DOCSLIB.ORG

SNP-Based Method for the Genetic Identification of Ramin Gonystylus Spp. Timber and Products: Applied Research Meeting CITES Enforcement Needs

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
SNP-Based Method for the Genetic Identification of Ramin Gonystylus Spp. Timber and Products: Applied Research Meeting CITES Enforcement Needs Vol. 9: 255–261 ENDANGERED SPECIES RESEARCH Published online November 6, 2008 doi: 10.3354/esr00141 Endang Species Res Contribution to the Theme Section ‘Forensic methods in conservation research’ OPENPEN ACCESSCCESS SNP-based method for the genetic identification of ramin Gonystylus spp. timber and products: applied research meeting CITES enforcement needs Rob Ogden1, 5,*, H. Noel McGough2, Robyn S. Cowan2, Lilian Chua3, Madeleine Groves2, Ross McEwing4, 5 1Wildlife DNA Services, Tepnel, Appleton Parkway, Livingston EH54 7EZ, UK 2Royal Botanic Gardens, Kew, Richmond, Surrey TW9 3AB, UK 3Forest Research Institute Malaysia (FRIM), 52109 Kepong, Selangor, Malaysia 4TRACE Wildlife Forensics Network, Science Campus, Deiniol Rd, Bangor LL57 2UW, UK 5School of Biological Sciences, Bangor University, Deiniol Road, Bangor LL57 2UW, UK ABSTRACT: We describe the development of a genetic assay for the identification of the tropical hardwood ramin Gonystylus spp., a CITES-listed genus subject to illegal international trade. Sam- ples representing different ramin species, confamilial genera and morphologically similar taxa were obtained. DNA extraction from leaf material and wood products was achieved using com- mercially available kits. Five chloroplast genes were examined for Single Nucleotide Polymor- phism (SNP) loci capable of discriminating ramin. A locus within the matK gene was selected and a TaqMan® assay designed for sample genotyping. The assay was validated against different spe- cies to demonstrate its specificity and reproducibility. The final assay provides a robust, cost-effec- tive, transferable method for identifying processed ramin. The research represents a feasibility study, addressing each of the steps required to develop a genetic identification assay for enforce- ment use; however, it should be noted that further work is required to produce a fully validated forensic identification tool. KEY WORDS: Illegal trade · Logging · Forensics · Endangered species · Species identification Resale or republication not permitted without written consent of the publisher INTRODUCTION Trade in Endangered Species (CITES) enforcement issues, including illegal fishing (Magnussen et al. The illegal international trade in flora and fauna 2007), the ivory trade (Wasser et al. 2004) and trade in leads to loss of habitat and biodiversity on a global traditional Asian medicines (Linacre et al. 2003). scale, as well as sustaining organised crime. Despite Applications to timber identification have long been increasing efforts to implement trade regulations, fun- recognised but until recently such approaches have damental issues such as the species identification of been restricted by technical limitations. Advances in traded products continue to hamper law enforcement. DNA recovery (Deguilloux et al. 2002, Asif & Cannon In cases where external anatomical characteristics 2005), coupled with the increase in availability of have been lost, forensic DNA techniques are now genomic sequence data through initiatives such as the being used to identify items being smuggled or sold Barcoding of Life (Chase et al. 2007, Hollingsworth illegally. Genetic identification of species has been 2008), have now paved the way for the development of applied to a number of Convention on International forensic genetic timber-identification methods. *Email: [email protected] © Inter-Research 2008 · www.int-res.com 256 Endang Species Res 9: 255–261 The current method for the identification of traded more than US $100 million yr–1. A proposal submitted timber and processed wood products is anatomical by Indonesia to list the genus Gonystylus on Appen- analysis. Identification of single samples can be perfor- dix 2 of CITES was adopted by consensus at the 13th med quickly and reliably by expert wood anatomists, meeting of the CITES Conference of the Parties in and the technique is routinely employed at specialist Bangkok, Thailand in October 2004 (Gray 2005). The research institutes in several countries, including the generic listing was proposed to allow adequate identi- UK, the USA and Germany. The recent development of fication using traditional wood anatomy techniques. a computer-based anatomical key (Richter et al. 2008) All parts and derivatives of ramin wood were subject to has also improved the potential for initial identification CITES regulation to match the international market. of many traded timber species by enforcement offi- The European Union (EU) is a major importer of cials. Despite these resources, identification of certain ramin, as is the USA. Within the EU, Italy imports the species remains problematic; with a growing need to largest portion of ramin; other major importers include routinely screen large numbers of samples, a comple- the UK, the Netherlands, Germany, Belgium, and mentary technique is required. The development of a Spain (Affre et al. 2004). Due to its high market value, DNA-based technique, employed as a standard labo- ramin is subject to illegal trade into and within the EU, ratory tool, capable of high throughput analysis and of often in the form of finished products (Fig. 1) that are delivering categorical identification for forensic appli- difficult or too numerous to identify anatomically. The cation would enhance the ability of both commercial EU also re-exports ramin products, such as dowels, and government authorities to regulate the trade. picture frames and paint brushes. The trade is domi- Where necessary, such techniques would also support nated and hence characterised by the movement of the enforcement of national and international legisla- large numbers of finished products. It was the first tion, allowing exporting and importing countries to trade of this type to be subject to CITES control (Affre identify and prosecute illegal movements, greatly et al. 2004). increasing our chances of ensuring a sustainable trade We present here the research and development un- in timber. dertaken to produce a validated method for the foren- Ramin Gonystylus spp. is a light tropical hardwood sic genetic identification of ramin Gonystylus spp. tree of swamp forests with a centre of diversity in the timber and wood products for use by enforcement island of Borneo (Tawan 2004). The distribution in- agencies (customs/border inspection), and traders of cludes Brunei Darussalam, Fiji, India (Nicobar Islands), timber and wood products. The project was designed Indonesia (Kalimantan and Sumatra), Malaysia (Penin- as a pilot study to provide proof of concept for the de- sular Malaysia, Sabah, Sarawak), Papua New Guinea, velopment of an applied assay. It therefore had a lim- the Philippines and the Solomon Islands (T. M. A. Ut- ited scope, targeting a single genus, but including all teridge pers. comm.). The Gonystylus genus includes stages in the production of an assay, from sample col- about 30 species (Tawan 2004), although a full taxo- lection and DNA extraction through to marker selec- nomic review to confirm the exact status of described tion, assay design and validation. Importantly, the re- species is currently required (T. M. A. Utteridge pers. search was driven by the needs of the end user, in this comm.). Of these species some 10 taxa are reported to case, Her Majesty’s (HM) Revenue and Customs (UK). have uses as timber or medicine (some taxa produce This approach led to criteria governing the assay being Agar) (CITES 2002). A number of species have been specified from the outset, including considerations of reported in international trade, with G. bancanus sup- assay transferability, per-sample cost, sample capacity, plying, by far, the greater part of the market. Lim et al. speed of assay and robustness of the technique to pro- (2004) estimated the annual trade in ramin to be worth vide reliable evidence for legal prosecution. Fig. 1. Examples of previously identified processed ramin timber products: (a) window blind toggle; (b) garden trowel handle; (c) panel of window blind Ogden et al.: Ramin DNA identification 257 MATERIALS AND METHODS length required for the final DNA test) from the same gene using specifically designed primers based on Sample collection. Ramin: Authenticated samples ramin DNA sequences. The primer sequences are were obtained for 7 species of ramin including all of as follows: Large Fragment Forward Primer (LFFP), those commonly traded. Leaf tissue was obtained from CCTATCCATCTGGAAATCTTAG (matk2.1); LF re- the Forest Research Institute of Malaysia under CITES verse P, GTTCTAGCACAAGAAAGTCG (matk5); licence. Wood samples were provided from the collec- Small FFP (SFFP), CGTGTGGTCTCAATCAGGAA tion at Royal Botanical Gardens (RBG) Kew. In addi- (matk415f); SFRP, CGATGCGTTACAAAAATTCG tion, a number of samples of processed wood products (matk637r). PCR reaction conditions were: 20 µl reac- were donated by HM Revenue and Customs CITES tion containing 0.25 units ABgene Thermo-Start DNA team. These had been stored following seizure and Polymerase, 1× Thermo-Start® reaction buffer, 2.5 mM had been identified anatomically by wood anatomists MgCl2, 0.2 mM each dNTP, 20 pmol primer and 2.0 µl at RBG Kew as originating from ramin species. of template DNA. PCR was performed on a PTC-200 Genetically similar taxa: The genus Gonystylus, MJ Research thermocycler under the following para- belongs to the family Thymeleaceae, subfamily Gony- meters: 95°C for 15 min; 40 cycles of 94°C for 60 s, 48°C styloideae, which also includes the genera Solmsia, for 60 s, 72°C for 60 s; followed by 72°C for 5 min. Arnhemia and
Load more

Recommended publications
  • CITES Appendix II
    PC20 Inf. 7 Annex 9 INTRODUCTION TO CITES AND AGARWOOD OVERVIEW Asian Regional Workshop on Agarwood; 22-24 November 2011 By Milena Sosa Schmidt, CITES Secretariat: [email protected] A bit of history Several genera from the family Thymeleaceae are agarwood producing taxa. These are: Aquilaria, Enkleia, Aetoxylon, Gonystylus, Wikstroemia, Gyrinops. They produce different qualities of agarwood from which Aquilaria seems to be the best (see Indonesia report of 2003). From these six genera we have currently three listed on CITES Appendix II. The history of these listings is as follows: THYMELAEACEAE (AQUILARIACEAE) (E) Agarwood, ramin; (S) Madera de Agar, ramin; (F) Bois d'Agar, ramin Aquilaria spp. II 12/01/05 #1CoP13 II/r AE 12/01/05 Excludes Aquilaria malaccensis. Excluye Aquilaria malaccensis. Exclus Aquilaria malaccensis. II/r KW 12/01/05 Excludes Aquilaria malaccensis. Excluye Aquilaria malaccensis. Exclus Aquilaria malaccensis. II/r QA 12/01/05 Excludes Aquilaria malaccensis. Excluye Aquilaria malaccensis. Exclus Aquilaria malaccensis. II/r SY 12/01/05 Excludes Aquilaria malaccensis. Excluye Aquilaria malaccensis. Exclus Aquilaria malaccensis. II 13/09/07 #1CoP14 II 23/06/10 #4CoP15 Aquilaria malaccensis II 16/02/95 #1CoP9 II 12/01/05 Included in Aquilaria spp. Incluida en Aquilaria spp. Inclus dans Aquilaria spp. Gonystylus spp. III ID 06/08/01 #1CoP11 III/r MY 17/08/01 II 12/01/05 #1CoP13 II/r MY 12/01/05 II/w MY 07/06/05 II 13/09/07 #1CoP14 II 23/06/10 #4CoP15 Gyrinops spp. II 12/01/05 #1CoP13 II/r AE 12/01/05 II/r KW 12/01/05 II/r QA 12/01/05 II/r SY 12/01/05 II 13/09/07 #1CoP14 II 23/06/10 #4CoP15 The current annotation for these taxa is #4 and reads: All parts and derivatives, except: 1 PC20 Inf.
    [Show full text]
  • Flexible Mating System in a Logged Population of Swietenia Macrophylla King (Meliaceae): Implications for the Management of a Threatened Neotropical Tree Species
    Plant Ecol (2007) 192:169–179 DOI 10.1007/s11258-007-9322-9 ORIGINAL PAPER Flexible mating system in a logged population of Swietenia macrophylla King (Meliaceae): implications for the management of a threatened neotropical tree species Maristerra R. Lemes Æ Dario Grattapaglia Æ James Grogan Æ John Proctor Æ Roge´rio Gribel Received: 21 February 2007 / Accepted: 22 May 2007 / Published online: 19 June 2007 Ó Springer Science+Business Media B.V. 2007 Abstract Microsatellites were used to evaluate the crossed matings and that the remaining 6.75% had mating system of the remaining trees in a logged genotypes consistent with self-fertilisation. Apomixis population of Swietenia macrophylla, a highly valu- could be ruled out, since none of the 400 seedlings able and threatened hardwood species, in the Brazil- analysed had a multi-locus genotype identical to ian Amazon. A total of 25 open pollinated progeny its mother tree. The high estimate of the multi-locus arrays of 16 individuals, with their mother trees, were outcrossing rate (tm = 0.938 ± 0.009) using the mixed genotyped using eight highly polymorphic microsat- mating model also indicated that the population in ellite loci. Genotypic data analysis from the progeny this remnant stand of S. macrophylla was predomi- arrays showed that 373 out of the 400 seedlings nantly allogamous. The relatively large difference (93.25%) were unambiguously the result of out- between the multi-locus and single-locus outcrossing estimates (tmÀts = 0.117 ± 0.011) provides evidence that, in spite of the high outcrossing rate, a consid- & M. R. Lemes ( ) Á R.
    [Show full text]
  • Seasoning and Handling of Ramin1
    U. S. DEPARTMENT OF AGRICULTURE FOREST SERVICE FOREST PRODUCTS LABORATORY MADISON,WIS. In Cooperation with the University of Wisconsin U. S. FOREST SERVICE RESEARCH NOTE FPL- 0172 SEPTEMBER 1967 SEASONING AND HANDLING OF RAMIN1 By JOHN M. McMILLEN, Technologist Forest Products Laboratory, Forest Service U.S. Department of Agriculture Abstract One of the imported woods that is finding increasing use for specific purposes is ramin (Gonystylus spp.). It originates in the Southwest Pacific and has seasoning properties somewhat like oak. Many importers, custom dryers, and users are not aware of the special seasoning and handling requirements of this wood. As a result, some firms have experienced heavy losses. This note brings together suggestions that should greatly reduce or eliminate these losses. Ramin--Production and Properties Ramin (pronounced ray-min) is the common name used in the United States for wood from Gonystylus spp., principally G. bancanus growing in Sarawak, Malaysia. Another common name used in Malaya is melawis. The trees grow 1 Partly based on information from experienced importers, custom dryers, and users of ramin. in fresh water swamp forests and have straight, clean boles averaging 60 feet long and 2 feet in diameter near the base. Principal sources are the river valleys of Sarawak and the west coast of Malaya. In the Philippines, G. macrophyllus is common in the primary forests. An undetermined species is fairly comon in the Solomon Islands, Ramin is an attractive, high-class utility hardwood having about the same weight as sycamore or paper birch. Both the sapwood and the heartwood are white to pale straw in color.
    [Show full text]
  • Complete Index of Common Names: Supplement to Tropical Timbers of the World (AH 607)
    Complete Index of Common Names: Supplement to Tropical Timbers of the World (AH 607) by Nancy Ross Preface Since it was published in 1984, Tropical Timbers of the World has proven to be an extremely valuable reference to the properties and uses of tropical woods. It has been particularly valuable for the selection of species for specific products and as a reference for properties information that is important to effective pro- cessing and utilization of several hundred of the most commercially important tropical wood timbers. If a user of the book has only a common or trade name for a species and wishes to know its properties, the user must use the index of common names beginning on page 451. However, most tropical timbers have numerous common or trade names, depending upon the major region or local area of growth; furthermore, different species may be know by the same common name. Herein lies a minor weakness in Tropical Timbers of the World. The index generally contains only the one or two most frequently used common or trade names. If the common name known to the user is not one of those listed in the index, finding the species in the text is impossible other than by searching the book page by page. This process is too laborious to be practical because some species have 20 or more common names. This supplement provides a complete index of common or trade names. This index will prevent a user from erroneously concluding that the book does not contain a specific species because the common name known to the user does not happen to be in the existing index.
    [Show full text]
  • Congratulations About Shorea Wood Parts List & Hardware Care & Maintenance
    DINING TABLE DINING Care & Maintenance Parts List & Hardware ROUND 48 INCH 48 ROUND Care & Maintenance Parts List & Hardware RD48TA Your Oxford furniture arrives in its natural state, A (8) Washers without any oils or finishes. Upon completion of assembly, you may notice some staining from your B (8) Hexagon Nuts hands, or possibly some water stains from C (5) Bolts shipping. Shorea is extremely dense, and therefore D (5) Insert Nuts any staining will be only on the very surface of the wood, so any marks or abrasions can be easily E (1) Allen Key removed by liberally sanding the wood with 100 F (4) Wood Screws grit, or medium, sandpaper. G (1) Table Top Shorea is strong enough and weather resistant H (4) Table Legs enough to be left totally untreated. If left alone, I (1) Top Cross Bar your furniture will weather naturally with time, J (1) Bottom Cross Bar turning a warm and soothing shade of gray. If you prefer to prevent this natural weathering, or to enhance the luster and color of the wood, you may seasonally apply a coat of teak oil. If you allow your Congratulations furniture to weather, and later decide to restore it to About Shorea Wood its original condition, use a teak cleaner first, and Congratulations, and thank you, for your purchase then you may apply the teak oil. These products Shorea is a tropical hardwood that grows plentifully are available at most hardware stores and boat of a finely crafted piece of natural shorea furniture in the Pacific Rim countries of Burma, Malaysia, from Oxford Garden Designs.
    [Show full text]
  • TREE RING CHARACTERISTICS of 30-YEAR-OLD SWIETENIA MACROPHYLLA PLANTATION TREES Cheng-Jung Lin* Chih-Hsin Chung Chih-Lung Cho Te
    TREE RING CHARACTERISTICS OF 30-YEAR-OLD SWIETENIA MACROPHYLLA PLANTATION TREES Cheng-Jung Lin* Associate Researcher Department of Forest Utilization Taiwan Forestry Research Institute Taipei, Taiwan E-mail: [email protected] Chih-Hsin Chung Assistant Researcher Department of Forest Management Taiwan Forestry Research Institute Taipei, Taiwan E-mail: [email protected] Chih-Lung Cho Professor Department of Natural Resources National I-Lan University Ilan, Taiwan E-mail: [email protected] Te-Hsin Yang Assistant Professor Department of Forestry College of Nature Resource and Agriculture National Chung Hsing University Taichung, Taiwan E-mail: [email protected] (Received October 2011) Abstract. Ring characteristics of mahogany (Swietenia macrophylla K.) plantation trees grown in Taiwan were explored. Significant differences in average ring width (RW) and ring density (RD) occurred among three tree-diameter classes and three radial stages of ring numbers. RW in the radial direction decreased from the pith outward to the bark and followed a distinctive three-stage variation pattern (juvenile, transition, and mature zones). RD in the radial direction increased slowly from the pith outward to the bark. Wider tree rings and lower density are associated with juvenile wood close to the pith, whereas narrower tree rings and higher density are typical for mature wood outward toward the bark. RD in overtopped trees was higher than that in dominant trees. However, RW in dominant trees was wider than that in intermediate and overtopped trees. Earlywood density, latewood density, maximum density, and minimum density were the most important factors determining overall RD. There was a weak relationship between RW and RD, indicating that it is unlikely for growth rates of mahogany plantation trees to have a significant impact on wood density.
    [Show full text]
  • English and French Cop17 Inf
    Original language: English and French CoP17 Inf. 77 (English and French only / Únicamente en inglés y francés / Seulement en anglais et français) CONVENTION ON INTERNATIONAL TRADE IN ENDANGERED SPECIES OF WILD FAUNA AND FLORA ____________________ Seventeenth meeting of the Conference of the Parties Johannesburg (South Africa), 24 September – 5 October 2016 CONSERVATION, TIMBER IDENTIFICATION AND SUSTAINABLE MANAGEMENT OF CENTRAL AFRICAN BUBINGA (KEVAZINGO) SPECIES This document has been submitted by Gabon* and the European Union* in relation to proposal No. 56, Inclusion of Guibourtia tessmannii, Guibourtia pellegriniana and Guibourtia demeusei in Appendix II. * The geographical designations employed in this document do not imply the expression of any opinion whatsoever on the part of the CITES Secretariat (or the United Nations Environment Programme) concerning the legal status of any country, territory, or area, or concerning the delimitation of its frontiers or boundaries. The responsibility for the contents of the document rests exclusively with its author. CoP17 Inf. 77 – p. 1 Conservation, Timber Identification and Sustainable Management of Central African Bubinga (Kevazingo) species This information document has been produced in response to concerns over threats to the conservation of Bubinga in its range States. Recent increases in value and demand of Guibourtia tessmannii and Guibourtia pellegriniana wood has increased pressure on populations and encouraged the development of unmanaged and illegal logging networks. This, together with typically low natural population densities for both species throughout their ranges, constitutes a clear threat to both species’ conservation and their sustainable use. This Inf. doc for Bubinga complements the CITES Appendix II listing proposal for Bubinga (CoP17 Prop.
    [Show full text]
  • Population Genetic Structure of Mahogany (Swietenia Macrophylla
    Molecular Ecology (2003) 12,2875-2883 doi: 10.1046/j.l365-294X.2003.01950.x Population genetic structure of mahogany (Swietenia macrophylla King, Meliaceae) across the Brazilian Amazon, based on variation at microsatellite loci: implications for conservation MARISTERRA R. LEMES,*t ROGERIO GRIBEL,*JOHN PROCTORt and DARIO GRATTAPAGLIAJ§ *Laboratorio de Genetica e Biologia Reprodutiva de Plantas, Institute) National de Pesquisas da Amazonia, C.P. 478, 69011-970 Manaus-AM, Brazil, ^Department of Biological Sciences, University of Stirling, Stirling FK9 4LA, UK, \haboraiorio de Genetica de Plantas, EMBRAPA-Recursos Geneticos e Biotecnologia, C.P. 02372, 70770-900 Brastlia-DF, Brazil, %Laboratorio de Biotecnologia Genomica, Pos-Graduaqao em Ciencias Genomicas, Universidade Catolica de Brasilia, SGAN 916 Mod. B, Asa Norte, 70790-160, Brasilia-DF, Brazil Abstract Mahogany (Swietenia macrophylla, Meliaceae) is the most valuable and intensively exploited Neotropical tree. No information is available regarding the genetic structure of mahogany in South America, yet the region harbours most of the unlogged populations of this prized hardwood. Here we report on the genetic diversity within and the differentiation among seven natural populations separated by up to 2100 km along the southern arc of the Brazilian Amazon basin. We analysed the variation at eight microsatellite loci for 194 adult individuals. All loci were highly variable, with the number of alleles per locus ranging from 13 to 27 (mean = 18.4). High levels of genetic diversity were found for all populations at the eight loci (mean ffE = 0.781, range 0.754-0.812). We found moderate but statistically significant genetic differentiation among populations considering both estimators of FST and RST, 9 = 0.097 and p = 0.147, respectively.
    [Show full text]
  • Conf. 14.4 Cooperation Between CITES and ITTO Regarding Trade in Tropical Timber
    Conf. 14.4 Cooperation between CITES and ITTO regarding trade in tropical timber RECOGNIZING that CITES aims to ensure the protection of certain species of wild fauna and flora against over-exploitation through international trade; ALSO RECOGNIZING that CITES can play a positive role in promoting the conservation of timber species through trade in accordance with the requirements of Articles III, IV and V of the Convention; FURTHER RECOGNIZING that the objectives of the International Tropical Timber Agreement (ITTA), 1994, include providing an effective forum for consultation, international cooperation and policy development with regard to all relevant aspects of the world timber economy and promoting trade in tropical timber from sustainable sources; NOTING the important role that the International Tropical Timber Organization (ITTO) has played and continues to play with respect to international trade in tropical timber species; WELCOMING the increase in cooperation between CITES and ITTO and especially the support provided by ITTO for meetings of the Bigleaf Mahogany (Swietenia macrophylla) Working Group, the International Experts Workshop on Non-detriment Findings for Bigleaf Mahogany, the Expert Meeting on the Effective Implementation of the Uplisting of Ramin (Gonystylus spp.) to Appendix II of CITES, as well as the assistance provided by ITTO to its members to enhance their capacity to implement CITES listings of tropical timber species; WELCOMING the ITTO project to support capacity building in range States for the implementation
    [Show full text]
  • Mechanical Properties of Wood
    Mechanical Properties of Wood Course No: S04-004 Credit: 4 PDH Gilbert Gedeon, P.E. Continuing Education and Development, Inc. 9 Greyridge Farm Court Stony Point, NY 10980 P: (877) 322-5800 F: (877) 322-4774 [email protected] Abstract Summarizes information on wood as an engineering material. Presents properties of wood and wood-based products of particular concern to the architect and engineer. Includes discussion of designing with wood and wood-based products along with some pertinent uses. Keywords: wood structure, physical properties (wood), mechanical properties (wood), lumber, wood-based composites, plywood, panel products, design, fastenings, wood moisture, drying, gluing, fire resistance, finishing, decay, sandwich construction, preservation, and wood- based products On the cover: (Left to right, top to bottom) 1. Research at the Forest Products Laboratory, Madison, Wisconsin, contributes to maximizing benefits of the Nation’s timber resource. 2. Testing the behavior of wood in fire helps enhance fire safety. 3. The all-wood, 162-m (530-ft ) clear-span Tacoma Dome exemplifies the structural and esthetic potential of wood construction (photo courtesy of Western Wood Structures, Inc., Tualatin, Oregon). 4. Bending tests are commonly used to determine the engineering properties of wood. 5. Engineered wood trusses exemplify research that has led to more efficient use of wood. 6. The Teal River stress-laminated deck bridge is March 1999 located in Sawyer County, Wisconsin. 7. Kiln drying of wood is an important procedure Forest Products Laboratory. 1999. Wood handbook—Wood as an during lumber manufacturing. engineering material. Gen. Tech. Rep. FPL–GTR–113. Madison, WI: 8. Legging adhesive (photo courtesy of Air Products U.S.
    [Show full text]
  • 118 PUBLIC LAW 89-392-APRIL 14, 1966 "(9) the Number of Such New
    118 PUBLIC LAW 89-392-APRIL 14, 1966 [80 STAT. "(9) the number of such new teachers obtained through volun­ tary reciprocal interchange agreements with school jurisdictions in the United States." Effective date. SEC. 2. The amendments made by the first section of this Act shall become effective on the first day of the first pay period which begins after the date of enactment of this Act. Approved April 14, 1966. Public Law 89-392 April 14, 1966 AN ACT [H. R. 7723] To amend the Tariff Schedules of the United States to suspend the duty on certain tropical hardwoods. Be it enacted hy the Senate and House of Rejyresentatlves of the Tropical hard woods United States of America in Congress assembled^ That subpart B of Duty suspension, part 1 of the appcudix to title I of the Tariff Act of 1930 (Tariff Schedules of the United States; 28 F.R., part II, Aug. 17, 1963; 77A 77A Stat. 434. Stat.; 19 U.S.C., sec. 1202) is amended by adding at the end thereof the following new items: 916.20 Hardwood lumber, rough, dressed, or On or before worked, provided for in item 202,36 Free $3 per 1,000 ft., 12/31/67 board meas­ ure 916. 21 Hardwood lumber, rough, dressed, or On or before worked, provided for in item 202.39 Free $3.10 per 1,000 12/31/67 ft., board measure 916.22 Hardwood lumber, rough, dressed, or On or before worked, provided for in item 202.41, 12/31/67 except Boxwood (Buxus spp.), Japanese maple (Acer spp.), and On or before Japanese white oak (Quercus spp.).., Free 15% ad val.
    [Show full text]
  • Chemometric Differentiation of Dipterocarpaceae Wood Species Based on Colorimetric Measurements
    Philippine Journal of Science 148 (3): 473-480, September 2019 ISSN 0031 - 7683 Date Received: 22 Feb 2019 Chemometric Differentiation of Dipterocarpaceae Wood Species Based on Colorimetric Measurements Monica Gibe1, Justine M. Kalaw2, Willie P. Abasolo1, and Fortunato Sevilla III2,3* 1College of Forestry and Natural Resources University of the Philippines Los Baños, Laguna 4031, Philippines 2Graduate School, University of Santo Tomas España Blvd., Manila 1015, Philippines 3Research Center for the Natural and Applied Sciences, University of Santo Tomas, España Blvd., Manila 1015, Philippines The international trade of illegal timber often involves the misdeclaration of the wood species. A simple and reliable means for the differentiation of wood species could contribute to the control of this fraud. In this study, eight (8) commercially important and endangered dipterocarp timber wood species and mahogany were differentiated through colorimetric measurements carried out on hot water and ethanol extracts from the samples. Colorimetric measurements were done using a fabricated colorimeter that measured the absorption of blue, green, and red radiation. Chemometric analysis of the colorimetric data using principal component analysis (PCA) and hierarchical cluster analysis (HCA) revealed clustering, which enabled an efficient differentiation of the wood species. Keywords: Dipterocarps, optical absorption, pattern recognition, wood extractives, wood species differentiation INTRODUCTION Several techniques have been applied for the determination of wood identity. Presently, the most frequently used The development of rapid and accurate methods for the method for timber identification is the visual analysis differentiation of wood species presents a challenge. A of the wood’s anatomical features. This technique is need has been expressed for methodologies that can be capable of identification to the genus level only, but applied for the definitive identification of illegally cut often information on the species level is needed (Gasson logs (Dormontt et al.
    [Show full text]