Phospholipid Scramblase 1 Mediates Hepatitis C Virus Entry Into Host Cells

View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector

FEBS Letters 585 (2011) 2647–2652

journal homepage: www.FEBSLetters.org

Phospholipid scramblase 1 mediates hepatitis C virus entry into host cells

Qiaoling Gong a,b,c, Min Cheng c, Hui Chen b, Xiuying Liu c, Youhui Si c, Yang Yang c, Yanzhi Yuan b, ⇑ ⇑ ⇑ Chaozhi Jin b, Wei Yang c, , Fuchu He b,d, , Jian Wang b,

a Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100005, China b State Key Laboratory of Proteomics, Beijing Proteome Research Center, Beijing Institute of Radiation Medicine, Beijing 102206, China c State Key Laboratory for Molecular Virology and Genetic Engineering, Institute of Pathogen Biology, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100176, China d Institutes of Biomedical Sciences, Fudan University, Shanghai 200032, China

article info abstract

Article history: Hepatitis C virus (HCV) infects human hepatocytes through several host factors. However, other pre- Received 22 April 2011 requisite factors for viral entry remain to be identified. Using a yeast two-hybrid screen, we found Revised 6 July 2011 that human phospholipid scramblase 1 interacts with HCV envelope proteins E1 and E2. These phys- Accepted 13 July 2011 ical interactions were confirmed by co-immunoprecipitation and GST pull-down assays. Knocking Available online 28 July 2011 down the expression of PLSCR1 inhibited the entry of HCV pseudoparticles. Moreover, PLSCR1 was Edited by Hans-Dieter Klenk required for the initial attachment of HCV onto hepatoma cells, where it specifically interacted with entry factor OCLN. We show that PLSCR1 is a novel attachment factor for HCV entry.

Keywords: Phospholipid scramblase 1 Structured summary of protein interactions: Hepatitis C virus OCLN physically interacts with PLSCR1 by anti tag coimmunoprecipitation (View interaction) Entry E2 physically interacts with PLSCR1 by anti tag coimmunoprecipitation (View interaction) PLSCR1 physically interacts with E2 by anti tag coimmunoprecipitation (View interaction) PLSCR1 physically interacts with OCLN by anti tag coimmunoprecipitation (View interaction) PLSCR1 physically interacts with E2 by pull down (View interaction) E1 physically interacts with PLSCR1 by two hybrid (View interaction) E2 physically interacts with PLSCR1 by two hybrid (View interaction) PLSCR1 physically interacts with E1 by anti tag coimmunoprecipitation (View interaction) E2 physically interacts with PLSCR1 by pull down (View interaction) E1 physically interacts with PLSCR1 by pull down (View interaction)

1. Introduction Previous studies identified a number of entry factors, including CD81 [3], scavenger receptor class B type I (SR-BI) [4], claudin-1 Hepatitis C virus (HCV) causes acute and chronic hepatitis, (CLDN1) [5], occludin (OCLN) [6,7], L-SIGN [8] and DC-SIGN [9]. which is often associated with an increased risk of developing CD81 acts at a stage after virus binding [3]. The identification of chronic liver disease and hepatocellular carcinoma [1]. The eluci- SR-BI as a HCV entry factor was reported with HCV pseudoparticles dation of HCV entry factors and entry mechanisms will help the (HCVpp) and confirmed with HCV cell culture (HCVcc) [10]. CLDN1 development of small animal models and antiviral therapeutics; spans the plasma membrane four times and is a component of the however, the knowledge of HCV entry into host remains limited. tight junction (TJ) barrier that restricts the free exchange of ions HCV glycoproteins E1 and E2 assemble as a non-covalent com- and aqueous molecules between cells [11]. During HCV entry, plex, which is presented on the surface of HCV particles. E1 and E2 CLDN1 plays a role at the post-binding stage and is required for are the major viral proteins that bind to host entry factors [2]. HCV envelope glycoprotein-mediated fusion [5]. Recently, OCLN was identified as an HCV entry factor [6]. It has been showed that the down-regulation of CLDN1 and OCLN results in a reduction of ⇑ Corresponding authors. Address: State Key Laboratory of Proteomics, Beijing HCV glycoprotein-dependent cell-to-cell fusion, which implicates Proteome Research Center, Beijing Institute of Radiation Medicine, 33 Life Science their role in the fusion process [7]. DC-SIGN and L-SIGN could func- Park Road, Beijing 102206, China (F. He). Fax: +86 10 67872436 (W. Yang), +86 10 tion as capture factors for HCV and transmit infectious virions to 80705155 (F. He), +86 10 80705155 (J. Wang). neighboring hepatocytes [12]. Additionally, the tight junction pro- E-mail addresses: [email protected] (W. Yang), [email protected] (F. He), [email protected] (J. Wang). teins CLDN6 and CLDN9 were reported to have a role during HCV

0014-5793/$36.00 Ó 2011 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2011.07.019 2648 Q. Gong et al. / FEBS Letters 585 (2011) 2647–2652 entry [13]. These results suggest that HCV entry involves multiple 2.4. RNA interference host factors. To explore novel interactions between host proteins and the To knock down the expression of PLSCR1 in Huh7.5.1 cells, a HCV envelope proteins E1 and E2, a yeast two-hybrid screen pQSuper-R lentiviral shRNA system was employed. The target se- was performed. PLSCR1, a calcium-dependent plasma membrane quences of shRNA were as follows: PLSCR1 (50-GATCCC protein, was identified to interact with both E1 and E2. PLSCR1 CAGTCTCCTCAGGAAATCTGTTCAAGAGACAGATTTCCTGAGGAGACT participates in the transbilayer movement of phospholipids TTTTTC-30), and non-specific (50-GATCCCCGGACGTCCTGGATTTA across the plasma membrane [14]. The transbilayer movement GTGTTCAAGAGACACTAAATCCAGGACGTCCTTTTTC-30). Stable cell usually happens after cellular injury or apoptosis [15]. PLSCR1 lines were selected with puromycin. The positive clone with the is a receptor for the secretory leukocyte protease inhibitor and lowest level PLSCR1 was used in the following experiments. interacts with CD4 at the plasma membrane [16]. Particularly, PLSCR1 binds to EGF and involves in EGF-induced clathrin-coated 2.5. HCVcc production and infection assay endocytosis [17]. As we know, HCV entry depends on clathrin- mediated endocytosis [18]. We speculate that PLSCR1 involves The production of cell culture-generated HCV (HCVcc, JFH-1 in HCV entry. Our results demonstrate that PLSCR1 interacts with strain, a generous gift from Dr. Wakita, The University of Tokyo, Ja- HCV envelope proteins and participates in cellular entry during pan) was performed as described [20]. For infection, HCVcc HCV infection. (MOI = 1.0) was inoculated into the cells, and the infected cells were grown for 72 h before qRT-PCR analysis. 2. Materials and methods 2.6. HCVcc attachment assay 2.1. Co-immunoprecipitation assay Stable knock-down Huh7.5.1 cells were grown on 24-well 4 HEK293T cells were transfected with Flag-PLSCR1 and CMV- plates (2 10 ). On the next day, the target cells were washed with E1E2, Flag-E2 and Myc-PLSCR1, Flag or Myc empty vector as cold culture medium once, then were incubated with HCVcc control. Cells were harvested 48 h later and lysed in HEPES lysis (MOI = 0.1) and HEPES (20 mM) at 4 °C. As a positive control, hep- buffer [0.2% NP-40, 150 mM NaCl, 1% (v/v) Tween 20, 50 mM arin (The final concentration is 250 lg/ml) was added. Cells were Tris–HCl (pH 7.5), 10% glycerol, 0.1% 1 M DTT and protease inhib- washed three times with cold PBS and prepared for qRT-PCR. itor cocktail]. Immunoprecipitations were performed using anti- Flag or anti-Myc antibodies and protein A/G-agarose at 4 °C. 2.7. In-cell Western assay Beads were washed with HEPES lysis buffer and proteins were eluted. Lysates and immunoprecipitates were detected using the Stable knock-down cell lines of Huh-7.5.1 were inoculated into indicated primary antibodies, followed by detection with ECL 96-well plates. On the next day, target cells were infected with substrate. HCVcc. After 72 h of infection, cells were washed and fixed with 3% formaldehyde at room temperature. Then, cells were washed 2.2. GST pull-down assay three times with PBS containing 0.1% Triton X-100, and the primary antibody for HCV core protein was added and incubated The soluble E2 (sE2) construct was a gift from Dr. Tianyi Wang overnight at 4 °C. The plates were washed. The red fluorescent la- (The University of Pittsburg, USA). The recombinant protein was beled secondary antibody was added to each well and incubated secreted by HEK293T cells. Other GST-fused proteins (GST-E1, for 60 minutes with gentle shaking. The plates were washed with GST-E2 and GST-PLSCR1) were expressed in Escherichia coli BL21 PBS and scanned immediately using the Odyssey Infrared Imaging by induction with IPTG. The cells were harvested and sonicated System. The virus foci formation data was quantified according to in pre-TGEM buffer (1% NP-40, 3% 5 M NaCl, 0.1% 1 M DTT and pro- the Odyssey Infrared Imaging System handbook. tease inhibitor cocktail). The GST-fused proteins were purified with glutathione-sepharose 4B (Amersham Pharmacia Biotech, Piscata- 2.8. Real-time PCR way, NJ) beads. Beads were washed with pre-TGEM buffer and proteins were eluted. Divided aliquots were incubated with cellular Total RNAs were extracted from HCV-infected cells, and real- TM extracts (Myc-PLSCR1, Flag-PLSCR1 or sE2). Bound proteins were time PCR was performed with the QuantiFast SYBR Green RT- analyzed by Western blotting. PCR kit (Qiagen, Foster city, CA). The level of HCV genomic RNA was quantified using a qRT-PCR method (with primers 50- 2.3. Pseudovirus production GTCTAGCCATGGCGTTAGTA-30 and 50-CTCCCGGGGCACTCGCAAGC- 30). The fold changes were shown in three independent experi- HCV pseudoparticle (HCVpp) packaging was performed as de- ments, each performed in triplicate. scribed [19]. The plasmids OH8 was from Dr. Linqi Zhang (Tsinghua University, China). The envelope-deficient pseudotype (Env-pp) 2.9. Supplementary materials and methods and VSV-G pseudotype were generated as controls. For lentivirus-mediated gene overexpression and RNAi, on the The other materials and methods were provided in Supplemen- day before transfection, HEK293T cells (5 105) were seeded in tary data. 6 well plate. The next day a total of 3.0 lg DNA was transfected using 6 ll Lipofectamine 2000 (Invitrogen). The following plasmid 3. Results mixtures and ratios (by weight) were transfected: (a) MLV gag-pol, (b) VSV-G and (c) the desired transgene or shRNA. The ratio of 3.1. PLSCR1 physically interacts with HCV E1 and E2 MLV Gag-Pol, VSV-G, and the desired transgene or shRNA is 5:1:5. Media was replaced after 4–6 h, supernatants containing To identify novel HCV E1 and E2 interacting proteins, we the pseudoparticles were harvested at 48 h and 72 h after screened a human liver cDNA library using the yeast two-hybrid transfection. technology. PLSCR1 was found to associate with both E1 and E2 Q. Gong et al. / FEBS Letters 585 (2011) 2647–2652 2649

Fig. 1. Validation of E1-PLSCR1 and E2-PLSCR1 interactions. (A) and (B). Confirmation of E1-PLSCR1 and E2-PLSCR1 interaction by GST pull-down. GST-E1 or GST-E2 purified on glutathione beads was used as an affinity matrix to pull down Myc tagged PLSCR1. (C) GST-PLSCR1 purified on glutathione beads was used as an affinity matrix for pull down sE2. After being washed, proteins bound to agarose beads were boiled in sample buffer, fractionated on a SDS–PAGE gel and analyzed by Western blot analysis. (D) and (E) Validation of E1-PLSCR1 and E2-PLSCR1 interactions by co-immunoprecipitation. Both E1 and E2 proteins are expressed in D. Extracts and immunoprecipitates from HEK293T cells were detected with indicated antibodies. The experiments were repeated at least three times.

Fig. 3. Knock-down of PLSCR1 inhibits HCV initial attachment to target cells. Huh- 7.5.1 cells stably expressing a control shRNA or PLSCR1-specific shRNA constructs. Total RNA was analyzed by qRT-PCR to determine HCV RNA levels. All The Fig. 2. HCVpp entry is inhibited by stable knock-down of PLSCR1 expression in experiments were independently repeated three times. For each graph data are Huh-7.5.1 cells. Huh-7.5.1 cells stably expressing a control shRNA or PLSCR1- means + S.E.M. (n = 3), P < 0.05. specific shRNA constructs were infected with Env-pp, HCVpp (OH8) and VSVpp for 1.5 h and then incubated at 37 °C for 1.5 h. The supernatants were removed and cells were added to 1 ml of fresh medium and incubated at 37 °C for 48 h. Cells were lysed for a luciferase assay according to the manufacturer’s instructions. The (Supplementary Fig. 1). To confirm the screening results, expression of PLSCR1 was silenced in Huh-7.5.1 cells were subjected to immuno- Myc-tagged PLSCR1 was expressed in HEK293T cells, and the blotting using rabbit anti-PLSCR1 and anti-beta-actin monoclonal antibodies and HRP-conjugated secondary antibodies. All The experiments were independently lysates were incubated with agarose beads immobilized by repeated three times. For each graph data are means + S.E.M. (n = 3), P < 0.05. GST-E1 and GST-E2 (Fig. 1A and B). Soluble HCV E2 (sE2) is the 2650 Q. Gong et al. / FEBS Letters 585 (2011) 2647–2652 soluble ectodomain of envelope glycoprotein E2. Thus, we tested pseudoparticles (Supplementary Fig. 3). The cell viability was mea- the interaction by pull-down assay and demonstrated an associa- sured using a CCK8 (Cell Counting Kit-8) assay, which showed that tion between GST-PLSCR1 and sE2 (Fig. 1C). Results showed that knock-down of PLSCR1 does not influence the cell viability (Sup- GST-E1 and GST-E2, but not GST alone, bound to PLSCR1, GST- plementary Fig. 4). The suppression of endogenous PLSCR1 after PLSCR1 associate with sE2. Furthermore, co-immunoprecipitation stable shRNA was confirmed by Western blot (Fig. 2, lower panel). results showed that PLSCR1 specifically immunoprecipitated with E1 by anti-Flag antibody (Fig. 1D), but no E1 was detected in con- 3.3. Knock-down of PLSCR1 inhibits HCV initial attachment to target trol lanes. The association of E2 and PLSCR1 proteins was con- cells firmed by immunoprecipitation with anti-Myc antibody. E2 only co-precipitated with PLSCR1 when co-expressed in HEK293T cells To explore whether PLSCR1 involves in the HCV initial attach- (Fig. 1E). These results indicate that PLSCR1 physically interacts ment, we carried out HCVcc attachment assay. Huh-7.5.1 cells sta- with HCV E1 and E2 in vitro. Furthermore, we suggest that the do- bly expressing a non-target control shRNA or PLSCR1-specific mains between 99 and 290 aa in PLSCR1 mediates the association shRNA constructs were washed with ice-cold culture medium once with E2 by co-immunoprecipitation assays (Supplementary Fig. 2). and then infected with HCVcc or HCVcc + heparin for 1 h at 4 °C (Heparin is a homolog of highly sulfated heparan sulfate and used 3.2. HCVpp entry is inhibited by stable knock-down of PLSCR1 as a control to reduce HCV attachment to the cell surface). Un- expression in Huh-7.5.1 cells bound viral particles were removed, and total RNA was analyzed by qRT-PCR to determine HCV RNA levels. As shown in Fig. 3, Due to the plasma membrane localization of PLSCR1 [16] and its knock-down of PLSCR1 inhibits HCV initial attachment to target ability to interact with HCV glycoproteins, the virus entry might be cells. regulated by PLSCR1. Particles pseudotyped with HCV envelope proteins were generated. The Env-pp and VSVpp were used as con- 3.4. Suppression of PLSCR1 expression inhibits HCVcc infection trols. Target cells were seeded onto 24-well plates, the supernatant containing Env-pp, HCVpp or VSVpp was added into each well and To further confirm the role of PLSCR1 during HCV infection, a transfected by a centrifuge method (2500 rpm, 90 min, 30 °C). JFH-1 derived HCVcc was employed. First, we established Then, the cells were incubated at 37 °C for 1.5 h. The supernatants Huh7.5.1 cells that were stably transfected with either a PLSCR1 were removed and the cells were incubated at 37 °C for 48 h. Cells shRNA cassette targeting PLSCR1 30-UTR or an empty vector as a were lysed for a luciferase assay. As shown in Fig. 2, compared with control. The cells were inoculated with HCVcc and quantified for control cells, HCVpp entry was significantly inhibited in PLSCR1 HCV RNA by qRT-PCR or virus foci formation by in cell Western. knock-down cells. Meanwhile, a similar inhibition was also ob- As shown in Fig. 4A and B, the knock-down of PLSCR1 significantly served with VSVpp, but an enhancement with the influenza virus abated the quantity of infectious HCV particles (more than 80% in

Fig. 4. Silencing of PLSCR1 in Huh-7.5.1 cells results in inhibition of HCV particles production. Huh-7.5.1 cells were transfected with shRNA as described. Lysates of control (empty) and transfected cells were subjected to immunoblotting using rabbit anti-PLSCR1 and anti-beta-actin monoclonal antibodies. Stable knock-down cell lines of Huh- 7.5.1 were then infected with HCVcc. For infection, HCVcc (MOI = 1.0) was inoculated for 3 h, the supernatants were removed and cells were added to 1 ml of fresh medium and incubated at 37 °C for 72 h. Cells were analyzed by (A) real-time PCR or by (B) In-cell Western. The virus foci formation data of the In-cell Western experiment was quantiﬁed. No HCVcc means non-infected cells as a control. All the above experiments were independently repeated three times. Q. Gong et al. / FEBS Letters 585 (2011) 2647–2652 2651

Fig. 5. PLSCR1 interacts with OCLN. HEK293T cells were transfected with indicated plasmids and detected by Western blot using indicated antibodies. (A) and (B) OCLN was immunoprecipitated with PLSCR1 by reciprocal co-immunoprecipitation assays. The experiments were independently repeated three times.

Fig. 4A and 25% in Fig. 4B). These results suggest that PLSCR1 par- the results of deletion mutants, the region between 99 and 290 aa ticipates in HCV infection in vitro. of PLSCR1 is crucial to the interaction of E2 and PLSCR1, which con- tains SH2, SH3 and Ca2+ binding domains (Supplementary Fig. 2). 3.5. PLSCR1 co-precipitates with OCLN The HCVpp model is a valuable tool to investigate host cell entry factors that involves in virus entry. We found that PLSCR1 phys- The aforementioned results suggest that PLSCR1 might interact ically interacts with E1 and E2 and mediates the entry process of with other entry factors to coordinately regulate the HCV infec- HCVpp infection (Fig. 2). HCVcc is the more authentic tool to study tion. To explore this possibility, we tested the protein interaction HCV entry and infection. So we used HCVcc assay to determine of PLSCR1 and known HCV entry factors by co-immunoprecipita- whether PLSCR1 contribute HCV entry or/and infection, results tion assays. Notably, PLSCR1 co-precipitated with OCLN (Fig. 5A showed that knock-down of PLSCR1 inhibit HCVcc attachment and Fig. 5B). However, PLSCR1 was unable to interact with CD81, and infection to Huh-7.5.1 cells (Fig. 3). We also conﬁrmed that CLDN1 and SR-BI in a co-immunoprecipitation assay (Supplemen- PLSCR1 interacts with OCLN. Further investigate the mechanisms tary Fig. 5). of PLSCR1 in the HCV infection will facilitate the development of new approaches for the treatment of HCV infection and HCV in- 4. Discussion duced liver disease.

We identified for the first time that PLSCR1 contributes to HCV Acknowledgements entry and infection through HCVpp and HCVcc assays. Moreover, PLSCR1 plays an important role in the initial attachment of HCV This work was supported by the grants from the National High- with target cells. These findings imply that PLSCR1 plays a crucial tec Research Developing Programme (2006AA02A310), the Special role in HCV entry into hepatocytes. Funds for Major State Basic Research of China (2011CB910600, HCV is an enveloped virus, which enters into host cells through 2011CB504800), the National International Cooperation Project a few entry factors. The virus entry is initiated by the binding of the (2011DFB30370), the National Key Technologies R&D Program viral particle to attachment factors, followed by cellular clathrin- for New Drugs (2009ZX09301-002), Chinese Science and Technol- mediated endocytosis through which viruses are internalized by ogy Key Project (2008ZX10002-014, 2009ZX10004-303, endosomes [21]. The HCV particle is composed of a nucleocapsid, 2009ZX09301-002) and National Natural Science Foundation of which surrounded by a lipid bilayer. The two envelope glycopro- China (30970156), State Key Laboratory for Molecular Virology teins, E1 and E2, form non-covalent heterodimers and plays an and Genetic Engineering (2010KF08). important role in HCV entry [22]. A few proteins have been identified as putative entry factors for HCV entry, such as CD81 [3,23], Appendix A. Supplementary data SR-BI [4], CLDN1 [5], and OCLN [6]. We identified PLSCR1 as a new protein that interacting with both E1 and E2. PLSCR1 regulates Supplementary data associated with this article can be found, in signaling transduction through several receptors, including the the online version, at doi:10.1016/j.febslet.2011.07.019. epidermal growth factor receptor (EGFR) [24,25] and the high- affinity IgE receptor [26,27]. EGF initiates rapid internalization of References both the PLSCR1 and EGFR receptors via clathrin-coated pits [17]. PLSCR1 involves in EGF-induced clathrin-mediated endocytosis. [1] Castello, G., Scala, S., Palmieri, G., Curley, S.A. and Izzo, F. (2010) HCV-related hepatocellular carcinoma: from chronic inflammation to cancer. Clin. The down-regulation of factors involved in clathrin-mediated Immunol. 134, 237–250. endocytosis inhibits HCVpp and HCVcc infection [28]. But whether [2] Dubuisson, J. (2007) Hepatitis C virus proteins. World J. Gastroenterol. 13, PLSCR1 is involved in HCV infection and the detailed mechanisms 2406–2415. [3] Pileri, P., Uematsu, Y., Campagnoli, S., Galli, G., Falugi, F., Petracca, R., Weiner, remains unknown. Our results showed that the stable knock-down A.J., Houghton, M., Rosa, D., Grandi, G., et al. (1998) Binding of hepatitis C virus of PLSCR1 inhibits HCVpp and HCVcc infection in Huh-7.5.1 cells. to CD81. Science 282, 938–941. Moreover, we showed that the stable knock-down of PLSCR1 also [4] Scarselli, E., Ansuini, H., Cerino, R., Roccasecca, R.M., Acali, S., Filocamo, G., Traboni, C., Nicosia, A., Cortese, R. and Vitelli, A. (2002) The human scavenger abate the entry of VSVpp (Fig. 2). It might due to that VSV entry receptor class B type I is a novel candidate receptor for the hepatitis C virus. also depend on clathrin-mediated endocytosis [29]. Furthermore, EMBO J. 21, 5017–5025. PLSCR1 is involved in the initial attachment of HCV virus to target [5] Evans, M.J., von Hahn, T., Tscherne, D.M., Syder, A.J., Panis, M., Wolk, B., Hatziioannou, T., McKeating, J.A., Bieniasz, P.D. and Rice, C.M. (2007) Claudin-1 cells. All of the results imply that PLSCR1 affects clathrin-mediated is a hepatitis C virus co-receptor required for a late step in entry. Nature 446, endocytosis and involves in HCV entry. 801–805. To confirm the essential region of PLSCR1 that participated in [6] Ploss, A., Evans, M.J., Gaysinskaya, V.A., Panis, M., You, H., de Jong, Y.P. and Rice, C.M. (2009) Human occludin is a hepatitis C virus entry factor required for the interaction with E2, a set of PLSCR1 mutants was constructed. infection of mouse cells. Nature 457, 882–886. We showed that the palmitoylation mutation of PLSCR1 (5C ? 5A) [7] Liu, S., Yang, W., Shen, L., Turner, J.R., Coyne, C.B. and Wang, T. (2009) Tight or the double mutant of palmitoylation motif and NLS sequence of junction proteins claudin-1 and occludin control hepatitis C virus entry and PLSCR1 (5C ? 5A, K ? A) did not affect the binding with E2. From are downregulated during infection to prevent superinfection. J. Virol. 83, 2011–2014. 2652 Q. Gong et al. / FEBS Letters 585 (2011) 2647–2652

[8] Falkowska, E., Durso, R.J., Gardner, J.P., Cormier, E.G., Arrigale, R.A., Ogawa, [19] Yang, W., Qiu, C., Biswas, N., Jin, J., Watkins, S.C., Montelaro, R.C., Coyne, C.B. R.N., Donovan, G.P., Maddon, P.J., Olson, W.C. and Dragic, T. (2006) L-SIGN and Wang, T. (2008) Correlation of the tight junction-like distribution of (CD209L) isoforms differently mediate trans-infection of hepatoma cells by Claudin-1 to the cellular tropism of hepatitis C virus. J. Biol. Chem. 283, 8643– hepatitis C virus pseudoparticles. J. Gen. Virol. 87, 2571–2576. 8653. [9] Pohlmann, S., Zhang, J., Baribaud, F., Chen, Z., Leslie, G.J., Lin, G., Granelli- [20] Zhong, J., Gastaminza, P., Cheng, G., Kapadia, S., Kato, T., Burton, D.R., Wieland, Piperno, A., Doms, R.W., Rice, C.M. and McKeating, J.A. (2003) Hepatitis C virus S.F., Uprichard, S.L., Wakita, T. and Chisari, F.V. (2005) Robust hepatitis C virus glycoproteins interact with DC-SIGN and DC-SIGNR. J. Virol. 77, 4070–4080. infection in vitro. Proc. Natl. Acad. Sci. USA 102, 9294–9299. [10] Bartosch, B., Vitelli, A., Granier, C., Goujon, C., Dubuisson, J., Pascale, S., [21] Dubuisson, J., Helle, F. and Cocquerel, L. (2008) Early steps of the hepatitis C Scarselli, E., Cortese, R., Nicosia, A. and Cosset, F.L. (2003) Cell entry of hepatitis virus life cycle. Cell. Microbiol. 10, 821–827. C virus requires a set of co-receptors that include the CD81 tetraspanin and [22] Lavie, M., Goffard, A. and Dubuisson, J. (2007) Assembly of a functional HCV the SR-B1 scavenger receptor. J. Biol. Chem. 278, 41624–41630. glycoprotein heterodimer. Curr. Issues Mol. Biol. 9, 71–86. [11] Schneeberger, E.E. and Lynch, R.D. (2004) The tight junction: a multifunctional [23] Flint, M., Thomas, J.M., Maidens, C.M., Shotton, C., Levy, S., Barclay, W.S. and complex. Am. J. Physiol. Cell Physiol. 286, C1213–C1228. McKeating, J.A. (1999) Functional analysis of cell surface-expressed hepatitis C [12] Lozach, P.Y., Amara, A., Bartosch, B., Virelizier, J.L., Arenzana-Seisdedos, F., virus E2 glycoprotein. J. Virol. 73, 6782–6790. Cosset, F.L. and Altmeyer, R. (2004) C-type lectins L-SIGN and DC-SIGN capture [24] Sun, J., Nanjundan, M., Pike, L.J., Wiedmer, T. and Sims, P.J. (2002) Plasma and transmit infectious hepatitis C virus pseudotype particles. J. Biol. Chem. membrane phospholipid scramblase 1 is enriched in lipid rafts and interacts 279, 32035–32045. with the epidermal growth factor receptor. Biochemistry 41, 6338–6345. [13] Zheng, A., Yuan, F., Li, Y., Zhu, F., Hou, P., Li, J., Song, X., Ding, M. and Deng, H. [25] Nanjundan, M., Sun, J., Zhao, J., Zhou, Q., Sims, P.J. and Wiedmer, T. (2003) (2007) Claudin-6 and claudin-9 function as additional coreceptors for Plasma membrane phospholipid scramblase 1 promotes EGF-dependent hepatitis C virus. J. Virol. 81, 12465–12471. activation of c-Src through the epidermal growth factor receptor. J. Biol. [14] Zhao, J., Zhou, Q., Wiedmer, T. and Sims, P.J. (1998) Level of expression of Chem. 278, 37413–37418. phospholipid scramblase regulates induced movement of phosphatidylserine [26] Pastorelli, C., Veiga, J., Charles, N., Voignier, E., Moussu, H., Monteiro, R.C. and to the cell surface. J. Biol. Chem. 273, 6603–6606. Benhamou, M. (2001) IgE receptor type I-dependent tyrosine phosphorylation [15] Frasch, S.C., Henson, P.M., Kailey, J.M., Richter, D.A., Janes, M.S., Fadok, V.A. and of phospholipid scramblase. J. Biol. Chem. 276, 20407–20412. Bratton, D.L. (2000) Regulation of phospholipid scramblase activity during [27] Amir-Moazami, O., Alexia, C., Charles, N., Launay, P., Monteiro, R.C. and apoptosis and cell activation by protein kinase Cdelta. J. Biol. Chem. 275, Benhamou, M. (2008) Phospholipid scramblase 1 modulates a selected set of 23065–23073. IgE receptor-mediated mast cell responses through LAT-dependent pathway. J. [16] Py, B., Basmaciogullari, S., Bouchet, J., Zarka, M., Moura, I.C., Benhamou, M., Biol. Chem. 283, 25514–25523. Monteiro, R.C., Hocini, H., Madrid, R. and Benichou, S. (2009) The phospholipid [28] Trotard, M., Lepere-Douard, C., Regeard, M., Piquet-Pellorce, C., Lavillette, D., scramblases 1 and 4 are cellular receptors for the secretory leukocyte protease Cosset, F.L., Gripon, P. and Le Seyec, J. (2009) Kinases required in hepatitis C inhibitor and interact with CD4 at the plasma membrane. PLoS ONE 4, e5006. virus entry and replication highlighted by small interference RNA screening. [17] Carpenter, G. (2000) The EGF receptor: a nexus for trafﬁcking and signaling. FASEB J. 23, 3780–3789. BioEssays 22, 697–707. [29] Sun, X., Yau, V.K., Briggs, B.J. and Whittaker, G.R. (2005) Role of clathrin- [18] Blanchard, E., Belouzard, S., Goueslain, L., Wakita, T., Dubuisson, J., Wychowski, mediated endocytosis during vesicular stomatitis virus entry into host cells. C. and Rouille, Y. (2006) Hepatitis C virus entry depends on clathrin-mediated Virology 338, 53–60. endocytosis. J. Virol. 80, 6964–6972.