DOCSLIB.ORG
Explore
Sign Up
Log In
Upload
Search
Home
» Tags
» Appenzeller Sennenhund
Appenzeller Sennenhund
Dog Breeds of the World
Exposition Des 10 & 11 Mai 1997
Breed Categorisations
Kurzform Rasse / Abbreviation Breed Stand/As Of: Sept
Dog Breeds Volume 5
13Th 2015 Showsite: Eslöv Ai
Dog Temperament: Everything You Need to Know to Choose (And Care For) the Best Dog for Your Lifestyle
WCHSA - 7 BREED GROUPS with Breeds List
Canine Genetic Tests by Breeds
Affenpinscher
Liste Des Chiens Mise En Ordre20140423veva 1
National Entlebucher Mountain Dog Association 2015 National Specialty
51& 52Steflanders DOGSHOW 23
Exon 2-3 Forward TCATTGTCATCTTCCAGTTCG G
The Bernese Mountain Dog Text and Illustrations by Ria Hörter
Rassenlijst 2020
Nomenclatorul Raselor Canine Fci
Alaskan Klee Kai See UKC Breed Standard
Top View
2010 Annual Report
Nhat – Hwt – Iht )
Dog Breeds Volume 1
FEDERATION CYNOLOGIQUE INTERNATIONALE (AISBL) Place Albert 1Er, 13, B – 6530 Thuin (Belgique), Tel : +32.71.59.12.38, Fax : +32.71.59.22.29, Internet
Sobota / Saturday 02.04.2016 Plemeno / Breed Nedeľa / Sunday
Einstufung Der Hunderassen in Gruppen
Nomenclatorul Raselor Canine Fci
Breed Categorisations
Hunderassen, Die Santévet Bis Zu Ihrem 5. Lebensjahr Versichert
Til Dansk Eksteriørchampionat Er 24 Må- Neder for Alle Racer
Premium List Two All-Breed Shows with Junior Showmanship, Two FSS Open Shows 4-6 Month Beginner Puppy on Saturday
The Bernese Mountain Dog
Choosing a Happy Healthy Puppy
Richter / Juges / Judges 2018
8345 / Fsx No.: 7217152 / E-Mail:
[email protected]
Dog Registration Rules & Regulations ______
Qualifying Searches and Titles Report by Breed
Health Seminar
American Leopard Hound See UKC Breed Standard
Qualifying Searches and Titles
Dog Breeds - Volume 3