TLR4-activated microglia have divergent effects on oligodendrocyte lineage cells

DISSERTATION

Presented in partial fulfillment of the requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

Evan Zachary Goldstein, BA

Neuroscience Graduate Program

The Ohio State University

2016

Dissertation Committee:

Dr. Dana McTigue, Advisor

Dr. Phillip Popovich

Dr. Jonathan Godbout

Dr. Courtney DeVries

Copyright by

Evan Zachary Goldstein

2016

i Abstract

Myelin accelerates action potential conduction velocity and provides essential metabolic support for axons. Unfortunately, myelin and myelinating cells are often vulnerable to injury or disease, resulting in myelin damage, which in turn can lead to axon dysfunction, overt pathology and neurological impairment.

Inflammation is a common component of CNS trauma and disease, and therefore an active inflammatory response is often considered deleterious to myelin health.

While inflammation can certainly damage myelin, inflammatory processes also benefit oligodendrocyte (OL) lineage progression and myelin repair. Consistent with the divergent nature of inflammation, intraspinal toll-like receptor 4 (TLR4) activation, an innate immune pathway, kills OL lineage cells, but also initiates oligodendrogenesis. Soluble factors produced by TLR4-activated microglia can reproduce these effects in vitro, however the exact factors are unknown. To determine what microglial factors might contribute to TLR4-induced OL loss and oligodendrogenesis, mRNA of factors known to affect OL lineage cells was quantified in TLR4-activated microglia and spinal cords (chapter 2). Results indicate that TLR4-activated microglia transcribe numerous factors that induce

OL loss, OL progenitor cell (OPC) proliferation and OPC differentiation.

However, some factors upregulated after intraspinal TLR4 activation were not

ii upregulated by microglia, suggesting that other cell types contribute to transcriptional changes in vivo.

Many factors produced by TLR4-activated microglia have no known effects on

OL lineage cells. In chapter 3, colony stimulating factor 3 (CSF3) and interleukin

7 (IL-7) were identified as factors produced by TLR4-activated microglia that might contribute to OPC proliferation or differentiation. Indeed, CSF3 injection into the uninjured spinal cord promoted OPC proliferation. Conversely, IL-7 injection into the uninjured spinal cord promoted OPC differentiation. Although it is unclear if these factors act directly on OPCs or if they initiate paracrine responses, CSF3 and IL-7 represent novel oligodendrogenic factors produced by

TLR4-activated microglia.

In chapter 4, an innate TLR4-induced iron chelation response was harnessed to sequester iron in a model of intraspinal iron accumulation. Because excess iron induces progressive neuronal and OL death, we hypothesized that intraspinal

TLR4 activation (with lipopolysaccharide; LPS) would enhance iron sequestration by CNS macrophages and reduce subsequent cytotoxicity. LPS co-injected with iron did promote in vivo iron storage as detected by increased ferritin-expressing microglia and intraspinal iron protein mRNA expression characteristic of iron sequestration. Nevertheless, this approach was not neuroprotective against progressive neuronal or glial loss. In fact, Iron+LPS injection reduced OL replacement from OPCs.

iii Collectively, this work demonstrates that activation of a single inflammatory receptor on microglia (TLR4) is capable of divergent effects on every stage of OL lineage progression. Thus, modulation of specific factors during demyelinating insults is a more advantageous therapeutic approach than general anti- inflammatory agents.

iv

Dedication

To my family and friends: past, present, and future

v Acknowledgments

First and foremost, I must acknowledge and thank my advisor Dr. Dana McTigue.

You have been a wonderful advisor and mentor. When I joined your lab, I was a naïve college graduate with an interest in oligodendrocytes. Over the years, you have taught me so many things, from how to be a scholar, to how to always be prepared with food and extra batteries in case of a blizzard! You pushed me to do the best work possible, and always had good advice when I knocked on your office door. Thank you for everything.

I would also like to thank the rest of my committee members. Dr. Phillip

Popovich, thank you for all your constructive criticism. You have certainly helped shape me as a scientist. Dr. Jonathan Godbout, thank you for teaching me neuroimmunology my first year in graduate school, and for all the subsequent advice on my dissertation work. Dr. Courney Devries, thank you for your words of encouragement and honest opinions on my work.

All of the work that I have completed throughout my graduate career would not have been possible without so many wonderful people in the lab that have generously donated their time to me. To all the past and present technicians in the lab, thank you for all the time you spent helping me get to this point. I realize how lucky I am to have such wonderful technical support, and I know whichever lab I go to next will not compare. To all of my fellow graduate students, thank you

vi for all of your friendships, support, and encouragement. I will try to keep in touch with as many of you as possible. To all the post-docs that have come through the lab, thank you for setting such a good example and for many friendships as well.

To my parents, you both have been the inspiration that has gotten me to this point. The work that you have accomplished throughout your careers motivates me to do the best science and make as large an impact as I can. However, the love, time and attention that you have always afforded me are truly baffling. No matter how busy you were, I never had to ask twice for help on math homework, edits on an essay, or feedback on a dissertation.

To Alexa, thank you for being a great big sister, always looking out for me and helping me navigate life.

And finally, to Christine, thank you for being so supportive and understanding. I love you and can’t wait to start the next chapter of our lives.

vii Vita

2006………………...James S. Rickards High School, Tallahassee, FL

2010………………...B.A. Biology & Psychology Case Western Reserve University, Cleveland, OH

2010 – 2016….…….Graduate Research Fellow The Ohio State University, Columbus, OH

Publications

Schonberg DL, Goldstein EZ, Sahinkaya FR, Wei P, Popovich PG, McTigue DM. Ferritin stimulates oligodendrocyte genesis in the adult spinal cord and can be transferred from macrophages to NG2 cells in vivo. J Neurosci, 32(16): 5374- 5384; 2012. PMID: 22514302 Hesp Z, Goldstein EZ, Miranda C, Kaspar, B, McTigue DM. Chronic oligodendrogenesis and remyelination after spinal cord injury in mice and rats. J Neurosci, 35(3): 1274-90; 2015 PMID:25609641 Goldstein EZ, Church JD, Hesp ZC, McTigue DM. Silver lining of inflammation: The beneficial effects of inflammation on myelination. Exp Neurol. In Press; 2016 PMID: 27151600

Fields of Study Major Field: Neuroscience

viii Table of Contents

Abstract…………………………………………………………………………………...ii

Dedication………………………………………………………………………………..v

Acknowledgments…..…………………………………………………………………..vi

Vita………………………………………………………………………………………viii

List of Tables…………………………………………………………………………….x

List of Figures…………………………………………………………………………...xi

Chapter 1. Introduction…………..…………………………………………………….1

Chapter 2. TLR4-activated microglia express factors known to influence OL lineage survival and oligodendrogenesis……………………………………………32

Chapter 3. CSF3 & IL-7 are novel oligodendrogenic factors produced by TLR4- activated macrophages/microglia.………………………………………………...…58

Chapter 4. Intraspinal TLR4 activation promotes iron storage but does not protect neurons or oligodendrocytes from progressive iron-mediated damage….…...... 91

Chapter 5. General conclusions and discussion………………………………….133

References……………………………………………………………………………151

ix

List of Tables

Table 1. Iron metabolism proteins……………………………………………………22

Table 2. TLR4-activated BMDMs increased transcription of cytokines and growth factors………………………………………………….……………….……………….70

Table 3. TLR4-activated BMDMs decreased transcription of cytokines and growth factors...……………………………………………………………………….……..…71

x List of Figures

Figure 1. The stages of OL lineage progression have distinct morphological characteristics and express different proteins……………….……..………………..5

Figure 2. Inflammatory mediators affect all stages of myelination……...……..…13

Figure 3. Macrophage iron import, storage and export…………………………....24

Figure 4. In vivo and in vitro TLR4 activation induced transcriptional changes in factors responsible for OL apoptosis………..………………………………….…...40

Figure 5. In vivo and in vitro TLR4 activation induced transcriptional changes in factors that influence OL survival……………………..……………………………..42

Figure 6. In vivo and in vitro TLR4 activation increased transcription of factors that initiate OPC proliferation……………………………………………………..….44

Figure 7. In vivo and in vitro TLR4 activation induced transcriptional changes IL-6 family of cytokines.…………………………………………..………………………...45

Figure 8. In vivo and in vitro TLR4 activation increased IL-1β mRNA transcription.

…………………………………………………………………………………..……….46

Figure 9. In vivo TLR4 activation increased CXCL12 mRNA transcription…...... 47

Figure 10. In vivo TLR4 activation increased TGFβ mRNA transcription....….…48

xi Figure 11. In vivo TLR4 activation increased BMP2 mRNA transcription.…..…..49

Figure 12. Bone marrow derived macrophages increased CSF3 and IL-7 mRNA after TLR4 activation………….………………………………………………..……..72

Figure 13. Neonatal microglia increased CSF3 and IL-7 mRNA after TLR4 activation.…………..…………………………………………………………………..73

Figure 14. Intraspinal CSF3 and IL-7 mRNA increased after intraspinal TLR4 activation……….……………………………………………………………..…..……74

Figure 15. CSF3, but not IL-7 induces OPC proliferation in the injection site at 3d.

…………………..………………………………………………………………...... 75

Figure 16. CSF3 and IL7 do not significantly change OPC number compared to vehicle control at 3d………..……………………………………………………..…...77

Figure 17. IL-7 enhances OPC differentiation in the injection site at 3d….……..78

Figure 18. Intraspinal CSF3 and IL-7 injections differentially activate CNS macrophages…………………………………………………………………...…...... 80

Figure 19. Intraspinal CSF3 and IL-7 injections increase ipsilateral CD11b expression at 3d…………………………………………………..………………..….80

Figure 20. Intraspinal CSF3 induces pSTAT3 expression in CNS macrophages and OPCs.………………………………………………………………………....…...82

xii Figure 21. CSF3 and CSF3R are differentially expressed after contusive SCI.

………...... ……84

Figure 22. Activation of TLR4 on microglia in vitro promoted iron uptake..…....105

Figure 23. Iron microinjection with or without TLR4 activation differentially induced CNS macrophage activation……………………….………………..……107

Figure 24. Densitometric quantification of Ox42 (CD11b/c) in the ipsilateral spinal cord revealed that both LPS alone and Iron+LPS induced a significant increase in

Cd11b expression compared with vehicle or Iron alone 1d post-injection.…....108

Figure 25. TLR4 activation altered the distribution of iron deposition.………....110

Figure 26. Iron+LPS injection induces ferritin expression in macrophages.…..112

Figure 27. Intraspinal TLR4 activation promotes an iron storage phenotype in vivo…………………………………….……………………………………………....115

Figure 28. TLR4 activation does not rescue progressive iron-induced neuron loss………………………………………………………………...………….……….116

Figure 29. TLR4 activation does not rescue iron-induced oligodendrocyte loss and iron impairs OPC differentiation……………………...………………………..119

Figure 30. Cytokines, nitrites and glutamate may mediate cytotoxicity in LPS but not Iron treated tissue………………………………………………………..……...122

Figure 31. TLR4 activation enhances tissue integrity 28d after Iron injection...124

xiii Figure 32. Iron+LPS injection increases myelin protein zero (P0) expression by

28d……………………………………..…………………………………………..….125

xiv

Chapter 1: Introduction

Introduction to dissertation

Neuroscience is the scientific study of the nervous system, a communication system that allows animals to sense and interact with an environment.

Commonly referred to as the fundamental unit in the nervous system, the neuron conducts electrical signals (or action potentials) along its axon, and communicates that signal to other cells. Myelination, the wrapping of axons in a compact membranous sheath, evolved in vertebrates over 400 million years ago as a mechanism to increase conduction velocity 100-fold without requiring an expansion of axon diameter. Indeed, myelinated axons allow for rapid reaction to dangerous stimuli, and thus evolved independently in 7 bilateral animal lineages

(Hartline and Colman, 2007). Without myelin it is estimated the human spinal cord would need a diameter of ~1 meter to achieve comparable conduction speeds (Zalc, 2015). In addition to enhancing conduction velocity, myelin provides structural and metabolic support to axons (Nave and Werner, 2014).

The deleterious and sometimes fatal effects of demyelination signify the essential role myelination has in the nervous system.

1 In the central nervous system (CNS), demyelination occurs in disease and trauma, such as multiple sclerosis (MS) and spinal cord injury (SCI).

Remyelination, the restoration of myelin, is an innate capacity of the nervous system. However, repair processes are often incomplete due to both intrinsic and extrinsic factors (Franklin and Goldman, 2015). In order to develop effective therapeutic interventions for demyelination, further understanding of myelin and the cells that make myelin is needed. This dissertation explores how CNS inflammation impacts oligodendrocyte (OL) lineage cells, the source of CNS myelin. We hypothesized that inflammation would have divergent effects on

OL lineage cells. Because inflammation occurs ubiquitously throughout CNS injury, this work has a broad application. The remainder of this chapter will further introduce the topics discussed in this dissertation.

What is Myelin?

Several illustrious scientists such as Ehrenberg, Remak, and Schwann first described nerve fibers (axons) surrounded by a fatty substance almost 200 years ago (Ehrenberg, 1837; Remak, 1838; Schwann, 1839; Rosenbluth, 1999). This fatty substance, now known as myelin, was initially thought to lie inside the outer membrane of axons. This misconception gave rise to the name, myelin, which comes from the Greek word myelos, meaning marrow (Virchow, 1858). With the advancement in microscopic and biochemical techniques, much more is now known about myelin and the cells that produce it.

2 Myelin is a lipid membrane that extends from myelinating cells and wraps around axons numerous times. This membrane is unique because it contains ~70-80% lipids and ~20-30% proteins, whereas most other cell membranes have the opposite ratio (Baumann and Pham-Dinh, 2001; Aggarwal et al., 2011). Of the lipids, ~40% are cholesterol, which allows for tight compaction between layers

(Bartzokis, 2004). The unique membrane characteristics of myelin are responsible for electrical insulation of axons. By increasing the resistance and decreasing the capacitance of the axon, myelin increases conduction velocity, the rapid propagation of electrical signals (action potentials). These action potentials are restricted to myelin-free nodes of Ranvier, where ion channels are clustered (Rasband and Shrager, 2000; Johnson et al., 2015).

In addition to electrical insulation, myelin also provides metabolic support to axons (Fünfschilling et al., 2012; Lee et al., 2012). Specifically, OLs supply lactate to axons through monocarboxylate transporter 1 (MCT1), a lactate transporter. Downregulation of MCT1 on OLs induces severe axonal injury, exhibiting the importance of metabolic support from OLs (Lee et al., 2012).

Indeed, this feature of myelin is important for portions of axons that are far from the neuronal cell body (Nave, 2010; Nave and Werner, 2014).

Schwann cells (SC) myelinate axons in the peripheral nervous system (PNS), while CNS myelin is produced by oligodendrocytes (OLs). While the basic structure of myelin produced by OLs and SCs is largely the same, there are numerous characteristics specific to each cell type. One obvious difference

3 between OLs and SCs is that SCs only myelinate one axon segment, while OLs can myelinate up to 60 different axons (Nave and Werner, 2014). The focus of this dissertation is on CNS injury and OLs and OL lineage cells. Thus, this chapter primarily introduces important concepts of CNS myelination and OL lineage progression. However, it is important to note that reparative qualities of

SCs are a major reason for enhanced tissue repair and remyelination after peripheral nerve injury compared to CNS injury (Nathaniel and Pease, 1963;

Schlaepfer and Hager, 1964). Furthermore, SCs have the capacity to infiltrate and remyelinate after CNS injury (Smith et al., 1979; Blight and Young, 1989;

Wrathall et al., 1998; Guest et al., 2005; McTigue et al., 2006). For these reasons, SCs will be discussed further in the pertinent chapters.

Oligodendrocyte lineage cells

OLs are mature post-mitotic glia generated from OL progenitor cells (OPCs) in a process termed oligodendrogenesis. Interestingly, OPCs persist in the adult

CNS and are the primary source of OL replacement and myelin repair (discussed further below). The stages of OL lineage progression are distinguished by their ability to migrate and proliferate, morphological characteristics and protein expression. Generally, OL lineage cells are classified into 3 groups: OPCs, non- myelinating OLs and myelinating OLs. Figure 1 demonstrates the morphologies of OL lineage cells, along with proteins expressed at each stage.

4

Figure 1. The stages of OL lineage progression have distinct morphological characteristics and express different proteins. Markers for each stage are listed below images with down-regulated markers indicated as (-).

First discovered over 30 years ago, OPCs are highly motile cells characterized by their multiple thin processes and ability to proliferate (Raff et al., 1983 & 1984;

Nishiyama et al., 2009). Developmentally, OPCs are formed during the mid- gestational period (~E12.5-14 in rodents; ~E45 in humans) in a similar manner in both the neural tube and telencephalon (embryonic precursors of the spinal cord and brain, respectively) (Pringle and Richardson, 1993; Hajihosseini et al., 1996;

Bergles and Richardson, 2015). In response to a diffusible gradient of Sonic

Hedgehog (SHH) secreted from the dorsal floor plate, ventrally derived neural stem cells are specified to the OL lineage via induction of the OLIG2 transcription

5 factor (Lu et al. 2002; Takebayashi et al. 2002; Zhou and Anderson 2002).

Slightly later in gestation there is a wave of dorsally derived OPCs that are SHH independent (Cai et al., 2005; Fogarty et al., 2005). It is estimated that ~80% of

OPCs are ventrally derived while ~20% are dorsally derived (Tripathi et al.,

2011). After their generation, OPCs rapidly proliferate and migrate, which leads to a uniform distribution throughout grey and white matter.

OPCs are commonly referred to as NG2 cells, due to NG2 proteoglycan on the cell surface, and the important role NG2 plays in oligodendrogenesis. However in the CNS, NG2 is also expressed on vascular pericytes and a subset of infiltrating macrophages after injury (Bu et al., 2001; Ozerdem et al., 2001). While NG2+

OPCs can be discerned from pericytes and macrophages by morphology, other markers such as PDGFRα, OLIG2 and SOX10 are often used to confirm OL lineage.

NG2 is an extremely important protein for OPC function. For example, the NG2 proteoglycan plays a key role in the proliferation and motility of OPCs. Work from the Stallcup lab demonstrated that NG2 binds with high affinity to platelet-derived growth factor A (PDGF A) and basic fibroblast growth factor (bFGF) (Goretzki et al., 1999). These two growth factors are essential mitogens for the survival, proliferation and differentiation of OPCs (Noble et al., 1988; Raff et al., 1988;

Pringle et al., 1989; Bogler et al., 1990; Barres et al., 1992). Furthermore, NG2 binds to integrins that initiate OPC migration via Rho GTPase-dependent actin polymerization (Nishiyama and Stallcup, 1993; Biname et al., 2013). The use of

6 NG2 null mice or NG2-blocking antibodies confirms that NG2 is essential for

PDGF-A mediated OPC proliferation and migration (Nishiyama et al., 1996;

Grako et al., 1999; Kucherova and Stallcup 2010). Thus, it is clear that NG2 is a vital protein for basal OPC function as well as the OPC response to demyelination.

What regulates OL lineage progression and myelination?

The majority of CNS myelination occurs over an extended period of time throughout adolescence, but even continues throughout adulthood. This combined with the fact that not all axons are myelinated indicates that OL lineage progression and myelination are strictly regulated. Indeed, both intrinsic and extrinsic mechanisms regulate OL lineage progression and myelination (Mitew et al., 2013; Zuchero and Barres, 2013).

Intrinsic regulation of OL lineage progression and myelination is primarily mediated by transcription factors such as SOX10, OLIG1, OLIG2, and Nkx, which induce transcription of genes required for OL lineage progression. Other transcription factors such as Id2 and Id4 regulate OL lineage progression by repressing myelin genes, thus inhibiting the differentiation of OPCs (Emery,

2010). Interestingly, epigenetic modifications via histone deacetylases (HDAC) are responsible for repressing the expression of Id2 and Id4, thus releasing the inhibition of OPC differentiation (Marin-Husstege et al., 2002; Ye et al., 2009).

Intrinsic mechanisms regulating OL dynamics explain how myelination of

7 synthetic fibers occurs in vitro without any signals from other cell types (Lee et al., 2012).

Nevertheless, in vivo myelination consists of numerous different cells capable of impacting OL dynamics. This extrinsic regulation of OL lineage progression and myelination occur through two primary mechanisms: neuronal activity and soluble factors such as cytokines and growth factors. Seminal work demonstrated that inhibition of neuronal action potentials impairs developmental myelination (Barres and Raff, 1993). Alternatively, stimulation of neuronal activity can enhance myelination (Wake et al., 2011; Gibson et al., 2014; McKenzie et al., 2014).

These findings indicate that neuronal activity is responsible for initiating myelination. Indeed, OPCs express a variety of neurotransmitter receptors including the AMPA and NMDA receptors and form synapses with axons (Barres et al., 1990; Bergles et al., 2000). Undoubtedly, the study of activity-dependent myelination and the OPC-axonal synapse is a rapidly growing field, which will yield many new and exciting discoveries over the next few years.

In addition to neuronal activity, OL lineage progression is regulated by soluble factors, many of which are expressed during development and CNS injury. Much of the work presented in this dissertation focuses on inflammatory-mediated factors that can influence oligogenesis, many of which are introduced below.

Inflammation damages OLs and causes demyelination

Inflammation is a ubiquitous feature of trauma and disease that can cause or exacerbate ongoing oxidative damage. For example, inflammatory cells produce

8 reactive oxygen species (ROS) in response to cytokines (e.g., tumor necrosis factor/TNF) or ligands that bind toll-like receptors (TLRs). These ROS combine with the pool of ROS generated by cell damage and lipid peroxidation

(Ramalingam and Kim, 2012; Nathan and Cunningham-Bussel, 2013; Mittal et al., 2014), to induce NFκB-dependent transcriptional changes that further propagate inflammation (Gloire et al., 2006).

In order to maintain the extensive lipid and protein composition of their multi- layered myelin sheaths, OLs exhibit a high metabolic rate (Pleasure et al., 1977;

Szuchet et al., 1983; Saher et al., 2005; Fünfschilling et al., 2012; Amaral et al.,

2015). As a result, and because OLs contain low levels of anti-oxidants

(Thorburne and Juurlink, 1996), OLs are vulnerable to oxidative damage present during inflammation.

Inflammatory cells also release cytokines and glutamate, which can further damage OLs (Loughlin et al., 1994; Merrill and Benveniste, 1996; Matute et al.,

2005; Merson et al., 2010). Inflammatory mediated damage directly to the myelin sheath is also possible. Indeed, macrophage invasion into and below myelin sheaths was described in 1975 in a guinea pig model of delayed hypersensitivity

(Wisniewski and Bloom, 1975). It was shown around the same time that macrophage-derived proteinases directly degrade myelin proteins (Norton et al.,

1978). Thus, it is clear that inflammation damages OLs and causes demyelination. Indeed, demyelination occurs in numerous neurological diseases

9 (ie. Multiple Sclerosis and inherited leukodystrophies), as well as CNS traumas

(ie. SCI), which all have a major inflammatory component.

Multiple Sclerosis (MS), the most common neurological disorder among young adults in North America and Europe, is an immune-mediated disease of the CNS that results in demyelination, axonal degeneration and progressive neurological deficits (Noseworthy et al., 2000; Trapp and Nave, 2008). In MS lesions, infiltrating monocytes and lymphocytes create an inflammatory environment that leads to OL loss and demyelination. In relapsing-remitting MS, the most common form, inflammation in these lesions resolves and remyelination promotes recovery. However, in later stages or more severe forms of MS, inflammatory lesions with concurrent demyelination and axonal damage become progressively worse, and do not recover.

OL loss and demyelination also occur after CNS trauma such as SCI. In rodent and monkey models of SCI, OL loss is evident as early as 4hrs post injury, and continues for at least 3 weeks (Crowe et al., 1997; Grossman et al., 2001). In fact, 93% of OLs are lost in the lesion epicenter at one week, which corresponds to the peak of macrophage infiltration and activation (Popovich et al., 1997;

McTigue et al., 2001). Because OLs can myelinate up to 60 different axon segments, this dramatic loss of OLs undoubtedly contributes to demyelination after SCI. Indeed, extensive demyelination occurs in a number of different SCI models and species, as well as after human SCI (Gledhill et al., 1973; Gledhill

10 and McDonald, 1977; Harrison and McDonald, 1977; Balentine and Paris, 1978;

Banik et al., 1980; Blight, 1983 & 1985; Guest et al., 2005).

Remyelination

Remyelination is a regenerative process in which OLs produce new myelin that wrap demyelinated axons (Franklin and ffrench-Constant, 2008; Franklin and

Goldman, 2015). In most cases, remyelination restores conduction velocity along axons and reverses functional deficits associated with demyelination (Smith et al., 1979; Jeffery and Blakemore, 1997; Liebetanz and Merkler, 2006). It is thought that remyelination also restores the metabolic support provided to axons; however, this has not been directly tested. Because of the obvious similarities to developmental myelination, remyelination is often thought of as a recapitulation of development (Franklin and Hinks, 1999; Fancy et al., 2011). However, new myelin is abnormally thin, has shorter internodes and does not always restore maximal conduction velocity (Blakemore, 1974; Blight, 1983; Ludwin and

Maitland, 1984; Blight, 1989; Powers et al., 2012; Fyffe-Maricich et al., 2013).

In relapsing-remitting MS and SCI, endogenous remyelination leaves few unmyelinated axons (Patrikios et al., 2006; Powers et al., 2012, Hesp et al.,

2015). However, reports of unmyelinated axons over 1 year post SCI, combined with enhanced functional outcomes and enhanced remyelination after cell transplantations, indicate that demyelination and remyelination are viable

11 therapeutic targets (Keirstead et al., 2005; Totoiu and Keirstead, 2005; Tetzlaff et al., 2011).

Due to the inflammatory component of demyelinating disease and trauma, a common strategy used to promote OL survival and preserve myelin has been treatment with anti-inflammatory agents. Some anti-inflammatory agents (e.g., corticosteroids) reduce neuropathology and improve neurological functional in preclinical models of demyelination as well as in the human demyelinating disease multiple sclerosis (MS), (Rodriguez and Lindsley, 1992; Pavelko et al.,

1998; Goodin, 2014). The positive effects of steroids further confirm that inflammation contributes to demyelination. However, several components of inflammation benefit remyelination and these attributes should be considered further to optimize the survival and differentiation of OL lineage cells and their ability to promote functionally effective remyelination.

Oligodendrogenesis is enhanced by inflammatory-related cytokines, chemokines, and growth factors

Because OLs are post-mitotic, remyelination must be achieved through oligodendrogenesis, the proliferation and differentiation of OPCs. Indeed, migration of OPCs also contributes to oligodendrogenesis, by contributing to the pool of progenitors that can differentiate into myelinating OLs. Inflammatory cells secrete a cocktail of cytokines, chemokines and growth factors that can have deleterious effects on OL lineage cells (Merson et al., 2010). However, several

12 studies suggest that inflammatory cytokines enhance survival, proliferation, migration, and differentiation of OL lineage cells and are essential for efficient myelin repair (Figure 2; Diemel et al., 1998; Schmitz and Chew, 2008; Napoli and

Neumann, 2010).

Figure 2. Inflammatory mediators affect all stages of myelination. Beneficial factors are listed in green and inhibitory factors are listed in red next to the stage of myelination they affect. Iron is listed in yellow due to its divergent role determined by amount and regulation.

Fitting this mold of cytokines with dual effects on OL lineage cells is TNFα. TNFα is a pro-inflammatory cytokine that can induce OL apoptosis (Arnett et al., 2001;

13 Li et al., 2008). However, absence of TNFα or TNFα-receptor 2 reduces the pool of proliferating OPCs and impairs remyelination after cuprizone-induced demyelination (Arnett et al., 2001). Genetic deletion of the inflammatory cytokine

IL-1β also impaired remyelination in the cuprizone model; however, instead of reduced OPCs, mice lacking IL-1β had significantly fewer mature OLs (Mason et al., 2001). OPCs also differentiate more readily in vitro when stimulated with IL-

1β, providing further support that this cytokine can benefit OL lineage cells (Vela et al., 2002). However, the in vitro effects of IL-1β were reversed when microglia and astrocytes were co-cultured with OPCs (Merrill, 1991). These data suggest that although inflammatory cytokines can support remyelination, the effects that these cytokines have on OL lineage cells are context-dependent and likely change as a function of time (and location) within the inflammatory milieu.

The IL-6 cytokine family is another well-studied group of factors released from activated macrophages and astrocytes. These factors, including IL-6, leukemia inhibitory factor (LIF) and ciliary neurotrophic factor (CNTF), activate the JAK-

STAT pathway, which enhances survival, differentiation, and proliferation of OL lineage cells. Seminal work exploring the factors needed to successfully culture

OL lineage cells found that IL-6, LIF and CNTF all promoted OL survival (Barres et al., 1993; Kahn and De Vellis, 1994). In addition, other in vitro studies showed that all three factors promote differentiation of OPCs into OLs ( Mayer et al.,

1994; Marmur et al., 1998; Zhang et al., 2004; Talbott et al., 2007), and that

CNTF promotes myelination in cerebral co-cultures (Stankoff et al., 2002).

14 Notably, CNTF is increased following brain injury but its increase depends on prior IL-1β expression, revealing an interesting link between these cytokine families (Herx et al., 2000).

More recently, studies have revealed a role for LIF in developmental myelination in vivo; in LIF knockout mice OPC differentiation is delayed leading to diminished optic nerve myelination (Ishibashi et al., 2009). LIF also appears essential for adult myelin repair since LIF knockout impairs spontaneous remyelination after cuprizone-induced demyelination (Marriott et al., 2008). Other studies showed that augmenting LIF can enhance remyelination. For instance, intraventricular injection of LIF-expressing adenovirus in the cuprizone model enhanced OPC proliferation, differentiation, and myelination (Deverman and Patterson, 2012). In concordance with in vitro findings, systemic administration of LIF reduced OL apoptosis in lateral hemisection models of SCI (Kerr and Patterson, 2005; Azari et al., 2006). Oncostatin M, another Il-6 family protein, also has been implicated in protection of OLs and mobilization of OPCs in demyelinating lesion models

(Glezer and Rivest, 2010; Janssens et al., 2015).

Chemokines, named for their ability to induce chemotaxis of immune cells, also affect OPC migration. For instance, CXCL12 (also known as stromal-derived growth factor or SDF-1) promotes OPC migration both in vitro and in vivo during embryonic spinal cord development (Dziembowska et al., 2005). In models of adult CNS injury or demyelination, CXCL12 is upregulated by astrocytes, microglia and endothelia (Imitola et al., 2004; Schönemeier et al., 2008; Patel et

15 al., 2010), including in human MS lesions where it is produced by macrophages

(Calderon et al., 2006; Moll et al., 2009). In studies of experimental demyelination, migration of transplanted neural stem cells and host OPCs into the demyelinated area was inhibited by blocking endogenous CXCL12 signaling

(Patel and McCandless, 2010; Carbajal et al., 2010; 2011; Banisadr et al., 2011).

In addition to migration, CXCL12 also influences OPC differentiation. Treating mixed cortical cultures with CXCL12 increased OL numbers and axon myelination (Kadi et al., 2006). Since OPCs express CXCL12 receptors including

CXCR4 (Dziembowska et al., 2005), it is possible that CXCL12 directly affects

OL lineage cells.

Another chemokine with beneficial actions on OL lineage cells is CXCL1 (aka

Gro-α), whose CNS developmental effects have been well described. For instance, in the developing spinal cord, CXCL1 reduces OPC migration and is thought to regulate OPC distribution (Robinson et al., 1998; Tsai et al., 2002;

Vora et al., 2012). Further, absence of CXCR2, the receptor for CXCL1, reduces

OL lineage cell number during development, leading to hypomyelination and reduced axon conduction (Padovani-Claudio et al., 2006). In vitro, CXCL1 synergizes with PDGF, another important developmental and injury-related molecule, to potently enhance PDGF-induced OPC proliferation (Robinson et al.,

1998; Wu et al., 2000). However, CXCL1 can inhibit PDGF-induced OPC migration, again suggesting it affects OPC positioning (Vora et al., 2012).

16 In the adult CNS, CXCL1 can protect OLs from apoptosis during viral-induced demyelination (Hosking et al., 2010) and CXCL1 over-expression reduced the severity of experimental allergic encephalomyelitis (EAE), an animal model of MS

(Omari et al., 2009). It should be noted, however, that at least one study showed that CXCR2 inhibition reduced lesion severity and increased remyelination in the

EAE model (Kerstetter et al., 2009), although the treatment likely affected immune cells in addition to OPCs. CXCR2 expression has been detected on human OLs and CXCL1 is expressed by reactive astrocytes and microglia in human MS lesions, setting the stage for CXCL1 to influence repair in human demyelination (Filipovic et al., 2003; Omari et al., 2005, 2006).

TGFβ is another cytokine/growth factor commonly found in CNS inflammatory environments and, based on early in vitro experiments, has long been suspected to influence OPC differentiation (McKinnon et al., 1993). Recently, in vivo loss/gain of function studies confirmed that TGFβ1 induces OPC differentiation and contributes to developmental myelination of subcortical white matter by

SMAD3/4, Fox01 and Sp1-mediated effects on cell cycle (Palazuelos et al.,

2014). Consistent with these findings, the macrophage-derived TGFβ family member activin-A was recently found to enhance OPC differentiation, both in vitro and in ex vivo demyelinated cerebellar slice cultures (Miron et al., 2013).

Numerous other factors associated with inflammatory lesions including PDGFα,

FGF, EGF, IGF, glutamate, semaphorins, and neurotrophins (BDNF/NT3) all can positively and/or negatively regulate OL lineage cell responses (Rosenberg et al.,

17 2006; Patel and Klein, 2011; Piaton et al., 2011; He and Lu, 2013; Lampron et al., 2015).

Toll-like receptor 4

“Inflammation” is a broad-based term that involves multiple cell types, ligands and their intracellular signaling pathways. One extensively studied inflammatory receptor and intracellular signaling pathway is TLR4, a pattern recognition receptor expressed predominantly on innate immune cells (e.g., microglia and blood monocytes). This highly conserved innate immune receptor, originally identified as Toll in Drosophila (Gay and Keith, 1991), recognizes both exogenous pathogen-associated molecular patterns (PAMPs) and endogenous proteins released from damaged tissues, i.e., damage-associated molecular patterns (DAMPs). Lipopolysaccharide (LPS), a cell surface protein on gram- negative bacteria, is an extensively studied activator of TLR4 and is used extensively in the work described in this dissertation (Poltorak et al., 1998).

TLR4 is made up of an extracellular domain with leucine-rich repeats, a transmembrane domain and a cytoplasmic Toll/IL-1 receptor (TIR) domain (Kigerl et al., 2014; Trotta et al., 2014). Upon ligand binding at the extracellular domain, the TIR domain recruits adaptor proteins that activate downstream signaling pathways. Indeed, TLR4 activation results in the activation of two distinct signaling pathways: myeloid differentiation primary response gene 88 (MyD88) dependent and MyD88 independent. The MyD88 dependent pathway is

18 responsible for releasing the inhibition of NFκB allowing for nuclear translocation and subsequent production of inflammatory factors (Medzhitov et al., 1997).

Alternatively, the MyD88 independent signaling pathway activates interferon regulatory factor 3 via TIR-domain-containing adaptor inducing interferon-β

(TRIF) and TRAM (TRIF-related adaptor molecule), which results in the production of anti-viral type I interferons (Yamamoto et al., 2003).

A primary role of TLR4 is to recognize PAMPs then signal inflammatory and bactericidal effector functions that will destroy the inciting pathogen. In “sterile” lesions of the CNS, including trauma and demyelination, these same functions can be elicited by DAMPs such as heme, HMGB1, heat shock proteins and fibronectin (Kigerl and Popovich, 2009; Trotta et al., 2014). DAMP-mediated activation of TLR4 (and other TLRs) can cause bystander damage of CNS parenchyma; however, OL lineage cells can also be positively affected by concomitant changes in release of select cytokines together with enhanced phagocytosis and changes in iron uptake or storage. Part of the explanation may lie in a time-dependent change in macrophage polarization (Kigerl et al., 2009;

David and Kroner, 2011; Miron et al., 2013).

Activating TLR4 is associated with enhanced OPC proliferation and differentiation into new OLs in vivo

While some studies have shown that activating TLR4 causes OL death (Lehnardt et al., 2002; Felts, 2005; Pang et al., 2010; Jeong et al., 2013; Zhang et al.,

19 2013), ex vivo and in vitro data indicate that TLR4-activated microglia also can induce oligodendrogenesis (Miron et al., 2013; Shigemoto-Mogami et al., 2014).

Recent work from our lab has highlighted key in vivo effects of activating TLR4 on OPC migration, proliferation and differentiation. For example, in vivo intraspinal TLR4 activation causes robust OPC migration, proliferation, and differentiation into new OLs with/adjacent to areas of florid inflammation dominated by activated microglia/macrophages (Schonberg et al., 2007; 2012).

These effects occur despite evidence of acute OL and OPC toxicity and without notable axon demyelination (Goldstein et al., unpublished data). Similar effects were noted in a unique model of intraspinal inflammatory excitotoxicity (Kigerl et al., 2012). In this model, LPS-dependent release of glutamate killed spinal neurons but numbers of OPCs and OLs were increased (Kigerl et al., 2012).

These effects appear to be specific to TLR4 activation; similar in vivo activation of TLR2 also induces robust microglia/macrophage activation but without augmenting OPC proliferation or OL replacement (Schonberg et al., 2007). OL lineage cells do not express TLR4 (or TLR2); therefore TLR4-induced oligodendrogenesis must be initiated by activating local microglia or macrophages. Indeed, when macrophages were activated with a TLR4 agonist ex vivo then grafted into the intact rat spinal cord white matter, host OPCs rapidly migrated to and wrapped processes around the macrophages within 24h, and by

6 days had proliferated profusely and integrated with the transplanted macrophages (Schonberg et al., 2012). Recent studies in our lab have also revealed that TLR4 deficiency after spinal cord injury (SCI) significantly blunts the

20 OPC response and reduces the normally robust OL replacement (Church et al.,

2016). This demonstrates that post-SCI TLR4 signaling augments endogenous repair, which is consistent with prior work showing that tissue loss and functional deficits after SCI are exacerbated by TLR4 deficiency (Kigerl et al., 2007).

Iron: an essential yet dangerous element

While it is clear that cytokines and growth factors play a major role in oligodendrogenesis and myelination, the important role of iron must not be overlooked. Indeed, iron is an essential element to all mammalian cells, and thus plays a major role in basic CNS functions. For example, iron is a cofactor for oxygen transport, lipid metabolism, gene regulation and DNA synthesis (Cairo et al., 2006). Therefore, iron is needed for such essential processes as neurotransmitter synthesis and myelin production in the CNS. Iron, however, is also highly reactive, and is therefore under strict homeostatic control by a myriad of iron metabolism proteins (Table 1). In general, these proteins can be organized into 5 groups based on function: transport, import, storage, export, and oxidation. These proteins act in concert to mobilize iron in low iron conditions, and store iron in over-abundant conditions. However, when iron levels get too high or too low to be regulated by these proteins, deleterious effects ensue.

21

Iron Protein Function Ceruloplasmin Ferroxidase: Fe(II)Fe(III) Divalent metal transporter 1 (DMT1) Iron importer: non-transferrin & non- haem bound iron Ferritin heavy chain Cytosolic iron storage component & ferroxidase Ferritin light chain Cytosolic iron storage component Ferroportin Iron exporter Hepcidin Binds, internalizes and degrades ferroportin Transferrin Iron binding protein & transporter Transferrin receptor Iron importer: binds and internalizes transferrin Table 1. Iron metabolism proteins.

Macrophage iron metabolism

Macrophages play a leading role in the metabolism and homeostatic control of iron (Figure 3). Accordingly, macrophages have numerous mechanisms for iron intake. The primary mechanism of macrophage iron intake is through the phagocytosis of damaged or senescent erythrocytes, which contains iron in the form of hemoglobin. Once inside the phagosome, heme is released from hemoglobin by proteolytic enzymes. Then, heme oxygenase (HO-1) breaks down heme into iron, biliverdin and carbon monoxide (Poss and Tonegawa, 1997).

HO-1 also liberates iron from heme that is endocytosed by scavenger receptors

CD163 and CD91 (Nielsen et al., 2010). An additional method of iron uptake is

22 through the transferrin receptor, which is endocytosed upon ligation with transferrin-bound iron (Harding et al., 1983). Because transferrin-bound iron is not associated with heme, HO-1 is not responsible for the liberation of iron from transferrin. Instead, the low pH of the endosome allows for the dissociation of iron from transferrin (Dautry-Varsat et al., 1983). Next, iron is transported out of either the endosome or phagosome by the iron transporters, natural resistance- associated macrophage proteins (Nramp)-1 and -2. In addition to cytoplasmic iron transport, Nramp2 (also known as DMT-1) is also expressed on the cell membrane and can take in free extracellular iron (Ludwiczek et al., 2003). Once iron is cytoplasmic, it is then either shuttled to the mitochondria, for energy production, ferritin for safe storage, or to ferroportin, the iron exporter. Although the chaperones that transport iron safely throughout the cytoplasm are largely unknown, poly (rC)-binding protein 1 (PCBP1) is responsible for transporting iron to ferritin (Shi et al., 2008). Once iron is exported via ferroportin, ceruloplasmin, a ferroxidase, is responsible for safely oxidizing iron so that it can be bound to extracellular transferrin (Musci et al., 2014).

23

Figure 3. Macrophage iron metabolism. Major proteins that regulate iron import, storage and export in macrophages.

The polarization of macrophages induces differences in iron metabolism. For example, classically activated macrophages (M1) are well characterized for their iron retention phenotype, which is considered a bacteriostatic response (see below). The primary mechanism of iron retention in M1 macrophages is mediated by hepcidin, which induces the internalization and degradation of ferroportin.

Indeed, the acute phase cytokine IL-6 initiates hepcidin production in response to an inflammatory stimulus (Wrighting and Andrews, 2006). However, an increase

24 in ferritin is also characteristic of M1 macrophages (Recalcati et al., 2012).

Conversely, alternatively activated macrophages (M2) display an iron mobilization phenotype, characterized by an increased level of ferroportin.

Because M2 macrophages increase expression of heme receptors CD163 and

CD91, elevated uptake of heme-bound iron results in increased transcription of

HO-1 and ferroportin (Delaby et al., 2008; Cairo et al., 2011). The subsequent release of transferrin-bound iron can then contribute to tissue repair.

Interestingly, the iron status of macrophages can also dictate the phenotype and function of macrophages. One example of this is in chronic venous leg ulcers, where macrophages that accumulate iron display an unrestrained M1 phenotype, characterized by production of TNFα and hydroxyl radicals. These iron-loaded macrophages are unable to transform into M2 macrophages, thus inhibiting the wound healing process (Sindrilaru et al., 2011). After SCI, iron-loaded macrophages also appear to produce elevated levels of TNFα, which further pushes macrophages to an M1 phenotype (Kroner et al., 2014). Additionally, iron uptake by M1 macrophages induces a “super” M1 phenotype, while iron uptake by M2 macrophages induces a rapid shift to TNFα-producing M1 macrophages (Mehta et al., 2013; Kroner et al., 2014). Therefore, it is clear that the iron status of macrophages plays a significant role in polarization, likely via activation of NFκB (She et al., 2002).

CNS iron accumulation

25 In the CNS, iron accumulation is associated with deleterious effects in numerous cases. In diseases such as Alzheimer’s, Parkinson’s, and Huntington’s disease, iron accumulates in various brain regions. While it is unclear if iron accumulation initiates neuronal loss or if iron accumulates as a result of neuronal loss, once iron levels overwhelm the iron metabolism proteins, further toxicity commences

(Zecca et al., 2004). To study isolated iron accumulation in the CNS, numerous experiments have directly injected iron into the brain or spinal cord. The subsequent and progressive neuronal and glial toxicity is unquestioned

(Armstrong et al., 2001; McDonald et al., 2002; Uttara et al., 2009; Caliaperumal et al., 2012). In CNS trauma, disruption in iron homeostasis occurs as a result of a mechanical insult causing vascular disruption and subsequent hemorrhage.

Excess iron from extravagated red blood cells and cellular debris cause damage by activating pro-inflammatory macrophages, inducing mitochondrial dysfunction, and the formation of reactive oxygen species (ROS) (Williams et al., 2012). In

SCI, iron accumulates and persists for at least 4 weeks, undoubtedly exacerbating damage and inhibiting repair (Rathore et al., 2008; Liu et al., 2003;

Blomster et al., 2012).

Iron and inflammation regulate OL lineage cells in development, disease, and injury

Although an overabundance of iron is deleterious, iron is a necessary element for

OL lineage cells. Differentiation of OPCs into mature myelinating OLs during

26 development is iron-dependent. At birth, microglia are the highest iron containing cells in the CNS. Over the first two post-natal weeks, microglia release intracellular iron, which is taken up by differentiating OPCs (Connor et al., 1995).

Iron is an essential co-factor for enzyme functions during this transition, including enzymes involved in proliferation, energy production and myelin protein and lipid synthesis (Connor and Menzies, 1996; Larkin and Rao, 1990). Thus, this developmental iron transfer from microglia to OPCs is essential, and iron deficient diets lead to hypomyelination (Franco et al., 2015; Todorich et al.,

2009). Interestingly, hypomyelination resulting from iron deficiency decreases total myelin and is not specific to individual myelin proteins (i.e. the composition and distribution of proteins normally found in myelin are not affected) (Larkin and

Rao, 1990). This indicates iron deprivation impairs the metabolic processes within oligodendrocytes controlling myelin output instead of affecting the production of specific lipids or proteins (Todorich et al., 2009). Importantly, the

World Health Organization estimates that >30% of the world population suffers from iron deficiency, which will negatively impact brain development and myelination in these populations.

Oligodendrogenesis in the adult CNS also requires iron and may recapitulate the developmental cross talk between microglia and OPCs. For instance, data from our lab showed that intraspinal activation of TLR4 initiates OPC proliferation and differentiation – an effect that requires iron since an iron chelator significantly reduced new OL formation (Schonberg and McTigue, 2009). In this model, TLR4-

27 activated microglia contained high levels of iron and the iron storage protein ferritin 1 day after TLR4 activation. However, 7 days after TLR4 activation, iron and ferritin levels were high in newly formed OLs. Direct transfer of iron- containing ferritin from macrophages to OPCs in vivo was revealed using fluorescently tagged ferritin, showing that activated macrophages serve as an iron source for OPCs in the adult CNS (Schonberg et al., 2012). This work sheds light on a potential immune signaling mechanism that could be used to replace lost OPCs and OLs after demyelinating CNS injury and disease.

Because iron is important to OL formation and myelination, it is logical that effective myelin repair will require proper iron regulation. Indeed, iron efflux from astrocytes is required for spontaneous remyelination after lysolecithin demyelination and iron recycling is enhanced in astrocytes in pre-clinical models of MS (Schulz et al., 2012; Zarruk et al., 2016). How iron and inflammation promote myelination may be explained by cytokine-dependent effects on iron storage and release. In vitro, iron loaded microglia release H-ferritin, a ferroxidase and component of the iron storage molecule ferritin (Zhang et al.,

2006). Additionally, data by Schulz et al. (2012) show that iron efflux from astrocytes regulates microglial expression of TNFα and IL-1β.

While it is clear that iron influences inflammatory cytokine production, the reverse is also true. For instance, Rathore et al. (2012) showed that cytokines differentially regulate expression of iron importers and exporters in astrocytes and microglia. Treating astrocytes or microglia with TNFα induced an iron

28 retention phenotype by increasing iron uptake and reducing iron efflux.

Conversely, TGFβ induced astrocytes to release iron but, similar to TNFα, induced an iron retention phenotype in microglia. Thus, cytokines act as key regulators of intracellular iron status in the CNS.

In addition to bidirectional regulation between cytokines and intracellular iron, growth factors can act synergistically with iron molecules to enhance myelin production. Espinosa-Jeffrey et al. (2002) showed that co-injecting IGF-1 and transferrin into the corpus callosum of P4 myelin-deficient rats increased MBP+ fibers two weeks later. These data highlight the importance of considering expression of inflammatory molecules and growth factors in conjunction with iron status to understand how inflammation, iron and glial interactions collectively may benefit OL lineage cells and myelination during development or disease.

TLR4-mediated “microbial defense”

Just as iron is an essential element for oligodendrogenesis, myelination, and basic cellular functions, it is also an essential element for microbial cells. For this reason, the immune system evolved a host defense mechanism that sequesters iron away from invasive pathogens (Nairz et al., 2010). Not surprisingly, TLR4 is activated by invasive pathogens, which initiates changes in iron proteins that induce iron sequestration. For example, TLR4-activated macrophages increase expression of DMT-1, but decrease transferrin receptor, which enhances the uptake of free iron (Kim and Ponka, 2000; Ludwiczek et al., 2003). Additionally,

29 monocytes and neutrophils produce hepcidin after TLR4 activation, which causes ferroportin internalization and breakdown thereby decreasing iron export

(Peyssonnaux et al., 2006; Theurl et al., 2008). Interestingly, the iron regulatory response to microbes is dependent on the specific localization of the pathogen.

For example, iron is sequestered from extracellular pathogens by an increase hepcidin expression. However, the role of ferroportin is reversed for intracellular microbes such as Salmonella. In this case, ferroportin expression increases and iron is exported as a means to deprive the intracellular microbe of the essential iron (Nairz et al., 2013).

Based on the iron-chelating properties of TLR4-activated immune cells, it is feasible that CNS macrophages can act similarly and sequester iron in response to TLR4 activation. Indeed, TLR4-activated microglia increase DMT-1 and hepcidin expression (Urrutia et al, 2013). Therefore, harnessing the iron- chelating qualities of TLR4-activated CNS macrophages has the potential to reduce iron-mediated cytotoxicity in CNS trauma and disease.

Summary

Oligodendrocytes are responsible for myelination in the CNS, and are lost in both

CNS disease and trauma. Remyelination restores function after demyelinating insults, however, this process is often incomplete. Although inflammation is responsible for OL loss, it can also benefit repair processes. Therefore, work in this dissertation explores how activation of one inflammatory pathway, TLR4, influences OL lineage cells. In the second chapter, transcription of cytokines and

30 growth factors with known effects on OL lineage cells are quantified after intraspinal and microglial TLR4 activation. In the third chapter, novel oligodendrogenic factors transcribed by TLR4-activated microglia are uncovered.

Then, in the fourth chapter, TLR4-mediated iron sequestration is induced; however, this does not reduce cytotoxicity and impairs OL replacement. Overall, the work in this dissertation provides a role for TLR4-mediated inflammation in both detrimental and beneficial effects on OL lineage cells. Thus, broad-spectrum approaches to enhance or inhibit inflammation are likely not effective therapeutic interventions for demyelination CNS insults.

31 Chapter 2: TLR4-activated microglia express factors known to influence OL

lineage survival and oligodendrogenesis

Abstract

Inflammation is a ubiquitous feature of CNS injury or disease that can cause or exacerbate ongoing cytotoxicity, but also benefits repair processes. Consistent with this divergent nature of inflammation, intraspinal toll-like receptor 4 (TLR4) activation, an innate immune pathway, kills oligodendrocyte (OL) lineage cells, but also initiates oligodendrogenesis. However, the mechanisms that initiate these changes are unclear. Because OL lineage cells do not express TLR4, we hypothesized that these effects are mediated by factors secreted by microglia, the primary TLR4-expressing cells in the CNS. To test this hypothesis, TLR4 was activated in vivo or in microglial cultures with the TLR4 agonist, lipopolysaccharide (LPS). At various time points, RNA was isolated and transcriptional changes of factors known to influence OL lineage cell responses were quantified. Intraspinal LPS injection increased transcription of factors that promote OL loss (TNFα, iNOS, and IL-1α), and decreased transcription of anti- apoptotic factor, IGF1. Nevertheless, intraspinal LPS injection also increased transcription of factors that promote OL progenitor cell (OPC) proliferation

32 (PDGF-A and CXCL1), and differentiation (IL-6, LIF, CNTF, IL-1β, CXCL12, and

TGFβ). Interestingly, microglial TLR4 activation only induced transcriptional changes in TNFα, iNOS, IL-1α, CXCL1, IL-6, LIF, and IL-1β, indicating that other cell types are responsible for many in vivo effects. Collectively, these data reveal the transcriptional timeline of various factors that correspond with TLR4-induced

OL loss and oligodendrogenesis. Further research will determine if these factors are viable therapeutic targets to reduce OL loss and enhance remyelination after

CNS injury.

33

Introduction

Oligodendrocytes (OL), the myelinating cells of the CNS, provide structural and metabolic support to axons while enhancing conduction velocity (Nave and

Warner, 2014; Bercury and Macklin, 2015). In CNS disease and trauma, OL apoptosis results in demyelination and axonal injury, leading to functional deficits

(Nave, 2010). Because OLs are post-mitotic, remyelination occurs through generation of new OLs from a pool of adult progenitor cells (OPC) (Keirstead and

Blakemore, 1997; Crawford et al., 2014). This process, named oligodendrogenesis, is a multi-step progression by which OPCs proliferate and differentiate into mature OLs with the capacity to myelinate.

Inflammation is a ubiquitous feature of CNS trauma and disease that can induce or exacerbate oxidative damage. However, inflammation also benefits repair processes after CNS injury, including oligodendrogenesis and remyelination

(Goldstein et al., 2016). One extensively studied inflammatory receptor and signaling pathway is toll-like receptor 4 (TLR4), a pattern recognition receptor expressed predominantly on innate immune cells (e.g., microglia and blood monocytes). TLR4 is activated by numerous ligands present in a CNS injury environment, such as fibronectin, heat shock proteins, and HMGB1 (Kigerl and

Popovich, 2009). Upon ligation, TLR4 signaling results in the production of numerous cytokines and chemokines, reactive oxygen and nitrogen species, as well as glutamate (Trotta et al., 2014). Depending on the expression patterns of

34 these factors, TLR4-mediated inflammation can have either beneficial or detrimental effects on CNS injuries and diseases. In cerebral stroke models, genetic inhibition of TLR4 signaling reduces lesion size and neurotoxicity (Caso et al., 2007; Hua et al., 2007). Alternatively, inhibition of TLR4 signaling reduces amyloid removal in Alzheimer’s disease (Tahara et al., 2006), and exacerbates white matter pathology after spinal cord injury (SCI) (Kigerl et al., 2007).

Consistent with this divergent nature of TLR4 signaling, intraspinal or microglial

TLR4-activation kills OL lineage cells, but also initiates oligodendrogenesis

(Lehnardt et al., 2002; Schonberg et al., 2007; Miron et al., 2013; Shigemoto-

Mogami et al., 2014; Goldstein et al., in preparation). Because OL lineage cells do not express TLR4, these effects are likely mediated by factors secreted by microglia.

Many factors secreted by microglia have known effects on OL lineage cells

(Schmitz and Chew, 2008). For instance, peroxynitrite induces OL lineage cell apoptosis whereas platelet-derived growth factor subunit A (PDGF-A) is an essential mitogenic factor (Noble et al., 1988; Raff et al., 1988; Nicholas et al.,

2001; Li et al., 2005). Numerous studies detail the transcriptome and secretome of TLR4-activated microglia and macrophages; however, the majority of this work has been conducted in mice, and in vivo studies are scarce (Duke et al., 2004;

Meissner et al., 2013; Das et al., 2015).

Therefore, this work addresses the hypothesis that TLR4 activation of microglia induces transcription of factors that influence survival, proliferation, and

35 differentiation of OL lineage cells in rats. To investigate this hypothesis, complementary in vitro and in vivo studies were carried out. Lipopolysaccharide

(LPS) was used to activate TLR4 in primary microglial cultures, and LPS was microinjected into the intact adult rat spinal cord to stimulate microglia. At various times after LPS administration, mRNA was isolated from either microglia or spinal cord homogenate, and quantitative real time polymerase chain reaction

(qRT-PCR) was performed.

Our results show that TLR4 activation orchestrates the transcription of multiple factors that regulate OL lineage dynamics. Acutely, TLR4-activated spinal cord and microglia transcribe factors that cause OL loss. However, transcription of factors that initiate OPC proliferation and differentiation, are also elevated after

TLR4 activation, and may explain the TLR4-induced oligodendrogenesis reported previously (Schonberg et al., 2007; Miron et al., 2013). Furthermore, differences between intraspinal and microglia transcription indicate that multiple cell types contribute to in vivo TLR4-mediated inflammation. Overall, these data detail the transcriptional timeline of various factors after TLR4 activation, providing cellular and molecular targets to limit OL loss and enhance oligodendrogenesis after

CNS injury.

Methods

Intraspinal LPS Microinjections

36 All surgical and postoperative care procedures were performed in accordance with The Ohio State University Institutional Animal Care and Use Committee.

Adult female Sprague-Dawley rats (~250 grams; n = 15) were anesthetized with an intra-peritoneal injection of ketamine (80mg/kg) and xylazine (10mg/kg).

Using aseptic technique, a laminectomy was performed at the T8 vertebral level.

UV-sterilized glass micropipettes, beveled to a diameter between 25-40µm, were pre-loaded and positioned 0.7mm lateral from the midline. Using a hydraulic micropositioner (David Kopf Instruments, Tujunga, CA) pipettes were lowered

1.1mm into the spinal cord. A 200nl bolus injection was administered bilaterally into the lateral gray-white matter border using a PicoPump (World Precision

Instruments). Injection sites were labeled with tissue paint, muscles surrounding the laminectomy were sutured, skin was stapled with wound clips, and rats were given 5cc sterile saline (subcutaneous) before being placed in a warmed recovery cage. Rats were randomly assigned to injection groups at the time of injection.

Tissue Processing

At 1, 3 and 7 days post microinjection, rats (n = 4 per group) were deeply anesthetized and transcardially perfused using ice-cold 0.1M DEPC-PBS. A

2mm segment of thoracic spinal cord centered on the injection site was then dissected. Immediately following the dissection, cords were homogenized in

TRIzol (Life Technologies) and frozen.

Neonatal microglia cultures

37 Neonatal microglia were cultured as previously described with some modifications (McCarthy and De Vellis 1980; Giulian and Baker 1986). Briefly,

P1-P2 rat pups were decapitated and sub-cortical regions and meninges were separated from the cortex. The cortical regions were then digested in a 0.1% trypsin solution for 30 min, and triturated after addition of 60 µl/ml DNase I and

5% FBS. Cells were then plated on 75cm2 cell culture flasks coated with 100

µg/ml poly-L-lysine. The mixed glial cultures were maintained for 10d in DMEM with 10% FBS, 1% glutamax, and 0.5% gentamycin, with 100% media changes at 3 and 6d. On 10d, cultures were vigorously shaken for 15 hours on a rotary shaker incubator (250rpm). After shaking, oligodendrocyte progenitors and microglia were separated by plating the cells in uncoated plastic wells, which only microglia adhere to. The following day, microglia were stimulated with either fresh control media, or media with LPS (100ng/ml; Sigma) for 6 or 24 hours.

Quantitative real-time PCR

TRIzol reagent was used to extract RNA from tissue or neonatal microglia following the manufacturer’s protocol (Life Technologies). RNA was then reverse transcribed using SuperScript II (Invitrogen) to generate cDNA. Quantitative real- time PCR was performed using gene-specific primers to measure mRNA levels in the stimulated microglia. PCR product was measured using SYBR Green fluorescence using an Applied Biosystems 7900HT Fast Real-Time PCR System.

The sequences for primers used were: 18S (F) TTCGGAACTGAGGCCATGAT,

(R) TTTCGCTCTGGTCCGTCTTG; TNFα (F) TGATCCGAGATGTGGAACTGG,

38 (R) CGATCACCCCGAAGTTCAGTAG; IGF1 (F)

GACCCGGGAACGTACCAAAAT, (R) CAAGCAGAGTGCCAGGTAGA; iNOS (F)

TTGGTGAGGGGACTGGACTTT, (R) CCGTGGGGCTTGTAGTTGA; IFNγ (F)

CACGCCGCGTCTTGGT (R) TCTAGGCTTTCAATGAGTGTGCC; LIF (F)

TCCCACCTTTCCATGCCAAT, (R) AGGTACGCGACCATCCGATA; IL-6 (F)

CTGGAGTTCCGTTTCTACCTGG, (R) TGGTCCTTAGCCACTCCTTCTG; LIF

(F) TCCCACCTTTCCATGCCAAT, (R) AGGTACGCGACCATCCGATA; IL-1β (F)

GAAGATGGAAAAGCGGTTTG, (R) AACTATGTCCCGACCATTGC; CNTF (F)

CTCCAAGTTTCTGCCTTTGCC, (R) TCTTGTAGGACCTTCAAGCCC; CXCL12

(F) GTGTGAGTCAGACGCCTGAGG, (R) AAGTGGCTATGGGCCCTTCCC;

TGFβ (F) GACCGCAACAACGCAATCTA, (R) GCTTCCCGAATGTCTGACGTA;

PDGF-A (F) TGTGCCCATTCGCAGGAAGAG, (R)

TTGGCCACCTTGACACTGCG; CXCL1 (F) CAGACAGTGGCAGGGATTCA, (R)

TGACTTCGGTTTGGGTGCAG. Gene expression relative to the housekeeping gene 18S was analyzed using the comparative CT method (Schmittgen and

Livak, 2008). Significance was reported when p < 0.05 after running a one-way

ANOVA with Tukey post hoc test.

Results

TLR4 activation induces transcriptional changes in factors that affect OL survival

Acute TLR4 activation kills OLs in vivo and in vitro via soluble factors released from microglia (Lehnardt et al., 2002; Pang et al., 2003; Schonberg et al., 2007;

39 Felts et al., 2008). To determine if factors known to kill OLs (TNFα, iNOS and

IFNγ) were transcribed after TLR4 activation, qRT-PCR was performed on LPS- injected spinal cords and LPS-stimulated microglia (Vartanian et al., 1995; Li et al., 2005; Zhang et al., 2005; Li et al., 2008). Intraspinal TLR4 activation increased tumor necrosis factor alpha (TNFα) mRNA ~14-fold, and inducible nitric oxide synthase (iNOS) mRNA ~550-fold at 1d compared with vehicle treatment (Fig. 4 A, B). In vitro, TLR4-activated microglia also increased transcription of these two factors, with TNFα transcription peaking at 6h (~15- fold), while iNOS transcription gradually increased from ~1000-fold at 6h to

~4000-fold at 24h (Fig. 4 D, E). Transcription of interferon gamma (IFNγ), a cytokine implicated in the pathogenesis of multiple sclerosis, did not significantly change after either in vivo or in vitro TLR4 activation (Fig. 4 C, F).

Figure 4. In vivo and in vitro TLR4 activation induced transcriptional changes in factors responsible for OL apoptosis. qRT-PCR on LPS-injected spinal cord homogenate (A-C), or LPS-stimulated microglia (D-F) measured the (Continued)

40 (Fig. 4 Continued) relative mRNA expression of A, D) tumor necrosis factor alpha (TNFα), B, E) inducible nitric oxide synthase (iNOS), and C, F) interferon gamma (IFNγ). Data represent mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001 versus naïve, unless otherwise noted.

Interleukin-1 alpha (IL-1α) impairs OL survival after SCI by down-regulating Tox3 in OLs, an anti-apoptotic transcription factor (Bastien et al., 2015). After intraspinal TLR4 activation, IL-1α transcription increased ~40-fold compared to vehicle injection at 1d (Fig. 5 A). IL-1α transcription was still increased at 7d compared to vehicle (~12-fold), however this was significantly reduced compared to 1d post LPS injection. Similarly, in vitro microglial IL-1α transcription increased

~500-fold and ~2000-fold 6h and 24h after TLR4 activation; however these data were not statistically significant (Fig. 5 C).

41

Figure 5. In vivo and in vitro TLR4 activation induced transcriptional changes in factors that influence OL survival. qRT-PCR on LPS-injected spinal cord homogenate (A-B), or LPS-stimulated microglia (C-D) measured the relative mRNA expression of A, C) interleukin-1 alpha (IL-1α), and B, D) insulin-like growth factor 1 (IGF1). Data represent mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001 versus naïve, unless otherwise noted.

Unlike TNFα, IFNγ, iNOS and IL-1α, insulin-like growth factor 1 (IGF1) promotes the survival of OLs after injury (Barres et al., 1992; Mason et al., 2000; Cao et al.,

2003; Lin et al., 2005). After intraspinal LPS microinjection, IGF1 transcription was significantly reduced at 1d, but returned to baseline by 3d (Fig. 5 B). In microglia in vitro, transcription of IGF1 was significantly reduced at both 6 and

42 24h after TLR4 activation (Fig. 5 D). Combined, these data support previous findings of TLR4-induced OL loss by increasing transcription of factors that contribute to OL apoptosis, while concurrently decreasing factors that protect against OL apoptosis.

TLR4 activation induces transcriptional changes in factors that initiate OPC proliferation

In addition to acute OL loss, TLR4 activation stimulates OPC proliferation as early as 72h (Schonberg et al., 2007; Miron et al., 2013). To determine if mitogenic factors are expressed after TLR4 activation, transcription of two well- studied OPC mitogenic factors, PDGF-A and chemokine (C-X-C motif) ligand 1

(CXCL1), was assessed (Noble et al., 1988; Raff et al., 1988; Robinson et al.,

1998; Wu et al., 2000). At 1d after intraspinal LPS microinjection, PDGF-A expression increased significantly (2-fold) compared to vehicle injection and a modest yet significant increase was sustained at 7d post LPS injection (Fig. 6 A).

Interestingly, an increase of PDGF-A expression was not recapitulated in TLR4- activated microglia, suggesting that cells other than microglia propagate in vivo transcription of PDGF-A after TLR4 activation (Fig. 6 C). CXCL1 transcription increased ~125-fold 1d post intraspinal TLR4 activation compared to vehicle treatment and later time points (Fig. 6 B). Similarly, TLR4-activated microglia increased transcription of CXCL1 ~200-fold at both 6 and 24h (Fig. 6 D).

Together, these data suggest that microglia and other cell types contribute to

TLR4-induced OPC proliferation.

43

Figure 6. In vivo and in vitro TLR4 activation increased transcription of factors that initiate OPC proliferation. qRT-PCR on LPS-injected spinal cord homogenate (A-B), or LPS-stimulated microglia (C-D) measured the relative mRNA expression of A, C) platelet-derived growth factor subunit A (PDGF-A), and B, D) chemokine (C-X-C motif) ligand 1 (CXCL1). Data represent mean ± SEM. *p < 0.05; ***p < 0.001 versus naïve, unless otherwise noted.

TLR4 activation induces transcriptional changes in factors that promote OPC differentiation

In addition to OL loss and OPC proliferation, intraspinal LPS injection results in an accumulation of mature OLs by 7d, indicative of enhanced OPC differentiation

(Schonberg et al., 2007). Again, this response is likely caused by secreted

44 factors from microglia because conditioned media from activated microglia increased OPC differentiation after 3d in vitro (Miron et al., 2013). One potential family of candidate molecules that induce OL differentiation is the interleukin-6

(IL-6) family of cytokines, which are produced by microglia (Mayer et al., 1994;

Marmur et al., 1998; Zhang et al., 2004; Talbott et al., 2007). Thus, we examined if TLR4 activation of rat spinal cords or if microglia changes expression of these factors. After intraspinal TLR4 activation, there was a significant increase of IL-6

(~100-fold) and leukemia inhibitory factor (LIF; ~70-fold) mRNA transcription at

1d compared to vehicle treatment and later LPS time points (Fig. 7 A, B).

However, ciliary neurotrophic factor (CNTF) mRNA was significantly elevated ~2- fold at 3d (Fig. 7 C). Similarly, TLR4-activated microglia in vitro also increased transcription of IL-6 and LIF but not CNTF, indicating that microglia likely contribute to the in vivo transcription of IL-6 and LIF, but not CNTF (Fig. 7 D-F).

Figure 7. In vivo and in vitro TLR4 activation induced transcriptional changes IL- 6 family of cytokines. qRT-PCR on LPS-injected spinal cord (Continued) 45 (Fig. 7 Continued) homogenate (A-C), or LPS-stimulated microglia (D-F) measured the relative mRNA expression of A, D) interleukin 6 (IL-6), B, E) leukemia inhibitory factor (LIF), and C, F) ciliary neurotrophic factor (CNTF). Data represent mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001 versus naïve, unless otherwise noted.

Next, IL-1β transcription was examined due to its beneficial role in promoting

OPC differentiation and remyelination (Mason et al., 2001; Vela et al., 2002).

Here, IL-1β transcription peaked 1d after intraspinal LPS injection (~150-fold) and was reduced by 3 and 7d (although still ~40-fold and ~20-fold higher than control, respectively; Fig. 8 A). TLR4-activated microglia in vitro also increased transcription of IL-1β compared to control microglia at 6h and 24h (~20-30-fold;

Fig. 8 B).

Figure 8. In vivo and in vitro TLR4 activation increased IL-1β mRNA transcription. qRT-PCR on LPS-injected spinal cord homogenate (A), or LPS- stimulated microglia (B) measured the relative mRNA expression of interleukin 1 beta (IL-1β). Data represent mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001 versus naïve, unless otherwise noted.

46 CXCL12 is another factor present in the injured CNS that enhances OPC differentiation and myelination (Imitola et al., 2004; Kadi, 2006). Here, CXCL12 transcription did not change 1d or 3d after intraspinal LPS injection. By 7d,

CXCL12 transcription increased ~3-fold compared to control tissue (Fig. 9 A). As expected from in vivo results, TLR4-activated microglia do not increase transcription of CXCL12, suggesting that microglia do not directly contribute to the in vivo increase of CXCL12 transcription (Fig. 9 B).

Figure 9. In vivo TLR4 activation increased CXCL12 mRNA transcription. qRT- PCR on LPS-injected spinal cord homogenate (A), or LPS-stimulated microglia (B) measured the relative mRNA expression of chemokine (C-X-C motif) ligand 12 (CXCL12). Data represent mean ± SEM. **p < 0.01; ***p < 0.001 versus naïve, unless otherwise noted.

Investigators have suspected that TGFβ plays a role in OPC differentiation based on in vitro experiments (McKinnon et al., 1993). Now, in vivo loss/gain of function experiments have confirmed that TGFβ1 induces OPC differentiation that results in subcortical white matter developmental myelination (Palazuelos et al., 2014). After intraspinal TLR4 activation, TGFβ transcription increased ~2.5-

47 fold and remained significantly elevated through 7d (Fig. 10 A). Microglia likely do not contribute to this increase because TLR4-activated microglia did not increase transcription of TGFβ in vitro (Fig. 10 B).

Figure 10. In vivo TLR4 activation increased TGFβ mRNA transcription. qRT- PCR on LPS-injected spinal cord homogenate (A), or LPS-stimulated microglia (B) measured the relative mRNA expression of transforming growth factor beta (TGFβ). Data represent mean ± SEM. **p < 0.01; ***p < 0.001 versus naïve, unless otherwise noted.

Unlike the factors discussed previously, bone morphogenetic protein 2 (BMP2) blocks the expression of olig1 and olig2 transcription factors thereby inhibiting

OPC differentiation (Mekki-Dauriac et al., 2002; Cheng et al., 2007). Here, we show that intraspinal TLR4 activation increased BMP2 transcription ~4-fold at 1d, which then returned to control levels by 3 and 7d (Fig. 11 A). Again, TLR4- activated microglia did not change BMP2 expression, indicating that in vivo changes of BMP2 likely are not directly microglia-dependent (Fig. 11 B).

48

Figure 11. In vivo TLR4 activation increased BMP2 mRNA transcription. qRT- PCR on LPS-injected spinal cord homogenate (A), or LPS-stimulated microglia (B) measured the relative mRNA expression of bone morphogenetic protein 2 (BMP2). Data represent mean ± SEM. **p < 0.01; ***p < 0.001 versus naïve, unless otherwise noted.

Discussion

In CNS trauma and disease, extensive remyelination occurs following robust oligodendrogenesis (Patrikios et al., 2006; Powers et al., 2012, Hesp et al.,

2015). Nevertheless, incomplete remyelination or remyelination failure is common in multiple sclerosis (MS) and experimental autoimmune encephalomyelitis (EAE), even with ample amounts of cells capable of forming new oligodendrocytes (Linington et al., 1992; Patrikios et al., 2006; Patani et al.,

2007). Furthermore, reports of unmyelinated axons over 1 year post SCI, combined with enhanced functional outcomes and enhanced remyelination after cell transplantations indicate that remyelination is a viable therapeutic target

(Keirstead et al., 2005; Totoiu and Keirstead, 2005; Tetzlaff et al., 2011).

Therefore, strategies to benefit outcomes after demyelinating CNS events should

49 target both stages of oligodendrogenesis and/or OL survival. Because endogenous remyelination is usually effective, understanding the mechanisms that regulate this process will help to develop therapeutic targets in cases of remyelination failure.

TLR4-mediated inflammation is an important aspect of demyelinating CNS events, because it affects numerous stages of myelin damage and repair that can be therapeutically targeted. Nevertheless, the exact mechanisms regulating these TLR4-mediated effects on OL lineage cells are not fully understood. This work provides a timeline of transcriptional changes in numerous factors that are likely to play a role in TLR4-mediated effects on OL lineage cells. Furthermore, it identifies which factors are produced by direct microglial activation of TLR4.

Although comparisons between in vivo and in vitro experiments allows for the delineation of specific microglial effects after TLR4 activation, certain caveats are important to consider in the interpretation of this data. First, microglial cultures were established from neonatal rats whereas in vivo experiments were conducted on adult rats. Furthermore, microglial cultures were isolated from the brain whereas microinjections were done in the spinal cord. Lastly, neonatal microglia were isolated from a mix of female and male rats whereas in vivo experiments were performed on only female rats. Because microglia display age, regional and sex-dependent heterogeneity, it is likely that microglia in the LPS- injected spinal cord respond differently than neonatal microglia (Schnell et al.,

1999; Schell et al., 2007; Lenz and McCarthy, 2015).

50 Another caveat to the interpretation of this work is that only transcriptional changes were examined, which does not account for any post-transcriptional modifications that might occur. One likely source of post-transcriptional modifications is by microRNAs (miRs). Upon hybridization to target mRNA, miRs either initiate mRNA degradation or repress translation. Indeed, TLR4-activated macrophages upregulate or downregulate numerous miRs (ie. miR-146a, miR-

155, miR-132, miR-21, miR-9, miR125b, let-7e, and miR-27b; Nahid et al., 2011).

Although many of the targets for TLR4-induced miRs modulate translation of

TLR4 signaling proteins, miR 125b directly targets TNFα mRNA for degradation

(Till et al., 2007). Therefore, future studies will need to verify that TLR4-induced transcriptional changes result in corresponding changes in protein levels.

The primary purpose of the immune system is to kill invading pathogens to stop the spread of infection. Therefore, it is understandable that inflammation contributes to bystander damage in the context of CNS injury and disease.

Indeed, intraparenchymal TLR4 activation results in acute OL loss; however, the mechanisms for this loss are unclear (Lehnardt et al., 2002; Schonberg et al.,

2007). In vitro evidence suggests that inflammatory cytokines and oxidative factors such as TNFα, IFNγ, and peroxynitrite kill OL lineage cells, and are also produced by microglia (Vartanian et al., 1995; Li et al., 2005; Kawanokuchi et al.,

2006; Li et al., 2008; Pang et al., 2010). Here we identify TNFα and peroxynitrite as microglia-derived factors that contribute to TLR4-induced OL loss in vivo.

Although peroxynitrite levels were not directly measured, iNOS produces

51 superoxide and nitric oxide, which then react to form peroxynitrite (Xia and

Zweier, 1997).

The data suggest that IFNγ does not contribute to TLR4-induced OL loss as transcription was not induced by intraspinal or microglial TLR4 activation. This is not surprising as T-cells and natural killer cells are the primary producers of IFNγ

(Schoenborn and Wilson, 2007). Furthermore, IFNγ production in T-cells and microglia is dependent on the synergistic stimulation by interleukin 18 and 12 (IL-

18 & IL-12; Tominaga et al., 2000; Kawanokuchi et al., 2006). Although IL-18 and

IL-12 levels were not quantified here, TLR4-activated mouse macrophages increase production of IL-12, but not IL-18 (Meissner et al., 2013). Combined, these findings indicate that TLR4 activation is not a major contributor of IFNγ in

CNS lesions.

In cases of CNS injury and disease, cytotoxicity is initiated via necrotic and apoptotic mechanisms. In fact, TNFα induces apoptotic OL loss (Akassoglou et al., 1998). As a means to combat apoptosis, cells express anti-apoptotic and survival factors that can induce mitogenic effects, induce anti-apoptotic genes, or inhibit pro-apoptotic factors (Portt et al., 2011). TOX high-mobility group box family member 3 (Tox3) is an anti-apoptotic transcription factor that protects neurons and OLs from apoptotic cell death (Dittmer et al., 2011; Bastien et al.,

2015). Recently, IL-1α knockout mice were found to have increased levels of

Tox3 in OLs, indicating that IL-1α likely contributes to apoptotic OL loss. Like

Tox3, IGF1 also prevents OL apoptosis; however, IGF1 is a growth factor

52 produced by microglia (Ueno et al., 2013). Although the exact mechanism is unknown, IGF1 likely prevents apoptosis by activating the phosphatidylinositol 3- kinase/Akt pathway, which results in the production of anti-apoptotic genes and inhibition of pro-apoptotic factors (Mason et al., 2000; Fernández et al., 2004).

Here, intraspinal and microglial TLR4 activation increased transcription of IL-1α and decreased transcription of IGF1 acutely, providing further mechanistic rational for acute TLR4-induced OL loss.

Despite acute OL loss, robust OPC proliferation is initiated after intraspinal TLR4 activation (Schonberg et al., 2007). PDGF-A, a well-characterized mitogen for

OPCs, is elevated at 1 and 7d after intraspinal LPS injection, and likely contributes to OPC proliferation (Raff et al., 1988; Richardson et al., 1988).

However, PDGF-A is not transcribed after microglial TLR4-activation, indicating that the in vivo increase in transcription is likely caused by other cell types.

Interestingly, PDGF-induced OPC proliferation is synergistically enhanced by

CXCL1 (Robinson et al., 1998; Wu et al., 2000). Here, transcription of both

PDGF-A and CXCL1 are elevated after intraspinal TLR4 activation, which might explain the robust proliferation of OPCs (Schonberg et al., 2007). Indeed, these two factors play important roles during development as transgenic inhibition of either signaling pathway results in reduced OL lineage cells as well as hypomyelination (Fruttiger et al., 1999; Padovani-Claudio et al., 2006).

Furthermore, both factors play a role in CNS injury. For example, CXCL1 protected OLs from apoptosis during viral-induced demyelination (Hosking et al.,

53 2010) and CXCL1 over-expression reduced the severity of experimental allergic encephalomyelitis (EAE), an animal model of MS (Omari et al., 2009).

Additionally, over-expression of PDGF-A promoted OL survival and remyelination after cuprizone-induced demyelination (Vana et al., 2007). Thus, it is clear that

PDGF-A and CXCL1 are viable targets for improving remyelination and TLR4 activation is a possible route to regulate these factors.

Although OPC proliferation is an important step in oligodendrogenesis, the accumulation of OPC in demyelinated lesions indicates that impaired differentiation of OPCs is the main cause of remyelination failure (Franklin and ffrench-Constant, 2008). One explanation for impaired OPC differentiation is a lack of factors that promote OPC differentiation. Indeed, many factors promote

OPC differentiation both in vitro and in vivo. For example, IL-1β enhances OPC differentiation in vitro, which might explain why IL-1β knockout mice have impaired remyelination after cuprizone-induced demyelination (Mason et al.,

2001; Vela et al., 2002). Additionally, members of the IL-6 cytokine family,

CXCL12, and TGFβ, all promote OPC differentiation and remyelination in various in vitro and in vivo models (McKinnon et al., 1993; Mayer et al., 1994; Marmur et al., 1998; Stankoff et al., 2002; Zhang et al., 2004; Kadi et al., 2006; Talbott et al., 2007; Marriott et al., 2008; Ishibashi et al., 2009; Deverman and Patterson,

2012; Palazuelos et al., 2014). Here, data reveal that intraspinal TLR4 increased the transcription of all of these factors at some point within 7d, implicating all of these factors in TLR4-induced OL accumulation. Interestingly, microglial TLR4

54 activation did not increase the transcription of some factors (CNTF, CXCL12, &

TGFβ), which correlated with later transcriptional increases in vivo.

Because most sites of demyelination have concomitant inflammation, and thus express many of the aforementioned factors, the presence of factors that inhibit

OPC differentiation is an alternative explanation for impaired OPC differentiation and ensuing remyelination failure. Here, the data show that transcription of one such factor, BMP2, is increased in response to intraspinal TLR4 activation. BMP2 induces the expression of ID (inhibitor of DNA binding) proteins, which then bind to transcription factors, blocking their activity. In OPCs, BMP2 initiates production of ID2, which then inhibits OLIG2, an essential transcription factor for numerous

OL proteins (Mekki-Dauriac et al., 2002; Cheng et al., 2007). Because BMP2 transcription is only elevated at 1d post intraspinal TLR4 activation, oligodendrogenesis can still proceed at later time points. Nevertheless, these data indicate that inhibition of BMP2 is a viable target to enhance remyelination.

Another important finding of this work is that microglial TLR4 activation does not increase transcription of many oligodendrogenic factors transcribed after intraspinal TLR4 activation. This indicates that other cell types respond directly to LPS or factors released from TLR4-activated microglia. Although numerous reports confirm that microglia are the dominant TLR4-expressing cells in the

CNS, TLR4 is also expressed on astrocytes, endothelial cells, and neurons

(Bsibsi et al., 2002; Bowman et al., 2003; Taylor et al., 2004; Acosta and Davies,

2008; Leow-Dyke et al., 2012). Indeed, many of the transcriptional changes after

55 intraspinal TLR4 activation can be explained by astrocyte transcription as PDGF-

A, CNTF, CXCL12, TGFβ, and BMP2 are all produced by astrocytes (Raff et al.,

1988; De Groot et al., 1999; Imitola et al., 2004; Tripathi and McTigue 2008;

Patel et al., 2010; Hu et al., 2012). However, the timeline of in vivo CXCL12 and

CNTF transcription suggests that paracrine signaling is responsible for the delay.

To determine if astrocytes respond directly to LPS or if they respond to paracrine factors produced by TLR4-activated microglia, purified cultures of astrocytes should be stimulated with LPS or with conditioned media from TLR4-activated microglia. Alternatively, targeted deletion of TLR4 from microglia or astrocytes using clustered regularly interspaced short palindromic repeats (CRISPR) genomic editing tools will help to delineate which factors are produced by direct

TLR4 activation of microglia or astrocytes in vivo.

Overall, this work demonstrates that TLR4-activated microglia transcribe factors that reduce OL survival, and enhance OPC proliferation and differentiation. This work also details the timeline of transcriptional changes that occur after intraspinal TLR4 activation, which provides mechanistic rationale for TLR4- induced effects on OL lineage cells (Schonberg et al., 2007). Due to the number of oligodendrogenic factors that are transcribed after intraspinal TLR4 activation but not microglial TLR4 activation, it is evident that microglia are not the only cells that contribute to oligodendrogenesis. Furthermore, it is important to keep in mind that these data only indicate changes in RNA transcription and thus does not take into account post-transcriptional modulators such as microRNAs.

56 Therefore, future studies are necessary to confirm changes at the protein level.

Additionally, the factors studied here only scratch the surface of factors that influence OL lineage cells, known and unknown. Nevertheless, these data provide both cellular and trophic targets for reducing OL loss and enhancing remyelination after CNS injury.

57 Chapter 3: CSF3 & IL-7 are novel oligodendrogenic factors produced by

TLR4-activated macrophages/microglia

Abstract

Oligodendrocyte (OL) loss and demyelination is a feature of numerous CNS diseases and injuries. Because OLs are post-mitotic, remyelination must be achieved through proliferation and differentiation of an endogenous pool of OL progenitor cells (OPCs), in a process termed oligodendrogenesis. Interestingly, intraspinal activation of toll-like receptor 4 (TLR4), a major immune receptor, initiates robust oligodendrogenesis. Soluble factors released from microglia are known to initiate oligodendrogenesis, however, many of these factors have no known effects on OL lineage cells. Colony stimulating factor 3 (CSF3) and interleukin 7 (IL-7) were identified as factors produced by TLR4-activated macrophages, microglia and spinal cord that might contribute to OPC proliferation or differentiation. Thus, to test the hypothesis that CSF3 or IL-7 initiate oligodendrogenesis, rats received a 500nl intraspinal injection of recombinant rat CSF3 or IL-7 into the intermediate gray/white matter (GM/WM) border. Compared to vehicle injections, CSF3 injection increased OPC proliferation in the GM, and IL-7 injection increased OPC differentiation in the

WM. Interestingly, CSF3 and IL-7 initiated distinct microglial responses, indicating that these factors also activate microglia. Collectively, this work

58 demonstrates that CSF3 and IL-7 are novel oligodendrogenic factors that are transcriptionally regulated by TLR4. Future work will determine the cellular targets of CSF3 and IL-7 in the CNS, and function-blocking experiments will assess the contribution of these factors in TLR4-mediated oligodendrogenesis.

Nevertheless, the oligodendrogenic effects of these factors make them ideal targets for enhancing remyelination in CNS injury and disease.

59

Introduction

Oligodendrocytes, the myelinating cells of the CNS, are vulnerable in injury environments due to their high metabolic rate and low anti-oxidant levels

(Thorburne and Juurlink, 1996). For example, after traumatic SCI, OLs that survive the primary trauma are then exposed to secondary injury cascades including robust inflammation, iron accumulation, excitotoxicity, ischemia, and free radicals (Profyris et al., 2004; Sauerbeck et al., 2013). These secondary injury cascades cause demyelination and a prolonged period of OL apoptosis

(Gledhill et al., 1973; Gledhill and McDonald, 1977; Harrison and McDonald,

1977; Balentine and Paris, 1978; Banik et al., 1980; Blight, 1983 & 1985; Crowe et al., 1997). Because OLs are post-mitotic, remyelination must be achieved through proliferation and differentiation of an endogenous pool of OPCs, in a process termed oligodendrogenesis. Indeed, oligodendrogenesis and remyelination occur after SCI (Gledhill et al., 1977; Blight, 1985; Tripathi and

McTigue, 2007; Powers et al., 2012; Hesp et al., 2015).

A cocktail of secreted factors present in an injury environment greatly contributes to oligodendrogenesis (Miron et al., 2013; Shigemoto-Mogami et al., 2014).

These factors originate from a variety of cell types, but CNS macrophages are likely a major source due to their large numbers in the post-SCI injury environment (Popovich et al., 1997; Fleming et al., 2006). Intraspinal activation of

TLR4, an inflammatory receptor present on CNS macrophages, stimulates robust

60 OPC proliferation and differentiation (Schonberg et al., 2007). The exact mechanism of TLR4-induced oligodendrogenesis is unclear. However, culturing

OPCs in conditioned media from TLR4-activated microglia initiates OPC proliferation, implicating soluble factors as a primary mechanism (Miron et al.,

2013).

The transcriptome and secretome of TLR4-activated macrophages is vast, and has been characterized extensively in mice. Indeed, mass spectrometric analysis found 775 unique proteins present in the supernatant of LPS-stimulated bone marrow derived macrophages (BMDMs) (Meissner et al., 2013). Although many factors expressed by TLR4-activated macrophages have documented effects on oligodendrogenesis, it is likely that other factors also contribute to TLR4- mediated oligodendrogenesis.

In this experiment, a PCR array for 84 unique cytokines, chemokines, and growth factors compared mRNA transcription in control versus TLR4-activated macrophages. TLR4 activation increased macrophage transcription of granulocyte colony stimulating factor (CSF3) and interleukin 7 (IL-7), factors with unknown effects on OL lineage cells. Interestingly, CSF3 promotes neutrophil genesis, whereas IL-7 promotes T cell proliferation and differentiation (Welte et al., 1985; Chakraborty et al., 1996; Brugnera et al., 2000; Li et al., 2006; Boudil et al., 2014). Thus, to test the hypothesis that CSF3 or IL-7 initiate oligodendrogenesis, rats received a 500nl intraspinal injection of recombinant rat

CSF3 or IL-7 into the intermediate gray/white matter (GM/WM) border. Spinal

61 cords were compared to those receiving vehicle (PBS) alone. Results show that

CSF3 increased OPC proliferation, while IL-7 increased OPC differentiation.

Interestingly, CSF3 and IL-7 initiated distinct microglial responses, suggesting that the effects on OPCs are indirect. However, expression of pSTAT3 in microglia and OPCs after CSF3 injection suggests that both cell types might respond directly to CSF3.

Collectively, these data suggest that CSF3 and IL-7 contribute to TLR4-mediated oligodendrogenesis. Although injection of these factors induced changes in microglia, future work is required to determine if oligodendrogenic effects are direct or indirect. Nevertheless, this work provides previously unexplored factors to target in demyelinating CNS disease or trauma.

Methods

Bone marrow derived macrophage cultures (BMDM)

Adult rat BMDMs were generated using a modified protocol described previously

(Longbrake et al., 2007). Briefly, bilateral femurs and tibias were dissected from adult Sprague Dawley rats. Using a 23 gauge needle, bone marrow was flushed into sterile conical tubes using a syringe filled with ice cold DMEM. Cells were then triturated into a single cell solution, and red blood cells were lysed in a lysis buffer (0.15M NH4Cl, 10mM KHCO3, 0.1mM Na2EDTA, pH 7.4). After washing, cells were plated at 1x106 cells per ml of DMEM supplemented with 10% FBS,

20% L929 supernatant, 0.5% gentamycin, 1% HEPES, 1% glutamax, and

62 0.001% β-mercaptoethanol. Supernatant from L929 cells contains macrophage colony stimulating factor (CSF1) required to drive bone marrow cells to differentiate into macrophages by (Burgess et al., 1985). After 7 days in vitro

BMDMs were re-plated into wells with DMEM, supplemented with 10% FBS, 1% glutamax, and 0.25% gentamycin. The following day, BMDMs were stimulated with either fresh control media, or media with LPS (100ng/ml; Sigma, 0111:B4) for 24 hours.

Cytokine/growth factor PCR array

RNA from untreated or LPS-treated BMDMs was purified using the RNeasy Mini

Kit following the manufacturers protocol (Qiagen). DNA contamination was then eliminated using the RNase-Free DNase Set (Qiagen). Next, cDNA was generated by reverse transcription using the RT2 First Strand Kit (Qiagen).

Finally, cDNA was combined with RNase-free water and RT2 SYBR Green

Mastermix and added to custom designed RT2 Profiler PCR Array plates with 84 unique cytokine, chemokine and growth factor primer pairs (Qiagen). PCR product was measured by SYBR Green fluorescence using an Applied

Biosystems 7900HT Fast Real-Time PCR System. RNA expression (normalized to housekeeping genes) was calculated in LPS-treated BMDMs compared to untreated BMDMs using the comparative CT method (Schmittgen and Livak,

2008). Fold-changes were only reported if the SYBR Green fluorescence

63 threshold was reasonably high in one sample and reasonably low in the other sample (i.e., low in untreated BMDMs and high in LPS-treated BMDMs).

Neonatal microglia cultures

Microglia were cultured as previously described, but with some modifications

(McCarthy and De Vellis 1980; Giulian and Baker 1986; Zhang et al., 2005).

Briefly, P1-P2 rat pups were decapitated and sub-cortical regions and meninges were separated from the cortex. The cortical regions were then digested in a

0.1% trypsin solution for 30 minutes, and triturated after addition of 60 µg/ml

DNase I and 5% FBS. Cells were then plated on 75cm2 cell culture flasks coated with 100µg/ml poly-L-lysine. The mixed glial cultures were maintained for 10 days in DMEM with 10% FBS, 1% glutamax, and 0.5% gentamycin, with 100% media changes on days 3 and 6. On day 10, cultures were vigorously shaken for 15 hours on a rotary shaker incubator (250rpm). After shaking, oligodendrocyte progenitors and microglia were separated by plating the cells in uncoated plastic wells, which only microglia adhere to. The following day, microglia were either given fresh control media, or media with LPS (100ng/ml; Sigma, 0111:B4) for 24 hours.

Spinal cord surgeries

All surgical and postoperative care procedures were performed in accordance with The Ohio State University Institutional Animal Care and Use Committee.

Adult female Sprague-Dawley rats (225-250 grams) were anesthetized with an

64 intra-peritoneal injection of ketamine (80mg/kg) and xylazine (10mg/kg). Using aseptic technique, a laminectomy was performed at the T8 vertebral level.

Intraspinal microinjections

UV-sterilized glass micropipettes, beveled to a diameter between 25-40µm, were positioned 0.7mm lateral from the midline. Pipettes were pre-loaded with LPS

(1mg/ml; Sigma, 0111:B4), recombinant rat CSF3 (100µg/ml; Peprotech), recombinant rat IL-7 (100µg/ml; R&D) or sterile 0.1M PBS (vehicle). Using a hydraulic micropositioner (David Kopf Instruments, Tujunga, CA) pipettes were lowered 1.1mm into the spinal cord. For recombinant cytokine experiments, a

500nl bolus injection was administered to the lateral gray-white matter border using a PicoPump (World Precision Instruments). For LPS experiments, a 200nl bolus injection was administered bilaterally in the lateral gray-white matter border. Injection sites were labeled with sterile charcoal. Back muscles surrounding the laminectomy were then sutured, skin was stapled with wound clips, and rats were given 5cc sterile saline (subcutaneously) before being placed in a warmed recovery cage.

Spinal cord contusion injuries

Rats (n = 4-5 per time point) received a moderate (150kDyne force) spinal contusion injury using the Infinite Horizons device (Precision Instruments).

Following back muscle suturing wound clip application and saline injection, animals were placed in a warmed recovery cage. Prophylactic antibiotics

65 (gentamicin, 5mg/kg) and sterile saline were administered for 5 days post injury.

Bladders were manually voided twice per day until spontaneous voiding returned.

Bromodeoxyuridine administration

A thymidine analog 5-bromo-2-deoxyuridine (BrdU) (50mg/kg, in sterile saline;

Roche) was used to label proliferating cells in recombinant cytokine experiments.

Rats were given an i.p. injection of BrdU at 1 and 4 hours post-microinjection and once a day until perfusion date.

Tissue processing: immunohistochemistry

Three days after recombinant cytokine injections, rats were deeply anesthetized and then perfused transcardially with 4% paraformaldehyde (PFA) in PBS.

Spinal cords were carefully removed and post-fixed for an additional 2 hours.

Following an overnight incubation in 0.2M PB, spinal cords were cryoprotected in a 30% sucrose solution for 48-72 hours. 8mm segments of spinal cord centered on the injection site were then cut and frozen on dry ice. Once frozen, cords were embedded in OCT (Electron Microscopy Sciences) and the blocks were frozen on dry ice. Spinal cord cross-sections were cut at 10µm using a cryostat, and mounted onto slides. Tissue was stored at -20°C until use.

Tissue processing: mRNA extractions

Spinal cord injured (1, 3, 7, 14, 28, & 42d) or intraspinal LPS-injected (1, 3, & 7d) rats were deeply anesthetized and transcardially perfused using ice-cold 0.1M

DEPC-PBS. A 2mm segment of thoracic spinal cord centered on the injury

66 epicenter or injection site was then dissected. Immediately following the dissection, cords were homogenized in TRIzol (Life Technologies) and frozen.

Quantitative real-time PCR

TRIzol reagent was used to extract RNA from tissue or cells following the manufacturers protocol (Life Technologies). RNA was then reverse transcribed using SuperScript II (Invitrogen) to generate cDNA. Quantitative real-time PCR was performed using gene-specific primers to measure mRNA expression. PCR product was measured by SYBR Green fluorescence using an Applied

Biosystems 7900HT Fast Real-Time PCR System. The sequences for primers used were: 18S (F) TTCGGAACTGAGGCCATGAT, (R)

TTTCGCTCTGGTCCGTCTTG; CSF3 (F) CCTGCCTTTGCCCCGAAGCT (R)

TGGCACACAGCTGCTCCAGC; IL-7 (F) TGGAATTCCTCCCCTGATCCT (R)

CCCAAAGGCTTTACCGTCCT; CSF3R (F) TTGAAGGAGCCAACTGGACC (R)

GGGTGTAAACTGGGGCTTGA; IL-2Rγ (F) GAGCCGCTTTAACCCGATCT (R)

CTCCCCCAGTGGATTGGTTG. Gene expression relative to the housekeeping gene 18S was analyzed using the comparative CT method (Schmittgen and

Livak, 2008). Significance was reported when p < 0.05 after running a one-way

ANOVA with Tukey post hoc test.

Immunohistochemistry

Briefly, slides were rinsed with 0.1M PBS followed by blocking of nonspecific antigens with 4% BSA/0.1% Triton-100/PBS (BP+) for 1 hour. Primary antibodies were then applied overnight at 4°C. After more rinses, biotinlyated secondary

67 antibodies were applied for 1h at room temperature. Endogenous peroxidase activity was then quenched using a 4 to 1 mixture of methanol and 30% hydrogen peroxide. Then, biotinylated secondary antibodies were visualized using Elite-ABC (Vector Laboratories) with DAB or SG as a substrate (Vector). In some instances, tissue was counter-stained with methyl green or neutral red.

Last, slides were dehydrated in ethanol and coverslipped with Permount (Fisher).

Sections labeled for BrdU were incubated in 2N HCl at 37°C for 25 minutes prior to primary antibody incubations. Primary antibodies: Ox42 (CD11b on CNS macrophages - 1:2000 – Serotec), NG2 (OPCs - 1:200 – Millipore), CC1 (OLs -

1:500 - Abcam), GFAP (astrocytes - 1:4000 - Sigma), BrdU (proliferating cells -

1:200 - DSHB), and pSTAT3 (1:200 – Cell Signaling).

Microscopy and quantitative analysis

All data are reported as mean ± SEM and analyses were performed in a blinded manner. Fluorescent images of double-labeled ferritin/Ox42 cells were captured using an Olympus FV1000 laser scanning confocal microscope, and processed with the corresponding Fluoview software. A Zeiss Axioskop 2 Plus microscope with a Sony 970 three-chip color camera was used to capture and analyze bright- field images. To quantify macrophage density in the ipsilateral cord, low power images (5x) were digitized and manually outlined using the MCID Elite imaging software (Imaging Research Inc., Canada). Proportional area was calculated as the area of Ox42 immunoreactivity, divided by outlined tissue area.

68 Cell counts for CC1, NG2, and NG2/BrdU were manually collected at high magnification (40x) using 0.02mm2 reticule boxes. For all quantifications, counts from 3 serial sections centered on the injection site were averaged. For OL and

OPC counts, one 0.02mm2 reticule box in the ventral/intermediate GM and three non-overlapping 0.02mm2 reticule boxes in the WM directly adjacent to GM were reported as “lesion.” For all analyses, data are expressed as the number of cells per cubed millimeter.

Because NG2 is also expressed on other cell types, conservative OPC counts were conducted based on morphological criteria. A single- or double-labeled

OPC was only counted if the NG2 expression surrounded an identifiable nucleus in a single plane of focus and possessed multiple NG2-expressing processes.

Because astrocytes can also express CC1, OLs were only counted if the CC1 expressing profile did not touch or co-express GFAP. Occasionally, NG2+ and

CC1+ profiles were verified at higher magnification (64x).

All statistical analysis and graphs were generated in Prism 5.0 (GraphPad

Software Inc.). Quantitative differences between groups were analyzed using a one-way ANOVA followed by Tukey’s post hoc test. An unpaired t-test was used whenever two groups were compared. Significance was set at p<0.05.

Results

PCR array reveals genes differentially expressed in BMDMs after TLR4 activation

69 After intraspinal LPS injection or LPS stimulation of microglia, mRNA expression of many oligodendrogenic factors is affected (see chapter 2; Schonberg et al.,

2007; Miron et al., 2013; Shigemoto-Mogami et al., 2014). While many factors have known effects on OL lineage cells, there are 775 unique proteins secreted from TLR4-activated murine macrophages, making it likely that other factors also contribute to TLR4-mediated oligodendrogenesis. To determine factors differentially regulated by TLR4-activated macrophages in rats, BMDMs were given fresh media with or without LPS (100ng/ml) for 24 hours. PCR arrays for cytokines, chemokines, and growth factors revealed 6 genes with up-regulated mRNA transcription and 13 genes with down-regulated mRNA transcription in the

LPS-treated BMDMs compared to the unstimulated cells. The six up-regulated genes were: macrophage colony stimulating factor (CSF1), granulocyte colony stimulating factor (CSF3), interleukin 1 alpha (IL-1α), interleukin 1 beta (IL-1β), interleukin 7 (IL-7), and vascular endothelial growth factor B (VEGF-B) (Table 2).

Up-regulated gene Fold Change CSF1 9.49 CSF3 14.03 IL-1α 6.98 IL-1β 8.59 IL-7 16.50 VEGF-B 5.60 Table 2. TLR4-activated BMDMs increased transcription of cytokines and growth factors. PCR array data are presented as increased mRNA fold change of LPS- stimulated BMDMs compared with control BMDMs.

70 The 13 down-regulated genes were: artemin (ARTN), bone morphogenetic protein 2 & 3 (BMP2/3), epidermal growth factor (EGF), fibroblast growth factor 1,

8, 10 & 13 (FGF1/8/10/13), insulin like growth factor 2 (IGF2), left-right determination factor 1 (LEFTY1), transforming growth factor beta 3 (TGFβ3), vascular endothelial growth factor C (VEGF-C), and zinc finger protein 91

(ZFP91) (Table 3).

Down-regulated gene Fold Change ARTN -3.56 BMP2 -3.46 BMP3 -5.98 EGF -53.33 FGF1 -3.10 FGF8 -9.51 FGF10 -3.25 FGF13 -6.23 IGF2 -30.63 LEFTY1 -4.00 TGFβ3 -4.14 VEGF-C -5.82 ZFP91 -4.96 Table 3. TLR4-activated BMDMs decreased transcription of cytokines and growth factors. PCR array data are presented as decreased mRNA fold change of LPS-stimulated BMDMs compared with control BMDMs.

The majority of these genes have no known effects on OL lineage cells.

Furthermore, to determine factors that might initiate oligodendrogenesis, only factors that were up-regulated were considered for further study. Of the up-

71 regulated factors, IL-1α and IL-1β are the only two factors with known effects on

OL lineage cells. IL-1α impairs OL survival (Bastien et al., 2015), whereas IL-1β initiates OPC differentiation and remyelination (Mason et al., 2001; Vela et al.,

2002). Of the remaining up-regulated factors, we chose to investigate CSF3 and

IL-7 because they had the highest increase in mRNA transcription and no known effects on OL lineage cells.

CSF3 and IL-7 transcription is increased in TLR4-activated BMDMs, microglia and spinal cords

Because PCR arrays were not run in duplicates, independent confirmation of array results was necessary. To verify the PCR array findings, BMDMs were given media with or without LPS (100ng/ml) for 24 hours. Quantitative real-time

PCR revealed a 2-fold increase of CSF3 mRNA in LPS-stimulated BMDMs compared to control BMDMs (Fig. 12 A). Similarly, IL-7 mRNA was increased 4- fold after TLR4 activation (Fig. 12 B).

Figure 12. Bone marrow derived macrophages increased CSF3 and IL-7 mRNA after TLR4 activation. qRT-PCR on LPS-stimulated BMDMs (A-B) measured the relative mRNA expression of A) colony stimulating factor 3 (CSF3), (Continued)

72 (Fig. 12 Continued) and B) interleukin 7 (IL-7). Data represent mean ± SEM. **p < 0.01; ****p < 0.0001 versus control.

Microglia are resident macrophages of the CNS, and are likely the first to respond to intraspinal TLR4 activation. Additionally, supernatant from TLR4- activated microglia stimulates OPC proliferation (Miron et al., 2013). To determine if microglia react similarly to BMDMs, isolated neonatal microglia were treated with media with or without LPS (100ng/ml) for 24 hours. Quantitative real- time PCR revealed a 2-fold increase of both CSF3 and IL-7 mRNA after TLR4 activation (Fig. 13 A-B). These data confirm that both CNS macrophage cell types respond similarly to TLR4 activation.

Figure 13. Neonatal microglia increased CSF3 and IL-7 mRNA after TLR4 activation. qRT-PCR on LPS-stimulated microglia (A-B) measured the relative mRNA expression of A) colony stimulating factor 3 (CSF3), and B) interleukin 7 (IL-7). Data represent mean ± SEM. **p < 0.01 versus control.

Finally, to determine if CSF3 and IL-7 mRNA transcription increased after in vivo

TLR4 activation, LPS was microinjected bilaterally into the thoracic spinal cord.

Quantitative real-time PCR revealed that CSF3 mRNA increased ~24-fold, 1d

73 after intraspinal TLR4 activation, then returned to control levels by 3d (Fig. 14 A).

Alternatively, IL-7 mRNA increased ~3-fold compared to vehicle treatment, which was significantly increased at 3d post TLR4 activation (Fig. 14 B). These data indicate that CSF3 and IL-7 are expressed after in vivo TLR4 activation, and might contribute to TLR4-induced oligodendrogenesis.

Figure 14. Intraspinal CSF3 and IL-7 mRNA increased after intraspinal TLR4 activation. qRT-PCR on LPS-injected spinal cord homogenate (A-B) measured the relative mRNA expression of A) colony stimulating factor 3 (CSF3), and B) interleukin 7 (IL-7). Data represent mean ± SEM. *p < 0.05; ***p < 0.001 versus vehicle control.

Intraspinal CSF3 injection induces OPC proliferation

To determine if CSF3 or IL-7 initiated OPC proliferation, CSF3 (100µg/ml), IL-7

(100µg/ml), or sterile PBS (vehicle) was microinjected into the intermediate

GM/WM border, and NG2/BrdU cells were counted (Fig 15. A-B).

Bromodeoxyuridine (BrdU) was administered daily to label all proliferating cells.

74 As expected, vehicle injections had minimal effect on OPC proliferation in the injection site at 3d (~50-100 cells/mm3) (Fig. 15 C-E). Interestingly, CSF3 injection sites induced a 3-fold increase in proliferating OPCs (~300 cells/mm3) compared to vehicle or IL-7 injections (~100 cells/mm3), suggesting that CSF3 initiates OPC proliferation (Fig. 15 C). Furthermore, this increase in NG2/BrdU cells was primarily driven by proliferating OPCs in the GM injection site (Fig. 4 D-

E).

Figure 15. CSF3, but not IL-7 induces OPC proliferation in the injection site at 3d. A) Diagram of a spinal cord cross-section, indicating the targeted intermediate GM/WM border injection site (grey circle). B) Representative image of NG2 (dark blue) and BrdU (brown) cells (red arrows) in CSF3 injection site. The number of NG2/BrdU-positive OPCs was quantified 3d after vehicle, CSF3 or IL-7 injection in the combined GM/WM injection site (C), the GM injection site (D), and the WM injection site (E). Data represent mean ± SEM. *p < 0.05, **p < 0.01 vs. vehicle control unless indicated otherwise. Scale Bar: (B) 30µm.

75 Intraspinal or microglial TLR4-activation initiates oligodendrogenesis, but also kills OL lineage cells (Schonberg et al., 2007; Shigemoto-Mogami et al., 2014;

Miron et al., 2013; Lehnardt et al., 2002). Therefore, to test if CSF3 or IL-7 impact

OPC survival, we counted total NG2 cells in the injection site at 3d (Fig. 16 A).

Compared to vehicle injections, there were no significant differences in total

OPCs at the injection site, despite a slight increase in OPCs after CSF3 injection

(~2000 vs. ~2500 cells/mm3) (Fig. 16 B). This increase was again driven largely by changes in the GM injection site (~3000 vs. ~6000 cells/mm3) (Fig. 16 C).

However, there were significantly more OPCs after CSF3 injection compared to

IL-7, in both the grey matter and total injection site. Combined, these data do not rule out the possibility of acute OPC loss after CSF3 injection, because OPC proliferation could replace any lost OPCs by 3d. However, IL-7 does not appear to influence OPC survival, as both OPC proliferation and total OPCs were at control levels.

76

Figure 16. CSF3 and IL7 do not significantly change OPC number compared to vehicle control at 3d. A) Representative image of an NG2 (dark blue)-positive OPC (red arrow) counterstained with neutral red. The total number of NG2- positive OPCs was quantified 3d after vehicle, CSF3 or IL-7 injection in the combined GM/WM injection site (B), the GM injection site (C), and the WM injection site (D). Data represent mean ± SEM. *p < 0.05 vs. IL-7. Scale Bar: (A) 20µm.

Intraspinal IL-7 injection induces OPC differentiation

To test if CSF3 or IL-7 altered OL survival or OPC differentiation, total CC1 OLs were counted at 3d post-injection (Fig 17. A). Interestingly, CSF3 injection had the same number of OLs as control (~4000 cells/mm3), indicating that CSF3- induced OPC proliferation did not lead to OPC differentiation, at least by 3d (Fig

17 B). In the WM injection site, IL-7 increased total OLs compared to vehicle and

77 CSF3, which resulted in an increase in the overall numbers (Fig 17 B-D). These data indicate that IL-7 induced OPC differentiation, and thus may be one of many factors that contribute to TLR4-induced oligodendrogenesis.

Figure 17. IL-7 enhances OPC differentiation in the injection site at 3d. A) Representative image of CC1 (brown) and GFAP (black) cells counterstained with methyl green. The total number of CC1-positive, GFAP-negative OLs was quantified 3d after vehicle, CSF3 or IL-7 injection in the combined GM/WM injection site (B), the GM injection site (C), and the WM injection site (D). Data represent mean ± SEM. **p < 0.01, ***p < 0.001 vs. vehicle control unless indicated otherwise. Scale Bar: (A) 50µm.

Intraspinal CSF3 and IL-7 activate CNS macrophages

Although CSF3 and IL-7 are expressed by CNS macrophages, it is unclear if these factors directly or indirectly initiate changes in OL lineage cells. In the periphery, CSF3 receptor (CSF3R) is primarily expressed on monocytes and

78 granulocytes, whereas IL-7 receptor alpha (IL-7Rα) is primarily expressed on lymphocytes (Boneberg et al., 2000; Mazzucchelli and Durum, 2007). In the

CNS, CSF3R is expressed on neurons and microglia, but expression of IL-7Rα has not been explored in naïve tissue (Schneider et al., 2005; Guo et al., 2013).

To determine if CNS macrophages respond to CSF3 or IL-7 microinjection, injection sites were immunolabeled with Ox42, a marker for CD11b, and compared to vehicle injections. As expected, vehicle injections had minimal CNS macrophage activation at 3d, aside from a thin band of reactive cells along the needle track (Fig. 18 A). In contrast, 3d after CSF3 injection, reactive CNS macrophages amassed primarily in the grey matter next to the injection site, resulting in a significant increase of CD11b expression in the ipsilateral cord (Fig.

18 B & Fig. 19). Interestingly, after IL-7 injection, reactive CNS macrophages were evenly distributed throughout the GM/WM injection site, which also resulted in a significant increase of CD11b expression in the ipsilateral cord (Fig. 18 C &

Fig. 19). Together, these data indicate that CSF3 and IL-7 injections activate

CNS macrophages, which may then indirectly affect oligodendrogenic responses.

79

Figure 18. Intraspinal CSF3 and IL-7 injections differentially activate CNS macrophages. A-C) Low power images of the injection site, 3d after vehicle (A), CSF3 (B), or IL-7 (C) microinjection. High power views of boxes are shown in (D- F). A, D) CNS macrophages in vehicle injections showed a resting phenotype aside from slight reactivity along the needle track. B, E) Reactive CNS macrophages amassed in the grey matter after CSF3 injection. C, F) Reactive CNS macrophages were evenly distributed throughout the GM and WM injection site after IL-7 injection. Scale bars: (A-C) 200µm; (D-F) 50µm.

Figure 19. Intraspinal CSF3 and IL-7 injections increase ipsilateral CD11b expression at 3d. Proportional area quantification of CD11b (Continued)

80 (Fig. 19 Continued) immunoreactivity in the ipsilateral spinal cord showed increased macrophage reactivity with CSF3 or IL-7 MI. Data represent mean ± SEM. **p < 0.01 vs. vehicle control.

Intraspinal CSF3 induces pSTAT3 expression in CNS macrophages and OPCs

CSF3 binding to CSF3R activates Janus kinase 1 (JAK1) and Janus kinase

(JAK2), non-receptor-type tyrosine kinases, which then phosphorylate signal transducer and activator or transcription 3 (STAT3). Activation of this signaling pathway is required for CSF3-induced proliferation and differentiation of granulocytes (Shimozaki et al., 1997). Because both CNS macrophages and

OPCs respond to CSF3 injection by 3d, pSTAT3 immunolabeling was combined with CD11b or NG2 to determine if either cell type displayed intracellular signaling indicative of CSF3R activation. In vehicle injections, some pSTAT3- expressing cells were present, but they were not expressed on CNS macrophages or OPCs (Fig. 20 A, C). As expected, numerous CNS macrophages expressed pSTAT3 3d after CSF3 injection, suggesting direct

CSF3R signaling in microglia (Fig. 20 B). Surprisingly, several OPCs also expressed pSTAT3 3d after CSF3 injection, suggesting that CSF3R is expressed on OPCs (Fig. 20 D). However, it is also possible that other cytokines activated pSTAT3 in OPCs in a paracrine manner.

81

Figure 20. Intraspinal CSF3 induces pSTAT3 expression in CNS macrophages and OPCs. A-B) High power images of CD11b/pSTAT3 immunolabeling reveal that many CNS macrophages express pSTAT3 (arrows) 3d after CSF3 injection. C-D) High power images of NG2/pSTAT3 immunolabeling reveal many pSTAT3 expressing OPCs 3d (arrows). Although some pSTAT3-expressing cells are present after vehicle injections (arrowheads), they are not CNS macrophages or OPCs. Scale bar (A-D): 20µm

CSF3 and CSF3R are differentially expressed after contusive SCI

TLR4-deficient mice have impaired WM sparing, OL replacement, and locomotor recovery after SCI (Kigerl et al., 2007; Church et al., 2016). Therefore, it is likely that TLR4 signaling plays an important role in remyelination after SCI, which

82 continues chronically (Hesp et al., 2015). Thus, to determine if CSF3 or IL-7 signaling is involved in the acute or chronic post-SCI injury environment, qRT-

PCR for CSF3, IL-7 and their receptors was performed on T8 contusive spinal cord injury (150kD) homogenate at 1, 3, 7, 14, 28, and 42d post-injury (dpi). At 1 and 3dpi, CSF3 transcription doubled compared with laminectomy controls, although these mean differences were not significant (Fig. 21 A). However, from

7-42dpi, CSF3 transcription was significantly reduced compared with 1dpi. At 3 and 7dpi, CSF3R transcription increased ~5-6-fold compared to controls (Fig. 21

B). These data suggest that CSF3 signaling is actively involved in the first week post-SCI. On the other hand, IL-7 transcription did not significantly change at any time-point post-SCI (Fig. 21 C). However, one of the receptor subunits for IL-7 signaling, IL-2Rγ, was increased 10-fold at 7dpi (Mazzucchelli and Durum, 2007).

Together, these data show that CSF3 is more likely to play a role in the post-SCI lesion; however, IL-7 is an interesting therapeutic target to enhance OL differentiation due to the increased expression of IL-2Rγ.

83

Figure 21. CSF3 and CSF3R are differentially expressed after contusive SCI. qRT-PCR on T8 contusive spinal cord injury homogenate (A-D) measured the relative mRNA expression of A) colony stimulating factor 3 (CSF3), B) colony stimulating factor 3 receptor (CSF3R), C) interleukin 7 (IL-7), and D) interleukin 2 receptor gamma (IL-2Rγ). Data represent mean ± SEM. *p < 0.05; ***p < 0.001 versus vehicle control, unless indicated otherwise.

Discussion

After a CNS injury or trauma, many inflammatory events are initiated, some of which are mediated by TLR4. Although aspects of inflammation are undoubtedly deleterious, inflammation also contributes to repair. One example of this is TLR4- mediated oligodendrogenesis. Both in vivo and microglial TLR4 activation result

84 in robust OPC proliferation and differentiation (Schonberg et al., 2007; Miron et al., 2013). Because OL lineage cells do not express TLR4 and microglia are the primary TLR4-expressing cells in the CNS, it is likely that soluble factors produced by microglia are responsible for these oligodendrogenic effects.

Indeed, TLR4-activated microglia transcribe numerous factors that affect oligodendrogenesis (see chapter 2). Because TLR4-activated macrophages secrete over 775 proteins, it is likely that microglia act similarly and that some of these proteins have undiscovered effects on OL lineage cells (Meissner et al.,

2003). This work identifies CSF3 and IL-7 as novel oligodendrogenic factors produced by TLR4 activated CNS macrophages.

Based on results from a cytokine, chemokine and growth factor PCR array, this work shows that CSF3 and IL-7 transcription was increased after TLR4 activation of CNS macrophages, as well as intraspinal TLR4 activation. BMDMs were used for the PCR array to ensure that RNA yield was adequate. However, these peripheral macrophages are relevant to CNS injury because they model infiltrating monocytes after CNS injury and disease (Popovich and Hickey, 2001;

Longbrake et al., 2007). Additionally, peripheral immune cells infiltrate the CNS after intraparenchymal LPS injection, and thus are likely contributers to TLR4- mediated oligogenesis (Montero-Menei et al., 1996; Nadeau and Rivest, 2003;

Felts et al., 2005; Zhou et al., 2006).

Blood-derived monocytes produce CSF3 in response to TLR4 activation, which initiates hematopoietic stem cell proliferation and neutrophil genesis (Metcalf and

85 Nicola et al., 1983; Welte et al., 1985; Vallenga et al., 1988). Thus, increased transcription of CSF3 in TLR4-activated BMDMs was not surprising. However, there are no reports of CSF3 production by microglia. In fact, neurons are the only CNS cells reported to produce CSF3, and this production is only in response to cerebral ischemia (Schneider et al., 2005). It is also possible that CNS endothelial cells produce CSF3, however CSF3 production has only been assessed in peripheral endothelial cells (Boettcher et al., 2014). Because neurons, endothelial cells, and infiltrating macrophages express TLR4, it is likely that the ~25-fold increase in CSF3 transcription after intraspinal LPS injection is a combined effect of multiple cell types. Nevertheless, further proteomic analysis will be important to determine if TLR4-induced microglial transcription translates to CSF3 production.

Here, the data also show that IL-7 transcription is elevated in TLR4-activated

BMDMs, microglia and spinal cord. IL-7 is well-characterized hematopoietic cytokine responsible for the development of T- and B- lymphocytes. Thus, the primary producers of IL-7 are stromal cells of lymphoid organs (Mazzucchelli and

Durum, 2007). Although not classically defined as a lymphoid organ, the liver produces IL-7 in response to a systemic injection of LPS. Furthermore, macrophages and microglia produce IL-7 in response to IL-12 (Jana et al., 2013).

Therefore, it is feasible that microglia are the primary cell responsible for IL-7 transcription after intraspinal TLR4 activation.

86 Because TLR4 activation increased transcription of CSF3 and IL-7, it is possible that these factors contribute to TLR4-induced oligodendrogenesis. Here, intraspinal injection of recombinant rat CSF3 initiated OPC proliferation.

Interestingly, CSF3 also stimulates the proliferation of hematopoietic stem cells in vitro, suggesting that CSF3 might act directly on OPCs (Metcalf and Nicola et al.,

1983). However, CSF3 only increased OPC proliferation in the GM, which corresponded with reactive microglia accumulation. This could indicate that

CSF3 acts on microglia, followed by paracrine effects on OPCs. Indeed, CSF3R is expressed on microglia, but has not been studied on OL lineage cells (Guo et al., 2013). Here, pSTAT3-labeled microglia and OPCs suggest that CSF3 initiates autocrine effects on microglia, and also has direct effects on OPCs.

However, in vitro and in vivo experiments with more acute time points are underway to determine if both cells are directly activated by CSF3.

Nevertheless, the question remains: why was OPC proliferation and microglial reactivity restricted to the GM? One simple yet unlikely explanation is that CSF3 microinjections were off-target. Another explanation is that GM microglia responded differently to CSF3 than WM microglia. Indeed, microglia in the GM and WM respond differently after a mid-thoracic spinal transection, indicating that microglia possess regional heterogeneity (McKay et al., 2007). A third explanation is that CSF3 acted on a cell type that is localized to the GM, such as neurons, which then triggered paracrine effects. CSF3 reduces infarct size after cerebral ischemia via activation of STAT3 and production of anti-apoptotic

87 protein Bcl-XL in neurons (Schneider et al., 2005). Based on this known function it is unclear how CSF3-stimulated neurons communicate with microglia or OPCs, however neurons are capable of producing cytokines and growth factors (Yeh et al., 1991; März et al., 1998; Acarin et al., 2000). Nevertheless, further experimentation is needed to determine if neuronal activity initiates OPC and microglial responses, and if CSF3 can promote OPC proliferation in the WM.

In contrast to CSF3, intraspinal injection of IL-7 promoted OPC differentiation.

This novel finding mimics other known functions of IL-7. For example, IL-7 promotes CD8+ T-cell differentiation and also induces differentiation of neural stem cells (Michaelson et al., 1996; Brugnera et al., 2000; Moors et al., 2010;

Boudil et al., 2015). Therefore, it is feasible that IL-7 acts directly on OPCs to promote differentiation. However, microglia also reacted to IL-7 resulting in an increase of CD11b expression. Although it is unknown which cells in the CNS express IL-7Rα, microglia and OPCs transcribe IL-7Rα mRNA (Sawada et al.,

1993). Thus, it is possible that IL-7 initiates autocrine effects microglia and also has direct effects on OPCs.

It is also interesting that IL-7 only initiated OPC differentiation in the GM.

Because reactive microglia were spread throughout the GM and WM, it is unclear if IL-7-mediated OPC differentiation is linked to microglial responses. However,

OPC differentiation in WM can be explained by regional heterogeneity of OPCs.

Numerous experiments demonstrated that WM OPCs differentiate into OLs more readily that GM OPCs (Dimou et al., 2008; Simon et al., 2011). Furthermore,

88 transplantation of GM OPCs into WM, and WM OPCs into GM revealed that regional differences are due to intrinsic properties of OPCs (Vigano et al., 2013).

Thus, it is no surprise that WM OPCs differentiated in response to IL-7 while GM

OPCs do not.

Finally, quantitative RT-PCR revealed that transcription of CSF3 and IL-7 after

SCI does not mimic the transcriptional timeline of these factors after intraspinal

TLR4 activation. Although TLR4 signaling is certainly initiated after SCI, these differences demonstrate the complexities of the post-SCI lesion. Indeed, traumatic SCI is initiated by a primary mechanical injury, which is followed by secondary injury cascades including inflammation, excitotoxicity, oxidative damage, hemorrhage and edema. Nevertheless, the beneficial role of CSF3 after cerebral ischemia, combined with increased CSF3R transcription 3 and 7d post

SCI, suggests that CSF3 is a therapeutic target to reduce progressive cytotoxicity. Indeed, studies report improved locomotor recovery in CSF3 treated rodents after SCI (Osada et al., 2010; Kadota et al., 2013). However, much more rigorous experimentation is needed to determine the cellular targets of CSF3 and anatomical correlates of improved recovery.

In addition to CSF3, IL-7 represents a potential target for enhancing oligodendrogenesis after SCI and other demyelination CNS insults. However, IL-

7 promotes production of IFNγ from T-cells and plays a role in the pathogenesis of EAE (Lee et al., 2011; Arbelaez et al., 2015). Therefore, IL-7 might not be an ideal therapeutic target in demyelinating insults with an adaptive immune

89 component. However, in the case of human SCI, peak lymphocyte infiltration is delayed until at least 1 month post-injury (Fleming et al., 2006). Thus, the first month post-SCI represents a therapeutic window in which IL-7 could potentially promote oligodendrogenesis and remyelination.

Collectively, this work demonstrates that CSF3 and IL-7 are novel oligodendrogenic factors that are transcriptionally regulated by TLR4. Future work will determine the cellular targets of CSF3 and IL-7 in the CNS, and function-blocking experiments will assess how vital a role these factors have in

TLR4-mediated oligodendrogenesis. Because neither factor alone triggers the same robust oligodendrogenic response that LPS causes, it is likely that a number of factors combine to produce such effects. Nevertheless, the oligodendrogenic effects of these factors make them ideal targets for enhancing remyelination in CNS injury and disease.

90

Chapter 4: Intraspinal TLR4 activation promotes iron storage but does not

protect neurons or oligodendrocytes from progressive iron-mediated

damage

Abstract

CNS trauma causes persistent hemorrhage-induced iron accumulation in lesions, leading to oxidative damage and progressive neurotoxicity. Iron chelation is a common strategy for targeting CNS iron accumulation; however, preferentially targeting CNS parenchyma is difficult. The immune system possesses an innate iron chelation mechanism, whereby macrophages sequester iron in response to foreign pathogen invasion. This “microbial defense response” is initiated by toll- like receptor 4 (TLR4) activation. Because microglia express TLR4, we hypothesized that intraspinal TLR4 activation would enhance iron sequestration and reduce the protracted neurotoxicity associated with iron exposure. To test this hypothesis we first determined that TLR4 activation stimulates microglial uptake of extracellular iron in vitro. Next, we microinjected iron, a TLR4 agonist

(lipopolysaccharide; LPS), or Iron+LPS into the intact spinal cord to determine if

91 iron sequestration was enhanced and tissue damage reduced by concomitant

TLR4 activation. LPS co-injected with iron did promote in vivo iron storage as detected by increased ferritin-expressing microglia and intraspinal iron protein mRNA expression characteristic of iron sequestration. Nevertheless, this approach was not neuroprotective against progressive neuronal or glial loss. In fact, Iron+LPS injection killed comparable numbers of oligodendrocytes (OLs) compared with either alone and also reduced OL replacement from adult OL progenitor cells (OPC). Because OPC proliferation was similar in all groups, OPC differentiation was likely impaired by the Iron+LPS combination. On the other hand, analysis of chronic tissue revealed that Iron+LPS tissue had improved tissue integrity than Iron alone, which correlated with more Schwann cell myelination. Collectively, this work reveals that TLR4 activation stimulates iron sequestration in the CNS. However, TLR4-induced cytotoxicity requires timing or delivery of TLR4 activators to be modified for potential therapeutic use.

92 Introduction

Iron is a ubiquitous cellular element, necessary for energy production and essential processes such as proliferation and protein synthesis. In excess, however, iron is highly reactive and can directly damage proteins, DNA and lipids. Thus, excess iron in the central nervous system (CNS), such as following hemorrhagic stroke or neurotrauma, causes potent neuropathology. Iron also accumulates in neurodegenerative disorders such as Alzheimer’s disease and

Parkinson’s disease (Zecca, 2004). In all cases, excess free iron in CNS parenchyma produces damaging free radicals that cause progressive neuronal and glial cell death (Armstrong et al., 2001; Uttara et al., 2009; Caliaperumal et al., 2012).

Because of the high reactivity and toxicity of iron, iron chelation strategies are commonly attempted to sequester excess redox-reactive iron (Ward et al., 2015).

A challenge for CNS iron overload, however, is reaching therapeutic levels of chelator within the CNS without disrupting peripheral iron regulation. For instance, we detected hepatic iron depletion in a rodent spinal cord injury (SCI) model treated systemically with an iron chelator (Sauerbeck et al., 2013).

Therefore, improved chelators or new approaches are needed to combat iron- induced CNS toxicity.

Notably, the immune system possesses an innate iron chelation mechanism that is initiated in response to systemic pathogen invasion. This response is activated through Toll-like receptor 4 (TLR4), which is primarily expressed on myeloid-

93 derived cells. When invading pathogens activate TLR4, macrophages sequester iron to prevent microbe proliferation and further infiltration (Nairz et al, 2010).

Whereas the systemic “microbial defense response” is well characterized, it is unclear if the same response occurs within the CNS.

In addition to invading pathogens, TLR4 is directly activated by endogenous molecules in CNS injury sites such as fibronectin, heat shock proteins and

HMGB1 (Kigerl and Popovich, 2009). Given that TLR4-expressing microglia and infiltrating monocytes accumulate within and around iron-rich CNS injury sites,

TLR4 activation may be protective by promoting iron uptake and sequestration, and thereby function as an endogenous “iron chelation therapy”. Indeed, our recent data suggest that is exactly what happens after SCI. That is, mice lacking functional TLR4 had impaired expression of ferritin, an iron storage protein, compared to controls, suggesting TLR4 activation promotes iron storage after

CNS trauma (Church et al., 2016).

Here we wanted to determine if endogenous iron sequestration properties of

TLR4-activated microglia and macrophages could be safely harnessed within the

CNS. Specifically, this study tested the hypothesis that intraspinal TLR4 activation concomitant with iron exposure would stimulate iron uptake by CNS macrophages and reduce progressive iron-induced neuron loss. Because oligodendrocytes (OLs) are also susceptible to iron-induced toxicity, this study also examined the response of OL lineage cells to Iron+LPS exposure. First, the ability of TLR4 activation to induce iron sequestration by microglia was verified in

94 vitro. Then, a modest in vivo iron-induced spinal cord lesion model was used

(McDonald et al., 2002). Rats received a non-traumatic 500nl microinjection of iron (ferric citrate) with or without concomitant LPS into the spinal gray/white matter (GM/WM) border. Spinal cords were compared with those receiving vehicle or LPS alone. Results from in vitro and in vivo studies show that TLR4 activation successfully promoted iron uptake and storage by microglia and CNS macrophages, similar to the systemic “microbial defense response.” However, enhanced iron sequestration did not slow the progressive neuronal loss throughout the first week post-injection. All injection groups (except vehicle) also had comparable OL loss, which was reversed over time in Iron or LPS alone groups. Concomitant Iron+LPS exposure, however, significantly limited the replacement of OLs from adult OL progenitor cells (OPCs). On the other hand,

Iron+LPS tissue had better tissue integrity than Iron alone at 28d, which correlated with more Schwann cell myelination.

Collectively, this work reveals that TLR4 activation induces iron protein expression and iron sequestration within the CNS, which enhanced chronic tissue integrity. Nevertheless, this was not protective against progressive iron- induced neuron loss, and even hampered the reparative response of OL lineage cells. Therefore, future work will need to focus on promoting iron sequestration in the CNS without concomitant inflammatory cytotoxicity in instances of intraparenchymal bleeding, such as after CNS trauma, stroke or surgery.

95 Methods

Neonatal microglia

Neonatal microglia were cultured as previously described with some modifications (McCarthy and De Vellis 1980; Giulian and Baker 1986; Zhang et al., 2005). Briefly, P1-P2 rat pups were decapitated and sub-cortical regions and meninges were separated from the cortex. The cortical region was digested in a

0.1% trypsin solution for 30 min, and triturated after addition of 60 µl/ml DNase I and 5% FBS. Cells were then plated on 75cm2 cell culture flasks coated with

100µg/ml poly-L-lysine. The mixed glial cultures were maintained for 10d in

DMEM with 10% FBS, 1% glutamax, and 0.5% gentamycin, with 100% media changes at 3 and 6d. On day 10, cultures were vigorously shaken for 15 h on a rotary shaker incubator (250rpm). After shaking, oligodendrocyte progenitors and microglia were separated by plating the cells in uncoated plastic wells, to which only microglia adhere. The following day, microglia were stimulated with

FeCl3 (1mM), LPS (100ng/ml) or both for 24 h. Microglia were then either fixed in

4% PFA for 15 min or homogenized in TRIzol reagent (Life Technologies).

In vitro iron uptake

Fixed microglia were stained for non-heme bound iron using a modified Perls

Prussian blue staining protocol. Briefly, endogenous peroxidase activity was quenched using a 4 to 1 mixture of methanol and 30% hydrogen peroxide. Cells were incubated in a 50-50 mixture of 4% HCL and 4% potassium ferrocyanide solution (Polysciences, Inc) for 30 min. Finally, after 10 min incubation with 0.1%

96 tritonX-100 in PBS, the Prussian blue signal was amplified using DAB with nickel

(Vector). Hoescht counterstain was used to identify nuclei. Then, images from 10 arbitrary fields of view were taken from each well (n = 4-6/group) on the

ArrayScanXTI High Content Analysis Reader (Thermo). The area of Perls staining was quantified using ImageJ (NIH) and normalized to total cell number in each well.

Glutamate and Griess assay

Adult rat bone marrow derived macrophages (BMDMs) were generated using a modified protocol described previously (Longbrake et al., 2007). Briefly, bilateral femurs and tibias were dissected from adult Sprague Dawley rats. Using a 23 gauge needle, bone marrow was flushed into sterile conical tubes using a syringe filled with ice cold DMEM. Cells were then triturated into a single cell solution, and red blood cells were lysed in a lysis buffer (0.15M NH4Cl, 10mM KHCO3,

0.1mM Na2EDTA, pH 7.4). After washing, cells were plated at 1x106 cells per ml of DMEM supplemented with 10% FBS, 20% L929 supernatant, 0.5% gentamycin, 1% HEPES, 1% glutamax, and 0.001% β-mercaptoethanol.

Supernatant from L929 cells contains macrophage colony stimulating factor

(CSF1) required to drive bone marrow cells to differentiate into macrophages by

(Burgess et al., 1985). After 7 days in vitro BMDMs were re-plated into wells with

DMEM, supplemented with 10% FBS, 1% glutamax, and 0.25% gentamycin.

The following day, BMDMs were stimulated with the either FeCl3 (1mM), LPS

(100ng/ml) or both LPS and FeCl3 for 24 hours. Supernatants were then

97 collected and spun at 13,000 x g to remove insoluble materials. Colormetric glutamate (Sigma) and Griess (ThermoFisher Scientific) assays were conducted according to manufacturer’s instructions.

Solution preparation

Vehicle and ferric-citrate solutions were prepared as described by McDonald et al. (2002). First, the vehicle solution was made using sodium citrate-dihydrate

(180mM), sodium bicarbonate (11.4 mM), and tris base (0.455M), in 0.1M sterile

PBS. A 0.75nM ferric citrate solution was made with ferric chloride hexahydrate

(100mM) diluted with vehicle. LPS (1mg/ml, Sigma; 0111:B4) was similarly diluted in the vehicle solution. LPS + Iron solution consisted of 2x concentrated

LPS and ferric-citrate solution mixed 1:1. All solutions were filter sterilized using a 0.22µm filter, and Iron+LPS solutions were mixed immediately before use.

Intraspinal microinjections

All surgical and postoperative care procedures were performed in accordance with The Ohio State University Institutional Animal Care and Use Committee.

Adult female Sprague-Dawley rats (~250 grams; n = 56) were randomly assigned to treatment groups (Vehicle, Iron, Iron+LPS, LPS; n=10/group), then anesthetized with an intra-peritoneal injection of ketamine (80mg/kg) and xylazine (10mg/kg). Using aseptic technique, a laminectomy was performed at the T8 vertebral level. Custom pulled UV-sterilized glass micropipettes, beveled to an outer tip diameter of 25-40µm, were pre-loaded and positioned 0.7mm lateral to the dorsal spinal cord midline. Using a hydraulic micropositioner (David

98 Kopf Instruments, Tujunga, CA), pipettes were lowered 1.1mm into the spinal cord. For histological experiments, a 500nl bolus injection was administered to the lateral gray-white matter border using a PicoPump (World Precision

Instruments). For tissue RNA experiments, a 200nl bolus injection was administered bilaterally in the lateral gray-white matter border. Injection sites were labeled with sterile charcoal (Sigma), muscles surrounding the laminectomy were sutured, skin was stapled with wound clips, and rats were given 5cc sterile saline (subcutaneous) before being placed in a warmed recovery cage. Two rats died due to complications with anesthesia.

Bromodeoxyuridine administration

A thymidine analog 5-bromo-2-deoxyuridine (BrdU) (50mg/kg, in sterile saline;

Roche) was used to label proliferating cells. Rats were given an i.p. injection of

BrdU at 2 and 4 hours post-microinjection and once a day until sacrifice date.

Tissue processing: immunohistochemistry

At 1d, 7d, or 28d post-injection, rats (n = 4-5 per group) were deeply anesthetized and then perfused transcardially with 4% paraformaldehyde (PFA) in PBS. Spinal cords were carefully removed and post-fixed for an additional 2h.

Following an overnight incubation in 0.2M PB, spinal cords were cryoprotected in a 30% sucrose solution for 48-72h. 8mm segments of spinal cord centered on the injection site were then blocked and frozen on dry ice. Once frozen, cords were embedded in OCT (Electron Microscopy Sciences) and the blocks were

99 frozen on dry ice. Spinal cord cross-sections were cut at 10µm using a cryostat, and mounted sequentially onto slides. Tissue was stored at -20°C until use.

Tissue processing: mRNA extractions

Rats (n = 4 per group) were deeply anesthetized and transcardially perfused using ice-cold 0.1M DEPC-PBS. A 2mm segment of thoracic spinal cord centered on the injection site was then dissected. Immediately following the dissection, cords were homogenized in TRIzol (Life Technologies) and frozen.

Immunohistochemistry

Briefly, slides were rinsed with 0.1M PBS followed by blocking of nonspecific antigens with 4% BSA/0.1% Triton-100/PBS (BP+) for 1 h. Primary antibodies were then applied overnight at 4°C. After rinsing, biotinylated secondary antibodies were applied for 1h at room temperature. Endogenous peroxidase activity was then quenched using a 4:1 mixture of methanol and 30% hydrogen peroxide. Then, biotinylated secondary antibodies were visualized using Elite-

ABC (Vector Laboratories) with DAB or SG as a substrate (Vector). In some instances, tissue was counter-stained with methyl green or neutral red. Last, slides were dehydrated in ethanol and coverslipped with Permount (Fisher).

Sections labeled for BrdU were incubated in 2N HCl at 37°C for 25 min prior to primary antibody incubations. Primary antibodies include: Ox42 (CD11b on CNS macrophages - 1:2000 – Serotec), NG2 (OPCs - 1:200 – Millipore), CC1 (OLs -

1:500 - Abcam), GFAP (astrocytes - 1:4000 - Sigma), BrdU (proliferating cells -

1:200 - DSHB), pSTAT3 (1:200 – Cell Signaling Technology), and NeuN

100 (neurons - 1:50,000 – Chemicon). Non-heme bound iron was labeled using a modified Perls Prussian blue staining protocol. Briefly, endogenous peroxidase activity was quenched using a 4:1 mixture of methanol and 30% hydrogen peroxide. Then, slides were incubated in a 50-50 mixture of 4% HCL and 4% potassium ferrocyanide solution (Polysciences, Inc) for 30 min. Finally, after a

10-min incubation with 0.1% tritonX-100 in PBS, the Prussian blue signal was amplified using DAB with nickel (Vector).

Immunofluorescence

Briefly, slides were rinsed with 0.1M PBS followed by blocking nonspecific antigens with BP+ for 1h. Primary antibodies were applied overnight at 4°C.

Following rinses, secondary Alexa Fluor antibodies (1:500-1000; Invitrogen) were applied for 1h at room temperature. Slides were incubated in DAPI (1:50,000;

Invitrogen) for 15 min at room temperature to label nuclei. After PBS and dH2O rinses, slides were coverslipped in Immu-Mount (Thermo Scientific). Primary antibodies: Ox42 (CD11b on CNS macrophages - 1:2000 – Serotec), H-Ferritin

(1:5000 – Abcam), L-Ferritin (1:2000 – Abcam), NF-H (1:500 – Chemicon) and

P0 (1:1000 – Aves).

Microscopy and quantitative analysis

All data are reported as mean ± SEM and all analyses were performed in a blinded manner. Fluorescent images of double-labeled ferritin/CD11b cells were captured using an Olympus FV1000 laser scanning confocal microscope, and processed with the corresponding Fluoview software. A Zeiss Axioskop 2

101 Imaging microscope with a Sony 970 three-chip color camera was used to capture and analyze bright-field images. To quantify macrophage density in the ipsilateral cord, low power images (5x) were digitized and manually outlined using the MCID Elite imaging software (Imaging Research Inc., Canada). For

Perls iron quantifications, a 0.1mm2 box was centered on the injection site, overlapping both gray and white matter. Proportional area was calculated as the area of CD11b or Perls immunoreactivity, divided by sample area.

Cell counts for CC1, NG2, NG2/BrdU, NG2/pSTAT3 and NeuN were manually collected at high magnification (40x) using 0.02mm2 reticule boxes. For all quantifications, counts from 3 serial sections centered on the injection site were averaged for each animal. For OL and OPC counts, one 0.02mm2 reticule box in the ventral/intermediate GM and three non-overlapping 0.02mm2 reticule boxes in the WM directly adjacent to GM were reported as “lesion.” NeuN counts consisted of one 0.02mm2 reticule box in the ventral/intermediate GM. For all analyses, data are expressed as the number of cells per cubed millimeter.

Because NG2 is also expressed on other cell types, conservative OPC counts were conducted based on morphological criteria (Tripathi and McTigue, 2007). A single- or double-labeled OPC was only counted if the NG2 immunoreactivity surrounded an identifiable nucleus in a single plane of focus and possessed multiple NG2-expressing processes. Because astrocytes can also express CC1,

OLs were only counted if the CC1 expressing profile did not co-express GFAP.

102 Occasionally, NG2+ and CC1+ profiles were verified at higher magnification

(64x).

All analyses were performed in a blinded manner. Statistical analyses and graphs were generated in Prism 5.0 (GraphPad Software Inc.). Quantitative differences between groups were analyzed using a 1-way ANOVA followed by

Tukey’s post hoc test or a 2-way ANOVA followed by Bonferroni’s post hoc test.

Significance was set at p<0.05.

Quantitative real-time PCR

TRIzol reagent was used to extract RNA from tissue or neonatal microglia following the manufacturers protocol (Life Technologies). RNA was reverse transcribed using SuperScript II (Invitrogen) to generate cDNA. Quantitative real- time PCR was performed using gene-specific primers to measure mRNA levels in the stimulated microglia. PCR product was measure using SYBR Green fluorescence using an Applied Biosystems 7900HT Fast Real-Time PCR System.

The sequences for primers used were: 18S(F) TTCGGAACTGAGGCCATGAT,

(R) TTTCGCTCTGGTCCGTCTTG; H-Ferritin (F)

TTGCAACTTCGTCGCTCCGCC, (R) TGGCGCACTTGCGAGGGAGA; L-Ferritin

(F) GCAGCGCTTTGGAGATCCCG, (R) AGTCCCCGGGTCTGTTCCGT; transferrin receptor (F) GGCTATGAGGAACCAGACCGCTACA, (R)

TGGACTTCGCAACACCAGGGC; DMT-1 (F) TGTCGCCTGTCCATTTGGCCG,

(R) TGGCGTGGCGGGGTTGAAAT; hepcidin (F)

TATCTCCGGCAACAGACGAG, (R) AGCGCACTGTCATCAGTCTT;

103 ceruloplasmin (F) TGCAACAAGCCCTCACCGGA, (R)

TGGTCTCCTCGGCAGCGATGTA; iNOS (F) TTGGTGAGGGGACTGGACTTT,

(R) CCGTGGGGCTTGTAGTTGA; IL-1α (F) TCACTCGCATGGCATGTGCTGA,

(R) TCGGGCTGGTTCCACTAGGCT; TNFα (F)

TGATCCGAGATGTGGAACTGG, (R) CGATCACCCCGAAGTTCAGTAG. Gene expression relative to the housekeeping gene 18S was analyzed using the comparative CT method (Schmittgen and Livak, 2008). Significance was reported when p < 0.05 after running a one-way ANOVA with Tukey post hoc test.

RESULTS

Activation of TLR4 on microglia in vitro promotes iron uptake

Microglia are the primary TLR4-expressing cells in the CNS (Trotta et al., 2014).

Furthermore, in vitro evidence suggests that in response to inflammatory stimuli, microglia increase expression of the free iron importer divalent metal transporter

1 (DMT1) and take up extracellular iron (Urrutia et al., 2013). Nevertheless, their capacity to internalize iron following TLR4 stimulation has not been directly visualized. Therefore, to determine if TLR4 activation promotes microglial iron uptake, microglia were stimulated in vitro with iron (1mM Ferric chloride), LPS

(100ng/ml), or Iron+LPS for 24 h. Intracellular iron was identified with Perls stain

(Fig. 22 A). Quantification of Perls staining in randomly selected images revealed microglia treated with iron alone took up significantly more iron compared with control media or LPS alone (Fig. 22 A-B). However, adding LPS

104 concomitant with iron almost doubled iron uptake compared with iron alone, confirming that TLR4 activation directly stimulates microglia to internalize extracellular iron.

Figure 22. Activation of TLR4 on microglia in vitro promoted iron uptake. A) Low- power images of fixed microglia stained for Perls 24hrs after stimulation with iron (1mM Ferric chloride), LPS (100ng/ml), or Iron+LPS. B) Densitometric quantification of Perls staining normalized to total cells revealed that microglia stimulated with Iron+LPS took up more iron than microglia treated with iron alone. Data represents mean ± SEM. One-way ANOVA with Tukey’s post hoc test: ***p<0.001 vs. control unless otherwise noted.

TLR4 activation overrides the CNS macrophage response to iron in vivo

Iron accumulates after CNS trauma and in numerous neurological disorders, creating a cytotoxic environment. To slow toxicity and enhance recovery after such injuries, strategies are needed to contain iron overload. To test whether

TLR4-mediated iron chelation could be safely induced in the CNS, an intraspinal

105 microinjection of iron +/- LPS was directed to the GM/WM border to model regions of CNS inflammation and iron accumulation.

We first characterized the CNS macrophage response 1 and 7d post-injection.

After vehicle treatment, microglia mostly maintained a resting phenotype (Fig. 23

A & A’). In contrast, 1d after iron microinjection, activated microglia surrounded the injection site in the intermediate and ventral gray matter with minimal white matter activation (Fig. 23 B & B’). When iron was co-injected with LPS, a completely different pattern emerged; in these sections, small round Cd11b+ cells spread extensively throughout the ipsilateral gray and white matter (Fig. 23

C & C’), a response apparently dominated by TLR4 since injection of LPS alone evoked a similar distribution (Fig. 23 D & D’). Quantification of the area of macrophage activation (Cd11b immunoreactive area) revealed that LPS alone and Iron+LPS significantly increased Cd11b expression compared with vehicle or

Iron alone (Fig. 24). Thus, TLR4 activation overrides the effect of iron on acute macrophage activation and distribution.

Between 1 – 7d after injection, macrophage distribution changed in all groups. At

7d after Iron injection, Cd11b was significantly increased as activated microglia and macrophages filled the local gray matter injection site (Fig. 23 F & F’; Fig.

24). In LPS and Iron+LPS groups, CNS macrophage activation had declined in white matter but was markedly denser in the gray matter compared with 1d, with most cells displaying a larger phenotype compared with 1d (Fig. 23 G-H’). The

Iron+LPS group had significantly more CD11b immunoreactivity at 7d compared

106 with Iron or LPS injection groups (Fig. 24). Thus, CNS macrophage activation was significantly enhanced by exposure to Iron+LPS compared with either alone.

Figure 23. Iron microinjection with or without TLR4 activation differentially induced CNS macrophage activation. A-D) Low-power images from the injection site 1d post-injection immunolabeled for CD11b. Dotted lines indicate the GM/WM border. A’-D’) High-power views of the grey-white matter border are shown below each low-power image. CNS macrophages in iron injections were much more hypertrophic/ramified than vehicle, while small phagocytic CNS macrophages accumulated throughout the injection site in Iron+LPS and LPS injections. E-H) Low-power images from the injection site 7d post-injection immunolabeled for CD11b. High-power views of boxes are shown in (E’-H’). By 7d, activated CNS macrophages filled the grey matter adjacent to the iron injection site. Similarly, large phagocytic macrophages filled the grey matter of Iron+LPS and LPS injections. Scale bars: (A-H) 200µm; (A’-H’) 50µm

107

Figure 24. Densitometric quantification of CD11b in the ipsilateral spinal cord revealed that both LPS alone and Iron+LPS induced a significant increase in Cd11b expression compared with vehicle or Iron alone 1d post-injection. By 7d, Iron+LPS injections had significantly more CD11b expression compared with Iron or LPS injection groups. Data represents mean ± SEM. Two-way ANOVA with Bonferroni post hoc test: *p<0.05, ***p<0.001 vs. control unless otherwise noted.

Intraspinal TLR4 activation promotes iron sequestration and ferritin expression

To determine if TLR4 activation alters the distribution of injected iron and promotes intraspinal iron uptake, sections were labeled with Perls stain was to visualize iron deposition at the injection site. At 1d post-injection, control spinal cords had no demonstrable iron (as expected), whereas tissue from the Iron group displayed dense Perls staining at the GM/WM border indicating that the

108 injected iron remained deposited at the injection site for at least 24h (Fig. 25 A,

B). In contrast, iron staining in the Iron+LPS group was significantly lower and localized to small round profiles spread within and around the injection site (Fig.

25 C & I). The morphology of these cells resembled macrophages, which was verified below. Perls staining in LPS injection sites was not different from vehicle controls, verifying prior results that intraspinal TLR4 activation does not stimulate acute iron sequestration (Schonberg and McTigue, 2009).

By 7d in the Iron-injected tissue, iron staining was reduced but still elevated 8- fold compared with control tissue (Fig. 25 F, I). In the Iron+LPS group, iron mostly localized to the gray matter, mimicking the distribution of CNS macrophages (Fig. 25 G). In the LPS group, there was a modest increase in iron compared with 1d (Fig 25 H, I), as shown previously (Schonberg and McTigue,

2009).

109

Figure 25. TLR4 activation altered the distribution of iron deposition. A-D) Low- power images of iron deposits from the injection site at 1d reveal that Iron injections displayed dense Perls staining at the GM/WM border, (Continued)

110 (Fig. 25 Continued) while Iron+LPS injections had small round Perls profiles spread throughout the injection site. E-H) Low-power images at 7d reveal that Perls staining accumulated in the GM in after Iron+LPS injection, mimicking the distribution of CNS macrophages. Dotted lines indicate the GM/WM border. I) Densitometric quantification of Perls in the ipsilateral spinal cord reveal that LPS +/- Iron injections had significantly less Perls staining than Iron alone injections at 1d. Data represents mean ± SEM. Two-way ANOVA with Bonferroni post hoc test: *p<0.05 vs. control unless otherwise noted. Scale bars: (A-H) 150µm.

Collectively, these data demonstrate that in vivo TLR4 activation shifts iron distribution from dense extracellular accumulation to a pattern indicative of uptake by macrophages. To verify this, sections were double-labeled for CD11b and ferritin, an intracellular iron storage protein upregulated in cells by TLR4 activation or by rising intracellular iron levels (Carraway et al., 1998; Rouault,

2006; Piccinelli and Samuelsson, 2007). This revealed that despite extensive extracellular iron in the Iron alone group, ferritin expression was minimal indicating that iron was not taken up by local cells within 24h (Fig. 26 B’). In contrast, when iron was co-injected with LPS, ferritin-expressing macrophages were abundant throughout the tissue (Fig. 26 C-C”), matching the distribution of iron in these sections (see Fig. 25 C). LPS alone induced a similar distribution of macrophages with fewer co-expressing ferritin (Fig. 26 D-D’). Collectively, these results indicate that TLR4 activation promotes microglial and macrophage uptake of extracellular iron and storage within ferritin.

111

Figure 26. Iron+LPS injection induced ferritin expression in macrophages. A-D’’) Single-label and merged confocal images from the grey-white matter border injection site 1d post-injection immunolabeled for Ox42 (Green) and H+L-Ferritin (Red). Ferritin-expressing macrophages (arrows) were scattered throughout the Iron+LPS injection site (C-C’’). Although iron accumulated after iron injections, this was not sufficient to induce a noticeable increase in ferritin expression (B- B’’). Few macrophages co-expressed ferritin after LPS alone injection (D-D’’). Scale bars: (A-D’’) 50µm.

112 Intraspinal TLR4 activation promotes an iron storage transcriptional phenotype in vivo

Because iron is vital but toxic, an elaborate program of evolutionarily conserved proteins regulates its import, export, storage, and oxidation status (Hentze et al.,

2004). Unfortunately, few validated antibodies reliably label these proteins in rat tissue; therefore, we isolated mRNA from spinal cords 1d post-injection and used quantitative real-time PCR to examine transcriptional changes.

The two main iron import proteins are transferrin receptor and divalent metal transporter 1 (DMT1). Intraspinal iron did not alter either one, which is consistent with the lack of iron uptake at this time shown above (see Fig. 25 A). LPS or

Iron+LPS injection slightly but significantly decreased transferrin receptor expression, and increased DMT1 expression nearly three-fold (p<0.001; Fig. 27

A-B), suggesting that TLR4 activation skews cells toward the uptake of transferrin-free iron.

The iron storage protein ferritin consists of two subunits, heavy (H) and light (L) chain, which were examined next. Iron alone slightly but significantly increased

H-ferritin mRNA but had no effect on L-ferritin (Fig. 27 C-D). Consistent with the findings above, both LPS alone and Iron+LPS significantly increased L- and H- ferritin mRNA compared with vehicle and Iron alone (Fig. 27 C-D). Interestingly, despite having no effect on its own, iron potentiated LPS-induced upregulation of

L-ferritin transcripts over LPS alone (Fig. 27 C). Collectively, this reveals that

113 TLR4 activation promotes an iron storage response that is accentuated by the presence of iron.

Finally, transcription of iron export-related molecules was examined. The only mechanism for cellular iron efflux is the iron exporter ferroportin, which works in conjunction with the ferroxidase ceruloplasmin; iron export is blocked by hepcidin, which binds to ferroportin protein causing its internalization and degradation (Rossi, 2005). Since ferroportin is regulated at the protein level, its

RNA was not examined. For ceruloplasmin, TLR4 activation (+/- iron) significantly increased its mRNA two-fold compared with iron or vehicle (Fig. 27 E).

Ceruloplasmin alone, however, cannot cause iron export without ferroportin. To get an indication of ferroportin status, hepcidin mRNA was examined, which revealed that TLR4 activation (+/- iron) increased hepcidin mRNA >20-fold compared with vehicle (or Iron), suggestive of enhanced cellular iron retention

(Fig. 27 F). These mRNA data combined with histological data support the hypothesis that TLR4 activation biases CNS tissue toward an iron sequestering phenotype whereas iron exposure alone has little effect.

114

Figure 27. Intraspinal TLR4 activation promoted an iron storage phenotype in vivo. qRT-PCR on spinal cord homogenate 1d after injection (A-F) measured the relative mRNA expression of A) transferrin receptor, B) divalent metal transporter 1 (DMT1), C) L-ferritin, D) H-ferritin, E) ceruloplasmin, and F) hepcidin. Data represent mean ± SEM. One-way ANOVA with Tukey’s post hoc test: *p < 0.05; **p < 0.01; ***p < 0.001 versus vehicle, unless otherwise noted.

115 TLR4 activation does not rescue progressive iron-induced neuron loss

To determine if enhanced iron sequestration reduced neuron loss, neurons at the injection site were counted. By 1d post-injection of Iron or Iron+LPS, neurons were significantly reduced by 50% (Fig. 28 A-B). Although not statistically significant, LPS alone reduced neurons by 30%. In all groups (except vehicle), neuron loss progressed over time such that by 7d, ~75-90% of neurons were lost. Thus, TLR4-induced iron sequestration did not prevent progressive iron- induced neuron loss.

Figure 28. TLR4 activation did not rescue progressive iron-induced neuron loss. A) Low-power images at the 1d and 7d injection site immunolabeled for NeuN reveal progressive neuron loss in all treatment groups. B) NeuN counts reveal that Iron +/- LPS injection reduced neurons by ~50% at 1d, while ~90% of neurons were lost in all groups by 7d. Data represents mean ± SEM. Two-way ANOVA with Bonferroni post hoc test: **p < 0.01; ***p < 0.001 versus vehicle. Scale bars: (A) 200µm

116 TLR4 activation does not rescue iron-induced oligodendrocyte loss and iron impairs OPC differentiation

In addition to neurons, oligodendrocytes are vulnerable to iron-mediated toxicity.

To determine if concomitant TLR4 activation protected OLs from iron-mediated loss, OLs were quantified in the lesion site at 1d (Fig. 29 A). As expected, Iron was toxic and killed >70% of OLs by 1d. Co-injection of Iron+LPS, however, was not protective as it killed comparable numbers of OLs by 1d, as did LPS injection alone. We showed previously that intraspinal LPS microinjection evokes robust oligodendrogenesis within 7d (Schonberg et al., 2007). Thus, we examined 7d tissue to determine if iron altered this reparative response. Whereas OL numbers increased in all three groups, Iron+LPS injection sites still had significantly fewer

OLs compared with control and LPS alone (Fig 29 A). Because all groups started at approximately the same OL number at 1d, the data suggest that the presence of iron impaired the oligodendrogenic response to TLR4 activation.

OL replacement in the adult CNS involves OPC survival, proliferation and differentiation. Because fewer OLs were generated in the Iron+LPS group, at least one of these stages must have been negatively affected. To examine OPC survival and accumulation, NG2+ OPCs were counted in the lesion sites at 1d post-injection (Fig. 29 B). LPS and Iron+LPS both significantly reduced OPCs at

1d post-injection but, unlike OLs, Iron alone had no effect on OPC numbers.

OPC replacement was examined next. By 7d post-injection, OPC numbers had increased in all treatment groups including the Iron group in which OPCs had not

117 been lost at 1d (Fig. 29 B). This suggests that Iron and LPS stimulated OPC proliferation, which was verified with BrdU immunolabeling (Fig. 29 C). OPC proliferation returned OPC numbers to baseline in the LPS and Iron+LPS groups and significantly increased OPCs over baseline in the Iron alone group (Fig. 29

B).

Thus, lack of OPC proliferation was not the cause of reduced OL replacement in the Iron+LPS group, suggesting that TLR4-induced OPC differentiation may have been impaired by the presence of iron. TLR4 activation induces expression of janus kinase – signal transducer and activator of transcription (JAK-STAT) pathway ligands such as IL-6, LIF and CNTF, which are implicated in OPC differentiation (Deverman and Patterson, 2012; Marmur et al., 1998; Marriott et al., 2008; Mayer et al., 1994; Stankoff et al., 2002; Talbott et al., 2007; Zhang et al., 2004). To determine if the JAK-STAT pathway was differentially activated in

OPCs in the different groups, sections from the 1d group were co-labeled with

NG2 and phosphorylated STAT3 (pSTAT3). In LPS injection sites, ~100% of

OPCs expressed pSTAT3 (Fig. 29 D). In contrast, only 30-40% of the remaining

OPCs in the Iron and Iron+LPS groups expressed pSTAT3 (Fig. 29 D). This suggests that the presence of iron limited LPS-induced activation of JAK/STAT in

OPCs.

118 Figure 29. TLR4 activation did not rescue iron-induced oligodendrocyte loss and iron impaired OPC differentiation. A) CC1+ OL counts in the injection site at reveal that Iron, Iron+LPS and LPS killed OLs at 1d. Although OL numbers increased in all three groups by 7d, Iron+LPS injection had significantly fewer OLs compared with control and LPS alone. B) NG2+ OPC counts in the injection site reveal OPC loss in Iron+LPS and LPS injection sites at 1d. By 7d, OPC numbers increased in all groups (except Vehicle). C) NG2+/BrdU+ OPC counts reveal that OPC proliferation occured to a similar extent in Iron, Iron+LPS, and LPS injection sites by 7d. D) NG2+/pSTAT3+ OPC counts reveal that a significantly lower percentage of OPCs expressed pSTAT3 in Iron and Iron+LPS injection sites at 1d. Data represents mean ± SEM. A-C) Two-way ANOVA with Bonferroni post hoc test. D) One-way ANOVA with Tukey’s post hoc test: *p<0.05; **p < 0.01; ***p < 0.001 versus vehicle or control, unless otherwise noted.

119 Cytokines, nitrites and glutamate may mediate cytotoxicity in LPS but not Iron treated tissue

To examine potential mediators of acute OL and OPC (and neuron) loss, we examined factors known to contribute to OL lineage toxicity. Using mRNA isolated from spinal cords at 1d post-injection, quantitative real-time PCR revealed that Iron+LPS and LPS alone significantly increased transcription of inducible nitric oxide synthase (iNOS, ~400-fold), tumor necrosis factor alpha

(TNFα, ~6-fold), and interleukin-1 alpha (IL-1α, ~20-fold), all factors that contribute to OL lineage toxicity (Fig. 30 A-C; Li et al., 2005 & 2008; Bastien et al., 2015). Not surprisingly, cultured neonatal microglia demonstrated the same pattern of transcriptional changes after LPS+Iron or LPS, suggesting that microglia may be the primary driver of in vivo transcriptional changes (Fig. 30 D-

F). Interestingly, Iron alone did not significantly change transcription of any of these factors in vivo or in vitro, suggesting that a different mechanism controlled iron-induced OL and neuron death. iNOS produces superoxide and nitric oxide, which then react to form peroxynitrite, a strong oxidant used to kill pathogens (Xia and Zweier et al.,

1997). To determine if transcriptional changes of iNOS resulted in nitrite production, the Griess assay was performed 24h after stimulation. Since large numbers of cells are needed to reach the sensitivity range of the assay, bone marrow derived macrophages (BMDMs) were used. Supernatants from Iron+LPS and LPS-treated macrophages had ~30-fold increase in nitrites compared with

120 control or Iron treated macrophages, verifying that TLR4 activation induced nitrite production (Fig. 30 G). Because glutamate excitotoxicity is another mechanism of

OL lineage cell and neuron death (McDonald et al., 1998; Pitt et al., 2003), glutamate levels were quantified from the same supernatants. Again, supernatant from Iron+LPS and LPS-treated macrophages had a significant two-fold increase in glutamate while Iron-treated levels matched controls and Iron (Fig. 30 H).

Collectively, these data suggest that the acute iron-mediated OL and neuron loss is likely a direct effect of iron rather than cytotoxic factors released from CNS macrophages.

121

Figure 30. Cytokines, nitrites and glutamate may mediate cytotoxicity in LPS but not Iron treated tissue. qRT-PCR on spinal cord homogenate 1d after injection (A-C), or cultured microglia (D-F) measured the relative mRNA expression of (A,D) inducible nitric oxide synthase (iNOS), (B,E) tumor necrosis factor alpha (TNFα), and (C,F) interleukin-1 alpha (IL-1α). Supernatant from macrophages stimulated for 24hrs revealed that Iron+LPS and LPS-treated macrophages produced significantly more nitrites (G) and glutamate (H) compared with control and Iron-treated macrophages. Data represents mean ± SEM. A-H) One-way ANOVA with Tukey’s post hoc test: *p<0.05; **p < 0.01; ***p < 0.001 versus vehicle or control, unless otherwise noted.

122 TLR4 activation enhanced tissue integrity 28d after Iron injection

Iron persists in the lesion after SCI for at least 42d post injury, which undoubtedly impairs repair processes (Sauerbeck et al., 2013). To determine if TLR4 activation improved chronic iron sequestration or removal in our model, 28d tissue was collected. Surprisingly, Perls staining revealed no appreciable iron in any injection sites at 28d (data not shown). This finding is likely due to the small volume of iron initially injected (500nl). Nevertheless, characterization of the

CNS macrophage and astrocyte response at 28d revealed that TLR4 activation concomitant with iron injection altered chronic tissue pathology compared with iron alone injection. As expected, microglia maintained a resting phenotype 28d after vehicle treatment (Fig. 31 A-A’). Similar to 7d injection sites, large phagocytic macrophages persisted in both Iron and Iron+LPS injection sites (Fig.

31 B-C’). Nevertheless, Iron+LPS injections had improved GM tissue integrity compared with Iron alone injection, which caused a dramatic reduction of GM

(Fig 31. B-C & F-G; dotted lines). Interestingly, while reactive CNS macrophages persisted in LPS alone injection, round phagocytic cells were scarce, indicative of a less inflammatory environment at 28d compared with 1 and 7d time points (Fig.

31 D & D’). Together, these data suggest that a more inflammatory environment persists 28d after Iron +/- LPS injection than LPS alone, but concomitant TLR4 activation improves tissue integrity after Iron injection.

123

Figure 31. TLR4 activation enhanced tissue integrity 28d after Iron injection. A- D) Low-power images from the injection site 28d post-injection immunolabeled for CD11b. Dotted lines indicate the GM/WM border. A’-D’) High-power views of the grey-white matter border are shown below each low-power image. E-H) Low- power images from the injection site 28d post-injection immunolabeled for GFAP and methyl green. CNS macrophages remain reactive 28d post-injection in all groups, but round phagocytic macrophages only persist in Iron and Iron+LPS injection sites. Astrocytes surrounding the injection site at 28d reveal a dramatic reduction of GM in Iron injection. Scale bars: (A-D) 200µm; (A’-D’) 50µm; (E-H) 200µm

TLR4 activation with concomitant Iron injection increases myelin protein zero expression by 28d, a marker of Schwann cell myelin

An intriguing yet not fully understood feature of SCI is the infiltration of peripheral

Schwann cells, which contribute to remyelination (Blight and Young, 1989;

Wrathall et al., 1998; Guest et al., 2005; McTigue et al., 2006). In addition to remyelination, Schwann cells benefit injury environments by producing

124 neurotrophic factors and extracellular matrix molecules and limiting lesion cavitation, all features that have led to clinical trials of Schwann cell transplants after SCI (Bunge and Wood, 2012; Xu, 2012). Although demyelination or remyelination were not assessed here, the presence of Schwann cells in the lesion was assessed by immunolabeling for myelin protein zero (P0), a Schwann cell myelin protein. As expected, P0 was not expressed 28d after vehicle treatment (Fig 32. A). Interestingly, P0 expression was significantly higher than vehicle treatment in Iron+LPS injections at 28d, despite noticeable P0 expression in both Iron and LPS alone injections (Fig 32. B-E). Thus, these data suggest that

TLR4 activation concomitant with iron-induced lesion may benefit chronic tissue pathology through enhanced Schwann cell infiltration and myelination.

Figure 32. Iron+LPS injection increases myelin protein zero (P0) expression by 28d. A-D) Low power images from the injection site 28d post-injection immunolabeled for P0, neurofilament heavy, and DAPI. E) High-power z-stack image of P0 myelin (red) surrounding a neurofilament profile (green). F) Densitometric quantification of P0 in the injection site revealed that (Continued)

125 (Fig. 32 Continued) Iron+LPS injections accumulate significantly more P0 by 28d compared with vehicle control. Data represents mean ± SEM. F) One-way ANOVA with Tukey’s post hoc test: *p<0.05. Scale bar: (A-D) 100µm

DISCUSSION

This work demonstrates that TLR4 activation enhances iron sequestration by

CNS macrophages in vivo and in vitro. Prior in vitro work showed that microglia take up iron (Widmer and Grune, 2005), and TLR4-activated microglia shift iron protein expression towards an iron sequestering phenotype (Urrutia et al., 2013).

Here, iron uptake by microglia in vitro was confirmed with Perls staining, which revealed that TLR4-activated microglia internalized over twice as much iron as non-activated microglia. These findings confirm that the endogenous iron chelating mechanism, described in the periphery as a microbial defense response (Nairz et al., 2010), is also present in the CNS.

Injuries causing CNS bleeding lead to massive increases in intraparenchymal iron. However, blood and serum factors complicate models of intraspinal hemorrhage or trauma (Sauerbeck et al., 2013; Sahinkaya et al., 2014).

Therefore, to get a clearer idea of how iron itself affects cellular responses, ferric citrate was microinjected directly into the spinal cord, as a reductionist approach to CNS iron accumulation and progressive cytotoxicity (McDonald, 2002). LPS was injected concomitantly with iron, to determine if TLR4 activation enhanced iron sequestration and reduced toxicity.

126 Compared with Iron injection alone, multiple outcome measures here suggest

TLR4 activation concurrent with iron stimulated greater iron uptake and storage in CNS macrophages. First, iron staining in Iron alone injections revealed a clump at the injection site whereas iron labeling in Iron+LPS sections mirrored the distribution of TLR4-activated macrophages at 1d and 7d post-injection. Also, robust ferritin expression by macrophages in the Iron+LPS group revealed these cells had an enhanced iron storage capacity. Interestingly, iron and macrophages accumulated in the grey matter 7d after iron alone injection, indicating that at least some iron is eventually taken up by macrophages without exogenous

TLR4-activation. This may be due to TLR4 activation by endogenous ligands such as HMGB1 or heat shock proteins released from dead or damaged cells

(Kigerl and Popovich, 2009).

Another indication of enhanced iron uptake by LPS co-injection was enhanced transcription of iron sequestration proteins. Upon TLR4 activation, peripheral immune cells modify iron protein expression to limit iron availability required for microbes to survive. For example, TLR4-activated macrophages increase expression of DMT-1, but decrease transferrin receptor, which enhances the uptake of free iron (Kim and Ponka, 2000; Ludwiczek et al., 2003). Additionally, monocytes and neutrophils produce hepcidin after TLR4 activation, which causes ferroportin internalization and breakdown thereby decreasing iron export

(Peyssonnaux et al., 2006; Theurl et al., 2008). Here, intraspinal TLR4 activation via LPS reproduced all of these changes, suggesting that CNS macrophages

127 respond to TLR4 activation in a similar manner as peripheral immune cells responding to pathogen invasion.

Interpreting the TLR4-mediated transcriptional changes is challenging for a number of reasons. First, iron regulatory proteins 1 and 2 (IRP1/2) post- transcriptionally regulate expression of many iron proteins. However, IRP expression is not always altered by inflammatory stimuli, suggesting that iron protein regulation is also transcriptionally controlled (Tacchini et al., 2008).

Further, whereas IRP1 and IRP2 are present in the CNS, their role has not yet been confirmed (Rouault, 2013; Ward et al., 2015). Nevertheless, intraspinal transcriptional changes detected here indicate that TLR4 activation alters iron protein transcription similarly in the CNS and periphery.

Another challenge in interpreting the intraspinal TLR4-induced transcriptional changes is that astrocytes, neurons, and OL lineage cells might contribute to

TLR4-induced transcriptional changes. Indeed, they all express iron proteins, and may express TLR4, although to a lesser extent (Trotta et al., 2014; Vaure and Liu, 2014). For example, TLR4 activation of microglia, astrocytes and neurons increases DMT-1 expression in all three cells (Urrutia et al., 2013).

However, given the TLR4-induced loss of neurons and OLs in the at 1d injection sites, these cells likely contribute little to gene transcription.

Although iron sequestration was enhanced in CNS macrophages by TLR4 activation, neurotoxicity was not reduced. The finding that TLR4 activation alone caused neurotoxicity adds to some inconsistencies in the literature. For example,

128 injection of LPS into the mouse spinal cord was only neurotoxic when combined with cysteine (Kigerl, 2012). However, TLR4-activated microglia phagocytose neurons in vitro (Lehnardt et al., 2003; Neher et al., 2011). One explanation for these differences is heterogeneity of commercially available LPS. For instance, individual lots of LPS have measured endotoxin units (EU, a measure of LPS potency) that can differ by an order of 10. Furthermore, unpublished work in our lab found that LPS isolated from different lines of E. coli induce varying levels of systemic immune activation. Additionally, TLRs exhibit species-specific ligand recognition and downstream gene expression (Schroder et al., 2012; Vaure and

Liu 2014). This may explain why CNS macrophage and oligodendrogenic responses vary between rats and mice in our hands (unpublished observation).

This work also shows that OLs were not protected from iron-induced toxicity despite TLR4-induced iron sequestration. In fact, all groups displayed a dramatic reduction of OLs in the injection site, indicating that both iron and intraspinal

TLR4 activation cause acute OL toxicity. This is in line with previous work showing that intra-parenchymal LPS injections induce OL loss and demyelination in adult rats and hypomyelination in developing rats (Lehnardt et al., 2002; Pang et al., 2003; Felts et al., 2008).

Although acute OL loss was not reversed, it was still possible that sequestering toxic iron would enhance oligodendrogenesis, the replacement of OLs by OPCs.

However, oligodendrogenesis was actually impaired by concomitant iron and

LPS injection compared with either alone. To understand why this occurred, OPC

129 survival and proliferation was examined. Surprisingly, TLR4 activation induced acute OPC loss, whereas OPCs were resistant to iron-induced toxicity. Previous descriptions of TLR4-induced oligodendrogenesis likely overlooked the acute loss of OPCs because it was always quantified between 3-11d after TLR4 activation (Schonberg et al., 2007; Miron et al., 2013; Shigemoto-Mogami et al.,

2014). Notably, in vitro studies showed that OL lineage cells are killed by cytokines and reactive oxygen/nitrogen species produced by TLR4-activated microglia (Lehnardt et al., 2002; Li et al., 2005; Li et al., 2008; Pang et al., 2010).

Our work is the first to demonstrate in vivo TLR4-induced OPC loss in adult rats.

Furthermore, we show that OPCs are resistant to iron-induced toxicity, which kills neurons and OLs. This suggests that the cytokines and reactive species in the injection site differ between the Iron alone and LPS +/- Iron groups. Indeed, LPS

+/- Iron groups had significantly increased transcription of iNOS, TNFα and IL-1α, compared with Iron and control groups. Additionally, macrophage supernatants from LPS +/- Iron groups had more nitrites and glutamate than Iron or control supernatants. Changes in all of these soluble factors is likely a major contributor to TLR4-induced OL and OPC loss, however they do not explain iron-induced OL loss, meaning this is likely a direct effect of iron.

Acute OPC loss does not explain delayed oligodendrogenesis after Iron+LPS injection because LPS alone injections had normal OL replacement. OPC proliferation at 1 and 7d was similar in all groups, suggesting that OPC differentiation was altered in Iron+LPS injections. The IL-6 family of cytokines

130 initiates OPC differentiation via phosphorylation of STAT3 (pSTAT3). After Iron and Iron+LPS injections, a lower percentage of NG2 cells expressed pSTAT3 compared with LPS injections. Reduced pSTAT3 signaling combined with acute

OPC loss might explain why Iron+LPS injections had reduced oligodendrogenesis. However, it is unclear why a lower percentage of OPCs expressed pSTAT3. One possible explanation is less IL-6, LIF or CNTF present after Iron+LPS injections. However, more work is needed to determine if this is the case.

Another explanation for reduced oligodendrogenesis is that TLR4-activated CNS macrophages act as iron chelators, and thus do not release iron. Indeed, iron chelation can reduce TLR4-induced oligodendrogenesis (Schonberg and

McTigue, 2009). Interestingly, lack of available iron also causes anemia of chronic disease (ACD), where infection-induced iron sequestration prohibits available iron for erythroid progenitor cells (Weiss, 2009). This explanation parallels the iron metabolism of polarized macrophages (Cairo et al., 2011). For example, M2 polarized macrophages, which are associated with anti- inflammatory and wound healing responses, release four times as much iron as

M1 or non-polarized macrophages (Recalcati et al., 2010). Additionally, supernatant from M2 macrophages increased renal carcinoma cell division twofold compared with M1 supernatant, which was reversed by an iron chelator

(Recalcati et al., 2010). Thus, a switch from a M1 to a M2 phenotype might benefit oligodendrogenesis after Iron+LPS injection.

131 Although Iron+LPS treatment did not prevent cytotoxicity and impaired oligodendrogenesis, the enhanced sequestration of iron may provide a delayed benefit. Indeed, tissue integrity was improved in Iron+LPS tissue compared with iron alone injections at 28d. This was true in lieu of the fact that activated CNS macrophages persisted in both groups. One explanation for the improved tissue integrity is that Iron+LPS tissue had more Schwann cell myelin. Schwann cells produce numerous trophic factors and extracellular matrix proteins that benefit repair (Griffin and Thompson, 2008; Gaudet et al., 2011). They also contribute to remyelination after SCI (Blight and Young, 1989; Wrathall et al., 1998; Guest et al., 2005; McTigue et al., 2006). While enhanced tissue integrity at 28d is correlated with elevated levels of Schwann cell myelin, it is not causative. Thus, further experiments will need to address if enhanced Schwann cell infiltration after Iron+LPS injections contributes to enhanced tissue integrity.

Overall, this work demonstrates the importance of proper iron homeostasis. In cases of iron overload, TLR4-activation enhances iron sequestration in CNS macrophages. However, any benefit of reduced free iron on neurotoxicity is negated by TLR4-induced neurotoxicity. Furthermore, oligodendrogenesis is impaired by iron-loaded CNS macrophages. Acutely, sequestering iron does not appear to be beneficial, however, it may be beneficial chronically. Nevertheless, methods to sequester iron that are less “inflammatory” and can safely release iron will have widespread impact due to the high number of cases involving iron- induced toxicity.

132 Chapter 5: General conclusions and discussion

Inflammation is a hallmark of CNS trauma and disease that is undoubtedly responsible for initiating and exacerbating damage. However, aspects of inflammation are certainly beneficial. This dissertation examines how activation of one inflammatory receptor, toll-like receptor 4 (TLR4), initiates both detrimental and beneficial effects on oligodendrocyte lineage cells.

Oligodendrocytes (OLs) are responsible for myelination in the CNS, which enhances conduction velocity while providing structural and metabolic support to axons. Because one OL can myelinate up to 60 individual axons, effective neuronal conduction is extremely dependent on the health of OLs. Indeed, demyelination is a major component of numerous CNS injuries and diseases, including spinal cord injury (SCI) and multiple sclerosis (MS) (Gledhill et al.,

1973; Gledhill and McDonald, 1977; Harrison and McDonald, 1977; Balentine and Paris, 1978; Banik et al., 1980; Blight, 1983 & 1985; Noseworthy et al., 2000;

Guest et al., 2005; Trapp and Nave, 2008). Although OLs have an endogenous capacity to remyelinate, this process is often incomplete (Guest et al., 2005;

Totoiu and Keirstead, 2005). Therefore, enhancement of remyelination and OL survival are viable therapeutic targets for demyelinating insults.

133 Because of the inflammatory component of demyelination, the obvious therapeutic option is anti-inflammatory agents, aimed at reducing OL loss and demyelination. However, it is clear that this blanket approach impairs repair processes such as oligodendrogenesis and remyelination (Goldstein et al.,

2016). Thus, a more effective approach would be to target precise inflammatory molecules or pathways in lieu of broad-spectrum anti-inflammatory agents.

Indeed, this would involve inhibition of factors that have negative effects on OL lineage cells, while exploiting factors with beneficial effects. In order to do this, an intricate understanding of the mechanisms that cause OL loss and oligodendrogenesis is needed.

In the CNS, microglia are the primary TLR4-expressing cells, and thus are the first responders to inflammatory stimuli. Much of the work in this dissertation builds upon previous work showing that TLR4-activated microglia initiate OL loss as well as oligodendrogenesis. However these two phenomena are usually reported separately. For example, seminal work in the field showed that lipopolysaccharide (LPS), a TLR4 ligand had no effect on OLs alone in vitro.

However, LPS-treated microglia plated in Boyden chambers over OLs, initiated significant OL loss via peroxynitrite and TNFα (Lehnardt et al., 2002; Li et al.,

2005; Li et al., 2008). Later in vitro studies then reported that LPS-treated microglia initiated OL progenitor cell (OPC) proliferation (Miron et al., 2013;

Shigemoto-Mogami, et al., 2014). Combined, these in vitro experiments showed that soluble factors released from microglia initiate either OL loss or OPC proliferation. Nevertheless, previous work from our lab demonstrated that

134 intraspinal LPS injection led to an acute loss of OLs, followed by robust proliferation and differentiation of OPCs (Schonberg et al., 2007). Although this work showed that TLR4-mediated OL loss and oligodendrogenesis are not mutually exclusive, the factors that mediate these effects are unknown.

To better understand the factors that initiate TLR4-induced OL loss and oligogenesis, experiments in chapter 2 sought to determine if cytokines and growth factors with known effects on OL lineage cells were produced by TLR4- activated microglia. To do this, mRNA expression was compared between an intraspinal injection of LPS (the previously established model), and microglia stimulated with LPS in vitro. Using these two experimental designs, it was possible to determine which factors were expressed during in vivo OL loss and replacement, and also determine if TLR4-activated microglia transcribed these factors. As expected, the data indicated that TLR4-activated microglia transcribe factors that affect OL survival, OPC proliferation and OPC differentiation. These findings provide mechanistic rationale for previously reported OL loss and oligodendrogenesis in vitro (Lehnardt et al., 2002; Li et al., 2005; Li et al., 2008;

Miron et al., 2013; Shigemoto-Mogami, et al., 2014). However, not all factors transcribed after in vivo TLR4 activation were also transcribed by microglia. To some extent, this finding is not surprising, due to the cellular heterogeneity of an in vivo setting. Nevertheless, it raises a number of questions that should be addressed in future studies.

135 The first question raised is whether or not other cell types in the CNS respond directly to LPS. Although microglia are the primary TLR4-expressing cells in the

CNS, reports indicate that TLR4 is also expressed on astrocytes, endothelial cells, and neurons (Bsibsi et al., 2002; Bowman et al., 2003; Taylor et al., 2004;

Acosta and Davies, 2008; Leow-Dyke et al., 2012). Thus, it is possible that some combination of these cells contribute to the in vivo TLR4-induced transcriptional changes. In vitro experiments with pure populations of each cell type or TLR4 knockouts on specific cell populations will contribute valuable insight into this possibility.

Interestingly, many factors that promote oligodendrogenesis, such as PDGF-A,

CNTF, TGFβ and CXCL12 are not produced by TLR4-activated microglia.

Furthermore, some of the transcriptional changes present in vivo, but not in vitro, only occur at later time points (i.e. CNTF at 3d and CXCL12 at 7d). This raises a second important question; do TLR4-activated microglia and subsequent cellular changes initiate paracrine signaling to other cell types? Undoubtedly, paracrine signaling occurs after intraspinal TLR4 activation, because astrocytes, neurons and endothelial cells all express cytokine and growth factor receptors.

Additionally, astrocytes are known producers of PDGF-A, CNTF, TGFβ and

CXCL12, and are likely a key player in the oligodendrogenic effects after intraspinal TLR4 activation (Raff et al., 1988; De Groot et al., 1999; Imitola et al.,

2004; Tripathi & McTigue 2008; Patel et al., 2010). However, delineating the contribution of each cell type is very difficult. One in vitro approach is to use conditioned media from LPS-stimulated microglia and stimulate each cell

136 population in isolation. However, to determine if transcriptional changes are due to paracrine signaling, LPS needs to be removed from the conditioned media.

Although endotoxin removal kits are available, these methods are only somewhat effective. Thus, stimulating astrocytes, neurons, or endothelial cells with individual factors produced by TLR4-activated microglia is likely the best option to study paracrine signaling in this model.

A final consideration for the differences in transcription between TLR4-activated microglia and spinal cords is the contribution of infiltrating immune cells not normally present in the CNS. Indeed, peripheral monocytes and neutrophils infiltrate the CNS after intraparenchymal LPS injection (Montero-Menei et al.,

1997; Nadeau and Rivest, 2003; Felts et al., 2005; Zhou et al., 2006; Ji et al.,

2007). These peripheral cells are present as early as 24hrs after LPS injection, and thus contribute to transcriptional changes at every time point we explored.

Previously, depletion of peripheral monocytes with clodronate liposomes enhanced recovery after SCI, in part by preserving myelinated axons (Popovich et al., 1999). However, in a lysolecithin-induced demyelinating lesion, peripheral monocyte depletion impaired remyelination (Kotter et al., 2001). In this and other demyelination models, the role of infiltrating monocytes is to phagocytose myelin debris, which is inhibitory to OPC differentiation (Robinson and Miller, 1999;

Kotter et al., 2006). However, after intraspinal LPS injection, little if any demyelination occurs (Schonberg et al. 2007). Thus, it is unclear what role infiltrating monocytes may have in our model. Therefore, depletion of peripheral monocytes or all hematopoietic cells, via irradiation, after intraspinal TLR4

137 activation will help to delineate the role of infiltrating immune cells in acute OL loss and oligodendrogenesis.

Collectively, the work in chapter 2 provides a mechanistic rationale for TLR4- induced effects on OL lineage cells, and shows that microglia contribute to many, but not all of the transcriptional changes. Because astrocytes produce many of the oligodendrogenic factors that are expressed after intraspinal TLR4 activation, microglia also likely play a major role in initiating astrocyte responses that benefit oligodendrogenesis.

TLR4-stimulated murine macrophages secrete over 775 unique proteins

(Meissner et al., 2013). Undoubtedly, some of these proteins have effects on OL lineage cells that are previously unknown. In chapter 3, intraspinal injection of colony stimulating factor 3 (CSF3) or interleukin 7 (IL-7) confirmed that other factors produced by TLR4-activated microglia influence oligodendrogenesis.

Intraspinal injection of CSF3 initiated a ~3-fold increase in OPC proliferation.

Interestingly, this response was not nearly as robust as intraspinal LPS injection, which initiated ~10-fold increase in proliferating OPCs. One explanation for this discrepancy is that multiple oligodendrogenic factors combine to produce the robust proliferative response after LPS injection. For example, CXCL1 synergizes with PDGF-A to potently enhance PDGF-induced OPC proliferation (Robinson et al., 1998; Wu et al., 2000). Indeed, transcription of both CXCL1 and PDGF-A is elevated after intraspinal LPS injection. However, another explanation for the discrepancy in OPC proliferation is that intraspinal LPS causes OPC loss, which requires OPC proliferation to restore baseline OPC numbers. Indeed, following

138 OPC death, neighboring OPCs proliferate to restore OPC homeostasis (Hughes et al., 2013). Data in chapter 4 revealed that intraspinal LPS injection causes acute OPC loss, which supports this explanation for a more robust OPC proliferation after intraspinal LPS injection. After CSF3 injection, total NG2+ cell counts did not reveal any significant difference in OPC numbers compared with vehicle. Thus, we cannot yet rule out the possibility that CSF3 caused OPC proliferation by first killing OPCs. An ongoing experiment to assess acute OPC responses to CSF3 will help confirm the exciting prospect that CSF3 initiates

OPC proliferation without prior OPC loss.

Intraspinal injection of IL-7 increased total OLs by ~25% above vehicle controls, which also was not as robust as the increase in total OLs after intraspinal LPS

(~100% increase). However, the robust increase in OLs after intraspinal LPS injection was not observed until 7d and was preceded by a significant loss in OL.

After IL-7 injection, an increase in OLs was observed at 3d, with no appreciable

OL loss. Thus, it is possible that by 7d, even more OLs will accumulate after IL-7 injection.

Although the discovery of two novel oligodendrogenic factors is exciting, more work is required to determine how these factors impact oligodendrogenesis. For example, it is unclear if receptors for CSF3 and IL-7 are expressed on OPCs. If direct stimulation of purified OPCs with CSF3 or IL-7 in vitro initiates oligodendrogenic effects, then OPCs must express the CSFR and IL-7Rα.

Conversely, the presence of reactive microglia after CSF3 or IL-7 injections indicates that microglia might initiate the oligodendrogenic effects via paracrine

139 signaling. One way to address this possibility is to quantify cellular responses to

CSF3 and IL-7 injections at a more acute time point. If microglia are reactive before any appreciable OPC response, than it is likely that the oligodendrogenic effects of CSF3 and IL-7 are initiated by paracrine signaling from microglia. This important experiment is currently underway.

Nevertheless, the identification of these two novel oligodendrogenic factors supports the exciting prospect that other factors have undiscovered effects on OL lineage cells. Indeed, OL lineage cells express receptors for numerous interleukins and other cytokines (Cannella and Raine, 2004; Peferoen et al.,

2014). Thus, a careful and systematic characterization of cytokine effects on OL lineage cells would benefit the myelin field immensely.

One method to identify potential factors that influence OL lineage cell responses is by in silico analysis of the TLR4-activated macrophage secretome (Meissner et al., 2013). Indeed, TLR4-activated macrophages secrete many of the same factors that were explored in chapters 2 and 3. For example, TLR4-activated murine macrophages secrete increased levels of TNFα, IL-6, CSF3 and CXCL1.

Based on increased mRNA levels, our data suggests that TLR4-activated rat microglia act similarly. Interestingly, TLR4-activated macrophages also produced elevated levels of endothilin-1, which inhibits OPC differentiation through Notch signaling (Hammond et al., 2014). Although endothilin-1 expression was not studied in this dissertation, this finding indicates that in silico analysis of the

TLR4-activated macrophage secretome is a viable method to identify factors that might contribute to TLR4-induced effects on OL lineage cells.

140 However, the secretome of TLR4-activated murine macrophages does vary slightly from the expected secretome of TLR4-activated rat microglia. For example, although IL-7 is secreted by TLR4-activated macrophages, the levels are not significantly different from unstimulated macrophages. Furthermore,

TLR4-activated macrophages also secrete PDGF-A and TGFβ, which TLR4- activated microglia do not based on mRNA levels (see Fig. 5 & 9). These discrepancies could be due to species differences, post-transcriptional regulation, or differences in cell types. Thus, it is important to consider the specific experimental parameters when conducting in silico data analysis.

Collectively, the work in chapters 2 and 3 took advantage of the divergent effects of TLR4-activated microglia on OL lineage cells to identify specific targets for therapeutic intervention in demyelinating disease and injury. Manipulation of these factors during and after demyelination will undoubtedly advance these findings closer to clinical translation. Indeed, some of these experiments have yielded exciting results. For example, intraventricular injection of LIF-expressing adenovirus enhanced OPC proliferation, differentiation, and myelination after cuprizone-induced demyelination. Also, over-expression of CXCL1 reduced the severity of experimental allergic encephalomyelitis (EAE), an animal model of

MS, by increasing OPC numbers and subsequent remyelination (Omari et al.,

2009). These promising results indicate that specifically targeting factors expressed by TLR4-activated microglia is a viable therapeutic approach to demyelinating disease and injury.

141 After characterizing mechanisms for the divergent effects of TLR4-activated microglia on OL lineage cells in chapters 2 and 3, work in chapter 4 sought to exploit a beneficial TLR4-mediated anti-microbial response to combat iron- induced toxicity in the CNS. In response to a systemic pathogen invasion, peripheral macrophages sequester iron, withholding the essential nutrient (Nairz et al., 2010). While iron is indeed essential, in excess, it produces damaging free radicals that cause progressive neuronal and glial cell death (Armstrong et al.,

2001; Uttara et al., 2009; Caliaperumal et al., 2012). Thus, in cases of CNS iron overload, mechanisms to enhance iron sequestration have obvious therapeutic appeal. Indeed, iron chelation strategies are commonly used to sequester excess redox-reactive iron (Ward et al., 2015). However, reaching therapeutic levels of chelator within the CNS without disrupting peripheral iron regulation is a challenge (Sauerbeck et al., 2013).

Work in chapter 4 revealed that TLR4 activated CNS macrophages sequester more iron after CNS overload. However, this did not diminish acute or protracted iron-induced cytotoxicity. Because TLR4-activated microglia and iron kill neurons and OLs, acute cytotoxicity was unsurprising (Lehnardt et al., 2002 & 2003;

McDonald et al., 2002; Schonberg et al., 2007; Neher et al., 2011). Nevertheless, we hypothesized that iron sequestration would limit progressive neuron loss and benefit oligodendrogenesis. Indeed, this was not the case. Intermediate GM neurons were lost in all treatment groups at 7d, while Iron+LPS injection caused a significant reduction in OL replacement. Because acute OL loss and OPC

142 proliferation was similar between groups, it is clear that iron-loaded CNS macrophages impaired OPC differentiation. These data indicate that instead of protecting neurons and OLs from iron-toxicity, iron-loaded CNS macrophages made the injection site more deleterious.

In addition to trauma and disease-induced iron accumulation, this finding is also relevant to the aged brain, in which microglia accumulate surplus iron (Zecca et al., 2004). It is theorized that iron-loaded microglia in the aged brain contribute to dysregulated inflammatory cytokine production and toxicity. Indeed, this theory is supported by work from Sam David’s group, which demonstrated that iron loading of alternatively-activated (M2) macrophages induces a rapid switch to pro-inflammatory (M1) macrophages (Kroner et al., 2014). Thus, instead of protecting neurons and OLs from iron-induced toxicity, iron-loaded CNS macrophages likely contribute to the deleterious environment.

Another characteristic of M1 macrophages is a diminished ability to release iron to iron-needy cells. For example, M2 macrophages release four times as much iron as M1 or non-polarized macrophages, which correlates with enhanced renal carcinoma cell division (Recalcati et al., 2010). Just as renal carcinoma cells require iron for division, OPCs require iron for differentiation. Indeed, during development microglia release intracellular iron, which is taken up by differentiating OPCs (Connor et al., 1995). Furthermore, in the lysolecithin- induced demyelination model, the remyelination phase is associated with a switch from M1 CNS macrophages to M2 (Miron et al., 2013). Thus, a switch

143 from a M1 to a M2 phenotype might benefit oligodendrogenesis after Iron+LPS injection, by inducing iron release from CNS macrophages.

An alternative explanation for the impaired OPC differentiation in Iron+LPS tissue is that pSTAT3 signaling in OPCs was diminished. Indeed, only ~25% of OPCs in

Iron+LPS tissue expressed pSTAT3 compared to ~100% after LPS alone injection. IL-6, LIF and CNTF are potent activators of OPC differentiation and signal via the STAT3 pathway (Mayer et al., 1994; Marmur et al., 1998; Zhang et al., 2004; Talbott et al., 2007). Thus, reduced pSTAT3 signaling after Iron+LPS injection suggests that iron either reduces IL-6, LIF, or CNTF levels or reduces

OPC responsiveness to them.

Collectively, work from chapter 4 demonstrates how a potentially beneficial iron chelation response is negated by TLR4-induced cytotoxicity. Additionally, impaired oligodendrogenesis in Iron+LPS injections reveal how important proper iron storage and transport are for basic cellular responses. Nevertheless, preliminary data indicate that iron sequestration enhances chronic GM tissue integrity, which might be related to enhanced Schwann cell infiltration and myelination. However, further analysis is needed to make such claims.

Collectively, the work in this dissertation advances the understanding of how

TLR4 activation contributes to the expression of cytokines and iron handling after

SCI. To a large extent, intraspinal TLR4 activation initiates a cascade of cytokine expression that mimics the post-SCI environment, suggesting that TLR4 activation may play a role after SCI. This is especially true for the expression of early inflammatory mediators (i.e., IL-1 and TNFα). For example, transcription of

144 IL-1β and TNFα is elevated within 20 minutes after SCI. Furthermore, protein levels of IL-1β, IL-1α and TNFα are all elevated within the first 6hrs (Wang et al.,

1996; Pineau and Lacroix, 2007; Bastien et al., 2015). Expression of these early inflammatory factors peak by 1d after SCI, and are back to baseline levels by 2d.

Intraspinal injection of LPS initiates the same expression profile for IL-1β, IL-1α and TNFα, indicating that TLR4 signaling may contribute to their post-SCI expression. In fact, TLR4-deficient mice express less IL-1β after SCI than wildtype mice (Kigerl et al., 2007; Church et al., 2016). Although IL-1 and TNFα contribute to neurotoxicity and OL loss, these factors also stimulate perivascular cells to produce chemoattractants, which initiates leukocyte infiltration (Thibeault et al., 2001; Pineau et al., 2010).

Interestingly, transcription of the neutrophil chemoattractant, CXCL1, increases acutely and transiently after SCI (McTigue et al., 1998). Again, intraspinal LPS injections induced a similar expression pattern, providing further evidence that

TLR4 signaling may play a role in leukocyte infiltration. On the other hand,

CXCL1 also synergizes with the potent mitogen, PDGF-A, to enhance OPC proliferation (Robinson et al., 1998; Wu et al., 2000). Although PDGF-A expression after SCI is not well characterized, a gene array indicated that PDGF-

A expression is elevated 1 and 3d post-SCI (Velardo et al., 2004). Because

CXCL1 and PDGF-A transcription is elevated acutely after LPS injection and

SCI, it is feasible that these factors contribute to the robust OPC proliferation that occurs in both cases. Interestingly, PDGF-A transcription is also increased 21d post-SCI, but not in TLR4-deficient mice (Church et al., 2016). Therefore, TLR4

145 signaling may also contribute to OPC proliferation that persists for at least 28d post-SCI (Hesp et al., 2015).

Similar to CXCL1, IL-6 and LIF are also expressed early and transiently after

SCI, which closely mimics the expression pattern after intraspinal LPS injection

(Streit et al., 1998; Pineau and Lacroix, 2007). These closely related cytokines serve numerous purposes in the injured CNS including neuronal protection, OL protection and enhancement of remyelination (Cheema et al., 1994; Ikeda et al.,

1996; Kerr & Patterson, 2005; Azari et al., 2006; Deverman & Patterson, 2012).

In addition to these beneficial effects, IL-6 and LIF are potent activators of microgliosis and astrogliosis (Penkowa et al., 1999; Kerr and Patterson, 2004).

Therefore, after SCI, IL-6 and LIF likely have conflicting roles. However, due to their early and transient expression, it is possible that they contribute to the remyelination process by enhancing OPC survival and proliferation, which precedes the wrapping of axons beginning around 2 weeks post-SCI (Gledhill et al., 1973).

Another inflammatory mediator that is expressed early after SCI is iNOS. Indeed, iNOS contributes to cytotoxicity after SCI via production of the free radical peroxynitrite. After SCI, iNOS transcription increases as early as 3hrs post-SCI, and returns to baseline by 2d (Satake et al., 2000). This increase in iNOS is correlated with evidence of oxidative damage that persists throughout the first week post-SCI (Xiong et al., 2007). Again, the similarities in iNOS expression between intraspinal TLR4 activation and SCI exemplify the deleterious potential of TLR4-induced inflammation.

146 On the other hand, factors known for neuroprotective and reparative qualities are also expressed after SCI. However, these factors tend to be expressed at less acute time points. For example, TGFβ, CNTF, and CXCL12 are all factors that are expressed between 3 and 7d, as well as months post-SCI (Lee et al., 1998;

McTigue et al., 2000; Zai et al., 2005; Tripathi and McTigue, 2008; Knerlich-

Lukoschus et al., 2011; Hesp et al., 2015). For the most part, intraspinal LPS evokes a similar expression profile for these factors over 7d; however, TLR4- activated microglia are not responsible for these effects. Therefore, TLR4 activation likely induces paracrine effects on astrocytes, which are the primary producers of TGFβ, CNTF, and CXCL12. In fact, CNTF expression after traumatic brain injury is markedly reduced in IL-1β deficient mice (Herx et al.,

2000). Interestingly, TLR4-deficient mice have elevated TGFβ transcription 21d- post SCI compared with wild type control, indicating that at least chronically,

TLR4 signaling acts to reduce TGFβ signaling (Church et al., 2016). Therefore, it is possible that TLR4 signaling both promotes and inhibits the expression of factors that promote OPC differentiation and remyelination, depending on the timing post-SCI.

Another factor that is expressed at sub-acute and chronic times after SCI is

IGF1. For example, after SCI, IGF1 expression is elevated from 3d until at least 1 month (Yao et al., 1995; Velardo et al., 2004). Interestingly, TLR4-deficient mice transcribe more IGF1 at both 7d and 21d post-SCI compared with wild type control. Therefore, TLR4-signaling may act to suppress the expression of IGF1 after SCI. Similarly, microglial and intraspinal TLR4 activation initiated a

147 reduction in IGF1 transcription. Thus, it is feasible that TLR4 signaling contributes to secondary neuron and OL loss after SCI by suppressing IGF1, which promotes survival of OLs and neurons (Barres et al., 1992; Gluckman et al., 1992; Mason et al., 2000; Cao et al., 2003).

Although the expression timeline of all the factors listed above are similar after

SCI and intraspinal LPS injection, the novel oligogenic factors uncovered in this dissertation (CSF3 and IL-7) have divergent transcriptional timelines after SCI and intraspinal LPS injection. For example, CSF3 and IL-7 transcription is significantly elevated at 1 and 3d post-LPS injection, respectively. However,

CSF3 and IL-7 mRNA are not significantly modified after SCI. Because expression of these factors is not increased after SCI, it is unlikely that the neuroprotective, neurogenic and oligodendrogenic qualities of CSF3 and IL-7 contribute significantly to the post-SCI injury milieu. Thus, it is clear that while

TLR4 signaling plays a major role after SCI, the lesion environment is immensely complex and cannot be recreated by a one-time activation of a single inflammatory receptor.

In addition to advancing the understanding of how TLR4 activation may influence the cytokine and growth factor expression after SCI, work in this dissertation provides evidence that TLR4 signaling may also orchestrate iron handling after

SCI. Previous work demonstrated that iron accumulates acutely after SCI, persists chronically, and is stored in ferritin-expressing macrophages (Rathore et al., 2008; Sauerbeck et al., 2013). Additionally, hepcidin levels increase as early as 1d post SCI (Rathore et al., 2008). After intraspinal Iron+LPS injection, iron

148 was taken up by CNS macrophages, stored in ferritin, and hepcidin expression increased. Conversely, Iron alone injection did not initiate an increase in ferritin, hepcidin, or uptake by CNS macrophages. Thus, TLR4 signaling after SCI may initiate iron sequestration by CNS macrophages.

Although iron was directly toxic to neurons and OLs after microinjection, the iron sequestration phenotype initiated by TLR4-activated CNS macrophages was equally toxic. This is likely due to the fact that iron in macrophages induces an unrestrained M1 phenotype, characterized by increased production of TNFα

(Mehta et al., 2013; Kroner et al., 2014). Indeed, TNFα transcription was increased after Iron+LPS injection compared with Iron alone injection. CNS macrophages are primarily classically activated (M1) following SCI, and iron inhibits a shift to the reparative M2 phenotype (Kigerl et al., 2009; Kroner et al.,

2014). Additionally, M2 macrophages switch to an M1 phenotype after transplantation into an SCI lesion, or after being loaded with iron. Thus, it is likely that the TLR4-induced sequestration of iron enhances the M1 phenotype, and impairs the switch to a more reparative M2 phenotype.

Overall, this dissertation drives home the point that TLR4-activated microglia mediate a wide range of divergent effects on OL lineage cell. Indeed, TLR4- activated microglia can negatively impact OL lineage cells with soluble factors, and by withholding essential elements such as iron. However, it is important not to overreact to the negative effects of TLR4-activated microglia, because microglia also produce numerous factors that protect OLs and initiate

149 oligodendrogenesis. Furthermore, TL4-activated microglia also appear to benefit oligodendrogenesis via paracrine activation of astrocytes. However, because oligodendrogenesis is not completely abrogated after SCI in TLR4-defieicent mice, it is clear that TLR4 signaling is not essential to oligodendrogenesis and remyelination. Nevertheless, the fact that one inflammatory receptor can have such a wide range of effects on one cell type indicates how complex an active inflammatory lesion really is. Even though broad-based anti-inflammatory agents may be a simple answer for treatment of complex diseases, it is imperative that scientists do not settle for simple answers. In depth analysis of reductionist models such as those in this dissertation are essential to uncovering clues that will help to solve much more complex diseases.

150 References

Acarin, L., González, B., Castellano, B., 2000. Neuronal, astroglial and microglial

cytokine expression after an excitotoxic lesion in the immature rat brain. Eur J

Neurosci 12, 3505-20.

Acosta C, Davies A., 2008. Bacterial lipopolysaccharide regulates nociceptin

expression in sensory neurons. J Neurosci Res 86, 1077-86.

Aggarwal, S., Yurlova, L., Simons, M., 2011. Central nervous system myelin:

structure, synthesis and assembly. Trends Cell Biol 21, 585-593.

doi:10.1016/j.tcb.2011.06.004.

Akassoglou K, Bauer J, Kassiotis G, Pasparakis M, Lassmann H, Kollias G,

Probert L.,1998. Oligodendrocyte apoptosis and primary demyelination

induced by local TNF/p55TNF receptor signaling in the central nervous

system of transgenic mice: models for multiple sclerosis with primary

oligodendrogliopathy. Am J Pathol 153, 801-13.

Amaral, A.I., Hadera, M.G., Tavares, J.M., Kotter, M.R.N., Sonnewald, U., 2015.

Characterization of glucose-related metabolic pathways in differentiated rat

oligodendrocyte lineage cells. Glia 64, 21–34. doi:10.1002/glia.22900

Arbelaez CA, Glatigny S, Duhen R, Eberl G, Oukka M, Bettelli E., 2015. IL-7/IL-7

151 Receptor Signaling Differentially Affects Effector CD4+ T Cell Subsets

Involved in Experimental Autoimmune Encephalomyelitis. J Immunol 195,

1974-1983. doi: 10.4049/jimmunol.1403135.

Armstrong C, Leong W, Lees GJ., 2001. Comparative effects of metal chelating agents on the neuronal cytotoxicity induced by copper (Cu+2), iron (Fe+3) and

zinc in the hippocampus. Brain Res 892, 51-62.

Arnett, H.A., Mason, J., Marino, M., Suzuki, K., Matsushima, G.K., Ting, J.P.Y.,

2001. TNF alpha promotes proliferation of oligodendrocyte progenitors and

remyelination. Nat Neurosci 4, 1116–1122. doi:10.1038/nn738

Azari, M.F., Profyris, C., Karnezis, T., Bernard, C.C., Small, D.H., Cheema, S.S.,

Ozturk, E., Hatzinisiriou, I., Petratos, S., 2006. Leukemia inhibitory factor

arrests oligodendrocyte death and demyelination in spinal cord injury. J

Neuropathol Exp Neurol 65, 914–929.

doi:10.1097/01.jnen.0000235855.77716.25

Balentine, J.D., Paris, D.U., 1978. Pathology of experimental spinal cord trauma.

II. Ultrastructure of axons and myelin. Lab Invest 39, 254-266.

Banik, N.L., Powers, J.M., Hogan, E.L., 1980. The effects of spinal cord trauma

on myelin. J Neuropathol Exp Neurol 39, 232-244.

Banisadr, G., Frederick, T.J., Freitag, C., Ren, D., Jung, H., Miller, S.D., Miller,

152 R.J., 2011. The role of CXCR4 signaling in the migration of transplanted

oligodendrocyte progenitors into the cerebral white matter. Neurobiol Dis 44,

19–27. doi:10.1016/j.nbd.2011.05.019

Barres, B.A., Hart, I.K., Coles, H.S., Burne, J.F., Voyvodic, J.T., Richardson,

W.D., Raff, M.C., 1992. Cell death and control of cell survival in the

oligodendrocyte lineage. Cell 70, 31-46.

Barres, B.A., Koroshetz, W.J., Swartz, K.J., Chun, L.L., Corey, D.P., 1990. Ion

channel expression by white matter glia: The O-2A glial progenitor cell.

Neuron 4, 507–524.

Barres, B.A., Schmid, R., Sendnter, M., Raff, M.C., 1993. Multiple extracellular

signals are required for long-term oligodendrocyte survival. Development

118, 283–295.

Bartzokis, G., 2004. Age-related myelin breakdown: a developmental model of

cognitive decline and Alzheimer’s disease. Neurobiol Aging 25, 5-18.

Bastien, D., Bellver Landete, V., Lessard, M., Vallières, N., Champagne, M.,

Takashima, A., Tremblay, M.È., Doyon, Y., Lacroix, S., 2015. IL-1α Gene

Deletion Protects Oligodendrocytes after Spinal Cord Injury through

Upregulation of the Survival Factor Tox3. J Neurosci 35, 10715-30.

Baumann, N., Pham-Dinh, D., 2001. Biology of oligodendrocyte and myelin in the

mammalian central nervous system. Physiol Rev 81, 871-927.

Bercury, K.K., Macklin, W.B., 2015. Dynamics and mechanisms of CNS

153 myelination. Dev Cell 32, 447-458.

Bergles DE, Roberts JD, Somogyi P, Jahr CE., 2000. Glutamatergic synapses on

oligodendrocyte precursor cells in the hippocampus. Nature 405, 187-91.

Bergles, D.E., Richardson, W.D., 2015. Oligodendrocyte Development and

Plasticity. Cold Spring Harb Perspect Biol 8, 1-27.

Binamé F, Sakry D, Dimou L, Jolivel V, Trotter J., 2013. NG2 regulates

directional migration of oligodendrocyte precursor cells via Rho GTPases and

polarity complex proteins. J Neurosci 33, 10858-74. doi:

10.1523/JNEUROSCI.5010-12.2013.

Blakemore, W.F., 1974. Pattern of remyelination in the CNS. Nature 249, 577–

578.

Blight, A.R., 1983a. Axonal physiology of chronic spinal cord injury in the cat:

intracellular recording in vitro. Neuroscience 10, 1471–1486.

Blight, A.R., 1983b. Cellular morphology of chronic spinal cord injury in the cat:

analysis of myelinated axons by line-sampling. Neuroscience 10, 521–543.

Blight, A.R., 1985. Delayed demyelination and macrophage invasion: A

candidate for secondary cell damage in spinal cord injury. Cent Nerv Syst

Trauma 2, 299-315.

Blight, A.R., Young, W., 1989. Central axons in injured cat spinal cord recover

electrophysiological function following remyelination by Schwann cells. J

Neurol Sci 91, 15–34.

154 Blomster L., Cowin G., Kurniawan N., Ruitenberg M., 2012. Detection of

endogenous iron deposits in the injured mouse spinal cord through high-

resolution ex vivo and in vivo MRI. NMR Biomed 26, 141-50

Boettcher S, Gerosa RC, Radpour R, Bauer J, Ampenberger F, Heikenwalder M,

Kopf M, Manz MG., 2104. Endothelial cells translate pathogen signals into G-

CSF-driven emergency granulopoiesis. Blood 124, 1393-403.

Bögler O, Wren D, Barnett SC, Land H, Noble M., 1990. Cooperation between

two growth factors promotes extended self-renewal and inhibits differentiation

of oligodendrocyte-type-2 astrocyte (O-2A) progenitor cells. Proc Natl Acad

Sci U S A 87, 6368-72.

Boneberg EM, Hareng L, Gantner F, Wendel A, Hartung T., 2000. Human

monocytes express functional receptors for granulocyte colony-stimulating

factor that mediate suppression of monokines and interferon-gamma. Blood

95, 270-6.

Boudil A, Matei IR, Shih HY, Bogdanoski G, Yuan JS, Chang SG, Montpellier B,

Kowalski PE, Voisin V, Bashir S, Bader GD, Krangel MS, Guidos CJ., 2015.

IL-7 coordinates proliferation, differentiation and Tcra recombination during

thymocyte β-selection. Nat Immunol 16, 397-405.

Bowman CC, Rasley A, Tranguch SL, Marriott I., 2003. Cultured astrocytes

express toll-like receptors for bacterial products. Glia 43, 281-291.

Brugnera E, Bhandoola A, Cibotti R, Yu Q, Guinter TI, Yamashita Y, Sharrow

155 SO, Singer A., 2000. Coreceptor reversal in the thymus: signaled CD4+8+

thymocytes initially terminate CD8 transcription even when differentiating into

CD8+ T cells. Immunity 13, 59-71.

Bsibsi M, Ravid R, Gveric D, van Noort JM., 2002. Broad expression of Toll-like

receptors in the human central nervous system. J Neuropathol Exp Neurol

61, 1013-1021.

Bu, J., Akhtar, N., Nishiyama, A., 2001. Transient expression of the NG2

proteoglycan by a subpopulation of activated macrophages in an excitotoxic

hippocampal lesion. Glia 34, 296-310

Cai, J., Qi, Y., Hu, X., Tan, M., Liu, Z., Zhang, J., Li, Q., Sander, M., Qiu, M.,

2005. Generation of oligodendrocyte precursor cells from mouse dorsal

spinal cord independent of Nkx6 regulation and Shh signaling. Neuron 45,

41–53.

Cairo, G., Bernuzzi, F., Recalcati, S., 2006. A precious metal: Iron, an essential

nutrient for all cells. Genes Nutr 1, 25-39.

Cairo G, Recalcati S, Mantovani A, Locati M., 2011. Iron trafficking and

metabolism in macrophages: contribution to the polarized phenotype. Trends

Immunol 32, 241-247. doi: 10.1016/j.it.2011.03.007.

Calderon, T.M., Eugenin, E.A., Lopez, L., Kumar, S.S., Hesselgesser, J., Raine,

C.S., Berman, J.W., 2006. A role for CXCL12 (SDF-1α) in the pathogenesis

of multiple sclerosis: Regulation of CXCL12 expression in astrocytes by

156 soluble myelin basic protein. J Neuroimmunol 177, 27–39.

doi:10.1016/j.jneuroim.2006.05.003

Caliaperumal J1, Ma Y, Colbourne F., 2012. Intra-parenchymal ferrous iron

infusion causes neuronal atrophy, cell death and progressive tissue loss:

implications for intracerebral hemorrhage. Exp Neurol 237, 363-9. doi:

10.1016/j.expneurol.2012.07.001.

Cannella B, Raine CS., 2004. Multiple sclerosis: cytokine receptors on

oligodendrocytes predict innate regulation. Ann Neurol 55, 46-57.

Cao, Y., Gunn, A.J., Bennet, L., Wu, D., George, S., Gluckman, P.D., Shao,

X.M., Guan, J., 2003. Insulin-like growth factor (IGF)-1 suppresses

oligodendrocyte caspase-3 activation and increases glial proliferation after

ischemia in near-term fetal sheep. J Cereb Blood Flow Metab 23, 739-47.

Carbajal, K.S., Miranda, J.L., Tsukamoto, M.R., Lane, T.E., 2011. CXCR4

signaling regulates remyelination by endogenous oligodendrocyte progenitor

cells in a viral model of demyelination. Glia 59, 1813–1821.

doi:10.1002/glia.21225

Carraway MS, Ghio AJ, Taylor JL, Piantadosi CA., 1998. Induction of ferritin and

heme oxygenase-1 by endotoxin in the lung. Am J Physiol 275, L583-92.

Caso, J.R., Pradillo, J.M., Hurtado, O., Lorenzo, P., Moro, M.A., Lizasoain, I.,

2007. Toll-like receptor 4 is involved in brain damage and inflammation after

experimental stroke. Circulation 115, 1599–1608.

Chakraborty A, White SM, Schaefer TS, Ball ED, Dyer KF, Tweardy DJ., 1996.

157 Granulocyte colony-stimulating factor activation of Stat3 alpha and Stat3 beta

in immature normal and leukemic human myeloid cells. Blood 88, 2442-9.

Cheema SS, Richards LJ, Murphy M, Bartlett PF., 1994. Leukaemia inhibitory

factor rescues motoneurones from axotomy-induced cell death. Neuroreport

5, 989-992.

Cheng X, Wang Y, He Q, Qiu M, Whittemore SR, Cao Q. 2007. Bone

morphogenetic protein signaling and olig1/2 interact to regulate the

differentiation and maturation of adult oligodendrocyte precursor cells. Stem

Cells 25, 3204-14.

Church JS, Kigerl KA, Lerch JK, Popovich PG, McTigue DM., 2016. TLR4

Deficiency Impairs Oligodendrocyte Formation in the Injured Spinal Cord. J

Neurosci 36, 6352-64. doi: 10.1523/JNEUROSCI.0353-16.2016.

Connor, J.R., Pavlick, G., Karli, D., Menzies, S.L., Palmer, C., 1995. A

histochemical study of iron-positive cells in the developing rat brain. J Comp

Neurol 355, 111–123. doi:10.1002/cne.903550112

Connor, J.R., Menzies, S.L., 1996. Relationship of iron to oligodendrocytes and

myelination. Glia 17, 83–93.

Crawford, A.H., Stockley, J.H., Tripathi, R.B., Richardson, W.D., Franklin, R.J.,

2014. Oligodendrocyte progenitors: adult stem cells of the central nervous

system? Exp Neurol 260, 50-55.

Crowe, M.J., Bresnahan, J.C., Shuman, S.L., Masters, J.N., Beattie, M.S., 1997.

158 Apopto- sis and delayed degeneration after spinal cord injury in rats and

monkeys. Nat Med 3, 73–76.

Dautry-Varsat A, Ciechanover A, Lodish HF., 1983. pH and the recycling of

transferrin during receptor-mediated endocytosis. Proc Natl Acad Sci U S A

80, 2258-2262.

David, S., Kroner, A., 2011. Repertoire of microglial and macrophage responses

after spinal cord injury. Nat Rev Neurosci 12, 388-399. doi:10.1038/nrn3053

Delaby C, Pilard N, Puy H, Canonne-Hergaux F., 2008. Sequential regulation of

ferroportin expression after erythrophagocytosis in murine macrophages:

early mRNA induction by haem, followed by iron-dependent protein

expression. Biochem J 411, 123-131.

De Groot CJ, Montagne L, Barten AD, Sminia P, Van Der Valk P. 1999.

Expression of transforming growth factor (TGF)-beta1, -beta2, and -beta3

isoforms and TGF-beta type I and type II receptors in multiple sclerosis

lesions and human adult astrocyte cultures. J Neuropathol Exp Neurol 58,

174-87.

Deverman, B.E., Patterson, P.H., 2012. Exogenous leukemia inhibitory factor

stimulates oligodendrocyte progenitor cell proliferation and enhances

hippocampal remyelination. J Neurosci 32, 2100–2109.

doi:10.1523/JNEUROSCI.3803-11.2012

Diemel, L.T., Copelman, C.A., Cuzner, M.L., 1998. Macrophages in CNS

159 remyelination: friend or foe? Neurochem Res 23, 341–347.

Dimou, L., Simon, C., Kirchhoff, F., Takebayashi, H., Gotz, M., 2008. Progeny of

Olig2-expressing progenitors in the gray and white matter of the adult mouse

cerebral cortex. J Neurosci 28, 10434–10442.

Dittmer S, Kovacs Z, Yuan SH, Siszler G, Kögl M, Summer H, Geerts A, Golz S,

Shioda T, Methner A., 2011. TOX3 is a neuronal survival factor that induces

transcription depending on the presence of CITED1 or phosphorylated CREB

in the transcriptionally active complex. J Cell Sci 124, 252-60.

Duke, D.C., Moran, L.B., Turkheimer, F.E., Banati, R., Graeber, M.B., 2004.

Microglia in culture: what genes do they express? Dev Neurosci 26, 30-37.

Dziembowska, M., Tham, T.N., Lau, P., Vitry, S., Lazarini, F., Dubois-Dalcq, M.,

2005. A role for CXCR4 signaling in survival and migration of neural and

oligodendrocyte precursors. Glia 50, 258–269. doi:10.1002/glia.20170

Ehrenberg, C.G., 1837. Observations on the structure hitherto unknown of the

nervous system in man and animals. Edinburgh Medical and Surgical Journal

48, 257–305.

Emery B., 2010. Regulation of oligodendrocyte differentiation and myelination.

Science 330, 779-82. doi: 10.1126/science.1190927.

Espinosa-Jeffrey, A., Kumar, S., Zhao, P.M., Awosika, O., Agbo, C., Huang, A.,

Chang, R., de Vellis, J., 2002. Transferrin regulates transcription of the MBP

gene and its action synergizes with IGF-1 to enhance myelinogenesis in the

160 md rat. Dev Neurosci 24, 227-241.

Fancy, S.P., Chan, J.R., Baranzini, S.E., Franklin, R.J., Rowitch, D.H., 2011.

Myelin regeneration: a recapitulation of development? Annu Rev Neurosci

34, 21–43.

Felts, P.A., Woolston, A.M., Fernando, H.B., Asquith, S., Gregson, N.A., Mizzi,

O.J., Smith, K.J., 2005. Inflammation and primary demyelination induced by

the intraspinal injection of lipopolysaccharide. Brain 128, 1649-1666.

Fernández M, Sánchez-Franco F, Palacios N, Sánchez I, Fernández C,

Cacicedo L., 2004. IGF-I inhibits apoptosis through the activation of the

phosphatidylinositol 3-kinase/Akt pathway in pituitary cells. J Mol Endocrinol

33, 155-63.

Filipovic R, Jakovcevski I, Zecevic N., 2003. GRO-alpha and CXCR2 in the

human fetal brain and multiple sclerosis lesions. Dev Neurosci 25, 279-90.

Fleming JC, Norenberg MD, Ramsay DA, Dekaban GA, Marcillo AE, Saenz AD,

Pasquale-Styles M, Dietrich WD, Weaver LC., 2006. The cellular

inflammatory response in human spinal cords after injury. Brain 129, 3249-

69.

Fogarty, M., Richardson, W.D., Kessaris, N., 2005. A subset of oligodendrocytes

generated from radial glia in the dorsal spinal cord. Development 132, 1951–

1959.

Franco, P.G., Pasquini, L.A., Pérez, M.J., Rosato-Siri, M.V., Silvestroff, L.,

161 Pasquini, J.M., 2015. Paving the way for adequate myelination: The

contribution of galectin-3, transferrin and iron. FEBS Lett 589, 3388–3395.

doi:10.1016/j.febslet.2015.08.001

Franklin, R.J., ffrench-Constant, C., 2008. Remyelination in the CNS: from

biology to therapy. Nat Rev Neurosci 9, 839–855.

Franklin, R.J.M., Goldman, S.A., 2015. Glia disease and repair—remyelination.

Cold Spring Harb Perspect Biol 7, 1-28. doi:10.1101/cshperspect.a020594.

Franklin RJ, Hinks GL., 1999. Understanding CNS remyelination: clues from

developmental and regeneration biology. J Neurosci Res 58, 207-13.

Fruttiger M, Karlsson L, Hall AC, Abramsson A, Calver AR, Boström H, Willetts

K, Bertold CH, Heath JK, Betsholtz C, Richardson WD., 1999. Defective

oligodendrocyte development and severe hypomyelination in PDGF-A

knockout mice. Development 126, 457-67.

Fünfschilling, U., Supplie, L.M., Mahad, D., Boretius, S., Saab, A.S., Edgar, J.,

Brinkmann, B.G., Kassmann, C.M., Tzvetanova, I.D., Möbius, W., Diaz, F.,

Meijer, D., Suter, U., Hamprecht, B., Sereda, M.W., Moraes, C.T., Frahm, J.,

Goebbels, S., Nave, K.-A., 2012. Glycolytic oligodendrocytes maintain myelin

and long-term axonal integrity. Nature 485, 517–521.

doi:10.1038/nature11007

Fyffe-Maricich SL, Schott A, Karl M, Krasno J, Miller RH., 2013. Signaling

through ERK1/2 controls myelin thickness during myelin repair in the adult

162 central nervous system. J Neurosci 33, 18402-8.

doi:10.1523/JNEUROSCI.2381-13.2013.

Gay, N.J., Keith, F.J., 1991. Drosophila Toll and IL-1 receptor. Nature 351, 355-

356.

Gibson EM, Purger D, Mount CW, Goldstein AK, Lin GL, Wood LS, Inema I,

Miller SE, Bieri G, Zuchero JB, Barres BA, Woo PJ, Vogel H, Monje M., 2014.

Neuronal activity promotes oligodendrogenesis and adaptive myelination in

the mammalian brain. Science 344, 1252304. doi: 10.1126/science.1252304.

Giulian, D., Baker, T.J., 1986. Characterization of ameboid microglia isolated

from developing mammalian brain. J Neurosci 6, 2163-2178.

Gledhill, R.F., Harrison, B.M., McDonald, W.I., 1973. Demyelination and

remyelination after acute spinal cord compression. Exp.Neurol 38, 472-487.

Gledhill, R.F., McDonald, W.I., 1977. Morphological characteristics of central

demyelination and remyelination: a single-fiber study. Ann Neurol 1, 552-560.

Glezer, I., Rivest, S., 2010. Oncostatin M is a novel glucocorticoid-dependent

neuroinflammatory factor that enhances oligodendrocyte precursor cell

activity in demyelinated sites. Brain Behav Immun 24, 695-704.

doi:10.1016/j.bbi.2010.01.005

Gloire, G., Legrand-Poels, S., Piette, J., 2006. NF-κB activation by reactive

oxygen species: Fifteen years later. Biochem Pharmacol 72, 1493–1505.

doi:10.1016/j.bcp.2006.04.011

163 Gluckman P, Klempt N, Guan J, Mallard C, Sirimanne E, Dragunow M, Klempt

M, Singh K, Williams C, Nikolics K., 1992. A role for IGF-1 in the rescue of

CNS neurons following hypoxic-ischemic injury. Biochem Biophys Res

Commun 182, 593-599.

Goretzki, L., Burg, M.A., Grako, K.A., Stallcup, W.B., 1999. High-affinity binding

of basic fibroblast growth factor and platelet-derived growth factor-AA to the

core protein of the NG2 proteoglycan. J Biol Chem 274, 16831-16837.

Goldstein, E.Z., Church, J.D., Hesp, Z.C., McTigue, D.M., 2016. Silver lining of

inflammation: The beneficial effects of inflammation on myelination. Exp

Neurol In Press

Goodin, D.S., 2014. Glucocorticoid treatment of multiple sclerosis, 1st ed, Spinal

Cord Injury. Elsevier B.V. doi:10.1016/B978-0-444-52001-2.00020-0

Grako KA, Ochiya T, Barritt D, Nishiyama A, Stallcup WB., 1999. PDGF (alpha)-

receptor is unresponsive to PDGF-AA in aortic smooth muscle cells from the

NG2 knockout mouse. J Cell Sci 112, 905-15.

Grossman SD, Rosenberg LJ, Wrathall JR., 2001. Temporal-spatial pattern of

acute neuronal and glial loss after spinal cord contusion. Exp Neurol 168,

273-82.

Guest, J.D., Hiester, E.D., Bunge, R.P., 2005. Demyelination and Schwann cell

responses adjacent to injury epicenter cavities following chronic human

spinal cord injury. Exp Neurol 192, 384–393.

164 doi:10.1016/j.expneurol.2004.11.033

Guo Y, Zhang H, Yang J, Liu S, Bing L, Gao J, Hao A., 2013. Granulocyte

colony-stimulating factor improves alternative activation of microglia under

microenvironment of spinal cord injury. Neuroscience 238,1-10.

Hajihosseini, M., Tham, T.N., Dubois-Dalcq, M., 1996. Origin of oligodendrocytes

within the human spinal cord. J Neurosci 16, 7981–7994.

Harding C, Heuser J, Stahl P., 1983. Receptor-mediated endocytosis of

transferrin and recycling of the transferrin receptor in rat reticulocytes. J Cell

Biol 97, 329-339.

Harrison, B.M., McDonald, W.I., 1977. Remyelination after transient experimental

compression of the spinal cord. Ann.Neurol 1, 542-551.

Hartline DK, Colman DR., 2007. Rapid conduction and the evolution of giant

axons and myelinated fibers. Curr Biol 17, R29-35.

He, L., Lu, Q.R., 2013. Coordinated control of oligodendrocyte development by

extrinsic and intrinsic signaling cues. Neurosci Bull 29, 129–143.

doi:10.1007/s12264-013-1318-y

Hentze MW, Muckenthaler MU, Andrews NC., 2004. Balancing acts: molecular

control of mammalian iron metabolism. Cell. 2004 117, 285-97.

Herx, L.M., Rivest, S., Yong, V.W., 2000. Central nervous system-initiated

inflammation and neurotrophism in trauma: IL-1 is required for the production

of ciliary neurotrophic factor. J Immunol 165, 2232–2239.

165 doi:10.4049/jimmunol.165.4.2232

Hesp ZC, Goldstein EZ, Miranda CJ, Kaspar BK, McTigue DM., 2015. Chronic

oligodendrogenesis and remyelination after spinal cord injury in mice and

rats. J Neurosci 35 1274-90. doi: 10.1523/JNEUROSCI.2568-14.2015.

Hosking MP, Tirotta E, Ransohoff RM, Lane TE., 2010. CXCR2 signaling

protects oligodendrocytes and restricts demyelination in a mouse model of

viral-induced demyelination. PLoS One 5, e11340.

Hu JG, Zhang YX, Qi Q, Wang R, Shen L, Zhang C, Xi J, Zhou JS, Lu HZ., 2012.

Expression of BMP-2 and BMP-4 proteins by type-1 and type-2 astrocytes

induced from neural stem cells under different differentiation conditions. Acta

Neurobiol Exp 72, 95-101.

Hua, F., Ma, J., Ha, T., Xia, Y., Kelley, J., Williams, D.L., Kao, R.L., Browder,

I.W., Schweitzer, J.B., Kalbfleisch, J.H., Li, C., 2007. Activation of Toll-like

receptor 4 signaling contributes to hippocampal neuronal death following

global cerebral ischemia/reperfusion. J. Neuroimmunol. 190, 101–111.

Hughes EG, Kang SH, Fukaya M, Bergles DE., 2013. Oligodendrocyte

progenitors balance growth with self-repulsion to achieve homeostasis in the

adult brain. Nat Neurosci 16, 668-676. doi: 10.1038/nn.3390.

Ikeda K, Iwasaki Y, Shiojima T, Kinoshita M., 1996. Neuroprotective effect of

various cytokines on developing spinal motoneurons following axotomy. J

Neurol Sci 135, 109-113.

166 Imitola, J., Raddassi, K., Park, K.I., Mueller, F.-J., Nieto, M., Teng, Y.D., Frenkel,

D., Li, J., Sidman, R.L., Walsh, C.A., Snyder, E.Y., Khoury, S.J., 2004.

Directed migration of neural stem cells to sites of CNS injury by the stromal

cell-derived factor 1alpha/CXC chemokine receptor 4 pathway. Proc Natl

Acad Sci USA 101, 18117–18122. doi:10.1073/pnas.0408258102

Ishibashi, T., Lee, P.R., Baba, H., Fields, R.D., 2009. Leukemia inhibitory factor

regulates the timing of oligodendrocyte development and myelination in the

postnatal optic nerve. J Neurosci Res 87, 3343–3355. doi:10.1002/jnr.22173

Jana M, Mondal S, Jana A, Pahan K., 2014. Interleukin-12 (IL-12), but not IL-23,

induces the expression of IL-7 in microglia and macrophages: implications for

multiple sclerosis. Immunology 141, 549-63.

Janssens, K., Maheshwari, A., Van den Haute, C., Baekelandt, V., Stinissen, P.,

Hendriks, J.J.A., Slaets, H., Hellings, N., 2015. Oncostatin M protects against

demyelination by inducing a protective microglial phenotype. Glia 63, 1729-

1737. doi:10.1002/glia.22840

Jeffery, N.D., Blakemore, W.F., 1997. Locomotor deficits induced by

experimental spinal cord demyelination are abolished by spontaneous

remyelination. Brain 120, 27–37.

Jeong, H-K., Ji, K-m., Kim, J., Jou, I., Joe, E-H., 2013. Repair of astrocytes,

blood vessels, and myelin in the injured brain: possible roles of blood

monocytes. Mol Brain 6:28. doi:10.1186/1756-6606-6-28

167 Ji KA, Yang MS, Jeong HK, Min KJ, Kang SH, Jou I, Joe EH., 2007. Resident

microglia die and infiltrated neutrophils and monocytes become major

inflammatory cells in lipopolysaccharide-injected brain. Glia 55, 1577-1588.

Johnson, C., Holmes, W.R., Brown, A., Jung, P., 2015. Minimizing the caliber of

myelinated axons by means of nodal constrictions. J Neurophysiol 114, 1874-

1884.

Kadi, L., Selvaraju, R., de Lys, P., Proudfoot, A.E.I., Wells, T.N.C., Boschert, U.,

2006. Differential effects of chemokines on oligodendrocyte precursor

proliferation and myelin formation in vitro. J Neuroimmunol 174, 133–146.

doi:10.1016/j.jneuroim.2006.01.011

Kadota R, Koda M, Kawabe J, Hashimoto M, Nishio Y, Mannoji C, Miyashita T,

Furuya T, Okawa A, Takahashi K, Yamazaki M., 2012. Granulocyte colony-

stimulating factor (G-CSF) protects oligodendrocyte and promotes hindlimb

functional recovery after spinal cord injury in rats. PLoS One 7, e50391.

Kahn, M.A., De Vellis, J., 1994. Regulation of an oligodendrocyte progenitor cell

line by the interleukin‐6 family of cytokines. Glia 12, 87–98.

Kawanokuchi J, Mizuno T, Takeuchi H, Kato H, Wang J, Mitsuma N, Suzumura

A. 2006. Production of interferon-gamma by microglia. Mult Scler 12, 558-64.

Keirstead, H.S., Blakemore, W.F., 1997. Identification of post-mitotic

oligodendrocytes incapable of remyelination within the demyelinated adult

spinal cord. J Neuropathol Exp Neurol 56, 1191–1201.

168 Keirstead HS, Nistor G, Bernal G, Totoiu M, Cloutier F, Sharp K, Steward O.,

2005. Human embryonic stem cell-derived oligodendrocyte progenitor cell

transplants remyelinate and restore locomotion after spinal cord injury. J

Neurosci 25, 4694-705.

Kerr BJ, Patterson PH., 2004. Potent pro-inflammatory actions of leukemia

inhibitory factor in the spinal cord of the adult mouse. Exp Neurol 188, 391-

407.

Kerr, B.J., Patterson, P.H., 2005. Leukemia inhibitory factor promotes

oligodendrocyte survival after spinal cord injury. Glia 51, 73–79.

doi:10.1002/glia.20177

Kerstetter AE, Padovani-Claudio DA, Bai L, Miller RH., 2009. Inhibition of CXCR2

signaling promotes recovery in models of multiple sclerosis. Exp Neurol 220,

44-56. doi: 10.1016/j.expneurol.2009.07.010.

Kigerl, K.A., Ankeny, D.P., Garg, S.K., Wei, P., Guan, Z., Lai, W., McTigue, D.M.,

- Banerjee, R., Popovich, P.G., 2012. System xc regulates microglia and

macrophage glutamate excitotoxicity in vivo. Exp Neurol 233, 333-341.

doi:10.1016/j.expneurol.2011.10.025

Kigerl KA, de Rivero Vaccari JP, Dietrich WD, Popovich PG, Keane RW., 2014.

Pattern recognition receptors and central nervous system repair. Exp Neurol

258, 5-16. doi: 10.1016/j.expneurol.2014.01.001.

Kigerl KA, Gensel JC, Ankeny DP, Alexander JK, Donnelly DJ, Popovich PG.,

169 2009. Identification of two distinct macrophage subsets with divergent effects

causing either neurotoxicity or regeneration in the injured mouse spinal cord.

J Neurosci 29, 13435-13444. doi: 10.1523/JNEUROSCI.3257-09.2009.

Kigerl, K.A., Lai, W., Rivest, S., Hart, R.P., Satoskar, A.R., Popovich, P.G., 2007.

Toll-like receptor (TLR)-2 and TLR-4 regulate inflammation, gliosis, and

myelin sparing after spinal cord injury. J Neurochem 102, 37–50.

Kigerl, K.A., Gensel, J.C., Ankeny, D.P., Alexander, J.A., Donnelly, D.J.,

Popovich, P.G., 2009. Identification of two distinct macrophage subsets with

divergent effects causing either neurotoxicity or regeneration in the injured

mouse spinal cord. J Neurosci 29, 13435-13444.

Kigerl, K.A., Popovich, P.G., 2009. Toll-like receptors in spinal cord injury.

Current topics in microbiology and immunology. Springer Berlin Heidelberg,

Berlin, Heidelberg, pp. 121–136.

Kim S, Ponka P., 2000. Effects of interferon-gamma and lipopolysaccharide on

macrophage iron metabolism are mediated by nitric oxide-induced

degradation of iron regulatory protein 2. J Biol Chem 275, 6220-6.

Kotter MR, Setzu A, Sim FJ, Van Rooijen N, Franklin RJ., 2001. Macrophage

depletion impairs oligodendrocyte remyelination following lysolecithin-induced

demyelination. Glia 35, 204-212.

Knerlich-Lukoschus F, von der Ropp-Brenner B, Lucius R, Mehdorn HM, Held-

Feindt J., 2011. Spatiotemporal CCR1, CCL3(MIP-1α), CXCR4,

170 CXCL12(SDF-1α) expression patterns in a rat spinal cord injury model of

posttraumatic neuropathic pain. J Neurosurg Spine 14, 583-97. doi:

10.3171/2010.12.SPINE10480.

Kroner A, Greenhalgh AD, Zarruk JG, Passos Dos Santos R, Gaestel M, David

S., 2014. TNF and increased intracellular iron alter macrophage polarization

to a detrimental M1 phenotype in the injured spinal cord. Neuron 83, 1098-

1116. doi: 10.1016/j.neuron.2014.07.027.

Kucharova K, Stallcup WB. 2010. The NG2 proteoglycan promotes

oligodendrocyte progenitor proliferation and developmental myelination.

Neuroscience 166, 185-94. doi: 10.1016/j.neuroscience.2009.12.014.

Lampron, A., Larochelle, A., Laflamme, N., Préfontaine, P., Plante, M-M.,

Sánchez, M.G., Yong, V.W., Stys, P.K., Tremblay, M-È., Rivest, S., 2015.

Inefficient clearance of myelin debris by microglia impairs remyelinating

processes. J Exp Med 212, 481-495. doi:10.1084/jem.20141656

Larkin, E.C., Rao, G.A., 1990. Importance of fetal and neonatal iron: Adequacy

for normal development of central nervous system. Brain, behavior and iron

in the infant diet.

Lee LF, Axtell R, Tu GH, Logronio K, Dilley J, Yu J, Rickert M, Han B, Evering W,

Walker MG, Shi J, de Jong BA, Killestein J, Polman CH, Steinman L, Lin JC.,

2011. IL-7 promotes T(H)1 development and serum IL-7 predicts clinical

response to interferon-β in multiple sclerosis. Sci Transl Med 3, 93ra68. doi:

10.1126/scitranslmed.3002400.

171 Lee MY, Kim CJ, Shin SL, Moon SH, Chun MH., 1998. Increased ciliary

neurotrophic factor expression in reactive astrocytes following spinal cord

injury in the rat. Neurosci Lett 255, 79-82.

Lee, S., Leach, M.K., Redmond, S.A., Chong, S.Y.C., Mellon, S.H., Tuck, S.J.,

Feng, Z.-Q., Corey, J.M., Chan, J.R., 2012. A culture system to study

oligodendrocyte myelination processes using engineered nanofibers. Nat

Methods 9, 917-922.

Lee, Y., Morrison, B.M., Li, Y., Lengacher, S., Farah, M.H., Hoffman, P.N., Liu,

Y., Tsingalia, A., Jin, L., Zhang, P.W., Pellerin, L., Magistretti, P.J., Rothstein,

J.D., 2012. Oligodendroglia metabolically support axons and contribute to

neurodegeneration. Nature 487, 443-448.

Lehnardt, S., Lachance, C., Patrizi, S., Lefebvre, S., Follett, P.L., Jensen, F.E.,

Rosenberg, P.A., Volpe, J.J., Vartanian, T., 2002. The toll-like receptor TLR4

is necessary for lipopolysaccharide-induced oligodendrocyte injury in the

CNS. J Neurosci 22, 2478–2486.

Lenz KM, McCarthy MM., 2015. A starring role for microglia in brain sex

differences. Neuroscientist 21, 306-321. doi: 10.1177/1073858414536468.

Leow-Dyke S, Allen C, Denes A, Nilsson O, Maysami S, Bowie AG, Rothwell NJ,

Pinteaux E., 2012. Neuronal Toll-like receptor 4 signaling induces brain

endothelial activation and neutrophil transmigration in vitro. J

Neuroinflammation 9, 230. doi: 10.1186/1742-2094-9-230.

172 Li, J., Baud. O., Vartanian, T., Volpe, J.J., Rosenberg, P.A., 2005. Peroxynitrite

generated by inducible nitric oxide synthase and NADPH oxidase mediates

microglial toxicity to oligodendrocytes. Proc Natl Acad Sci USA 102, 9936 –

9941.

Li, J., Ramenaden, E.R., Peng, J., Koito, H., Volpe, J.J., Rosenberg, P.A., 2008.

Tumor necrosis factor alpha mediates lipopolysaccharide-induced microglial

toxicity to developing oligodendrocytes when astrocytes are present. J

Neurosci 14, 5321-30.

Li WQ, Jiang Q, Aleem E, Kaldis P, Khaled AR, Durum SK., 2006. IL-7 promotes

T cell proliferation through destabilization of p27Kip1. J Exp Med 203, 573-

82.

Liebetanz, D., Merkler, D., 2006. Effects of commissural de- and remyelination

on motor skill behaviour in the cuprizone mouse model of multiple sclerosis.

Exp Neurol 202, 217–224.

Lin, S., Fan, L.W., Pang, Y., Rhodes, P.G., Mitchell, H.J., Cai, Z., 2005. IGF-1

protects oligodendrocyte progenitor cells and improves neurological functions

following cerebral hypoxia-ischemia in the neonatal rat. Brain Res 1063, 15-

26.

Linington C, Engelhardt B, Kapocs G, Lassman H. 1992. Induction of persistently

demyelinated lesions in the rat following the repeated adoptive transfer of

encephalitogenic T cells and demyelinating antibody.J Neuroimmunol 40,

219-24.

173 Liu, D., Liu, J., Sun, D., Alcock, N. Wen, J., 2003. Spinal cord injury increases

iron levels: catalytic production of hydroxyl radicals. Free Radical Biology and

Medicine 34, 64-71.

Longbrake EE, Lai W, Ankeny DP, Popovich PG. 2007. Characterization and

modeling of monocyte-derived macrophages after spinal cord injury. J

Neurochem 102, 1083-94.

Loughlin, A.J., Honegger, P., Woodroofe, M.N., Comte, V., Matthieu, J.M.,

Cuzner, M.L., 1994. Myelin basic protein content of aggregating rat brain cell

cultures treated with cytokines and/or demyelinating antibody: effects of

macrophage enrichment. J Neurosci Res 37, 647–653.

doi:10.1002/jnr.490370512

Lu, Q.R., Sun, T., Zhu, Z., Ma, N., Garcia, M., Stiles, C.D., Rowitch, D.H., 2002.

Common developmental requirement for Olig function indicates a motor

neuron/oligodendrocyte connection. Cell 109, 75–86.

Ludwiczek S, Aigner E, Theurl I, Weiss G., 2003. Cytokine-mediated regulation

of iron transport in human monocytic cells. Blood 101, 4148-54.

Ludwin SK, Maitland M., 1984. Long-term remyelination fails to reconstitute

normal thickness of central myelin sheaths. J Neurol Sci 64, 193-8.

Marin-Husstege, M., Muggironi, M., Liu, A., Casaccia-Bonnefil, P., 2002. Histone

deacetylase activity is necessary for oligodendrocyte lineage progression. J

Neurosci 22, 10333-10345.

174 Marmur, R., Kessler, J.A., Zhu, G., Gokhan, S., 1998. Differentiation of

oligodendroglial progenitors derived from cortical multipotent cells requires

extrinsic signals including activation of gp130/LIFβ receptors. J Neurosci 18,

9800–9811.

Marriott, M.P., Emery, B., Cate, H.S., Binder, M.D., Kemper, D., Wu, Q., Kolbe,

S., Gordon, I.R., Wang, H., Egan, G., Murray, S., Butzkueven, H., Kilpatrick,

T.J., 2008. Leukemia inhibitory factor signaling modulates both central

nervous system demyelination and myelin repair. Glia 56, 686–698.

März, P., Cheng, J.G., Gadient, R.A., Patterson, P.H., Stoyan, T., Otten, U.,

Rose-John, S., 1998. Sympathetic neurons can produce and respond to

interleukin 6. Proc Natl Acad Sci 95, 3251-6.

Mason, J.L., Ye, P., Suzuki, K., D'Ercole, A.J., Matsushima, G.K., 2000. Insulin-

like growth factor-1 inhibits mature oligodendrocyte apoptosis during primary

demyelination. J Neurosci 20, 5703-8.

Mason, J.L., Suzuki, K., Chaplin, D.D., Matsushima, G.K., 2001. Interleukin-

1beta promotes repair of the CNS. J Neurosci 21, 7046–7052.

Matute, C., Domercq, M., Sánchez-Gómez, M.-V., 2005. Glutamate-mediated

glial injury: Mechanisms and clinical importance. Glia 53, 212–224.

doi:10.1002/glia.20275

Mayer, M., Bhakoo, K., Noble, M., 1994. Ciliary neurotrophic factor and leukemia

inhibitory factor promote the generation, maturation and survival of

175 oligodendrocytes in vitro. Development 120, 143–153.

Mazzucchelli R, Durum SK., 2007. Interleukin-7 receptor expression: intelligent

design. Nat Rev Immunol. 7, 144-54.

McCarthy, K.D., de Vellis, J., 1980. Preparation of separate astroglial and

oligodendroglial cell cultures from rat cerebral tissue. J Cell Biol 85, 890-902.

Mcdonald JW, Stefovska VG, Liu XZ, Shin H, Liu S, Choi DW., 2002.

Neurotrophin potentiation of iron-induced spinal cord injury. Neuroscience

115, 931-9.

McKay SM, Brooks DJ, Hu P, McLachlan EM., 2007. Distinct types of microglial

activation in white and grey matter of rat lumbosacral cord after mid-thoracic

spinal transection. J Neuropathol Exp Neurol 66, 698-710.

McKenzie IA, Ohayon D, Li H, de Faria JP, Emery B, Tohyama K, Richardson

WD., 2014. Motor skill learning requires active central myelination. Science

346, 318-22. doi: 10.1126/science.1254960.

McKinnon, R.D., Piras, G., Ida, J.A., Dubois-Dalcq, M., 1993. A role for TGF-beta

in oligodendrocyte differentiation. J Cell Biol 121, 1397–1407.

McTigue DM, Popovich PG, Morgan TE, Stokes BT., 2000. Localization of

transforming growth factor-beta1 and receptor mRNA after experimental

spinal cord injury. Exp Neurol 163, 220-230.

McTigue DM, Tani M, Krivacic K, Chernosky A, Kelner GS, Maciejewski D, Maki

R, Ransohoff RM, Stokes BT., 1998. Selective chemokine mRNA

176 accumulation in the rat spinal cord after contusion injury. J Neurosci Res 53,

368-376.

McTigue, D.M., Tripathi, R., Wei, P., 2006. NG2 colocalizes with axons and is

expressed by a mixed cell population in spinal cord lesions. J. Neuropathol.

Exp. Neurol. 65, 406–420. doi:10.1097/01.jnen.0000218447.32320.52

McTigue DM, Wei P, Stokes BT., 2001. Proliferation of NG2-positive cells and

altered oligodendrocyte numbers in the contused rat spinal cord. J Neurosci

21, 3392-400.

Medzhitov R, Preston-Hurlburt P, Janeway CA Jr., 1997. A human homologue of

the Drosophila Toll protein signals activation of adaptive immunity. Nature.

388, 394-7.

Mehta V, Pei W, Yang G, Li S, Swamy E, Boster A, Schmalbrock P, Pitt D., 2013.

Iron is a sensitive biomarker for inflammation in multiple sclerosis lesions.

PLoS One 8, e57573. doi: 10.1371/journal.pone.0057573.

Meissner, F., Scheltema, R.A., Mollenkopf, H.J., Mann, M., 2013. Direct

proteomic quantification of the secretome of activated immune cells. Science

340, 475-478

Mekki-Dauriac S, Agius E, Kan P, Cochard P., 2002. Bone morphogenetic

proteins negatively control oligodendrocyte precursor specification in the

chick spinal cord. Development 129, 5117-5130.

Merrill, J.E., 1991. Effects of interleukin-1 and tumor necrosis factor-α on

177 astrocytes, microglia, oligodendrocytes, and glial precursors in vitro. Dev

Neurosci 13, 130–137.

Merrill, J.E., Benveniste, E.N., 1996. Cytokines in inflammatory brain lesions:

helpful and harmful. Trends Neurosci 19, 331–338.

Merson, T.D., Binder, M.D., Kilpatrick, T.J., 2010. Role of cytokines as mediators

and regulators of microglial activity in inflammatory demyelination of the CNS.

Neuromol Med 12, 99–132. doi:10.1007/s12017-010-8112-z

Metcalf D, Nicola NA., 1983. Proliferative effects of purified granulocyte colony-

stimulating factor (G-CSF) on normal mouse hemopoietic cells. J Cell Physiol

116, 198-206.

Michaelson MD, Mehler MF, Xu H, Gross RE, Kessler JA., 1996. Interleukin-7 is

trophic for embryonic neurons and is expressed in developing brain. Dev Biol.

179, 251-63.

Miron, V.E., Boyd, A., Zhao, J.-W., Yuen, T.J., Ruckh, J.M., Shadrach, J.L., van

Wijngaarden, P., Wagers, A.J., Williams, A., Franklin, R.J.M., ffrench-

Constant, C., 2013. M2 microglia and macrophages drive oligodendrocyte

differentiation during CNS remyelination. Nat Neurosci 16, 1211–1218.

Mitew S, Hay CM, Peckham H, Xiao J, Koenning M, Emery B., 2014.

Mechanisms regulating the development of oligodendrocytes and central

nervous system myelin. Neuroscience 276, 29-47. doi:

10.1016/j.neuroscience.2013.11.029.

178 Mittal, M., Siddiqui, M.R., Tran, K., Reddy, S.P., Malik, A.B., 2014. Reactive

oxygen species in inflammation and tissue injury. Antioxid & Redox Signal

20, 1126–1167. doi:10.1089/ars.2012.5149

Moll, N.M., Cossoy, M.B., Fisher, E., Staugaitis, S.M., Tucky, B.H., Rietsch, A.M.,

Chang, A., Fox, R.J., Trapp, B.D., Ransohoff, R.M., 2009. Imaging correlates

of leukocyte accumulation and CXCR4/CXCL12 in multiple sclerosis. Arch

Neurol 66, 44–53. doi:10.1001/archneurol.2008.512

Montero-Menei CN, Sindji L, Garcion E, Mege M, Couez D, Gamelin E, Darcy F.,

1996. Early events of the inflammatory reaction induced in rat brain by

lipopolysaccharide intracerebral injection: relative contribution of peripheral

monocytes and activated microglia. Brain Res 724, 55-66.

Moors M, Vudattu NK, Abel J, Krämer U, Rane L, Ulfig N, Ceccatelli S, Seyfert-

Margolies V, Fritsche E, Maeurer MJ., 2010. Interleukin-7 (IL-7) and IL-7

splice variants affect differentiation of human neural progenitor cells. Genes

Immun 11, 11-20.

Musci G, Polticelli F, Bonaccorsi di Patti MC., 2014. Ceruloplasmin-ferroportin

system of iron traffic in vertebrates. World J Biol Chem 5, 204-215. doi:

10.4331/wjbc.v5.i2.204.

Nadeau S, Rivest S., 2003. Glucocorticoids play a fundamental role in protecting

the brain during innate immune response. J Neurosci 23, 5536-44.

Nairz M, Schroll A, Sonnweber T, Weiss G., 2010. The struggle for iron - a metal

179 at the host-pathogen interface. Cell Microbiol 12, 1691-702.

Nahid MA, Satoh M, Chan EK., 2011. MicroRNA in TLR signaling and endotoxin

tolerance. Cell Mol Immunol 8, 388-403. doi: 10.1038/cmi.2011.26.

Nairz M, Schleicher U, Schroll A, Sonnweber T, Theurl I, Ludwiczek S, Talasz H,

Brandacher G, Moser PL, Muckenthaler MU, Fang FC, Bogdan C, Weiss G.,

2013. Nitric oxide-mediated regulation of ferroportin-1 controls macrophage

iron homeostasis and immune function in Salmonella infection. J Exp Med

210, 855-873. doi: 10.1084/jem.20121946.

Napoli, I., Neumann, H., 2010. Protective effects of microglia in multiple

sclerosis. Exp Neurol 225, 24-28. doi:10.1016/j.expneurol.2009.04.024

Nathan, C., Cunningham-Bussel, A., 2013. Beyond oxidative stress: an

immunologist’s guide to reactive oxygen species. Nat Rev Immunol 13, 349–

361. doi:10.1038/nri3423

Nathaniel, E., Pease, D.C., 1963. Regenerative changes in rat dorsal roots

following Wallerian degeneration. J Ultrastruct Res 9, 533–549.

Nave, K.A., 2010. Myelination and support of axonal integrity by glia. Nature 468,

244-252.

Nave, K.A., Werner, H.B., 2014. Myelination of the nervous system: Mechanisms

and functions. Annu Rev Cell Dev Biol 30, 503–533.

Neher JJ, Neniskyte U, Zhao JW, Bal-Price A, Tolkovsky AM, Brown GC., 2011.

Inhibition of microglial phagocytosis is sufficient to prevent inflammatory

180 neuronal death. J Immunol 186, 4973-83.

Noble, M., Murray, K., Stroobant, P., Waterfield, M.D., Riddle, P., 1988. Platelet-

derived growth factor promotes division and motility and inhibits premature

differentiation of the oligodendrocyte/type-2 astrocyte progenitor cell. Nature

333, 560-562.

Norton, W.T., Cammer, W., Bloom, B.R., Gordon, S., 1978. Neutral proteinases

secreted by macrophages degrade basic protein: a possible mechanism of

inflammatory demyelination. Adv Exp Med Biol 100, 365–381.

Noseworthy, J.H., Lucchinetti, C., Rodriguez, M., Weinshenker, B.G., 2000.

Multiple sclerosis. N Engl J Med 343, 938–52

Nicholas, R.S., Wing, M.G., Compston, A., 2001. Nonactivated microglia promote

oligodendrocyte precursor survival and maturation through the transcription

factor NF-kappa B. Eur J Neurosci 13, 959-967.

Nielsen MJ, Møller HJ, Moestrup SK., 2010. Hemoglobin and heme scavenger

receptors. Antioxid Redox Signal 12, 261-273. doi: 10.1089/ars.2009.2792.

Nishiyama, A., Lin, X.H., Giese, N., Heldin, C.H., Stallcup, W.B., 1996.

Interaction between NG2 proteoglycan and PDGF alpha-receptor on O2A

progenitor cells is required for optimal response to PDGF. J Neurosci Res 43,

315-330.

Nishiyama, A., Komitova, M., Suzuki, R., Zhu, X., 2009. Polydendrocytes (NG2

cells): multifunctional cells with lineage plasticity. Nat Rev Neurosci 10, 9-22.

181 doi:10.1038/nrn2495

Nishiyama A, Stallcup WB. Expression of NG2 proteoglycan causes retention of

type VI collagen on the cell surface. Mol Biol Cell 4, 1097-108.

Omari KM, John G, Lango R, Raine CS., 2006. Role for CXCR2 and CXCL1 on

glia in multiple sclerosis. Glia 53, 24-31.

Omari KM, John GR, Sealfon SC, Raine CS., 2005. CXC chemokine receptors

on human oligodendrocytes: implications for multiple sclerosis.Brain 128,

1003-15.

Omari KM, Lutz SE, Santambrogio L, Lira SA, Raine CS., 2009. Neuroprotection

and remyelination after autoimmune demyelination in mice that inducibly

overexpress CXCL1. Am J Pathol 174, 164-76. doi:

10.2353/ajpath.2009.080350.

Osada T, Watanabe M, Hasuo A, Imai M, Suyama K, Sakai D, Kawada H,

Matsumae M, Mochida J., 2010. Efficacy of the coadministration of

granulocyte colony-stimulating factor and stem cell factor in the activation of

intrinsic cells after spinal cord injury in mice. J Neurosurg Spine 13, 516-23.

Ozerdem, U., Grako, K.A., Dahlin-Huppe, K., Monosov, E., Stallcup, W.B., 2001.

NG2 proteoglycan is expressed exclusively by mural cells during vascular

morphogenesis. Dev Dyn 222, 218–227.

Padovani-Claudio, D.A., Liu, L., Ransohoff, R.M., Miller, R.H., 2006. Alterations

in the oligodendrocyte lineage, myelin, and white matter in adult mice lacking

182 the chemokine receptor CXCR2. Glia 54, 471–483. doi:10.1002/glia.20383

Palazuelos, J., Klingener, M., Aguirre, A., 2014. TGFβ signaling regulates the

timing of CNS myelination by modulating oligodendrocyte progenitor cell

cycle exit through SMAD3/4/FoxO1/Sp1. J Neurosci 34, 7917–7930.

doi:10.1523/JNEUROSCI.0363-14.2014

Pang, Y., Cai, Z., Rhodes, P.G., 2003. Disturbance of oligodendrocyte

development, hypomyelination and white matter injury in the neonatal rat

brain after intracerebral injection of lipopolysaccharide. Brain Res Dev Brain

Res, 16, 205-14.

Pang, Y., Campbell, L., Zheng, B., Fan, L., Cai, Z., Rhodes, P., 2010.

Lipopolysaccharide-activated microglia induce death of oligodendrocyte

progenitor cells and impede their development. Neurosci 166, 464–475.

doi:10.1016/j.neuroscience.2009.12.040

Patani R, Balaratnam M, Vora A, Reynolds R., 2007. Remyelination can be

extensive in multiple sclerosis despite a long disease course. Neuropathol

Appl Neurobiol 33, 277-87.

Patel, J.R., McCandless, E.E., 2010. CXCR4 promotes differentiation of

oligodendrocyte progenitors and remyelination. Proc Natl Acad Sci USA 107,

11062-11067. doi:10.1073/pnas.1006301107/-/DCSupplemental

Patel, J.R., Klein, R.S., 2011. Mediators of oligodendrocyte differentiation during

remyelination. FEBS Lett 585, 3730–3737. doi:10.1016/j.febslet.2011.04.037

183 Patrikios, P., Stadelmann, C., Kutzelnigg, A., Rauschka, H., Schmidbauer, M.,

Laursen, H., Sorensen, P.S., Brück, W., Lucchinetti, C., Lassmann, H., 2006.

Remyelination is extensive in a subset of multiple sclerosis patients. Brain

129, 3165–3172.

Pavelko, K.D., van Engelen, B.G., Rodriguez, M., 1998. Acceleration in the rate

of CNS remyelination in lysolecithin-induced demyelination. J Neurosci 18,

2498–2505.

Peferoen L, Kipp M, van der Valk P, van Noort JM, Amor S., 2014.

Oligodendrocyte-microglia cross-talk in the central nervous system.

Immunology 141, 302-13. doi: 10.1111/imm.12163.

Penkowa M, Moos T, Carrasco J, Hadberg H, Molinero A, Bluethmann H,

Hidalgo J., 1999. Strongly compromised inflammatory response to brain

injury in interleukin-6-deficient mice. Glia 25, 343-57.

Peyssonnaux C, Zinkernagel AS, Datta V, Lauth X, Johnson RS, Nizet V., 2006.

TLR4-dependent hepcidin expression by myeloid cells in response to

bacterial pathogens. Blood 107, 3727-32.

Piaton, G., Aigrot, M.S., Williams, A., Moyon, S., Tepavcevic, V., Moutkine, I.,

Gras, J., Matho, K.S., Schmitt, A., Soellner, H., Huber, A.B., Ravassard, P.,

Lubetzki, C., 2011. Class 3 semaphorins influence oligodendrocyte precursor

recruitment and remyelination in adult central nervous system. Brain 134,

1156–1167. doi:10.1093/brain/awr022

184 Piccinelli P, Samuelsson T., 2007. Evolution of the iron-responsive element.

RNA. 13, 952-66.

Pineau I, Lacroix S., 2007. Proinflammatory cytokine synthesis in the injured

mouse spinal cord: multiphasic expression pattern and identification of the

cell types involved. J Comp Neurol 500, 267-285.

Pineau I, Sun L, Bastien D, Lacroix S., 2010. Astrocytes initiate inflammation in

the injured mouse spinal cord by promoting the entry of neutrophils and

inflammatory monocytes in an IL-1 receptor/MyD88-dependent fashion. Brain

Behav Immun 24, 540-553. doi: 10.1016/j.bbi.2009.11.007.

Pitt D, Nagelmeier IE, Wilson HC, Raine CS., 2003. Glutamate uptake by

oligodendrocytes: Implications for excitotoxicity in multiple sclerosis.

Neurology 61, 1113-20.

Pleasure, D., Abramsky, O., Silberberg, D., Quinn, B., Parris, J., Saida, T., 1977.

Lipid synthesis by an oligodendroglial fraction in suspension culture. Brain

Res 134, 377–382.

Poltorak, A., He, X., Smirnova, I., Liu, M.Y., Van Huffel, C., Du, X., Birdwell, D.,

Alejos, E., Silva, M., Galanos, C., Freudenberg, M., Ricciardi-Castagnoli, P.,

Layton, B., Beutler, B., 1998. Defective LPS signaling in C3H/HeJ and

C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282, 2085–2088.

Popovich PG, Guan Z, Wei P, Huitinga I, van Rooijen N, Stokes BT., 1999.

Depletion of hematogenous macrophages promotes partial hindlimb recovery

185 and neuroanatomical repair after experimental spinal cord injury. Exp Neurol

158, 351-365.

Popovich PG, Hickey WF., 2001. Bone marrow chimeric rats reveal the unique

distribution of resident and recruited macrophages in the contused rat spinal

cord. J Neuropathol Exp Neurol 60, 676-85.

Popovich PG, Wei P, Stokes BT., 1997. Cellular inflammatory response after

spinal cord injury in Sprague-Dawley and Lewis rats. J Comp Neurol 377,

443-64.

Portt L, Norman G, Clapp C, Greenwood M, Greenwood MT., 2011. Anti-

apoptosis and cell survival: a review. Biochim Biophys Acta 1813, 238-59.

Poss KD, Tonegawa S., 1997. Heme oxygenase 1 is required for mammalian

iron reutilization. Proc Natl Acad Sci U S A 94, 10919-10924.

Powers, B.E., Lasiene, J., Plemel, J.R., Shupe, L., Perlmutter, S.I., Tetzlaff, W.,

Horner, P.J., 2012. Axonal thinning and extensive remyelination without

chronic de- myelination in spinal injured rats. J Neurosci 32, 5120–5125.

Pringle N, Collarini EJ, Mosley MJ, Heldin CH, Westermark B, Richardson WD.,

1989. PDGF A chain homodimers drive proliferation of bipotential (O-2A) glial

progenitor cells in the developing rat optic nerve. EMBO J 8, 1049-56.

Profyris C, Cheema SS, Zang D, Azari MF, Boyle K, Petratos S., 2004.

Degenerative and regenerative mechanisms governing spinal cord

injury.Neurobiol Dis 15, 415-36.

186 Pringle, N.P., Richardson, W.D., 1993. A singularity of PDGF alpha-receptor

expression in the dorsoventral axis of the neural tube may define the origin of

the oligodendrocyte lineage. Development 117, 525-533.

Raff, M.C., Lillien, L.E., Richardson, W.D., Burne, J.F., Noble, M.D., 1988.

Platelet-derived growth factor from astrocytes drives the clock that times

oligodendrocyte development in culture. Nature 333, 562-565.

Raff, M.C., Miller, R.H., Noble, M., 1983. A glial progenitor cell that develops in

vitro into an astrocyte or oligodendrocyte depending on culture medium.

Nature 303, 390-396.

Raff, M.C., Williams, B.P., Miller, R.H., 1984. The in vitro differentiation of a

bipotential glial progenitor cell. EMBO J 3, 1857-1864.

Ramalingam, M., Kim, S.-J., 2012. Reactive oxygen/nitrogen species and their

functional correlations in neurodegenerative diseases. J Neural Transm 119,

891–910. doi:10.1007/s00702-011-0758-7

Rasband, M.N., Shrager, P., 2000. Ion channel sequestration in central nervous

system axons. J Physiol 525, 63-73.

Rathore, K., Kerr, B., Redensek, A., López-Vales, R., Jeong, S., David, S., 2008.

Ceruloplasmin protects injured spinal cord from iron-mediated oxidative

damage. J Neurosci 28, 12736-47.

Rathore, K.I., Redensek, A., David, S., 2012. Iron homeostasis in astrocytes and

microglia is differentially regulated by TNF-α and TGF-β1. Glia 60, 738–750.

187 doi:10.1002/glia.22303

Recalcati S, Locati M, Gammella E, Invernizzi P, Cairo G., 2012. Iron levels in

polarized macrophages: regulation of immunity and autoimmunity.

Autoimmun Rev 11, 883-889. doi: 10.1016/j.autrev.2012.03.003.

Recalcati S, Locati M, Marini A, Santambrogio P, Zaninotto F, De Pizzol M,

Zammataro L, Girelli D, Cairo G., 2010. Differential regulation of iron

homeostasis during human macrophage polarized activation. Eur J Immunol.

40, 824-35.

Remak, R., 1838. Observationes anatomicae et microscopicae de systematis

nervosi structura. Berlin: Reimer.

Robinson, S., Tani, M., Strieter, R.M., 1998. The chemokine growth-regulated

oncogene-α promotes spinal cord oligodendrocyte precursor proliferation. J

Neurosci 18, 10457–10463.

Rodriguez, M., Lindsley, M.D., 1992. Immunosuppression promotes CNS

remyelination in chronic virus‐induced demyelinating disease. Neurology 42,

348–357.

Rosenberg, S.S., Ng, B.K., Chan, J.R., 2006. The quest for remyelination: a new

role for neurotrophins and their receptors. Brain Pathol 16, 288–294.

doi:10.1111/j.1750-3639.2006.00035.x

Rosenbluth, J., 1999. A brief history of myelinated nerve fibers: one hundred and

fifty years of controversy. J Neurocytol 28, 251-262.

188 Rossi E., 2005.Hepcidin--the iron regulatory hormone.Clin Biochem Rev 26, 47-

9.

Rouault TA., 2006. The role of iron regulatory proteins in mammalian iron

homeostasis and disease. Nat Chem Biol 2, 406-14.

Rouault TA., 2013. Iron metabolism in the CNS: implications for

neurodegenerative diseases. Nat Rev Neurosci 14, 551-64.

Roth, G., Dicke, U., 2005. Evolution of the brain and intelligence. Trends Cogn

Sci 9, 250-257.

Saher, G., Brügger, B., Lappe-Siefke, C., Möbius, W., Tozawa, R.-I., Wehr, M.C.,

Wieland, F., Ishibashi, S., Nave, K.-A., 2005. High cholesterol level is

essential for myelin membrane growth. Nat Neurosci doi:10.1038/nn1426

Sahinkaya FR, Milich LM, McTigue DM., 2014. Changes in NG2 cells and

oligodendrocytes in a new model of intraspinal hemorrhage. Exp Neurol 255,

113-26.

Satake K, Matsuyama Y, Kamiya M, Kawakami H, Iwata H, Adachi K, Kiuchi K.,

2000. Nitric oxide via macrophage iNOS induces apoptosis following

traumatic spinal cord injury.Brain Res Mol Brain Res 85, 114-122.

Sauerbeck A, Schonberg DL, Laws JL, McTigue DM., 2013. Systemic iron

chelation results in limited functional and histological recovery after traumatic

spinal cord injury in rats. Exp Neurol 248, 53-61.

Sawada M, Itoh Y, Suzumura A, Marunouchi T., 1993. Expression of cytokine

189 receptors in cultured neuronal and glial cells. Neurosci Lett 160, 131-4.

Schell JB, Crane CA, Smith MF Jr, Roberts MR., 2007. Differential ex vivo nitric

oxide production by acutely isolated neonatal and adult microglia. J

Neuroimmunol 189, 75-87.

Schlaepfer, W.W., Hager, H., 1964. Ultrastructural studies of INH-induced

neuropathy in rats. II. Alteration and decomposition of the myelin sheath. Am

J Pathol 45, 423–433.

Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the

comparative C(T) method. Nat Protoc 3, 1101-1108.

Schmitz, T., Chew, L.-J., 2008. Cytokines and Myelination in the Central Nervous

System. ScientificWorldJournal 8, 1119–1147.

Schneider A, Krüger C, Steigleder T, Weber D, Pitzer C, Laage R, Aronowski J,

Maurer MH, Gassler N, Mier W, Hasselblatt M, Kollmar R, Schwab S,

Sommer C, Bach A, Kuhn HG, Schäbitz WR., 2005. The hematopoietic factor

G-CSF is a neuronal ligand that counteracts programmed cell death and

drives neurogenesis. J Clin Invest 115, 2083-98.

Schnell L, Fearn S, Schwab ME, Perry VH, Anthony DC., 1999. Cytokine-

induced acute inflammation in the brain and spinal cord. J Neuropathol Exp

Neurol 58, 245-54.

Schonberg, D.L., Goldstein, E.Z., Sahinkaya, F.R., Wei, P., Popovich, P.G.,

McTigue, D.M., 2012. Ferritin stimulates oligodendrocyte genesis in the adult

190 spinal cord and can be transferred from macrophages to NG2 cells in vivo. J

Neurosci 32, 5374–5384.

Schonberg, D.L., McTigue, D.M., 2009. Iron is essential for oligodendrocyte

genesis following intraspinal macrophage activation. Exp Neurol 218, 64–74.

Schonberg, D.L., Popovich, P.G., McTigue, D.M., 2007. Oligodendrocyte

generation is differentially influenced by toll-like receptor (TLR) 2 and TLR4-

mediated intraspinal macrophage activation. J Neuropathol Exp Neurol 66,

1124–1135.

Schoenborn JR, Wilson CB., 2007. Regulation of interferon-gamma during innate

and adaptive immune responses.Adv Immunol 96, 41-101.

Schönemeier, B., Kolodziej, A., Schulz, S., Jacobs, S., Hoellt, V., Stumm, R.,

2008. Regional and cellular localization of the CXCl12/SDF-1 chemokine

receptor CXCR7 in the developing and adult rat brain. J Comp Neurol 510,

207–220. doi:10.1002/cne.21780

Schroder K, Irvine KM, Taylor MS, Bokil NJ, Le Cao KA, Masterman KA, Labzin

LI, Semple CA, Kapetanovic R, Fairbairn L, Akalin A, Faulkner GJ, Baillie JK,

Gongora M, Daub CO, Kawaji H, McLachlan GJ, Goldman N, Grimmond SM,

Carninci P, Suzuki H, Hayashizaki Y, Lenhard B, Hume DA, Sweet MJ.,

2012. Conservation and divergence in Toll-like receptor 4-regulated gene

expression in primary human versus mouse macrophages. Proc Natl Acad

Sci U S A. 109, E944-53.

191 Schulz, K., Kroner, A., David, S., 2012. Iron efflux from astrocytes plays a role in

remyelination. J Neurosci 32, 4841–4847. doi:10.1523/JNEUROSCI.5328-

11.2012

Schwann, T., 1839. Microscopical researches into the accordance in the

structure and growth of animals and plants. Translated by Smith, H. 1847.

London: Sydenham Society.

She H, Xiong S, Lin M, Zandi E, Giulivi C, Tsukamoto H., 2002. Iron activates

NF-kappaB in Kupffer cells. Am J Physiol Gastrointest Liver Physiol 283,

G719-726.

Shi H, Bencze KZ, Stemmler TL, Philpott CC., 2008. A cytosolic iron chaperone

that delivers iron to ferritin. Science 320, 1207-1210. doi:

10.1126/science.1157643.

Shigemoto-Mogami, Y., Hoshikawa, K., Goldman, J.E., Sekino, Y., Sato, K.,

2014. Microglia enhance neurogenesis and oligodendrogenesis in the early

postnatal subventricular zone. J Neurosci 34, 2231–2243.

Shimozaki K, Nakajima K, Hirano T, Nagata S., 1997. Involvement of STAT3 in

the granulocyte colony-stimulating factor-induced differentiation of myeloid

cells. J Biol Chem 272, 25184-9.

Simon, C., Gotz, M., Dimou, L., 2011. Progenitors in the adult cerebral cortex:

Cell cycle properties and regulation by physiological stimuli and injury. Glia

59, 869–881.

192 Sindrilaru A, Peters T, Wieschalka S, Baican C, Baican A, Peter H, Hainzl A,

Schatz S, Qi Y, Schlecht A, Weiss JM, Wlaschek M, Sunderkötter C,

Scharffetter-Kochanek K., 2011. An unrestrained proinflammatory M1

macrophage population induced by iron impairs wound healing in humans

and mice. J Clin Invest 121, 985-997. doi: 10.1172/JCI44490.

Smith, K.J., Blakemore, W.F., McDonald, W.I., 1979. Central remyelination

restores secure conduction. Nature 280, 395–396.

Stankoff, B., Aigrot, M.-S., Noël, F., Wattilliaux, A., Zalc, B., Lubetzki, C., 2002.

Ciliary neurotrophic factor (CNTF) enhances myelin formation: a novel role

for CNTF and CNTF-related molecules. J Neurosci 22, 9221–9227.

Streit WJ, Semple-Rowland SL, Hurley SD, Miller RC, Popovich PG, Stokes BT.,

1998. Cytokine mRNA profiles in contused spinal cord and axotomized facial

nucleus suggest a beneficial role for inflammation and gliosis. Exp Neurol

152, 74-87.

Szuchet, S., Yim, S.H., Monsma, S., 1983. Lipid metabolism of isolated

oligodendrocytes maintained in long-term culture mimics events associated

with myelinogenesis. Proc Natl Acad Sci USA 80, 7019–7023.

Tacchini L, Gammella E, De Ponti C, Recalcati S, Cairo G., 2008. Role of HIF-1

and NF-kappaB transcription factors in the modulation of transferrin receptor

by inflammatory and anti-inflammatory signals. J Biol Chem 283, 20674-86.

Tahara, K., Kim, H.D., Jin, J.J., Maxwell, J.A., Li, L., Fukuchi, K., 2006. Role of

193 Toll-like receptor signalling in Aβ uptake and clearance. Brain 129, 3006–

3019.

Takebayashi, H., Nabeshima, Y., Yoshida, S., Chisaka, O., Ikenaka, K., 2002.

The basic helix-loop-helix factor olig2 is essential for the development of

motoneuron and oligodendrocyte lineages. Curr Biol 12, 1157–1163.

Talbott, J.F., Cao, Q., Bertram, J., Nkansah, M., Benton, R.L., Lavik, E.,

Whittemore, S.R., 2007. CNTF promotes the survival and differentiation of

adult spinal cord-derived oligodendrocyte precursor cells in vitro but fails to

promote remyelination in vivo. Exp Neurol 204, 485–489.

doi:10.1016/j.expneurol.2006.12.013

Taylor KR, Trowbridge JM, Rudisill JA, Termeer CC, Simon JC, Gallo RL., 2004.

Hyaluronan fragments stimulate endothelial recognition of injury through

TLR4. J Biol Chem 279, 17079-17084.

Tetzlaff, W., Okon, E.B., karimi-Abdolrezaee, S., Hill, C.E., Joseph, S.S., Plemel,

J.R., Ward, P.T., Tsai, E.C., Baptiste, D., Smithson, L.J., Kawaja, M.D.,

Fehlings, M.G., Kwon, B.K., 2011. A systematic review of cellular

transplantation therapies for spinal cord injury. J Neurotrauma 28, 1611–

1682.

Theurl I, Theurl M, Seifert M, Mair S, Nairz M, Rumpold H, Zoller H, Bellmann-

Weiler R, Niederegger H, Talasz H, Weiss G., 2008. Autocrine formation of

hepcidin induces iron retention in human monocytes. Blood 111, 2392-2399.

194 Thibeault I, Laflamme N, Rivest S., 2001. Regulation of the gene encoding the

monocyte chemoattractant protein 1 (MCP-1) in the mouse and rat brain in

response to circulating LPS and proinflammatory cytokines. J Comp Neurol

434, 461-477.

Thorburne SK, Juurlink BH., 1996. Low glutathione and high iron govern the

susceptibility of oligodendroglial precursors to oxidative stress. J Neurochem

67, 1014-22.

Tili E, Michaille JJ, Cimino A, Costinean S, Dumitru CD, Adair B, Fabbri M, Alder

H, Liu CG, Calin GA, Croce CM., 2007. Modulation of miR-155 and miR-125b

levels following lipopolysaccharide/TNF-alpha stimulation and their possible

roles in regulating the response to endotoxin shock. J Immunol 179, 5082-

5089.

Todorich, B., Pasquini, J.M., Garcia, C.I., Paez, P.M., Connor, J.R., 2009.

Oligodendrocytes and myelination: The role of iron. Glia 57, 467–478.

doi:10.1002/glia.20784

Tominaga K, Yoshimoto T, Torigoe K, Kurimoto M, Matsui K, Hada T, Okamura

H, Nakanishi K. 2000. IL-12 synergizes with IL-18 or IL-1beta for IFN-gamma

production from human T cells. Int Immunol 12, 151-60.

Totoiu, M.O., Keirstead H.S., 2005. Spinal cord injury is accompanied by chronic

progressive demyelination. J Comp Neurol 486, 373-383.

Trapp BD, Nave KA., 2008. Multiple sclerosis: an immune or neurodegenerative

195 disorder? Annu Rev Neurosci 31, 247-69.

Tripathi, R.B., Clarke, L.E., Burzomato, V., Kessaris, N., Anderson, P.N., Attwell,

D., Richardson, W.D., 2011. Dorsally and ventrally derived oligodendrocytes

have similar electrical properties but myelinate preferred tracts. J Neurosci

31, 6809-6819.

Tripathi R, McTigue DM., 2007. Prominent oligodendrocyte genesis along the

border of spinal contusion lesions. Glia 55, 698-711.

Tripathi RB, McTigue DM. 2008. Chronically increased ciliary neurotrophic factor

and fibroblast growth factor-2 expression after spinal contusion in rats. J

Comp Neurol 510, 129-44.

Trotta, T., Porro, C., Calvello, R., Panaro, M.A., 2014. Biological role of Toll-like

receptor-4 in the brain. J Neuroimmunol 268, 1–12.

Tsai, H.-H., Frost, E., To, V., Robinson, S., ffrench-Constant, C., Geertman, R.,

Ransohoff, R.M., Miller, R.H., 2002. The chemokine receptor CXCR2 controls

positioning of oligodendrocyte precursors in developing spinal cord by

arresting their migration. Cell 110, 373–383.

Ueno M, Fujita Y, Tanaka T, Nakamura Y, Kikuta J, Ishii M, Yamashita T., 2013.

Layer V cortical neurons require microglial support for survival during

postnatal development. Nat Neurosci 16, 543-51.

Urrutia, P., Aguirre, P., Esparza, A., Tapia, V., Mena, N.P., Arredondo, M.,

González-Billault, C., Núñez, M.T., 2013. Inflammation alters the expression

of DMT1, FPN1 and hepcidin, and it causes iron accumulation in central

196 nervous system cells. J Neurochem 126, 541-549.

Uttara B, Singh AV, Zamboni P, Mahajan RT., 2009. Oxidative stress and

neurodegenerative diseases: a review of upstream and downstream

antioxidant therapeutic options. Curr Neuropharmacol 7, 65-74. doi:

10.2174/157015909787602823.

Velardo MJ, Burger C, Williams PR, Baker HV, López MC, Mareci TH, White TE,

Muzyczka N, Reier PJ., 2004. Patterns of gene expression reveal a

temporally orchestrated wound healing response in the injured spinal cord. J

Neurosci 24, 8562-8576.

Vellenga E, Rambaldi A, Ernst TJ, Ostapovicz D, Griffin JD., 1988. Independent

regulation of M-CSF and G-CSF gene expression in human monocytes.

Blood 71, 1529-32.

Vana AC, Flint NC, Harwood NE, Le TQ, Fruttiger M, Armstrong RC., 2007.

Platelet-derived growth factor promotes repair of chronically demyelinated

white matter.J Neuropathol Exp Neurol 66, 975-88.

Vartanian, T., Li, Y., Zhao, M., Stefansson, K., 1995. Interferon-gamma-induced

oligodendrocyte cell death: implications for the pathogenesis of multiple

sclerosis. Mol Med 1, 732-43.

Vela, J.M., Molina-Holgado, E., Arévalo-Martín, A., Almazán, G., Guaza, C.,

2002. Interleukin-1 regulates proliferation and differentiation of

oligodendrocyte progenitor cells. Mol Cell Neurosci 20, 489–502.

197 doi:10.1006/mcne.2002.1127

Vigano, F., Mobius, W., Gotz, M., Dimou, L., 2013. Transplantation reveals

regional differences in oligodendrocyte differentiation in the adult brain. Nat

Neurosci 16, 1370–1372.

Virchow, R., 1858. Cellular Pathology. Berlin: Hirschwald. Translated by Chance,

F., 1860. London: Churchill.

Vora, P., Pillai, P., Mustapha, J., Kowal, C., Shaffer, S., Bose, R., Namaka, M.,

Frost, E.E., 2012. Experimental Neurology. Exp Neurol 236, 259–267.

doi:10.1016/j.expneurol.2012.04.012

Wake H, Lee PR, Fields RD., 2011. Control of local protein synthesis and initial

events in myelination by action potentials. Science 333, 1647-51. doi:

10.1126/science.1206998.

Wang CX, Nuttin B, Heremans H, Dom R, Gybels J., 1996. Production of tumor

necrosis factor in spinal cord following traumatic injury in rats. J

Neuroimmunol 69, 151-156.

Ward RJ, Dexter DT, Crichton RR., 2015. Neurodegenerative diseases and

therapeutic strategies using iron chelators. J Trace Elem Med Biol.

2015;31:267-73.

Welte K, Platzer E, Lu L, Gabrilove JL, Levi E, Mertelsmann R, Moore MA., 1985.

Purification and biochemical characterization of human pluripotent

hematopoietic colony-stimulating factor. Proc Natl Acad Sci U S A. 82, 1526-

198 30.

Widmer R, Grune T., 2005. Iron uptake of the normoxic, anoxic and postanoxic

microglial cell line RAW 264.7. Biofactors 24, 247-54.

Williams, R., Buchheit, C., Berman, N., LeVine, S., 2012. Pathogenic implications

of iron accumulation in multiple sclerosis. J Neurochem 120, 7-25.

Wisniewski, H.M., Bloom, B.R., 1975. Primary demyelination as a nonspecific

consequence of a cell-mediated immune reaction. J Exp Med 141, 346–359.

Wrathall, J.R., Li, W., Hudson, L.D., 1998. Myelin gene expression after

experimental contusive spinal cord injury. J Neurosci 18, 8780–8793.

Wrighting DM, Andrews NC., 2006. Interleukin-6 induces hepcidin expression

through STAT3. Blood 108, 3204-3209.

Wu, Q., Miller, R.H., Ransohoff, R.M., Robinson, S., Bu, J., Nishiyama, A., 2000.

Elevated levels of the chemokine GRO-1 correlate with elevated

oligodendrocyte progenitor proliferation in the jimpy mutant. J Neurosci 20,

2609–2617.

Xia Y, Zweier JL., 1997. Superoxide and peroxynitrite generation from inducible

nitric oxide synthase in macrophages. Proc Natl Acad Sci U S A 94, 6954-8.

Yamamoto, M., Sato, S., Hemmi, H., Hoshino, K., Kaisho, T., Sanjo, H.,

Takeuchi, O., Sugiyama, M., Okabe, M., Takeda, K., Akira, S., 2003. Role of

adaptor TRIF in the MyD88-independent Toll-like receptor signaling pathway.

Science 301, 640–643.

199 Yao DL, West NR, Bondy CA, Brenner M, Hudson LD, Zhou J, Collins GH,

Webster HD., 1995. Cryogenic spinal cord injury induces astrocytic gene

expression of insulin-like growth factor I and insulin-like growth factor binding

protein 2 during myelin regeneration. J Neurosci Res 40, 647-659.

Ye, F., Chen, Y., Hoang, T., Montgomery, R.L., Zhao, X-H., Bu, H., Hu, T.,

Taketo, M.M., van Es, J.H., Clevers, H., Hsieh, J., Bassel-Duby, R., Olson

E.N., Lu, R.Q., 2009. HDAC1 and HDAC2 regulate oligodendrocyte

differentiation by disrupting the b-catenin–TCF interaction. Nat Neurosci 12,

829-838.

Yeh, H.J., Ruit, K.G., Wang, Y.X., Parks, W.C., Snider, W.D., Deuel, T.F., 1991.

PDGF A-chain gene is expressed by mammalian neurons during

development and in maturity. Cell 64, 209-216.

Zai LJ, Yoo S, Wrathall JR., 2005. Increased growth factor expression and cell

proliferation after contusive spinal cord injury. Brain Res 1052, 147-155.

Zalc, B., 2015. The acquisition of myelin: An evolutionary perspective. Brain Res

1–7. doi:10.1016/j.brainres.2015.09.005

Zarruk, J.G., Berard, J.L., Santos, dos, R.P., Kroner, A., Lee, J., Arosio, P.,

David, S., 2016. Expression of iron homeostasis proteins in the spinal cord in

experimental autoimmune encephalomyelitis and their implications for iron

accumulation. Neurobiol Dis 1–15. doi:10.1016/j.nbd.2015.02.001

Zecca L, Youdim MB, Riederer P, Connor JR, Crichton RR., 2004. Iron, brain

200 ageing and neurodegenerative disorders. Nat Rev Neurosci 5, 863-73.

Zhang, F., Yao, S-Y., Whetsell, W.O., Sriram, S., 2013. Astrogliopathy and

oligodendrogliopathy are early events in CNS demyelination. Glia 61, 1261-

1273. doi:10.1002/glia.22513

Zhang, P., Chebath, J., Lonai, P., Revel, M., 2004. Enhancement of

oligodendrocyte differentiation from murine embryonic stem cells by an

activator of gp130 signaling. Stem Cells 22, 344–354.

Zhang, X., Haaf, M., Todorich, B., Grosstephan, E., Schieremberg, H.,

Surguladze, N., Connor, J.R., 2005. Cytokine toxicity to oligodendrocyte

precursors is mediated by iron. Glia 15, 199-208.

Zhang, X., Surguladze, N., Slagle-Webb, B., Cozzi, A., Connor, J.R., 2006.

Cellular iron status influences the functional relationship between microglia

and oligodendrocytes. Glia 54, 795–804. doi:10.1002/glia.20416

Zhou, Q., Anderson, D.J., 2002. The bHLH transcription factors OLIG2 and

OLIG1 couple neuronal and glial subtype specification. Cell 109, 61–73.

Zhou H, Lapointe BM, Clark SR, Zbytnuik L, Kubes P., 2006. A requirement for

microglial TLR4 in leukocyte recruitment into brain in response to

lipopolysaccharide. J Immunol 177, 8103-10.

Zuchero JB, Barres BA., 2013. Intrinsic and extrinsic control of oligodendrocyte

development. Curr Opin Neurobiol 23, 914-20. doi:

10.1016/j.conb.2013.06.005.

201