DOCSLIB.ORG
Explore
Sign Up
Log In
Upload
Search
Home
» Tags
» Phospholipid scramblase
Phospholipid scramblase
Constitutive Phospholipid Scramblase Activity of a G Protein-Coupled Receptor
Phospholipid Ebb and Flow Makes Mitochondria Go
Phosphatidylserine in Non-Apoptotic Cell Death Inbar Shlomovitz1, Mary Speir2,3 and Motti Gerlic1*
Download
Phosphatidylserine, a Death Knell
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Transcriptomic and Proteomic Profiling Provides Insight Into
GHSR-D2R Heteromerization Modulates Dopamine Signaling Through an Effect on G Protein Conformation
Two Phospholipid Scramblase 1–Related Proteins (Plscr1like-A
Table S4. Trophoblast Differentiation-Associated Genes
Role and Regulation of Snon/Skil and PLSCR1 Located at 3Q26.2
Supp Table 6.Pdf
The Role of Phosphatidylserine in Recognition of Apoptotic Cells by Phagocytes
Genome-Wide Gene Expression Profiles of Ovarian Carcinoma: Identification of Molecular Targets for the Treatment of Ovarian Carcinoma
Drosophila Melanogaster Scramblases Modulate Synaptic Transmission
ALG-2-Interacting Tubby-Like Protein Superfamily Member PLSCR3 Is Secreted by an Exosomal Pathway and Taken up by Recipient Cultured Cells
Induction of Therapeutic Tissue Tolerance Foxp3 Expression Is
Title Phospholipid Scrambling on the Plasma Membrane. Author(S)
Top View
Calcium Ions Trigger PS Exposure on Necrotic Cells
The Ins and Outs of Phospholipid Asymmetry in the Plasma Membrane: Roles in Health and Disease
Phospholipid Scramblase-1-Induced Lipid Reorganization Regulates Compensatory Endocytosis in Neuroendocrine Cells
Axonal Degeneration in Retinal Ganglion Cells Is Associated with a Membrane Polarity-Sensitive Redox Process
Supplementary Table S2. List of Genes with Expression That Is Positively Correlated (Pearson Correlation Coefficient P>0.3)
Phospholipid Scramblase: an Update
Supplemental Data
Dimerization Deficiency of Enigmatic Retinitis Pigmentosa-Linked
(5' to 3') TLR4 F: AACAGTGGGTACAGGATGCAATT R
Supplemental Table 1. 4062 Tumor Mutation Profile
Single-Molecule Analysis of Phospholipid Scrambling by TMEM16F
Phospholipid Scramblase 1 Mediates Hepatitis C Virus Entry Into Host Cells
Recent Advances in the Label-Free Characterization of Exosomes for Cancer Liquid Biopsy: from Scattering and Spectroscopy to Nanoindentation and Nanodevices
Supplementary Table 1 - Transcriptomics Analysis
Supplementary Appendix
List of 1124 Genes Whose Binding to Eif4e Was Induced by Radiation
Biophysj92353 1..12
A Mechanism of Release of Calreticulin from Cells During Apoptosis
Phospholipid Scramblase 3 Controls Mitochondrial Structure, Function, and Apoptotic Response
Palmitoylated Calnexin Is a Key Component of the Ribosome-Translocon Complex
Supplementary Table 1
Exposure of Phosphatidylserine on the Cell Surface
Identifying Common Therapeutic Targets in Merlin- Deficient Brain Tumours
Titanium Dioxide Nanoparticles Enhance Thrombosis Through
Relevance to Alzheimer Disease
Perspectives on Mitochondria–ER and Mitochondria–Lipid Droplet Contact in Hepatocytes and Hepatic Lipid Metabolism
Membrane Lipids: Where They Are and How They Behave
and -Secretases and Lipid Rafts
Dysregulated Calcium Homeostasis Prevents Plasma Membrane Repair
Lineage-Specific Programming Target Genes Defines Potential for Th1
Responsive Nuclear Proteins in Collecting Duct Cells
Focus on Antivirals REVIEWS