0480 transcriptional regulator hemA b1210 2.4332 0.0162 glutamyl-tRNA reductase hemC b3805 0.3060 0.0013 hydroxymethylbilane synthase hemD b3804 0.4619 0.0020 uroporphyrinogen III synthase hemG b3850 0.6070 0.0126 protoporphyrinogen oxidase hemH b0475 1.6618 0.0431 ferrochelatase hflD b1132 0.5428 0.0224 membrane protein in operon with purB hflX b4173 0.6818 0.0118 putative GTPase; possible regulator of HflKC RNA-binding protein that affects many cellular processes; homolog of hfq b4172 0.5741 0.0397 mammalian Sm/Sm-like proteins hha b0460 0.3066 0.0051 haemolysin expression modulating protein hisC b2021 0.5274 0.0366 histidine-phosphate aminotransferase hisD b2020 0.4683 0.0485 histidinal dehydrogenase / histidinol dehydrogenase hisF b2025 0.8078 0.0189 imidazole glycerol phosphate synthase, HisF subunit hisS b2514 0.6173 0.0477 histidyl-tRNA synthetase hns b1237 0.5055 0.0012 H-NS transcriptional dual regulator hofO b3393 2.0366 0.0008 conserved hypothetical protein holA b0640 1.8168 0.0002 DNA polymerase III, delta subunit holC b4259 0.2779 0.0200 DNA polymerase III, chi subunit holE b1842 0.2376 0.0017 DNA polymerase III, theta subunit hslR b3400 1.6952 0.0251 heat shock protein Hsp15 htrA b0161 1.3676 0.0489 DegP htrL b3618 3.3010 0.0333 involved in lipopolysaccharide biosynthesis hycH b2718 1.3428 0.0378 processing of large subunit (HycE) of hydrogenase 3 (part of the FHL complex) hypF b2712 1.5597 0.0001 hydrogenase maturation protein ibpA b3687 1.9972 0.0407 small heat shock protein IbpA iclR b4018 0.3761 0.0272 IclR-PEP idnD b4267 0.6061 0.0334 L-idonate 5-dehydrogenase idnO b4266 0.6120 0.0319 5-keto-D-gluconate 5-reductase / putative acetoin dehydrogenase ilvG_1 b3767 0.3376 0.0394 IlvG_1 ilvM b3769 0.3697 0.0001 acetohydroxybutanoate synthase II / acetolactate synthase II imp b0054 0.6460 0.0370 organic solvent tolerance infA b0884 1.9363 0.0438 protein chain initiation factor IF-1 intR b1345 0.5249 0.0341 putative transposase intZ b2442 0.7707 0.0220 putative prophage integrase iscR b2531 3.2160 0.0490 IscR transcriptional regulator iscU b2529 2.3333 0.0037 scaffold protein involved in iron-sulfur cluster assembly 140

APPENDIX I

gene blattner ratio p-value Function A/B iscX b2524 1.9429 0.0374 protein with possible role in iron-sulfur cluster biogenesis ispA b0421 0.2156 0.0032 geranyl diphosphate synthase / farnesyl diphosphate synthase ispG b2515 0.4793 0.0372 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate synthase kdpA b0698 1.4635 0.0082 potassium ion P-type ATPase transporter kdtA b3633 0.5128 0.0192 KDO transferase kefC b0047 1.4900 0.0328 KefC potassium CPA2 transporter lctD b3605 1.5950 0.0088 L-Lactate:Quinone Oxidoreductase leuA b0074 0.5604 0.0386 2-isopropylmalate synthase leuO b0076 0.4172 0.0372 LeuO transcriptional activator ligT b0147 0.3631 0.0028 hypothetical protein lipB b0630 1.7073 0.0027 lipoyl-protein ligase lolB b1209 0.5077 0.0232 outer membrane lipoprotein, localization of lipoproteins in the outer membrane lon b0439 1.7720 0.0416 DNA-binding, ATP-dependent protease La lpcA b0222 0.5206 0.0283 lipopolysaccharide core biosynthesis; phosphoheptose isomerase lpxP b2378 1.5961 0.0222 palmitoleoyl acyltransferase maa b0459 0.4667 0.0368 maltose acetyltransferase malP b3417 1.6906 0.0124 maltodextrin phosphorylase monomer malT b3418 0.4985 0.0239 MalT-MalK marA b1531 0.5442 0.0225 MarA transcriptional activator mazE b2783 0.8900 0.0434 antitoxin of the MazEF "addiction module" mcrA b1159 0.4973 0.0172 restriction of DNA at 5-methylcytosine residues mcrB b4346 1.3712 0.0144 MrcB subunit of 5-methylcytosine restriction system mdaB b3028 0.5909 0.0179 NADPH quinone reductase mdoG b1048 1.3670 0.0155 periplasmic glucan (MDO) biosynthesis protein mdtF b3514 2.2727 0.0041 YhiV mdtK b1663 0.4631 0.0216 NorE multidrug efflux MATE transporter mdtN b4082 1.4199 0.0116 putative membrane protein menF b2265 0.3329 0.0082 isochorismate synthase, menaquinone-specific metC b3008 1.3616 0.0383 L-cysteine desulfhydrase / cystathionine-beta-lyase mgrB b1826 0.6490 0.0364 hypothetical protein; product of a gene induced by low magnesium cell division inhibitor of the MinC-MinD-MinE and DicB-MinC systems that minC b1176 0.1945 0.0010 regulate septum placement membrane ATPase of the MinC-MinD-MinE system that regulates septum minD b1175 0.3435 0.0101 placement cell division topological specificity factor and inhibitory component of the MinC- minE b1174 0.3672 0.0145 MinD-MinE system that regulates septum placement mltC b2963 0.5062 0.0384 membrane-bound lytic murein transglycosylase C mnmC b2324 0.5470 0.0326 bifunctional enzyme catalyzing the formation of mnm5s2U in tRNA mobA b3857 0.6706 0.0302 molybdopterin guanine dinucleotide synthase MotB protein, enables flagellar motor rotation, linking torque machinery to cell motB b1889 0.7051 0.0060 wall mreB b3251 0.5301 0.0235 rod shape-determining protein msbB b1855 0.3370 0.0177 myristoyl acyltransferase methionine sulfoxide reductase B / protein-methionine-S-oxide reductase / msrB b1778 1.0943 0.0060 methionine sulfoxide reductase mtlD b3600 0.4275 0.0087 mannitol-1-phosphate 5-dehydrogenase mukE b0923 0.4201 0.0052 protein involved in chromosome partitioning mukF b0922 0.2947 0.0054 Ca2+-binding protein involved in chromosome partitioning murC b0091 1.5288 0.0169 UDP-N-acetylmuramate-alanine ligase murI b3967 2.4431 0.0020 glutamate racemase mutM b3635 1.4678 0.0408 formamidopyrimidine DNA glycosylase mutY b2961 0.3818 0.0326 adenine glycosylase; G.C --> T.A transversions nadD b0639 2.2259 0.0009 nicotinate-mononucleotide adenylyltransferase nadE b1740 0.7970 0.0374 NAD+ synthase, glutamine dependent / NAD+ synthase, NH3-dependent nadK b2615 1.2935 0.0461 NAD kinase monomer nagZ b1107 0.5177 0.0214 β-N-acetylglucosaminidase nanR b3226 0.3753 0.0253 NanR transcriptional regulator napC b2202 1.5349 0.0131 cytochrome c protein 141

APPENDIX I

gene blattner ratio p-value Function A/B narI b1227 1.4294 0.0314 nitrate reductase A, γ subunit narP b2193 0.5047 0.0363 NarP-Phosphorylated transcriptional regulator narX b1222 0.7241 0.0227 NarX-Phis ndh b1109 0.3534 0.0481 NADH cupric reductase / NADH dehydrogenase II nfo b2159 0.7313 0.0447 endonuclease IV nhaA b0019 1.6748 0.0323 sodium/proton NhaA transporter nhaB b1186 0.7111 0.0329 NhaB sodium/proton transporter nhaR b0020 1.5626 0.0364 NhaR-Na+ transcriptional activator nirD b3366 1.2931 0.0487 nitrite reductase, small subunit nlpB b2477 0.4282 0.0017 lipoprotein-34 nlpD b2742 0.5889 0.0384 NlpD putative outer membrane lipoprotein nmpC b0553 0.2798 0.0066 outer membrane porin protein; locus of qsr prophage nrdH b2673 1.5595 0.0197 glutaredoxin-like protein; hydrogen donor nrfB b4071 1.4551 0.0140 nitrite reductase complex nrfG b4076 0.7857 0.0445 maturation of formate-dependent nitrite reductase complex nth b1633 2.1800 0.0177 endonuclease III; specific for apurinic and/or apyrimidinic sites nudF b3034 0.5025 0.0228 hypothetical protein nudH b2830 0.4636 0.0223 putative invasion protein nuoA b2288 1.6995 0.0472 NADH dehydrogenase I nuoB b2287 1.5197 0.0379 NADH dehydrogenase I nuoE b2285 1.4198 0.0304 NADH dehydrogenase I nuoF b2284 1.4220 0.0317 NADH dehydrogenase I nusG b3982 0.2852 0.0347 component in transcription antitermination ompX b0814 1.4445 0.0493 outer membrane protein X osmB b1283 3.4496 0.0098 OsmB osmotically inducible lipoprotein para-aminobenzoate synthase multi-enzyme complex / para-aminobenzoate pabA b3360 1.6781 0.0002 synthase para-aminobenzoate synthase multi-enzyme complex / para-aminobenzoate pabB b1812 0.5495 0.0354 synthase para-aminobenzoate synthase multi-enzyme complex / para-aminobenzoate pabC b1096 0.3442 0.0019 synthase panB b0134 0.7353 0.0027 3-methyl-2-oxobutanoate hydroxymethyltransferase monomer panE b0425 0.5460 0.0418 2-dehydropantoate reductase parC b3019 0.4320 0.0075 Topoisomerase IV subunit A pcnB b0143 0.6795 0.0070 poly(A) polymerase I pdxA b0052 1.3711 0.0238 PdxA dehydrogenase/decarboxylase pdxK b2418 1.2254 0.0374 pyridoxamine kinase / hydroxymethylpyrimidine kinase / pyridoxal kinase pepA b4260 0.3097 0.0122 aminopeptidase A/I pepB b2523 2.2644 0.0239 aminopeptidase (AP) pepP b2908 1.3593 0.0065 proline aminopeptidase P II pepT b1127 0.6833 0.0395 peptidase T pgm b0688 1.5303 0.0417 phosphoglucomutase pgpB b1278 0.4697 0.0419 phosphatidylglycerophosphatase B pheA b2599 0.6656 0.0384 chorismate mutase / prephenate dehydratase pheT b1713 0.7457 0.0492 phenylalanyl-tRNA synthetase β-chain phoP b1130 0.6028 0.0020 PhoP-Phosphorylated transcriptional dual regulator pitB b2987 0.4848 0.0403 PitB plsC b3018 0.4674 0.0213 1-acylglycerol-3-phosphate acyltransferase protease involved in Microcin B17 maturation and in sensitivity to the DNA pmbA b4235 0.4596 0.0021 gyrase inhibitor LetD pmrF b2254 0.5087 0.0075 undecaprenyl phosphate-L-Ara4FN transferase pncA b1768 1.5147 0.0154 pyrazinamidase / nicotinamidase polB b0060 3.0331 0.0022 DNA polymerase II poxA b4155 0.4978 0.0301 putative regulator of pyruvate oxidase protein phosphatase 2 / protein-tyrosine-phosphatase / phosphoprotein pphB b2734 1.5408 0.0047 phosphatase ppk b2501 0.3409 0.0076 polyphosphate kinase pppA b2972 0.8174 0.0270 prepilin peptidase 142

APPENDIX I

gene blattner ratio p-value Function A/B pqqL b1494 2.4892 0.0097 putative zinc peptidase prkB b3355 0.6558 0.0194 probable phosphoribulokinase prmA b3259 1.1549 0.0237 methylation of 50S ribosomal subunit protein L11 proB b0242 0.4436 0.0305 gamma-glutamyl kinase-GP-reductase multienzyme complex proQ b1831 0.4270 0.0085 protein that affects osmoregulation of ProP transporter prpR b0330 1.3979 0.0217 PrpR transcriptional regulator pspE b1308 1.3420 0.0120 thiosulfate sulfurtransferase pssA b2585 0.3090 0.0108 phosphatidylserine synthase ptsA b3947 1.4554 0.0198 PEP-protein phosphotransferase system enzyme I purA b4177 0.5294 0.0086 adenylosuccinate synthase purC b2476 0.1639 0.0003 phosphoribosylaminoimidazole-succinocarboxamide synthase purE b0523 0.2509 0.0013 N5-carboxyaminoimidazole ribonucleotide mutase purF b2312 0.2414 0.0192 amidophosphoribosyl transferase purM b2499 0.1577 0.0004 phosphoribosylformylglycinamide cyclo-ligase purN b2500 0.5155 0.0120 phosphoribosylglycinamide formyltransferase purR b1658 0.3655 0.0001 PurR transcriptional repressor purT b1849 0.6975 0.0250 GAR transformylase 2 purU b1232 0.4724 0.0343 formyltetrahydrofolate deformylase puuC b1300 1.2759 0.0124 aldehyde dehydrogenase pykA b1854 1.2788 0.0072 pyruvate kinase II monomer pykF b1676 0.6019 0.0200 pyruvate kinase I monomer pyrC b1062 0.5738 0.0154 dihydroorotase pyrF b1281 0.3505 0.0074 orotidine-5'-phosphate-decarboxylase qseB b3025 0.5963 0.0366 putative 2-component transcriptional regulator radC b3638 0.7993 0.0107 hypothetical protein rarA b0892 1.3775 0.0153 recombination factor rbsA b3749 1.3686 0.0067 ribose ABC transporter rdoA b3859 0.3650 0.0037 cytoplasmic protein of low abundance RecB; DNA helicase, ATP-dependent dsDNA/ssDNA exonuclease V subunit, recB b2820 1.3049 0.0003 ssDNA endonuclease recF b3700 1.8782 0.0203 ssDNA and dsDNA binding, ATP binding recN b2616 3.2489 0.0013 protein used in recombination and DNA repair rfaJ b3626 2.9390 0.0359 UDP-D-glucose:(galactosyl)lipopolysaccharide glucosyltransferase rfaK b3623 2.5429 0.0162 lipopolysaccharide core biosynthesis; probably hexose transferase rfaS b3629 2.4712 0.0160 lipopolysaccharide core biosynthesis rfaY b3625 2.7443 0.0257 lipopolysaccharide core biosynthesis rfaZ b3624 2.8758 0.0135 protein involved in KdoIII attachment during lipopolysaccharide core biosynthesis rfbX b2037 1.5328 0.0192 RfbX lipopolysaccharide PST transporter rfc b2035 2.1537 0.0085 O-antigen polymerase rfe b3784 0.2504 0.0025 undecaprenyl-phosphate α-N-acetylglucosaminyl transferase rffC b3790 1.8384 0.0174 TDP-fucosamine acetyltransferase rhaR b3906 1.5371 0.0023 RhaR-L-rhamnose transcriptional activator rhlE b0797 0.5998 0.0306 DEAD-box-containing ATP-dependent RNA helicase family member rhsD b0497 0.3038 0.0094 RhsD protein in rhs element ribB b3041 0.4756 0.0036 3,4-dihydroxy-2-butanone 4-phosphate synthase ribC b1662 0.6034 0.0484 riboflavin synthase ribF b0025 0.2311 0.0048 riboflavin kinase / FMN adenylyltransferase acetylates N-terminal alanine of 30S ribosomal subunit protein S18 / ribosomal- rimI b4373 1.2616 0.0232 protein-alanine N-acetyltransferase acetylates N-terminal alanine of 30S ribosomal subunit protein S5 / ribosomal- rimJ b1066 0.3654 0.0033 protein-alanine N-acetyltransferase rluE b1135 1.5925 0.0139 23S rRNA pseudouridine synthase rnc b2567 0.3545 0.0116 RNase III, ds RNA rpmA b3185 1.2009 0.0086 50S ribosomal subunit protein L27 rpmB b3637 0.7069 0.0448 50S ribosomal subunit protein L28 rpmF b1089 1.3157 0.0137 50S ribosomal subunit protein L32 rpoD b3067 2.3387 0.0271 sigma70 factor 143

APPENDIX I

gene blattner ratio p-value Function A/B rpoE b2573 0.6299 0.0405 sigmaE rpoH b3461 1.4151 0.0363 sigma32 factor rseA b2572 0.4158 0.0006 anti-sigma factor that inhibits sigmaE negative regulator of sigmaE; interacts with RseA and stimulates binding of RseA rseB b2571 0.5185 0.0085 to sigmaE rssA b1234 0.5582 0.0116 hypothetical protein rssB b1235 0.6895 0.0442 RssB-P rsxA b1627 1.9291 0.0099 integral membrane protein of SoxR-reducing complex rsxB b1628 1.6538 0.0104 member of SoxR-reducing complex rsxC b1629 2.0272 0.0303 member of SoxR-reducing complex rsxD b1630 1.5930 0.0439 integral membrane protein of SoxR-reducing complex rsxE b1632 2.2544 0.0002 integral membrane protein of SoxR-reducing complex rsxG b1631 2.4324 0.0084 member of SoxR-reducing complex rtn b2176 1.1293 0.0298 hypothetical protein sanA b2144 0.4376 0.0187 vancomycin sensitivity sbcD b0398 1.3094 0.0159 ATP-dependent dsDNA exonuclease sdaB b2797 1.2729 0.0279 L-threonine deaminase II / L-serine deaminase 2 sdhA b0723 2.4428 0.0087 succinate dehydrogenase flavoprotein sdhB b0724 1.8201 0.0024 succinate dehydrogenase iron-sulfur protein sdhC b0721 2.3445 0.0253 succinate dehydrogenase membrane protein sdhD b0722 1.9449 0.0060 succinate dehydrogenase membrane protein sdiA b1916 0.5260 0.0202 SdiA transcriptional activator secE b3981 0.2013 0.0210 Sec Protein Secretion Complex secG b3175 0.5355 0.0233 Sec Protein Secretion Complex sfsB b3188 1.4450 0.0295 Nlp transcriptional regulator shiA b1981 0.3314 0.0445 ShiA shikimate MFS transporter skp b0178 1.3482 0.0022 periplasmic chaperone smg b3284 0.4759 0.0018 hypothetical protein smpA b2617 2.0368 0.0327 SmpA small membrane protein A smtA b0921 0.1981 0.0013 S-adenosylmethionine-dependent methyltransferase sodC b1646 0.5884 0.0295 superoxide dismutase precursor (Cu-Zn) speC b2965 1.1224 0.0484 ornithine decarboxylase, biosynthetic speG b1584 0.4098 0.0187 spermidine acetyltransferase spr b2175 0.3174 0.0244 putative lipoprotein spy b1743 1.6823 0.0465 periplasmic protein related to spheroblast formation 30S ribosomal subunit protein S22; sub-stoichiometric stationary phase ribosomal sra b1480 0.5126 0.0007 component srlR b2707 0.4372 0.0018 GutR-sorbitol srmB b2576 0.2487 0.0347 SrmB, DEAD-box RNA helicase sscR b2765 0.5881 0.0085 putative 6-pyruvoyl tetrahydrobiopterin synthase sspA b3229 1.4235 0.0255 regulator of transcription; stringent starvation protein A sthA b3962 1.4674 0.0398 soluble pyridine nucleotide transhydrogenase sucA b0726 1.7215 0.0420 subunit of E1(0) component of 2-oxoglutarate dehydrogenase sufS b1680 1.4919 0.0303 L-selenocysteine lyase (and L-cysteine desulfurase) monomer sulA b0958 0.3282 0.0018 suppressor of lon; inhibits cell division and ftsZ ring formation tam b1519 1.3876 0.0359 trans-aconitate methyltransferase tap b1885 2.0690 0.0425 MCP-IV tatB b3838 1.3899 0.0436 TatABCE protein export complex tatC b3839 1.3590 0.0079 TatABCE protein export complex tdcB b3117 1.5829 0.0012 threonine dehydratase (catabolic) tdcC b3116 0.6742 0.0130 TdcC threonine STP transporter tesA b0494 0.4687 0.0017 lysophospholipase L₁ / thioesterase I thyA b2827 2.4688 0.0437 thymidylate synthase tktA b2935 0.7435 0.0147 transketolase I tolC b3035 0.6930 0.0345 TolC outer membrane channel torS b0993 0.8969 0.0128 TorS-Phis850 torY b1873 0.3115 0.0139 trimethylamine N-oxide reductase III, c-type cytochrome subunit 144

APPENDIX I

gene blattner ratio p-value Function A/B torZ b1872 0.7072 0.0237 trimethylamine N-oxide reductase III, TorZ subunit trkH b3849 0.6885 0.0381 TrkH potassium ion Trk Transporter trmH b3651 1.8914 0.0192 tRNA (Gm18) 2'-O-methyltransferase trpE b1264 0.3805 0.0021 anthranilate synthase component I trxB b0888 2.0565 0.0480 thioredoxin reductase monomer tsx b0411 0.2461 0.0277 nucleoside channel; receptor of phage T6 and colicin K ttk b3641 0.6729 0.0216 Ttk transcriptional regulator tufA b3339 0.7291 0.0156 elongation factor Tu tyrR b1323 0.7217 0.0246 TyrR-Phenylalanine transcriptional repressor ubiC b4039 0.2269 0.0075 chorismate pyruvate lyase udk b2066 1.5831 0.0047 uridine kinase / cytidine kinase ugpB b3453 1.9109 0.0225 glycerol-3-P ABC transporter / tranport ulaG b4192 1.5035 0.0480 putative L-ascorbate 6-phosphate lactonase uppS b0174 0.6969 0.0442 subunit of undecaprenyl diphosphate synthase uspF b1376 0.5835 0.0176 nucleotide binding protein uvrB b0779 1.7413 0.0390 DNA repair; excision nuclease subunit B uvrY b1914 0.5143 0.0135 UvrY- Phosphorylated transcriptional regulator DNA mismatch endonuclease of the very short patch (VSP) mismatch repair vsr b1960 0.6583 0.0004 pathway wbbI b2034 1.8917 0.0454 hypothetical protein; not required for colanic acid biosynthesis wcaB b2058 3.4010 0.0356 putative transferase wcaC b2057 3.4672 0.0035 putative glycosyl transferase wcaE b2055 2.1253 0.0353 putative colanic acid biosynthesis glycosyl transferase wcaF b2054 2.3400 0.0172 putative transferase wcaJ b2047 3.5268 0.0124 putative colanic acid biosynthsis UDP-glucose lipid carrier transferase wcaK b2045 3.6607 0.0020 putative galactokinase (EC 2.7.1.6). wcaL b2044 3.4923 0.0027 putative colanic biosynthesis glycosyl transferase wcaM b2043 3.6739 0.0018 hypothetical protein wzc b2060 2.2224 0.0433 tyrosine kinase involved in colanic acid biosynthesis wzxC b2046 3.2937 0.0149 WzxC metabolism; biosynthesis of macromolecules (cellular constituents); wzxE b3792 1.7476 0.0290 enterobacterial common antigen (surface glycolipid) transport wzzE b3785 0.5895 0.0452 putative transport protein xapR b2405 0.3135 0.0382 XapR transcriptional activator xdhB b2867 1.1750 0.0243 putative xanthine dehydrogenase subunit, FAD-binding domain putative oxidoreductase; possible component of selenate reductase with possible xdhD b2881 1.6833 0.0105 role in purine salvage xerD b2894 0.4958 0.0395 site-specific recombinase xseB b0422 0.1694 0.0020 exonuclease VII, small subunit xylA b3565 0.4106 0.0021 xylose isomerase xylG b3567 0.8076 0.0315 xylose ABC transporter xylR b3569 0.5108 0.0188 XylR-Xylose transcriptional activator yabP b0056 0.5438 0.0159 conserved hypothetical protein yadL b0137 0.6723 0.0395 putative adhesin-like protein yaeB b0195 1.4683 0.0342 hypothetical protein yaeF b0193 1.3932 0.0097 putative synthase of the YaeF/YiiX family yaeH b0163 0.7470 0.0373 putative structural protein conserved protein; in enteroaggregative E. coli, YafK is required for development yafK b0224 0.3497 0.0087 of biofilms yagA b0267 1.6510 0.0239 hypothetical protein yagK b0277 1.2809 0.0271 hypothetical protein yagL b0278 2.0628 0.0124 DNA-binding protein yagN b0280 0.4906 0.0152 hypothetical protein yagU b0287 0.5401 0.0210 conserved protein yagZ b0293 1.5683 0.0418 conserved hypothetical protein yahA b0315 0.3553 0.0092 hypothetical protein yahG b0321 1.5771 0.0398 conserved protein yahJ b0324 1.6920 0.0040 putative deaminase 145

APPENDIX I

gene blattner ratio p-value Function A/B yaiB b0382 0.2451 0.0009 conserved hypothetical protein yajR b0427 1.2541 0.0397 YajR MFS transporter ybaJ b0461 0.2101 0.0016 conserved hypothetical protein ybaN b0468 0.4651 0.0207 hypothetical protein ybaP b0482 0.4012 0.0131 putative ligase ybbK b0489 1.2971 0.0106 putative protease ybbW b0511 1.7524 0.0306 YbbW NCS1 Transporter ybcK b0544 2.1084 0.0046 hypothetical protein ybdM b0601 1.5187 0.0100 conserved protein ybeD b0631 2.1582 0.0344 conserved hypothetical protein ybeY b0659 2.4213 0.0071 conserved hypothetical protein ybeZ b0660 2.9088 0.0292 putative ATP-binding protein ybfE b0685 1.8437 0.0015 hypothetical protein, transcriptionally regulated by LexA ybgA b0707 1.5859 0.0393 conserved protein ybgD b0719 0.5899 0.0284 putative fimbrial-like protein ybhC b0772 0.4417 0.0083 putative pectinesterase ybiN b0807 0.6910 0.0207 putative methyltransferase ybjC b0850 0.5669 0.0359 conserved hypothetical protein; gene is within soxRS regulon ybjK b0846 1.7319 0.0164 putative DEOR-type transcriptional regulator ybjP b0865 1.4541 0.0338 putative enzyme ycaL b0909 0.4083 0.0132 putative heat shock protein ycbB b0925 0.6763 0.0145 putative amidase ycdO b1018 1.6105 0.0013 conserved hypothetical protein yceJ b1057 1.4910 0.0123 putative cytochrome ycfM b1105 0.5966 0.0118 putative fibronectin-binding protein ycfQ b1111 2.1759 0.0130 hypothetical protein ycgE b1162 0.4795 0.0012 putative transcriptional regulator ycgH_1 b1169 1.8719 0.0154 conserved protein; member of the Autotransporter family ycgJ b1177 0.7096 0.0429 hypothetical protein ycgL b1179 0.3597 0.0007 conserved hypothetical protein ycgN b1181 0.2099 0.0018 conserved hypothetical protein ychF b1203 1.8344 0.0127 putative GTP-binding protein ychJ b1233 0.4063 0.0421 conserved hypothetical protein yciK b1271 0.5205 0.0025 putative oxidoreductase yciO b1267 1.3356 0.0473 conserved protein yciS b1279 0.6049 0.0052 conserved hypothetical protein ycjG b1325 0.4886 0.0004 L-Ala-D/L-Glu epimerase, a muconate lactonizing enzyme ycjZ b1328 0.3753 0.0083 putative transcriptional regulator LYSR-type ydaO b1344 0.4843 0.0448 conserved protein ydaT b1358 1.2401 0.0281 hypothetical protein ydbK b1378 1.3365 0.0031 putative pyruvate synthase ydcD b1457 0.4394 0.0073 hypothetical protein ydcV b1443 1.5826 0.0274 YdcS/YdcT/YdcV/YdcU ABC transporter ydeH b1535 0.6334 0.0003 hypothetical protein ydeI b1536 0.7006 0.0434 conserved hypothetical protein ydeO b1499 1.8404 0.0071 putative ARAC-type regulatory protein ydeP b1501 1.8515 0.0329 acid resistance protein ydeQ b1502 1.5966 0.0329 putative adhesin; similar to FimH protein ydeS b1504 2.0807 0.0078 putative fimbrial-like protein ydfH b1540 0.6051 0.0014 hypothetical protein ydfT b1559 1.2620 0.0433 hypothetical protein YdgE b1599 0.5062 0.0374 YdgE SMR Protein ydgI b1605 1.2957 0.0413 ArcD APC transporter ydgT b1625 0.2841 0.0002 conserved hypothetical protein ydhF b1647 0.5142 0.0040 putative oxidoreductase, NAD(P)-linked ydhH b1640 0.5712 0.0220 conserved hypothetical protein 146

APPENDIX I

gene blattner ratio p-value Function A/B ydhK b1645 0.7743 0.0177 putative membrane protein ydhR b1667 0.5054 0.0468 conserved hypothetical protein ydiA b1703 0.3698 0.0021 conserved protein ydiO b1695 1.7686 0.0429 putative acyl-CoA dehydrogenase ydjF b1770 0.6322 0.0205 putative DEOR-type transcriptional regulator ydjG b1771 1.1870 0.0339 putative oxidoreductase ydjJ b1774 0.7716 0.0258 putative oxidoreductase ydjO b1730 0.7452 0.0045 putative enzyme yeaK b1787 0.5384 0.0111 conserved hypothetical protein yeaL b1789 0.5540 0.0222 hypothetical protein yeaO b1792 0.7835 0.0264 conserved hypothetical protein yeaS b1798 1.1343 0.0208 hypothetical protein yebC b1864 1.9628 0.0112 conserved protein yebE b1846 1.4183 0.0339 conserved hypothetical protein yebF b1847 1.6011 0.0157 conserved hypothetical protein yebG b1848 2.0455 0.0150 hypothetical protein; gene is part of SOS regulon yebK b1853 0.6198 0.0144 hypothetical protein yebN b1821 0.1208 0.0031 putative membrane protein, terpenoid synthase-like yebQ b1828 1.7129 0.0232 YebQ yebR b1832 0.2946 0.0066 conserved hypothetical protein yebY b1839 0.3459 0.0078 conserved hypothetical protein yebZ b1840 0.5397 0.0052 putative resistance protein yecN b1869 0.4794 0.0004 putative membrane protein yecO b1870 0.6886 0.0159 putative methyltransferase yedI b1958 0.7429 0.0417 hypothetical protein yedL b1932 0.8697 0.0339 putative acyl-CoA N-acyltransferase yedS_1 b1964 0.5165 0.0447 putative outer membrane protein yedS_3 b1966 0.5465 0.0327 putative outer membrane protein yedW b1969 0.2470 0.0035 putative 2-component transcriptional response regulator yeeN b1983 7.1154 0.0127 conserved protein yeeT b2003 1.3786 0.0008 hypothetical protein yeeU b2004 2.0721 0.0304 antitoxin of the YeeV-YeeU toxin-antitoxin pair yefM b2017 1.3962 0.0282 antitoxin of the YoeB-YefM toxin-antitoxin pair yegE b2067 1.7115 0.0038 putative sensor-type protein yegI b2070 0.5358 0.0484 putative chaperonin yegS b2086 3.9159 0.0491 conserved protein yehD b2111 2.1221 0.0057 putative fimbrial-like protein yeiE b2157 0.6563 0.0387 LYSR-type transcriptional regulator yejE b2179 1.5636 0.0046 YejA/YejB/YejE/YejF ABC transporter yejG b2181 1.5816 0.0091 conserved hypothetical protein yfaE b2236 1.4667 0.0481 conserved hypothetical protein, 2Fe-2S ferredoxin-related yfbE b2253 0.3390 0.0015 UDP-L-Ara4O C-4" transaminase yfbN b2273 0.6296 0.0373 conserved hypothetical protein yfcL b2325 1.4297 0.0332 conserved hypothetical protein yfcR b2335 1.6257 0.0449 putative fimbrial protein yfdK b2354 0.8266 0.0174 hypothetical protein yfdO b2358 1.7079 0.0258 hypothetical protein yfdP b2359 1.3431 0.0013 hypothetical protein yfgA b2516 0.3616 0.0096 putative membrane protein yfhG b2555 0.4592 0.0050 conserved protein yfiB b2605 0.6708 0.0141 putative outer membrane protein yfiF b2581 0.4349 0.0213 hypothetical protein yfjD b4461 1.1920 0.0274 putative membrane protein, hemolysin-like yfjG b2619 1.8537 0.0213 toxin of a putative toxin-antitoxin pair yfjJ b2626 1.4374 0.0028 hypothetical protein ygaH b2683 0.3070 0.0005 putative transport protein 147

APPENDIX I

gene blattner ratio p-value Function A/B ygaZ b2682 0.2806 0.0339 hypothetical protein ygcH b2756 1.5103 0.0470 hypothetical protein ygcK b2759 0.5237 0.0303 hypothetical protein hypothetical protein with possible relationship to novobiocin and deoxycholate ygcL b2760 0.4734 0.0068 resistance ygcT b2773 1.3680 0.0295 hypothetical protein ygdR b2833 2.0681 0.0458 conserved hypothetical protein ygeO b2857 1.4246 0.0028 hypothetical protein ygfB b2909 0.6455 0.0197 conserved hypothetical protein putative oxidoreductase with a FAD-binding domain; possible component of ygfM b2880 1.8759 0.0385 selenate reductase ygfZ b2898 0.6440 0.0118 conserved protein yggG b2936 1.3788 0.0242 conserved protein yggH b2960 0.3883 0.0278 tRNA (m7G46) methyltransferase yggJ b2946 0.4258 0.0253 conserved hypothetical protein yggL b2959 0.4522 0.0265 conserved hypothetical protein yggN b2958 0.5163 0.0247 conserved hypothetical protein conserved hypothetical protein with role in oxidation-resistance of iron-sulfur yggX b2962 0.3380 0.0026 clusters yghO b2981 1.4352 0.0178 putative acyltransferase ygiA b3036 0.6569 0.0453 hypothetical protein ygiD b3039 1.2199 0.0229 putative enzyme with dioxygenase domain ygiF b3054 0.4578 0.0171 conserved hypothetical protein ygiL b3043 0.4481 0.0024 putative fimbrial-like protein ygiU b3022 0.5823 0.0419 putative cyanide hydratase ygjD b3064 0.5001 0.0291 putative O-sialoglycoprotein endopeptidase yhbY b3180 2.4069 0.0493 possible RNA-binding protein yhcE b3217 1.6908 0.0322 hypothetical protein yhdA b3252 0.4853 0.0034 conserved protein yhdN b3293 2.2147 0.0304 conserved hypothetical protein yheN b3345 0.7236 0.0466 conserved hypothetical protein yheO b3346 0.6587 0.0186 hypothetical protein yhfA b3356 0.4740 0.0196 conserved hypothetical protein yhfG b3362 1.5910 0.0072 conserved hypothetical protein yhfL b3369 0.7399 0.0465 hypothetical protein yhfU b3378 1.5087 0.0383 hypothetical protein yhfX b3381 1.4728 0.0231 conserved protein yhhH b3483 0.7173 0.0406 hypothetical protein yhhJ b3485 1.2472 0.0276 YhiH/YhhJ ABC transporter yhhS b3473 0.5354 0.0441 YhhS MFS transporter yhhZ b3442 1.5149 0.0020 conserved protein yhiS b3504 1.7373 0.0348 conserved protein yhjA b3518 1.6786 0.0050 putative cytochrome C peroxidase (EC 1.11.1) yhjR b3535 0.3739 0.0105 hypothetical protein yhjY b3548 1.6225 0.0111 putative lipase yi5A b3557 0.5204 0.0060 IS5 protein yiaA b3562 0.3268 0.0239 hypothetical protein yiaB b3563 0.2619 0.0011 inner membrane protein yiaN b3578 0.5853 0.0361 YiaMNO Binding Protein-dependent Secondary (TRAP) Transporter yiaW b3587 0.4349 0.0065 hypothetical protein yibD b3615 2.3369 0.0409 putative glycosyltransferase yibJ b3595 1.4681 0.0140 hypothetical protein yicE b3654 0.2155 0.0218 YicE NCS2 tranporter yicL b3660 0.5423 0.0107 inhibitor of heme biosynthesis yicN b3663 0.7539 0.0488 conserved hypothetical protein yidF b3674 1.4127 0.0375 putative transcriptional regulator yidP b3684 1.4297 0.0316 putative transcriptional regulator 148

APPENDIX I

gene blattner ratio p-value Function A/B yieG b3714 0.5508 0.0395 putative membrane / transport protein yieH b3715 0.4511 0.0214 putative enzyme with a phophatase-like domain yieN b3746 1.6277 0.0158 putative 2-component regulator yihF b3861 0.7083 0.0087 conserved protein yihI b3866 0.6516 0.0111 conserved protein yihP b3877 1.3286 0.0172 YihP GPH transporter yihS b3880 1.5315 0.0430 conserved hypothetical protein yihT b3881 1.5667 0.0274 putative aldolase yihW b3884 0.5351 0.0149 putative DEOR-type transcriptional regulator yihX b3885 0.5078 0.0280 putative phosphatase yiiR b3921 0.7676 0.0009 putative membrane protein yjbE b4026 2.5798 0.0431 conserved hypothetical protein yjbQ b4056 0.5074 0.0444 conserved hypothetical protein yjdA b4109 0.2889 0.0378 hypothetical protein yjeB b4178 0.3239 0.0058 conserved protein with a Winged helix domain yjeF b4167 0.6840 0.0052 putative kinase yjeM b4156 0.5081 0.0299 YjeM APC transporter yjeQ b4161 0.5621 0.0278 GTPase and putative translation factor / GTPase yjfI b4181 0.4271 0.0151 conserved hypothetical protein yjfK b4183 0.6194 0.0161 conserved hypothetical protein yjgN b4257 0.8020 0.0292 putative membrane protein possible involved in transport yjgP b4261 0.6738 0.0413 putative transmembrane protein possibly involved in transport yjhB b4279 1.8533 0.0006 YjhB MFS transporter yjhH b4298 0.5277 0.0150 putative lyase/synthase yjiJ b4332 0.6007 0.0492 putative transport protein yjiP b4338 1.2689 0.0190 hypothetical protein yjiY b4354 0.7537 0.0416 putative carbon starvation protein yjjG b4374 1.8650 0.0152 phosphatase yjjN b4358 1.3488 0.0441 putative oxidoreductase yjjQ b4365 0.5404 0.0231 putative regulator yjjV b4378 1.6584 0.0452 putative hydrolase ykgC b0304 0.4244 0.0245 putative oxidoreductase ykgE b0306 0.2061 0.0044 putative dehydrogenase subunit ykgF b0307 0.3156 0.0100 putative dehydrogenase ylaB b0457 1.6806 0.0383 conserved protein yliI b0837 2.0458 0.0402 putative dehydrogenase ymbA b0952 1.2388 0.0174 conserved protein ymdA b1044 1.4317 0.0156 conserved hypothetical protein ymfM b1148 1.7959 0.0269 hypothetical protein ymfO b1151 1.4852 0.0432 hypothetical protein ymjA b1295 0.4272 0.0063 hypothetical protein ynaE b1375 0.4467 0.0021 hypothetical protein ynaK b1365 0.5999 0.0473 hypothetical protein yncA b1448 0.6404 0.0336 putative N-acetyltransferase yncI b1458 2.0101 0.0095 conserved protein yneH b1524 0.6554 0.0043 putative glutaminase ynfB b1583 0.3413 0.0147 conserved hypothetical protein ynfG b1589 2.1065 0.0456 oxidoreductase, Fe-S subunit paralog of DmsB ynfN b1551 0.5507 0.0270 hypothetical protein yoaH b1811 0.7603 0.0410 conserved hypothetical protein yobA b1841 0.4646 0.0330 hypothetical protein yobD b1820 1.1210 0.0371 conserved protein ypfJ b2475 0.4521 0.0132 conserved protein yphF b2548 1.2411 0.0065 YphD/YphE/YphF ABC transporter ypjA b2647 0.5454 0.0295 putative outer membrane protein ypjC b2650 1.9137 0.0202 hypothetical protein 149

APPENDIX I

gene blattner ratio p-value Function A/B ypjF b2646 1.4842 0.0227 member of the YeeV, YkfI, YpjF family of toxin proteins yqaA b2689 0.3779 0.0112 putative integral membrane protein yqeF b2844 1.4118 0.0054 putative acyltransferase yqeI b2847 0.4452 0.0151 putative sensory transducer yqeJ b2848 0.5502 0.0358 conserved hypothetical protein yqiA b3031 0.5500 0.0167 putative hydrolase yqiJ b3050 1.2244 0.0073 putative oxidoreductase yqjI b3071 1.2930 0.0385 conserved hypothetical protein yraM b3147 0.6143 0.0013 putative glycosylase yrbK b3199 0.5981 0.0347 conserved hypothetical protein yrbL b3207 0.4490 0.0310 conserved hypothetical protein; transcription is regulated by Mg2+ yrdA b3279 1.2726 0.0344 putative transferase yrdD b3283 0.4972 0.0020 putative DNA topoisomerase yrfG b3399 1.7111 0.0126 putative hydrolase with a phophatase-like domain ytfH b4212 1.2193 0.0109 putative transcriptional regulator ytfM b4220 0.6790 0.0262 hypothetical protein zapA b2910 0.2597 0.0002 ZapA protein, localizes to the cytokinetic ring zntR b3292 2.0077 0.0173 ZntR transcriptional regulator znuA b1857 0.5075 0.0106 ZnuA/ZnuB/ZnuC ABC transporter znuB b1859 2.2343 0.0178 ZnuA/ZnuB/ZnuC ABC transporter b0332 1.2327 0.0317 b0395 0.7576 0.0331

Supplementary table – X: LZ41 wild-type (A) Vs LZ41 fis::cm (B) gene blattner ratio A/B p-value Function aceB b4014 0.4276 0.0445 malate synthase A acrE b3265 1.7547 0.0454 transmembrane protein affects septum formation and cell membrane permeability add b1623 0.8139 0.0457 deoxyadenosine deaminase / adenosine deaminase adhE b1241 0.5944 0.0064 PFL-deactivase / alcohol dehydrogenase / acetaldehyde dehydrogenase adiA b4117 0.7038 0.0075 Adi adk b0474 0.4914 0.0219 adenylate kinase aer b3072 0.3604 0.0182 aerotaxis sensor receptor, flavoprotein afuB b0263 0.6224 0.0389 AfuB agn43 b2000 0.3450 0.0040 outer membrane fluffing protein, sim. to adhesin ahpC b0605 0.5014 0.0291 AhpC component ahpF b0606 0.5624 0.0434 AhpF component aldA b1415 0.7702 0.0392 putative succinate-semialdehyde dehydrogenase / aldehyde dehydrogenase aldB b3588 0.4765 0.0388 putative aminobutyraldehyde dehydrogenase / aldehyde dehydrogenase B allR b0506 0.3911 0.0082 AllR transcriptional regulator amn b1982 0.6432 0.0084 AMP nucleosidase argO b2923 1.8685 0.0322 arginine export protein aroA b0908 0.6815 0.0220 3-phosphoshikimate-1-carboxyvinyltransferase aroB b3389 1.7762 0.0173 3-dehydroquinate synthase aroK b3390 2.0007 0.0057 shikimate kinase I arpA b4017 0.7171 0.0434 regulator of acetyl CoA synthetase artI b0863 0.6821 0.0113 arginine ABC transporter asnS b0930 0.6778 0.0337 asparaginyl-tRNA synthetase aspC b0928 0.5126 0.0438 aspartate transaminase aspS b1866 0.5612 0.0181 aspartyl-tRNA synthetase atpG b3733 1.2411 0.0477 ATP synthase, F1 complex, gamma subunit b0374 b0374 1.8747 0.0267 putative flagellin structural protein b1364 b1364 1.9078 0.0056 hypothetical protein bax b3570 2.7324 0.0137 putative ATP-binding protein 150

APPENDIX I gene blattner ratio A/B p-value Function bcsG b3538 1.3907 0.0114 putative membrane protein bioA b0774 4.8174 0.0341 adenosylmethionine-8-amino-7-oxononanoate aminotransferase monomer bioC b0777 2.0996 0.0055 biotin biosynthesis; reaction prior to pimeloyl CoA bioF b0776 2.1697 0.0187 8-amino-7-oxononanoate synthase btuE b1710 0.4583 0.0002 vitamin B12 transport system cdd b2143 0.5184 0.0071 cytidine deaminase cdsA b0175 1.5062 0.0193 CDP-diglyceride synthetase cld b2027 1.6377 0.0049 regulator of length of O-antigen component of lipopolysaccharide chains clpS b0881 0.6844 0.0260 specificity factor for ClpA-ClpP chaperone-protease complex cobC b0638 1.5268 0.0269 alpha-ribazole-5'-P phosphatase codA b0337 0.5518 0.0394 cytosine deaminase crl b0240 0.5173 0.0122 Crl transcriptional regulator crr b2417 0.7022 0.0165 EIIBCMalX cspG b0990 1.2495 0.0397 cold shock protein CspG cybB b1418 0.6780 0.0427 cytochrome b561 cyoB b0431 1.4550 0.0005 cytochrome bo terminal oxidase subunit I cyoD b0429 1.8390 0.0014 cytochrome bo terminal oxidase subunit IV cysE b3607 1.3082 0.0119 cysteine synthase cysZ b2413 0.5453 0.0464 required for sulfate transport cytR b3934 0.6111 0.0078 CytR-cytidine dadA b1189 0.9183 0.0319 D-amino acid dehydrogenase, small subunit dam b3387 1.2185 0.0464 DNA adenine methylase dapA b2478 0.4234 0.0248 dihydrodipicolinate synthase dapB b0031 0.7373 0.0483 dihydrodipicolinate reductase dcp b1538 0.5793 0.0064 dipeptidyl carboxypeptidase II def b3287 2.0636 0.0181 peptide deformylase degQ b3234 1.3585 0.0176 serine endoprotease dgoA b3692 0.2418 0.0237 dgoA 3871635-3871018 : '2-dehydro-3-deoxyphosphogalactonate aldolase / dgoD 3871021-3869873 : galactonate dehydratase dhaL b1199 2.3586 0.0311 dihydroxyacetone kinase subunit L dinB b0231 0.3459 0.0147 DNA polymerase IV (Y-family DNA polymerase; translesion DNA synthesis) dinD b3645 0.3811 0.0274 DNA-damage-inducible protein dld b2133 0.2646 0.0007 D-lactate:Quinone Oxidoreductase dnaE b0184 2.0422 0.0092 DNA polymerase III, alpha subunit dnaG b3066 2.2790 0.0124 DNA biosynthesis; DNA primase dnaK b0014 0.6706 0.0044 chaperone Hsp70; DNA biosynthesis; autoregulated heat shock proteins dps b0812 0.6003 0.0129 stationary phase nucleoid protein that sequesters iron and protects DNA from damage dsbA b3860 0.4929 0.0066 disulfide oxidoreductase dusB b3260 3.5507 0.0209 tRNA dihydrouridine synthase dxr b0173 1.4993 0.0175 DXP reductoisomerase ecfB b2969 1.8193 0.0019 putative protein exporter (General Secretory Pathway) ecfG b3055 2.2413 0.0064 protein with possible extracytoplasmic function ecfM b3096 1.7005 0.0256 conserved hypothetical protein with possible extracytoplasmic function eco b2209 0.4839 0.0047 ecotin monomer; serine protease inhibitor eda b1850 0.6319 0.0048 oxaloacetate decarboxylase / 2-keto-3-deoxy-6-phosphogluconate aldolase / 2-keto- 4-hydroxyglutarate aldolase efp b4147 1.3561 0.0306 elongation factor P (EF-P) elaA b2267 0.2865 0.0039 hypothetical protein emrY b2367 2.0045 0.0181 EmrY putative multidrug MFS transporter eno b2779 0.5823 0.0163 enolase entA b0596 4.0462 0.0315 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase entB b0595 4.2178 0.0260 apo-EntB essQ b1556 2.3474 0.0281 hypothetical protein evgA b2369 2.3983 0.0080 EvgA-Phosphorylated transcriptional regulator exbB b3006 5.6978 0.0342 ExbB protein; uptake of enterochelin; tonB-dependent uptake of B colicins exbD b3005 7.3350 0.0026 ExbD uptake of enterochelin; tonB-dependent uptake of B colicins fabB b2323 1.1422 0.0378 beta-ketoacyl-ACP synthase I / malonyl-ACP decarboxylase fadJ b2341 0.6377 0.0434 FadJ monomer fbaB b2097 0.1525 0.0179 fructose bisphosphate aldolase monomer 151

APPENDIX I gene blattner ratio A/B p-value Function fdx b2525 1.5992 0.0271 oxidized ferredoxin fecA b4291 4.3615 0.0002 outer membrane receptor; citrate-dependent iron transport, outer membrane receptor fecB b4290 11.8210 0.0049 ferric dicitrate uptake system fecD b4288 13.4703 0.0266 ferric dicitrate uptake system fecI b4293 2.5694 0.0143 sigma19 factor fepA b0584 2.2534 0.0377 FepA, outer membrane receptor for ferric enterobactin (enterochelin) and colicins B and D fhuF b4367 2.6792 0.0312 acts in reduction of ferrioxamine B iron fimA b4314 0.0452 0.0017 major type 1 subunit fimbrin (pilin) fimI b4315 0.2478 0.0086 fimbrial protein fis b3261 4.8968 0.0026 Fis transcriptional dual regulator fixC b0043 0.7563 0.0451 flavoprotein (electron transport), possibly involved in anaerobic carnitine metabolism fklB b4207 0.4661 0.0011 FKBP-type 22KD peptidyl-prolyl cis-trans isomerase (a rotamase) flgA b1072 0.6317 0.0353 flagellar biosynthesis; assembly of basal-body periplasmic P ring flgE b1076 0.5821 0.0222 flagellar hook protein FlgE flgH b1079 1.4155 0.0024 flagellar L-ring protein FlgH; basal-body outer-membrane L (lipopolysaccharide layer) ring protein fliC b1923 0.7914 0.0186 flagellar biosynthesis; flagellin, filament structural protein fliG b1939 1.5644 0.0322 flagellar motor switch protein FliG; component of motor switching and energizing, enabling rotation and determining its direction fliJ b1942 1.5214 0.0394 flagellar biosynthesis protein FliJ fliL b1944 2.0419 0.0147 flagellar biosynthesis fliM b1945 2.0037 0.0079 flagellar motor switch protein FliM; component of motor switch and energizing, enabling rotation and determining its direction fliN b1946 1.5234 0.0159 flagellar motor switch protein FliN; component of motor switch and energizing, enabling rotation and determining its direction fliP b1948 1.8269 0.0083 flagellar biosynthesis protein FliP fliQ b1949 3.0840 0.0021 flagellar biosynthesis protein FliQ fliR b1950 7.4349 0.0077 flagellar biosynthesis protein FliR flxA b1566 0.4049 0.0066 hypothetical protein; gene is regulated by FliA fmt b3288 3.0666 0.0067 10-formyltetrahydrofolate:L-methionyl-tRNA(fMet) N-formyltransferase folE b2153 0.4596 0.0053 GTP cyclohydrolase I folP b3177 0.4636 0.0126 dihydropteroate synthase frlA b3370 0.7394 0.0427 YhfM methione APC transporter frr b0172 0.7314 0.0363 ribosome recycling factor fruL b0079 1.7136 0.0205 fruR leader peptide fruR b0080 2.1871 0.0153 FruR transcriptional dual regulator fryB b2387 0.7759 0.0158 putative PTS system enzyme IIB component ftnA b1905 0.4482 0.0169 cytoplasmic ferritin, an iron storage protein) ftsI b0084 2.0097 0.0312 essential cell division protein FtsI; penicillin-binding protein 3 ftsK b0890 1.3776 0.0159 essential cell division protein FtsK ftsL b0083 1.5537 0.0073 essential cell division protein FtsL ftsQ b0093 1.3855 0.0418 essential cell division protein FtsQ ftsZ b0095 0.8510 0.0421 essential cell division protein FtsZ galF b2042 1.2879 0.0298 homolog of Salmonella UTP--glucose-1-P uridyltransferase, probably a UDP-gal transferase galM b0756 0.7402 0.0368 aldose-1-epimerase gatC b2092 0.5085 0.0245 EIIGat gatY b2096 0.4530 0.0132 tagatose-1,6-bisphosphate aldolase 2 gcvA b2808 2.3893 0.0386 GcvA transcriptional dual regulator gcvR b2479 0.5830 0.0331 GcvR-gly ghrA b1033 0.5389 0.0362 glyoxylate reductase glcB b2976 0.6074 0.0247 malate synthase G glk b2388 0.6440 0.0382 glucokinase glmU b3730 1.3338 0.0066 N-acetylglucosamine-1-phosphate uridyltransferase / glucosamine-1-phosphate acetyltransferase glnB b2553 0.7567 0.0160 PII-UMP glnH b0811 1.3681 0.0225 glutamine ABC transporter glnP b0810 2.0480 0.0032 glutamine ABC transporter glnQ b0809 1.9701 0.0255 glutamine ABC transporter 152

APPENDIX I gene blattner ratio A/B p-value Function gloB b0212 1.6853 0.0005 glyoxalase II glpD b3426 1.5383 0.0086 glycerol 3-phosphate dehydrogenase, aerobic glpE b3425 1.5932 0.0002 thiosulfate sulfurtransferase glpG b3424 2.4244 0.0321 inner membrane-associated protein of glp regulon glpQ b2239 0.5777 0.0048 glycerophosphoryl diester phosphodiesterase, periplasmic gltB b3212 0.2558 0.0049 glutamate synthase (NADPH) large chain precursor gltD b3213 0.2960 0.0005 glutamate synthase (NADPH) small chain gltF b3214 2.1372 0.0310 regulator of gltBDF operon, induction of Ntr enzymes gltX b2400 0.6185 0.0045 glutamyl-tRNA synthetase glyA b2551 0.4249 0.0030 glycine hydroxymethyltransferase gmd b2053 0.3424 0.0173 GDP-mannose 4,6-dehydratase gnd b2029 0.7263 0.0098 6-phosphogluconate dehydrogenase (decarboxylating) gpt b0238 0.3020 0.0046 xanthine phosphoribosyltransferase / guanine phosphoribosyltransferase / hypoxanthine phosphoribosyltransferase groE b4142 0.7287 0.0389 GroES, 10 Kd chaperone binds to Hsp60 in pres. Mg-ATP, suppressing its ATPase activity grxB b1064 0.5199 0.0055 oxidized glutaredoxin 2 gst b1635 0.2880 0.0003 glutathione transferase guaB b2508 0.3418 0.0146 IMP dehydrogenase hchA b1967 0.3576 0.0101 heat shock protein (Hsp) 31 hdeA b3510 0.5429 0.0329 acid-resistance protein, possible chaperone hdhA b1619 0.7009 0.0222 7-alpha-hydroxysteroid dehydrogenase hemC b3805 0.6080 0.0324 hydroxymethylbilane synthase hemG b3850 2.0623 0.0029 protoporphyrinogen oxidase hemL b0154 0.4775 0.0155 glutamate-1-semialdehyde aminotransferase hepA b0059 0.5983 0.0278 RNA Polymerase (RNAP)-binding ATPase and RNAP recycling factor hflD b1132 0.7830 0.0127 membrane protein in operon with purB hipA b1507 2.6139 0.0487 HipA transcriptional activator hisC b2021 0.4902 0.0017 histidine-phosphate aminotransferase hisD b2020 0.4810 0.0042 histidinal dehydrogenase / histidinol dehydrogenase hisF b2025 0.8798 0.0136 imidazole glycerol phosphate synthase, HisF subunit hisH b2023 0.6139 0.0394 imidazole glycerol phosphate synthase, HisH subunit hisI b2026 0.6499 0.0032 phosphoribosyl-AMP cyclohydrolase / phosphoribosyl-ATP pyrophosphatase hisJ b2309 0.4481 0.0121 histidine ABC transporter hofO b3393 1.8479 0.0374 conserved hypothetical protein hscA b2526 1.6604 0.0128 chaperone, member of Hsp70 protein family hsdR b4350 2.3402 0.0036 host restriction; endonuclease R hslO b3401 2.0138 0.0492 molecular chaperone Hsp33 htrA b0161 4.1874 0.0178 DegP hycI b2717 0.6596 0.0114 hydrogenase 3 maturation protease ibpA b3687 0.6656 0.0494 small heat shock protein IbpA ilvY b3773 2.5426 0.0045 IlvY transcriptional dual regulator infA b0884 1.2615 0.0395 protein chain initiation factor IF-1 infB b3168 0.8553 0.0153 protein chain initiation factor IF-2 iscA b2528 1.2803 0.0391 iron-sulfur cluster assembly protein iscR b2531 1.7491 0.0017 IscR transcriptional regulator iscS b2530 1.4813 0.0077 cysteine desulfurase monomer iscX b2524 1.6876 0.0213 protein with possible role in iron-sulfur cluster biogenesis ispH b0029 0.5317 0.0441 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate reductase kbl b3617 0.7553 0.0413 2-amino-3-ketobutyrate CoA ligase kdgR b1827 0.6868 0.0412 putative ICLR-type transcriptional regulator kdgT b3909 1.6515 0.0454 KdgT 2-keto-3-deoxygluconate transporter kduD b2842 0.5804 0.0334 2-deoxy-D-gluconate 3-dehydrogenase kduI b2843 0.5660 0.0006 homolog of pectin degrading enzyme 5-keto 4-deoxyuronate isomerase lctD b3605 4.5610 0.0020 L-Lactate:Quinone Oxidoreductase lepB b2568 0.4975 0.0172 leader peptidase (signal peptidase I) leuA b0074 2.1920 0.0484 2-isopropylmalate synthase lipB b0630 0.5344 0.0060 lipoyl-protein ligase lolB b1209 0.7109 0.0354 outer membrane lipoprotein, localization of lipoproteins in the outer membrane

153

APPENDIX I gene blattner ratio A/B p-value Function lpxB b0182 2.4803 0.0069 lipid A disaccharide synthase lpxD b0179 1.9305 0.0077 UDP-3-O-[3-hydroxymyristoyl]glucosamine N-acetyltransferase lysU b4129 0.3741 0.0006 lysyl-tRNA synthetase (LysRSu), inducible macB b0879 0.7619 0.0000 MacAB macrolide efflux transporter complex manY b1818 0.5887 0.0161 EIIMan map b0168 1.6259 0.0237 methionine aminopeptidase marA b1531 2.1164 0.0161 MarA transcriptional activator marR b1530 1.7225 0.0168 MarR-salicylate mdaB b3028 1.6569 0.0030 NADPH quinone reductase mdh b3236 0.4517 0.0007 malate dehydrogenase mdoC b1047 6.6596 0.0265 protein required for succinyl modification of osmoregulated periplasmic glucans mdoD b1424 0.7811 0.0064 glucan biosynthesis protein D menG b3929 0.6569 0.0011 inhibitor of ribonuclease E (RNase E) activity metB b3939 0.5240 0.0189 O-succinylhomoserine lyase / O-succinylhomoserine(thiol)-lyase metG b2114 1.6218 0.0213 methionyl-tRNA synthetase metK b2942 1.3643 0.0040 MetK S-adenosylmethionine synthetase monomer metN b0199 3.0698 0.0232 L- and D-methionine uptake ABC permease mglB b2150 0.4951 0.0238 galactose ABC transporter mgsA b0963 0.5158 0.0118 methylglyoxal synthase miaB b0661 0.5108 0.0076 hypothetical protein mntR b0817 1.3178 0.0124 putative toxin moaE b0785 0.5674 0.0315 molybdopterin synthase large subunit moeB b0826 0.5088 0.0285 molybdopterin biosynthesis mog b0009 0.6449 0.0095 required for the efficient incorporation of Mo into molybdoproteins motB b1889 0.7958 0.0468 MotB protein, enables flagellar motor rotation, linking torque machinery to cell wall mraY b0087 1.6065 0.0384 phospho-N-acetylmuramoyl-pentapeptide transferase mraZ b0081 2.0473 0.0380 protein encoded by an operon involved in formation of the cell envelope and cell division mreB b3251 0.7067 0.0373 rod shape-determining protein mscL b3291 0.5625 0.0188 MscL (Large Mechanosensitive Channel) msrB b1778 0.2242 0.0071 methionine sulfoxide reductase B / protein-methionine-S-oxide reductase / methionine sulfoxide reductase mug b3068 0.1598 0.0002 stationary phase mismatch/uracil DNA glycosylase murB b3972 0.6411 0.0055 UDP-N-acetylmuramate dehydrogenase murG b0090 1.8627 0.0219 N-acetylglucosaminyl transferase mutM b3635 0.5636 0.0298 formamidopyrimidine DNA glycosylase nagB b0678 0.6053 0.0321 glucosamine-6-phosphate deaminase narL b1221 0.3590 0.0003 NarL-Phosphorylated transcriptional dual regulator narV b1465 2.0037 0.0423 nitrate reductase Z, γ subunit narX b1222 0.4701 0.0282 NarX-Phis nfnB b0578 0.6965 0.0277 dihydropteridine reductase nlpB b2477 0.5501 0.0285 lipoprotein-34 nlpD b2742 0.5577 0.0232 NlpD putative outer membrane lipoprotein nrdA b2234 2.5576 0.0170 ribonucleoside-diphosphate reductase / CDP reductase / UDP reductase / ADP reductase / GDP reductase nrdB b2235 1.5476 0.0143 ribonucleoside-diphosphate reductase / CDP reductase / UDP reductase / ADP reductase / GDP reductase nudE b3397 3.6839 0.0376 ADP-ribose diphosphatase nupC b2393 0.4373 0.0148 NupC nucleoside NUP transporter nusB b0416 0.6482 0.0130 transcription termination; L factor ogrK b2082 0.4525 0.0057 OgrK transcriptional regulator ompA b0957 0.6960 0.0393 outer membrane protein 3a (II*;G;d) ompR b3405 0.6561 0.0127 OmpR transcriptional dual regulator oppA b1243 0.5783 0.0065 OppA-oligopeptide ABC transporter substrate-binding osmC b1482 0.5889 0.0305 osmotically inducible peroxidase OsmC oxyR b3961 0.5975 0.0148 OxyR transcriptional dual regulator paaX b1399 0.6230 0.0285 PaaX transcriptional regulator pal b0741 0.5655 0.0097 Tol-Pal Cell Envelope Complex panB b0134 0.5737 0.0067 3-methyl-2-oxobutanoate hydroxymethyltransferase monomer pckA b3403 1.2819 0.0394 phosphoenolpyruvate carboxykinase (ATP) 154

APPENDIX I gene blattner ratio A/B p-value Function pdxA b0052 1.8798 0.0156 PdxA dehydrogenase/decarboxylase pdxH b1638 0.5634 0.0154 pyridoxine 5'-phosphate oxidase / pyridoxamine 5'-phosphate oxidase pdxJ b2564 0.5506 0.0132 pyridoxine 5'-phosphate synthase monomer pdxK b2418 0.7062 0.0312 pyridoxamine kinase / hydroxymethylpyrimidine kinase / pyridoxal kinase pepB b2523 0.7989 0.0086 aminopeptidase (AP) pepD b0237 0.6038 0.0133 peptidase D pepE b4021 0.6872 0.0420 peptidase E, a dipeptidase where amino-terminal residue is aspartate pepT b1127 0.6315 0.0216 peptidase T pfkA b3916 0.4420 0.0165 6-phosphofructokinase-1 monomer / putative NAD+ kinase pfkB b1723 0.5181 0.0126 6-phosphofructokinase-2 monomer pflA b0902 0.4936 0.0038 pyruvate formate-lyase activating enzyme pgpA b0418 0.8301 0.0117 phosphatidylglycerophosphatase A pgpB b1278 0.7228 0.0332 phosphatidylglycerophosphatase B pheS b1714 1.6482 0.0332 phenylalanyl-tRNA synthetase α-chain plsX b1090 2.5029 0.0151 glycerolphosphate auxotrophy in plsB background potC b1124 0.7615 0.0005 putrescine/spermidine ABC transporter potD b1123 0.7572 0.0238 putrescine/spermidine ABC transporter potI b0857 0.7509 0.0248 putrescine ABC transporter ppsA b1702 0.3641 0.0451 phosphoenolpyruvate synthase pptA b1461 0.4533 0.0164 probable 4-oxalocrotonate tautomerase (4-OT) monomer pqiB b0951 0.6225 0.0116 paraquat-inducible protein B prfA b1211 2.6557 0.0311 peptide chain release factor RF-1 prfC b4375 0.8757 0.0393 peptide chain release factor RF-3 prlC b3498 1.4622 0.0107 oligopeptidase A prmA b3259 0.6684 0.0246 methylation of 50S ribosomal subunit protein L11 pspE b1308 0.4076 0.0040 thiosulfate sulfurtransferase pstC b3727 1.5388 0.0331 phosphate ABC transporter ptrA b2821 0.4205 0.0083 protease III ptsI b2416 0.5853 0.0249 PTS enzyme I purB b1131 0.6886 0.0011 5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole lyase / adenylosuccinate lyase purM b2499 0.5518 0.0249 phosphoribosylformylglycinamide cyclo-ligase purU b1232 0.6528 0.0200 formyltetrahydrofolate deformylase putA b1014 0.4763 0.0210 PutA bifunctional enzyme and transcriptional regulator puuR b1299 2.5246 0.0286 putative oxidoreductase/putative regulator pykA b1854 0.5364 0.0003 pyruvate kinase II monomer pyrD b0945 0.6409 0.0178 dihydroorotate oxidase qseB b3025 1.3558 0.0154 putative 2-component transcriptional regulator radC b3638 1.5771 0.0440 hypothetical protein rdoA b3859 0.4925 0.0088 cytoplasmic protein of low abundance recD b2819 0.4467 0.0117 DNA helicase, ATP-dependent dsDNA/ssDNA exonuclease V subunit, ssDNA endonuclease recN b2616 2.0533 0.0461 protein used in recombination and DNA repair recO b2565 0.5768 0.0062 protein interacts with RecR and possibly RecF proteins recR b0472 0.6890 0.0234 recombination and repair relB b1564 0.5403 0.0279 antitoxin of the RelE-RelB toxin-antitoxin system and transcriptional repressor of relBEF relE b1563 0.4842 0.0123 toxin of the RelE-RelB toxin-antitoxin system; cleaves mRNA in ribosome rfaH b3842 1.8283 0.0327 RfaH transcriptional regulator rfaI b3627 0.7426 0.0277 UDP-D-galactose:(glucosyl)lipopolysaccharide-alpha-1,3-D-galactosyltransferase rfaY b3625 0.6530 0.0111 lipopolysaccharide core biosynthesis rfaZ b3624 0.6938 0.0035 protein involved in KdoIII attachment during lipopolysaccharide core biosynthesis rfbB b2041 1.5853 0.0067 RmlB rhlE b0797 1.1385 0.0098 DEAD-box-containing ATP-dependent RNA helicase family member rhoL b3782 1.7040 0.0054 rho operon leader peptide rhsB b3482 0.8055 0.0317 RhsB protein in rhs element ribA b1277 1.4064 0.0192 GTP cyclohydrolase II rihA b0651 0.3965 0.0007 ribonucleoside hydrolase 1 (pyrimidine-specific) rimJ b1066 0.6008 0.0050 acetylates N-terminal alanine of 30S ribosomal subunit protein S5 / ribosomal- protein-alanine N-acetyltransferase 155

APPENDIX I gene blattner ratio A/B p-value Function rnb b1286 0.5168 0.0188 RNase II, mRNA degradation rnpA b3704 2.3870 0.0025 RNase P protein component; processes tRNA, 4.5S RNA rph b3643 0.3966 0.0020 RNase PH monomer rplC b3320 1.5214 0.0402 50S ribosomal subunit protein L3 rplD b3319 1.4899 0.0297 50S ribosomal subunit protein L4, regulates expression of S10 operon rplI b4203 1.7848 0.0067 50S ribosomal subunit protein L9 rplK b3983 1.4690 0.0323 50S ribosomal subunit protein L11 rplN b3310 1.8011 0.0070 50S ribosomal subunit protein L14 rplQ b3294 1.5026 0.0193 50S ribosomal subunit protein L17 rplS b2606 1.8032 0.0386 50S ribosomal subunit protein L19 rpmH b3703 2.4577 0.0050 50S ribosomal subunit protein L34 rpmI b1717 1.6463 0.0100 50S ribosomal subunit protein A rpoS b2741 0.4760 0.0008 sigma38 factor rpsI b3230 1.5944 0.0225 30S ribosomal subunit protein S9 rpsJ b3321 1.8766 0.0045 30S ribosomal subunit protein S10 rpsM b3298 1.7120 0.0194 30S ribosomal subunit protein S13 rpsN b3307 1.4824 0.0194 30S ribosomal subunit protein S14 rpsP b2609 1.4326 0.0450 30S ribosomal subunit protein S16 rpsR b4202 1.4594 0.0190 30S ribosomal subunit protein S18 rseA b2572 1.2269 0.0063 anti-sigma factor that inhibits sigmaE rseC b2570 2.1501 0.0204 protein involved in reduction of the SoxR iron-sulfur cluster rsmB b3289 1.4365 0.0248 16S rRNA m5C967 methyltransferase rspA b1581 0.2047 0.0078 starvation sensing protein RspA rsxB b1628 2.6069 0.0042 member of SoxR-reducing complex rsxC b1629 2.5542 0.0057 member of SoxR-reducing complex rumA b2785 1.8745 0.0344 23S ribosomal RNA 5-methyluridine methyltransferase rusA b0550 2.0786 0.0385 endodeoxyribonuclease RUS (Holliday junction resolvase) ruvA b1861 0.4849 0.0298 branch migration of Holliday structures; repair sdaB b2797 0.6285 0.0002 L-threonine deaminase II / L-serine deaminase 2 sdaC b2796 0.4271 0.0117 SdaC serine STP transporter secM b0097 1.3178 0.0023 secretion monitor that regulates SecA translation (General Secretory Pathway) seqA b0687 2.1946 0.0082 SeqA, negative modulator of initiation of replication sfcA b1479 0.8152 0.0181 MaeA sfmF b0534 1.6970 0.0472 putative fimbrial-like protein sirA b3470 0.6006 0.0488 possible RNA-binding protein required for wild-type FtsZ ring formation on rich media slyB b1641 0.4312 0.0113 putative outer membrane protein slyD b3349 0.6005 0.0258 FKBP-type rotamase, peptidyl prolyl cis-trans isomerase smg b3284 2.8745 0.0310 hypothetical protein smpB b2620 0.6515 0.0414 small protein B sodB b1656 0.5233 0.0110 superoxide dismutase (Fe) sodC b1646 0.4968 0.0252 superoxide dismutase precursor (Cu-Zn) speB b2937 0.6792 0.0484 agmatinase speC b2965 0.3877 0.0088 ornithine decarboxylase, biosynthetic speD b0120 0.3187 0.0009 adenosylmethionine decarboxylase, proenzyme speE b0121 0.4811 0.0061 spermidine synthase spr b2175 1.5236 0.0048 putative lipoprotein sra b1480 0.3080 0.0010 30S ribosomal subunit protein S22; sub-stoichiometric stationary phase ribosomal component sscR b2765 1.5203 0.0399 putative 6-pyruvoyl tetrahydrobiopterin synthase sseA b2521 0.5767 0.0312 3-mercaptopyruvate:cyanide sulfurtransferase sspA b3229 1.2589 0.0498 regulator of transcription; stringent starvation protein A sspB b3228 1.8474 0.0062 SspB monomer sstT b3089 1.4008 0.0348 YgjU DAACS transporter talA b2464 0.6019 0.0196 transaldolase A tar b1886 0.6394 0.0421 MCP-II tauD b0368 1.2571 0.0377 taurine dioxygenase tdcD b3115 2.0221 0.0493 propionate kinase / acetate kinase C tdh b3616 0.6205 0.0168 threonine dehydrogenase

156

APPENDIX I gene blattner ratio A/B p-value Function tdk b1238 0.7191 0.0164 thymidine kinase / deoxyuridine kinase tehB b1430 0.6931 0.0312 tellurite resistance tnaA b3708 0.3883 0.0042 L-cysteine desulfhydrase / tryptophanase tolA b0739 1.8858 0.0200 Tol-Pal Cell Envelope Complex tolB b0740 0.6129 0.0276 Tol-Pal Cell Envelope Complex tolC b3035 1.8109 0.0166 TolC outer membrane channel topB b1763 1.9680 0.0432 DNA topoisomerase III torZ b1872 0.6633 0.0251 trimethylamine N-oxide reductase III, TorZ subunit tpiA b3919 0.5807 0.0093 triose phosphate isomerase monomer tpx b1324 0.4685 0.0031 thiol peroxidase 2 treB b4240 0.7492 0.0204 EIITre trg b1421 0.3929 0.0362 MCP-III trkH b3849 2.8270 0.0037 TrkH potassium ion Trk Transporter trpA b1260 0.6073 0.0425 tryptophan synthase, alpha subunit / indoleglycerol phosphate aldolase trpB b1261 0.6074 0.0328 tryptophan synthase, beta subunit trpH b1266 0.7233 0.0438 putative enzyme typA b3871 0.6670 0.0187 protein possibly involved in LPS biosynthesis and host colonization ubiB b3835 1.7738 0.0367 2-octaprenylphenol hydroxylase ubiC b4039 0.4470 0.0135 chorismate pyruvate lyase ubiF b0662 0.4865 0.0324 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinone hydroxylase ubiG b2232 0.5625 0.0002 3-demethylubiquinone 3-methyltransferase / 2-octaprenyl-6-hydroxyphenol methylase ucpA b2426 2.1286 0.0385 putative acetoin dehydrogenase ulaE b4197 0.5257 0.0078 L-xylulose 5-phosphate 3-epimerase upp b2498 0.5910 0.0244 uracil phosphoribosyltransferase uvrA b4058 0.5239 0.0019 excision nuclease subunit A uvrD b3813 0.8144 0.0346 DNA-dependent ATPase I and helicase II wbbK b2032 0.7715 0.0198 putative transferase wcaI b2050 0.6835 0.0103 putative colanic biosynthesis glycosyl transferase wcaM b2043 0.3200 0.0127 hypothetical protein wzxC b2046 0.7084 0.0032 WzxC wzyE b3793 1.9754 0.0268 4-α-fucosyltransferase xthA b1749 0.6059 0.0079 exonuclease III xylF b3566 1.8870 0.0111 xylose ABC transporter xylH b3568 2.3622 0.0026 xylose ABC transporter yaaW b0011 1.5008 0.0488 HtgA transcriptional regulator yacH b0117 1.3881 0.0384 putative membrane protein yadK b0136 1.6125 0.0421 putative adhesin-like protein yaeB b0195 1.3994 0.0117 hypothetical protein yafL b0227 1.2458 0.0276 putative lipoprotein yafO b0233 0.6314 0.0485 conserved protein with a possible role in spontaneous mutagenesis; toxin of a putative toxin-antitoxin pair yafY b0251 0.6373 0.0205 inner membrane lipoprotein YafY yagM b0279 1.3267 0.0037 hypothetical protein yahO b0329 0.7159 0.0211 conserved hypothetical protein yaiP b0363 2.5784 0.0399 polysaccharide metabolism yaiY b0379 1.3880 0.0403 putative membrane protein yajG b0434 2.1052 0.0002 putative polymerase/proteinase yajL b0424 0.6797 0.0397 YajL ybaB b0471 0.7466 0.0289 conserved hypothetical protein; trnascription is rpoE-dependent ybaD b0413 0.7223 0.0384 conserved protein ybaK b0481 0.4834 0.0267 conserved hypothetical protein ybbN b0492 0.4921 0.0481 putative thioredoxin-like protein ybdB b0597 6.2505 0.0061 conserved hypothetical protein ybeB b0637 0.7632 0.0489 conserved hypothetical protein ybeD b0631 0.3535 0.0003 conserved hypothetical protein ybeL b0643 0.4340 0.0165 conserved hypothetical protein ybeZ b0660 0.7738 0.0071 putative ATP-binding protein ybfC b0704 0.2580 0.0019 hypothetical protein

157

APPENDIX I gene blattner ratio A/B p-value Function ybfD b0706 0.2417 0.0088 conserved protein ybfE b0685 3.2986 0.0038 hypothetical protein, transcriptionally regulated by LexA ybgA b0707 0.5694 0.0092 conserved protein ybgC b0736 2.2715 0.0226 Tol-Pal Cell Envelope Complex ybhL b0786 0.4736 0.0364 putative transport protein ybiB b0800 0.5707 0.0300 putative enzyme ybiC b0801 0.2496 0.0064 putative dehydrogenase ybiF b0813 1.6029 0.0489 Threonine and Homoserine Exporter ybiR b0818 2.1306 0.0273 YbiR ybjO b0858 2.2594 0.0431 putative membrane protein ycbL b0927 0.6866 0.0197 putative enzyme ycbQ b0938 0.6103 0.0474 putative fimbrial-like protein ycbR b0939 0.6518 0.0108 putative chaperone ycdN b1016 0.7257 0.0321 hypothetical protein of the OFeT transport family ycdX b1034 0.6937 0.0343 putative DNA polymerase subunit ycdY b1035 0.4819 0.0151 putative oxidoreductase component ycdZ b1036 0.9178 0.0037 putative transport protein yceK b1050 1.6485 0.0298 hypothetical protein yceP b1060 1.2575 0.0186 conserved hypothetical protein ycfF b1103 0.5809 0.0081 hypothetical protein ycfL b1104 0.6008 0.0188 conserved hypothetical protein ycfP b1108 0.6776 0.0253 putative hydrolase ycfQ b1111 0.4481 0.0222 hypothetical protein ycfX b1119 0.6020 0.0137 putative sugar kinase, ROK family protein ycgH_1 b1169 2.6426 0.0080 conserved protein; member of the Autotransporter family ycgM b1180 0.8640 0.0332 putative isomerase ycgR b1194 0.5120 0.0005 protein involved in flagellar function ycgZ b1164 0.1971 0.0013 hypothetical protein yciA b1253 2.3276 0.0365 putative enzyme yciN b1273 0.5538 0.0078 conserved hypothetical protein yciS b1279 0.5680 0.0114 conserved hypothetical protein ycjO b1311 2.7124 0.0316 YcjN/YcjO/YcjP ABC transporter ycjP b1312 0.7347 0.0241 YcjN/YcjO/YcjP ABC transporter ycjX b1321 0.6578 0.0175 putative EC 2.1 enzyme ydcR b1439 2.5283 0.0312 multi modular; putative transcriptional regulator ; also putative ATP-binding component of a transport system ydcX b1445 2.1871 0.0183 hypothetical protein yddH b1462 2.2272 0.0241 putative enzyme ydeR b1503 2.5428 0.0348 putative fimbrial-like protein ydeS b1504 0.5808 0.0291 putative fimbrial-like protein ydfH b1540 0.6839 0.0190 hypothetical protein ydfJ b1543 2.0107 0.0124 YdfJ ydgA b1614 0.6747 0.0482 conserved protein YdgF b1600 2.1962 0.0042 YdgF SMR protein; toxin of a putative toxin-antitoxin pair ydgR b1634 1.2643 0.0005 YdgR putative peptide POT Transporter ydhH b1640 0.4079 0.0176 conserved hypothetical protein ydhR b1667 0.4304 0.0347 conserved hypothetical protein ydhT b1669 0.7874 0.0102 conserved protein ydiA b1703 0.2931 0.0113 conserved protein ydiY b1722 0.7966 0.0467 conserved hypothetical protein ydiZ b1724 0.3092 0.0002 conserved hypothetical protein ydjA b1765 0.6823 0.0153 conserved protein ydjY b1751 1.2582 0.0333 conserved protein, 4Fe-4S protein yeaC b1777 0.2726 0.0143 conserved hypothetical protein yebF b1847 1.2639 0.0016 conserved hypothetical protein yebR b1832 1.5900 0.0450 conserved hypothetical protein yebV b1836 0.7303 0.0472 hypothetical protein yedF b1930 0.5758 0.0367 conserved hypothetical protein; might bind RNA yedI b1958 0.6020 0.0091 hypothetical protein 158

APPENDIX I gene blattner ratio A/B p-value Function yegD b2069 0.1096 0.0022 actin family protein yegP b2080 0.7106 0.0331 conserved hypothetical protein yegS b2086 0.6537 0.0417 conserved protein yegV b2100 0.6305 0.0488 putative kinase yejK b2186 0.5169 0.0083 nucleoid component yfaE b2236 1.5204 0.0066 conserved hypothetical protein, 2Fe-2S ferredoxin-related yfaY b2249 0.6445 0.0134 putative competence-damage protein yfbB b2263 0.4472 0.0003 putative enzyme yfcZ b2343 0.5741 0.0249 conserved hypothetical protein yfdG b2350 2.8866 0.0223 hypothetical protein yfdH b2351 4.5779 0.0047 putative glycan biosynthesis enzyme yfdZ b2379 0.4718 0.0255 putative aminotransferase yfhA b2554 0.6241 0.0138 putative 2-component transcriptional regulator yfiF b2581 0.3793 0.0154 hypothetical protein yfiH b2593 2.3518 0.0047 conserved hypothetical protein yfiQ b2584 0.6139 0.0054 putative NAD(P)-binding and ATP-binding acyl-CoA synthetase ygaF b2660 0.3095 0.0000 hypothetical protein ygaZ b2682 2.9721 0.0184 hypothetical protein ygcL b2760 0.7291 0.0047 hypothetical protein with possible relationship to novobiocin and deoxycholate resistance ygeA b2840 0.4954 0.0300 putative resistance protein ygeO b2857 1.8523 0.0339 hypothetical protein ygfJ b2877 0.6146 0.0146 conserved protein ygfS b2886 1.7328 0.0364 putative oxidoreductase, Fe-S subunit yggJ b2946 1.6239 0.0074 conserved hypothetical protein yggL b2959 0.6458 0.0023 conserved hypothetical protein yggW b2955 1.3703 0.0151 putative oxidase yghB b3009 0.7895 0.0308 putative integral membrane protein yghU b2989 0.2467 0.0025 glutathione transferase-like protein possibly involved in glutathionylspermidine metabolism ygiA b3036 1.6742 0.0177 hypothetical protein yhaV b3130 0.5692 0.0077 conserved hypothetical protein yhcA b3215 2.1510 0.0365 putative chaperone yhdE b3248 0.4955 0.0496 conserved hypothetical protein yhdH b3253 0.3436 0.0006 putative dehydrogenase yheL b3343 3.0897 0.0190 conserved hypothetical protein yheM b3344 4.4555 0.0202 conserved hypothetical protein yheN b3345 2.6968 0.0330 conserved hypothetical protein yheO b3346 2.2685 0.0223 hypothetical protein yhfA b3356 0.5425 0.0352 conserved hypothetical protein yhhM b3467 0.7356 0.0202 putative receptor yhhT b3474 1.3859 0.0171 hypothetical protein yhiQ b3497 1.6969 0.0181 putative methyltransferase yhjK b3529 1.4678 0.0029 conserved protein yiaT b3584 0.8971 0.0295 putative outer membrane protein yibI b3598 1.5584 0.0342 hypothetical protein yicC b3644 0.6226 0.0107 conserved protein yifN b3777 0.6923 0.0355 conserved hypothetical protein yigZ b3848 2.8187 0.0073 putative elongation factor yiiR b3921 0.6478 0.0117 putative membrane protein yijP b3955 0.4791 0.0024 hypothetical protein; related to invasion protein of pathogenic E. coli yjbQ b4056 0.2981 0.0075 conserved hypothetical protein yjcZ b4110 1.2700 0.0269 hypothetical protein yjdM b4108 0.3921 0.0080 hypothetical protein yjgB b4269 0.6383 0.0112 putative oxidoreductase yjiG b4329 0.6702 0.0021 putative membrane protein yjjA b4360 0.6315 0.0065 putative glycoprotein/receptor yjjQ b4365 1.8874 0.0056 putative regulator ykfG b0247 1.4225 0.0448 putative DNA repair protein

159

APPENDIX I gene blattner ratio A/B p-value Function ykgB b0301 0.2697 0.0126 putative membrane protein ykgI b0303 0.1371 0.0142 hypothetical protein yliD b0832 0.5942 0.0294 YliA/YliB/YliC/YliD ABC transporter ymgA b1165 0.1880 0.0008 hypothetical protein ynaJ b1332 0.6770 0.0219 conserved hypothetical protein ynfD b1586 0.4744 0.0302 conserved hypothetical protein ynjH b1760 0.1079 0.0001 conserved hypothetical protein yoaB b1809 0.4229 0.0064 conserved protein yoaC b1810 0.4432 0.0033 conserved hypothetical protein yphC b2545 0.7253 0.0435 predicted oxidoreductase yqeG b2845 2.3330 0.0145 YqeG STP transporter yqfB b2900 0.5018 0.0235 conserved hypothetical protein yqiA b3031 1.8528 0.0482 putative hydrolase yqiI b3048 1.5915 0.0251 conserved protein yqjD b3098 0.5135 0.0398 conserved hypothetical protein yraM b3147 0.6915 0.0206 putative glycosylase yrbA b3190 1.6358 0.0200 hypothetical protein yrdC b3282 1.9330 0.0102 RNA-binding protein with unique protein fold yrdD b3283 3.2410 0.0102 putative DNA topoisomerase yrfF b3398 3.1897 0.0119 putative dehydrogenase ytfA b4205 0.6230 0.0360 hypothetical protein znuA b1857 3.6361 0.0065 ZnuA/ZnuB/ZnuC ABC transporter znuC b1858 1.3426 0.0008 ZnuA/ZnuB/ZnuC ABC transporter zraR b4004 2.5337 0.0077 ZraR-Phosphorylated transcriptional activator

Supplementary table – XI: LZ54 wild-type (A) Vs LZ54 fis::cm (B)

gene blattner ratio p-value Function A/B aaeX b3242 0.3200 0.0268 hypothetical protein abgB b1337 0.4513 0.0162 hypothetical protein aceF b0115 1.4049 0.0029 AceF-lipoate acs b4069 0.0998 0.0401 putative hydroxycinnamate-CoA ligase / acetyl-CoA synthetase adk b0474 0.4908 0.0443 adenylate kinase aegA b2468 0.4339 0.0331 putative oxidoreductase, Fe-S subunit ahpC b0605 0.4949 0.0199 AhpC component aldB b3588 0.6066 0.0090 putative aminobutyraldehyde dehydrogenase / aldehyde dehydrogenase B allR b0506 0.3675 0.0004 AllR transcriptional regulator amyA b1927 1.4397 0.0367 alpha-amylase, cytoplasmic aniC b4115 0.9075 0.0200 AdiC Arginine:Agmatine Antiporter argR b3237 0.5889 0.0462 ArgR transcriptional dual regulator aroA b0908 0.7038 0.0037 3-phosphoshikimate-1-carboxyvinyltransferase artQ b0862 1.3759 0.0198 arginine ABC transporter atpG b3733 1.3528 0.0009 ATP synthase, F1 complex, gamma subunit b0309 b0309 0.3686 0.0298 hypothetical protein b0373 b0373 0.5710 0.0097 hypothetical protein b1364 b1364 1.7894 0.0168 hypothetical protein baeS b2078 0.5383 0.0205 BaeS-Phis bglG b3723 1.2005 0.0036 BglG monomer cbl b1987 0.7237 0.0159 Cbl transcriptional activator hypothetical protein, encoded by an operon required for growth on N,N'- chbG b1733 2.1422 0.0047 diacetylchitobiose cheB b1883 2.0876 0.0004 CheB-Pasp / PGluMase / protein-glutamine glutaminase cheZ b1881 1.3201 0.0444 CheZ citE b0616 2.1449 0.0394 subunit of citryl-ACP lyase 160

APPENDIX I

gene blattner ratio p-value Function A/B citX b0614 0.4000 0.0370 holo-ACP synthase clpA b0882 0.7887 0.0340 ATP-binding component of serine protease cpsB b2049 0.3934 0.0301 mannose-1-phosphate guanylyltransferase-(GDP) regulator of the Cpx response and possible chaperone involved in resistance to cpxP b3913 2.7585 0.0052 extracytoplasmic stress creA b4397 0.6098 0.0489 hypothetical protein csgA b1042 0.5922 0.0165 curlin, major subunit cydC b0886 0.5727 0.0423 abc-6-cplx dcd b2065 0.5033 0.0057 dCTP deaminase dcp b1538 0.5735 0.0138 dipeptidyl carboxypeptidase II deoB b4383 2.8180 0.0292 phosphopentomutase dgoR b4479 0.3103 0.0080 regulator protein for dgo operon dinB b0231 0.5729 0.0144 DNA polymerase IV (Y-family DNA polymerase; translesion DNA synthesis) dinD b3645 0.5218 0.0499 DNA-damage-inducible protein dld b2133 0.3096 0.0065 D-lactate:Quinone Oxidoreductase dnaG b3066 2.8483 0.0412 DNA biosynthesis; DNA primase dnaQ b0215 0.4868 0.0086 DNA polymerase III, epsilon subunit dppB b3543 0.3745 0.0395 dipeptide ABC transporter elaA b2267 0.3654 0.0026 hypothetical protein elbB b3209 0.7262 0.0373 sigma cross-reacting protein 27A (SCRP-27A) emtA b1193 0.5201 0.0102 murein transglycosylase E entS b0591 5.6019 0.0045 YbdA MFS transporter erfK b1990 0.4581 0.0299 hypothetical protein with similarity to universal stress protein exbB b3006 9.4812 0.0258 ExbB protein; uptake of enterochelin; tonB-dependent uptake of B colicins exbD b3005 4.8930 0.0016 ExbD uptake of enterochelin; tonB-dependent uptake of B colicins fbaB b2097 0.1818 0.0492 fructose bisphosphate aldolase monomer outer membrane receptor; citrate-dependent iron transport, outer membrane fecA b4291 3.3493 0.0110 receptor fecB b4290 8.7354 0.0011 ferric dicitrate uptake system feoA b3408 1.5400 0.0067 ferrous iron transport protein A FepA, outer membrane receptor for ferric enterobactin (enterochelin) and colicins fepA b0584 3.0382 0.0381 B and D fhuF b4367 6.4472 0.0140 acts in reduction of ferrioxamine B iron fimA b4314 0.0474 0.0033 major type 1 subunit fimbrin (pilin) fimI b4315 0.1958 0.0097 fimbrial protein fklB b4207 0.6485 0.0088 FKBP-type 22KD peptidyl-prolyl cis-trans isomerase (a rotamase) fkpA b3347 0.6246 0.0037 peptidyl-prolyl cis-trans isomerase; in protein folding flgJ b1081 2.4784 0.0147 FlgJ flgM b1071 1.3378 0.0033 anti-FliA (anti-sigma) factor; also known as RflB protein flgN b1070 1.6620 0.0138 flagellar biosynthesis protein FlgN flhB b1880 1.7009 0.0337 flagellar biosynthesis protein FlhB fliE b1937 1.4750 0.0088 flagellar basal-body protein FliE flagellar M-ring protein FliF; basal-body MS(membrane and supramembrane)- fliF b1938 1.6666 0.0306 ring and collar protein flagellar motor switch protein FliG; component of motor switching and fliG b1939 2.1045 0.0069 energizing, enabling rotation and determining its direction fliL b1944 2.1945 0.0188 flagellar biosynthesis flagellar motor switch protein FliM; component of motor switch and energizing, fliM b1945 2.0791 0.0003 enabling rotation and determining its direction fliP b1948 1.9491 0.0114 flagellar biosynthesis protein FliP fliQ b1949 3.0936 0.0072 flagellar biosynthesis protein FliQ fliZ b1921 1.4597 0.0276 possible cell-density responsive regulator of sigmaF flxA b1566 1.6260 0.0119 hypothetical protein; gene is regulated by FliA folE b2153 0.6211 0.0207 GTP cyclohydrolase I frmA b0356 1.1962 0.0067 formaldehyde dehydrogenase, glutathione-dependent ftnA b1905 0.4044 0.0002 cytoplasmic ferritin, an iron storage protein) ftsI b0084 2.4213 0.0314 essential cell division protein FtsI; penicillin-binding protein 3 ftsL b0083 1.7997 0.0053 essential cell division protein FtsL 161

APPENDIX I

gene blattner ratio p-value Function A/B galR b2837 2.6916 0.0029 GalR-galactose UDP-glucose-hexose-1-phosphate uridylyltransferase / galactose-1-phosphate galT b0758 0.6631 0.0384 uridylyltransferase galU b1236 1.8258 0.0242 UTP-glucose-1-phosphate uridylyltransferase garR b3125 0.6022 0.0007 tartronate semialdehyde reductase gcl b0507 0.3585 0.0257 glyoxylate carboligase ghrA b1033 0.3564 0.0005 glyoxylate reductase glmS b3729 1.0956 0.0218 L-glutamine:D-fructose-6-phosphate aminotransferase gloA b1651 0.8364 0.0384 glyoxalase I gltB b3212 0.5950 0.0474 glutamate synthase (NADPH) large chain precursor gltD b3213 0.5153 0.0061 glutamate synthase (NADPH) small chain glyA b2551 0.5605 0.0266 glycine hydroxymethyltransferase gmhB b0200 0.6287 0.0027 GmhB gpp b3779 2.2141 0.0307 guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase grxB b1064 0.4556 0.0213 oxidized glutaredoxin 2 gst b1635 0.5631 0.0185 glutathione transferase gutQ b2708 0.7061 0.0173 protein with a sugar isomerase domain hdeD b3511 1.5185 0.0068 protein involved in acid resistance hdfR b4480 0.6083 0.0428 transcriptional regulator hemL b0154 0.6270 0.0356 glutamate-1-semialdehyde aminotransferase hepA b0059 0.5258 0.0325 RNA Polymerase (RNAP)-binding ATPase and RNAP recycling factor hflD b1132 0.6486 0.0423 membrane protein in operon with purB hipA b1507 2.1862 0.0158 HipA transcriptional activator hisI b2026 0.7672 0.0436 phosphoribosyl-AMP cyclohydrolase / phosphoribosyl-ATP pyrophosphatase hisJ b2309 0.5028 0.0038 histidine ABC transporter hscA b2526 1.7721 0.0266 chaperone, member of Hsp70 protein family hsdM b4349 0.7275 0.0448 host modification; DNA methylase M hsdS b4348 0.6614 0.0101 specificity determinant for hsdM and hsdR htrA b0161 2.8995 0.0097 DegP hybD b2993 0.4468 0.0191 hydrogenase 2 maturation endopeptidase hydN b2713 1.2745 0.0490 putative electron transport protein HydN ibpA b3687 2.0616 0.0065 small heat shock protein IbpA inaA b2237 1.3823 0.0226 pH-inducible protein involved in stress response infC b1718 1.3280 0.0197 protein chain initiation factor IF-3 iscA b2528 1.4270 0.0242 iron-sulfur cluster assembly protein iscS b2530 1.4016 0.0167 cysteine desulfurase monomer iscU b2529 1.3576 0.0171 scaffold protein involved in iron-sulfur cluster assembly iscX b2524 1.8316 0.0294 protein with possible role in iron-sulfur cluster biogenesis kdgT b3909 2.3520 0.0274 KdgT 2-keto-3-deoxygluconate transporter kduD b2842 0.7186 0.0150 2-deoxy-D-gluconate 3-dehydrogenase kduI b2843 0.7822 0.0384 homolog of pectin degrading enzyme 5-keto 4-deoxyuronate isomerase leuA b0074 2.9952 0.0235 2-isopropylmalate synthase lplA b4386 0.6314 0.0266 lipoyl-protein ligase A lysU b4129 0.3830 0.0029 lysyl-tRNA synthetase (LysRSu), inducible maa b0459 0.6405 0.0004 maltose acetyltransferase malX b1621 0.5038 0.0496 EIIBCMalX malY b1622 0.7775 0.0304 bifunctional: repressor of maltose regulon / cystathionine beta-lyase manA b1613 0.5147 0.0334 mannose-6-phosphate isomerase map b0168 1.5951 0.0157 methionine aminopeptidase marA b1531 5.0995 0.0031 MarA transcriptional activator marR b1530 4.0195 0.0022 MarR-salicylate mbhA b0230 0.4200 0.0113 putative motility protein mdaB b3028 1.9345 0.0233 NADPH quinone reductase mdoD b1424 0.6780 0.0394 glucan biosynthesis protein D mdtH b1065 0.5184 0.0019 YceL MFS transporter menG b3929 0.7805 0.0366 inhibitor of ribonuclease E (RNase E) activity mfd b1114 0.5397 0.0158 transcription-repair coupling factor; mutation frequency decline 162

APPENDIX I

gene blattner ratio p-value Function A/B mglC b2148 0.1817 0.0059 galactose ABC transporter moeB b0826 0.3297 0.0018 molybdopterin biosynthesis mog b0009 0.6094 0.0062 required for the efficient incorporation of Mo into molybdoproteins motA b1890 1.4410 0.0182 MotA protein, proton conductor component of motor; no effect on switching mpaA b1326 0.6680 0.0238 murein peptide amidase A mraW b0082 1.6512 0.0423 S-adenosyl-dependent methyltransferase methionine sulfoxide reductase A / protein-methionine-S-oxide reductase / msrA b4219 0.3359 0.0142 methionine sulfoxide reductase mug b3068 0.2422 0.0049 stationary phase mismatch/uracil DNA glycosylase mukE b0923 2.2877 0.0118 protein involved in chromosome partitioning mukF b0922 2.1539 0.0075 Ca2+-binding protein involved in chromosome partitioning murC b0091 1.3976 0.0217 UDP-N-acetylmuramate-alanine ligase murD b0088 1.1421 0.0308 UDP-N-acetylmuramoylalanine-D-glutamate ligase mutH b2831 0.4240 0.0337 MutHLS complex, methyl-directed mismatch repair nadR b4390 0.6257 0.0268 NadR transcriptional repressor / NMN adenylyltransferase nagA b0677 0.5678 0.0282 N-acetylglucosamine-6-phosphate deacetylase nagB b0678 0.4101 0.0011 glucosamine-6-phosphate deaminase narL b1221 0.5206 0.0007 NarL-Phosphorylated transcriptional dual regulator narX b1222 0.4355 0.0202 NarX-Phis nfi b3998 0.6846 0.0473 endonuclease V (deoxyinosine 3'endoduclease) nfnB b0578 0.7962 0.0085 dihydropteridine reductase nfrA b0568 0.3236 0.0069 bacteriophage N4 receptor, outer membrane protein nfsA b0851 1.5581 0.0063 NADPH nitroreductase nlpD b2742 0.6439 0.0366 NlpD putative outer membrane lipoprotein nudH b2830 1.4474 0.0158 putative invasion protein ompA b0957 0.7281 0.0106 outer membrane protein 3a (II*;G;d) ompC b2215 2.0986 0.0040 outer membrane porin OmpC ompX b0814 0.6904 0.0223 outer membrane protein X oxyR b3961 0.6290 0.0201 OxyR transcriptional dual regulator paaB b1389 0.0991 0.0404 putative subunit of phenylacetate-CoA oxygenase paaI b1396 1.8933 0.0289 hypothetical protein with some similarity to thioesterases pal b0741 0.5468 0.0040 Tol-Pal Cell Envelope Complex panF b3258 0.7935 0.0164 PanF sodium/pantothenate SSS transporter pepQ b3847 1.5249 0.0184 proline dipeptidase pfkA b3916 0.5688 0.0041 6-phosphofructokinase-1 monomer / putative NAD+ kinase pfkB b1723 0.4510 0.0068 6-phosphofructokinase-2 monomer pgk b2926 1.3521 0.0229 phosphoglycerate kinase pheS b1714 1.4275 0.0242 phenylalanyl-tRNA synthetase α-chain phnI b4099 2.1789 0.0451 phosphonate metabolism plsX b1090 2.1023 0.0467 glycerolphosphate auxotrophy in plsB background protease involved in Microcin B17 maturation and in sensitivity to the DNA pmbA b4235 0.6317 0.0323 gyrase inhibitor LetD pnuC b0751 1.2218 0.0260 PnuC NMN transporter poxA b4155 0.4524 0.0462 putative regulator of pyruvate oxidase ppiD b0441 0.7431 0.0500 peptidyl-prolyl cis-trans isomerase prfA b1211 2.0627 0.0070 peptide chain release factor RF-1 prfH b0236 0.3770 0.0439 probable peptide chain release factor prlC b3498 0.5779 0.0203 oligopeptidase A prmA b3259 0.6861 0.0196 methylation of 50S ribosomal subunit protein L11 proA b0243 0.8509 0.0152 gamma-glutamyl kinase-GP-reductase multienzyme complex ptrA b2821 0.2672 0.0247 protease III 5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole lyase / purB b1131 0.7424 0.0127 adenylosuccinate lyase purD b4005 0.6497 0.0099 phosphoribosylamine-glycine ligase purE b0523 0.5049 0.0089 N5-carboxyaminoimidazole ribonucleotide mutase purR b1658 1.3164 0.0433 PurR transcriptional repressor purT b1849 0.4486 0.0494 GAR transformylase 2 163

APPENDIX I

gene blattner ratio p-value Function A/B puuA b1297 0.4444 0.0002 putative glutamine synthetase (EC 6.3.1.2) puuR b1299 2.1380 0.0256 putative oxidoreductase/putative regulator racR b1356 1.7456 0.0218 hypothetical protein rcsF b0196 0.7467 0.0352 RcsF-P RecB; DNA helicase, ATP-dependent dsDNA/ssDNA exonuclease V subunit, recB b2820 0.3206 0.0117 ssDNA endonuclease DNA helicase, ATP-dependent dsDNA/ssDNA exonuclease V subunit, ssDNA recC b2822 2.3410 0.0070 endonuclease rep b3778 0.5395 0.0242 rep helicase, a single-stranded DNA dependent ATPase rffD b3787 1.6810 0.0404 UDP-N-acetyl-D-mannosaminuronic acid dehydrogenase rffG b3788 1.4341 0.0315 dTDP-glucose 4,6-dehydratase 2 rhsC_1 b0700 0.2172 0.0239 RhsC protein in rhs element, interrupted rhtB b3824 0.4705 0.0156 RhtB homoserine Rht Transporter acetylates N-terminal alanine of 30S ribosomal subunit protein S5 / ribosomal- rimJ b1066 0.6184 0.0212 protein-alanine N-acetyltransferase rob b4396 0.6252 0.0498 Rob transcriptional activator rplD b3319 1.8347 0.0070 50S ribosomal subunit protein L4, regulates expression of S10 operon rplP b3313 1.3529 0.0061 50S ribosomal subunit protein L16 rpmG b3636 1.7607 0.0218 50S ribosomal subunit protein L33 rpsI b3230 2.3038 0.0446 30S ribosomal subunit protein S9 ruvA b1861 0.6819 0.0478 branch migration of Holliday structures; repair sanA b2144 3.4542 0.0022 vancomycin sensitivity sapB b1293 1.2822 0.0403 peptide uptake ABC transporter sbcC b0397 0.5204 0.0154 ATP-dependent dsDNA exonuclease sbcD b0398 0.5232 0.0154 ATP-dependent dsDNA exonuclease secG b3175 2.8489 0.0079 Sec Protein Secretion Complex secY b3300 1.6629 0.0061 Sec Protein Secretion Complex setB b2170 0.5873 0.0068 YeiO MFS transporter slt b4392 0.7163 0.0041 soluble lytic murein transglycosylase smtA b0921 2.2662 0.0008 S-adenosylmethionine-dependent methyltransferase sodA b3908 1.6251 0.0428 superoxide dismutase (Mn) sodB b1656 0.6871 0.0357 superoxide dismutase (Fe) sohA b3129 0.3949 0.0001 putative protease, affects protein secretion soxS b4062 0.7246 0.0408 SoxS transcriptional activator speC b2965 0.2278 0.0104 ornithine decarboxylase, biosynthetic speD b0120 0.4229 0.0032 adenosylmethionine decarboxylase, proenzyme speE b0121 0.3868 0.0023 spermidine synthase spoT b3650 2.1390 0.0249 GDP diphosphokinase / guanosine-3',5'-bis(diphosphate) 3'-diphosphatase sspB b3228 1.6238 0.0353 SspB monomer stpA b2669 0.6804 0.0362 DNA-binding protein; H-NS-like protein; chaperone activity; RNA splicing? talA b2464 0.5618 0.0078 transaldolase A tauC b0367 1.2163 0.0350 TauA/TauB/TauC ABC transporter tdcA b3118 0.7075 0.0382 TdcA transcriptional activator tesB b0452 0.5076 0.0130 thioesterase II thrA b0002 1.5206 0.0439 aspartate kinase I / homoserine dehydrogenase I thrS b1719 1.2919 0.0110 threonyl-tRNA synthetase tnaB b3709 0.3751 0.0371 TnaB tryptophan ArAAP transporter tolB b0740 0.6004 0.0079 Tol-Pal Cell Envelope Complex TonB protein; energy transducer; uptake of iron, cyanocobalimin; sensitivity to tonB b1252 4.8369 0.0178 phages, colicins topB b1763 2.2188 0.0171 DNA topoisomerase III tpiA b3919 0.5602 0.0113 triose phosphate isomerase monomer tpx b1324 0.5721 0.0037 thiol peroxidase 2 trkH b3849 1.6425 0.0408 TrkH potassium ion Trk Transporter trpA b1260 0.6895 0.0091 tryptophan synthase, alpha subunit / indoleglycerol phosphate aldolase ubiB b3835 1.8429 0.0208 2-octaprenylphenol hydroxylase ulaG b4192 0.5353 0.0428 putative L-ascorbate 6-phosphate lactonase ves b1742 1.6031 0.0028 cold-induced member of the CspA family 164

APPENDIX I

gene blattner ratio p-value Function A/B wcaM b2043 0.7903 0.0280 hypothetical protein putative oxidoreductase; possible component of selenate reductase with possible xdhD b2881 0.4314 0.0203 role in purine salvage xseB b0422 0.6395 0.0007 exonuclease VII, small subunit xylF b3566 0.8595 0.0048 xylose ABC transporter yaaA b0006 0.6867 0.0434 putative membrane protein yadI b0129 0.6721 0.0176 EIIAga yaeR b0187 0.6633 0.0090 putative enzyme conserved protein; in enteroaggregative E. coli, YafK is required for development yafK b0224 0.5143 0.0141 of biofilms yafL b0227 0.6653 0.0187 putative lipoprotein yagB b0266 0.3543 0.0199 hypothetical protein yahG b0321 0.4435 0.0499 conserved protein yajC b0407 0.6234 0.0285 Sec Protein Secretion Complex yajL b0424 0.5924 0.0146 YajL yajQ b0426 0.7004 0.0019 nucleotide binding protein ybbA b0495 0.4961 0.0210 YbbA/YbbP ABC transporter ybbN b0492 0.5804 0.0095 putative thioredoxin-like protein ybdB b0597 1.8841 0.0034 conserved hypothetical protein ybeD b0631 0.5752 0.0204 conserved hypothetical protein ybeF b0629 0.5481 0.0405 putative transcriptional regulator LYSR-type ybeL b0643 0.5838 0.0267 conserved hypothetical protein ybeR b0645 0.6981 0.0297 conserved hypothetical protein ybfC b0704 0.4592 0.0473 hypothetical protein ybgA b0707 0.5380 0.0378 conserved protein ybgF b0742 0.7414 0.0495 Tol-Pal Cell Envelope Complex ybhA b0766 0.4283 0.0208 putative phosphatase ybhL b0786 0.4806 0.0166 putative transport protein ybiC b0801 0.2705 0.0026 putative dehydrogenase ybjC b0850 2.1246 0.0155 conserved hypothetical protein; gene is within soxRS regulon ybjT b0869 0.5382 0.0222 putative dTDP-glucose ycaO b0905 0.5635 0.0133 conserved hypothetical protein ycaR b0917 0.8119 0.0434 hypothetical protein ycbK b0926 0.4625 0.0396 conserved hypothetical protein ycbQ b0938 0.3915 0.0212 putative fimbrial-like protein ycbW b0946 0.4707 0.0294 conserved hypothetical protein ycdK b1010 0.6659 0.0336 conserved protein ycdO b1018 3.1170 0.0011 conserved hypothetical protein ycdX b1034 0.6258 0.0106 putative DNA polymerase subunit ycdY b1035 0.5220 0.0048 putative oxidoreductase component yceP b1060 3.0327 0.0061 conserved hypothetical protein ycfF b1103 0.7821 0.0425 hypothetical protein ycfX b1119 0.5588 0.0062 putative sugar kinase, ROK family protein ycgF b1163 0.4183 0.0033 conserved protein ycgZ b1164 0.2379 0.0051 hypothetical protein yciA b1253 2.1238 0.0447 putative enzyme ycjO b1311 2.0646 0.0042 YcjN/YcjO/YcjP ABC transporter ycjZ b1328 1.5357 0.0455 putative transcriptional regulator LYSR-type multi modular; putative transcriptional regulator ; also putative ATP-binding ydcR b1439 2.1811 0.0125 component of a transport system ydcX b1445 2.0821 0.0245 hypothetical protein yddB b1495 1.8931 0.0263 conserved protein yddE b1464 0.5672 0.0290 conserved protein yddH b1462 2.1448 0.0097 putative enzyme ydeK b1510 0.7567 0.0259 YdeK ydeR b1503 2.0061 0.0065 putative fimbrial-like protein ydfD b1576 1.1486 0.0464 hypothetical protein 165

APPENDIX I

gene blattner ratio p-value Function A/B ydfG b1539 0.5150 0.0046 3-hydroxy acid dehydrogenase monomer ydfJ b1543 2.2617 0.0173 YdfJ ydfR b1555 1.4544 0.0272 hypothetical protein YdgF b1600 4.2412 0.0211 YdgF SMR protein; toxin of a putative toxin-antitoxin pair ydhH b1640 0.4438 0.0035 conserved hypothetical protein ydhO b1655 1.6025 0.0127 putative lipoprotein ydhR b1667 2.0667 0.0134 conserved hypothetical protein ydiA b1703 0.5498 0.0081 conserved protein ydiJ b1687 0.6760 0.0039 putative oxidase ydiZ b1724 0.4478 0.0112 conserved hypothetical protein ydjA b1765 0.7449 0.0457 conserved protein ydjJ b1774 0.4478 0.0421 putative oxidoreductase conserved hypothetical protein with structural similarity to metal binding yecM b1875 0.5730 0.0459 isomerases and oxygenases yecR b1904 2.2905 0.0227 conserved hypothetical protein yedA b1959 0.3926 0.0268 putative transmembrane subunit yedS_2 b1965 1.2318 0.0336 putative outer membrane protein yedW b1969 1.7473 0.0293 putative 2-component transcriptional response regulator yeeV b2005 2.3889 0.0447 toxin of the YeeV-YeeU toxin-antitoxin pair yegD b2069 0.4221 0.0152 actin family protein yehS b2124 1.5509 0.0010 conserved hypothetical protein yfaY b2249 0.6432 0.0439 putative competence-damage protein yfcO b2332 2.0298 0.0093 conserved hypothetical protein yfdG b2350 1.9660 0.0295 hypothetical protein yfdH b2351 2.2682 0.0127 putative glycan biosynthesis enzyme yfdQ b2360 0.7084 0.0485 hypothetical protein yfdZ b2379 0.4682 0.0142 putative aminotransferase yfeA b2395 3.1873 0.0153 putative membrane protein yfgA b2516 1.6228 0.0427 putative membrane protein yfgG b2504 1.9854 0.0010 hypothetical protein yfiC b2575 0.6816 0.0353 putative enzyme ygaF b2660 0.2733 0.0438 hypothetical protein ygaH b2683 4.1143 0.0001 putative transport protein ygaZ b2682 3.8502 0.0126 hypothetical protein ygdR b2833 0.7101 0.0443 conserved hypothetical protein ygeA b2840 0.7747 0.0342 putative resistance protein yggG b2936 0.5864 0.0044 conserved protein glutathione transferase-like protein possibly involved in glutathionylspermidine yghU b2989 0.2346 0.0021 metabolism yghX b2999 0.7351 0.0450 putative enzyme ygiB b3037 0.6675 0.0272 conserved hypothetical protein ygiC b3038 0.6545 0.0203 putative glutathione-like synthetase ygjK b3080 0.7192 0.0047 putative isomerase yhaH b3103 1.7228 0.0160 putative cytochrome yhaO b3110 0.4765 0.0045 YhaO STP transporter yhaV b3130 0.4633 0.0039 conserved hypothetical protein yhdN b3293 0.5429 0.0431 conserved hypothetical protein yhgA b3411 0.8004 0.0317 hypothetical protein yhhW b3439 0.5175 0.0175 conserved hypothetical protein yhhX b3440 0.6329 0.0101 putative galactose 1-dehydrogenase yicC b3644 0.7406 0.0216 conserved protein yidS b3690 0.7631 0.0435 putative oxidoreductase with FAD/NAD(P)-binding domain yidW b3694 0.3773 0.0239 yidZ b3711 0.8211 0.0483 putative transcriptional regulator LysR-type yifK b3795 3.1137 0.0009 YifK APC transporter yiiM b3910 0.7020 0.0122 conserved hypothetical protein yjdI b4126 0.7375 0.0469 conserved hypothetical protein 166

APPENDIX I

gene blattner ratio p-value Function A/B yjdL b4130 0.8934 0.0340 YjdL peptide POT transporter yjeJ b4145 1.3189 0.0227 conserved protein yjhH b4298 0.5714 0.0293 putative lyase/synthase yjhQ b4307 0.5879 0.0424 hypothetical protein yjjQ b4365 0.7703 0.0016 putative regulator ykgB b0301 0.1144 0.0233 putative membrane protein ykgI b0303 0.0811 0.0115 hypothetical protein yliC b0831 0.5742 0.0208 YliA/YliB/YliC/YliD ABC transporter ymdB b1045 0.4293 0.0044 conserved protein ymfL b1147 0.6034 0.0298 hypothetical protein ymgA b1165 0.2057 0.0011 hypothetical protein ymgB b1166 0.2193 0.0045 hypothetical protein ynbB b1409 1.8755 0.0346 putative phosphatidate cytidiltransferase ynbD b1411 2.0382 0.0189 putative enzyme yncE b1452 1.5010 0.0124 putative receptor ynfA b1582 0.5690 0.0326 inner membrane protein ynfF b1588 1.3945 0.0073 oxidoreductase subunit paralog of DmsA ynfK b1593 1.3710 0.0451 hypothetical protein yoaB b1809 0.6323 0.0226 conserved protein yohK b2142 0.6522 0.0298 putative transporter yojI b2211 4.8991 0.0006 YojI ypfG b2466 0.5804 0.0215 conserved hypothetical protein ypjF b2646 0.6684 0.0339 member of the YeeV, YkfI, YpjF family of toxin proteins yqcD b2794 0.5550 0.0359 conserved hypothetical protein yqgF b2949 0.5076 0.0306 possible Holliday junction resolvase yqjE b3099 0.5661 0.0492 conserved protein yraR b3152 0.6835 0.0499 putative NADH dehydrogenase yrdA b3279 0.3644 0.0141 putative transferase yrdD b3283 1.3095 0.0130 putative DNA topoisomerase ytfN b4221 0.7492 0.0064 conserved protein zipA b2412 2.6840 0.0155 essential cell division protein ZipA znuA b1857 2.8611 0.0069 ZnuA/ZnuB/ZnuC ABC transporter

Supplementary table – XII: LZ41 wild-type (A) Vs LZ41 hns-205::Tn10 (B)

gene blattner ratio p-value Function A/B aat b0885 0.7595 0.0479 leucyl, phenylalanyl-tRNA-protein transferase abgR b1339 0.6195 0.0042 putative transcriptional regulator LYSR-type acrA b0463 4.5010 0.0065 AcrA Membrane Fusion Protein acrE b3265 0.1208 0.0044 transmembrane protein affects septum formation and cell membrane permeability acrF b3266 0.6175 0.0474 AcrEF-TolC Drug Efflux Transport System ade b3665 0.0536 0.0002 cryptic adenine deaminase monomer agaA b3135 0.5197 0.0250 AgaA agaC b3139 0.5391 0.0363 EIIAga aldB b3588 0.6583 0.0359 putative aminobutyraldehyde dehydrogenase / aldehyde dehydrogenase B allA b0505 0.6574 0.0061 ureidoglycolate hydrolase allB b0512 0.4423 0.0151 allantoinase allC b0516 0.4293 0.0117 allantoate amidohydrolase allD b0517 0.4905 0.0101 ureidoglycolate dehydrogenase alsB b4088 0.4271 0.0007 YjcX aniC b4115 0.4105 0.0212 AdiC Arginine:Agmatine Antiporter araG b1900 0.7483 0.0333 arabinose ABC transporter 167

APPENDIX I

gene blattner ratio p-value Function A/B araH b4460 0.4566 0.0067 high-affinity L-arabinose transport protein (ABC superfamily, membrane) arnT b2257 0.2829 0.0208 4-amino-4-deoxy-L-arabinose (L-Ara4N) transferase aroD b1693 0.6190 0.0316 3-dehydroquinate dehydratase aroH b1704 0.5580 0.0038 2-dehydro-3-deoxyphosphoheptonate aldolase asnS b0930 1.7622 0.0368 asparaginyl-tRNA synthetase astB b1745 1.3454 0.0327 succinylarginine dihydrolase atoA b2222 2.3479 0.0324 AtoA / putative acetate CoA-transferase b0501 b0501 0.1596 0.0008 hypothetical protein b0816 b0816 0.4687 0.0373 hypothetical protein b1172 b1172 0.1061 0.0001 conserved hypothetical protein b1354 b1354 0.5533 0.0243 hypothetical protein b1364 b1364 10.5092 0.0054 hypothetical protein b1903 b1903 0.2168 0.0033 hypothetical protein b2596 b2596 0.5031 0.0010 hypothetical protein b2680 b2680 0.7122 0.0494 YgaY MFS transporter b2856 b2856 0.6466 0.0035 hypothetical protein bcsE b3536 0.5509 0.0240 putative protease bcsF b3537 0.5029 0.0319 hypothetical protein bcsZ b3531 0.5272 0.0166 endo-1,4-D-glucanase bdm b1481 0.4413 0.0416 hypothetical protein bioB b0775 1.5107 0.0398 biotin synthase monomer blc b4149 0.6930 0.0385 Blc outer membrane lipoprotein (lipocalin) bolA b0435 0.5808 0.0485 BolA transcriptional regulator borD b0557 0.2028 0.0066 bacteriophage lambda Bor protein homolog outer membrane receptor for transport of vitamin B12, E colicins, and btuB b3966 2.0282 0.0268 bacteriophage BF23 cadA b4131 0.1817 0.0010 lysine decarboxylase cadB b4132 0.2314 0.0183 CadB cadaverine/lysine APC exchanger / Transporter chaA b1216 1.1728 0.0177 ChaA calcium CaCA transporter chbF b1734 0.4431 0.0084 6-phospho-beta-glucosidase; cryptic hypothetical protein, encoded by an operon required for growth on N,N'- chbG b1733 0.5453 0.0153 diacetylchitobiose chbR b1735 0.2703 0.0116 ChbR transcriptional regulator cheY b1882 3.2891 0.0487 CheY-Pasp clpB b2592 0.7053 0.0387 ClpB chaperone cmr b0842 0.4212 0.0345 MdfA/Cmr MFS multidrug transporter codA b0337 1.3776 0.0127 cytosine deaminase cpsB b2049 0.0143 0.0001 mannose-1-phosphate guanylyltransferase-(GDP) cpsG b2048 0.0793 0.0000 phosphomannomutase csgA b1042 0.1297 0.0015 curlin, major subunit csgB b1041 0.2784 0.0091 curlin, minor subunit precursor csgD b1040 0.2937 0.0139 CsgD transcriptional activator csgE b1039 0.4605 0.0168 curli production assembly/transport component csgG b1037 0.3495 0.0413 curli production component cspA b3556 2.1715 0.0311 cold shock protein CspA cspB b1557 0.3823 0.0091 cold shock protein CspB cspC b1823 0.2854 0.0008 cold shock protein CspC cspG b0990 0.2179 0.0008 cold shock protein CspG cspI b1552 0.1377 0.0009 cold shock protein CspI cycA b4208 0.7201 0.0338 CycA serine/alanine/glycine APC transporter cyoC b0430 0.6460 0.0438 cytochrome bo terminal oxidase subunit III cysW b2423 0.6811 0.0088 sulfate ABC transporter dadX b1190 0.5637 0.0240 alanine racemase, major dctR b3507 0.4508 0.0475 protein involved in metabolism of C4-dicarboxylates dcuC b0621 0.4523 0.0022 DcuC dicarboxylate transporter dcyD b1919 1.4064 0.0091 D-cysteine desulfhydrase monomer degQ b3234 1.3540 0.0123 serine endoprotease 168

APPENDIX I

gene blattner ratio p-value Function A/B purine nucleoside phosphorylase / guanosine phosphorylase / deoxyguanosine phosphorylase / inosine phosphorylase / deoxyinosine phosphorylase / adenine deoD b4384 1.5417 0.0073 phosphorylase / deoxyadenosine phosphorylase dgt b0160 0.6156 0.0126 deoxyguanosinetriphosphate triphosphohydrolase dmsC b0896 1.2108 0.0248 dimethyl sulfoxide reductase, chain C dnaA b3702 1.5798 0.0490 DnaA-ATP transcriptional dual regulator dnaG b3066 1.3368 0.0473 DNA biosynthesis; DNA primase dnaK b0014 0.5937 0.0163 chaperone Hsp70; DNA biosynthesis; autoregulated heat shock proteins dnaN b3701 1.8832 0.0335 DNA polymerase III, beta-subunit dnaX b0470 1.3300 0.0296 DNA polymerase III, tau and gamma subunits; DNA elongation factor III dpiB b0619 0.4224 0.0076 DpiB dppF b3540 1.1825 0.0280 dipeptide ABC transporter stationary phase nucleoid protein that sequesters iron and protects DNA from dps b0812 0.5769 0.0236 damage dsdX b2365 0.3602 0.0190 DsdX Gnt tranporter dtd b3887 1.2548 0.0380 D-Tyr-tRNATyr deacylase elaC b2268 0.6406 0.0465 binuclear zinc phosphodiesterase monomer emrE b0543 0.4603 0.0035 EmrE SMR transporter emrK b2368 0.5558 0.0366 EmrK putative membrane fusion protein emrY b2367 0.1336 0.0000 EmrY putative multidrug MFS transporter envC b3613 1.5602 0.0371 EnvC murein hydrolase essQ b1556 4.4414 0.0125 hypothetical protein eutB b2441 0.7106 0.0143 ethanolamine ammonia-lyase, probable regulatory subunit eutD b2458 0.4881 0.0053 putative phosphate acetyltransferase, ethanolamine utilization eutN b2456 0.5116 0.0035 putative detox protein, ethanolamine utilization GDP-4-dehydro-6-deoxy-D-mannose epimerase / GDP-4-dehydro-6-L- fcl b2052 0.0327 0.0006 deoxygalactose reductase outer membrane receptor; citrate-dependent iron transport, outer membrane fecA b4291 0.6549 0.0354 receptor fecB b4290 0.6183 0.0038 ferric dicitrate uptake system fhlA b2731 1.2443 0.0006 FhlA-Formate transcriptional activator fhuC b0151 2.0062 0.0140 ferrichrome uptake system stationary-phase protein with possible role in p-aminobenzoate or folate fic b3361 1.3138 0.0372 biosynthesis fimA b4314 0.0526 0.0007 major type 1 subunit fimbrin (pilin) fimB b4312 0.0776 0.0001 regulator for fimA fimD b4317 0.3019 0.0243 outer membrane protein; export and assembly of type 1 fimbriae, interrupted fimE b4313 0.0565 0.0001 regulator for fimA fimG b4319 0.5755 0.0041 fimbrial morphology fimI b4315 0.0712 0.0005 fimbrial protein fixB b0042 0.3451 0.0185 probable flavoprotein subunit required for anaerobic carnitine metabolism flavoprotein (electron transport), possibly involved in anaerobic carnitine fixC b0043 0.4760 0.0273 metabolism flgA b1072 27.1534 0.0010 flagellar biosynthesis; assembly of basal-body periplasmic P ring flgB b1073 24.5528 0.0038 flagellar basal-body rod protein FlgB flgC b1074 14.9393 0.0009 flagellar basal-body rod protein FlgC flgD b1075 16.5742 0.0019 flagellar biosynthesis, initiation of hook assembly flgE b1076 9.2717 0.0007 flagellar hook protein FlgE flgF b1077 6.1174 0.0007 flagellar basal-body rod protein FlgF flgG b1078 21.9901 0.0010 flagellar basal-body rod protein FlgG flagellar L-ring protein FlgH; basal-body outer-membrane L (lipopolysaccharide flgH b1079 9.7694 0.0040 layer) ring protein flgI b1080 15.6181 0.0055 flagellar P-ring protein FlgI flgJ b1081 6.3428 0.0005 FlgJ flgK b1082 4.5952 0.0289 flagellar biosynthesis, hook-filament junction protein 1 flgM b1071 28.5501 0.0060 anti-FliA (anti-sigma) factor; also known as RflB protein flgN b1070 7.0812 0.0008 flagellar biosynthesis protein FlgN flhA b1879 2.5230 0.0463 flagellar biosynthesis protein FlhA flhB b1880 10.7222 0.0025 flagellar biosynthesis protein FlhB 169

APPENDIX I

gene blattner ratio p-value Function A/B flhE b1878 1.3435 0.0065 flagellar protein fliA b1922 32.8560 0.0014 sigma28 factor fliC b1923 10.1921 0.0486 flagellar biosynthesis; flagellin, filament structural protein fliD b1924 12.4018 0.0338 flagellar cap protein FliD; filament capping protein; enables filament assembly fliE b1937 18.5368 0.0018 flagellar basal-body protein FliE flagellar M-ring protein FliF; basal-body MS(membrane and supramembrane)- fliF b1938 23.8464 0.0001 ring and collar protein flagellar motor switch protein FliG; component of motor switching and fliG b1939 17.5399 0.0006 energizing, enabling rotation and determining its direction fliH b1940 18.6885 0.0041 flagellar biosynthesis protein FliH fliJ b1942 14.2153 0.0015 flagellar biosynthesis protein FliJ fliK b1943 11.4774 0.0028 flagellar hook-length control protein FliK fliL b1944 21.9931 0.0024 flagellar biosynthesis flagellar motor switch protein FliM; component of motor switch and energizing, fliM b1945 24.5354 0.0007 enabling rotation and determining its direction flagellar motor switch protein FliN; component of motor switch and energizing, fliN b1946 20.1390 0.0021 enabling rotation and determining its direction fliO b1947 6.1100 0.0078 flagellar biosynthesis protein FliO fliQ b1949 16.8460 0.0006 flagellar biosynthesis protein FliQ fliR b1950 14.0112 0.0024 flagellar biosynthesis protein FliR fliS b1925 11.4258 0.0360 flagellar biosynthesis protein FliS periplasmic cystine-binding protein; member of extracellular bacterial solute- fliY b1920 4.6961 0.0053 binding protein family III fliZ b1921 11.3145 0.0013 possible cell-density responsive regulator of sigmaF folX b2303 0.7774 0.0119 dihydroneopterin triphosphate 2'-epimerase frvR b3897 1.5713 0.0220 FrvR predicted transcriptional regulator frwC b3949 1.2134 0.0259 EIIBCFrw ftnA b1905 0.2411 0.0207 cytoplasmic ferritin, an iron storage protein) ftnB b1902 0.2538 0.0225 hypothetical protein ftsB b2748 2.1787 0.0303 essential cell division protein FtsB ftsK b0890 0.8409 0.0222 essential cell division protein FtsK ftsY b3464 1.1435 0.0290 SRP receptor fucI b2802 0.7804 0.0498 L-fucose isomerase fucU b2804 0.5451 0.0123 cytoplasmic L-fucose binding protein fumC b1611 0.5797 0.0314 fumarase C monomer fusA b3340 1.6060 0.0216 elongation factor G fxsA b4140 0.5479 0.0484 inner membrane protein; overproduction inhibits F exclusion of bacteriophage T7 gadA b3517 0.0922 0.0055 glutamate decarboxylase A subunit gadC b1492 0.1563 0.0066 XasA GABA APC transporter gadE b3512 0.1055 0.0047 GadE transcriptional activator gadW b3515 0.4779 0.0095 GadWtranscriptional repressor galP b2943 0.5043 0.0494 GalP - galactose MFS transporter galS b2151 0.7119 0.0404 GalS-galactose garL b3126 0.5428 0.0453 alpha-dehydro-beta-deoxy-D-glucarate aldolase gatA b2094 0.2319 0.0238 EIIGat gatC b2092 0.3166 0.0061 EIIGat gatD b2091 0.3602 0.0414 galactitol-1-phosphate dehydrogenase negative DNA-binding transcriptional regulator of galactitol metabolism, subunit gatR_1 b2087 0.6518 0.0330 of GatR transcriptional repressor glf b2036 0.6716 0.0075 UDP-galactopyranose mutase glgS b3049 0.5189 0.0061 glycogen biosynthesis, rpoS dependent glpG b3424 1.5025 0.0339 inner membrane-associated protein of glp regulon gltF b3214 0.2557 0.0049 regulator of gltBDF operon, induction of Ntr enzymes glxR b0509 0.4957 0.0241 tartronate semialdehyde reductase 2 gmd b2053 0.0770 0.0082 GDP-mannose 4,6-dehydratase gmk b3648 1.2627 0.0032 deoxyguanylate kinase / guanylate kinase gmr b1285 0.6330 0.0116 RNase II modulator gnd b2029 0.5770 0.0017 6-phosphogluconate dehydrogenase (decarboxylating) 170

APPENDIX I

gene blattner ratio p-value Function A/B gnsB b1550 0.3110 0.0035 protein that affects unsaturated fatty acid abundance gspD b3325 0.5089 0.0206 putative protein secretion protein for export gspE b3326 0.6419 0.0197 putative protein secretion protein for export gspG b3328 0.6256 0.0416 putative protein secretion protein for export gspH b3329 0.1773 0.0015 putative protein secretion protein for export hcaC b2540 1.4004 0.0273 ferredoxin, 3-phenylpropionate dioxygenase system hchA b1967 0.4961 0.0197 heat shock protein (Hsp) 31 hcr b0872 0.5809 0.0410 NADH oxidoreductase hdeA b3510 0.0218 0.0006 acid-resistance protein, possible chaperone hdeB b3509 0.0715 0.0064 10K-L protein, related to acid resistance protein of Shigella flexneri hdhA b1619 0.3868 0.0075 7-alpha-hydroxysteroid dehydrogenase hemA b1210 0.1261 0.0284 glutamyl-tRNA reductase hha b0460 0.3850 0.0259 haemolysin expression modulating protein hipA b1507 8.3272 0.0254 HipA transcriptional activator hlyE b1182 0.0720 0.0009 hemolysin E hns b1237 9.0470 0.0012 H-NS transcriptional dual regulator holB b1099 3.2529 0.0455 DNA polymerase III, delta prime subunit hslR b3400 0.8182 0.0329 heat shock protein Hsp15 htrA b0161 0.3019 0.0256 DegP htrL b3618 0.3142 0.0055 involved in lipopolysaccharide biosynthesis hybB b2995 0.6320 0.0450 probable cytochrome Ni/Fe component of hydrogenase-2 icdA b1136 0.6386 0.0068 Icd idnK b4268 0.6017 0.0247 gluconokinase II idnO b4266 0.5978 0.0248 5-keto-D-gluconate 5-reductase / putative acetoin dehydrogenase inaA b2237 2.1979 0.0462 pH-inducible protein involved in stress response intF b0281 1.8823 0.0476 putative phage integrase intG b1936 0.3321 0.0004 hypothetical protein intR b1345 0.5389 0.0226 putative transposase katE b1732 0.5629 0.0051 hydroperoxidase II kbl b3617 0.5504 0.0248 2-amino-3-ketobutyrate CoA ligase kduD b2842 1.1891 0.0386 2-deoxy-D-gluconate 3-dehydrogenase kduI b2843 0.6885 0.0274 homolog of pectin degrading enzyme 5-keto 4-deoxyuronate isomerase leuO b0076 0.3307 0.0226 LeuO transcriptional activator lit b1139 0.4834 0.0364 Lit, cell death peptidase; phage exclusion; e14 prophage lon b0439 0.6940 0.0326 DNA-binding, ATP-dependent protease La lysS b2890 1.2168 0.0189 lysyl tRNA synthetase (LysRSs), constitutive maa b0459 0.5169 0.0308 maltose acetyltransferase malP b3417 2.3538 0.0003 maltodextrin phosphorylase monomer malZ b0403 0.5110 0.0173 maltodextrin glucosidase mcrA b1159 0.6575 0.0372 restriction of DNA at 5-methylcytosine residues mcrB b4346 0.5308 0.0084 MrcB subunit of 5-methylcytosine restriction system mcrC b4345 0.4781 0.0069 MrcC subunit of 5-methylcytosine restriction system mdoC b1047 0.5105 0.0193 protein required for succinyl modification of osmoregulated periplasmic glucans mdoG b1048 0.6617 0.0179 periplasmic glucan (MDO) biosynthesis protein mdtD b2077 0.2947 0.0001 YegB mdtM b4337 0.2035 0.0056 YjiO drug MFS transporter mdtP b4080 0.6347 0.0466 putative enzyme metE b3829 0.7137 0.0147 Cobalamin-independent homocysteine transmethylase mhpD b0350 1.7196 0.0017 2-keto-4-pentenoate hydratase moaE b0785 1.1425 0.0282 molybdopterin synthase large subunit mokC b0018 0.5463 0.0278 regulatory peptide whose translation enables hokC (gef) expression MotB protein, enables flagellar motor rotation, linking torque machinery to cell motB b1889 31.7966 0.0090 wall mqo b2210 1.3940 0.0142 malate dehydrogenase msbA b0914 1.4206 0.0411 ATP-binding transport protein; multicopy suppressor of htrB mtr b3161 0.5406 0.0232 Mtr tryptophan ArAAP transporter murB b3972 1.3239 0.0246 UDP-N-acetylmuramate dehydrogenase 171

APPENDIX I

gene blattner ratio p-value Function A/B mutS b2733 1.7394 0.0434 MutHLS complex, methyl-directed mismatch repair mviN b1069 6.8399 0.0383 putative virulence factor nagA b0677 1.4358 0.0326 N-acetylglucosamine-6-phosphate deacetylase nanA b3225 1.4721 0.0000 N-acetylneuraminate lyase nanC b4311 0.1875 0.0025 conserved hypothetical protein narV b1465 10.0792 0.0064 nitrate reductase Z, γ subunit nucleoside diphosphate kinase / UDP kinase / CDP kinase / dUDP kinase / dCDP ndk b2518 0.5474 0.0389 kinase / dTDP kinase / dADP kinase / dGDP kinase / GDP kinase nmpC b0553 0.1597 0.0178 outer membrane porin protein; locus of qsr prophage nrdH b2673 1.9330 0.0215 glutaredoxin-like protein; hydrogen donor nrfB b4071 0.7562 0.0150 nitrite reductase complex nudD b2051 0.0081 0.0000 GDP-mannose mannosyl hydrolase ompF b0929 4.4090 0.0048 outer membrane porin OmpF ompL b3875 0.4607 0.0424 OmpL oppC b1245 0.4030 0.0434 oligopeptide ABC transporter osmB b1283 0.1157 0.0062 OsmB osmotically inducible lipoprotein osmC b1482 0.2146 0.0012 osmotically inducible peroxidase OsmC otsA b1896 0.4210 0.0107 trehalose-6-phosphate synthase paaB b1389 0.4994 0.0344 putative subunit of phenylacetate-CoA oxygenase paaI b1396 8.7551 0.0044 hypothetical protein with some similarity to thioesterases pagP b0622 0.2253 0.0082 PagP monomer parE b3030 1.4510 0.0027 Topoisomerase IV subunit B pdxA b0052 0.8447 0.0010 PdxA dehydrogenase/decarboxylase pflB b0903 0.5179 0.0369 pyruvate formate-lyase (inactive) pflD b3951 0.7011 0.0477 formate acetyltransferase 2 pgaC b1022 0.4106 0.0015 predicted N-glycosyltransferase pgaD b1021 0.3002 0.0038 putative inner membrane protein pheM b1715 0.5171 0.0303 phenylalanyl-tRNA synthetase (pheST) operon leader peptide pinR b1374 0.1294 0.0012 putative transposon resolvase pitB b2987 0.4130 0.0274 PitB plsB b4041 1.4149 0.0072 glycerol-3-phosphate acyltransferase pmrF b2254 0.1668 0.0000 undecaprenyl phosphate-L-Ara4FN transferase polB b0060 1.4392 0.0465 DNA polymerase II potC b1124 0.7024 0.0321 putrescine/spermidine ABC transporter poxA b4155 0.5601 0.0149 putative regulator of pyruvate oxidase protein phosphatase 2 / protein-tyrosine-phosphatase / phosphoprotein pphB b2734 0.2574 0.0011 phosphatase pptA b1461 0.4035 0.0291 probable 4-oxalocrotonate tautomerase (4-OT) monomer pqqL b1494 0.3738 0.0359 putative zinc peptidase prfA b1211 6.2321 0.0253 peptide chain release factor RF-1 prfH b0236 0.4740 0.0086 probable peptide chain release factor ptrB b1845 0.6002 0.0443 protease II purC b2476 1.2969 0.0425 phosphoribosylaminoimidazole-succinocarboxamide synthase puuR b1299 8.2529 0.0016 putative oxidoreductase/putative regulator pyrE b3642 0.5836 0.0304 orotate phosphoribosyltransferase rarD b3819 0.3373 0.0007 hypothetical protein rbfA b3167 1.2320 0.0250 ribosome-binding factor A rbsD b3748 0.3624 0.0037 D-ribose utilization positive DNA-binding transcriptional regulator of capsular polysaccharide rcsA b1951 0.2865 0.0016 synthesis, activates its own expression recT b1349 0.2404 0.0026 recombinase, DNA renaturation rfbA b2039 0.6165 0.0268 dTDP-glucose pyrophosphorylase rfbB b2041 0.5623 0.0045 RmlB rfbC b2038 0.5770 0.0462 dTDP-4-dehydrorhamnose 3,5-epimerase rfbX b2037 0.5272 0.0173 RfbX lipopolysaccharide PST transporter rfc b2035 0.5906 0.0455 O-antigen polymerase rhsA b3593 0.4056 0.0183 RhsA protein in rhs element 172

APPENDIX I

gene blattner ratio p-value Function A/B rhsD b0497 0.1818 0.0162 RhsD protein in rhs element rihB b2162 0.4616 0.0135 ribonuceloside hydrolase 2 (pyrimidine-specific) rluC b1086 0.7606 0.0060 23S rRNA pseudouridine synthase rmuC b3832 1.5317 0.0486 conserved protein rplM b3231 1.1735 0.0393 50S ribosomal subunit protein L13 rpmG b3636 1.3762 0.0233 50S ribosomal subunit protein L33 rpoA b3295 1.7007 0.0053 RNA polymerase, alpha subunit rpsO b3165 1.2800 0.0383 30S ribosomal subunit protein S15 rseA b2572 0.6762 0.0264 anti-sigma factor that inhibits sigmaE negative regulator of sigmaE; interacts with RseA and stimulates binding of RseA rseB b2571 0.5923 0.0358 to sigmaE rstA b1608 0.4644 0.0241 RstA- Phosphorylated transcriptional regulator rsxB b1628 0.8140 0.0337 member of SoxR-reducing complex rsxD b1630 0.8446 0.0469 integral membrane protein of SoxR-reducing complex ruvA b1861 0.7247 0.0021 branch migration of Holliday structures; repair sbmA b0377 1.2804 0.0236 SbmA sdhA b0723 0.5308 0.0031 succinate dehydrogenase flavoprotein sdhB b0724 0.6045 0.0340 succinate dehydrogenase iron-sulfur protein sfmC b0531 0.6341 0.0140 putative chaperone sfsA b0146 0.7060 0.0346 SfsA sgbU b3582 0.3459 0.0092 probable 3-hexulose-6-phosphate isomerase shiA b1981 0.3567 0.0076 ShiA shikimate MFS transporter skp b0178 1.0703 0.0483 periplasmic chaperone slp b3506 0.4891 0.0409 outer membrane protein induced after carbon starvation slyA b1642 0.5661 0.0360 SlyA transcriptional activator speD b0120 0.6822 0.0032 adenosylmethionine decarboxylase, proenzyme stpA b2669 0.1356 0.0074 DNA-binding protein; H-NS-like protein; chaperone activity; RNA splicing? tatA b3836 1.3939 0.0306 TatA tatD b4483 1.7888 0.0417 magnesium-dependent DNase tauA b0365 0.5600 0.0404 TauA/TauB/TauC ABC transporter tauB b0366 0.6178 0.0194 TauA/TauB/TauC ABC transporter tdcB b3117 0.2584 0.0065 threonine dehydratase (catabolic) tdcC b3116 0.2341 0.0055 TdcC threonine STP transporter tdcD b3115 0.4677 0.0419 propionate kinase / acetate kinase C tdcF b3113 0.2775 0.0099 hypothetical protein tdk b1238 0.3639 0.0022 thymidine kinase / deoxyuridine kinase tnaA b3708 0.1418 0.0152 L-cysteine desulfhydrase / tryptophanase tolA b0739 0.8478 0.0322 Tol-Pal Cell Envelope Complex torS b0993 2.0482 0.0380 TorS-Phis850 torY b1873 0.2576 0.0198 trimethylamine N-oxide reductase III, c-type cytochrome subunit torZ b1872 0.3923 0.0120 trimethylamine N-oxide reductase III, TorZ subunit treB b4240 25.0943 0.0439 EIITre treC b4239 7.6034 0.0357 trehalose-6-phosphate hydrolase trmA b3965 1.5449 0.0177 tRNA (uracil-5-)-methyltransferase trmH b3651 1.5347 0.0249 tRNA (Gm18) 2'-O-methyltransferase 3-demethylubiquinone 3-methyltransferase / 2-octaprenyl-6-hydroxyphenol ubiG b2232 1.1103 0.0475 methylase ugd b2028 0.0650 0.0009 UDP-glucose 6-dehydrogenase ulaA b4193 1.5705 0.0194 eiisga ulaR b4191 0.7810 0.0103 putative DeoR-type transcriptional regulator uppP b3057 0.5663 0.0449 undecaprenyl diphosphatase; bacitracin resistance uspD b3923 0.4337 0.0346 stress protein involved in resistance to UV irradiation uvrC b1913 0.4947 0.0149 excinuclease ABC, subunit C; repair of UV damage to DNA uxaA b3091 0.7147 0.0481 altronate dehydratase DNA mismatch endonuclease of the very short patch (VSP) mismatch repair vsr b1960 0.7256 0.0064 pathway wbbI b2034 0.6317 0.0228 hypothetical protein; not required for colanic acid biosynthesis 173

APPENDIX I

gene blattner ratio p-value Function A/B wbbJ b2033 0.6009 0.0130 putative transferase wcaA b2059 0.1328 0.0082 putative regulator wcaB b2058 0.0815 0.0015 putative transferase wcaC b2057 0.1000 0.0029 putative glycosyl transferase wcaD b2056 0.0149 0.0002 putative colanic acid polymerase wcaE b2055 0.0409 0.0011 putative colanic acid biosynthesis glycosyl transferase wcaF b2054 0.0262 0.0002 putative transferase wcaI b2050 0.3118 0.0133 putative colanic biosynthesis glycosyl transferase wcaJ b2047 0.1255 0.0000 putative colanic acid biosynthsis UDP-glucose lipid carrier transferase wcaK b2045 0.1130 0.0074 putative galactokinase (EC 2.7.1.6). wcaL b2044 0.0764 0.0036 putative colanic biosynthesis glycosyl transferase wcaM b2043 0.0293 0.0005 hypothetical protein Wza Outer Membrane Auxiliary (OMA) Protein, putative polysaccharide export wza b2062 0.1207 0.0140 protein wzb b2061 0.3249 0.0468 tyrosine phosphatase wzc b2060 0.1280 0.0091 tyrosine kinase involved in colanic acid biosynthesis wzxC b2046 0.2888 0.0079 WzxC metabolism; biosynthesis of macromolecules (cellular constituents); wzxE b3792 1.5446 0.0476 enterobacterial common antigen (surface glycolipid) transport xapB b2406 0.4569 0.0141 XapB xanthosine MFS transporter xapR b2405 0.3765 0.0027 XapR transcriptional activator yaaW b0011 3.2924 0.0115 HtgA transcriptional regulator yacH b0117 0.8161 0.0238 putative membrane protein yadC b0135 0.4099 0.0206 putative fimbrial-like protein yadL b0137 0.2631 0.0178 putative adhesin-like protein yadN b0141 0.6154 0.0468 putative fimbrial-like protein yafT b0217 0.2068 0.0031 putative aminopeptidase yagL b0278 0.0609 0.0012 DNA-binding protein yagM b0279 0.3618 0.0281 hypothetical protein yagU b0287 0.5429 0.0268 conserved protein yagW b0290 0.1221 0.0006 putative receptor yagX b0291 0.1265 0.0029 putative enzyme yagZ b0293 0.0142 0.0005 conserved hypothetical protein yahA b0315 0.3523 0.0129 hypothetical protein yahB b0316 0.6555 0.0219 putative transcriptional regulator LYSR-type yahI b0323 0.5829 0.0393 putative carbamate kinase yaiB b0382 0.4839 0.0452 conserved hypothetical protein yaiP b0363 0.2167 0.0005 polysaccharide metabolism ybaJ b0461 0.2263 0.0008 conserved hypothetical protein ybaT b0486 1.5467 0.0361 YbaT APC transporter hypothetical protein with similarity to the ALU1-P aluminum tolerance protein of ybaX b0444 1.3088 0.0297 Arthrobacter viscosus ybbD b0500 0.3711 0.0158 conserved hypothetical protein ybbJ b0488 0.4127 0.0062 conserved protein ybbW b0511 0.1329 0.0228 YbbW NCS1 Transporter ybcC b0539 0.6619 0.0153 putative exonuclease (EC 3.1.11.3) of lambda ybcK b0544 0.2294 0.0058 hypothetical protein ybcL b0545 0.2269 0.0037 possible kinase regulator ybcM b0546 0.1406 0.0048 putative ARAC-type regulatory protein ybcW b0559 0.4816 0.0023 hypothetical protein ybdG b0577 0.5895 0.0193 putative transport protein ybdJ b0580 0.5837 0.0492 conserved hypothetical protein ybdM b0601 0.8195 0.0493 conserved protein ybdO b0603 0.2801 0.0308 putative transcriptional regulator LYSR-type ybeZ b0660 0.6636 0.0464 putative ATP-binding protein ybfD b0706 0.1079 0.0006 conserved protein ybfG b0690 0.4707 0.0244 conserved hypothetical protein 174

APPENDIX I

gene blattner ratio p-value Function A/B ybfH b0691 0.3421 0.0007 conserved hypothetical protein ybhM b0787 0.3888 0.0098 hypothetical protein ybjC b0850 0.7170 0.0462 conserved hypothetical protein; gene is within soxRS regulon ybjG b0841 0.2116 0.0107 putative permease ybjJ b0845 3.1930 0.0116 putative DEOR-type transcriptional regulator ybjL b0847 0.3923 0.0043 putative transport protein ybjN b0853 0.8482 0.0409 putative sensory transduction regulator ycaN b0900 0.5581 0.0284 putative transcriptional regulator LYSR-type ycbQ b0938 0.0713 0.0025 putative fimbrial-like protein ycbR b0939 0.1824 0.0184 putative chaperone ycbS b0940 0.1652 0.0073 putative outer membrane protein yccE b1001 0.4529 0.0130 putative hemoglobin-binding protein yccM b0992 0.6335 0.0164 hypothetical protein ycdN b1016 1.6654 0.0122 hypothetical protein of the OFeT transport family ycdU b1029 0.1999 0.0116 putative enzyme yceI b1056 0.2268 0.0001 periplasmic protein; possibly secreted yceJ b1057 0.1945 0.0009 putative cytochrome yceP b1060 0.3901 0.0267 conserved hypothetical protein ycgH_1 b1169 0.1993 0.0039 conserved protein; member of the Autotransporter family ycgH_2 b1170 0.4386 0.0046 conserved protein; member of the Autotransporter family ycgV b1202 0.3109 0.0415 putative adhesion and penetration protein ycgX b1161 0.7611 0.0359 hypothetical protein ycgZ b1164 0.5664 0.0112 hypothetical protein yciA b1253 11.0540 0.0002 putative enzyme yciE b1257 0.3808 0.0301 conserved protein yciF b1258 0.1428 0.0003 conserved protein yciQ b1268 5.5117 0.0014 putative membrane protein ycjO b1311 8.6194 0.0110 YcjN/YcjO/YcjP ABC transporter ycjQ b1313 0.2968 0.0286 putative oxidoreductase ydaL b1340 0.6179 0.0096 hypothetical protein ydaT b1358 0.7086 0.0152 hypothetical protein ydaY b1366 0.4876 0.0346 hypothetical protein ydbA_2 b1405 0.4749 0.0312 hypothetical protein product of fragment 2 of a split CDS ydcC b1460 0.1497 0.0021 conserved protein, similar to H-repeat associated proteins ydcD b1457 0.5139 0.0497 hypothetical protein multi modular; putative transcriptional regulator ; also putative ATP-binding ydcR b1439 5.6513 0.0349 component of a transport system ydcX b1445 3.8934 0.0011 hypothetical protein yddB b1495 7.9254 0.0046 conserved protein yddH b1462 11.8388 0.0095 putative enzyme yddJ b1470 1.7194 0.0428 hypothetical protein yddK b1471 0.7743 0.0210 putative glycoportein yddV b1490 0.4278 0.0017 conserved protein ydeH b1535 0.3768 0.0061 hypothetical protein ydeI b1536 0.0747 0.0002 conserved hypothetical protein ydeK b1510 0.4789 0.0370 YdeK ydeO b1499 0.0998 0.0062 putative ARAC-type regulatory protein ydeP b1501 0.1115 0.0201 acid resistance protein ydeQ b1502 0.2304 0.0123 putative adhesin; similar to FimH protein ydeR b1503 7.3709 0.0202 putative fimbrial-like protein ydeS b1504 0.3919 0.0199 putative fimbrial-like protein ydfJ b1543 42.4461 0.0301 YdfJ ydfO b1549 0.5234 0.0174 hypothetical protein ydfV b1565 0.7286 0.0417 hypothetical protein YdgE b1599 0.2334 0.0201 YdgE SMR Protein YdgF b1600 0.0826 0.0007 YdgF SMR protein; toxin of a putative toxin-antitoxin pair ydiA b1703 0.2332 0.0171 conserved protein 175

APPENDIX I

gene blattner ratio p-value Function A/B ydiB b1692 0.4286 0.0109 shikimate dehydrogenase ydiF b1694 0.3148 0.0286 putative enzyme / putative acetate CoA-transferase ydiO b1695 0.4529 0.0403 putative acyl-CoA dehydrogenase ydiR b1698 1.8775 0.0115 putative subunit of YdiQ-YdiR flavoprotein ydjH b1772 0.4958 0.0014 putative kinase ydjI b1773 0.2754 0.0004 putative aldolase ydjJ b1774 0.1765 0.0009 putative oxidoreductase yeaE b1781 0.4708 0.0318 putative oxidoreductase, NAD(P)-linked yeaJ b1786 0.4275 0.0188 putative membrane protein yebN b1821 0.3622 0.0207 putative membrane protein, terpenoid synthase-like yebQ b1828 3.1669 0.0052 YebQ yecD b1867 0.4967 0.0298 putative enzyme yecR b1904 18.6699 0.0070 conserved hypothetical protein yecT b1877 0.3511 0.0159 hypothetical protein yedK b1931 1.3670 0.0277 conserved hypothetical protein yedM b1935 2.1595 0.0289 hypothetical protein yedN_2 b1933 0.5833 0.0372 hypothetical protein yedS_1 b1964 0.4832 0.0090 putative outer membrane protein yedS_2 b1965 0.1868 0.0002 putative outer membrane protein yedS_3 b1966 0.0869 0.0022 putative outer membrane protein yedV b1968 0.3589 0.0025 putative 2-component sensor protein yedW b1969 0.3706 0.0275 putative 2-component transcriptional response regulator yeeE b2013 0.7926 0.0476 putative transport system permease protein yeeN b1983 0.5430 0.0021 conserved protein yeeW b2006 0.7709 0.0145 hypothetical protein yegI b2070 0.3095 0.0072 putative chaperonin yegJ b2071 0.2268 0.0018 hypothetical protein yegR b2085 0.1713 0.0037 hypothetical protein yegS b2086 0.2875 0.0021 conserved protein yegW b2101 0.7504 0.0332 putative transcriptional regulator yegZ b2083 0.2051 0.0136 hypothetical protein yehL b2119 0.1192 0.0005 putative transport protein (ABC superfamily, atp_bind) yehM b2120 0.2962 0.0436 conserved hypothetical protein yehX b2129 1.5433 0.0241 YehW/YehX/YehY/YehZ ABC transporter yeiG b2154 0.6806 0.0088 putative esterase (EC 3.1.1.-). yeiH b2158 0.6070 0.0478 putative membrane protein yeiT b2146 0.5692 0.0283 putative dihydrothymine dehydrogenase yfaO b2251 0.3555 0.0129 putative enzyme (Nudix hydrolase) yfaQ b2226 0.6289 0.0473 conserved protein yfaS_1 b2228 0.4905 0.0091 putative membrane protein yfaU b2245 0.3551 0.0071 protein with similarity to HHED aldolases yfbB b2263 1.5292 0.0311 putative enzyme yfbE b2253 0.4484 0.0060 UDP-L-Ara4O C-4" transaminase yfbP b2275 0.5151 0.0301 hypothetical protein yfdP b2359 0.5750 0.0474 hypothetical protein yfdU b2373 0.4607 0.0057 putative enzyme yffB b2471 0.3324 0.0071 conserved thioredoxin-like protein yfgH b2505 0.4115 0.0103 putative outer membrane lipoprotein yfhK b2556 1.8314 0.0452 putative 2-component sensor protein yfiB b2605 0.6217 0.0406 putative outer membrane protein yfiC b2575 0.7187 0.0190 putative enzyme yfiP b2583 1.3837 0.0071 conserved hypothetical protein yfiR b2603 0.3222 0.0010 conserved protein yfjK b2627 0.3419 0.0029 hypothetical protein yfjL b2628 0.3105 0.0061 hypothetical protein yfjO b2631 0.3841 0.0077 hypothetical protein 176

APPENDIX I

gene blattner ratio p-value Function A/B ygbT b2755 0.1586 0.0012 conserved hypothetical protein ygcG b2778 0.4150 0.0418 putative membrane protein ygcI b2757 0.0266 0.0000 hypothetical protein ygcJ b2758 0.4687 0.0197 conserved hypothetical protein ygcK b2759 0.0180 0.0001 hypothetical protein hypothetical protein with possible relationship to novobiocin and deoxycholate ygcL b2760 0.1023 0.0021 resistance ygdR b2833 0.4092 0.0084 conserved hypothetical protein ygeQ b2863 0.6468 0.0449 hypothetical protein ygeW b2870 0.5789 0.0021 putative carbamoyl transferase yghJ b2973 0.4626 0.0310 predicted inner membrane lipoprotein yghR b2984 1.2529 0.0320 conserved protein ygiL b3043 0.0354 0.0001 putative fimbrial-like protein ygjD b3064 1.4330 0.0151 putative O-sialoglycoprotein endopeptidase yhaB b3120 0.6588 0.0079 conserved protein yhcH b3221 1.4678 0.0226 conserved hypothetical protein; gene is in sialic acid catabolic operon yhdH b3253 1.5233 0.0446 putative dehydrogenase yhfK b3358 0.7711 0.0070 hypothetical protein yhfL b3369 0.1799 0.0003 hypothetical protein yhhI b3484 0.1140 0.0042 conserved protein similar to H-repeat-associated proteins yhiK b3489 0.5909 0.0164 hypothetical protein yhjB b3520 0.6632 0.0240 putative regulator yhjH b3525 15.5314 0.0446 protein involved in flagellar function yhjR b3535 0.3106 0.0149 hypothetical protein yiaA b3562 0.3589 0.0101 hypothetical protein yiaJ b3574 1.4560 0.0188 YiaJ transcriptional repressor yiaN b3578 0.5883 0.0029 YiaMNO Binding Protein-dependent Secondary (TRAP) Transporter yiaT b3584 0.3441 0.0061 putative outer membrane protein yiaU b3585 0.3785 0.0049 putative transcriptional regulator LYSR-type yiaV b3586 0.5890 0.0043 putative membrane protein yiaW b3587 0.2799 0.0038 hypothetical protein yibA b3594 0.1903 0.0047 putative lyase yibJ b3595 0.2186 0.0238 hypothetical protein yieL b3719 0.5420 0.0231 putative xylanase yigF b3817 0.2284 0.0094 conserved hypothetical protein yigZ b3848 1.3342 0.0497 putative elongation factor yihN b3874 0.4333 0.0156 YihN MFS transporter yihO b3876 0.6279 0.0411 YihO GPH transporter yihQ b3878 0.6251 0.0380 putative glycosidase yiiG b3896 0.2402 0.0073 conserved protein yiiS b3922 0.2364 0.0157 conserved hypothetical protein yiiU b3928 1.3852 0.0299 conserved hypothetical protein yjbE b4026 0.0840 0.0029 conserved hypothetical protein yjbM b4048 0.4310 0.0137 conserved hypothetical protein yjeB b4178 1.6962 0.0415 conserved protein with a Winged helix domain yjeJ b4145 0.3840 0.0307 conserved protein yjeM b4156 0.2229 0.0057 YjeM APC transporter yjeN b4157 0.3408 0.0038 conserved hypothetical protein yjfJ b4182 0.6175 0.0334 conserved protein yjfK b4183 0.4529 0.0043 conserved hypothetical protein yjfL b4184 0.5766 0.0073 hypothetical protein yjfN b4188 1.3712 0.0202 conserved hypothetical protein yjfZ b4204 0.3394 0.0322 hypothetical protein yjgM b4256 0.4628 0.0240 putative acyltransferase yjgN b4257 0.5071 0.0145 putative membrane protein possible involved in transport yjhB b4279 0.3122 0.0246 YjhB MFS transporter yjhC b4280 0.3612 0.0064 KpLE2 phage-like element; putative NAD(P)-binding dehydrogenase 177

APPENDIX I

gene blattner ratio p-value Function A/B yjhF b4296 0.1057 0.0123 YjhF Gnt tranporter yjhG b4297 0.3226 0.0116 putative dehydratase yjhH b4298 0.0468 0.0002 putative lyase/synthase yjhI b4299 0.1141 0.0053 putative regulator yjhP b4306 0.5874 0.0178 putative methyltransferase yjiW b4347 0.2530 0.0215 hypothetical protein ykgA b0300 0.5109 0.0205 putative ARAC-type regulatory protein ykgB b0301 0.2477 0.0014 putative membrane protein ykgF b0307 0.2214 0.0430 putative dehydrogenase ykgH b0310 0.3306 0.0076 conserved protein ykgI b0303 0.0848 0.0003 hypothetical protein ykiA b0392 0.3451 0.0025 hypothetical protein ylbA b0515 0.4807 0.0467 conserved hypothetical protein yliF b0834 0.7291 0.0466 conserved protein ymcC b0986 0.5145 0.0239 putative synthetase, lipoprotein, and/or outer membrane porin ymfE b1138 0.1606 0.0015 hypothetical protein ymfK b1145 1.3071 0.0271 putative phage repressor ymgA b1165 0.3510 0.0002 hypothetical protein ymgB b1166 0.2729 0.0002 hypothetical protein ymgD b1171 0.1185 0.0000 hypothetical protein ynaE b1375 0.1056 0.0000 hypothetical protein ynaI b1330 0.5331 0.0212 YnaI ynaK b1365 0.2104 0.0022 hypothetical protein ynbB b1409 9.4657 0.0003 putative phosphatidate cytidiltransferase ynbD b1411 8.0957 0.0101 putative enzyme yncD b1451 7.7140 0.0189 Probable TonB-dependent receptor yncH b1455 0.6158 0.0168 hypothetical protein yncI b1458 0.0504 0.0048 conserved protein yneG b1523 1.4493 0.0097 conserved hypothetical protein yneK b1527 0.7595 0.0440 conserved protein ynfC b1585 0.6339 0.0385 YnfC lipoprotein ynfN b1551 0.1481 0.0169 hypothetical protein ynjI b1762 0.5647 0.0434 conserved protein yoaC b1810 0.5527 0.0163 conserved hypothetical protein yobF b1824 0.2638 0.0011 hypothetical protein yodA b1973 0.4038 0.0074 cadmium-induced metal binding protein yodB b1974 0.6011 0.0076 putative cytochrome ypdE b2384 0.1729 0.0092 putative endoglucanase yphE b2547 0.7172 0.0119 YphD/YphE/YphF ABC transporter yqeA b2874 0.7065 0.0379 putative carbamate kinase yqeI b2847 0.5345 0.0347 putative sensory transducer yqeJ b2848 0.5636 0.0205 conserved hypothetical protein yqgF b2949 2.0009 0.0211 possible Holliday junction resolvase yqiH b3047 0.4868 0.0245 putative membrane protein yqiJ b3050 0.3830 0.0118 putative oxidoreductase yqjK b3100 0.7262 0.0339 conserved hypothetical protein yraH b3142 0.2087 0.0035 putative fimbrial-like protein yraI b3143 0.2992 0.0267 putative chaperone ytfT b4230 1.3375 0.0312 YtfQ/YtfR/YtfS/YtfT/YjfF ABC transporter znuB b1859 0.7309 0.0475 ZnuA/ZnuB/ZnuC ABC transporter b0322 0.7535 0.0039

178

APPENDIX I

Supplementary table – XIII: LZ54 wild-type (A) Vs LZ54 hns-205::Tn10 (B)

gene blattner ratio p-value Function A/B acrA b0463 8.3277 0.0131 AcrA Membrane Fusion Protein acrE b3265 0.1011 0.0148 transmembrane protein affects septum formation and cell membrane permeability acrF b3266 0.2552 0.0263 AcrEF-TolC Drug Efflux Transport System add b1623 1.4042 0.0098 deoxyadenosine deaminase / adenosine deaminase ade b3665 0.0660 0.0072 cryptic adenine deaminase monomer adiY b4116 0.0713 0.0172 AdiY transcriptional activator ais b2252 0.1177 0.0011 protein induced by aluminum allC b0516 0.3939 0.0128 allantoate amidohydrolase alsI b4090 0.7750 0.0194 allose-6-phosphate isomerase / ribose-5-phosphate isomerase B alsK b4084 2.5002 0.0286 putative D-allose kinase amiC b2817 1.7337 0.0146 N-acetylmuramyl-L-alanine amidase arsR b3501 1.4310 0.0291 ArsR transcriptional regulator atoS b2219 0.6377 0.0248 AtoS-Phis b0309 b0309 0.4289 0.0345 hypothetical protein b0501 b0501 0.2721 0.0205 hypothetical protein b1172 b1172 0.1161 0.0024 conserved hypothetical protein b1354 b1354 0.2405 0.0296 hypothetical protein b1578 b1578 0.6068 0.0497 hypothetical protein b1903 b1903 0.3571 0.0463 hypothetical protein b2084 b2084 0.2100 0.0429 hypothetical protein b2680 b2680 1.5403 0.0320 YgaY MFS transporter b3044 b3044 0.5660 0.0243 IS21 protein basS b4112 0.6845 0.0066 BasS-Phis bcsF b3537 0.4067 0.0472 hypothetical protein bdm b1481 0.1582 0.0096 hypothetical protein betA b0311 2.0313 0.0247 choline dehydrogenase betB b0312 2.1260 0.0391 betaine aldehyde dehydrogenase betI b0313 3.1436 0.0193 BetI-choline bglJ b4366 0.3117 0.0457 BglJ transcriptional regulator borD b0557 0.2556 0.0172 bacteriophage lambda Bor protein homolog cadA b4131 0.4549 0.0121 lysine decarboxylase caiA b0039 1.3966 0.0108 crotonobetaine reductase cdd b2143 0.6686 0.0274 cytidine deaminase chbB b1738 1.5210 0.0330 EIIChb chbR b1735 0.3341 0.0058 ChbR transcriptional regulator chpB b4225 0.7179 0.0459 ChpB transcriptional regulator citE b0616 1.9938 0.0234 subunit of citryl-ACP lyase cmtA b2933 0.4295 0.0164 EIIABCmt cpsB b2049 0.2756 0.0341 mannose-1-phosphate guanylyltransferase-(GDP) creC b4399 0.7339 0.0442 CreC-Phis creD b4400 0.6783 0.0283 tolerance to colicin E2 csgD b1040 0.1783 0.0088 CsgD transcriptional activator csgE b1039 0.2969 0.0355 curli production assembly/transport component cspA b3556 1.4925 0.0396 cold shock protein CspA cspC b1823 0.3803 0.0208 cold shock protein CspC cspI b1552 0.1418 0.0099 cold shock protein CspI cstA b0598 1.7226 0.0068 peptide transporter induced by carbon starvation cynT b0339 1.4406 0.0420 carbonate dehydratase monomer cytR b3934 0.4811 0.0258 CytR-cytidine dacA b0632 1.4499 0.0371 D-alanyl-D-alanine carboxypeptidase, fraction A; penicillin-binding protein 5 damX b3388 1.5321 0.0329 putative membrane protein dapE b2472 0.5982 0.0184 N-succinyl-L-diaminopimelate desuccinylase subunit dcm b1961 1.6163 0.0045 DNA cytosine methylase dcuR b4124 0.5341 0.0130 DcuR-Pasp56 179

APPENDIX I

gene blattner ratio p-value Function A/B dcuS b4125 0.5773 0.0341 DcuS-Phis349 djlB b0646 1.2276 0.0139 putative chaperone dnaE b0184 1.5214 0.0034 DNA polymerase III, alpha subunit dnaK b0014 0.4911 0.0367 chaperone Hsp70; DNA biosynthesis; autoregulated heat shock proteins dpiB b0619 0.4548 0.0076 DpiB emrE b0543 0.6713 0.0308 EmrE SMR transporter emrY b2367 0.2312 0.0466 EmrY putative multidrug MFS transporter entA b0596 2.3095 0.0058 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase envR b3264 0.5029 0.0145 EnvR transcriptional regulator essQ b1556 4.5609 0.0352 hypothetical protein eutN b2456 0.6705 0.0289 putative detox protein, ethanolamine utilization evgA b2369 0.2767 0.0265 EvgA-Phosphorylated transcriptional regulator evgS b2370 0.4198 0.0441 EvgS-Phis fabB b2323 0.8572 0.0316 beta-ketoacyl-ACP synthase I / malonyl-ACP decarboxylase fabR b3963 1.6568 0.0385 FabR transcriptional repressor fbp b4232 0.7673 0.0093 fructose 1,6 bisphosphatase monomer fecR b4292 4.8729 0.0414 regulator for fec operon, periplasmic fepE b0587 0.2112 0.0281 ferric enterobactin (enterochelin) transport FhuA outer membrane protein receptor for ferrichrome, colicin M, and phages T1, fhuA b0150 2.6610 0.0397 T5, and phi80 fhuC b0151 2.1677 0.0270 ferrichrome uptake system fimA b4314 0.1075 0.0169 major type 1 subunit fimbrin (pilin) fimB b4312 0.0623 0.0004 regulator for fimA fimD b4317 0.6323 0.0042 outer membrane protein; export and assembly of type 1 fimbriae, interrupted fimE b4313 0.0983 0.0165 regulator for fimA fimI b4315 0.1498 0.0170 fimbrial protein flgA b1072 5.9250 0.0103 flagellar biosynthesis; assembly of basal-body periplasmic P ring flgB b1073 2.4622 0.0099 flagellar basal-body rod protein FlgB flgC b1074 5.0956 0.0165 flagellar basal-body rod protein FlgC flgD b1075 4.9964 0.0107 flagellar biosynthesis, initiation of hook assembly flgE b1076 5.2448 0.0144 flagellar hook protein FlgE flgF b1077 3.8916 0.0140 flagellar basal-body rod protein FlgF flgG b1078 6.8388 0.0172 flagellar basal-body rod protein FlgG flagellar L-ring protein FlgH; basal-body outer-membrane L (lipopolysaccharide flgH b1079 2.7794 0.0275 layer) ring protein flgI b1080 4.9957 0.0130 flagellar P-ring protein FlgI flgJ b1081 4.6874 0.0136 FlgJ flgM b1071 4.1452 0.0056 anti-FliA (anti-sigma) factor; also known as RflB protein flgN b1070 2.3884 0.0246 flagellar biosynthesis protein FlgN flhB b1880 3.0669 0.0156 flagellar biosynthesis protein FlhB fliA b1922 9.7781 0.0072 sigma28 factor fliC b1923 2.9614 0.0275 flagellar biosynthesis; flagellin, filament structural protein fliD b1924 3.9935 0.0464 flagellar cap protein FliD; filament capping protein; enables filament assembly fliE b1937 4.0249 0.0012 flagellar basal-body protein FliE flagellar M-ring protein FliF; basal-body MS(membrane and supramembrane)- fliF b1938 7.3494 0.0024 ring and collar protein flagellar motor switch protein FliG; component of motor switching and fliG b1939 6.5031 0.0323 energizing, enabling rotation and determining its direction fliH b1940 3.0144 0.0294 flagellar biosynthesis protein FliH fliJ b1942 4.6660 0.0065 flagellar biosynthesis protein FliJ fliK b1943 3.4194 0.0186 flagellar hook-length control protein FliK fliL b1944 7.1439 0.0097 flagellar biosynthesis flagellar motor switch protein FliM; component of motor switch and energizing, fliM b1945 7.9995 0.0100 enabling rotation and determining its direction flagellar motor switch protein FliN; component of motor switch and energizing, fliN b1946 7.8012 0.0123 enabling rotation and determining its direction fliQ b1949 3.9371 0.0296 flagellar biosynthesis protein FliQ fliS b1925 4.0888 0.0000 flagellar biosynthesis protein FliS 180

APPENDIX I

gene blattner ratio p-value Function A/B fliZ b1921 4.4203 0.0056 possible cell-density responsive regulator of sigmaF focA b0904 0.3591 0.0199 FocA formate FNT transporter frlA b3370 0.6250 0.0009 YhfM methione APC transporter frmB b0355 1.4987 0.0417 putative S-formylglutathione hydrolase fsaB b3946 1.6046 0.0285 fructose 6-phosphate aldolase 2 fxsA b4140 0.5805 0.0376 inner membrane protein; overproduction inhibits F exclusion of bacteriophage T7 gadA b3517 0.1582 0.0235 glutamate decarboxylase A subunit gadC b1492 0.2334 0.0316 XasA GABA APC transporter gadE b3512 0.1309 0.0490 GadE transcriptional activator galE b0759 1.2371 0.0142 UDP-glucose 4-epimerase monomer gatD b2091 0.2599 0.0438 galactitol-1-phosphate dehydrogenase gatY b2096 0.2067 0.0396 tagatose-1,6-bisphosphate aldolase 2 gatZ b2095 0.1364 0.0278 tagatose-1,6-bisphosphate aldolase 2 ghrA b1033 1.3218 0.0231 glyoxylate reductase glf b2036 0.7362 0.0107 UDP-galactopyranose mutase glpF b3927 0.6041 0.0017 GlpF - glycerol MIP channel glpG b3424 1.3109 0.0131 inner membrane-associated protein of glp regulon gltD b3213 1.3195 0.0434 glutamate synthase (NADPH) small chain gltF b3214 0.1336 0.0102 regulator of gltBDF operon, induction of Ntr enzymes gltK b0653 1.4577 0.0267 glutamate ABC transporter gmd b2053 0.3426 0.0190 GDP-mannose 4,6-dehydratase gntX b3413 1.8845 0.0301 gluconate periplasmic binding protein gshA b2688 1.5587 0.0456 glutamate-cysteine ligase gspD b3325 0.5645 0.0087 putative protein secretion protein for export gspE b3326 0.6429 0.0423 putative protein secretion protein for export hdeA b3510 0.0429 0.0068 acid-resistance protein, possible chaperone hdeB b3509 0.0449 0.0041 10K-L protein, related to acid resistance protein of Shigella flexneri hdeD b3511 0.3744 0.0297 protein involved in acid resistance hdhA b1619 0.3986 0.0141 7-alpha-hydroxysteroid dehydrogenase hipA b1507 4.0652 0.0109 HipA transcriptional activator hisH b2023 1.7301 0.0302 imidazole glycerol phosphate synthase, HisH subunit hlyE b1182 0.1729 0.0157 hemolysin E hns b1237 6.1952 0.0176 H-NS transcriptional dual regulator hofM b3395 1.4093 0.0034 conserved hypothetical protein hscA b2526 2.5483 0.0441 chaperone, member of Hsp70 protein family hycI b2717 1.2466 0.0014 hydrogenase 3 maturation protease hypC b2728 1.6554 0.0250 pleiotrophic effects on 3 hydrogenase isozymes ibpA b3687 0.6923 0.0383 small heat shock protein IbpA idnK b4268 0.4140 0.0285 gluconokinase II ilvN b3670 1.7883 0.0127 acetohydroxybutanoate synthase I / acetolactate synthase I intZ b2442 1.7292 0.0221 putative prophage integrase ispB b3187 1.2318 0.0439 octaprenyl diphosphate synthase kbl b3617 0.5690 0.0286 2-amino-3-ketobutyrate CoA ligase kdpB b0697 1.6697 0.0185 potassium ion P-type ATPase transporter kdsB b0918 1.7064 0.0110 3-deoxy-D-manno-octulosonate-cytidylyltransferase kefB b3350 1.5528 0.0397 KefB potassium CPA2 transporter lepA b2569 1.9688 0.0349 GTP-binding elongation factor, may be inner membrane protein lolD b1117 1.2471 0.0101 LolCDE ABC lipoprotein transporter lysP b2156 2.0194 0.0452 LysP lysine APC transporter maa b0459 0.4245 0.0030 maltose acetyltransferase mdtG b1053 1.2882 0.0249 YceE drug MFS transporter mdtL b3710 0.7142 0.0215 YidY drug MFS transporter metH b4019 0.7227 0.0004 Cobalamin-dependent homocysteine transmethylase metI b0198 1.4979 0.0420 L- and D-methionine uptake ABC permease metR b3828 1.6070 0.0336 MetR-Homocysteine transcriptional activator miaB b0661 1.4769 0.0167 hypothetical protein 181

APPENDIX I

gene blattner ratio p-value Function A/B cell division inhibitor of the MinC-MinD-MinE and DicB-MinC systems that minC b1176 0.5656 0.0077 regulate septum placement mltB b2701 1.6697 0.0259 membrane-bound lytic murein transglycosylase B moaB b0782 1.8201 0.0406 MoaB subunit MotB protein, enables flagellar motor rotation, linking torque machinery to cell motB b1889 8.5864 0.0015 wall msbA b0914 2.4362 0.0074 ATP-binding transport protein; multicopy suppressor of htrB murP b2429 0.3070 0.0310 MurP nadC b0109 1.2142 0.0267 quinolinate phosphoribosyltransferase (decarboxylating) monomer nagA b0677 1.3065 0.0297 N-acetylglucosamine-6-phosphate deacetylase nanC b4311 0.1870 0.0154 conserved hypothetical protein nfnB b0578 0.5525 0.0086 dihydropteridine reductase nikC b3478 1.8058 0.0147 nickel ABC transporter nmpC b0553 0.0693 0.0038 outer membrane porin protein; locus of qsr prophage nrfD b4073 0.4712 0.0109 nitrite reductase complex nudD b2051 0.0587 0.0129 GDP-mannose mannosyl hydrolase nudE b3397 1.8481 0.0487 ADP-ribose diphosphatase ogrK b2082 0.4983 0.0113 OgrK transcriptional regulator ompC b2215 0.6383 0.0480 outer membrane porin OmpC ompF b0929 2.5595 0.0108 outer membrane porin OmpF osmB b1283 0.2432 0.0020 OsmB osmotically inducible lipoprotein osmC b1482 0.4503 0.0263 osmotically inducible peroxidase OsmC pagP b0622 0.2419 0.0392 PagP monomer parE b3030 1.4390 0.0125 Topoisomerase IV subunit B pflB b0903 0.5987 0.0440 pyruvate formate-lyase (inactive) pgaD b1021 0.2752 0.0393 putative inner membrane protein phoR b0400 1.8038 0.0289 PhoR-Phis pinR b1374 0.1363 0.0086 putative transposon resolvase pioO b3322 0.5656 0.0226 calcium-binding protein required for initiation of chromosome replication pitB b2987 0.3142 0.0356 PitB proB b0242 0.5567 0.0474 gamma-glutamyl kinase-GP-reductase multienzyme complex prpD b0334 1.8705 0.0377 2-methylcitrate dehydratase purL b2557 1.1685 0.0423 phosphoribosylformylglycinamide synthase puuP b1296 1.5737 0.0077 YcjJ APC transporter puuR b1299 3.1778 0.0435 putative oxidoreductase/putative regulator rbsC b3750 0.3361 0.0271 ribose ABC transporter rbsD b3748 0.2044 0.0179 D-ribose utilization rbsK b3752 0.6382 0.0278 ribokinase positive DNA-binding transcriptional regulator of capsular polysaccharide rcsA b1951 0.0925 0.0303 synthesis, activates its own expression rcsD b2216 0.7698 0.0039 putative 2-component sensor protein relA b2784 1.3700 0.0315 GDP pyrophosphokinase / GTP pyrophosphokinase rffD b3787 2.2065 0.0462 UDP-N-acetyl-D-mannosaminuronic acid dehydrogenase rho b3783 2.2388 0.0451 transcription termination factor Rho monomer; polarity suppressor rhsA b3593 0.4975 0.0344 RhsA protein in rhs element rhsD b0497 0.1777 0.0029 RhsD protein in rhs element ribD b0414 1.2103 0.0239 pyrimidine reductase / pyrimidine deaminase rihC b0030 2.3026 0.0130 ribonucleoside hydrolase 3 rng b3247 1.6144 0.0451 ribonuclease G (RNAse G) monomer rplK b3983 1.5386 0.0382 50S ribosomal subunit protein L11 rplL b3986 1.6665 0.0070 50S ribosomal subunit protein L7/L12 rplU b3186 1.8052 0.0302 50S ribosomal subunit protein L21 rpsC b3314 1.5181 0.0057 30S ribosomal subunit protein S3 rpsJ b3321 1.3506 0.0099 30S ribosomal subunit protein S10 rpsR b4202 1.5535 0.0028 30S ribosomal subunit protein S18 rpsS b3316 1.5309 0.0152 30S ribosomal subunit protein S19 rspB b1580 0.2910 0.0312 putative dehydrogenase RspB 182

APPENDIX I

gene blattner ratio p-value Function A/B rumB b0859 2.8430 0.0229 23S ribosomal RNA 5-methyluridine methyltransferase rzpR b1362 0.3718 0.0295 putative prophage lambda endopeptidase serC b0907 0.8655 0.0233 phosphohydroxythreonine transaminase / phosphoserine transaminase sfmF b0534 1.5761 0.0050 putative fimbrial-like protein sfsB b3188 0.6211 0.0341 Nlp transcriptional regulator sgbU b3582 0.4728 0.0465 probable 3-hexulose-6-phosphate isomerase sgcR b4300 0.7052 0.0469 SgcR transcriptional regulator sieB b1353 0.6826 0.0164 phage superinfection exclusion protein slp b3506 0.2794 0.0041 outer membrane protein induced after carbon starvation 30S ribosomal subunit protein S22; sub-stoichiometric stationary phase ribosomal sra b1480 0.3405 0.0369 component ssuC b0934 1.3094 0.0450 YcbE/YcbM ABC transporter stpA b2669 0.2394 0.0352 DNA-binding protein; H-NS-like protein; chaperone activity; RNA splicing? sufA b1684 2.2615 0.0121 scaffold protein for iron-sulfur cluster assembly ATPase component of SufB-SufC-SufD cysteine desulfurase (SufS) activator sufC b1682 2.6029 0.0111 complex tar b1886 5.6716 0.0475 MCP-II tatD b4483 1.8518 0.0203 magnesium-dependent DNase tauA b0365 0.3175 0.0372 TauA/TauB/TauC ABC transporter tdcC b3116 0.1433 0.0075 TdcC threonine STP transporter tdcD b3115 0.4925 0.0458 propionate kinase / acetate kinase C tgt b0406 0.7951 0.0462 tRNA-guanine transglycosylase monomer thiD b2103 0.7993 0.0109 hydroxymethylpyrimidine kinase 2 / HMP-P kinase tnaA b3708 0.0673 0.0163 L-cysteine desulfhydrase / tryptophanase tolB b0740 1.3875 0.0321 Tol-Pal Cell Envelope Complex trpD b1263 1.2758 0.0363 anthranilate synthase component II tsr b4355 2.6861 0.0245 MCP-I ttdB b3062 0.7602 0.0085 L-tartrate dehydratase, beta subunit ubiC b4039 1.5219 0.0401 chorismate pyruvate lyase ugd b2028 0.1087 0.0032 UDP-glucose 6-dehydrogenase ung b2580 1.1711 0.0157 uracil-DNA-glycosylase uvrB b0779 1.5839 0.0266 DNA repair; excision nuclease subunit B uvrC b1913 0.6579 0.0189 excinuclease ABC, subunit C; repair of UV damage to DNA uvrY b1914 0.5041 0.0474 UvrY- Phosphorylated transcriptional regulator wcaA b2059 0.5870 0.0415 putative regulator wcaC b2057 0.5717 0.0358 putative glycosyl transferase wcaD b2056 0.0530 0.0169 putative colanic acid polymerase wcaE b2055 0.1901 0.0098 putative colanic acid biosynthesis glycosyl transferase wcaF b2054 0.1153 0.0195 putative transferase wcaM b2043 0.3407 0.0472 hypothetical protein wzc b2060 0.3446 0.0355 tyrosine kinase involved in colanic acid biosynthesis metabolism; biosynthesis of macromolecules (cellular constituents); wzxE b3792 1.8477 0.0010 enterobacterial common antigen (surface glycolipid) transport wzyE b3793 1.4866 0.0048 4-α-fucosyltransferase xapR b2405 0.1931 0.0064 XapR transcriptional activator site-specific recombinase, acts on cer sequence of ColE1, effects chromosome xerC b3811 1.4882 0.0457 segregation at cell division xseA b2509 1.6165 0.0433 exonuclease VII, large subunit xylB b3564 0.4772 0.0249 xylulokinase xylF b3566 0.5971 0.0345 xylose ABC transporter yaaY b0024 2.2168 0.0034 hypothetical protein yabP b0056 0.6871 0.0260 conserved hypothetical protein yadD b0132 1.2444 0.0248 hypothetical protein yadL b0137 0.2804 0.0369 putative adhesin-like protein yafD b0209 1.4135 0.0200 conserved hypothetical protein yafJ b0223 0.6082 0.0284 putative amidotransferase yafS b0213 1.4431 0.0410 putative methyltransferase yagG b0270 0.5001 0.0099 YagG GPH Transporter 183

APPENDIX I

gene blattner ratio p-value Function A/B yagT b0286 0.6949 0.0498 putative oxidoreductase, Fe-S subunit yagX b0291 0.3706 0.0491 putative enzyme yagZ b0293 0.0536 0.0008 conserved hypothetical protein yahA b0315 0.3956 0.0385 hypothetical protein ybaJ b0461 0.2760 0.0119 conserved hypothetical protein ybbD b0500 0.3847 0.0090 conserved hypothetical protein ybbL b0490 0.7678 0.0092 YbbL ybcJ b0528 1.3234 0.0305 putative RNA-binding protein ybcW b0559 0.4321 0.0311 hypothetical protein ybdB b0597 1.9962 0.0233 conserved hypothetical protein ybfD b0706 0.2376 0.0116 conserved protein ybfF b0686 1.5949 0.0464 putative enzyme ybgD b0719 0.5377 0.0327 putative fimbrial-like protein ybgS b0753 1.8287 0.0028 putative homeobox protein ybhM b0787 0.4738 0.0397 hypothetical protein ybiB b0800 1.3766 0.0189 putative enzyme ybiU b0821 0.8261 0.0211 conserved hypothetical protein ybjD b0876 0.5663 0.0278 conserved protein with a nucleotide triphosphate hydrolase domain ybjL b0847 0.5150 0.0010 putative transport protein ycbQ b0938 0.1147 0.0155 putative fimbrial-like protein ycdJ b1009 1.6640 0.0210 putative acetyltransferase ycdL b1011 2.0719 0.0001 putative synthetase yceG b1097 2.3657 0.0237 putative thymidylate kinase (EC 2.7.4.9) yceI b1056 0.3488 0.0018 periplasmic protein; possibly secreted yceJ b1057 0.3421 0.0458 putative cytochrome ycfH b1100 2.0979 0.0027 putative hydrolase ycfR b1112 5.2716 0.0014 conserved hypothetical protein ycgE b1162 0.6911 0.0063 putative transcriptional regulator ycgV b1202 0.2423 0.0354 putative adhesion and penetration protein ycgX b1161 0.4727 0.0469 hypothetical protein ychJ b1233 1.3522 0.0498 conserved hypothetical protein ychQ b1213 1.7261 0.0345 hypothetical protein yciA b1253 2.8879 0.0202 putative enzyme yciF b1258 0.3526 0.0266 conserved protein ycjN b1310 0.3041 0.0419 YcjN/YcjO/YcjP ABC transporter ycjO b1311 2.4268 0.0369 YcjN/YcjO/YcjP ABC transporter ycjT b1316 0.7525 0.0127 putative enzyme ydbA_1 b1401 0.7593 0.0356 hypothetical protein product of fragment 1 of a split CDS ydcC b1460 0.2272 0.0112 conserved protein, similar to H-repeat associated proteins ydcL b1431 0.6791 0.0441 conserved hypothetical protein multi modular; putative transcriptional regulator ; also putative ATP-binding ydcR b1439 4.0253 0.0261 component of a transport system ydeA b1528 2.7790 0.0432 YdeA MFS transporter ydeI b1536 0.1821 0.0253 conserved hypothetical protein ydeK b1510 0.6187 0.0071 YdeK ydeP b1501 0.1915 0.0184 acid resistance protein ydeS b1504 0.4539 0.0400 putative fimbrial-like protein ydfB b1572 1.6584 0.0428 hypothetical protein ydfE b1577 0.6538 0.0130 hypothetical protein ydfJ b1543 3.1165 0.0181 YdfJ YdgE b1599 0.2358 0.0111 YdgE SMR Protein YdgF b1600 0.1460 0.0053 YdgF SMR protein; toxin of a putative toxin-antitoxin pair ydgR b1634 2.3865 0.0058 YdgR putative peptide POT Transporter ydiA b1703 0.3853 0.0309 conserved protein ydjG b1771 0.6625 0.0268 putative oxidoreductase ydjI b1773 0.3205 0.0299 putative aldolase ydjJ b1774 0.3084 0.0391 putative oxidoreductase 184

APPENDIX I

gene blattner ratio p-value Function A/B ydjL b1776 0.6122 0.0341 putative oxidoreductase yeaG b1783 0.4721 0.0039 conserved protein yeaJ b1786 0.4354 0.0260 putative membrane protein yebN b1821 0.2184 0.0221 putative membrane protein, terpenoid synthase-like yebW b1837 1.6464 0.0240 hypothetical protein yecR b1904 3.4357 0.0288 conserved hypothetical protein yedS_2 b1965 0.2584 0.0387 putative outer membrane protein yedS_3 b1966 0.2391 0.0482 putative outer membrane protein yedV b1968 0.1575 0.0161 putative 2-component sensor protein yeeE b2013 1.3107 0.0382 putative transport system permease protein yeeN b1983 0.3367 0.0153 conserved protein yegJ b2071 0.2035 0.0169 hypothetical protein yehT b2125 0.5225 0.0364 two-component response regulator yeiS b2145 0.4474 0.0138 hypothetical protein yfaL b2233 1.3955 0.0170 potential adhesin yfaO b2251 0.4117 0.0366 putative enzyme (Nudix hydrolase) yfbE b2253 0.2945 0.0149 UDP-L-Ara4O C-4" transaminase yfbN b2273 0.1982 0.0195 conserved hypothetical protein yfcI b2305 0.5760 0.0448 hypothetical protein yfcV b2339 0.1962 0.0324 putative fimbrial-like protein yfdP b2359 0.7302 0.0446 hypothetical protein yfdZ b2379 1.3458 0.0451 putative aminotransferase yfeD b2399 0.6741 0.0159 hypothetical protein yfeX b2431 1.2507 0.0360 conserved protein yffB b2471 0.3893 0.0112 conserved thioredoxin-like protein yfgH b2505 0.1761 0.0294 putative outer membrane lipoprotein yfiR b2603 0.5716 0.0344 conserved protein yfjH b2623 0.5403 0.0467 putative histone yfjK b2627 0.5869 0.0193 hypothetical protein ygbE b2749 2.2898 0.0383 putative cytochrome oxidase subunit ygbT b2755 0.3143 0.0043 conserved hypothetical protein ygcF b2777 0.4973 0.0417 hypothetical protein ygcI b2757 0.0520 0.0045 hypothetical protein ygcJ b2758 0.4560 0.0338 conserved hypothetical protein ygcK b2759 0.0541 0.0086 hypothetical protein hypothetical protein with possible relationship to novobiocin and deoxycholate ygcL b2760 0.0966 0.0050 resistance ygdI b2809 1.7669 0.0042 hypothetical protein ygdL b2812 1.7338 0.0474 putative enzyme ygeO b2859 0.7191 0.0320 conserved protein yggP b2931 0.4937 0.0082 putative NAD(P)-binding dehydrogenase (B2931) yghQ b2983 1.6030 0.0092 putative serine protease yghS b2985 0.3944 0.0088 conserved protein ygiL b3043 0.0454 0.0037 putative fimbrial-like protein ygiR b3015 2.2378 0.0114 ygiU b3022 1.4623 0.0263 putative cyanide hydratase yhbW b3160 1.3420 0.0364 putative enzyme yhcA b3215 0.4083 0.0170 putative chaperone yhdX b3269 0.4868 0.0189 YhdW/YhdX/YhdY/YhdZ ABC transporter yhfL b3369 0.2237 0.0277 hypothetical protein yhhH b3483 0.5665 0.0435 hypothetical protein yhhI b3484 0.2639 0.0294 conserved protein similar to H-repeat-associated proteins yhiP b3496 1.4822 0.0076 YhiP peptide POT transporter yhjB b3520 0.5360 0.0254 putative regulator yhjR b3535 0.3791 0.0427 hypothetical protein yhjX b3547 0.4577 0.0155 YhjX MFS transporter yiaA b3562 0.2225 0.0295 hypothetical protein 185

APPENDIX I

gene blattner ratio p-value Function A/B yiaN b3578 0.3218 0.0405 YiaMNO Binding Protein-dependent Secondary (TRAP) Transporter yiaT b3584 0.3228 0.0018 putative outer membrane protein yiaU b3585 0.2708 0.0129 putative transcriptional regulator LYSR-type yiaV b3586 0.6530 0.0169 putative membrane protein yiaW b3587 0.1805 0.0226 hypothetical protein yibA b3594 0.2554 0.0369 putative lyase yibI b3598 1.5678 0.0042 hypothetical protein yibJ b3595 0.4409 0.0364 hypothetical protein yifK b3795 1.6627 0.0041 YifK APC transporter yiiS b3922 0.2877 0.0426 conserved hypothetical protein yjbE b4026 0.2320 0.0056 conserved hypothetical protein yjdI b4126 0.3844 0.0223 conserved hypothetical protein yjeJ b4145 0.1947 0.0001 conserved protein yjfJ b4182 0.4165 0.0368 conserved protein yjfO b4189 0.6287 0.0167 conserved protein yjgA b4234 1.4336 0.0306 putative transport protein (ABC superfamily, atp_bind) yjgM b4256 0.3526 0.0092 putative acyltransferase yjhF b4296 0.3026 0.0290 YjhF Gnt tranporter yjhG b4297 0.3862 0.0320 putative dehydratase yjhH b4298 0.1447 0.0289 putative lyase/synthase yjhI b4299 0.1010 0.0196 putative regulator yjiW b4347 0.3016 0.0341 hypothetical protein yjjQ b4365 0.5375 0.0405 putative regulator yjjY b4402 1.8482 0.0252 hypothetical protein ykfF b0249 1.4653 0.0173 hypothetical protein ykgA b0300 0.3332 0.0455 putative ARAC-type regulatory protein ykgB b0301 0.4130 0.0197 putative membrane protein ykgF b0307 0.0923 0.0096 putative dehydrogenase ykgI b0303 0.1914 0.0271 hypothetical protein ykgK b0294 0.3670 0.0464 putative regulator ykiA b0392 0.4606 0.0100 hypothetical protein yliF b0834 0.5389 0.0387 conserved protein ymgD b1171 0.2996 0.0307 hypothetical protein ynaE b1375 0.1454 0.0051 hypothetical protein ynaI b1330 0.4059 0.0015 YnaI ynaK b1365 0.2128 0.0235 hypothetical protein yncC b1450 0.7923 0.0469 hypothetical protein yncD b1451 4.6042 0.0276 Probable TonB-dependent receptor yncI b1458 0.2616 0.0295 conserved protein ynfN b1551 0.1250 0.0013 hypothetical protein ynjF b1758 1.9527 0.0260 putative cytochrome oxidase ynjI b1762 0.6095 0.0436 conserved protein yoaC b1810 0.5329 0.0343 conserved hypothetical protein yobF b1824 0.2197 0.0180 hypothetical protein yodA b1973 0.3883 0.0353 cadmium-induced metal binding protein yohL b2105 0.8820 0.0341 conserved hypothetical protein yojI b2211 2.6739 0.0227 YojI ypfJ b2475 1.7103 0.0293 conserved protein ypjF b2646 1.7408 0.0282 member of the YeeV, YkfI, YpjF family of toxin proteins yqcC b2792 1.1876 0.0346 conserved hypothetical protein yqeI b2847 0.3092 0.0385 putative sensory transducer yqhC b3010 1.5425 0.0156 putative ARAC-type regulatory protein yqjF b3101 1.9399 0.0112 putative membrane protein yraH b3142 0.4222 0.0010 putative fimbrial-like protein yraQ b3151 1.7555 0.0334 putative membrane protein yrdD b3283 0.8037 0.0413 putative DNA topoisomerase 186

APPENDIX I

gene blattner ratio p-value Function A/B yrfF b3398 1.2449 0.0097 putative dehydrogenase ysgA b3830 1.9227 0.0146 putative enzyme ytfA b4205 0.5673 0.0178 hypothetical protein ytfT b4230 1.5645 0.0022 YtfQ/YtfR/YtfS/YtfT/YjfF ABC transporter ytjB b4387 1.3640 0.0001 membrane protein

187

Statement of sources

Declaration

I declare that this thesis is my own work and has not been submitted in

any form for another degree or diploma at any university or other

institution of tertiary education. Information derived from published scientific work has been cited in the text and listed in the references.

Signature Date

188

189

190