<<

Supporting Information for:

Inhibition of WTA synthesis blocks the cooperative action of PBPs and sensitizes MRSA to ß

lactams

Authors: Maya A. Farha †, Alexander Leung †, Edward W. Sewell †, Michael A. D’Elia †, Sarah E. Allison †, Linda Ejim †, Pedro M. Pereira ‡, Mariana G. Pinho ‡, Gerard D. Wright † and Eric D. Brown †,*

Affiliations:

†M.G. DeGroote Institute for Infectious Disease Research and Department of Biochemistry and Biomedical Sciences, McMaster University, Hamilton, Ontario, Canada, L8N 3Z5

‡Laboratory of Bacterial Cell Biology, Instituto de Tecnologia Química e Biológica, Universidade Nova de Lisboa, 2781901 Oeiras,

*Correspondence to: [email protected]

1

Supporting Methods

Generation of ∆tarO deletion strain. CAMRSA USA300 ∆tarO and HAMRSA EMRSA15

∆tarO deletion strains (EBII230 and EBII228, respectively) were generated by transduction using bacteriophage Ø11 and standard protocols (1), using the donor strain EBII44 where the chromosomal copy of tarO was previously replaced by a spectinomycin resistance cassette (2).

Deletion mutants were selected for on Mueller Hinton containing spectinomycin (300

g/mL). The resulting strain was confirmed by PCR.

Plasmid pLI50tagO was generated by digestion of pSweettagO with HindIII and

BamHI (NEB) and subsequent ligation into pLI50 cut with the same . The complemented deletion, EBII234, was generated by transformation of pLI50tagO into EBII228 by passage through RN4220 using standard electroporation methods and selected for on MHA containing chloramphenicol (15 g/mL) (3).

MIC determination. MIC determination was performed based on CLSI guidelines and were carried out in 200 l in 96well Ubottom MIC plates (VWR), in triplicate, using cationadjusted

Mueller Hinton Broth (MHB). A starting inoculum of of 10 5 CFU/mL was used for each strain.

Plates were shaken (250 rpm) and incubated at 37°C for 20 hours in and read at 600nm. The concentration where the optical density was less than 0.05 was deemed the MIC of the test compound. Fold change was calculated by dividing the MIC of the in the parent strain by the MIC in the deletion strain.

Assembly of the PAD library. We have previously assembled a library of 1,124 previously approved drugs from the overlap between our inhouse chemical collection and compounds listed in the FDA Orange Book (http://www.fda.gov/cder/ob/) of approved drug products (4). To this subset, we have added a nonredundant subset of PADs from the Johns Hopkins Clinical

2

Compound Library (JHCCL, Baltimore, MD), such that the final PAD collection contains 2,080 drugs.

Galleria mellonella survival assay. G. mellonella were injected (5 l aliquots) with 5x10 6 cfu of live CAMRSA USA300 using a Hamilton syringe. Following bacterial cells, cefuroxime, and their combination (dissolved in water) were administered in 2 l aliquots. Five control groups were used, including untreated larvae, larvae injected with saline, water and their combination, and larvae injected with saline and cefuroxime, ticlopidine and their combination. For each treatment, a group of at least 10 larvae were injected. Experiments were repeated 3 independent times with different batches of larvae and the results averaged. Larvae were left at room temperature and scored as dead or alive every 24 hrs for 14 days.

Interaction studies of ticlopidine with of known mechanism. 8x8 matrices of ticlopidine in combination with various known antibiotics were tested for interactions against

CAMRSA USA300 using the same conditions as screening. FIC indexes were calculated to evaluate the interactions.

TarO expression . tarO optimized for expression in E. coli and inserted into pBAD24 was obtained from GenScript. Empty vector or pBAD24tarO was transformed into E. coli BW25113

wecA from the KEIO collection (5) for protein expression . An overnight culture was diluted

1/100 into fresh LB and incubated at 37 oC, 250 rpm until cultures reached an OD of 0.4. Protein expression was induced with 2 % (w/v) arabinose and incubated for 3 hrs under the same conditions. Cells were harvested by centrifugation (10 minutes, 8 000 x g), washed with 0.85%

NaCl and stored at 80 oC overnight. Frozen cell pellets were thawed in an equal volume of lysis

1 1 buffer (50 mM Tris pH = 8, 10 mM MgCl 2, 1 mM EDTA, 100 µg mL DNase, 100 µg mL

RNase, 1 protease inhibitor cocktail tablet (Roche)), and lysed with a One Shot Cell Disruptor

3

(Constant Systems Ltd.). Lysate was clarified by centrifugation (40 000 x g, 15 minutes).

Membranes were recovered from the supernatant of the previous step by ultracentrifugation (111

000 x g, 60 min) and resuspended in Reaction Buffer (50 mM Tris pH = 8, 10 mM MgCl 2, 1 mM

EDTA) to a final concentration of approximately 60 mg membrane protein/mL (as determined by the Bradford method).

Generation of a tarH conditional deletion strain . To create a xylosedependent tarH conditional strain (EBII244), the xylose repressor encoded by xylR and the xylA promoter were first subcloned from pSWEETtarD into the MfeI and BamHI sites of pCL55 to generate pCL55 tarD . tarH was amplified from pG164 tarH (EBII10) with primers # (5'

GGGCTTAATTAAGGAAGGTCTACAAATGAACGTTTCGGTAAACA 3') and # (5'

GGGCGGATCCGTTTAAACTCGAGCGGCCGCTTATTTAATAACGA 3') and cloned into the PacI and BamHI sites of pCL55 tarD to generate pCL55tarH . All inserts were verified by sequencing (MOBIX, McMaster University, Hamilton, ON). pCL55 tarH was then transformed into EBII4 using standard electroporation methods and selected for on MHA containing chloramphenicol (15ug/mL) and kanamycin (20ug/mL). Integration of pCL55tarH into the geh locus of EBII4 was confirmed by PCR. This tarH single integrant strain was then passaged three times on MHA containing 5% sucrose, 2% xylose and (10ug/mL). The resultant conditional tarH deletion strain (EBII244) was confirmed by PCR and tested for xylose dependence by streaking on MHA plates with or without 2% xylose.

Phage susceptibility. Strain S. aureus RN450 was grown to exponential phase in the presence of compounds, plated and incubated with bacteriophage 11. Plates were incubated for 24 hours at

37°C.

4

Peptidoglycan isolation and lysozyme susceptibility. samples from ticlopidine treated cells and CAMRSAUSA300 ∆tarO were treated with 48% hydrofluoric acid at 4°C for

24 hours. Peptidoglycan was harvested by centrifugation at 30,000 rpm for 30 minutes and washed twice with water. Peptidoglycan was incubated in 80mM NaOH at 37 °C for 3 h, spun and resuspended in 80 mM buffer/0.85% NaCl (pH 6.5) to similar optical densities. Peptidoglycan was digested with 300 g/mL chicken egg white lysozyme (Sigma

Aldrich). The decrease in the absorbance at OD600 nm was monitored at 30min intervals for 6 hrs using a Sunrise plate reader (Tecan).

TarA and MnaA expression and purification. Expression and purification of TarA and MnaA as previously described(6).

In vitro TarA inhibition assay. TarA was assayed in 50 uL reactions containing 50 mM tris (pH

8), 250 mM NaCl, 2% DMSO, 0.2% TX100, 01.7 mM Ticlopidine, 200 uM α, 50 nM

TarA, and 4 uM MnaA. MnaA was added to the assay to catalyze the isomerization of UDP

GlcNAc to the TarA substrate, UDPManNAc. Reactions were initiated by the addition of 200 uM UDPGlcNAc and terminated with the addition of 50 uL of 8 M urea. Reaction products were separated and quantified by PICHPLC, as reported previously(6)

5

Supplementary Figures and Tables

Supplementary Figure 1. Chemical structure of a completed wall teichoic acid from S. aureus bound to Nacetylmuramic acid of peptidoglycan . PBP transglycosylase domains catalyze the polymerization of disaccharide units composed of Nacetylmuramic acid ( NAM) and N acetylglucosamine ( NAG). Adjacent stems are crosslinked by the transpeptidase function of PBPs to provide the cell wall polymer with its structural integrity . Attached at the 6 hydroxyl of NAM is a completed WTA polymer, composed of (n = 13) glycerol phosphate and (m = 2040) repeating ribitol phosphate units that are modified by D (Dala) and N acetylglucosaminyl residues (GlcNAc).

6

a

120 b 100

80

60

40

20

crosslinking PG Percent 0

tarO tarO agO ∆∆∆ ∆∆∆ t 50 SA SA CAMRSAR HAMRSAR M CA HAM tarO pLI ∆∆∆ RSA M A H Supplementary Figure 2. Highly crosslinked muropeptides, contributed by PBP4, are less abundant in MRSA ∆tarO deletion strains. (a) HPLC analysis of mutanolysindigested PG of the parental strains HAMRSA EMRSA15, CAMRSA USA300, their ∆tarO deletions and the complemented deletion strain, HAMRSA EMRSA15∆tarO pLI50tagO . Arrow points to highly crosslinked muropeptide species. Roman numerals I to V indicate muropeptide species form monomers to pentamers. (b) Quantification of highly crosslinked muropeptides (peaks > V) from the HPLC analyses. The values denote a representative analysis and variations in sample concentration were corrected for by calculating the areas for each peak and dividing the obtained values by the total area of the chromatogram.

7

a b 2.0

1.8

1.6

1.4

1.2

1.0

0.8

0.6

Normalized combination (R2) Normalized ratio 0.4

0.2 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8 2.0 Normalized combination ratio (R1)

Supplementary Figure 3. Screen of a previouslyapproved drug library to uncover molecules that potentiate the activity of cefuroxime as potential inhibitors of WTA synthesis. (a) Replicate plot of the primary screening results. CAMRSA USA300 was grown with one eighth the MIC of cefuroxime (16 g/mL) and each of the 2,080 PAD compounds at 10 M. Shown are the ratios of the growth of the combinations normalized to the growth of the PADs alone of replicate samples (RI and R2). In red are statistically significant hit molecules with a ≤0.7 cutoff. (b) Schematic diagram of the work flow of the screen conducted from 2,080 compounds to the lead molecule, ticlopidine. Compounds were eliminated at each stage according to the criteria indicated. Specifically, after confirming synergistic interactions among the compounds and cefuroxime in a checkerboard analysis, the various combinations were tested in CAMRSA USA300 ∆tarO to look for suppression. Only the synergy between ticlopidine and cefuroxime was completely suppressed in the deletion strain.

8

Supplementary Figure 4. Microdilution checkerboard analysis showing the combined effect of targosil and ticlopidine against S. aureus RN4220 where the extent of inhibition is shown as a heat plot. Ticlopidine antagonizes the effect of targosil, a WTA latestep inhibitor.

9

0.7

0.6

0.5

0.4

0.3

0.2

0.1 mol phosphate/mg cell wall molphosphate/mg 0.0 WT tarO 20 64 200 [Ticlopidine] (g/mL)

Supplementary Figure 5. Ticlopidinetreated S. aureus SA178R1 cells have decreased phosphate content in their cell wall.

10

Supplementary Figure 6. Ticlopidinetreated cells are less susceptibility to phage infection. Strain S. aureus RN450 was grown to exponential phase in the presence of ticlopidine (200ug/mL) and tunicamycin (0.025 ug/mL), plated and incubated with bacteriophage Ø11. Plates were incubated for 24 hours at 37°C.

11

Supplementary Figure 7. Peptidoglycan derived from ticlopidinetreated cells is more susceptible to degradation by lysozyme. Shown is the hydrolysis of purified PG from CAMRSA USA300 (circles), CAMRSA USA300 ∆tarO (squares) and ticlopidine (200 g/mL)treated CAMRSA USA300 (triangles) followed by monitoring the decrease in OD 600nm over time.

12

Supplementary Figure 8. Validation of in vitro assay for TarO activity. Assay was validated by showing incorporation of [14C]GlcNAc from UDP[14C]GlcNAc into lipid extractable material.Generation of the reaction product (likely undecaprenyPP[14 C]GlcNAc) was shown to be dependent on expression of TarO from pBAD24 expression plasmid. No lipidlinked radioactive species were observed from the cells harboring empty pBAD24 plasmid.

13

120

100 80

60 40

Activity Percent 20 0

0.1 1 10 100 1000 10000 [Ticlopidine] (M)

Supplementary Figure 9. Assay of TarA activity in the presence of ticlopidine. No inhibition was observed on the transferase activity of TarA with increasing concentrations of ticlopidine .

14

Supplementary Table 1. Cell wall phosphate analysis of CAMRSA USA300 and HAMRSA EMRSA 15 strains and their ∆tarO deletion strains.

mol phosphate Strain / mg cell wall

CAMRSA USA300 0.430 ± 0.040 CAMRSA USA300 ∆tarO 0.085 ± 0.009

HAMRSA EMRSA15 0.300 ± 0.050 HAMRSA EMRSA15 ∆tarO 0.035 ± 0.007

HAMRSA EMRSA15 ∆tarO – pLI50tagO 0.307 ± 0.03

15

Supplementary Table 2. Components of the PAD Library.

tinoridine hydrochloride HCL thioctic acid amide Ethinyl Sodium Sulphate todralazine hydrochloride Phthalylsulfathiazole Ammonium carbonate Guaiacol Sulindac Levopropoxyphene napsylate Atracurium Brompheniramine (+/) Clioquinol Doxylamine Flurbiprofen Moexepril Dicyclomine Strophanthidin Acarbose sodium glucuronate Levobunolol aspart ambroxol hydrochloride acetaminophen Hydroxyprogesterone acetate allantoin Capsaicin sodium Metformin Felbinac Guaifenesen Estrone Emedastine difumarate Fluspirilene hydrochloride Pyrimethamine Nicotinyl oxethazaine Nabumetone 6Aminocaproic acid sodium succinate Carbazochrome xanthinol niacinate Aminocaproic acid Iodine resublimed, p.a. Chlorphenesin LThyroxine Benzonatate methacycline hydrochloride (1R,2S)() Hydroflumethiazide Acrivastine Sulfacetamide Dimethindene (S, +) maleate Thiamphenicol methyldopate hydrochloride Terpin Lymecycline mesylate Ticlopidine Propranolol Hetastarch benzylmandelat Prednicarbate Heparin tegafur Ibandronate Meticrane Cromolyn panthenol Cyclopenthiazide Sulfadiazine trans

16

Norethynodrel Bromodiphenhydramine hydrochloride Dapsone ozagrel sodium Fexofenadine hydrochloride Talampicillin Oxybuprocaine Spaglumic acid Amyl Nitrate Loracarbef Coumarin quinine ethylcarbonate Fondaparinux sodium naphazoline hydrochloride Pravastatin sodium Sulfaphenazole fumarate epirizole meptazinol Tolonium chloride Ipecac syrup Zalcitabine chloride 6hydrate Naproxen Proguanil Methylcellulose Minaprine carbonate Miconazole Netilmicin Potassium bitartrate Procarbazine mesulfen Natamycin D Methyclothiazide Chloramphenicol Ribavirin hydrochloride Glycocyamine Betazole Proscillaridin Aluminum acetate, basic Mecamylamine Sodium , powder Pivampicillin Bismuth(III) citrate Dibucaine Torasemide Bismuth(III) oxide Prednisone Mecamylamine Captopril Aprepitant oxycinchophen Saquinavir Potassium tetrahydrate hydrochloride Cholestyramine resin Azapropazone Oxalic acid dyhydrate Nifurtimox D Sodium taurochlolate hydrate Aloe Tribenoside Bismuth subcarbonate Pyrvinium Idoxuridine Dimenhydrinate antipyrine Pivmecillinam Calcium hydroxide efloxate Sertaconazole Potassium cyclobutyrol Halofantrine Safflower oil trichlorfon Deptropine Esmolol

17

Homatropine Pancuronium Karaya powder Bismuth subnitrate Sulfathiazole Levodopa Ethambutol dimaleate salt Naftifine sodium Pheniramine Edetate calcium disodium Phenoxyacetic acid zimeldine Citric acid Ampicillin Fluticasone Bismuth (III) phosphate Alprostadil Sodium bismuthate Bismuth III gallate basic hydrate Isoconazole Moricizine Difenidol hydrochloride Bethanechol Potassium phosphate monobasic Succimer Trimethobenzamide Clofibrate Nomegestrol DL hydrochloride dehydrocholic acid Hesperetin fursultiamin Benzyl salicylate Benzathine benzylpenicillin oxide Prochlorperazine dimaleate Calamine Acenocoumarol viomycin sulfate Diphemanil Propranolol Nalmefene Metronidazole Cyclopentolate 3hydroxytyramine Metolazone Meropenem Ondansetron Chlorambucil Witch hazel Vitamin K Zinc chloride Casanthranol vinorelbine Boric acid chlorpheniramine Danthron eflornithine hydrochloride Dolasetron mesylate Sulfaguanidine Fenoldopam

18

Apomorphine Verteporfin Potassium nitrate Dorzolamide Torsemide Chlorhexidine Thiethylperazine Magnesium Taurocholic acid, sodium salt hydrate Chlortetracycline Cyclacillin Carboxymethylcellulose Prostaglandins Olive oil Gallamine Metyrosine Croton oil cortisone acetate Potassium phosphate dibasic Gallic acid Oleic acid Magnesium acetate Senna syrup Midecamycin Benzylpenicillin Josamycin Nialamide LArginine hydrochloride mithramycin Potassium bicarbonate, granular Prostaglandins SelenoD, L aminopyrine hydrochloride hydrochloride Lithium Epinephrine fumarate Niclosamide 4Aminobenzoic acid Trifluridine Psyllium husk Oleandomycin Hexadimethrine bormide moroxydine oxedrine Glucose (D) Rifabutin Basic fuchsin hydrochloride acyclovir Artesunate DXylose Prostaglandins Sodium Thiosulfate Acetylsalicylic acid gammaaminobutyric acid oxalate Cefotaxime stavudine Epinephrine Sertraline hydrochloride flupenthixol Dichlorophenamide Ethylenediaminetetraacetic acid Edrophonium Ticarcillin Phenolsulfonphthalein LArginine Lglutamate salt Clocortolone Sodium acetate Cerulenin diatrizoate Disulfiram Prostaglandins Glycerin (Glycerol) calcium laspartate Thioproperazine doxylamine succinate Lithium salicylate

19

Isoniazid Biperiden hydrochloride hydrochloride DLhomatropine Erythromycin Ciprofibrate Tiopronin Sodium phosphate dibasic Cefepime Copper (II) sulfate Quinethazone Mebrofenin Fumagillin Chymopapain chlorpheniramine maleate Disofenin Nalbuphine Amsacrine Lithium benzoate Dihydrostreptomycin Clodronic acid Tranexamic acid Trilithium citrate Levoglutamide Calcium bromide Tiratricol Cycloserine Sodium polystyrene Ramipril LArginine Oxyphenbutazone Mafenide Oxaprozin Sodium iodide Trientine Silymarin Magnesium sulfate benztropine mesylate DLGlutamic acid monohydrate Indapamide gadopentetate dimeglumine sodium Dantrolene hydrobromide maleate gallamine triethiodide Dioxybenzone Pyrantel Fluorescein piperacetazine chlorphenesin mesalamine Sodium chromate Iproniazide santonin Sodium sulfate, powder Sulfamethoxazole Prostaglandins Trimethoprim rutosid Ketoprofen doxazosin mesylate bromide hexahydrate Lisinopril Dipivefrin HCl Piroxicam oxitriptan L hydrochloride Chlorzoxazone Bentiromide Ornidazole levallorphan tartrate Fomepizole Metyrosine Rubidium iodide Cloxacillin protoporphyrin disodium Protamine chloride, grade V Nalidixic acid Butylscopolamine Zoxazolamine Fenbufen tropisetron

20

Nefopam desoxycorticosterone acetate methicillin Iproniazid Bromhexine Ammonium bromide Norfloxacin Inulin Rose bengal Aceclofenac Sodium phosphate monobasic Picotamide Lidofenin Succinylcholine Tropicamide tropisetron Molindone hydrochloride levomenol Benztropine MethaneSulfonate Pseudoephedrine Flavoxate vitamin a palmitate Etodolac diethyltoluamide Carbocloral Idarubicin Dihydroergotamine methanesulfonate Methocarbamol fomepizole Aztreonam oxycodone Bimatoprost Meparfynol Mebendazole hexasodium Olsalazine Lomefloxacin Auranofin Phenelzine xylitol Chlorothiazide Methylthiouracil 21acetate Diphenidol Amcinonide Pyroxylin Vitamin A (acetate) Oxolinic acid isoproterenol Menthyl salicylate metaproterenol Frovatriptan succinate Tiapride sodium sulfate tranilast Desonide Hydralazine Dexamethasone phosphate alpha tocopherol acetate Colloidal oatmeal Cyclosporin A Triprolidine Hydroxychloroquine DPantothenic acid calcium salt Levamisole Menadiol disulfate Flufenamic acid Iodine iofetamine Lantanoprost Flumequine compactin Akwa tears Nifenazone 2,2,2Trichloroethanol Acetal

21

Nitrofurantoin aminoethylsulfonic acid Corticotropin A Phenformin Benzoyl peroxide Malathion Vincamine Acetarsol Deoxyribonuclease I Indomethacin Teniposide Riboflavin Alanine, D, L loxoprofen sodium citrate Gemfibrozil Choline dihydrogen citrate Metampicillin pentolinium Magnesium bromide Mephenesin sapropterin hydrochloride Arbutin Hydroxypropyl cellulose Ephedrine Fluocinolone acetonide 21acetate Fludrocortisone Methoxsalen Fenoterol Vitamin D2 Ephedrine Selenium sulfide Glafenine Econazole hydrochloride Valproic acid sulfate sobuzoxane Eletriptan hydrobromide Oxytetracycline Esculin monohydrate decanoate amodiaquin flumethasone Pimecrolimus Streptomycin cefoperazone sodium Aluminum chlorohydrate Aminolevulinic acid Acetic acid Lincomycin retinol Calcium Lascorbate dihydrate Dtartrate Enalapril Sulisobenzone Rugby artificial tears solution 21Acetoxypregnenolone Trifluperidol Azaribine Quinacrine hydroxyamphetamine hydrobromide Calcipotriene Acetylcarnitine Dichlorisone acetate Methapyrilene avobenzone Retinoic acid Edoxudine Ferrous bromide Cymarin Octyl Methoxycinnamate Dropropizine Busulfan 1,2Ethanedisulfonic acid

22

Pinacidil sodium edetate Albendazole Hydrocortisone hemisuccinate Oxacillin Ethylamine Flumethasone pivalate Praziquantel Mesna Methdilazine hydrochloride chlorthalidone Dibekacin Methyl nicotinate Ferric phosphate Bufexamac Stannous fluoride (Tin(II) fluoride) Nortriptyline Acetohydroxamic acid Latanoprost opthalmic solution Carbenicillin Lithium carbonate Isotretinoin alitretinoin diiodohydroxyquinoline Aminopyrine Antazoline Oxyquinoline Meloxicam Ethacrynic acid Tyrothricin Triamcinolone acetonide acetate Foscarnet Phenylbutazone Cetrimonium Betamethasone Sodium ferric gluconate Rofecoxib Vitamin A acetate Dyclonine Aminosalicylic Acid Allantoic acid dimenhydrinate Cetylpyridinium Indium(III) chloride gentian violet Peruvian balsam Mechlorethamine Cholecalciferol G aCasein dephosphorylated Clomipramine Broxyquinoline Diethyl oxalate Dibutyl Ketotifen Ethohexadiol sennoside Human immunoglobulin Hycanthone Amodiaquine Niacinamide hydrochloride Fenofibrate chlorocresol Vitamin K3 Glucosamine Chromium (III) chloride Medroxyprogesterone Podophyllum resin pseudoephedrine Cevimeline hydrochloride guanidine Potassium citrate monohydrate Sulfinpyrazone Anisindione Orotic acid Clofoctol Pyrethrins technical mixture Cortisone Toltrazuril

23

Diethylcarbamazine anthralin Sodium formate chenodiol Chloroxylenol Pyridoxine hydrochloride Perhexiline Zinc sulfide Oxybutynin Methenamine Neovitamin A Disulfiram pyrilamine maleate meglumine Ferrous gluconate hydrate and ethinyl estradiol Thiotepa Ethylenediamine dihydrochloride Homochlorcyclizine Lomofungin Pimethixene benztropine Hydroxocobalamin hydrochloride Dexchlorpheniramine Acemetacin Hexachlorophene Riboflavin phosphate sodium sodium Vitamin B12 Fipexide Pseudoephedrine Ferric sulfate heptahydrate glycyrrhetic acid Chlorophenothane gammaaminobetahydro Ferrous sulfate Semustine Zidovudine hydrate Irbesartan Bifonazole Metergoline betacarotene Vitamin B4 Amikacin Colistimethate Ammonium lactate Cefoperazone Hexylresorcinol Picric acid Bezafibrate norethindrone acetate Cod liver oil Mimosine Resorcinol Butopyronoxyl Retinol Dinoprost tromethamine Cefixime Floxuridine Dimethyl phthalate Ciclosporin Celecoxib Potassium ricinoleate Digoxin acrisorcin Ferric ammonium citrate Enoxacin Ethacridine lactate alphaDLactose monohydrate Pyrithione zinc Procainamide Hydroxyprogesterone Zirconium(IV) oxide Dequalinium orphenadrine citrate Potassium hydroxide thioguanine Ferrous fumarate Fusidic acid carprofen Sodium ethasulfate dthyroxine Quinapril Ursodiol Azithromycin Doxapram hydrochloride

24

Hydrocortisone Metaxalone Colchicine candesartan Flubendazole Probucol Rosiglitazone Sodium hydroxide Famciclovir Magnesium phosphate hydrate Amoxicillin Cobalamine concentrate Oxantel Ammonium magnesium phosphate hydrate Prochlorperazine Ipriflavone Butyl Rutin trihydrate erythromycin gluceptate Brompheniramine 2h1benzopyran2one Dimethyl sulfoxide Meclozine Albuterol Cevimeline methotrexate Divalproex Metrifonate Kanamycin Losartan Calcium phosphate tribasic Zinc stearate Perindopril Nadide Tacrine Ergosterol chlorophenothane Dodecylamine cholesterol Ferrous lactate Cyanocobalamin Polymyxin B Iron(II) sulfate heptahydrate Bacampicillin Simethicone demeclocycline hydrochloride Butyl chloride Hematin Symclosene Ascorbic acid Gatifloxacin c Adenosine Ezetimibe Mepartricin clomiphene Rosuvastatin Trilocarban l Protionamide Pikrinic acid Penimepicycline Suloctidil Thiram Docosanol Hydroxyprogesterone Carzenide epidihydrocholesterin Bucetin Butoconazole clomiphene citrate Mebhydrolin Valdecoxib Rufloxacin HCl Ambroxol Almotriptan Oxibendazole Pazufloxacin Dactinomycin Nifursol Estradiol Pipobroman Tetramisole

25

Cefotetan Warfarin Carteolol Benzyl benzoate Biotin sodium cromoglicate Polidocanol Sulfisoxazole meclocycline sulfosalicylate hydrochloride Brinzolamide Moxifloxacin Climbazole Clofazimine Olmesartan medoxomil Clorsulon Cephalexin Troxerutin Closantel Sulfanilate Zinc Droperidol Thiopental Zanamivir anethol tocopherol flopropione Benzododecinium chloride Meclocycline Aminophenazone Lidocaine Nethyl bromide Doxorubicin Gentamicin 5hydroxyDLTryptophan Clopamide lvaline Mitoxantrone Pioglitazone Pidolic acid Etoposide Ceftibuten Cyacetacide Thiacetazone calcium gluconate Tilorone dihydrochloride Cloxyquin Ouabain Fluconazole Florfenicol Cefadroxil dichlorophen Primaquine Aminobutyric acid Benzetimide Melatonin Dexetimide Neostigmine pentolinium tartrate Niridazole podofilox Oxfendazole Ceforanide Cefdinir Clinafloxacin HCl Biperiden Trandolapril Nitroxoline isethionate betamethasone valerate Bitoscanate Cefaclor acetrizoate sodium Clopidol Tiaprofenic acid Rifamycin sv Vancomycin DLgammaAminobeta hydroxybutyric Acid Mercaptamine Periciazine Meclofenamate Sulpiride (+/) chlorguanide Nbutyl bromide Psoralens for systemic use Benazepril Potassium antimonyl tartrate trihydrate Metixene Valsartan Nadifloxacin Telithromycin Sulfamoxole Benperidol Carbadox

26

Terconazole Escitalopram Fleroxacin Sisomicin Dipyrocetyl Tosufloxacin Nystatin NDesmethylclozapine Triflusal loxapine succinate Nitrofurazone podofilox Dibenzepine Amphotericin B Avermectines 3formyl Rifamycin Triethylenemelamine Sulfachlorpyridazine Probenecid Eflornithine hydrochloride Oltipraz Propylthiouracil Arsenic trioxide Betamipron Samarium(III) acetate hydrate Thiostrepton Tetrachloroethylene Tenoxicam Anthranilic acid Bromoform Phenindione Quinine Nonivamide Creosote, Beechwood Tar (s,s +) Cetalkonium chloride cis(Z)Flupenthixol dihydrochloride ergocalciferol Mitomycin Sarafloxacin HCl 6Mercaptopurine monohydrate Artemesinin Selegiline Phenanthrene Ricobendazole Pyrazinamide Asparaginase Enrofloxacin Diethylstilbesterol Benznidazole Ethionamide Gemcitabine pArsanilic acid Silver (I) sulfadiazine, 98% Methylphedrine Chloroquine Nithiamide Cinchophen Trimetazidine Thiabendazole NAcetylL calcifediol dCycloserine Paroxetine Acedoben Ciclopirox Hydroxyurea Idebenone Temozolomide Tiabendazole Lomustine Meclofenoxate Eflornithine Lactitol monohydrate Metyrosine Pyridoxal5phosphate Molsidomine Nifuroxime Carvacrol Anetholetrithione Iobenguane Sodium butyrate Carbimazole Amodiaquin Nedaplatin mestanolone Pyrithioxin Hexetidine Histamine

27

Cetirizine Anthracene Cinromide Atovaquone Quinaldine blue Azulene levamisole Capecitabine Cerium oxalate prasterone Tioxolone Dirithromycin Bismuth tribromophenate Ceftazidime Chlorquinaldol Octabenzone ethamivan Potassium permanganate Aminothiazole Pilocarpine Quinine urea hydrochloride Chromocarb (+)p Epirizole Cefotiam Cisplatin Acepromazine Phenacetin Cytarabine Tobramycin Thiourea Apocodeine Nifuroxazide Gallium (III) nitrate hydrate Acriflavine hydrochloride maleate Tartaric acid L(+) Isopaglumic acid Iodoform Cyclizine Quinine hydrobromide Metoclopromide Menadione Abacavir Procodazole Dinoprost Carmustine Dextrorphan tartrate Nitrofural Strontium chloride hexahydrate Fosfosal Betahistine Epirubicin Fampridine (Casodex) Aceneuramic acid Colistin Melphalan Monophosphothiamine Daunorubicin Roxarsone LOrnithine Carbon Tetrachloride disodium Bromperidol Methenamine mandelate Pyridoxamine, Dihydrochloride Sulfasalazine Pentamidine Oxeladin citrate salt Naphthalene Cycloheximide Gold(III) chloride trihydrate Vitamin B2 (Riboflavin) Amifostine Fomocaine Folic acid Irinotecan hydrochloride trihydrate Dimethadione Dydrogesterone Fumagillone Tricaprilin Saponin, from quillaja bark Storax Flurandrenolide Isoniazid Dglucosamine sulfate ChloramineT hydrate HCl Cefmetazole Quinine bisulfate Flavin adenine dinucleotide Phenazopyridine Dichlorophene Benzyl nicotinate Tubocurarine Fenticlor Carbaryl

28

Noscapine Mitotane Clothiapine Atropine Cladribine Pyrogallol rescinnamine Roxindole Mesylate trihexyphenidyl Mechlorethamine HCL Etofylline Halcinonide 4 Hexylresorcinol Sodium feredetate Suxibuzone Silver nitrate , alpha Cefuroxime Acetarsone Butetamate Sulfapyridine Echinacea juice Phenylpropanol pAminosalicylic acid Carbocysteine Eserine atropine Lamivudine galantamine Cefepime hydrochloride Lithium Hydroxide Voriconazole Hydroxyquinone sulpyrine Calcium propionate DGlucosamine 2sulfate Lanatoside C Cefpodoxime proxetil Mecobalamin Ceftriaxone Ascorbic acid 6palmitate Cephradine Leflunomide Oxychlorosene Carbophenothion Vitamin B1 (Thiamine) Triple dye Difluprednate Vitamin B6 (Pyridoxine) Potash, sulfurated hydrocotarnine hydroc Sodium propionate Ebselen Didanosine (2'3'dideoxyinosine) Amylene hydrate gelsemin Zinc undecylenate Bismuth aluminate Imiquimod Durapatite Doxycycline hyclate tetrahydrozoline nitrate Fosfomycin tromethamine Pimagedine Aminoguanidine bicarbonate Alclometasone Daptomycin Zinc carbonate Podophyllotoxin Sodium lauryl sulfate Clobetasone butyrate Dihydroergocristine Aminacrine Mizoribine syrosingopine Domiphen bromide Decitabine Hydroquinine Anisomycin Diloxanide furoate Diflorasone TNP470 Benzoylpas calcium Benfotiamine Oxiconazole nitrate Monoethanolamine chlorcyclizine Phthalylsulfacetamide Eucatropine benzethonium Mafenide Clofibric acid Clobetasol Mezlocillin sodium Congo red

29

Penicillin V Bronopol Carbazole Aluminum Phosphate Dacarbazine Oxamniquine Demecarium Nelfinavir mesylate Emetine Triacetin Cianidanol Succinylsulfathiazole Sulfamerazine Propionic acid sodium salt HCl pramocaine Sulfadoxine Chondroitin sulfate A Penicillin G benzathine Naproxen Penicillin V Polyoxyl 10 oleyl ether Brij 92 Tazobactam sodium salt Carbamide peroxide trihexyphenidyl Ferric chloride anhydrous Bemesetron yohimbin Streptomycin sulfate Racecadotril Lopinavir/ Gold sodium thiomalate quinisocain Oxolamine Itraconazole Nitrocefin Valacyclovir Adrenalone hydrochloride mestanolone Cefprozil Thyropropic acid trioxsalen Furaltadone Anazolene sodium Streptozocin Sulfabenzamide Debrisoquin sulfate Medrysone 5Chlorosalicylanilide Denopamine Potassium chlorate Bithionoloxide Diclofenac Cinchonine sulfate Diacerein vincamine Terbinafine Tegafur (Ftorafur) Penciclovir Miltefosine Candicidin Aspartame Isosorbide dinitrate Potassium iodide Pantethine (DPantethine) Linezolid Benzaldehyde cephalothin Sparfloxacin Cabufocon Sulfamethizole 4Nitrophenol Demeclocycline Captan Abamectin Meclofenoxate Sodium perborate tetrahydrate Bumetrizole Meglumine Broxuridine Glycopyrrolate Tioconazole Secnidazole guanadrel sulfate Undecylenic acid Ditiocarb Sulfanilamide Cefonicid sodium Cefpiramide 1Pentanol Ceftizoxime 4Aminobutyric acid

30

Iopromide Sulbactam Maleate Bromthymol blue, sodium salt Althiazide Piromidic acid Ethyl vanillate Bisoctrizole Norgestrel and Veratrole Spiramycin Itopride HCl Azithromycin dihydrate Oxaceprol merbromin Cefmenoxime hydrochloride levonordefrin Carbomycin Oxiniacic acid Cinoxacin Penicillin V potassium CitrateDextrose solution Methazolamide Penicillin G Hydrastinine Sulfisomidine Spectinomycin Dodecylbenzenesulfonic acid, sodium Meglutol salt, tech Trichlormethiazide Paraformaldehyde Broquinaldol Ammonium citrate Piperacillin Castile soap lmethionine Tinidazole Zinc sulfate Clodronate disodium Sulfadimethoxine Mitobronitol isoetharine Methylbenzethonium chloride Bamethan sulfate / Pravastatin Cisatracurium besylate Bismuth Sodium Triglycollamate Isobutamben (Isobutyl 4 aminobenzoate) Cefsulodin Ethyl vinyl ether L beclomethasone Methotrimeprazine Desmethylastemizole Sulfamethoxypyridazine Regular human insulin Fiduxosin sulfamethazine Potassium iodate () Hydrochloride Guaifenesin 2,4Dinitroanisole Melengestrol acetate Leucovorin Proflavine hemisulfate salt hydrate, Dimethicone powder methacholine chloride solution Indigotindisulfonate Carbinoxamine Scopolamine () Allylthiourea Clidinium hydrochloride Pempidine sulfamonomethoxine Dipyrone Phosphocreatine benzthiazide Anisotropine methylbromide Bipenamol Mivacurium chloride Acadesine Fenoprofen Acetomenaphthone dicumarol Terpene resin Bendazol Methimazole Ammonium sulfate Brivudine Ribostamycin chloride hydrate hydrochloride

31 sulfameter Thymol iodide Amperozide bergenin Tizanadine Imazodan Cefoxitin Ergothioneine Ifosfamide Bilirubin novobiocin sodium Decamethonium Bromide RIAA 94 Diphenoxylate hydrochloride/Atropine Conduritol sulfate Fluocinonide Norgestrel Isocarboxazid Zinc peroxide azelaic acid Iodine 0.1 mo ICI/I hydrochloride (+) Vidarabine 2Phenoxyethanol Zomepirac 3,5Dibromosalicylaldehyde Bromofos Azlocillin Alfafosfalin trimeprazine tartrate LHyoscyamine hydrochloride Napthol blue black Nafcillin , dodecasodium salt hydrate Procyclidine Phenacaine Tartrazine Miglitol Ginkgolide A Bendroflumethiazide Sodium perchlorate monohydrate Shikimic acid Ammonium phosphate dibasic Butacetin Cefamandole Povidone iodine Pridinol Brilliant green Butylated hydroxytoluene paroxetine hydrochloride Ammonium salicylate Antimony (III) sulfide Doxycycline Valethamate bromide Zimelidine dihydrochloride Liothyronine sodium Aminopentamide sulfate Tanshinone IIA Diperodon hydrochloride Suprofen Vitamin E nicotinate Deferoxamine Human insulin S(+)Terguride Cefazolin Cetyl alcohol (1Hexadecanol) Carsalam 2Iodobenzoic acid Fumaranol 2Phenylphenol Pipenzolate Dichlorodiphenylmethane Hydrochloride Denbufylline Camphor Eseroline Etidronic acid Rocuronium bromide Metrifudil Benactyzine HCL Indoprofen Sodium fluoride Quinpirole dihydrochloride βEstradiol Epicatechin () Paromomycin Potassium perchlorate Docebenone

32

Ioversol Benzoin A Sulconazole Bornyl acetate, () Benzarone Gadopentetic acid 5 Aminosalicylic acid Diloxanide Benoxinate Eticlopride hydrochloride (S) Flucytosine Trolamine Phloridzin Ethoxazene desoxycortone Ursolic acid Bacitracin Protirelin Tolmetin Human insulin Scopolamine Terpineol mixed isomers Aconiazide diclofenamide Cetylpyridinium bromide monohydrate Bentonite Chlorothymol Bromocyclen crotamiton Phenyl salicylate Bioallethrin Salicyl alcohol hydrochloride Sulfosalicylic acid Bephenium Eugenol 2Iodomelatonin Vecuronium bromide hydrochloride Ketorolac Harmine Azacitidine Alpha bisabolol Furazolidone 17βEestradiol Dipropionate Amaranth moxalactam disodium Estrone Bromebric acid ethopropazine Chlorphenoxamine hydrochloride Butylated hydroxyanisole Bemegride Clemizole Bromophenol Blue, sodium salt Pirfenidone Tyloxapol Dyphylline Altretamine Epinastine hydrochloride Brilliant Blue Ethynodiol Diacetate Quinelorane dihydrochloride iodipamide meglumine Sodium nitroprusside αKetoglutaric acid Chloropyramine Strophanthin K () Benmoxin Ganciclovir Butoxamine hydrochloride Tripelennamine aesculin Hydrocodone Camylofine dihdrochloride polistirex/chlorpheniramine polistirex Pralidoxime Desloratadine Aminohippuric acid Norephedrine Hydrochloride Sodium stibogluconate Megestrol Potassium guaiacolsulfonate Fluphenazine Nmustard Vasopressin 4Hydroxydebrisoquin Enalaprilat Decoyinine

33

Propantheline Isosorbide Myristic acid Atenolol Etidronate disodium Rolitetracycline Pipemidic acid Levalbuterol nicotinic acid Oxtriphylline Albuterol Proparacaine Olopatadine hydrochloride N,NDimethylhexylamine Azelastine HCl Azatadine maleate Amlodipine besylate Phenyltoloxamine Fluvastatin Hexamethonium Chloride Dextran Nitroglycerine tosylate free acid Eptifibatide Meglumine antimonate DESOXIMETASONE benserazide hydrochloride Pamidronate disodium

34

Supplementary Table 3. Deletion of tarO in S. aureus RN4220, does not lead to sensitization to ßlactams. Fold change refers to the MIC of the antibiotic in the parent strain divided by MIC in the deletion strain.

ßlactam Antibiotic Fold change Ampicillin 1 Cloxacillin 1 Cefaclor 1 Ceftizoxime 1 Cefotaxime 1 Cefoxitin 1 Cefuroxime 1 Piperacillin 1

35

Supplementary Table 4. Thienopyridine group of molecules in combination with cefuroxime against CAMRSA USA300.

MIC MIC FIC 1 FIC 1 FIC Thienopyridine thienopyridine cefuroxime thienopyridine cefuroxime Index 2 (g/mL) (g/mL) Ticlopidine > 128 0.063 ≥ 256 0.032 ≤0.063 (Ticlid®) > 128 0.063 ≥ 256 0.063 ≤0.125 (Plavix®) > 128 0.25 ≥ 256 0.250 ≤0.5 (Effient®)

1 Fractional Inhibitory Concentration (FIC) = [X]/MIC X, where [X] is the lowest inhibitory concentration of drug in the presence of the codrug. 2 FIC index = FIC thienopyridine + FIC cefuroxime

a b c O O O Cl F N S S S N N O Cl

O

36

Supplementary Table 5. Fold change in the MIC of various antibiotics, including several ß lactams, in the presence of ticlopidine against CAMRSA USA 300.

High affinity Antibiotic Fold change 1 binding to PBP2 (ref) Chloramphenicol 1 NA Clarithromycin 1 NA Cycloserine 1 NA Daptomycin 1 NA Erythromycin 1 NA Fosfomycin 4 NA Kanamycin 1 NA Levofloxacin 1 NA Minocycline 1 NA Neomycin 1 NA Norfloxacin 1 NA Novobiocin 1 NA Streptomycin 1 NA Trimethoprim 1 NA Vancomycin 1 NA Ampicillin 8 (7) Cefaclor 16 (8) Cefadroxil 1 Cefamandole 4 Cefotaxime 8 (7) Cefoxitin 8 Cefsulodin 1 Ceftazidime 1 Ceftizoxime 16 (9) Cefuroxime 64 (10 ) Cephalexin 2 Cephalothin 8 (7) Cephradine 2 Cloxacillin 8 (8) Meropenem 2 Methicillin 4 Nafcillin 16 (8) Oxacillin 16 (11 ) Penicillin G 16 (7) Piperacillin 8 (10 ) 1Fold change refers to the MIC of the antibiotic alone divided by the lowest MIC of the antibiotic in combination.

37

Supplementary Table 6. FIC determination of cefoxitin in combination with ßlactams of high affinity for PBP2 (*) and of low affinity for PBP2 against CAMRSA USA300. Fold change represents the decrease in the MIC of the ßlactam in the presence of cefoxitin.

Antibiotic Ref . for affinity Fold Change FIC Index Cefuroxime * (10 ) > 64 0.039 Ceftizoxime * (9) 128 0.094

Oxacillin * (11 ) > 32 0.094

Penicillin * (7) 32 0.094

Ceftazidime (10 ) 8 0.250

Cefsulodin (10 ) 2 1.00 Cephradine (7) 4 0.750

38

Supplementary Table 7. Bacterial strains and plasmids used in this study.

Ref. or Strain Genotype/phenotype a source RN4220 Restrictiondeficient mutant (12 ) RN450 Prophagecured S. aureus strain 8325 (13 ) EBII16 SA178R1; RN4220 derivative, containing T7 pol (2) EBII44 SA178R1 tarO ::spec (spec r) (2) EBII4 SA178R1 tarH ::pSCH1382 ∆tarH (erm (2) Newman Clinical isolate (ATCC 25904) (14 ) HAMRSA USA600, SCCmec type II (15 ) HAMRSA USA 100/800/NY, SCCmec type II (15 ) HAMRSA SCCmec type III (15 ) HAMRSA USA 200/EMRSA16, SCCmec type II (15 ) HAMRSA USA500, SCCmec type IV (15 ) HAMRSA SCCmec type III (15 ) CAMRSA USA400/MW2, SCCmec type IV (15 ) HAMRSA EMRSA15, SCCmec type IV (15 ) HAMRSA SCCmec type II (15 ) CAMRSA USA300, SCCmec type IV (15 ) EBII230 CAMRSA USA300 tarO ::spec (spec r) This study EBII228 HAMRSA EMRSA15 tarO ::spec (spec r) This study EBII234 HAMRSA EMRSA15 tarO ::spec pLI50tagO (spec r, chl r) This study EBII244 tarH::erm pCL55tarH This study a HA, hospitalassociated isolate, CA, communityassociated isolate

Ref. or Plasmid Description source pLI50 E. coli / S. aureus shuttle vector (amp r, chl r) (16 ) pSweettagO Source for vector containing B. subtilis tagO (amp r, (17 ) chl r) pLI50tagO pLI50 with xylR tagO from pSweettagO (amp r, This study chl r) pSweettarD (18 )

39

Supplementary References

1. Novick, R. P. (1991) Genetic systems in staphylococci, Methods Enzymol 204 , 587636. 2. D'Elia, M. A., Pereira, M. P., Chung, Y. S., Zhao, W., Chau, A., Kenney, T. J., Sulavik, M. C., Black, T. A., and Brown, E. D. (2006) Lesions in teichoic acid biosynthesis in Staphylococcus aureus lead to a lethal gain of function in the otherwise dispensable pathway, J Bacteriol 188 , 41834189. 3. Lee, J. C. (1995) Electrotransformation of Staphylococci, Methods Mol Biol 47 , 209216. 4. Ejim, L., Farha, M. A., Falconer, S. B., Wildenhain, J., Coombes, B. K., Tyers, M., Brown, E. D., and Wright, G. D. (2010) Combinations of antibiotics and nonantibiotic drugs enhance antimicrobial efficacy, Nat Chem Biol 7, 348350. 5. Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y., Baba, M., Datsenko, K. A., Tomita, M., Wanner, B. L., and Mori, H. (2006) Construction of Escherichia coli K12 inframe, singlegene knockout mutants: the Keio collection, Mol Syst Biol 2, 2006 0008. 6. Pereira, M. P., Schertzer, J. W., D'Elia, M. A., Koteva, K. P., Hughes, D. W., Wright, G. D., and Brown, E. D. (2008) The wall teichoic acid polymerase TagF efficiently synthesizes poly(glycerol phosphate) on the TagB product lipid III, Chembiochem 9, 13851390. 7. Georgopapadakou, N. H., Smith, S. A., and Bonner, D. P. (1982) Penicillinbinding proteins in a Staphylococcus aureus strain resistant to specific betalactam antibiotics, Antimicrob Agents Chemother 22 , 172175. 8. Chambers, H. F., and Sachdeva, M. (1990) Binding of betalactam antibiotics to penicillinbinding proteins in methicillinresistant Staphylococcus aureus, J Infect Dis 161 , 11701176. 9. Leski, T. A., and Tomasz, A. (2005) Role of penicillinbinding protein 2 (PBP2) in the antibiotic susceptibility and cell wall crosslinking of Staphylococcus aureus: evidence for the cooperative functioning of PBP2, PBP4, and PBP2A, J Bacteriol 187 , 18151824. 10. Georgopapadakou, N. H., and Liu, F. Y. (1980) Binding of betalactam antibiotics to penicillinbinding proteins of Staphylococcus aureus and Streptococcus faecalis: relation to antibacterial activity, Antimicrob Agents Chemother 18 , 834836. 11. Moisan, H., Pruneau, M., and Malouin, F. (2010) Binding of ceftaroline to penicillin binding proteins of Staphylococcus aureus and Streptococcus pneumoniae, J Antimicrob Chemother 65 , 713716. 12. Kreiswirth, B. N., Lofdahl, S., Betley, M. J., O'Reilly, M., Schlievert, P. M., Bergdoll, M. S., and Novick, R. P. (1983) The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage, Nature 305 , 709712. 13. Novick, R. (1967) Properties of a cryptic highfrequency transducing phage in Staphylococcus aureus, Virology 33 , 155166. 14. Duthie, E. S., and Lorenz, L. L. (1952) Staphylococcal coagulase; mode of action and antigenicity, J Gen Microbiol 6, 95107. 15. Christianson, S., Golding, G. R., Campbell, J., and Mulvey, M. R. (2007) Comparative genomics of Canadian epidemic lineages of methicillinresistant Staphylococcus aureus, J Clin Microbiol 45 , 19041911. 16. Lee, C. Y., Buranen, S. L., and Ye, Z. H. (1991) Construction of singlecopy integration vectors for Staphylococcus aureus, Gene 103 , 101105.

40

17. D'Elia, M. A., Millar, K. E., Bhavsar, A. P., Tomljenovic, A. M., Hutter, B., Schaab, C., MorenoHagelsieb, G., and Brown, E. D. (2009) Probing teichoic acid genetics with bioactive molecules reveals new interactions among diverse processes in bacterial cell wall biogenesis, Chem Biol 16 , 548556. 18. Badurina, D. S., ZolliJuran, M., and Brown, E. D. (2003) CTP:glycerol 3phosphate cytidylyltransferase (TarD) from Staphylococcus aureus catalyzes the cytidylyl transfer via an ordered BiBi reaction mechanism with micromolar K(m) values, Biochim Biophys Acta 1646 , 196206.

41