Shah Hussain Phd Thesis.Pdf

SPECIES DIVERSITY OF BASIDIOMYCETES OF DISTRICT MALAKAND

SHAH HUSSAIN

DEPARTMENT OF BOTANY HAZARA UNIVERSITY MANSEHRA 2016

HAZARA UNIVERSITY MANSEHRA

Department of Botany

SPECIES DIVERSITY OF BASIDIOMYCETES OF DISTRICT MALAKAKAND

SHAH HUSSAIN

This research study has been conducted and reported as partial fulfillment of the requirements of PhD degree in Botany awarded by Hazara University Mansehra, Pakistan

Mansehra, The Thursday 05, May 2016

SPECIES DIVERSITY OF BASIDIOMYCETES OF DISTRICT MALAKAND

A thesis submitted for fulfillment the requirements of the degree of Doctor of Philosophy in Botany

SUBMITTED BY SHAH HUSSAIN PhD Scholar

RESEARCH SUPERVISOR PROF. HABIB AHMAD PhD TI Chairman Department of Genetics Hazara University, Mansehra

CO-SUPERVISOR DR. NAJAM-UL-SAHAR AFSHAN Assistant Professor Centre for Undergraduate Studies University of the Punjab Quaid-e-Azam Campus, Lahore

DEPARTMENT OF BOTANY HAZARA UNIVERSITY MANSEHRA 2016

Dedication

I would like to dedicate the success of this study to my family and my teachers.

CONTENTS Page No.

List of Figures iv List of Tables viii List of Abbreviations ix Acknowledgement x Abstract xii Chapter 1 Introduction 1 1.1. The study area 1 1.2. Fungi in Pakistan 4 1.3. Taxonomy of fungi 6 1.4. Molecular biology of fungi 7 1.5. Scope and limitations of the study 8 1.6. Objectives of the study 8 Chapter 2 Materials and Methods 9 2.1. Survey and collection 9 2.1.1 Monsoon rainy season 9 2.1.2 Dry season 9 2.1.3 Spring season 9 2.2. Morphological characterization of species 9 2.3. Molecular characterization 10 2.3.1 DNA extraction, PCR and Sequencing 10 2.3.2 Phylogenetic analyses 13 2.4. Diversity index 14 Chapter 3 Results 15 3.1. Agaricus bisporiticus 18 3.2. Agaricus campestris 19 3.3. Agaricus malakandensis nom. prov. 23

3.4. Agaricus minorus nom. prov. 25 3.5. Hymenagaricus pakistaniensis nom. prov. 31 3.6. Leucoagaricus badius nom. prov. 36 3.7. Leucoagaricus sultanii nom. prov. 38 3.8. Leucocoprinus birnbaumii 46 3.9. Lycoperdon dermoxanthum 50 3.10. Tulostoma ahmadii 54 3.11. Conocybe papillata 60 3.12. Cantharocybe pakistanicus nom. prov. 65 3.13. Termitomyces umkowaan 70 3.14. Marasmiellus palmivorus 74 3.15. Omphalotus nidiformis 79 3.16. Pleurotus cystidiosus 83 3.17. Volvariella bombycina 87 3.18. Coprinellus curtus 91 3.19. Coprinellus disseminatus 93 3.20. Coprinellus micaceus 94 3.21. Coprinellus radians 95 3.22. Coprinopsis hispidus nom. prov. 99 3.23. Parasola auricoma 104 3.24. Parasola lentiformis nom. prov. 106 3.25. Parasola lilatincta 110 3.26. Parasola malakandensis nom. prov. 112 3.27. Parasola schroeteri 117 3.28. Psathyrella candolleana 121 3.29. Psathyrella fusiformis nom. prov. 122 3.30. Agrocybe pediades 127 3.31. Agrocybe semiorbicularis 130 3.32. Stropharia ambigua 134

3.33. Geastrum velutinum 138 3.34. Phellinus badius 142 3.35. Irpex lacteus 144 3.36. Rigidoporus vinctus 146 3.37. Earliella scabrosa 148 3.38. Trametes cubensis 150 3.39. Trametes lactinae 152 3.40. Phragmidium papillatum 155 3.41. Phragmidium rubi-idaei 157 3.42. Puccinia aestivalis 159 3.43. Puccinia conclusa 161 3.44. Puccinia duthiei 164 3.45. Puccinia microspore 167 3.46. Puccinia nakanishikii 170 3.47. Puccinia striiformis var. striiformis 172 3.48. Puccinia violae 174 3.49. Puccinia melanocephala 176 3.50. Uromyces lespedezae-procumbentis 177 3.51. Urocystis avenastri 180 3.52. Diversity of basidiomycetous fungi 182 3.52.1 Diversity of basidiomycetous fungi in Dargai tehsil 182 3.52.2 Diversity of basidiomycetous fungi in Batkhela tehsil 182 Chapter 4 Discussion 190 Conclusion 206 Recommendations 207 Chapter 5 References 208

iii

LIST OF FIGURES Page No. Figure 1. Map of district Malakand 2 Figure 2. Basidiomata of Agaricus bisporiticus and A. campestris 21 Figure 3. Anatomical features of Agaricus bisopriticus and A. campestris 22 Figure 4. Basidiomata of Agaricus malakandensis and A. minorus 27 Figure 5. Anatomical features of Agaricus malakandensis and A. minorus 28 Figure 6. Phylogenetic tree of Agaricus spp. 30 Figure 7. Basidiomata of Hymenagaricus pakistaniensis 33 Figure 8. Anatomical features of Hymenagaricus pakistaniensis 34 Figure 9. Phylogenetic tree of Hymenagaricus and allied genera 35 Figure 10. Basidiomata of Leucoagaricus species 40 Figure 11. Anatomical features of Leucoagaricus species 41 Figure 12. Phylogenetic tree based on ITS dataset of Leucoagaricus spp. 44 Figure 13. Phylogenetic tree based four genes regions of Leucoagaricus spp. 45 Figure 14. Morpho-anatomical features of Leucocoprinus birnbaumii 48 Figure 15. Phylogenetic tree of Leucocoprinus spp. 49 Figure 16. Morpho-anatomical features of Lycoperdon dermoxanthum 52 Figure 17. Phylogenetic tree of Lycoperdon spp. 53 Figure 18. Basidiomata and basidiospores of Tulostoma ahmadii 57 Figure 19. Morpho-anatomical features of Tulostoma ahmadii 58 Figure 20. Phylogenetic tree of Tulostama spp. 59 Figure 21. Basidiomata of Conocybe papillata 62 Figure 22. Anatomical features of Conocybe papillata 63 Figure 23. Phylogenetic tree of Conocybe spp. 64 Figure 24. Basidiomata of Cantharocybe pakistanicus 67 Figure 25. Anatomical features of Cantharocybe pakistanicus 68 Figure 26. Phylogenetic tree of Hygrophoraceae 69 Figure 27. Morpho-anatomical features of Termitomyces umkowaan 72

Figure 28. Phylogenetic tree of Termitomyces spp. 73 Figure 29. Sporophores of Marasmiellus palmivorus 76 Figure 30. Anatomical features of Marasmiellus palmivorus 77 Figure 31. Phylogenetic tree of Marasmiellus palmivorus and allied genera 78 Figure 32. Morpho-anotmical features of Omphalotus nidiformis 81 Figure 33. Phylogenetic tree of Omphalotus spp. 82 Figure 34. Morpho-anatomical features of Pleurotus cystidiosus 85 Figure 35. Phylogenetic tree of Pleurotus spp. 86 Figure 36. Basidiomata of Volvariella bombycina 88 Figure 37. Anatomical features of Volvariella bombycina 89 Figure 38. Phylogenetic tree of Volvariella spp. 90 Figure 39. Anatomical features of Coprinellus curtus 92 Figure 40. Basidiomata of Coprinellus spp. 96 Figure 41. Anatomical features of Coprinellus spp. 97 Figure 42. Phylogenetic tree of Coprinellus species 98 Figure 43. Basidiomata and basidiospores of Coprinopsis hispidus 101 Figure 44. Anatomical features of Coprinopsis hispidus 102 Figure 45. Phylogenetic tree of Coprinopsis spp. 103 Figure 46. Figure 46. Basidiomata of Parasola auricoma and Pa. lentiformis 108 Figure 47. Anatomical features of Parasola auricoma and Pa lentiformis 109 Figure 48. Basidiomata and anatomical features Parasola lilatincta 111 Figure 49. Basidiomata of Parasola malakandensis 114 Figure 50. Morpho-anatomical features of Parasola malakandensis 115 Figure 51. Three gene phylogeny (ITS-LSU-tef-1α) of Pa. malakandensis 116 Figure 52. Basidiomata and anatomical features of Parasola schroeterii 118 Figure 53. Phylogeny of Parasola spp., based on ITS sequences 120 Figure 54. Basidiomata of Psathyrella candolleana and Ps. fusiformis 124 Figure 55. Anatomical features of Psathyrella candolleana and Ps. fusiformis 125 Figure 56. Phylogenetic tree of Psathyrella species 126

Figure 57. Morpho-anatomical features of Agrocybe pediades 128 Figure 58. Phylogenetic tree of Agrocybe spp. 129 Figure 59. Basidiomata and spores of Agrocybe semiobricularis 131 Figure 60. Anatomical features of Agrocybe semiobricularis 132 Figure 61. Phylogenetic tree of Agrocybe spp. 133 Figure 62. Morpho-anatomical features of Stropharia ambigua 136 Figure 63. Phylogenetic tree of Stropharia and Hypholoma 137 Figure 64. Morpho-anatomical features of Geastrum velutinum 140 Figure 65. Phylogenetic tree of Geastrum spp. 141 Figure 66. Morpho-anatomical features of Phellinus badius 143 Figure 67. Morpho-anatomical features of Irpex lacteus 145 Figure 68. Morpho-anatomical features of Rigidoporus vinctus 147 Figure 69. Morpho-anatomical features of Earliella scabrosa 149 Figure 70. Morpho-anatomical features of Trametes cubensis 151 Figure 71. Morpho-anatomical features of Trametes lactinea 153 Figure 72. Phylogenetic tree of Polyporales 154 Figure 73. Phragmidium papillatum Potentilla geradiana 156 Figure 74. Phragmidium rubi-idaei on Rubus fruiticosus 158 Figure 75. Puccinia aestivalis on Microstegium nudum 160 Figure 76. Puccinia conclusa on Cyperus iria 162 Figure 77. Line drawings Puccinia conclusa 163 Figure 78. Puccinia duthiei on Dichanthium annulatum 165 Figure 79. Line drawings of Puccinia duthiei 166 Figure 80. Puccinia microspora on Imperata cylindrica 168 Figure 81. Drawings of Puccinia microspora 169 Figure 82. Puccinia nakanishikii on Sorghum halepense 171 Figure 83. Puccinia striiformis var. striiformis on Triticum aestivum 173 Figure 84. Puccinia violae on Viola canescense 175 Figure 85. Puccinia sp. on Saccharum bengalense 177

Figure 86. Uromyces lespedezae-procumbentis on Lespedeza juncea var. sericea 179 Figure 87. Urocystis avenastri 181 Figure 88. Species diversity index of Dargai tehsil 187 Figure 89. Species diversity index of Batkhela tehsil 188 Figure 90. Diversity index of different families of Basidiomycota of Malakand 189

vii

List of Tables Page No. Table 1. Primers used in this study 12

Table 2. Diversity Indices of fungal species of tehsil Dargai, district Malakaknd 183

Table 3. Diversity Indices of fungal species of tehsil Batkhela, district Malakaknd 185

Table 4. Diversity Indices of different fungal families of district Malakaknd 186

viii

List of abbreviations

A. Agaricus BPP Bayesian Posterior Probabilities Beast Bayesian evolutionary analysis sampling trees Co. Coprinellus Cop. Coprinopsis FH Farlow Herbarium ITS Internal Transcribed Spacer KP Khyber Pakhtunkhwa La. Leucoagaricus Lc. Leucocoprinus L. Lepiota MEGA Molecular Evolutionary Genetic Analysis ML Maximum Likelihood MP Maximum Parsimony P. Puccinia Pa. Parasola Ph. Phragmidium Ps. Psathyella rDNA Ribosomal DNA rpb2 Ribosomal RNA polymerase II subunit 2 SZMC Szeged Microbiological Collection tef-1α translation elongation factor 1 alpha

ACKNOWLEDGMENTS I would like to express my sincere thankfulness and deep gratitude to my supervisor Prof. Dr. Habib Ahmad TI, Chairman Department of Genetics and Vice Chancellor, Hazara University Mansehra, Pakistan, for his excellent guidance, fine instructions and constructive criticism during the course of this research work. I wish to express my profound gratitude to my co-supervisor, Dr. Najam-ul-Sahar Afshan, Assistant Professor, Centre for Undergraduate Studies, University of the Punjab, Lahore for her kind help, critical conversations, encouragement and the care she provided me during my studies. I express my sincere gratitude to my respected teacher, Prof. Dr. Abdul Nasir Khalid, Department of Botany, University of the Punjab Lahore, to whom I owe my research carrier, providing me an excellent and friendly environment in his Fungal Systematic and Biotechnology lab, and comfortable accommodation in hostel. His keen interest, nice and kind behavior, the care he provided me during this study and encouraged me to complete this task well in time. I would like to express my gratitude to Dr. Abdul Rehman Khan Niazi, Assistant Professor, Department of Botany, University of the Punjab Lahore, for his personal interest, sincere behavior and valuable suggestions during my studies. My special thanks are due to the Higher Education Commission of Pakistan especially IRSIP program and DG Mr. Jahanzeb Khan for financial support of the foreign training. I extend my special thanks to Prof. Dr. Manzoor Hussain, Chairman Department of Botany, Dr Muhammad Afzal Assistant Professor, Department of Botany and to all faculty members of Departments of Genetics and Botany, Hazara University Mansehra for their every kind of help and encouragement. I am greatly thankful to Prof. Dr. Donald H. Pfister, Farlow Herbarium, Harvard University, MA, USA, for providing me excellent opportunity to work in his lab, and encouraging me in my study. I am grateful to Farlow members Dr. Kathy LoBuglio (Research Assistant, Pfister Lab), Danny Haelewaters (Graduate

x student), Dr. Feng Xu (Post-Doctoral research fellow), Dr. Teresa Iturriaga (Visiting Research Scientist), Dr. Michaela Schmull (Research and Curatorial Associate Harvard University Herbaria), Jason Karakehian and my friend Chang Lin Zhao for their cooperation and help in phylogenetic analyses. I am also thankful to my friend, Mr. Muhammad Bilal and all family members of Mr. Mumtaz Ahamd for their support during my stay at Harvard University, USA. I highly appreciate the cooperation of Dr. Laszlo G. Nagy (Biological Research Centre, Hungarian Academy of Sciences) related to coprinoid mushrooms. I am also thankful to my lab fellows, Mr. Sadiqullah, Mr. Ishtiaq Ahmad, Dr. Nousheen Yousaf, Ms. Aamna Ishaq, Ms. Sana Jabeen, Ms. Afshan, Ms. Malka Saba, Ms. Tayyaba Qasim, Ms. Aamna Imran, Ms. Lubna, Ms. Hira Basheer, Ms. Munazza, Ms. Ayesha Farooqi, Mr. Zia Ullah, Mr. Junaid Khan and Mr. Muhammad Usman Mughal. I am also thankful to my friend and roommate Saqib Iqbal for giving me a nice company during my stay at Hostel (University of the Punjab), Lahore. I am indebted to all my family members especially my parents and my brothers Rehmat Hussain, Ahmad Hussain and Arshad Hussain, who provided invaluable moral and financial support at various times during the course of this study and ever prayed for my success.

Shah Hussain

ABSTRACT

This dissertation communicates the results of a scientific endeavor undertaken for exploring the diversity of Basidiomycetous fungi of District Malakand, Pakistan.

The District Malakand is an administrative unit of the Khyber Pakhtunkhwa province, occupies 952 Km2 land within the geographical limits of 34⁰ 35’ to 34⁰

66’ N and 71⁰ 65’ to 72⁰ 25’ E. Collections of mushrooms, rust and smut fungi were made from different area of Malakand District during the years 2013 and 2014.

Field data of the specimens were recorded on the spot, proper photographs were taken and the collection was dried and preserved accordingly. More than 150 specimens of Basidiomycota were collected, comprising of 51 taxa belonging to 17 families. Distribution pattern of the groups shows that Agaricomycotina, the mushroom forming fungi, was the largest group represented by 39 species,

Pucciniomycotina, the pathogenic rust fungi by 11 species and the smut fungi,

Ustilaginomycotina, with a single species viz., Urocystis avenastri. All these fungi were characterized morpho-anatomically. The members of Agaricomycotina were also subjected to molecular identification, based on four gene regions viz., ITS, nrLSU, rpb2, tef-1α. Phylogenies of the analyzed taxa were elaborated with maximum likelihood, maximum parsimony and Bayesian analysis.

Our research outputs includes one new species to science viz., Tulotoma ahmadii.

Ten more taxa viz., Agaricus malakandensis nom. prov., A. minorus nom. prov.,

Cantharocybe pakistanicus nom. prov., Coprinopsis hispidus nom. prov.,

Hymenagaricus pakistaniensis nom. prov., Leucoagaricus badius nom. prov., La. xii sultanii nom. prov., Parasola lentiformis nom. prov., Pa. malakandensis nom. prov. and Psathyrella fusiformis nom. prov., are in the process of recognition / publication as new species. Furthermore, other 12 species viz., Agrocybe semiorbicularis,

Conocybe papillata, Coprinellus curtus, Marasmiellus palmivorus, Pleurotus cystidiosus,

Parasola lilatincta, Pa. schroeterii, Stropharia ambigua, Puccinia microspora, P. nakanishikii, Termitomyces umkowaan and Trametes lactinea are added as new records to the species list of the fungi of Pakistan.

In Agaricomycotina, Agaricaceae proved to be the most frequent family represented by six genera (Agaricus, Hymenagaricus, Leucoagaricus, Leucocoprinus,

Lycoperdon and Tulostoma). The second largest family was Psathyrellaceae with four genera viz., Coprinellus, Coprinopsis, Parasola and Psathyrella. Only two genera were recorded for each the family i.e., Omphalotaceae, Polyporaceae and

Strophariaceae. Whereas families like Bolbitaceae, Hygrophoraceae,

Hymenocheataceae, Geastraceae, Lyophyllaceae, Miripelaceae, Mirulaceae,

Pleurotaceae and Pluteaceae were represented by a single genus each i.e.,

Conocybe, Cantharocybe, Phillanus, Geastrum, Termitomyces, Rigidoporus, Irpex,

Pleurotus and Volvariella, respectively.

Pucciniomycotina was represented by two families, Phragmidiaceae

(Phragmidium) and Puccineaceae represented by (Puccinia, Uromyces). The

Ustiloginomycotina was monotypic only represented by Urocystis avenastri.

This study concluded that low altitude mountains, foothills and grassy lands of

Malakand are rich in fungi species and needs exploration of other groups also.

xiii

These findings have not only upgraded the existing knowledge of basidiomycetes

Mycota from District Malakand but also established a sound baseline for future research and exploitation of fungi in Pakistan.

xiv

Chapter-1

INTRODUCTION

The history of research on fungi goes far back to the ancient Egyptian civilization where the edible fungus – mushrooms were considered the plant of immortality.

Fungi contributes a lot to the humanity in terms of ecosystem services as saprotrophic and parasitic agents, in agriculture, forestry, medicine, food industry, textiles, bioremediation, natural cycling, as bio-fertilizers and many other ways. Fungal biotechnology has become an integral part of the human welfare (Manoharachary et al., 2005).

1.1. THE STUDY AREA

The Malakand District is located at 34° 35´ to 34° 65´ N and 71° 65´ to 72° 25´ E.

Malakand District is an administrative unit of Khyber Pakhtunkhwa province of

Pakistan. It is bounded on the north by Dir, on northeast by Swat and east by Buner

Districts, on the south by Mardan and Charsadda Districts and on west by

Mohmand and Bajaur Agencies (Figure 1). Malakand extends from the rugged mountain ranges of the southern extension of Hindu Kush viz. Hindu Raj down to northern edge of the Peshawar basin. This district is the gateway to Dir, Chitral,

Swat districts and Federally Administered Tribal Areas (FATA), which are very famous for tourism. The total area of Malakand District is 952 Km2 and has a population density of 475 people per sq km. The population of Malakand was estimated to be 567,000 in 2004−05 (Anonymous, 2010).

Figure 1. Map of Pakistan showing the geographical location of District Malakand.

Administratively, district Malakand is divided in two tehsils, Dargai and Batkhela.

Climatically, both Dargai and Batkhela tehsils are subtropical in nature. Annual temperature of the area varies between –4 ºC in winter to 42 ºC in summer (Karim,

2008). The annual rainfall varies between 600 mm to 1100 mm. The rainfall is erratic, mostly received in monsoon i.e. from July to August. Snowfall is much rare and seldom occurs on the top of some mountains, which usually melt soon. Frost commonly occurs and starts by the mid of the November, but the south facing foothills has frost free zones, best for offseason agriculture (Anonymous, 2010).

The mountains in Malakand District are generally of low elevation, varying between 1200 and 1800 m at Malakand Pass to 2727 m at Hazar Nao ((Zabihullah et al., 2006; Murad et al., 2012). Natural vegetation of the mountains is mostly subtropical and fall under the forest type of Coniferous Sub-tropical Pine Forest of

Pakistan (Sheikh, 1993). The dominant forest trees are the Pinus roxburghii Sarg. mixed with Quercus incana Roxb. and Olea ferruginea Royle., Acacia modesta Wall. and Dodonaea viscosa Jacq. at the lower elevation (Barkatullah & Ibrar, 2011).

Malakand Pass Hills fall mostly in the territory of Dargai tehsil. The elevation of these hills varies from 1200 to 1800 m, having sub-tropical vegetation (Zabihullah et al., 2006). From these mountains, 169 species of plants were reported, among which Poaceae was the dominant family represented by 16 species (Barkatullah &

Ibrar, 2011). Mountains of Kot valley are also located in Dargai tehsil, with shrubby vegetation of thorny subtropical type with abundance of Acacia modesta Wall. and

Dodonaea viscosa Jacq. (Zabihullah et al., 2006).

Most part of Hazar Nao hills are included in Batkhela tehsil. These mountains have high elevation (2727 m), with thick forest of Quercus leucotrichophora A. Camus and

Pinus roxburghii. About 90 species of vascular plants are reported from Hazar Nao hills. Euphorbiaceae, Moraceae and Poaceae are the most frequently distributed families of these mountains (Murad et al., 2012). Similarly, the Charkotli Hills of

Batkhela region are dominated with plants of Acacia modesta, Berberis lyceum, Butea monosperma (L.) Taub., Calotropis procera (Ait) R. Br., Justicia adhatoda L., Olea ferruginea Royle, Rubus ulmifolius Schott., Teucrium stocksianum Boiss, and Vitex negunda L. (Barkatullah et al., 2009).

1.2. FUNGI IN PAKISTAN

Fungal diversity of Pakistan was listed by Butler & Bisby (1931) and Mundkur

(1938) when this region was a part of British India. The exploration of fungal diversity of Pakistan was explored in detail by Dr. Sultan Ahmad, from 1939 to

1983. During this era he described more than 2500 species of different groups of fungi viz., Basidomycetes of Pakistan (1972), Fungi of West Pakistan (1956a, 1969),

Gastromyctes of Pakistan (1952), Pezizales of West Pakistan (1955), Uredinales of

West Pakistan (1956b), Ustilaginales of West Pakistan (1956c), and many research articles were published in different journals of international repute.

The Japanese scientists have also made a significant contribution to the rust and smut fungi of Pakistan during their Cryptogamic Expedition of Pakistan (Izumi et al., 1992; Ono, 1992; Ono and Kakishima, 1992; Ono & Kakishima, 1993; Kakishima et al., 1993).

In 1990s, Iqbal and Khalid compiled all the described fungi of Pakistan (Ahmad et al., 1997). Sultana et al. (1997) worked on edible mushrooms. Gardezi (1998) and

Gardezi & Ayub (2003) worked on mushrooms of Azad Jammu & Kashmir. Fifty eight species of mushrooms have been reported by Sultan et al. (2001), Sabir et al.

(2001) Tullos et al. (2001), Burni et al. (2006) and Niazi et al. (2006) from different areas of Pakistan.

So far, approximately 1452 species of Basidiomycota have been reported from different areas of Pakistan. Among these fungi, Agaricomycotina is represented by 867 species (Niazi, 2008; Niazi et al., 2010; Sarwar & Khalid, 2012; Razaq et al.,

2012; Fiaz, 2013, Nawaz et al., 2013; Hanif et al., 2014; Thongklang et al., 2014; Ge et al., 2015; Hussain et al., 2015a, 2015b; Qasim et al., 2015; Sarwar et al., 2015, Hussain et al., 2016). Similarly, the rust fungi are represented by approximately 446 taxa

(Afshan, 2009; Afshan et al., 2011, 2012; Afshan and Khalid, 2013; Ishaq et al., 2013;

Saba et al., 2013; Afshan and Khalid, 2014; Fiaz et al., 2015; Sadiqullah et al., 2014;

Hussain et al., 2015c). The estimated number of rust fungi on grasses mostly in the

Northern Areas and KP province of Pakistan may go up to 750 (Afshan et al., 2007).

As far as the smut fungi are concerned, about 123 species have been reported from

Pakistan (Ahmad et al., 1997; Vánky et al., 2007; Denchev et al., 2012, 2013; Fiaz,

2013; Fiaz et al., 2013). All these attempts to explore the diversity of Basidiomycota seem to be limited to certain specific regions of the country, especially in the KP

Province. However, there is no such report about the exploration of these fungi in

Malakand District, which is explored and presented here for the first time.

1.3. TAXONOMY OF FUNGI

Taxonomy of the Kingdom Fungi is in a state of constant flux, especially due to recent research based on DNA comparisons. The most recent and generally accepted taxonomy of fungi is based on large-scale collaborative research effort of numerous mycologists and scientists working on fungal taxonomy (Hibbett et al.,

2007). According to this system, fungi is classified into one kingdom, one subkingdom, seven phyla, ten subphyla, 35 classes, 12 subclasses, and 129 orders.

The subkingdom Dikarya comprises Basidiomycota and Ascomycota (Kirk et al.,

2008 & Lee et al., 2010). The former includes subphyla Pucciniomycotina (rusts, pathogens specialized in infecting plants), Ustilagomycotina (true smuts and some yeasts, mostly plant pathogens), and Agaricomycotina which includes the vast majority of mushroom forming fungi (Hibbett et al., 2007 & McLaughlin et al.,

2009).

Among different fungal groups, Basidiomycota is the second largest assemblage of described fungi, divided into three subphyla (including six unassigned classes),

16 classes, 52 orders, 177 families, 1,589 genera, and 31,515 species (Kirk et al.,

2008), which is least described from Pakistan. The sub-phylum Agaricomycotina

― mushrooms, bracket fungi and puffballs, is the largest group of Basidiomycota, having more than 20000 describe species (Hibbett et al., 2007). Similarly, the subphylum Pucciniomycotina comprises of more than 8000 species, majority of which

(about 90%) belong to a single order of obligate plant pathogens, the Pucciniales commonly called rust fungi (Aime et al., 2006). The 3rd subphylum is

Ustilaginomycotina, represented by 1640 species (Vánky, 2012), these fungi are commonly called the smut fungi.

1.4. MOLECULAR BIOLOGY OF FUNGI

In the last couple of decades, the molecular tools were developed to describe the diversity of fungi in a more straight-forward, practical and rapid approach as compared to the conventional morphological studies. These tools provide DNA- based information for identifying taxa and facilitate testing of ecological hypotheses, contributing to the better understanding of the structure and functioning of ecosystems. The vast majority of recent studies targeting the description of fungal communities are based on sequence data (Taylor, 2008). In general, these molecular tools target the nuclear ribosomal DNA region. The rDNA of eukaryotes are short repeats including small subunit of ribosomal DNA

(SSU 18S), internal transcribed spacer ITS (ITS1-5.8S-ITS2) and large subunit of ribosomal DNA (LSU 25–28S). Among these, ITS is one of the most sequenced

DNA region in fungi (Peay et al., 2008) and has been recommended as universal fungal barcode (Schoch et al., 2012). It has typically been most useful for molecular systematics at the species level, and even within species to identify geographic races (Peay et al., 2008). Other rDNA regions have been utilized for the phylogenies in Basidiomycota (Binder & Hibbett, 2002; Binder et al., 2005; Larsson et al., 2004;

Lutzoni et al., 2004).

Phylogeny of Basidiomycota relied principally on rDNA analyses, which have contributed considerable insight. Protein coding genes are also used in the

7 phylogenetic studies of this group of fungi (Matheny et al., 2006; Hofstetter et al.,

2007).

1.5. SCOPE AND LIMITATIONS OF THE STUDY

On the basis of these reports, the present research work was conducted to explore the diversity of Basidiomycota in Malakand District by using morphological as well as molecular techniques. In district Malakand, no serious attempt was made in the past to study the diversity of fungi through molecular tools like ITS and LSU of rDNA. This research endeavor was an attempt to enlist rusts, smuts and mushroom forming fungi of Malakand for contributing to the biodiversity of fungi from Pakistan.

1.6. OBJECTIVES OF THE STUDY

1. To collect Basidiomycota from ground, decaying logs and parasites on plants in

Malakand District.

2. To identify and confirm of the fungal taxa using morphological and molecular

techniques.

3. To provide Herbarium Specimens and reference sequences in GenBank as

future reference.

4. To elaborate phylogenetic affinities of different taxa and propose correct names

to the taxa based on molecular study.

Chapter–2

MATERIALS AND METHODS

To achieve the above mentioned objectives of the present study, the following methodologies were adopted.

2.1. SURVEY AND COLLECTION

Survey of the study area and collection of basidiomycetous fungi were carried out in three seasons of the year 2013–2014.

2.1.1 Monsoon rainy season

During and after monsoon rains macrofungi (mushrooms) were collected from different sites of the study area (Figure 1). These fungi were photographed, tagged, dried and were kept in zip-lock bags.

2.1.2 Dry season

In dry season, rusts and smuts were collected along with the host plants during the months of October and November. The infected parts of the plants were photographed, tagged and preserved. Similarly, healthy parts like inflorescence of the infected plants were also collected for correct host identification.

2.1.3 Spring season

During the months of March and April, pathogenic fungi like rusts and smuts of grasses and cereals and other macrofungi were collected, photographed, tagged and preserved.

2.2. MORPHOLOGICAL CHARACTERIZATION OF SPECIES

In morphological features, color of the basidiocarps, size of the pileus and stipe, presence or absence of annulus and its orientation were basic parameters. Field notes of the macrofungi in term of these properties supplemented with more careful examination of spores in the laboratory were carried out. Sections of lamellae of basidiocarps was prepared in 5% KOH, 1% Congo red and lactic acid, and observed under the light microscope equipped with camera lucida. Size dimensions were determined for at least 20 measurements of basidia, cystidia, from each basidioma (Razaq et al., 2012). In case of basidiospores, 50 spores were measured at 100x under oil immersion and measurements were rounded to the nearest 0.5 µm. Similarly, in case of rust and smut fungi, spores were mounted in lactophenol or lactic acid on glass slide and kept for 2−3 hours to rehydrate the spores (Afshan et al., 2012; Denchev et al., 2012).

2.3. MOLECULAR CHARACTERIZATION

2.3.1 DNA extraction, PCR and sequencing

DNA was extracted from 5–15 mg of dried herbarium specimens using CTAB method (Porebski et al., 1997) and DNeasy Plant Mini Kit (QIAGEN) according to the manufacturer’s instructions. The primers used in this study are listed in the

Table 1. rDNA region of ITS1-5.8S-ITS2 (ca. 660 bp) and LSU (ca. 800 bp) were amplified along-with protein coding genes rpb2 gene (ca. 800 bp) and tef-1α gene

(ca. 500 bp) using the primer combinations ITS1F/ITS4; LROR/LR5; gRPB2-

6F/gRPB2-7R and EF1-983R/EF1-1567F, respectively (Vellinga et al., 2011; Ge et

10 al., 2014, 2015). 25 µL volume PCR reactions were performed, containing 2.5 µL

10X Econo Taq Buffer, 0.5 µL dNTPs, 1.25 µL of each primer (10 µM/µL), 0.125 µL of Econo Taq® DNA Polymerase, 14.375 µL H2O and 5 µL of DNA template.

Amplification protocols and PCR conditions were the same as described in Ge et al. (2014), except that annealing temperatures were optimized for each gene region:

54 ºC for ITS, 52 ºC for nrLSU, and 60 ºC for rpb2 and tef-1α. PCR products were purified using the QIAquick PCR Purification kit (QIAGEN, Valencia, CA, USA).

Sequencing was performed with the same PCR primers using the Big Dye

Sequencing Kit v.3.1 on an ABI-3730-XL DNA Analyzer (Applied Biosystems,

Foster City, CA, USA). Sequences produced for this study have been deposited in

GenBank.

Table 1. Primers used in this study Primer Region/gene Sequence 5’ to 3’ Reference

ITS1-F (forward) ITS region CTTGGTCATTTAGAGGAAGTAA Gardes and Bruns, 1993 ITS4 (reverse) ITS region TCCTCCGCTTATTGATATGC White et al., 1990

LR0R (forward) LSU region ACCCGCTGAACTTAAGC Vilgalys and Hester, 1990 LR5 (reverse) LSU region TCCTGAGGGAAACTTCG Vilgalys and Hester, 1990 gRPB2-6R (forward) RNA Polymerase II TGGGGKWTGGTYTGYCCTGC Liu et al., 1999 subunit 2 (rpb2) gRPB2-7F (reverse) RNA Polymerase II ATGGGKAAGCARGCWATGGG Liu et al., 1999 subunit 2 (rpb2)

EF1-983F (forward) Translation elongation GCYCCYGGHCAYCGTGAYTTYAT Rehner, 2001 factor 1α, EF-1α (tef-1α)

EF1-1567R (reverse) Translation elongation ACHGTRCCRATACCACCRATCTT Rehner, 2001 factor 1α, EF-1α ((tef-1α)

2.3.2 Phylogenetic analyses

DNA sequences were aligned in BioEdit 7.2.5 (Hall, 1999) and CLUSTAL X 2.1

(Larkin et al., 2007). Ambiguous positions and regions were excluded from the matrix. Gaps were treated as missing data. Phylogenetic analyses were performed by three methods, Maximum parsimony (MP), Maximum likelihood (ML) and

Bayesian posterior probabilities (PP). Maximum parsimony (MP) analyses were performed in PAUP4.0b10 (Swofford, 2004) with a heuristic search of 1000 replicates with random stepwise addition using tree-bisection-reconnection (TBR) branch swapping and starting from trees obtained by the stepwise addition of sequences.

Maximum likelihood tree generation was performed using MEGA6 (Tamura et al.,

2013) and with RAxML-HPC v.8 on XSEDE implemented on the CIPRES Science

Gateway v. 3.3 (Miller et al., 2010). Rapid bootstrap analysis/search for best- scoring ML tree (-f a) was configured. For the bootstrapping phase GTRGAMMA model was selected. One thousand rapid bootstrap replicates were run. A bootstrap proportion greater than 70% was considered as significant.

Bayesian analyses were done with a Markov chain Monte Carlo (MCMC) coalescent approach implemented in BEAST 1.6.2 (Drummond & Rambaut, 2007).

A Bayesian skyline coalescent tree prior was used in all simulations, and the starting tree was randomly generated. Four independent runs were undertaken.

Chain length was 10 million generations, with a sampling frequency of 1000.

TRACER 1.5 (Rambaut & Drummond, 2009) was used to check the effective

13 sample size (ESS), and burnin values were adjusted to achieve an overall ESS of ≥

200. Consensus trees (0% burnin value) were generated using TREEANNOTATOR

1.6.2 (Drummond & Rambaut, 2007). Posterior probabilities greater than 0.95% were considered significant.

For tree visualization, FigTree 1.4.2 (Rambaut, 2012) was used and tree annotating was done through Adobe Illustrator CS6.

2.4. DIVERSITY

Species diversity of basidiomycetous fungi was measured by using Simpson's

Diversity Index: D=∑n(n-1)/N(N-1). Where n is the number of individuals of a species and N is the total number of individuals of all the species. The value of D ranges between 0 and 1. With this index, 1 represents infinite diversity and 0 with no diversity (Simpson, 1949).

Chapter–3

RESULTS

In present research work, 51 taxa belonging to 17 families of Basidiomycota are studied and presented in the following order. Order: Agaricales 1. Agaricaceae: 1. Agaricus bisporiticus 2. A. campestris 3. A. malakadensis nom. prov. 4. A. minorus nom. prov. 5. Hymenagaricus pakistaniensis nom. prov. 6. Leucoagaricus badius nom. prov. 7. La. sultanii nom. prov. 8. Leucocoprinus birnbaumii 9. Lycoperdon dermoxanthum 10. Tulostoma ahmadii 2. Bolbitaceae 11. Conocybe papillata 3. Hygrophoraceae 12. Cantharocybe pakistanicus nom. prov. 4. Lyophyllaceae 13. Termitomyces umkowaan 5. Omphalotaceae 14. Marasmiellus palmivorus 15. Omphalotus nidiformis 6. Pleurotaceae 16. Pleurotus cystidiosus 7. Pluteaceae 17. Volvariella bombycina 8. Psathyrellaceae 18. Coprinellus curtus 19. Co. disseminatus 20. Co. micaceus 21. Co. radians

22. Coprinopsis hispidus nom. prov. 23. Parasola auricoma 24. Pa. lentiformis nom. prov. 25. Pa. lilatintcta 26. Pa. malakandensis nom. prov. 27. Pa. schroeteri 28. Psathyrella candolleana 29. Ps. fusiformis nom. prov. 9. Strophariaceae 30. Agrocybe pediades 31. Ag. semiorbicularis 32. Stropharia ambigua Order: Geastrales 10. Geastraceae 33. Geastrum velutinum Order: Hymenochaetales 11. Hymenochaetaceae 34. Phellinus badius Order: Polyporales 12. Miripelaceae Meruliaceae 35. Irpex lacteus 13. Miripelaceae 36. Rigidoporus vinctus 14. Polyporaceae 37. Earliella scabrosa 38. Trametes cubensis 39. Trametes lactinea Order: Pucciniales

15. Phragmidiaceae 40. Phragmidium papillatum 41. Ph. rubi-idaei 16. Pucciniaceae 42. Puccinia aestivalis 43. P. conclusa 16

44. P. duthiei 45. P. microspora 46. P. nakanishikii 47. P. striiformis 48. P. violae 49. P. melanocephala 50. Uromyces lespedezae-procumbentis Order: Urocystidales

17. Urocystidaceae 51. Urocystis avenastri

3.1. Agaricus bisporiticus Nawaz, Callac, Thongklang & Khalid. Mycologia 106:

1224 (2014) (Figure 2 & Figure 3)

Pileus 30–50 × 4–5 mm, convex to hemispheric, with slightly obtuse disc, light gray with grayish yellowish brown (10YR 4/2–10YR 5/2) to dark grayish yellow brown

(10YR 2/2–10YR 3/2) center, slightly fibrillose, smooth at periphery; margin deflexed then uplifted. Lamellae free, crowded, dark brown. Stipe 30–50 × 3–7 mm, equal, smooth with uplifted single membrane edge annulus.

Basidiospores 5–6.1 × 2–4 µm, ellipsoid to broadly ellipsoid, light pink, smooth.

Basidia 13–18 × 5.4–9 µm, cylindrical to clavate, 2– and 4– spored, hyaline.

Cheilocystidia 14–21 × 8–11 µm, broadly clavate, hyaline. Pleurocystidia absent.

Pileipellis alternatively hyaline with dark grayish hyphae, highly septate, branched, hyaline hyphae 12–14 µm diam, darker 6–9 µm.

Habitat: Saprotrophic.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Dargai, Malakand,

510 m asl, in sandy soil under Acacia modesta Wall., 07. 08. 2014, S. Hussain

(LAH-SH-169); 20. 08. 2014, S. Hussain (SZMC-SH-169); 02. 10. 2014, S.

Hussain (SH-220).

Comments: Agaricus bisporiticus has been described simultaneously from Pakistan and Thailand (Thongklang et al., 2014). For the first time this species is reported from Malakand, Khyber Pakhtunkhwa, Pakistan.

3.2. Agaricus campestris L. Sp. pl. 2: 1173 (1753)

(Figure 2 & Figure 3)

Pileus 20−35 × 10−15 mm, initially broadly paraboloid later becoming hemispherical, surface smooth or fibrillose, fibrils light pink (2.5R 9/4−5R 9/4) to pale pink (2.5R 9/2−5R 9/2); margin slightly wavy, non-striate, incurved, smooth.

Lamellae free, close, regular with wavy edge, moderate pink (2.5R 7/4−5R 7/4) to dark pink (2.5R 6/6−5R 6/6). Stipe 25−40 × 10−15 mm, central, cylindrical or tapered toward the base, smooth with slightly fibrillose, light pink (2.5R 9/4−5R

9/4) to pale yellowish pink (2.5YR 9/2−7.5YR 9/2), annulus thin, cortina.

Basidiopsores (7.4)9–11(13) × (5)5.7–6(7) µm, [avl × avw = 9.7 x 5.9 µm, Q = 1.4–

1.9, avQ = 1.6], cylindrical to ellipsoidal or elliptical, dark brown with rudimentary germ pore. Basidia 16−22 × 4−7 µm, clavate, hyaline, bisporic. Cheilocystidia

13−19 × 5−8 µm, broadly clavate, hyaline, abundant at gills edge. Pleurocystidia absent. Pileipellis with highly branched hyphae, 10−14 µm diameter.

Habitat: Saprotrophic.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

510 m asl, in sandy soil under Acacia modesta, 07. 03. 2014, S. Hussain (LAH-

SH-101).

Comments: Basidiomata of (LAH-SH-101) collected during early spring of 2014, show similarities with Agaricus campestris on BLAST search. Anatomically, the spores of collection (LAH-SH-101) were found with a rudimentary germ pore which is a unique character. Similarly, spore size is much larger in the present

19 collection (LAH-SH-101) as compared to Agaricus campestris (McKnight &

McKnight, 1981). Using maximum likelihood analysis, the ITS sequences of collection (LAH-SH-101) sorted in the Agaricus clade with 95% bootstrap support.

Figure 2. Basidiomata of Agaricus bisporiticus and A. campestris. A–C: Agaricus bisporiticus, D–E: Agaricus campestris. Scale bars: A–C = 30 mm, D–E = 25 mm.

Figure 3. Anatomical features of Agaricus bisporiticus and A. campestris. A. bisporiticus (A–D): A. Basidiospores, B. Basidia, C. Cheilocystidia, D. Pileipellis. Agaricus campestris (E–G): E. Basidiospores, F. Basidia, C. Cheilocystidia. Scale bars: A = 7 µm, B–C = 15 µm, D = 12 µm, E = 7 µm, F = 15 µm, G = 6 µm.

3.3. Agaricus malakandensis nom. prov.

(Figure 4 & Figure 5)

Holotype: PAKISTAN. KHYBER PAKHTUNKHWA: Malakand, Dargai,

470 m, 02. 08. 2014, S. Hussain (Holotype LAH-SH-166)

Etymology: The specific epithet “malakandensis” refers to the region

Malakand, from where this species was collected.

Pileus 20–30 mm in diam., convex to hemispheric, with slightly umbonate disc, surface scaly, scales moderate pink (2.5R 7/4 – 5R 7/4) to dark pink (2.5R 6/6 – 5R

6/6), concentrated at the center with light cream to pale pink background; sulcate striate margins. Lamellae free, crowded, light pink (2.5R 9/4 – 5R 9/4). Stipe 30–

45 × 7–10 mm, cylindrical or tapered toward the apex, smooth or fibrillose, light yellowish pink (2.5YR 9/4–5YR 9/4) at the base, annulus double edged, membranous, ascendant.

Basidiosporers (4.5)5.5–5.7(6.5) × (3.1)3.7–4.0(4.5) µm, [avl × avw = 5.6 × 3.8 µm, Q

= 1.3–1.7; avQ = 1.5], cylindrical to ellipsoid or ovoid to globose, dark brown.

Basidia 12–18 × 5–7 µm, clavate to cylindrical, 2– or 4–spored. Cheilocystidia 40–

48 × 6–9 µm, clavate, hyaline. Pileipellis septate hyphae, hyaline, rarely branched without clamp, with cylindrical terminal cells, 5–12 µm diameter. Stipe with cylindrical, septate, unbranched hyphae, 7–11 µm diameter.

Habitat: Saprotrophic. Solitary to scattered on nutrient rich loamy soil. It is

so far only known from lowlands of northern Pakistan.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

490 m asl, in loamy soil under deciduous trees, 08. 14. 2014, S. Hussain (SH-

275); Punjab, University of the Punjab, New Campus, Lahore, 14. 09. 2014,

S. Hussain (SH-221).

Comments: Agaricus malakandensis nom. prov., seems an undescribed species in section Minores. Morpho-anatomical features of basidiomata and its position in phylogenetic tree reveals that this may be a new species in the genus Agaricus.

3.4. Agaricus minorus nom. prov.

(Figure 4 & Figure 5)

Holotype: PAKISTAN. KHYBER PAKHTUNKHWA: Malakand, Qaldara,

490 m, 02. 08. 2013, S. Hussain (Holotype LAH-SH-7)

Etymology: The specific epithet “minorus” refers to the section Minores of

genus Agaricus from which this species belongs.

Pileus 25−30 mm diam., initially broadly parabolic later on broadly convex, surface fibrillose, fibrils very deep red at young stage (2.5R 1/8) then light to moderate pink (2.5R 9/4−2.5R 7/4), at the pileal center dark pink (10RP 6/6); margin smooth; lamellae free, crowded, light yellowish pink (10R 9/4−7.5R 9/6) with even edge. Stipe 20–30 × 2–5 mm, equal to cylindrical, smooth to fibrillose, fibrils white to light pink; annulus white, single edged, descending, membranous.

Basidiospores (5.3)6–6.6(7.4) × (3)4–4.4(5.3) µm, [avl × avw= 6.4 x 4.2 µm, Q= 1.3–

1.7; avQ= 1.5], ellipsoid to cylindrical to ovoid, smooth, thick-walled, brown.

Basidia 12−16 × 4−6 µm, cylindrical to clavate, smooth and hyaline, 2– or 4–spored.

Cheilocystidia 10−14 × 4−5 µm, broadly clavate, smooth and hyaline.

Pleurocystidia absent. Pileipellis hyphae hyaline to brown, 4−6 µm diameter.

Habitat: Saprotrophic. Solitary to scattered on nutrient rich loamy soil. It is

so far only known from lowlands of northern Pakistan.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara

510 m asl, loamy soil under Acacia modesta, 03. 8. 2013, S. Hussain (SH-Ag4,

SH-222); Punjab, University of the Punjab, New Campus, Lahore, 217 m asl,

under broad leaved trees, 04. 09. 2014, S. Hussain (SH-301, SH-302).

Comments: Agaricus minorus seems an undescribed species of Agaricus.

Morphological features and phylogenetic analysis revealed that the new species belongs to section Minores.

Figure 4. Basidiomata of Agaricus malakandensis and A. minorus. A–B: Agaricus malakandensis (Holotype LAH-SH-166), C–E: Agaricus minorus (Holotype LAH-SH- 7). Scale bars. A–B = 20 mm, C–E = 18 mm.

Figure 5. Anatomical features of Agaricus malakandensis and A. minorus. A. malakandensis (A–D): A. Basidiospores, B. Basidia, C. Cheilocystidia, D. Pileipellis. Agaricus minorus (E–H): E. Basidiospores, F. Basidia, G. Cheilocystidia, H. Pileipellis. Scale bars: A = 5 µm, B = 9 µm, C = 22 µm, D = 19 µm, E = 6 µm, F = 10 µm, G = 7 µm, H = 18 µm.

Phylogenetic analyses of Agaricus species (Figure 6)

The ITS dataset consisted of 91 sequences and is 734 bp long. After removal of ambiguously aligned sites, the final ITS dataset has 344 distinctly aligned positions. In the ITS phylogram, different taxa of Agaricus were recovered in three sections i.e., Agaricus, Minores and Xanthodermatei. Three ITS sequences of Agaricus bisporiticus sorted in a well-supported clade with A. xalapensis (HQ322269) and A. romagnesii (FJ478118) in section Xanthodermatei. Species of section Agaricus is

Agaricus campestris (SH-101) recovered with excellent bootstrap support. Taxa included in section Minores are: Agaricus malakandensis nom. prov. that forms clade with A. goossenseai (JF514519). Agaricus minorus nom. prov., sorted in a clade with an undescribed species (JF727871 MATA774).

Figure 6. Phylogenetic tree of Agaricus spp. ITS phylogram of Agaricus taxa based on 91 sequences, bootstrap values above 70% are considered significant, sequences generated for this study are presented with boldface.

3.5. Hymenagaricus pakistaniensis nom. prov.

(Figure 7 & Figure 8)

Holotype: PAKISTAN. KHYBER PAKHTUNKHWA: Malakand, Qaldara,

510 m, 02. 10. 2014, S. Hussain (Holotype LAH-SH-207).

Etymology: The specific epithet “pakistanienis” refers to the country from

where this taxon was collected.

Pileus 15–20 × 2 mm, plane to plano-convex, light orange yellow (7.5YR 9/8–10YR

9/8) to dark orange yellow (7.5YR 6/8–10YR 6/8) initially covered by dark brown to black squamules soon disrupting except at the center where it is retained as one or more large squamules, with small, scattered, blackish squamules toward the margins. Lamellae free, closed, 0 to 3 level of lamelullae, light reddish brown

(2.5YR 5/4–2.5YR 6/4). Stipe 10–15 × 1–2 mm, central, equal, with yellowish brown to deep yellowish brown squamules.

Basidiospores (6.3)7–7.3(8) × (6)6.5–7(7.5) µm, [avl × avw = 7.2 x 6.7 µm; Q =1.1–

1.2, avQ = 1.1], rounded to globose, thin walled, without germ pore. Basidia 11.5–

17.5 × 5.6–8 µm, tetra spored, cylindrical to clavate. Cheilocystidia 12–16 × 6.3–7.7

µm, clavate. Pileipellis globose to circular chain of cells, brownish, 20–47 × 18–44

µm. Stipetipellis irregular trichoderm, with clavate to cylindrical hyphae, 18–26 ×

6–9 µm, thin-walled, light brown, septate, clamp connection absent.

Habitat: Saprotrophic. Scattered on humus rich dry soil under deciduous

trees of Acacia modesta. It is so far only known from lowlands of northern

Pakistan.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

3 Km North-West of Swat-Malakand Highway, under deciduous trees, 22.

10. 2014, S. Hussain (SH-315, SH-389).

Phylogenetic analysis (Figure 9)

The ITS dataset consisted of 35 sequences and is 711 bp long. After the exclusion of ambiguous sites, the final analysis of ITS region consisted of 332 distinctly aligned sites. The optimal ITS tree was found with a log likelihood score of -

4162.513368. In the ITS phylogram, three clades were recovered with excellent bootstrap support. One clade with 89% bootstrap supported, consisted of taxa of

Agaricus, other clade consisted of taxa of Micropsalliota with 100% bootstrap support, and the representative new species Hymenagaricus pakistaniensis nom. prov., recovered in Hymenagaricus clade.

Comments: Hymenagaricus pakistaniensis nom. prov., is characterized morpho- anatomically and molecularly. This analysis revealed that H. pakistaniensis nom. prov., is an undescribed species.

Figure 7. Basidiomata of Hymenagaricus pakistaniensis. A. Sporophores in situ (Holotype LAH-SH-207), B. Pileal squamules, C. Lamellae, D. Pileal and stipe squamules. Scale bar: 30 mm.

Figure 8. Anatomical features of Hymenagaricus pakistaniensis. A. Basidiospores, B. Basidia, C. Stipetipellus, D. Cheilocystidia, E. Pileipellus. Scale bars: A = 14 µm, B = 6 µm, C = 30 µm, D = 6 µm, E = 38 µm.

Figure 9. Phylogenetic tree of Hymenagaricus and allied genera. RAxML tree based on ITS phylogeny of Hymenagaricus and related genera, the new species H. pakistanienis represented in boldface.

3.6. Leucoagaricus badius nom. prov.

(Figure 10 & Figure 11)

Holotype: PAKISTAN. KHYBER PAKHTUNKHWA: Malakand, Qaldara,

490 m, 13. 08. 2014, S. Hussain (Holotype LAH 13082014).

Etymology: The specific epithet “badius” refers to the dark red color of

pileus.

Pileus 20–40 mm diam., at first ovoid to ellipsoid, expanding to applanate to convex, with deflexed margins; moderate red (5R 4/8–5R 4/10) to dark red (5R

3/6–5R 3/8), fibrillose squamules on the white background, squamules usually with reddish tinge, umbo conspicuous, deep reddish (5R 3/10). Lamellae free, crowded, white, 5 mm tall, with 1–2 series of lamellulae, edge finely scalloped.

Stipe 50–70 × 1.5–2.5 mm, subclavate, thickening towards base, white, smooth, hollow; annulus white, membranous, persistent, midway on the stipe. Context white, no color change on handling.

Basidiospores (6)6.5–7.5(8.5) × (3.5)4–5(5.5) µm, [avl × avw = 7.1 × 4.8 µm; Q =

1.35–1.55, avQ = 1.46], amygdaliform to oblong or ovoid to ellipsoid in the side view, ovoid in the face view, slightly thick-walled, hyaline in KOH, without germ pores, smooth, strongly dextrinoid, metachromatic. Basidia 14–17 × 6–8 µm, hyaline, four-spored, rarely two-spored. Cheilocystidia 21–31 × 9–13 µm, hyaline, arranged in clusters, clavate to fusiform. Pleurocystidia not seen. Pileipellis is a cutis, with radially arranged cylindrical hyphae, yellowish, 4–8 µm diameter.

Habitat: Saprotrophic. Solitary to scattered on nutrient-rich loamy soil

under Acacia modesta and A. indica. It is so far only known from lowlands of

northern Pakistan.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Kharkai, Malakand,

450 m, scattered in humus rich soil, 30. 09. 2014, S. Hussain (SH-210),

Malakand, Batkhela, 850 m asl, 03. 10. 2014, S. Hussain (FH-SH210)

Comments: Leucoagaricus badius nom. prov., seems a new species on the basis of morpho-anatomical and phylogenetic study.

3.7. Leucoagaricus sultanii nom. prov.

(Figure 10 & Figure 11)

Holotype: PAKISTAN. KHYBER PAKHTUNKHWA: Malakand, Qaldara,

510 m, 12. 09. 2014, S. Hussain (Holotype LAH 12082014).

Etymology: The specific epithet “sultanii” refers to the great mycologist of

Pakistan, the late Sultan Ahmad.

Pileus 40–60 mm diam, initially broadly ovate to conical, later plane, at maturity depressed with slightly uplifted margin; with moderate yellowish pink (2.5YR 7/4

– 5YR 7/4) to dark yellowish pink (7.5R 6/6) umbo; short, slightly fibrillose to rimose squamules on white background, squamules usually with light yellowish tinge,. Gills free, crowded with 1–3 series of lamellulae, white, with even margin.

Stipe 30–70 × 3–7 mm, smooth, central, equal, white, with double edged uplifted annulus, with bulbous base.

Basidiospores (5)5.5–7(7.5) × (3)3.5–4.5(5) µm, [avl × avw = 6.6 × 4.0 µm; Q = 1.27–

1.57, avQ =1.44], ellipsoid to ovoid in face view, amygdaliform to ellipsoid in side view, smooth, with no germ pore. Basidia 21–27 × 7–10 µm, subcylindrical to clavate, 2– to 4–spored, hyaline. Cheilocystidia 33–41 × 8–11 µm, abundant, fusiform to cylindrical, hyaline with crystals. Pileipellis a cutis with radially arranged hyphae, 3–6 µm wide, hyaline, thin-walled, with acute apex, clamp connections absent.

Habitat: Saprotrophic. Abundant on nutrient-rich loamy soil under

deciduous trees, Acacia modesta and A. indica. So far only known from

lowland northern Pakistan.

Material examined: Pakistan, Khyber Pakhtunkhwa, Kharkai, Malakand,

450 m, scattered in humus rich soil, 30. 08. 2014, S. Hussain (LAH-SH115,

FH-SH115).

Comments: Leucoagaricus sultanii nom. prov., seems an undescribed species on the basis of morpho-anatomical and phylogenetic study.

Figure 10. Basidiomata of Leucoagaricus species. Leucoagaricus badius (A–C): A– B. Holotype of La. badius, D. Holotype of La. sultanii. Scale bars: A–B = 16 mm, C = 30 mm, D = 20 mm.

Figure 11. Anatomical features of Leucoagaricus species. Leucoagaricus badius (A– D): A. Basidiospores, B. Cheilocystidia, C. Basidia, D. Pileipellis; La. sultanii (E–H): E. Basidiospores, F. Basidia, G. Cheilocystidia, H. Pileipellis. Scale bars: A= 12 µm, B= 23 µm, C= 11 µm, D= 21 µm, E= 8 µm, F= 17 µm, G= 20, H= 11 µm.

Phylogenetic analyses of the secies of Leucoagaricus

(Figure 12 & Figure 13)

The ITS dataset consisted of 89 sequences of 889 nucleotides in length. After exclusion of ambiguous sites, the final analysis of the ITS region consisted of 620 bp. The optimal maximum likelihood tree was found with a log likelihood score of -11792.300875. In the ITS phylogram, the new taxa were recovered in a well- supported clade with maximum likelihood bootstrap, maximum parsimony bootstrap and Bayesian posterior probabilities of MLB 89%, MPB 81%, BPP 1 respectively. This clade, consisting of species with both white and colored basidiomata, is formed by members of Leucoagaricus sect. Rubrotincti (typified by

La. rubrotinctus (Peck) Singer) with colored pilei and subgenus Sericeomyces

(typified by La. serenus (Fr.) Bon & Boiffard) that typically has a white basidiomata.

The new species with colored pilei, La. sultanii nom. prov., forms a well-supported clade with La. asiaticus Qasim, Nawaz & Khalid, La. subcrystallifer Z.W. Ge & Zhu

L. Yang, La. crystallifer Vellinga, La. subvolvatus (Malençon & Bertault) Bon and La. menieri (Sacc.) Singer. Leucoagaricus badius nom. prov., was recovered with excellent bootstrap support together with an undescribed Leucoagaricus sp. from

India (GenBank accession KR154966).

The combine ITS, nrLSU, rpb2 and tef-1α dataset included of 57 sequences and 4114 bp long. The final analysis of the four gene loci consisted of 2262 distinctly aligned sites after the exclusion of ambiguous positions. The analysis resulted in an optimal ML tree with log score -33058.711364. The new taxa are nested within a

42 strongly supported clade (MLB 94%; MPB 85%; BPP 1) with other members of La. sect. Rubrotincti and subgen. Sericeomyces. Species within this strongly supported clade share some morphological characters, such as, the cutis-like pileipellis and shape of the spores and the cystidia. The pileus coverings of these species are composed of subcylindrical, smooth, repent, rarely differentiated hyphae, more often radially arranged; ovoid to amygdaliform basidiospores, that are more or less constricted near the apex and lacking a germ pore.

Figure 12. Phylogenetic tree based on ITS dataset of Leucoagaricus spp. Maximum likelihood phylogeny of Leucoagaricus based on nrITS sequences, bootstrap support values above branches are the maximum likelihood bootstrap (MLB), maximum parsimony bootstrap (MPB) in boldface, and Bayesian posterior probabilities (BPP). The new species in boldface, represented by (•), nested in a well-supported clade. 44

Figure 13. Phylogenetic tree based four genes region (ITS, nrLSU, rpb2 and tef- 1a) of Leucoagaricus spp. Maximum likelihood (ML) phylogeny, bootstrap support values are presented in order MLB, MPB (based on 1000 bootstrap replicates, respectively) and Bayesian posterior probabilities (BPP) greater than 0.95, the new species represented by (•).

3.8. Leucocoprinus birnbaumii (Corda) Singer, Sydowia 15(1-6): 67 (1962)

(Figure 14)

Pileus 20−30 × 25 mm, initially broadly parabolic then convex to broadly convex with umbonate disc, first deep brown later on brilliant yellow, slightly plicate surface, almost smooth having fine warts at the center; lamellae free, crowded, concolorous to pileus with even edge. Stipe 20−50 × 5−14 mm, central, equal with bulbous base, double edged partial veil of brilliant yellow color, almost smooth.

Basidiospores 7.5−12 × 6−9 µm, strongly ellipsoid to broadly ellipsoid, smooth with 1−2 greenish oil droplets. Basidia 40−50 × 9−13 µm, clavate, almost hyaline with some oil droplets. Cheilocystidia 30−35 × 10−15 µm, broadly clavate, hyaline.

Pleurocystidia absent.

Habitat: Saprotrophic.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Jaban, 460

m asl, sandy soil, under the trees of Acacia indica and A. modesta, 09. 8. 2013,

S. Hussain (SH-9).

Phylogenetic analysis Leucocoprinus birnbaumii (Figure 15)

The targeted ITS region gave fragments of 700 base pair length on amplification in polymerase chain reaction using ITS primers (ITS1F and ITS4). Initial blast analysis of the amplified product has a query cover of 100% and 97% similarity with

Leucocoprinus birnbaumii (GenBank accession #AY534115). Similar sequences were retrieved from GenBank database along with Coprinus comatus (AY635772) as outgroup for phylogenetic analysis. ITS dataset consists of 31 sequences, was

46 aligned with MUSCL 3.8 (Edger, 2004), following by manual editing in BioEdite

(Hall, 1999). The final alignment was consisted of 768 characters, including 248 conserved sites, 409 variable, 207 parsimony informative, and 275 uninformative.

In ML phylogeny, the sequence clustered with Leucocoprinus birnbaumii

(AY534115) at 88% bootstrap support, which showed that our specimen is

Leucocoprinus birnbaumii.

Comments: Leucocoprinus birnbaumii has been reported from different sites of

Punjab and Khyber Pakhtunkhwa, Pakistan (Ahmad et al., 1997). In this study this taxon is characterized phylogenetically from Pakistan.

Figure 14. Morpho-anatomical features of Leucocoprinus birnbaumii. A. Basidiospores, B. Basidia, C. Cheilocystidia, D–E. Basidiomata. Scale bars: A = 10 µm, B = 20 µm, C = 15 µm, D–E = 23 mm.

Figure 15. Phylogenetic tree of Leucocoprinus spp. ML tree of Leucocoprinus taxa including 31 ITS sequences, Pakistani Leucocoprinus taxa are represented in boldface.

3.9. Lycoperdon dermoxanthum Vittad., Monogr. Lycoperd.: 178 (1843)

(Figure 16)

Gasterocarp 15−25 × 20 mm, globose, initially white later on strong yellowish brown, attached to the substratum by a thin, white mycelial cord. The exoperidium thin, white with small scales or low warts, thin walled, septate hyphae; endoperidium light brown, gleba cottony, light brown, eucapillitium Lycoperdon type, 5−7 µm diameter (1−1.5 µm wall thickness), rarely dichotomously branched, nonsepetate, elastic with porous wall. Basidiospores 3.4–4.7 µm diameter, globose, rounded to almond shape, slightly asperulate, central, with single greenish droplet; pedicel of 2–4.2 µm.

Habitat: Saprotrophic. Scattered in grassland.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

510 m asl, sandy soil with grasses., 03. 8. 2013, S. Hussain (SH-35);

Malakand, Batkhela, 870 m asl, 15. 08. 2014, S. Hussain (SHL-38).

Phylogenetic analysis of Lycoperdon dermoxanthum (Figure 17)

Initial blast analysis of the amplified product has a query cover of 100% and 95% identity with Lycoperdon pusillum (GenBank accession # AB067724). The ITS dataset consisted of 32 sequences and 713 bp long, with Agaricus wariatodes

(JX984556) as outgroup. The final ITS alignment after the exclusion of ambiguous sites consisted of 521 distinctly aligned region. The ITS phylogram with optimized maximum likelihood score -2300.489397. Maximum likelihood (ML) was analysed with RAxML implemented on the CIPRES Science Gateway v. 3.3 (Miller et al.,

2010) and Maximum parsimony (MP) analysis using PAUP4.0b10 (Swofford,

2004). Three clades were recovered in the analyses where the representative species Lycoperdon dermoxanthum (SH-35, SHL-38) falls in clade I.

Comments: Lycoperdon dermoxanthum has previously been reported from Punjab,

Pakistan (Ahmad et al., 1997). It is a new record for Malakand.

Figure 16. Morpho-anatomical features of Lycoperdon dermoxanthum. A−C. Gasterocarp, D,F. Basidiopores, E,G. Eucapillitia. Scale bars: A–C = 10 mm, D–E = 2µm, F–G = 5µm.

Figure 17. Phylogenetic tree of Lycoperdon spp. Maximum likelihood phylogeny of Lycoperdon based on 32 ITS sequences, bootstrap values above branches are shown in order: maximum parsimony (MP) in boldface and maximum likelihood (ML) with 1000 bootstrap replicates.

3.10. Tulostoma ahmadii Hussain and Khalid, Turk. J. Bot. 40: 220 (2016)

(Figure 18 & Figure 19)

Holotype: PAKISTAN. KHYBER PAKHTUNKHWA: Malakand, Qaldara

Dargai, gregarious, on sandy soil and dead wood, 510 m a.s.l., 31. 08. 2013,

S. Hussain (Holotype LAH-SH-33).

Mycobank: MB811201

Etymology: Named after pioneer Pakistani mycologist late Sultan Ahmad.

Spore sac 8−15 mm high × 15−20 mm in diam., globose to sub-globose. Peridium double. Exoperidium membranous to warty, warts light olive brown (2.5Y 5/2 −

2.5Y 5/2). Endoperidium papery, pinkish, opens by an apical mouth at maturity;

Mouth circular, tubular, surrounded with white mass of hyphae. Socket conspicuous, with several dentate concentrically organized membranes of different lengths; the external one hanging from the endoperidium and the longest ones are embracing the stem. Stipe 30−40 × 3−8 mm, cylindrical, slightly tapering towards spore case, hollow, squamose-ugose, scaly; Scales striated, thick, strong reddish brown (10R 3/8 − 10R 3/10) to deep reddish brown (10R 1/10 − 10R 2/6), sloughs off at several points, from base upwards, base of the stipe bulbous with thin, white rhizoids. Mature fruiting bodies arise in the form of bunch from the underground woody flat mycelial base. Gleba orange (5YR 6/12 − 5YR 7/12).

Basidia rare, 2-spored, ellipsoid to clavate, 23 × 9 µm. Eucapillitium light green, undulate, rarely branched, septate, thick walled, 6−9 µm in diam., wall thickness

2−3 µm. Basidiosores (6)7.5−9.4(10.3) × (4)6.3−8.2(9.4) µm (avX = 9.36 × 7.99 µm),

Q = 1.11−1.36, avQ = 1.17, globose to sub-globose, brown in 5% KOH, with small apiculus, ornamented, in the form of thin and wide, solitary and appressed spines.

Exoperidium with two sub-layers; outer layer composed of sub globose to elongated hyphal cells; 7−10 × 2−4 µm, irregularly arranged; inner layer present below the warts, composed of thin, straight, septate hyphae, 3−5 µm.

Endoperidium composed of smooth, long, septate, highly branched hyphae, 3−5

µm, wall thickness 1−2 µm. Socket membranes composed of cylindrical hyphae,

3−4.5 µm. Stipe composed of thin walled, hyaline, straight and septate hyphae, 4−6

µm. The basal bulb hyphae up to 1−2 µm.

Habitat: Saprotrophic. Scattered under deciduous trees in humus rich

sandy soil near Justicia adhatoda L. along with Convolvulus sp.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

510 m asl, sandy soil and dead wood, 10. 08. 2013, S. Hussain and A. N.

Khalid (SHP-33); 03. 03. 2014 (SH-34); 20. 09. 2014 (SZMC-SH-33).

Phylogenetic analysis of Tulostoma ahmadii (Figure 20)

The ITS1 region comprising of 613 bp of two specimens of Tulostoma ahmadii was sequenced. Similar sequences from blast search were retrieved from GenBank for phylogenetic study. ITS dataset consisted of 16 nucleotides along the Lycoperdon perlatum consider as outgroup. Phylogeny was analysed by maximum likelihood bootstrap method through MEGA v6. The final dataset consists of 646 characters including conserved sites 381, variable 247, parsimony informative 142 and singleton 107 respectively. Other sequences along with the out group were

55 retrieved from GenBank. Maximum Likelihood method based on Jukes-Cantor model was used for phylogenetic analysis. ML heuristic method of Tree Inference was based Nearest-Neighbor-Interchange (NNI). The tree with the highest log likelihood (-3681.5903) is shown. Bootstrap value below 50% was not shown in analysis. In the phylogenetic analysis two clades were made based on shape and ornamentation of the basidiospores. In clade I all the species have globose to subglobose spores with verruculose ornamentation. Tulostoma ahmadii was distinctly clustered in clade I due to globose to subglobes basidiospores with verrucolose ornamentation. Species with reticulate ornamentation placed in clade

II.

Figure 18. Basidiomata and basidiospores of Tulostoma ahmadii: AB,E–G. Different views of mature basidiomata (Holotype SH-33), C–D. Tubular mouth, H–I. Attachment of Spore-sac to stipe through socket. J–L. Spores. Scale bars: A–B,F = 18 mm, C–E = 7 mm, G = 13.5 mm, H–I = 26 mm, J–L = 6 µm.

Figure 19. Morpho-anatomical features of Tulostoma ahmadii. A. Basidiomata, B. Endoperidial hyphae, C. Exoperidium warts cells, D. Basidiospores, E. Capillitium, F. Exoperidium membrane, G. Socket hyphae, H. Stipe hyphae. Scale bars: A = 20 mm, B = 0.12 µm, C = 0.36 µm, D = 0.25 µm, E = 0.11 µm, F = 0.12 µm, G–H = 0.16 µm.

Tulostoma ahmadii SH33

Tulostoma ahmadii SH33N

Tulostoma_squamosum_DQ415732

Tulostoma_domingueziae_HQ667593

Tulostoma_domingueziae_HQ667594 Clade I

Tulostoma_melanocyclum_EU784435

Tulostoma_melanocyclum_EU784436

Tulostoma_sp_HQ667595

Tulostoma_sp_HQ667596

Tulostoma_kotlabae_DQ112629

Tulostoma_xerophilum_HQ667592

Tulostoma_niveum_EU784437 Clade II Tulostoma_brumale_EU784433

Tulostoma_brumale_EU784434

Tulostoma_beccarianum_AF097752

Lycoperdon_perlatum_AY264919

Figure 20. Phylogenetic tree of Tulostama spp. ML tree of based on 16 ITS sequences of Tulostoma and related taxa, the new species Tulostoma ahmadii, is represented by (■).

3.11. Conocybe papillata Hauskn. & L. Nagy, Öst. Z. Pilzk. 16: 150 (2007)

(Figure 21 & Figure 22)

Pileus 15–25 × 4–6 mm, broadly conical to hemispheric, light yellow (2.5Y 9/6 –

5Y 9/6) to moderate yellow (2.5Y 7/6 – 5Y 7/6), smooth; with slightly papillate center, moderate orange yellow (7.5YR 7/8 – 10YR 7/8) to dark orange yellow

(7.5YR 6/8 – 10YR 6/8); dentate margins. Lamellae free, slightly crowded, with 1–

4 series of lamellulae, ventricose, light yellow, with even edge. Stipe 40 – 60 × 2–3 mm, equal smooth, central, light yellow.

Basidiospores 11–13.5 × 6.5–8.5 µm, ellipsoidal, broadly ellipsoidal to ovoid, bright yellow, smooth, with central germ pore 1.4–2 µm, wall thickness upto 1 µm.

Basidia 21–27 × 7.5–10 µm, broadly clavate to subcylindrical, almost hyaline with oil content. Cheilocystidia 23–25 × 10–12 µm, lecythiform, with capitulum 2–2.5

µm wide. Pileipellis hymeniform with fusiform pileocystidia, 23–28 × 11–15 µm, along with slender elements 37–54 × 2–4 µm. Stipitipellis consists of lecythiform caulocysidia, 15–22 × 6–10 µm, with 2–3 µm wide capitula. Veil dark orange, slightly branched, irregular, 6–9 µm diameter.

Habitat: Saprotrophic.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Dargai,

490 m asl, on humus rich soil under broad leaved trees, 15. 08. 2014, S.

Hussain (SHP-1, SHP-16).

Phylogenetic analysis of Conocybe papillata (Figure 23)

Two ITS sequences were developed for phylogenetic study. Blast search match

99% with Conocybe papillata (GenBank # JX968216). ITS dataset consisted of 40 sequences was aligned through MUSCLE 3.8 (Edgar, 2004). The alignment has 682 characters including 329 conserved sites, 337 variable, 237 parsimony informative and 98 were singleton, respectively.

In phylogenetic analysis Conocybe papillata (SHP-1, SHP-16) of Pakistan fall in the papillate clade with Hungarian collections (GenBank # JX968216). Anatomically both collections (SHP-1, SHP-16) of the present study are similar to C. papillata.

Comments: Concybe papillata was described for the first time in Hungary

(Hausknecht & Nagy, 2007). This mushroom is a new record for Asia.

Figure 21. Basidiomata of Conocybe papillata. Bar: 15 mm.

Figure 22. Anatomical features of Conocybe papillata. A. Basidiospors, B. Basidia, C. Cheilocystidia, D. Pileipellis elements, E. Veil, F. Caulocystidia. Scale bars: A = 11 µm, B = 17 µm, C–D = 13 µm, E = 45 µm, F= 14 µm.

Conocybe_crispa_AY194544 Conocybe_crispa_AY194524 Conocybe_crispa_AY194525 Conocybe_crispella_JX968208 Conocybe_apala_JX968209 Conocybe_lactea_AY213997 Conocybe_zeylanica_JX968207 Conocybe_crispa_AY194532 Conocybe_lactea_AY194546 Conocybe_subcrispa_AY194549 Conocybe_sp_AY194529 Conocybe_romagnesii_JX968206 Conocybe_sp_AY194547 Conocybe_volvata_JX968205 Conocybe_vaginata_JX968204 Conocybe_bulbifera_JF907824 Gastrocybe_lateritia_AY194554 Conocybe_deliquescens_JX968210 Conocybe_sp_AY194553 Gastrocybe_lateritia_AY194555 Gastrocybe_lateritia_AY194552 Gastrocybe_lateritia_AY194551 Gastrocybe_lateritia_AY194550 Conocybe_anthracophila_JX968212 Conocybe_zuccherellii_JX968213 Conocybe_inocybeoides_JX968202 Conocybe_bispora_JX968203 Conocybe_karinae_JX968151 Conocybe_intrusa_JX968211 Conocybe_dumetorum_JX968201 Conocybe_mandshurica_JQ247197 Conocybe_dumetorum_JF907834 Conocybe_antipus_JX968215 Conocybe_alboradicans_JX968219 Conocybe_alboradicans_JX968220 Conocybe_cettoiana_JX968218 Conocybe_papillata_JX968216 SH_P16_ITS4 SH_P1_Consensus Conocybe_fiorii_JX968217

Figure 23. Phylogenetic tree of Conocybe spp. ML phylogeny of Conocybe, based 40 ITS sequences, Pakistani collections are represented by (■).

3.12. Cantharocybe pakistanicus nom. prov. (Figure 24 & Figure 25)

Holotype: Pakistan, Khyber Pakhtunkhwa: Malakand, Dargai, 470 m asl,

under deciduous trees, 22. 08. 2013, S. Hussain (Holotype LAH-SH-1).

Etymology: The specific epithet “pakistanicus” refers to the country from

where this species was collected.

Pileus 60–100 × 5–10 mm, initially broadly parabolic to covex later on broadly convex to hemispheric, smooth to slighly cracked, grayish yellow brown (10YR

4/2 – 10YR 5/2) to dark grayish yellow brown (10YR 2/2 – 10YR 3/2), with translucent straite margin. Gills decurrent, moderately crowded, light yellow (2.5Y

9/6 – 5Y 9/6) with serrate edge. Stipe 60–80 × 8–12 mm, equal, central, slightly verrocuse, moderate yellow (2.5Y 7/6 – 5Y 7/6) to pale yellow (2.5Y 9/4 – 5Y 9/4), with no annulus.

Basidiospores 9–12 × 5−7 µm, strongly ellipsoid, rarely obovoid to ovoid, dextrinoid. Basidia 36–42 × 10–13 µm, cylindrical, 2– to 4–spored. Cheilocystidia

42–49 × 11–14 µm, lecythiform or fusiform, with long capitula 10–17 × 2 µm.

Pleurocystidia 34–40 × 9–13 µm, cylindrical to clavate, abundent. Pileipellis branched and clamped hyphae; with ventricose to clavate terminal cells, light yellow, 23–39 × 10–13 µm, with thin capitula 3.5–6 µm.

Habitat: Seems mycorrhizal. Scattered under Acaia modesta and A. indica

trees.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

505 m asl, under broad leaved trees, 29. 08. 2014, S. Hussain (SH-2);

Malakand, Agra, 02. 09. 2014, S. Hussain (SH-2a).

Phylogenetic analysis of Cantharocybe pakistanicus nom. prov. (Figure 26)

On BLAST search of LSU of rDNA shows 90% similarity with Cantharocybe sp.,

(KF303143, India). The LSU dataset consisted of 48 sequences of different members of Hygrophoraceae. After the exclusion ambiguously aligned sites, the final LSU dataset consisted of 996 bp. Phylogeny was analyzed through maximum likelihood with RAxML (Science Gateway v. 3.3, Miller et al., 2010). All the members of genus Cantharocybe were recovered in a single clade with 64% bootstrap support.

Comments: On the basis of presence of decurrent gills, this taxon (SH-1) belongs to Hygrophoraceae. It is revealed from anatomical and phylogenetic study that

Cantharocybe pakistanicus nom. prov., is a close relative of C. virosa.

Figure 24. Basidiomata of Cantharocybe pakistanicus. A–B. Holotype, C–F. Sporophores in situ. Bar: 70 mm.

Figure 25. Anatomical features of Cantharocybe pakistanicus. A. Basidiospores, B. Basidia, C. Cheilocystidia, D. Pileipellis, E. Pleurocystidia. Scale bars: A = 8.5 µm, B = 14 µm, C–D = 18 µm.

Figure 26. Phylogenetic tree of Hygrophoraceae. RaxML tree based on 48 LSU sequences of Hygrophoraceae, where Cantharocybe pakistanicus with boldface, falls in Cantharocybe clade.

3.13. Termitomyces umkowaan (Cooke & Massee) D.A. Reid, Contr. Bolus Herb. 7:

118 (1975) (Figure 27)

Pileus 50−130 × 3–8 mm diameter, initially campanulate to ovate, later on shallowly depressed and become stare shaped, in some cases convex, with cuspidate, papillate and umbonate disc modification, smooth silky to fibrillose, shiny and moderately moist; straight or flaring to recurred or appendiculate margin; thin but fleshy texture with pleasant odor, pale greenish yellow (7.5Y 9/4

− 10Y 9/6) to pale brown (2.5Y 9/4 − 5Y 9/4) color. Lamellae 40−50 mm free and approximate to adnexed, closed to crowded with wavy edges, remain unchanged with light yellow green (5GY 9/4) to bright yellowish pink (2.5GY 9/6) later on yellowish brown color. Stipe 40−90 × 7−15 mm, central, solid, equal shape, smooth with hairy bulbous base, grayish yellow to white (7.5Y 7/4 − 10Y 7/4); pseudorrhizae upto 100 mm long.

Basidiospores 5.9−8.8 × 3.3−5.0 µm, ovoid, broadly ellipsoid to ellipsoid, smooth and hyaline, amyloid with greenish tinge. Basidia 18−24 × 6.6−9 µm, smooth and hyaline with clavate to cylindrical shape having sharp sterigmata of 2.3−6 µm.

Pleurocystidia 22−27 × 6.6−8.5 µm clavate to elongated. Cheilocystidia not found.

Habitat: Saprotrophic.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Qaldara Dargai, 513

m asl, sandy soil and Acacia indica, A. modesta, 03. 8. 2013, S. Hussain (SH-

39); Malakand, Pirano, near Swat-Malakand Highway 1068 m asl, sandy

soil, 12. 9. 2013, S. Hussain (SH-5).

Phylogenetic analysis of Termitomyces umkowaan (Figure 28)

On PCR amplification, the ITS1 region of Termitomyces umkowaan gave fragments of 635 base pair, using ITS primers (ITS1F and ITS4). Sequences from GenBank database with Agaricus wariatodes (GenBank # JX984556) as outgroup were retrieved for alignment and phylogenetic analysis. Maximum Likelihood method based Tamura 3-parameter model with initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood

(MCL) approach, and then selecting the topology with superior log likelihood (-

1755.1380) value. Bootstrap values based on 1000 replicates, with below 50% values are not shown in the final tree. The analysis involved 23 nucleotide sequences with a total of 547 positions in the final dataset. All the Termitomyces taxa clustered in five clades with strong supported bootstrap values represented.

Phylogenetic analysis revealed that T. umkowaan of Pakistan clustered in a separate clade (III) with 100 BS value.

Comments: Termitomyces umkowaan is a new record for Pakistan.

Figure 27. Morpho-anatomical features of Termitomyces umkowaan. A–B. Basidiomata, C. Basidioma with pseudorrhizae, D. Basidiospores, E. Basidia, F. Pleurocystidia. Scale bar: AB = 100 mm, C = 60 mm, D = 6 µm, E–F = 14 µm.

Figure 28. Phylogenetic tree of Termitomyces spp. ML phylogeny based on 23 sequences of ITS, Termitomyces umkowaan is shown by (■), recoverd with 100 bootstrap support.

3.14. Marasmiellus palmivorus (Sharples) Desjardin. (Figure 29 & Figure 30)

Pileus 20–30 × 2–4 mm, infundebuleform, slightly rugose, pale yellowish pink

(2.5YR 9/2 – 7.5YR 9/2), with rolled margin. Lamellae adnate, crisped, pale yellowish pink. Stipe 10–15 × 1 mm, central, tapper towards the base, smooth, pale yellowish pink.

Basidiospores 6–9 × 4–5 µm, ellipsoid to obovoid, hyaline, inamyloid, smooth.

Basidia 17–25 × 7–10 µm, cylindrical to clavate, hyaline. Cheilocystidia 15–21 × 6–

11 µm, clavate wih rouded apex having small tenticles, hyaline. Pleurocystidia

250–450 × 20–27 µm, cylindrical, subclavate, hyaline with clamp.

Habitat: Pathogenic.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

510 m asl, on the stem of Saccharum officinarum L., 30. 07. 2014, S. Hussain

(SH-113, SZMC-SH-113)

Phylogenetic analysis of Marasmiellus palmivorus (Figure 31)

The consensus ITS sequence after editing in BioEdit v7.1 comprises of 644 bp. On

BLAST search, the sequence (SH-113) matches 99% identity and 100% query cover with Marasmiellus palmivorus (GenBank # JQ653442). Maximum likelihood method was used for phylogenetic analysis through MEGA v6 (Tamura et al., 2013). The final ITS dataset contain 769 characters including 474 were conserved sites, 274 variable, 188 parsimony informative and 83 singleton respectively. Marasmiellus palmivorus (SH-113) falls in Marasmiellus clade with 64% bootstrap support.

Comments: Marasmiellus palmivorus is a new record for Pakistan, reported on the stem of Saccharum officinarum. It is a pathogenic mushroom (Pong et al., 2012)

Figure 29. Sporophores of Marasmiellus palmivorus on Saccharum officinarum. Scale bar: 10 mm.

Figure 30. Anatomical features of Marasmiellus palmivorus. A. Basidiospores, B. Basidia, C. Cheilocystidia, D. Pleurocystidia. Scale bar: 5 µm.

Marasmiellus palmivorus JQ653441 Marasmiellus palmivorus JQ653438 Marasmiellus palmivorus JQ653442 Marasmiellus palmivorus JQ653437 Marasmiellus palmivorus JQ653430 Marasmiellus sp JQ586345 Marasmiellus sp JQ586344 Marasmiellus sp JQ586347 Marasmiellus sp JQ586346 Marasmiellus sp JQ586343 Marasmiellus palmivorus JQ653432 Marasmiellus palmivorus JQ653434 Marasmiellus palmivorus JQ653435 Marasmiellus Hemimycena sp GQ452780 Marasmiellus palmivorus JQ653436 Marasmiellus palmivorus JQ653433 Marasmiellus palmivorus JQ653429 Crinipellis sp AM055944 Crinipellis sp JN578263 Marasmiellus palmivorus SH 113 Marasmiellus palmivorus JQ653440 Marasmiellus palmivorus JQ653439 Marasmiellus palmivorus JQ653431 Crinipellis sp JN900255 Marasmiellus mesosporus AB517375 Marasmiellus sp KJ545432 Moniliophthora sp FJ167668 Moniliophthora perniciosa GQ9191 Moniliophthora perniciosa GQ9191 Moniliophthora perniciosa GQ9191 Moniliophthora perniciosa GQ9191 Crinipellis aff iopus FJ167637 Crinipellis aff iopus FJ167639 Crinipellis aff iopus FJ167638 Crinipellis aff iopus FJ167636 Crinipellis roreri var roreri AY Moniliophthora Moniliophthora roreri JX515291 Moniliophthora roreri JX515288 Moniliophthora roreri JX515290 Moniliophthora roreri JX515287 Moniliophthora roreri JX315284 Moniliophthora roreri JX315282 Moniliophthora roreri JX315281 Crinipellis mauretanica JF907968 Chaetocalathus magnus FJ167666 Chaetocalathus craterellus FJ167 Chaetocalathus Chaetocalathus galeatus FJ167663

Figure 31. Phylogenetic tree of Marasmiellus and allied genera. ML phylogeny based on 47 ITS sequences of Marasmiellus and allied taxa, Pakistani collection of M. palmivorus is represented by (■).

3.15. Omphalotus nidiformis (Berk.) O.K. Mill., Mycol. helv. 6(2): 93 (1994).

(Figure 32)

Pileus 40−60 mm, first convex later on broadly convex with moderate indented disc; margin incurved at first, expanding and becoming wavy, upturned in age; surface smooth, moist and brownish orange (2.5YR 5/8 − 5YR 5/8) to strong brown (5YR 4/8 − 5YR 4/10); lamellae arcuate, 20−30 mm length, crowded and crisped with wavy edge, concolorous with pileus, later on dark brown. Stipe 30−50

× 7−10 mm size, slightly eccentric, equal in shape with bulbous base, solid, smooth and dry, dark below the gills and brownish orange at the base (2.5YR 5/8 − 5YR

5/8) with no veil.

Basidiospores 4.5−5.8 × 3.3−4.8 µm, [avl × avw = 5.02 × 4.1 ×, Q = 1.27−1.42, avQ

= 1.22], globose to sub-globose, smooth, hyaline and thin-walled, non-amyloid.

Basidia 25−35 × 4−6 µm, thin-walled, 2−spored, sometimes 4−spored; sterigmata up to 4 µm long; basal clamps sometimes present. Cheilocystidia 20−33 × 4−8 µm, cylindrical to clavate, smooth, hyaline and thin walled. Pleurocystidia 27−45 × 5−8

µm, sub-cylindrical to subglobose with greenish droplets.

Habitat: Saprotrophic. Solitary.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

520 m asl, sandy loamy soil under deciduous trees, 03. 08. 2013, S. Hussain

(SH-16).

Phylogenetic analysis of Omphalotus nidiformis (Figure 33)

Blast results reveal that the specimen (SH-16) matches with 93% identity and 100% query with Omphalotus olivascens (GenBank # AY313281). ITS dataset consisted of

31 sequences was alignment in MUSCLE v3.8 (Edger, 2004), along with Coprinus comatus (GenBank # AY635772). The final dataset consists of 1201 characters having 303 conserved sites, 268 variable, 67 parsimony informative and 197 singleton, respectively. The tree with highest log likelihood (-2953.9120) is shown.

Comments: Omphalotus nidiformis has previously been reported from Pakistan

(Ahmad et al., 1997). But, it is a new record for Khyber Pakhtunkhwa.

Figure 32. Morpho-anotmical features of Omphalotus nidiformis. A–B. Basidioma, C. Basidiospores, D. Basidia, E. Cheilocystiadia, F. Pleurocystidia. Scale bars: A,B = 10 mm, C = 2.5 µm, D = 12 µm, E = 10 µm, F = 14 µm.

Omphalotus olearius DQ494681 Omphalotus olearius AY313277 Omphalotus olearius AY313278 Olearius Omphalotus olearius AY313276 Omphalotus olearius AF525052 Omphalotus olearius AF525051 Omphalotus japonicus AY313286 Omphalotus japonicus AF525067 Omphalotus japonicus AF525068 Japonicus Omphalotus japonicus AY534113 Omphalotus japonicus AB301601 Omphalotus subilludens AY313285 Omphalotus cf subilludens AY3132 Subilludens Omphalotus subilludens AY313283 Omphalotus subilludens AY313282 Omphalotus olivascens AY313281 Omphalotus olivascens AY313280 Omphalotus olivascens var olivas Olivascens Omphalotus olivascens AY313279 Omphalotus olivascens var olivas Omphalotus mexicanus AY313274 Omphalotus mexicanus AF525062 Omphalotus illudens AY313273 Mexicanus/Illudens Omphalotus illudens AY313272 Omphalotus illudens AY313271 Omphalotus nidiformis AY313275 Omphalotus nidiformis AF525072 Nidiformis Omphalotus nidiformis AF525071 Omphalotus nidiformis AF525070 Omphalotus sp SH16 Pak Omphalotus sp Coprinus comatus AY635772

Figure 33. Phylogenetic tree of Omphalotus spp. Phylogeny based on 31 sequences of ITS region of Omphalotus species.

3.16. Pleurotus cystidiosus O.K. Mill. Mycologia 61:889 (1969) (Figure 34)

Pileus 100−130 × 63−80 mm, convex in young stage then depressed, parabolic modification of pileus disc, surface scaly, dry velvety in touch, smooth and slightly lobed margins, with grayish yellow pink context (2.5YR 7/2 − 10R 7/2), scales moderate reddish brown (7.5R 3/4 − 2.5YR 4/4). Lamellae decurrent, 40−80 mm in length, closed, with marginate edge, moderate reddish brown (7.5R 3/4 − 2.5YR

4/4) face brilliant yellow (2.5Y 9/10 − 5Y 9/), thin and remain unchanged on drying. Stipe eccentric, 37−50 × 24−35 mm, equal and flattened, smooth, slightly curved at the base, grayish brown (7.5YR 3/2 − 7.5YR 4/2), dry velvety, solid, with no veil and the bulbous base.

Basidiospores 7−14 × 3−6 µm, [avl × avw = 11 × 5 µm, Q = 1.35–1.85, avQ = 2.2], cylindrical to ellipsoidal, thin-walled, hyaline, smooth and inamyloid. Basidia

24−35 × 4−6 µm, cylindrical to clavate, thin walled, hyaline, 2− or 4−spored, with sharp and thin sterigmata of 1.5−2 µm. Chielocystidia 24−40 × 3−6 µm, frequent, pyriform to cylindrical, thin walled; pleurocystidia 26−42 × 6−9 µm, thin-walled, hyaline, sub-fusiform to sub-globose. Stipe hyphae 6−10 µm diameter, septate, thin-walled, hyaline with frequent clamp.

Habitat: Wood decaying. Solitary.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Hazar

Nao Hills Agra, 1245 m asl, on trunk of Morus alba L., 05. 8. 2013, S. Hussain

(SH-22); Malakand, Qaldara, 14. 08. 2013, S. Hussain (SH-26).

Phylogenetic analysis of Pleurotus cystidiosus (Figure 35)

Maximum Likelihood method, based on Tamura 3-parameter model was used for phylogenetic tree construction. ML heuristic method of Tree Inference was based on Nearest-Neighbor-Interchange (NNI). The tree with the highest log likelihood

(-2276.6537) is shown. There were a total of 741 positions in the final dataset.

Bootstrap value below 50% was not shown in the tree. In phylogenetic tree, five clades were formed of all Pleurotus taxa. All P. cystidiosus s.s species including the

Pakistani collections are monophyletic and morphologically homogenous and clustered together with very strong MLBS value of 99%. Pleurotus fuscosquamulosus having distinct cystidia was separated in another clade with 99% BS. The remaining taxa that are easily distinguished macroscopically like color, shape and size of basidioma (Isikhuemhen et al., 2000; Segedin et al., 1995) were distributed in three different clades each with highest BS values (P. smithii, P. australis and P. tuberregium each 100%). Agaricus bisporus (GenBank # EF460355) was considered as an out group for phylogenetic tree construction.

Comments: Pleurotus cystidiosus is a new record of edible mushrooms for Pakistan.

Figure 34. Morpho-anatomical features of Pleurotus cystidiosus. A–B. Basidiomata on Morus alba, C. Pleurocystidia, D. Basidioma, E. Basidiospores, F. Basidia, G. Chielocystidia, H. Stipe Hyphae. Scale bars: A,B,D = 12 mm, C = 6.3 µm, E = 9 µm, F = 10 µm, G = 8 µm, H = 11 µm.

Figure 35. Phylogenetic tree of Pleurotus spp. Phylogeny based on 24 sequences of ITS region of Pleurotus taxa, where the Pakistani collections are shown by (■).

3.17. Volvariella bombycina (Schaeff.) Singer, Lilloa 22: 401 (1951)

(Figure 36 & Figure 37)

Pileus 40–60 × 15–25 mm, convex to hemispheric, with silky hair, pale yellowish pink (2.5YR 9/2 – 7.5R 9/2) with fibrillose margins. Lamellae free, crowded, light yellowish pink (2.5YR 9/4 – 5YR 9/4), with slightly wavy edge. Stipe 40–70 × 7–

10 mm, tapper at the apex, central, smooth, pale white, with tough volva, 30–40 mm hight.

Basidiospores 6.5–8.5 × 5.0–6.0 µm, ellipsoidal to ovoid, light greenish in 5% KOH.

Basidia 24–30 × 7–10 µm, cylindrical to clavate, with oil droplets. Cheilocystidia

47–66 × 14–19 µm, fusiform to ventricose, broader at the middle, thinner at the apices. Pleurocystidia 62–123 × 15–23 µm, clavate, hyaline, rare.

Habitat: Wood decaying.

Materials examined: Pakhistan, Khyber Pakhtunkhwa, Malakand, Palai, 540 m asl, on log of Populus alba L., 23. 08. 2014, S. Hussain (SH–202).

Phylogenetic analysis of Volvariella bombycina (Figure 38)

The ITS dataset included of 25 sequences and the alignment is 829 bp long. The final ITS analysis after the exclusion of ambigous positions consisted of 480 distinctly aligned sites. Two clades were recovered in the analysis. Vovariella bombycina falls in clade II.

Comments: Volariella bombycina has been reported from different parts of Pakistan

(Ahmad et al., 1997). This species is a new record for Malakand, KP.

Figure 36. Basidiomata of Volvariala bombycina. Scale bar: 20 mm.

Figure 37. Anatomical features of Volvariala bombycina. A. Basidiospores, B. Basidia, C. Pleurocystidia, D. Cheilocystidia, E. Veil elements. Scale bars: A–D = 10 µm, E = 5 µm.

Figure 38. Phylogenetic tree of Volvariella spp. RAxML tree of Volvariella species based on ITS sequences, Pakistani taxa are represented with red bold fonts in clade II.

3.18. Coprinellus curtus (Kalchbr.) Vilgalys, Hopple & Jacq. Johnson Taxon 50(1):

233 (2001) (Figure 39 & Figure 40)

Pileus 15–20 × 5–8 mm, convex to plane, smooth, deeply plicate and furred, light grayish pink (2.5R 7/2 – 5R 7/2) to pale pink (2.5R 9/2 – 5R 9/2); with slightly obtuse center of moderately orange yellow color; margin sulcate striate. Lamellae free, attached to pseudocollarium, distant, concolorous to pileus with dark black edge. Stipe 40–60 × 2–3 mm, equal, translucent, fragile.

Basidiospores 10.5–12.5 × 8.0–9.0 µm, slightly pyriform to ellipsoid with truncate base, dark brown to almost black, germ pore eccentric 1.3–2 µm, wall thickness up to 1.5 µm. Basidia 22–24 × 9–12 µm, clavate, 2– or 4–spored, hyaline in 5% KOH.

Cheilocystidia 22–30 ×19–28 µm, rounded to globose, and hyaline. Pileocystidia

78–94 × 10–12 µm, lageniform, cylindrical, with rounded apex, elongated rod shape neck with rounded enlarged base, hyaline in 5% KOH. Veil elements rounded cells in chain, thick walled, dark brown, terminal cell 17–23 × 12–15 µm.

Habitat: Saprotrophic.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Salgaro,

480 m asl, scattered under herbaceous plants, 27. 07. 2014, S. Hussain (SHP-

10).

Comments: Coprinellus curtus is new record for Pakistan and addition to the coprinoid mushrooms of the country.

Figure 39. Anatomical features of Coprinellus curtus. A. Basidiospores, B. Basidia, C. Pileostidia, D. Cheilocystidia, E. Veil cells, F. Caulocystidia. Scale bars: A = 13 µm, B = 18 µm, C = 15 µm, D = 18 µm, E = 13 µm, F = 24 µm.

3.19. Coprinellus disseminatus (Pers.) J.E. Lange Dansk bot. Ark. 9: 93 (1938)

(Figure 40 & Figure 41)

Pileus 15−20 × 20 mm, oval at first then broadly convex, almost white with grayish center, slightly plicate surface with plicate straight margin; lamellae free, distant, concolourous with pileus. Stipe 20−40 × 4 mm, equal, central, smooth, curved with white color and hollow.

Basidiospores 7.5−9.0 × 5.0−6.5 µm, ellipsoid, smooth with central germ pore and brown in 5% KOH. Basidia 26−30 × 7−9.5 µm, clavate to cylindrical 2 or 4−spored, hyaline. Cheilocystidia 7−9 × 11−15 µm, abundant, globose or broadly ellipsoid.

Pleurocystidia absent. Pileocystidia moderately numerous, lageniform with blunt neck and slightly abtuse apex, hyaline and smooth, 118−165 × 23−28 µm.

Habitat: Saprotrophic.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

490 m asl, in clusters on broad leaved trees, 09. 8. 2013, S. Hussain (SH-15);

Malakand, Tahna, 25. 08. 2014, S. Hussain (SH-321; SHW-3).

Comments: Coprinellus disseminatus has been reported from different regions of

Pakistan (Ahmad et al., 1997). This is the first molecular report of this fungus from the country.

3.20. Coprinellus micaceus (Bull.) Vilgalys, Hopple & Jacq. Johnson, Taxon 50: 234

(2001) (Figure 40 & Figure 41)

Pileus 20–35 × 10–20 mm, convex to hemispheric, slightly shagy with flate disc, light grayish red (2.5R6/2 – 5R6/2) to dark grayish red (2.5R3/2 – 5R3/2) with grayish reddish orange center (2.5YR5/6 – 10R5/6); margin sulcate striate and uplefting. Lamellae free, crowded, dark black, dilquescence at maturity. Stipe 70–

100 × 3–7 mm, equal, smooth, milky white.

Basidiospores 8–11 × 5–6 µm, triangular to elliptical, smooth, germ pore central, upto 2 µm wide. Basidia 19–29 × 7–10 µm, cylindrical to subclavte, hyaline.

Cheilocystidia 36–47 × 35–45 µm, globose to subglobose, hyaline, abudent.

Pleurocystidia absent. Veil elements cylindrical to fusiform, branched hyphae, 5.5–

15 µm diameter.

Habitat: Saprotrophic..

Materials examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Dargai,

470 m asl, found in bunch at the log of Morus nigra, 28. 08. 2014, S. Hussain

(SH-144); Malakand, Agra, 05. 08. 2013, S. Hussain (SH-144b).

Comments: Coprinellus micaceus is a new record for KP province of Pakistan.

3.21. Coprinellus radians (Desm.) Vilgalys, Hopple & Jacq. Johnson Taxon 50: 234

(2001) (Figure 40 & Figure 41)

Pileus 10−20 × 15 mm, initially broadly parabolic then convex to hemispheric, universal veil in the form of densely squamose scales, grayish red (5R 5/6) to dark grayish red (5R 3/2) with white context.

Basidiospores 8.5−12 × 6.5−9.5 µm, ellipsoid, smooth, brown in 5% KOH, eccentric germ pore, 1.2 µm. Basidia 20−32 × 7−10 µm, clavate, hyaline, rare. Cheilocystidia

30−62 × 12−19 µm, elongated to cylindrical. Pleurocystidia absent.

Habitat: Saprophytic.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Sakhakot, 430 m asl, on log of Ailanthus altissima (Mill.) Swingle, 13. 8. 2013, S. Hussain (SH-23).

Phylogenetic analysis of Coprinellus species (Figure 42)

The ITS dataset consisted of 55 sequences, representing the three sections of

Coprinellus; Domestici, Micacei and Setulosi. Bayesian analysis was done with Beast v 1.8.2 (Drummond & Rambaut, 2007). Bayesian posterior probabilities (BPP) greater than 0.80% were considered significant. Pakistani collections of Coprinellus are represented by bold fonts.

Figure 40. Basidiomata of Coprinellus taxa. A–B. Coprinellus curtus, C. Coprinellus disseminatus, D. Coprinellus radians, E. Coprinellus micaceus. Scale bar: 10 mm.

Figure 41. Anatomical features of Coprinellus taxa. Coprinellus disseminatus (A– B): A. Basidiospore, B. Basidia; Co. micaceus (C–F): C. Basidiospores, D. Veil cells, E. Pileocystidia, F. Basidia; Co. dissemimatus (G–I): G. Basidiospores, H. Basidia, I. Cheilocystidia. Scale bar= 10 µm.

Figure 42. Phylogenetic tree of Coprinellus species. Bayesian analysis of Coprinellus species with Beast, taxa studied in this study are represented with boldface, posterior probabilities above 0.80% are considered significant.

3.22. Coprinopsis hispidus nom. prov. (Figure 43 & Figure 44)

Holotype: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara, 479 m asl,

7. 08. 2014, S. Hussain (Holotype LAH-SH-114).

Etymology: The specific epithet ‘hispidus’ refers to the shaggy and blistery

pileus.

Pileus 30–50 × 2–4 mm, initially conical to parabolic, later on convex and finally plan to uplifted, deeply plicate, shaggy, grayish pink (2.5R 7/2 – 5R 7/2) to pale pink (2.5R 9/2 – 5R 9/2); with moderate red (5R 4/8 – 5R 4/10) to dark red (2.5R

3/4 – 5R 3/4) center; with inverted rolled margin. Lamellae free, crowded, dark black at maturity, finally losing turgor and collapsing. Stipe 60–90 × 4–8 mm, equal, milky white, smooth with fine hairs.

Basidiospores (8.6)9.5–11.5(12) × (5.7)6.0–7.0(7.5) × (4.2)5.5–6.5(8) µm, [avl × avb × avw = 10.3 × 6.4 × 6.1 µm; Q = 1.5–1.7; avQ = 1.6], in face view oblong to ellipsoid, in side view slightly phaseoliform to ellipsoid, dark brown, smooth, germ pore central, 1–1.4 µm wide. Basidia 20–24 × 7.5–9.5 µm, clavate to cylindrical, 4–spored, with some oil contents. Cheilocystidia 50–65 × 23–30 µm, ellipsoidal to rounded to subglobose, hyaline and abundant. Pleurocystidia 71–81 × 18–31 µm, subclavate, narrow at the apex with broader base, hyaline in 5% KOH. Pileocystidia 49–60 ×

11–17 µm, fusiform to ellipsoid, with elongated neck and broader base. Veil elements highly septate, rarely branched hyphae, hyaline with terminal cells pale greenish, 4–7 µm diameter. Stipe covering septate hyphae with clamped at the terminal cells, 9–12 µm diameter.

Habitat: Saprotrophic. Scattered under deciduous trees, so far only known

from the lowland of northern Pakistan.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

479 m asl, on leaf litter Acacia modesta, 29. 08. 2014, S. Hussain (SH-289).

Phylogenetic analysis of Coprinopsis hispidus (Figure 45)

The ITS dataset included of 36 sequences and the resulted alignment is 656 bp long.

After the exclusion of ambiguous sites, the final ITS analysis consisted of 244 distinctly aligned region. The analysis resulted with the final optimized ML tree with log likelihood score -3387.466518. Species of Coprinopsis have been divided in to five sections on the basis of veil structure on pileus (Schafer, 2010). In RAxML maximum likelihood tree, species of Coprinopsis was recovered in two clades with excellent MLB support. Clade I consisted of taxa of Coprinopsis section Alachuani

(Sing.) D.J. Schaf. Species in this section have veil cells in the form of filament, which are branched or sometimes diverticulate. Species in clade II, consisted of

Coprinopsis section Lanatuli (Fr.) D.J. Schaf., where the veil elements are filamentous and unbranched (Schafer 2010). The representative new species

Coprinopsis hispidus nom. prov. belongs to section Lanatuli on the basis of filamentous, unbranched veil and medium size basidiomata.

Comments: On the basis of veil structure, Coprinopsis hispidus nom. prov. belongs to section Lanatuli. Morphology and anatomy of the basidiomata along with sequence analysis of ITS region shows that the specimen (LAH-SH-114) may be an undescribed species in genus Coprinopsis.

100

Figure 43. Basidiomata and basidiospores of Coprinopsis hispidus. A. Basidiomata of the holotype (LAH-SH-114), B. Pileus with hairs, C. Young basidiomata, D–E. Basidiospores. Scale bars: A = 31 mm, B–C= 20 mm, D = 8 µm, E= 11 µm.

101

Figure 44. Anatomical features of Coprinopsis hispidus. A. Basidiospores, B. Pleurocystidia, C. Basidia, D. Cheilocystidia, E. Pileocystidia, F. Veil elements, G. Stipe covering. Scale bars: A = 7 µm, B = 19 µm, C = 12 µm, D = 27 µm, E = 20 µm, F = 2 µm, G = 16 µm.

102

Figure 45. Phylogenetic tree of Coprinopsis spp. RaxML tree of Coprinopsis taxa based on ITS sequences, the new species falls in clade II, represented by blue fonts, bootstrap values above 70% are considered significant.

103

3.23. Parasola auricoma (Pat.) Redhead, Vilgalys & Hopple, Taxon 50: 235 (2001)

(Figure 46 & Figure 47)

Pileus 15–30 × 5–10 mm, convex to broadly convex, deeply plicate, light grayish reddish brown (2.5YR 5/2) to grayish reddish brown (2.5YR 3/2); center dark reddish orange (7.5R 4/8) to grayish reddish orange (2.5YR 5/6), indistinctly hairy. Lamellae free and remote, closed, initially concolorous with pileus, later on dark black, finally losing turgor and collapsing. Stipe 40–65 × 2–5 mm, equal, smooth, central, hollow.

Basidiospores (10.6)12.5–13.5(14.8) × (8.2)8.5–9.5(10.0) × (7.3)8.0–9.0(9.7) µm, [avl

× avb × avw = 12.9 × 9.0 × 8.5 µm; Q1 = 1.5–1.6, Q2 = 1.3–1.4, avQ = 1.5], in face view subcylindrical to ellipsoid or ovoid, in side view ellipsoidal to elliptical, strong reddish brown to blackish in 5% KOH, smooth, germ pore central and 2–

2.5 µm wide, with wall thickness 1.5 µm. Basidia 30–38 × 7–11 µm, clavate to subcylindrical, 2– or 4–spored. Cheliocystidia 33–45 × 12–25 µm, subclavate to subglobose, abundant. Pleuocystidia 30–40 × 11–15 µm, cylindrical to clavate, pale brown at the base, rare. Sclerocystidia 90–170 × 4–7 µm, dark brown, with acute apex and bulbous base, wall thickness 1.4–2 µm.

Habitat: Saprotrophic.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Kharkai,

460 m asl, scattered in grassland under herbaceous plants, 10. 08. 2014, S.

Hussain (SHP-11, SHP-7, SHP-6); Malakand, Agra, 05. 08. 2013, S. Hussain

(SHP-6a, SHP-7a).

104

Comments: The collections (SHP-11, SHP-7, SHP-6) are closer to Parasola auricoma on morpho-anatomical features. However, phylogeny based ITS regions of rDNA revealed that this taxon maybe an undescribed species of Parasola section Auricomi.

We studied Farlow Herbarium material of P. auricoma (FH 1942), in which the spores are ellipsoid to cylindrical. In our collections of P. auricoma, spores are cylindrical to ellipsoid and ovoid to elliptical.

105

3.24. Parasola lentiformis nom. prov. (Figure 46 & Figure 47)

Holotype: PAKISTAN. KHYBER PAKHTUNKHWA: Malakand, Qaldara,

480 m asl, scattered under herbaceous plants, 15. 08. 2014, S. Hussain

(Holotype LAH-SH-P5).

Etymology: Species epithet ‘lentiformis’ refers to the lentiform shape of

basidiospores of this species.

Pileus 20–30 × 0.3–0.6 mm, initially subglobose, later on convex to hemispheric; at first smooth, the center glabrous at maturity, becoming deeply plicate towards the margin; pale pink (2.5R 9/2 – 5R 9/2) to grayish pink (2.5R 7/2 – 5R 7/2); disc depressed, deep pink (5R 6/8) pileal disc separated by light pink (2.5R 9/4) circular band from the rest of the pileus. Lamellae free, fairly crowded, separated from the stipe by pseudocollarium, 0–2 lamellulae, regular, initially concolorous with pileus, dark brown at maturity, finally losing turgor and collapsing. Stipe 30–

60 × 2–3 mm, central, equal, smooth, slightly sub-bulbous at the base, hollow, white, fragile, without annulus.

Basidiospores (13.4)15.5–16.5(18.1) × (6.7)10.5–11.5(15.1) × (8.9)9.5–10.5(11.5) µm,

[avl × avb × avw = 15.8 × 10.9 × 10.1 µm; Q1 = 1.3–1.5, Q2 = 1.4–1.6, avQ = 1.4], in face view broadly ovoid to lentiform, in side view ellipsoidal to cylindrical, blackish in 5% KOH, germ pore eccentric and upto 1.5 µm wide. Basidia 28–41 ×

10–13 µm, clavate to cylindrical, 2– and 4–spored, hyaline. Cheilocystidia 25–37 ×

9–12 µm, clavate and hyaline. Pileocystidia 47–60 × 13–16 µm, clavete, light brown toward the base. Pleurocystidia absent.

106

Habitat: Saprotrophic. Scattered under herbaceous plants on grass land. So

far only known from the lowland of northern Pakistan.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

480 m asl, 28. 05. 2015, S. Hussain (SH-P5a).

Comments: We named this taxon Parasola lentiformis on account of its basidiospore shape, which is lentiform or somewhat broadly ovoid. Phylogenetic study based on ITS region of rDNA and morpho-anatomical features of the basidiomata revealed that this taxon maybe an undescribed species in the genus Parasola section

Auricomi.

107

Figure 46. Basidiomata of Parasola auricoma and Pa. lentiformis. A–B. Parasola auricoma, C–D. Holotype of Pa. lentiformis. Scale bars: A–B = 30 mm, C = 15 mm, D = 6 mm.

108

Figure 47. Anatomical features of Parasola auricoma and Pa lentiformis. Parasola auricoma (A–E): A. Basidiospores, B. Cheilocystidia, C. Basidia, D. Pleurocystidia, E. Sclerocystidia; Parasola lentiformis (F–I): F. Basidiospores, G. Basidia, H. Cheilocystidia, I. Pileipellis. Scale bars: A = 9 µm, B = 16 µm, C–D = 26 µm, E = 21 µm, F = 9 µm, G = 19 µm, H = 17 µm, I = 22 µm. 109

3.25. Parasola lilatincta (Bender & Uljé) Redhead, Vilgalys & Hopple, Taxon 50:

2001 (Figure 48)

Pileus 15–20 mm, broadly convex to applanate, deeply plicate and membranous, smooth and velvety, light grayish brown (7.5YR 5/2 – 7.5YR 6/2); center slightly depressed, light orange (7.5R 5/2); sulcate straight margin, lacking any velar structure. Lamellae free, even, distant, initially concoloros to the pileus, later on blackish and finally losing turgor and collapsing. Stipe 40 – 70 × 2 – 4 mm, equal, central and hollow, smooth and snow-white.

Basidiospores (12.4)13.5–15(16.4) × (10)10.5–11(11.7) × (8.1)8.5–9.5(10.2) µm, [avl × avb × avw = 14.4 × 10.8 × 9.2; Q1 = 1.3–1.4, Q2 = 1.3–1.5, avQ = 1.4], in face view lentiform to rounded triangular, in side view ellipsoid; dark brown, germ pore eccentric and 1.5–2.5 µm wide; thick-walled, upto 2 µm, blackish to deep brown.

Basidia 17–23 × 6–9 µm, clavate to cylindrical, 2– or 4–spored, light brown and smooth. Cheilocystidia 25–32 × 6–9 µm, cylindrical, hyaline. Pileipellis 28–34 × 9–

12 µm, clavate, hyaline, smooth with greenish oil droplets. Pleurocystidia absent.

Habitat: Saprotrophic.

Materials examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

510 m asl, scattered under herbaceous plants, 03. 08. 2013, S. Hussain (SH-

4); 10. 08. 2014, S. Hussain (SHP-2, SHP-9).

Comments: Parasola lilatincta is a new record and addition to the coprinoid mushrooms of Pakistan.

110

Figure 48. Basidiomata and anatomical features Parasola lilatincta. A–B. Basidiomata, C–D. Microscopic photographs of basidiospores, E. Pileipellis, F. Drawings of spores, G. Basidia, H. Cheliocystidia, I. Pileipellis elements Scale bars: A = 39 mm, B = 17 mm, C = 13 µm, D = 15 µm, E = 17 µm, F = 8 µm, G = 13.5 µm, H = 20 µm, I = 17 µm.

111

3.26. Parasola malakandensis nom. prov.

(Figure 49 & Figure 50)

Holotype: PAKISTAN. KHYBER PAKHTUNKHWA: Malakand, Qaldara,

479 m asl, on leaf litter of Acacia modesta, 31. 08. 2013, S. Hussain (Holotype

LAH-SHP-13); gene sequences of the holotype KP738713 (ITS), KU599829

(nLSU), KU59983 (tef-1α).

Etymology: The specific epithet ‘malakandensis’ refers to Malakand region

of Pakistan where this species was collected.

Pileus 15–30 × 10–15 mm, initially cylindrical to subglobose, later on convex, in some cases plane to depressed; at first smooth, the center glabrous at maturity, in some specimens remaining smooth, becoming deeply plicate towards the margin; light reddish brown (2.5YR 5/4–10R 5/4) to light grayish reddish brown (2.5YR

5/2 –2.5YR 6/2); disc indistinctly umbonate to umbilicate, grayish reddish orange

(2.5YR 5/6). Lamellae free, separated from the stipe by pseudocollarium, fairly crowded, 0–2 lamellulae, regular, distant with even edge, initially brownish orange but becoming blackish at maturity and finally losing turgor and collapsing.

Stipe 70–95 × 1–2 mm, central, equal, slightly sub-bulbous at the base, smooth, hollow, fragile, almost white and without annulus.

Basidiospores (11.5–)13–18(–19) × (10.5–)12.5–16(–16.5) × (9.5–)10–13(–14) µm

[avX= 17.2 × 13.4 × 11.8 µm, Q1= 1.06–1.14, Q2=1.33–1.38], in face view broadly oblong to subglobose, in side view ellipsoid to oblong, with central germ-pore of

1.4–2.4 µm diameter; wall 1.5 µm, thick, dark brown to blackish. Basidia 24–38 ×

112

12–15 µm, (avl × avw= 31.5 × 13.8 µm), 2– rarely 4–spored, cylindrical to clavate, hyaline, sterigmata 2.1–3.5 µm long. Cheilocystidia 42–68 × 15–20 µm (avl × avw=

55.3 × 17.4 µm), subclavate, to subcylindrical, hyaline and abundant.

Pleurocystidia 25–46 × 14–22 µm (avl × avw= 40.4 × 16.4 µm), lageniform, utriform or subcylindrical, smooth, hyaline and rare. Pileipellis hymeniform, consists of clavate cells 20–28 × 4–7 µm, light brown at the base, along with thick-walled, dark brown sclerocystidia of 70–165 × 5–10 µm. Stipe with cylindrical, septate, unbranched, hyaline hyphae, 3–5 µm diameter.

Habitat: Saprotrophic. Scattered under herbaceous plants.

Materials Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

scattered on humus rich soil, 11 August 2014, S. Hussain (FH-SH-P15); 14

August 2014, S. Hussain (HUP-SH-P14); 20 August 2014, S. Hussain (HUP-

SH 17502); 29 August 2014, S. Hussain (SZMC-SHP-13); Punjab, University

of the Punjab, Lahore, scattered on grassland, 9 September 2014, A.N.

Khalid and S. Hussain (LAH-SHP-17).

Comments: Parasola malakandensis nom. prov., seems a new species based on anatomical features of basidiomata and phylogenetic analyses based on ITS, nLSU and tef-1α gene regions (Figure 51). The species was distinctly placed in section

Auricomi due to the presence of sclerocystidia on pileus and central germ pore in basidiospores.

113

Figure 49. Basidiomata of Parasola malakandensis. A= Holotype (LAH-SHP-13). Scale bar = 30 mm

114

Figure 50. Morpho-anatomical features of Parasola malakandensis. A. Basidiospores, B. Basidia, C. Pleurocystidia, D. Cheilocystidia, E. Pileipellis, F. Stipe hyphae, G. Sclerocystidia, H. basidiomata. Scale bars. A = 16 µm, B = 24 µm, C = 27 µm, D = 28 µm, E = 18 µm, F = 18 µm, G = 53 µm, H = 26 mm.

115

Figure 51. Three gene phylogeny (ITS-LSU-tef-1α) of Parasola malakandensis. Maximum likelihood phylogram of Parasola from the ITS-LSU-tef-1α combine sequence data. Maximum likelihood bootstrap (≥ 60%) and Bayesian posterior probabilities (≥ 0.90) are shown by the nodes. The new species Parasola malakandesnis represented with bold fonts in Auricomi clade.

116

3.27. Parasola schroeteri (P. Karst.) Redhead, Vilgalys & Hopple, Taxon 50(1): 236

(2001) (Figure 52)

Pileus 15–20 × 5–10 mm, hemispheric to pulvinate, smooth, pale pink (2.5R 9/2 –

5R 9/2) to grayish pink (2.5R 7/2 – 5R 7/2) with brilliant orange (2.5YR 8/12 –

5YR 8/12) to strong orange (2.5YR 6/12 – 5YR 6/12) center, sulcate striate margin.

Lamellae free, separated from the stipe by pseudocollarium, distant, lamellae edge blackish while faces initially concolorous with the pileus but later on black and finally losing turgor and collapsing. Stipe 40–60 × 1–3 mm, equal, smooth and white.

Basidiospores (12)13–14.5(15.6) × (11.6)12–12.5(13.5) × (6.1)8.5–11(13.5) µm, [avl × avb × avl = 14.5 × 12.5 × 9.9 µm; Q1 = 1.1–1.2, Q2 = 1.2–1.5, avQ = 1.3], in the face view rounded triangular to subglobose, in side view ovoid or amygdaliform, with eccentric germ pore 2–2.5 µm wide. Basidia 17–22 × 6–9 µm, 2–spored, cylindrical to clavate, hyaline. Cheilocystidia 25–29 × 23–26 µm, rounded to globose, rare.

Pleurocystidia 34–40 × 11–14 µm, cylindrical to subclavate. Pileipellis 33–37 × 9–

12 µm, clavate hyphae containing oil contents.

Habitat: Saprotrophic.

Materials examined: Pakistan, Khyber Pakhtunkhwa, Qaldara Dargai, 430

m asl, scattered under herbaceous plants, 11. 08. 2014, S. Hussain (SHP-8).

Comments: Parasola schroeterii is a new record and addition to coprinoid mushrooms of Pakistan in the genus Parasola section Glabri.

117

Figure 52. Basidiomata and anatomical features of Parasola schroeterii. A–B. Basidiomata, C. Basidiospores, D. Pileipellis, E. Basidia, F. Cheilocystidia, G. Pleurocystidia. Scale bars: A = 7.5 mm, B = 10 mm, C = 16 µm, D = 27 µm, E = 16 µm, F = 30 µm, G = 35 µm.

118

Phylogenetic analyses of Parasola taxa (Figure 53)

The ITS dataset consisted of 54 sequences and is 689 bp long. After the exclusion of ambiguous sites, the final ITS analysis was included of 490 distinctly aligned regions. Maximum likelihood analysis was performed via CIPRES Science

Gateway (Miller et al., 2010) employing RAxML-HPC v.8 on XSEDE. The optimal maximum likelihood tree with log score -3461.020529. Psathyrella candolleana

(LAH-SH-158) was choose as outgroup. In the ITS phylogram, species of Parasola were recovered in three clades. Clade I with strong bootstrap support (100%), consisted of species of section Glabri, where germ pore is eccentric in basidiospore and piliepellis are without sclerocystidia. Species in clade II and III with excellent bootstrap support, are belong to section Auricomi on account of central germ pore in the spores and pileipellis have sclerocystidia.

The new species Parasola lentiformis nom. prov., Pa. lilatincta and Pa. schroeterii fall in clade I. Clade II consisted entirely of Parasola malakandensis nom. prov., while

Pa. auricoma recovered in clade III.

119

Figure 53. Phylogeny of Parasola spp., based on ITS sequences. RAxML tree based on 54 ITS sequences where species of Parasola recovered in three clades, taxa of Glabri fall in clade I while clades II & III have species of section Auricomi, the species sequenced during this study are represented in bold fonts.

120

3.28. Psathyrella candolleana (Fr.) Maire, Bull. Soc. mycol 29: 185 (1913)

(Figure 54 & Figure 55)

Pileus 15−30 mm, companulate later on broadly convex, almost smooth to slightly plicate, pale yellowish to brown orange, rimose margins. Lamellae free, crowded, with 1–3 series of lamellulae, initially yellowish later on black. Stipe 40−60 × 2−4 mm, central, equal, hollow, smooth, white with no veil.

Basidiospores 8.5−11.8 × 6.2−8.5 µm, ellipsoid to cylindrical, smooth, dark brown in 5% KOH with central germ pore, 1.2–1.8 µm. Basidia 10−13 × 3−5 µm, clavate, hyaline, sterigmata 2−4, sharp. Cheilocystidia 25−31 × 8−12 µm, cylindrical to subcylindrical, hyaline. Pleurocystidia absent. Pileipellis is hymeniform, with broadly ovoid to obvoid cells, 36−79 × 35−68 µm, hyaline and thin walled.

Habitat: Saprotrophic.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

scattered in bunches on humid and humus rich soil, 510 m asl, 12. 8. 2014,

S. Hussain (SH-141, SH-158, SH-163).

Comments: Psathyrella candolleana has previously been reported from different regions of Pakistan (Ahmad et al., 1997).

121

3.29. Psathyrella fusiformis nom. prov. (Figure 54 & Figure 55)

Holotype: PAKISTAN. KHYBER PAKHTUNKHWA: Qaldara, 479 m asl,

saprotrophic, 20. 08. 2013, S. Hussain (Holotype LAH-SH-107)

Etymology: The specific epithet ‘fusiformis’ refers to the fusiform shape of

basidiospores of this species.

Pileus 20–30 × 5–10 mm, initially globose, becoming convex to plane, slightly plicate, light reddish brown (2.5YR 5/4 – 10R 5/4) to moderate reddish brown

(7.5R 3/6 – 2.5YR 4/4); surface innate fibrillose squamose, squamules white, covered the marginal portion of pileus, at the center with small white patches of veil; plicate margins. Lamellae free, slightly crowded, 1–3 series of lamelullae, concolorous with pileus, becoming blackish at maturity. Stipe 40–60 × 1–2 mm, smooth, central, pale color, without annulus.

Basidiospores (9)10–10.5(12) × (5)5.5–6(6.7) µm, [avl × avw = 10.3 × 6 µm; Q =

(1.5)1.7–1.8(2), avQ = 1.7], ellipsoid to oblong or ellipsoid to subphaseoliform, light brown to pale color in water, germ pore central, rudimentary, with thin-walled.

Basidia 13–16 × 6–8 µm, clavate, hyaline, rarely 2– mostly 4–spored. Cheilocystidia

36–45 × 13–17 µm, ventricose, rare. Pleurocystidia absent. Pileipellis 52–58 × 47–53

µm, in the form of chain of rounded to globose cells with light orange color.

Habitat: Saprotrophic. Scattered in loamy soil under Morus trees.

Material examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

510 m asl, under deciduous trees, 30. 07. 2014, S. Hussain (SH-10).

122

Comments: Psathyrella fusiformis nom. prov., seems an undescribed species, based on anatomical features of basidiomata and phylogenetic analysis of ITS region.

Phylogenetic analysis of Psathyrella species (Figure 56)

The ITS dataset included of 65 sequences and 630 bp long. After the exclusion of ambiguous position the final ITS analysis was consisted of 408 distinctly aligned sites. The optimized RAxML tree with log score -5797.482270. In the ITS phylogram, taxa of Psathyrella were recovered in two clades. Clade consisted of members of section Spintrigerae (Fr.) Konrad & Maubl., in which cheilocystidia utriform to pyriform, pleurocystidia are usually absent and basidiospores shorter than 10 µm. The new species Psathyrella fusiformis nom. prov., with above mentioned characters, placed in section Spintrigerae. Clade II consisted of species of section Spadiceogrisea Kits van Wav., with utriform cheilo and pleurocystidia, both thin-walled, not muricate; veil present but without spherocytes, surface of pileus not innate fibrillose-squamose, and average length of basidiospores 7.6 µm or more (Kits and Waveren, 1985).

123

Figure 54. Basidiomata of Psathyrella candolleana and Ps. fusiromis. A. Psathyrella fusiformis (Holotype SH-107); B. Psathyrella candolleana. Bar: 20 mm.

124

Figure 55. Anatomical features of Psathyrella candolleana and Ps. fusiformis. Psathyrella candolleana (A–D): A. Basidiospores, B. Basidia, C. Cheilocystidia, D. Pileipellis; Psathyrella fusiformis (E–H): E. Basidiospores, F. Basidia, G. Cheilocystidia, H. Pileipellis. Scale bars: A = 10 µm, B = 14 µm, C = 17 µm, D = 50 µm, E = 11 µm, F = 10.5 µm, G = 17, H = 61 µm.

125

Figure 56. Phylogenetic tree of Psathyrella spp. RAxML tree based on 65 sequences of ITS region of Psathyrella, the new species P. fusiformis is in bold fonts in clade I.

126

3.30. Agrocybe pediades (Fr.) Fayod, Annls Sci. Nat., Bot., sér. 79: 358 (1889) (Figure 57)

Pileus 15−30 mm diam, broadly convex, smooth, light yellow (2.5Y 9/6 − 5Y 9/6) with dark orange yellow center, slightly sulcate margins; Lamellae sinulate, closed, strong brown to light brown (7.5YR 3/6 − 7.5YR 3/8) and even. Stipe 40−60

× 5 mm, equal and central, solid, curved and slightly twisted at the middle, smooth, pale greenish yellow (7.5Y 9/4 − 10Y 9/4) with bulbous base.

Basidiospores 11−13 × 7−9.5 µm, strongly ellipsoidal, with central germ pore having size of 1.2-2.3 µm, smooth and brown in KOH. Basidia 20−23 × 7−10 µm, cylindrical to clavate, hyaline. Cheilocystidia 17−19 × 9−12 µm, elongated, lageniform to clavate and hyaline. Pleurocystidia absent. Pileilal element rounded to oblong, 9.4−11.8 6−8.2 µm.

Habitat: Saprotrophic.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

510 m asl, under deciduous trees, 03. 8. 2013, S. Hussain (SH-3).

Comments: Agrocybe pediades have been reported from different regions of

Pakistan (Ahmad et al., 1997). For the time this mushroom is reported from

Malakand.

127

Figure 57. Morpho-anatomical features of Agrocybe pediades. A−C. Basidiomata, D. Basidiopores, E. Basidia, F. Cheilocystidia, G. Pileilall elements. Scale bard: A–C = 5 mm, D–G = 3.2 µm.

128

Agrocybe subpediades JN684790 Agrocybe pediades f bispora JN68 Agrocybe pediades JN684799 Agrocybe pediades FJ810131 Agrocybe pediades FJ810133 Agrocybe pediades AY168829 Agrocybe pediades DQ484057 Agrocybe arenicola JN684805 Agrocybe arenicola JN684804 Agrocybe subpediades JN684795 Agrocybe pediades f bispora JN68 Agrocybe pediades f bispora JN68 Agrocybe pediades f bispora JN68 Agrocybe pediades FN386288 Clade I Agrocybe semiorbicularis AY52124 Agrocybe pediades AF345806 Agrocybe semiorbicularis AY19453 Agrocybe tuberosa KF006385 Agrocybe praecox AF345805 Agrocybe smithii KC176295 Agrocybe smithii KC176296 Agrocybe praecox AF124713 Agrocybe praecox KC842389 Agrocybe praecox JF304941 Agrocybe erebia KF668291 Agrocybe erebia AY168830 Agrocybe erebia AY168831 Agrocybe pediades Clade II Agrocybe pediades KC505557 Coprinus comatus AY635772

Figure 58. Phylogenetic tree of Agrocybe spp. Phylogenetic analysis of Agrocybe pediades based on ITS sequences.

129

3.31. Agrocybe semiorbicularis (Bull.) Fayod, Annls Sci. Nat., Bot., sér. 7 9: 358

(1889) (Figure 59 & Figure 60)

Pileus 15–25 × 2–4 mm, convex to flat, later depressed to uplifted, smooth, light orange yellow (7.5YR 9/8 – 10YR 9/8) moderate orange yellow (7.5YR 7/8 – 10YR

7/8), with uplifted dentate margins. Lamellae free and approximate, slightly crowded, ventricose, with even edge. Stipe 30–50 × 2–3 mm, almost equal, slightly broader at the top, moderate orange yellow.

Basidiospores 10–13 × 8–10 µm, broadly ellipsoid, ellipsoid to ovoid, brilliant yellow in 5% KOH, with central germ pore 1.9 µm. Basidia 25–32 × 7.5–10 µm, clavate to broadly cylindrical, mostly 4–spored, rarely 2–spored, hyaline.

Cheilocystidia 24–36 × 7–9 µm, fusiform to lentiform, abundant. Pleurocystidia 22–

28 × 7.7–11 µm, cylindrical, hyaline. Pileipellis chain of cylindrical cells, with rounded to subglobose terminal cells 15–20 × 7–10 µm.

Habitat: Saprotrophic.

Materials examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Batkhela,

710 m asl, under deciduous trees, 03. 8. 2013 (SH-152).

Comments: Agrocybe semiobricularis is new record for Pakistan.

130

Figure 59. Basidiomata and spores of Agrocybe semiobricularis. A. Basidiomata, B–C: Basidiospores. Scale bars: A = 28 mm, B–C= 11 µm.

131

Figure 60. Anatomical features of Agrocybe semiobricularis. A. Basidiospores, B. Basidia, C. Cheilocystidia, D. Pleurocystidia, E. Pileipellis element. Scale bars: A= 9 µm, B–C = 23 µm, D = 20 µm, E = 32 µm.

132

Figure 61. Phylogenetic tree of Agrocybe spp. Maximum likelihood phylogeny based on 35 ITS sequences, Agrocybe semiobicularis represented by (■) falls in clade I, consisted of species of Agrocybe and clade II with taxa of Psilocybe.

133

3.32. Stropharia ambigua (Peck) Zeller, Mycologia 6(3): 144 (1914) (Figure 62)

Pileus 20−50 mm diam., conical to umbonate then parabolic to convex, smooth, dry and velvety, light yellow (2.5Y 9/6 − 5Y 9/6) with some deep yellow spots

(2.5Y 6/10 − 5Y 6/10); margins wavy but non-striate with abundant velar remnants, context white to yellowish white and cottony. Lamellae adnexed, regular, close, membranous, grayish brown (7.5YR 3/2 − 7.5YR 4/2) to dark brown

(5YR 1/2 − 7.5YR 1/2). Stipe 30−40 × 7−10 mm, cylindrical and equal, central, hollow with smooth surface, light green yellow (5GY 8/4 − 5GY 9/4) to moderate yellow green (7.5GY 6/4 − 7.5GY 7/4). Annulus as velar remnants on stipe, upturned, whitish having lamellar fragments.

Basidiospores 11.5−16 × 5−8 µm, ellipsoid to cylindrical, thick walled, smooth with central germ pore, yellowish brown in 5% KOH. Basidia 26−35 × 11−15 µm, clavate to cylindrical, hyaline and tetrasporic. Pleurochrysocystidia 45−60 × 10−17 µm, fusiform with mucronate apex. Cheilocystidia 32−40 × 9−14 µm, cylindrical, hyaline, abundent. Pileipellis hyaline, thin walled prostrate hyphae with cylindrical cells, diameter 5−11 µm.

Habitat: Saprotrophic.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

510 m asl, scattered in sugarcane field, 24. 04. 2014, (SH-102).

134

Phylogenetic analysis of Stropharia ambigua (Figure 63)

The ITS dataset consisted of 38 sequences and 640 bp long. Using maximum likelihood, two clades were recovered, consisted of Hypholoma and Stropharia, respectively. The representative species Stropharia ambigua falls in Stropharia clade.

Comments: Stropharia ambigua is a new agaric mushroom for Pakistan.

135

Figure 62. Morpho-anatomical features of Stropharia ambigua. A–B Basidiomta, C. Microscropic photos of basidiospores, D. Spores drawings, E. Pleurochrysocystidia, F. Cheilocystidia, G. Basidia, H. Pileipellis hyphae. Scale bars: A–B= 7 mm, C = 14 µm, D = 4 µm, E = 7 µm, F = 10 µm, G = 8 µm. H = 12 µm.

136

Figure 63. Phylogenetic tree of Stropharia and Hypholoma. Maximum likelihhod tree of Stropharia and Hypholoma, based on 38 sequences of ITS region.

137

3.33. Geastrum velutinum Morgan J. Cincinnati Soc. Nat. Hist. 18: 38 (1895)

(Figure 64)

Gasterocarp 15−30 mm diameter, Exoperidium splitting to middle into 7−9 rays, light greenish yellow (7.5Y 9/6 − 10Y 9/6) to dark orange yellow (7.5YR 6/8 −

10YR 6/8), Endoperidium 7−15 × 6−12 mm, grayish yellowish brown (10YR 4/2 −

10YR 5/2), Peristome 2−3 mm height, finely plicate, distinctly delimited, darker than endoperidium, applanate, broadly conical and truncate to mammiform.

Gleba blackish and cottony. Dorsally the gastrocarp has white mycelia cord.

Basidiospores 4−5 × 4.0−5.5 µm, globose to subglobose, spore walls echinate.

Eucapillitia Geastrum type, lack pores, long hyphae, rarely branched and unspetate,

2.5−4.3 µm diameter.

Habitat: Saprotrophic.

Materials examined: Pakistan, Khyber Pakhtunkhwa, Malakand,

Dargai, 470 m asl, scattered under deciduous trees, 29. 08. 2013, S.

Hussain (SHG-3).

Phylogenetic analysis of Geastrum velutinum (Figure 65)

ITS dataset consisted of 66 sequences and 678 bp long. The final analysis of ITS dataset has 379 distinctly aligned region after the exclusion of ambiguous sites.

Four clades were recovered using RAxML phylogenetics. The representative species Geastrum velutinum along with an undescribed species (G1 shussain) fall in clade I.

138

Comments: The specimen (G3) was quite interesting collection of Geastrum indeed. On the basis of morpho-anatomical features of gasterocarp and its position in phylogenetic tree, this taxon looks like Geastrum velutinum.

139

Figure 64. Morpho-anatomical features of Geastrum velutinum (G3). A−D. Basidiospores, E. Capillitia, F. Basidioma. Scale bars: A–D = 3.3 µm, E = 2.6, F = 8.3 mm.

140

Figure 65. Phylogenetic tree of Geastrum spp. Maximum likelihood analysis of Geastrum velutinum based on 76 sequences of the ITS region, the species studied during this work are represented by bold fonts in clade I.

141

3.34. Phellinus badius (Cooke) G. Cunn. Pl. Dis. Div. 164: 273 (1965)

(Figure 66)

The basidiome annuals, resupinate, smooth and lobed, 60−90 × 10−25 mm, tubes layered, 3−4 mm deep, pores 2−4/mm, smooth and rounded, strong reddish brown (10R 3/8 − 10R 3/12) to deep reddish brown (10R 1/10 − 10R 2/10).

Basidiospores 6−7 × 3.6−5 µm, broadly ellipsoidal to cylindrical, smooth, moderate reddish brown (10R 4/6) in 5% KOH, non-amyloid, wall thickness up to

1 µm. Basidia 14–18 × 6–8 µm, clavate to cylindrical, smooth, hyaline. Hyphal system dimitic.

Habitat: Wood decaying.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara, 513 m asl, on the stem of Acacia indica, 03. 8. 2013, S. Hussain (SH-50).

Comments: This taxon have been reported from different sites of Punjab by

Ahmad (1972). This is a new record for Khyber Pakhtunkhwa, characterized through nuclear ribosomal DNA.

142

Figure 66. Morpho-anatomical features of Phellinus badius. A. Basdiocarp, B. Hymenophore, C. Basidiospores, D. Basidia. Scale bars: A = 20 mm, B = 6 mm, C = 3.5 µm, D = 6 µm.

143

3.35. Irpex lacteus (Fr.) Fr., Elench. fung. 1: 142 (1828) (Figure 67)

Basidiocarp 30−50 × 40−50 mm, resupinate, refluxed, creamy to pale yellow (2.5Y

9/4 − 5Y 9/4) with whitish smooth margin; teeth flattened, angular edged, mostly denticulate at the apex, 4 × 1 mm. Basidiospores 5−6.3 × 3.2−4 µm, broadly ellipsoid to obvoid, hyaline, smooth and inamyloid. Basidia 21−26 × 5−7 µm, clavate, hyaline with 4 sharp sterigmata. Cystidia 20−36 × 4−6 µm, cylindrical to clavate, developed on generative hyphae. Hyphal system is dimatic; generative hyphae branched and clamped, thin walled, 2−3 µm diameter. Skeletal hyphae thick walled, mostly unbranched, 5−6 µm diameter.

Habitat: As wood decaying of Acacia modesta.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

513 m asl, on the dead bark of Acacia modesta, 03. 8. 2013, S. Hussain (SH-

45).

Comments: Irpex lacteus was reported from Azad Jammu and Kashmir on dead logs (Gardezi, 2007). However the basidiocarp looking smooth in that report, actually this taxon has dentate not a smooth fruiting body (Lim & Jung, 2003). In the present study we use morphological as well as ITS sequencing to confirm the identification of Irpex lacteus.

144

Figure 67. Morpho-anatomical features of Irpex lacteus. A. Dentate Hymenophore, B, Basidiospores, C. Basidia, D. Generative hyphae along with cystidia. Scale bars: A = 10 mm, B = 2.3 µm, C = 7 µm, D = 12 µm.

145

3.36. Rigidoporus vinctus (Berk.) Ryv., Norw. Jl Bot. 19(2): 143 (1972)

(Figure 68)

Basidiocarp 200−300 × 100−200 cm, annuals, irregular, slightly rounded, resupinate, smooth with slightly rough relative to the bark of the host, tightly attached to the substrate, moderate orange (2.5YR 6/8 − 5YR 6/8) to brownish orange (2.5YR 5/8 − 5YR 5/8), and porous. Tubes 1−1.5 mm deep, rounded to polygonal, 5−6/mm. Basidiospores 5.3−7 × 2−4 µm, ellipsoidal, smooth, hyaline, non-amyloid. Basidia not found. Hyphal system dimitic.

Habitat: Wood decaying.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Agra, 890

m asl, on the stem of Populus euphratica Oliv., 05. 08. 2013, S. Hussain (SH-

75).

Comments: Previously Rigidoporus vinctus was reported on Morus alba L. from

Changa Manga and Chichawatni, Pakistan (Ahmad & Ahmad, 1982). For this first time this taxon is reported on Populus euphratica from Khyber Pakhtunkhwa.

146

Figure 68. Morpho-anatimical features of Rigidoporus vinctus. A. Basidiocarp, B. Hymenophorous surface, C. Basidiospores. Scale bars: A = 10 mm, B = 3 mm, C = 6 µm.

147

3.37. Earliella scabrosa (Pers.) Gilbn. & Ryvarden., Mycotaxon 22: 364. 1985

(Figure 69)

Basidiocarps effused-replexed to resupinate; pilei 70−130 × 30−70 mm, semicircular or partially imbricate. Individual pilei horizontal or slightly ascending, dimidiate (one part developed more than the other), often imbricate

(overlapped), more or less radially rugulose (wrinkled surface), sulcate (grooved); upper surface initially soft white to cream later on corky-rigid with dull red center having white margin; lower surface creamy then pale brown; context duplex, upper layer separated from the dense compact lower layer by a thin black line; tubes 3−6 mm radiating from the point of attachment to the margin, thin, glabrous thin and creamy, later tough and pale brown; pore surface cream color,

1−1.5 mm wide; pores elongated angular to round. Basidiospores 5.6−10.1 ×

3.5−4.7 μm, ellipsoidal, sub-cylindrical to bullet shape, smooth and thin walled; basidia rare, 15.5−28.5 × 4−5.6 μm, clavate, hyaline, smooth and thin walled; context trimitic; generative 1.5−2.3 μm, clamped and branched; skeletal rarely branched, 3−3.5 μm; binding similar to skeletal but much branched.

Habitat: Wood decaying of deciduous trees.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Sakhakot,

460 m asl, on the stem of Populus alba, 13. 8. 2013, S. Hussain (SH-40).

148

Comments: Previously Earliella scabrosa was reported with its synonym Trametes corrugata (Pers. ex Fr.) Bres., on Dalbergia sissoo Roxb., and Morus alba, from Changa

Manga forest, Pakistan (Ahmad, 1967, 1969, 1972). It is a new record for Malakand.

Figure 69. Morpho-anatomical features of Earliella scabrosa. A. Basidiocarp, B. Tubes, C. Basidiospores, D. Basidia. Scale bars: A = 10 mm, B = 5 mm, C= 7 µm, D= 10 µm.

149

3.38. Trametes cubensis (Mont.) Sacc., Syll. fung. 9: 198 (1891)

(Figure 70)

Pileus 130−200 × 80−150 × 10−30 mm, semi lunar to bracket shape, upper surface soft and velvety, rough, often grooved, grayish yellow (2.5Y 7/4 − 5Y 7/4) to dark grayish yellow (2.5Y 6/4 − 5Y 6/4) with smooth margin. Lower surface porous, brownish pink (7.5YR 7/2) with small stipe, 1−1.5 cm. Tubes 1−3 mm deep, creamy to pinkish. Pores 2−3/mm, angular to rounded. Basidiospores 8−10 × 4−6 µm, cylindrical to ellipsoidal, smooth, brown in 5% KOH, non-amyloid. Basidia 16−19

× 6−7 µm, clavate, 4 sterigmata, simple clamped. Hyphal system trimitic.

Generative hyphae 2.3−3.5 µm diameter, branched and clamped, thin walled.

Binding hyphae 4.7−7 µm, thin walled and branched. Skeletal hyphae 5−10.6 µm, thick walled and unbranched.

Habitat: Wood decaying of different deciduous trees.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Sakhakot,

460 m asl, on the stem of Acacia modesta, 21. 08. 2013 (SH-77).

Comments: Trametes cubensis on Acacia modesta is for the first time reported from

Pakistan, an addition to the Polyporales of the country.

150

Figure 70. Morpho-anatomical features of Trametes cubensis. A. Upper surface of Basidiocarp, B. Lower surface of Basidiocarp, D. Basidiospores, E. Basidia, F. Generative hyphae, G. Binding hyphae, H. Skeletal hyphae. Scale bars: AB = 10 mm, C = 3 mm, D = 2.3 µm, E = 8 µm, F = 6 µm, G = 5 µm, H = 6 µm.

151

3.39. Trametes lactinea (Berk.) Sacc., Syll. fung. 6: 343 (1888) (Figure 71)

Fruit body annual, mostly occurred in groups, 70−130 × 50−80 cm, initially convex, later on resupinate, upper surface smooth, glabrous, warty, light grayish yellow

(2.5Y 7/4 − 5Y 7/4) to moderate olive brown (2.5Y 4/2 − 2.5Y 4/6) with some smooth, pale yellow margin (2.5Y 9/4 − 5Y 9/4). Lower surface first smooth then porous and dry. Pores 1−2 mm deep, white to creamy, rounded with smooth edge,

1−2/mm. Basidiospores 4.5−6 × 2−3 µm, ellipsoid to oblong, smooth and non- amyloid. Basidia 12−15 × 3−4 µm, clavate, 4−spored with immature basidia.

Cystidia 25−30 × 5−7 µm, sub-cylindrical to clavate, thin walled, hyaline. Hyphal system dimitic. Generative hyphae branched and clamped, thin walled, hyaline,

5−7 µm. Skeletal hyphae straight, unbranched, thick walled with small lumen,

10−14 µm diameter, wall thickness 2−3 µm.

Habitat: Wood decaying of different deciduous trees.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

513 m asl, on the stem of Morus alba, 21. 08. 2013, S. Hussain (SH-71).

Comments: Trametes lactinea has been reported on logs of Morus alba, Dalbergia sissoo, Quercus incana, from Gujrat, Chichawatni and Changa Munga forest of

Pakistan (Ahmad, 1972). For the first time Trametes lactinea is reported from

Khyber Pakhtunkhwa.

152

Figure 71. Morpho-anatomical features of Trametes lactinea. A. Fruiting body, B. Basidiospores, C. Basidia, D. Cystidia, E. Generative hyphae, F. Skeletal hyphae. Scale bars: A = 10 mm, B = 3 µm, C = 4 µm, D = 3.5 µm, E = 6 µm, F = 5 µm.

Phylogenetic analysis of polypores (Figure 72)

The ITS dataset consisted of 22 sequences, resulted an alignment with 383 distinctly aligned position in the final ITS analysis. Phellinus badius was treated as outgroup. Bootstrap support above 60% was considered significant. The

Polyporales of Malakand clustered in the core polyporoid clade with maximum bootstrap support (100%). The core polyporoid clade further divided in different clades with strong BS supported value; Trametes clade (MLBS 99%), Earliella

(100%), Rigidoporus (100%) and Irpex (100%).

153

Figure 72. Phylogenetic tree of Polyporales of Malakand. Maximum likelihood phylogeny of polypores based on 22 sequences of ITS, species sequenced during this study are represented by (■).

154

3.40. Phragmidium papillatum Dietel, Hedwigia 29: 25, 1890 (Figure 73)

Uredinia yellow to orange yellow, rounded, erumpent, scattered on the whole leaf surface, sometimes on the petiole; Urediniospores globose to ovoid, ellipsoid or obovoid, 15−17.5 × 19−29 µm, dark orange content, verruculose, 1−3 germ pores.

Teliospores 2−4 celled, mostly 4−celled, 3−celled 50−56 × 19−26 µm and 4−celled

60−75.5 × 20−27 µm, dark black, cylindrical, mostly straight, smooth dark black wall upto 3 µm thick, hyaline, slightly tubular apical papilla about 6 µm; pedicel

32−47 ×7−10 µm, hyaline smooth with eroded thinner apex.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

510 m asl, on Potentilla geradiana Lindle., II and III stage, 22. 11. 2013, S.

Hussain (SHR-3).

Comments: Phragmidium papillatum has been reported from Mansehra, KP,

Pakistan infecting Potentilla geradiana (Fiaz, 2013).

155

Figure 73. Phragmidium papillatum on Potentilla geradiana. A. Infected host plan, B. Uredinial and Telial sori, C. Urediniospores, D–E, Teliospores. Scale bar: 10 µm.

156

3.41. Phragmidium rubi-idaei (DC.) P. Karst., Bidr. Kann. Finl. Nat. Folk, 31: 52,

1879 (Figure 74)

Spermogonia and Aecia not found. Uredinia rounded, minute, densely scattered on the whole leaf surface in small patches. Urediniospores globose to subglobose, aserulate to slightly verruculose, hyaline with yellowish oil droplets, germ pore 2-

4, obscure. Telia hypophyllous, mostly grouped, black. Teliospores 90–123 × 30–

37–8 µm, mostly 7–8 celled, rarely 6 or 9 celled, dark brown, rounded to broadly convex at both ends with asperulate wall; apical papilla 12–15 µm, smooth and hyaline. Pedicel 83–116 × 17–20 µm, broader and verruculose at the apex.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

510 m asl, on Rubus fruticosus Agg., II & III stage, 22. 11. 2013, S. Hussain

(SHR-50).

Comments: Phragmidium rubi-idaei has been reported on different Rubus spp. from the northern Pakistan (Afshan, 2009; Fiaz, 2013). This is the first report of this fungus from Malakand region.

157

Figure 74. Phragmidium rubi-idaei on Rubus fruticosus. A–B. Uredinia and Telia, C−F. Teliospores, G. Urediniospores. Scale bars: A = 10 mm, B = 5 mm, C–F = 50 µm, D,E,G = 20 µm.

158

3.42. Puccinia aestivalis Dietel, Bot. Jb. 34: 585 (1905) (Figure 75)

Aecia, spermogonia and telia not found. Uredinia deep brown to dark black, amphigenous, 0.2−0.4 mm, ellipsoid to globose. Urediniospores 20−26 × 16−20

µm, globose to broadly ellipsoid, echinulate, hyaline, 2−4 equatorial germ pores, wall thickness 1−2 µm. Amphispores 30−33.8 × 20−23 µm, obovoid to ellipsoid, chestnut brown to dark brown, smooth, 2−4 equatorial germ pores, wall thickness

1.9−3.2 µm, with pale brown pedicel, 40−52 × 4−5 µm.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

490 m asl, on Microstegium nudum A. Camus, with stage II, 510 m asl, 12. 11.

2013, S. Hussain (SHR-16).

Comments: Puccinia aestivalis on Microstegium nudum has previously been reported from Azad Jammu and Kashmir with uredinial stage only (Saba et al.,

2013). It is a new record for district Malakand with distinct amphispores. The amphispores seems smooth walled, these are described as echinulated in the original description by Cummins (1970).

159

Figure 75. Puccinia aestivalis on Microstegium nudum. A. Infected leaves of Microstegium nudum, B–C. Sori, D–F. Amphispores, G. Drawings of Urediniospores, H. Drawings of Amhispores. Scale bars: B = 2 mm, C = 0.3 mm, D−F = 6 µm, G = 4 µm, H = 8 µm.

160

3.43. Puccinia conclusa Thuem., Journal Sci. math. phys. nat, Lisbosa, 6(24): 237

(1887) (Figure 76 & Figure 77)

Aecia not found. Sori sub-epidermal, rounded to oblong, pale brown.

Urediniospores not found, Amphispores clavate to broadly ellipsoid, smooth with granular contents, hyaline to pale brown, 32−45 × 15−21 µm, wall thickness 1.8−3

µm. Pedicel 30−35 × 7−9 µm, hyaline, smooth and mostly persistent. Telia elongated, early exposed. Teliospores 33−55 × 14−18 µm, clavate to subcylindrical, wall thickness 1−1.8 µm with prominent papilla upto 4.7−7.7 µm, short pedicel 14−16.5 × 5−7 µm.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

490 m asl, on Cyperus iria L., with stage II and III, 510 m asl, 12. 11. 2013, S.

Hussain (SHR-15).

Comments: Puccinia conclusa has been reported from different areas of Pakistan

(Ahmad et al., 1997; Afshan et al., 2008). The fungus is a new record for Malakand district.

161

Figure 76. Puccinia conclusa on Cyperus iria. A. Cyperus iria, B. Inflorescence of host, C. Infected leaf of host, D. Telia, E. Uredia, F,I. Amphispores, G,H,J. Teliospores. Scale bars: F = 14.8 µm, G–H = 13 µm, I–J = 5 µm.

162

Figure 77. Line drawings Puccinia conclusa. AB. Teliospores, C. Amphispores, D. Amphispore, E. Teliospore. Scale bars: A–B = 7 µm, C = 7.5 µm, D–E = 4.7 µm.

163

3.44. Puccinia duthiei Ellis & Tracy, Bull. Torrey bot. Club 24(6): 283 (1897)

(Figure 78 & Figure 79)

Spermogonia and aecia not found. Uredinia subepidermal, golden brown.

Urediniospores 27−33 × 17−22 µm, ovoid, obovoid or ellipsoid, pale brown to golden brown, germ pore (1)2-3(4), scattered, echinulate with wall thickness 1.4−2

µm. Telia amphigenous, subepidermal, dark reddish brown, loculate. Teliospores

34−42 × 19−24 µm, wall 2.1−3.0 µm thick at sides, 4−6 µm apically broadly ellipsoid to obvoid, vivid red to deep red, smooth with granular content, rounded ends, pedicel hyaline to light green, 5−9 ×106−119 µm.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

510 m asl, on Dichanthium annulatum (Forssk.) Stapf, with stage II and III,

510 m asl, 12. 11. 2013, S. Hussain (SHR-5).

Comments: Puccinia duthiei has been reported on Dichanthium annulatum and

Bothriochloa bladhii (Retz.) S.T. Blake., from Pakistan (Afshan & Khalid, 2008). It is a new record for Malakand.

164

Figure 78. Puccinia duthiei on Dichanthium annulatum. A. Infected plant of Dichanthium annulatum, B–C. Telia, D–E. Teliospores. Scale bars: B–C = 0.5 mm, D–E= 12.5 µm.

165

Figure 79. Line drawings of Puccinia duthiei. A. Urediniospores, B. Paraphyses, C. Teliospores. Scale bars: A = 8 µm, B = 4 µm, C = 14 µm.

166

3.45. Puccinia microspora Dietel, Bot. Jb. 27: 101 (1905)

(Figure 80 & Figure 81)

Aecia not found. Sori frequently on the abaxial surface, Uredinia pale brown to cinnamon brown. Urediniospores 22.5−26 × 17−20 µm, oval to obovoid, cinnamon brown, echinulate, germ pore 3−4, equatorial, wall thickness 1.7−2.3 µm. Telia dark brown to blackish brown, teliospores 33.4−39 × 20.5−25 µm, smooth, chestnut brown, wall thickness 2−3 µm, the pale brown pedicels, 22−26 µm, thin walled, persistent.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

490 m asl, on Imperata cylindrica (L.) P.Beauv, with stage II + III, 510 m asl,

10. 04. 2014, S. Hussain (SHR-25).

Comments: Puccinia microspora has been published by the authors (Hussain et al.,

2015c) as a new record for Pakistan. This fungus has previously been reported from Brazil, Broneo, China, Japan, United States (Cummins, 1971) and India

(Bagyanarayana & Ravinder, 1988).

167

Figure 80. Puccinia microspora on Imperata cylindrica. A. Host plant, B. Infected leaves of Imperata cylindrica, C−E, Urediniospores, F−H: Teliospores Scale bars: B = 0.1 mm, C−E = 5 µm, F−H = 7 µm.

168

Figure 81. Drawings of Puccinia microspora. A. Urediniospores; B: Teliospores. Scale bar: 10 µm.

169

3.46. Puccinia nakanishikii Dietel. Bot. Jahrb. 34: 585. 1905 (Figure 82)

Aecia not found. Uredinial sori amphigeous, light brown to cinnamon-brown, rounded to globose. Urediniospore 25−30 × 18−24 µm, globose to ellipsoid, echinulate, light brown to chestnut brown, 4−5 equatorial germ pores, wall thickness 1−2.5 µm. Telia sub-epidermal but early exposed, dark brown to blackish brown, elongated, 0.2−0.5 mm. Teliospore 32−38 × 20−26 µm, chestnut brown to dark brown, ellipsoidal, smooth with little granular contents, wall thickness at sides 2.3−3.5 µm, and 4−6 µm apically. Pedicels usually persistent, light brown, thick walled, 94−111 × 5−7 µm.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Jaban, 510

m asl, on Sorghum halepense (L.) Pers., with stage II + III, 490 m asl, 12. 11.

2013, S. Hussain (SHR-14).

Comments: Puccinia nakanishikii on Sorghum halepense is a new record for the

Pakistan (Hussain et al., 2015c). However, this fungus is reported world-wide on different members of Poaceae i.e., Cymbopogon citratus (DC. ex Nees) Stapf., C. nardus (L.) Rendle and Sorghum halepense by Cummins (1971).

170

Figure 82. Puccinia nakanishikii on Sorghum halepense. A. Infected leaves of Sorghum halepense, B. Telia, C–D. Urediniospores, E−G. Teliospores, H. Drawings of urediniospore, I. Teliospores. Scale bars: A–B = 10 mm, C–D,H–I = 10 μm, E–G = 12 μm.

171

3.47. Puccinia striiformis Westend. var. striiformis, Bull. Acad. R. Sci. Belg., Cl. Sci.,

21: 235 (1854) (Figure 83)

Uredinia amphigenous, mostly on the adaxial surface, oblong, yellowish orange,

0.2−0.5 mm. Urediniospores 20−29 × 19−24 µm, obovoid to broadly ellipsoid, hyaline to pale yellow, echinulate, 5−9 scattered germ pores. Telia sub-epidermal, oblong to elongated, blackish to dark black. Teliospores 39−54 × 20−25 µm, usually oblong to clavate, golden brown to chestnut brown, smooth, wall thickness 1−2

µm at sides, and 3−5 µm apically, apex mostly truncate, sometimes rounded or conical, pedicel short, 10−13 × 5−7 µm.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

505 m asl, on Triticum aestivum L., with stage II + III, 495 m a.s.l., 08. 02. 2014,

S. Hussain, (SHR-26).

Comments: Puccinia striiformis var. striiformis haas previously been reported from

Pakistan, infecting different host plants like Dactylis glomerata L., Hordeum vulgare

L., Leersia oryzoides (L.) Sw., Poa sp., and Triticum aestivum (Afshan & Khalid, 2013).

The fungus is a new record for Malakand.

172

Figure 83. Puccinia striiformis var. striiformis on Triticum aestivum. A. Infected leaves of Triticum aestivum, B. Telia, CD. Urediospores, E−H. Teliospores, I. Drawings of urediniospore, J. Drawings of teliospores. Scale bars: C = 6.5 µm, D = 4 µm, E = 13 µm, F,H = 5 µm, I = 5.5 µm, J = 5.8 µm.

173

3.48. Puccinia violae (Schumach.) DC., Fl. franç., Edn 3 (Paris) 6: 62 (1815)

(Figure 84)

Aecia not found. Sori early exposed, uredinia chestnut brown, usually aggregated to form large dots, 1−2 mm. Urediniospores 19−26 × 17−21 µm, rounded to globose, pale brown, echinulate, 2−3 equatorial germ pores, wall thickness 1.6−2.8

µm. Telia blackish, circular, surrounded by uredinia, in some cases independent of uredia and of large size, about 2−4 mm. Teliospores 26−31 ×16−21 µm, clavate to broadly ellipsoid, pale brown to chestnut brown, smooth with single terminal germ pore, wall thickness 1.5−3 µm. Pedicels usually not persistent, upto 10 µm long.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Sakhakot,

460 m asl, on Viola canescense L., with stage II + III, 410 m asl, 24. 10. 2013, S.

Hussain (SHR-2).

Comments: This fungus has been reported from northern Pakistan on Viola canescense (Afshan, 2009).

174

Figure 84. Puccinia violae on Viola canescense. A. Host plant Viola canescense, B. Infected leaves of Viola canescense, C. Sori, D−F. Urediniospores, H−J. Teliospores, K. Drawings of teliospores, L. Drawings of urediniospores. Scale bars: D–F = 6.5 µm, G–J = 6.3 µm, K = 4.5 µm, L = 5.5 µm.

175

3.49. Puccinia melanocephala Syd. & P. Syd. Annls mycol. 5(6): 500 (1907)

(Figure 85)

Aecia and spermogonia not found. Uredinia on abaxial leaf surface, rounded to globose, chestnut brown, 0.04−0.08 mm. Urediniospores 20−28 × 19−25 µm, obvoid, globose to ellipsoidal, light brown to chestnut brown, echinulate, 3−4 equatorial germ pores. Telia blackish, elongated, usually early exposed, on both sides of the leaf, 0.8−1 mm. Teliospores 26−30 × 20−24 µm, mostly ellipsoidal, chestnut brown, smooth with granular contents, wall thickness at sides 1.5−3 µm, and 4−5 µm apically. Pedicel mostly persistent, hyaline to light brown, thick walled, 56−84 × 6−8 µm.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Qaldara,

510 m asl, on Saccharum bengalense Retz., with stage II + III, , 510 m asl, 15.

10. 2013, S. Hussain (SHR-4).

Comments: Puccinia melanocephala has previously been reported from Pakistan

(Afshan & Khalid, 2013). This is a new record for district Malakand.

176

Figure 85. Puccinia melanocephala on Saccharum bengalense. A–B. Telia on the leaves of Saccharum sp, C−E. Urediniospores, F−H. Teliospores, I. Drawings of teliospores, J. Drawings of urediniospore. Scale bars: A–B = 0.135 mm, C–H = 4.7 µm, I = 6 µm, J = 5 µm.

177

3.50. Uromyces lespedezae-procumbentis (Schwein.) Lagerh., Cat. Pl. No.Car: 123

(1869). (Figure 86)

Spermogonia, aecidia and uredinia absent. Telia amphigenous, usaully hypophallous, minute, scattered, pulverulent, dark brown to black. Teliospores

16–22.4 × 24.6–30.2 µm, ovate to ellipsoid, smooth, reddish brown, with 1.5–2 µm thick, apices round or acute, 4–7 µm thick, pedicel hyaline, mostly decidous, upto

30 µm long.

Material examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Agra, 1050

m asl, on Lespedeza juncea var. sericea (Thunb.), with stage III, 10. 11. 2014, S.

Hussain (SHR-45).

Comments: Uromyces lespedezae-procumbentis has been reported from different parts of northern Pakistan (Afshan, 2009; Fiaz, 2013). It is the first report of this fungus from Malakand region.

178

Figure 86. Uromyces lespedezae-procumbentis on Lespedeza juncea var. sericea. A. Infected branch of Lespedeza juncea var. sericea, B. Telia, C–D. Teliospores, E: Drawings of teliospores. Scale bars: C = 16 µm, D = 20 µm, E = 16.5 µm.

179

3.51. Urocystis avenastri (Massenot) Nannf. Symb. bot. upsal. 16: 84 (1959)

(Figure 87)

Smut fungus Urocystis found on leaves and young inflorescence of Helictotrichon virescens (Nees ex Steud.) Henr., as black powdery mass. The spore mass is dark black mostly on adaxial surface of leaf sheaths and leaf blades. Spore balls rounded to globose, 19−32 × 20−42 µm, with 1−4 (5) spores per spore ball. Teliospores

10.5−15.5 × 14−18(20) µm, ellipsoid to broadly ellipsoid or globose, dark brown with granular content, mostly completely covered by sterile cells. Sterile cells 5−9

× 3−5 µm, ovoid to broadly ellipsoid to rounded, pale yellow and smooth.

Material Examined: Pakistan, Khyber Pakhtunkhwa, Malakand, Hazar

Nao, 1200 m asl, on Helictotrichon virescens, 21-09-2013, S. Hussain (LAH-

SHsmut-1); Australia, Brisbane, (BRIP 61071).

Comments: Urocystis avenastri has previously been reported from northern

Pakistan, on Helictotrichon virescens (Ahmad et al., 1997). It is a new record for

Malakand.

180

Figure 87. Urocystis avenastri. A–E. Spore balls of teliospores. Scale bar: 6 µm.

181

3.52. Diversity of Basidiomycetous fungi

To find out the diversity of basidiomycetous fungi, a number of collection trips to different region of the study area were conducted. Sampling was done randomly in rainy season, dry season and spring, during 2013 and 2014, as discussed earlier at page 8 (2.1). Data on diversity of basidiomycetous fungi were compiled for

Dargai and Batkhela tehsils of district Malakand. More than 150 samples were collected and identified up to species level. They collected specimens comprised of 51 species belonging to 29 genera of 17 families of Basidiomycota.

3.52.1 Diversity of basidiomycetous fungi in Dargai tehsil

Sampling sites in Dargai tehsil were Qaldara, Kharkia, Jaban, Dargai, Palai, Kot and Sakhakot. During this study, highest diversity of basidiomycetous fungi was found in this tehsil with 47 species belonging to 26 genera (Table 2, Figure 88).

Agaricaceae was found the most diverse family in this study with 6 genera and 10 species, followed by Psathyrellaceae with 4 genera and 12 spp. Similarly, Puccinia was found as one of the most species rich genus with 9 species during this study

(Figure 89).

3.52.2 Diversity of basidiomycetous fungi in Batkhela tehsil

Areas which were explored for diversity of basidiomycetous fungi in Batkhela tehsil are Hazar Nao, Agra, Batkhela and Tahna. In this tehsil, 14 species belonging to 12 genera were reported (Table 3, Figure 90). Here, it was noted that total no. of different species are less as compared to Dargai tehsil, however, this tehsil is more diverse with respect to the presence of different genera.

182

Table 2. Diversity Indices of different basidiomycetous fungi of tehsil Dargai, district Malakaknd. Simpson’s Sr. No. Basidiomycetous species Diversity Index No. individuals D=∑n(n-1) / N(N-1) 1 Agaricus bisporiticus 15 0.0013 2 A. campestris 2 0.00002 3 A. malakandensis nom. prov. 17 0.0017 4 A. minorus nom. prov. 18 0.0019 5 Hymenagaricus pakistaniensis nom. prov. 10 0.0005 6 Leucoagaricus badius nom. prov. 6 0.00019 7 La. sultanii nom. prov. 15 0.0013 8 Leucocoprinus brinbaumii 5 0.00012 9 Lycoperdon dermoxanthum 3 0.00003 10 Tulostoma ahmadii 20 0.0024 11 Conocybe papillata 6 0.00019 12 Cantharocybe pakistanicus nom. prov. 14 0.0015 13 Termitomyces umkowaan 7 0.0002 14 Marasmiellus palmivorus 9 0.0004 15 Omphalotus nidiformis 1 0.00001 16 Pleurotus cystidiosus 2 0.00002 17 Volvariella bombycina 3 0.00003 18 Coprinellus curtus 4 0.00004 19 Co. disseminatus 19 0.0021 20 Co. micaceus 8 0.0003 21 Co. radians 6 0.00019 22 Coprinopsis hispidus nom. prov. 12 0.0008 23 Parasola auricoma 8 0.0003 24 Pa. lentiformis nom. prov. 5 0.00012 25 Pa. lilatincta 10 0.0005 26 Pa. malakandensis nom. prov. 23 0.0032 27. Pa. schroeterii 3 0.00003 28 Psathyrella candolleana 10 0.0005 29 Ps. fusiformis 15 0.0013 30 Agrocybe pediades 4 0.00004 31 Stropharia ambigua 6 0.00019 32 Geastrum vilutinum 2 0.00002 33 Phellinus badius 2 0.00002 34 Irpex lacteus 2 0.00002 35 Earliella scabrosa 6 0.00019 36 Trametes cubensis 2 0.00002

183

37 Trametes lactinae 2 0.00002 38 Phragmidium papillatum 7 0.0002 39 Ph. rubi-idaei 10 0.0005 40 Puccinia aestivalis 15 0.0013 41 Pu. conclusa 5 0.0001 42 Pu. duthei 7 0.0002 43 Pu. microspore 10 0.0005 44 Pu. nakanishikii 9 0.0004 45 Pu. striformis var. striformis 8 0.0003 46 Pu. violae 10 0.0005 47 Puccinia melanocephala 13 0.0009

184

Table 3. Diversity Indices of different basidiomycetous fungi of tehsil Batkhela, district Malakaknd. Simpson’s Sr. No. Basidiomycetous species Diversity Index No. individuals D=∑n(n-1) / N(N-1) 1 Leucoagaricus badius nom. prov. 3 0.0019 2 Lycoperdon dermoxanthum 2 0.0006 3 Cantharocybe pakistanicus nom. prov. 5 0.0064 4 Termitomyces umkowaan 3 0.0019 5 Pleurotus cystidiosus 1 0.0003 6 Volvariella bombycina 2 0.0006 7 Coprinellus disseminatus 7 0.0136 8 Co. micaceus 3 0.0019 9 Parasola auricoma 6 0.0097 10 Agrocybe semiorbicularis 10 0.0291 11 Rigidoporus vinctus 2 0.0006 12 Phragmidium rubi-idaei 2 0.0006 13 Uromyces lespedezae-procumbentis 5 0.0064 14 Urocystis avenastri 5 0.0064

185

Table 3. Diversity Indices of different families of Basidiomycota of district Malakaknd.

Simpson’s Sr. No. Diversity Index Families No. individuals D=∑n(n-1) / N(N-1)

1 Agaricaceae 116 0.065 2 Bolbitiaceae 6 0.00014 3 Hygrophoraceae 19 0.0016 4 Lyophyllaceae 10 0.00044 5 Omphalotaceae 10 0.00044 6 Pleurotaceae 3 0.00002 7 Pluteaceae 5 0.00009 8 Psathyrellaceae 139 0.0940 9 Strophariaceae 20 0.0018 10 Geastraceae 2 0.000009 11 Hymenocheataceae 2 0.000009 12 Meruliaceae 2 0.000009 13 Miripelaceae 2 0.000009 14 Polyporaceae 10 0.00044 15 Phragmidiaceae 19 0.0016 16 Pucciniaceae 82 0.032 17 Urocystidaceae 5 0.00009

186

0.0035 0.0032

0.003

0.0025

0.0024 0.0021

0.002

0.0019 0.0017

0.0015 0.0015

0.0013

0.0013 Diversity (D) Diversity

0.001 0.0009

0.0008 0.0005 0.0005

0 1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 Species

Figure 88. Species diversity index of Dargai tehsil. 1. Agaricus bisporiticus, 2. A. campestris, 3. A. malakandensis, 4. A. minorus, 5. Hymenagaricus pakistaniensis, 6. Leucoagaricus badius, 7. La. sultanii, 8. Leucocoprinus brinbaumii, 9. Lycoperdon dermoxanthum, 10. Tulostoma ahmadii, 11. Conocybe paillata, 12. Cantharocybe pakistanicus, 13. Termitomyces umkowaan, 14, Marasmiellus palmivorus, 15. Omphalotus nidiformis, 16. Pleurotus cystidiosus, 17. Volvariella bombycina, 18. Coprinellus disseminatus, 19. Co. micaceus, 20. Co. radians, 21. Co. radians, 22. Coprinopsis hispidus, 23. Parasola auricoma, 24. Pa. lentiformis, 25. Pa. lilatincta, 26. Pa. malakandensis, 27. Pa. schroeterii, 28. Psathyrella candolleana, 29. Ps. fusiformis, 30. Agrocybe pediades, 31. Stropharia ambigua, 32. Geastrum vilutinum, 33. Phellinus badius, 34. Irpex lacteus, 35. Earlialla scabrosa, 36. Trametes cubensis, 37. Tra. lactinae, 38. Phragmidium papillatum, 39. Ph. rubi-idaei, 40. Puccinia aestivalis, 41. P. conclusa, 42. P. duthei, 43. P. microspora, 44. P. nakanishikii, 45. P. striformis var. striformis, 46. P. melanocephala, 47. Pu. violae.

187

0.1 0.094 0.09 0.08

0.07 0.065 0.06 0.05

0.04 Diversity (D) Diversity 0.03 0.02

0.01

0.0018

0.0016

0.00044 0.00044 0.00044

0.00014

0.00009

0.00002

0.000009 0.000009 0.000009 0.000009 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14

Species

Figure 89. Species diversity index of Batkhela tehsil. 1. Leucoagaricus badius, 2. Lycoperdon dermoxanthum, 3. Cantharocybe pakistanicus, 4. Termitomyces umkowaan, 5. Pleurotus cystidiosus, 6. Volvariella bombycina, 7. Coprinellus disseminatus, 8. Co. micaceus, 9. Parasola auricoma, 10. Agrocybe semiorbicularis, 11. Rigidoporus vinctus, 12. Phragmidium rubi-idaei 13. Uromyces lespedezae-procumbentis, 14. Urocystis avenastri.

188

0.1 0.065 0.09

0.08

0.07 0.094

0.06

0.05

Diversity (D) Diversity 0.04 0.032 0.03

0.02

0.01

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Families

Figure 90. Diversity index of different families of Basidiomycota of Malakand. 1. Agaricaceae, 2. Bolbitiaceae, 3. Hygrophograceae, 4. Lyophyllaceae, 5. Omphalotaceae, 6. Pleurotaceae, 7. Pluteaceae, 8. Psathyrellaceae, 9. Strophariaceae, 10. Geasteraceae, 11. Hymenocheataceae, 12. Meruliaceae, 13. Miripelaceae, 14. Polyporaceae, 15. Phragmidiaceae, 16. Pucciniaceae, 17, Urocystidaceae.

189

Chapter-4

DISCUSSION

In the present study, more than 150 specimens of basidiomycetous fungi were collected from subtropical and dry temperate regions of district Malakand during

2013 and 2014. The collected specimens comprised of 51 species belonging to 29 genera of 17 families of Basidiomycota. The specimens were characterized by morphological and anatomical features of basidiomata. Their phylogenetic analyses were studied based on internal transcribed spacer (ITS) and LSU of rDNA, region 6–7 of the gene for the second largest subunit of RNA polymerase II

(rpb2) and translation elongation factor 1α (tef-1α).

Among Basidiomycotina, Agaricaceae is an important family of tropical region

(Parra, 2013), represented in this study by six genera: Agaricus L., Hymenagaricus

Heinem., Leucoagaricus Locq. ex Singer, Leucocoprinus Pat., Lycoperdon Pers. : Pers. and Tulostoma Pers. Species identification in these genera on morpho-anatomical basis are usually problematic, therefore rDNA regions (ITS and LSU) and protein coding genes (rpb2, tef-1α) are the most important tools for species delimitation in

Agaricaceae (Vellinga, 2004; Ge et al., 2015).

Agaricus is one of the most important genus of the family, nearly represented by

400 species, where most of the records are from tropical countries (Zhao et al., 2011;

Parra, 2013; Thongklang et al., 2014). In Pakistan, 21 species of Agaricus have been reported (Ahmad et al., 1997; Sultana et al., 1997; Thongklang et al., 2014). In the present study, four taxa of Agaricus are documented, viz., A. bisporiticus, A.

190 camperstris, A. malakandensis nom. prov., and A. minorus nom. prov. Section

Xanthodermatie Sing., is represented in this study by one species, Agaricus bisporiticus. Members of this section are commonly characterized by a negative

Schaffer’s reaction, a positive KOH reaction (yellow), an odor of phenol, a yellow discoloration when cut or touched (Kerrigan et al., 2005; Parra, 2013). Yellow discoloration can be noted in section Minores with characteristic almond odor. The new species Agaricus malakandensis nom. prov., is placed in Minores due to yellow staining reaction, almond odor and a hanging annulus. On the basis of maximum likelihood analysis the close relative of the Agaricus malakandensis nom. prov., is A. goossensiae (JF514519). However, Agaricus goossensiae has larger pileus (25–50 mm diam.), whitish ocher to deep yellow squamules, larger basidiospores (6–7.5 × 4.5–

5.5 µm) and basidia (25–30 × 7–9 µm) and similar pileiplles but with clamp connections (Moreno et al., 1990). Similarly, the new species Agaricus malakandensis nom. prov., was recovered in separated clade with excellent bootstrap support.

Another species in section Minores is Agaricus minorus nom. prov., forming a well- supported clade with Agaricus sp. (JF7277871 MATTA774).

Hymenagaricus is represented by 10 species and most of the records are from tropical areas (Kirk et al., 2008). Taxa of this genus can be distinguished from other taxa of the family by their hymenidermal to psuedoparenchymatous structure of pileal elements (Heinemann & Little Flower, 1984). In this study, Hymenagaricus is represented by some important collections H. pakistaniensis nom. prov., (SH-207,

SH-315, SH-389). Morpho-anatomically and phylogenetically, these collections

191 appear to be an undescribed species in the genus. Using maximum likelihood analysis Hymenagaricus pakistaniensis nom. prov. falls in Hymenagaricus clade. The close relative of the new taxon are: Hymenagaricus taiwanensis Zhu L. Yang, Z.W.

Ge & C.M. Chen (DQ006271) and H. epipastus (Berk. & Broome) Heinem. & Little

Flower (HM436649). Spore size and shape of Hymenagaricus pakistaniensis nom. prov. and H. taiwanensis are almost similar, however the later has larger pileus (15–

35 mm) with yellow brown to dark brown squamules, incurred margins, crowded lamellae and with a larger stipe of 40–70 × 6–9 mm (Yang et al., 2008).

Hymenagaricus epipastus has larger stipe (40 × 7 mm), smaller basidiospores (3.7–

4.7 µm) than our newly described species (Heinemann & Little Flower, 1984).

The genus Leucoagaricus includes approximately 90 established species (Kirk et al.,

2008). However, this number does not reflect the recent work that has added a number of species to this genus (Liang et al., 2010; Vellinga et al., 2010; Malysheva et al., 2013; Justo et al., 2015; Ge et al., 2015; Qasim et al., 2015). Species of

Leucoagaricus can be recognized macroscopically by having small to medium size basidiomata that vary from fragile and slender to sturdy and fleshy; a pileus surface that is radially fibrillose, floccose, squamulose to fibrillose-scaly, and rarely granulose; an entire or very narrow striate margin; a thin or thick context that may or may not stain when bruised; free lamellae and a central, equal to bulbous stipe, with a membranous, sometimes moveable, annulus. The basidiospores lack germ pores, or rarely have a rudimentary germ pore; with thin, smooth to ornamented spore walls; the pileipellis is either a trichoderm or a cutis

192 of repent and radially arranged hyphae lacking sphaerocystes; pleurocystidia rarely are present but are mostly absent; cheilocystidia are frequent and lack clamp connections (Singer, 1986; Vellinga, 2001).

Phylogenetic studies have revealed that Leucoagaricus is a heterogeneous assemblage. Species of Leucoagaricus and Leucocoprinus Pat. intermix in a clade in the large phylogenetic tree (Vellinga, 2003, 2004; Vellinga et al., 2011). Taxonomic and phylogenetic relationships among many of the species of Leucoagaricus and

Leucocoprinus have not been resolved due to limited availability of molecular data for described species. Morphological characters are primarily used to distinguish

Leucoagaricus from Leucocoprinus. Leucocoprinus species have a plicate pileus, spores with apical germ pores and hymenia with pseudoparaphyses (Singer,

1986). We place our species in Leucoagaricus because they are more similar to features outlined above or to that genus.

Phylogeny based on four gene regions (ITS, nrLSU, rpb2, tef-1α) revealed that both the new species, Leucoagaricus badius and La. ahmadii fall in section Rubrotincti.

The main distinguishing features of Leucoagaricus badius are: fragile basidiomata with dark red pileus, covered by radially arranged fibrillose squamules tinged and a deep red umbo; basidiopsores amygdaliform to ovoid, slightly thick-walled, without germ pore; cheilocystidia smooth, fusiform; pileipellis cutis of radially arranged elements.

In the maximum likelihood analysis of ITS sequences, Leucoagaricus badius falls within the section Rubrotincti. The close relatives are La. vassiljevae E. F. Malysheva,

193

T. Yu. Svetasheva & E. M. Bulakh, La. sublittoralis (Kühner ex Hora) Singer, and the newly described species La. pakistaneinsis.

Leucoagaricus vassiljevae differs from La. badius by its medium-size pileus with appressed red-brown or crimson-brown fibrils, deep brown umbo; longer stipe

(50–130 mm), with similarly shaped spores that are larger in size (8–11 × 4–5 µm) and with apical papilla; and broadly narrowly clavate to subutriform or cylindrical cheilocystidia (Malysheva et al., 2013). Whereas La. sublittoralis differs in its pale pink-brown pileus and cheilocystidia that are more variable, from clavate to narrowly clavate. It differs from La. rubrotinctus mostly by the shape of spores

(Vellinga, 2001). There is a species recently described from Pakistan, La. lahorensis, with brownish pileus covering, basidiospores (8–10 × 6–7 µm) mostly ellipsoid to amygdaliform, with narrowly clavate to subcylindrical cheilocystidia (Qasim et al.,

2015). Leucoagaricus subpurpureolilacinus Z.W. Ge & Zhu L. Yang with similarly shaped spores differs from our species by its broad, brown to dark ruby umbo and clavate cheilocystidia with gelatinized covering intermixed with crystals (Ge et al.,

2015).

Leucoagaricus sultanii can be distinguished from other species by its medium sized, white basidiomata, depressed pileus with dark yellowish umbo, slightly fibrillose squamules, with uplifted pileus margins, amygdaliform basidiospores; fusiform to cylindrical cheilocystidia, pileipellis a cutis with radially arranged cells.

The taxa closely related to Leucoagaricus sultanii are: La. asiaticus, La. crystallifer La. menieri, La. subvolvatus and La. subcrystallifer.

194

Leucoagaricus sultanii resembles La. asiaticus in some morphological features, for example, both the species have medium-sized basidiomata, bulbous stipes and amygdaliform spores, however, the later has a dark brown umbo with grayish brown squamules and comparatively larger (7–10 × 5–6.5 µm) basidiospores (Ge et al., 2015).

Leucoagaricus crystallifer has cream to ocher colored umbo, inflexed margin, crystalline cheilocystidia and longer spores (5.5–9.0 × 3.5–4.5 µm; Vellinga 2001).

Similarly, the two white species La. menieri (Sacc.) Singer and La. subvolvatus, both have similarly shaped basidiospores and cheilocystidia with crystals at the apex.

However, La. menieri has fragile, shining, sericeous basidiomata and La. subvolvatus has stout, fleshy basidiomata with a white to cream pileus, roundish stipe base that is somewhat volvate (Candusso & Lanzoni, 1990; Bon, 1996).

Leucoagaricus subcrystallifer is a white species with greenish gray to yellow gray cutis with olive gray to dark gray umbo, with large-sized spores (7.5–8.5 µm; Ge et al., 2015).

Members of Leucocoprinus have a plicate pileus, spores with apical germ pores and hymenia with pseudoparaphyses (Singer, 1986). Four species including Lc. birnbaumii of the genus have been reported from Pakistan (Ahmad et al., 1997).

The genus Tulostoma is a large group of gasteroid fungi, commonly called stalked puffballs. Distinguishing features of the genus include rounded spore case with apical mouth attached to a stipe. It is represented by 81 established species (Kirk et al., 2008; Caffot et al., 2011) but more than 100 names for this group have been

195 cited in the literature (Wright, 1987; Moreno et al., 1992, 1995, 2002; Fan & Liu,

2005). The distribution of these fungi is worldwide, but it prefers xeric, warm and sandy habitats (Wright, 1987; Esqueda-Valle et al., 2000). Most of the taxa of this genus are found throughout the year.

Previously, 24 taxa in the genus Tulostoma have been reported from Pakistan

(Ahmad et al., 1997). In the present study, a new species, Tulostoma ahmadii has been published (Hussain et al., 2016).

Conocybe paillata (SHP-16) a member of family Boltbitiaceae Singer, is a new record for Pakistan, inferred by molecular analysis of ITS region. Anatomically C. paillata

(SHP-16) is much closer to the type description of this taxon (Hausknecht & Nagy

2007), however its phylogenetic position reveals that more molecular data are needed for the accurate systematic of Pakistani collections of Conocybe.

Hygrophoraceae Losty, an important agaric family with 600 species (not all described) and 26 named genera, and thus one of the larger families in the

Agaricales (Moncalvo et al., 2002; Lodge et al., 2014). Most of the members of this family are mycorrhizal with trees (Seitzman et al., 2011; Tedersoo et al., 2010), ferns and bryophytes (Lawrey et al., 2009).

In this study, Hygrophoraceae is represented by a single taxon of the genus

Cantharocybe H.E. Bigelow & A.H. Sm. The specimen (SH-1) was studied morph- anatomically and phylogenetically based on LSU of rDNA region. Morphology and anatomy of specimen (SH-1) is closely similar to Cantharocybe virosa. We studied the anatomical features of the Canthrocybe virosa loaned from Tennessee

196

Herbarium (# 063482) for comparison. Anatomical features of the loaned materials match almost similar with our collections (SH-1, SH-2, SH-290). Sequences of our collections get separated in the phylogenetic tree from the Tennessee collection, which shows that Cantharocybe pakistanicus is different species from already described species of C. virosa.

The genus Termitomyces introduced by Heim. (1942), belongs to family

Lyophyllaceae Jülich, are edible mushrooms. Species of Termitomyces has world- wide distribution and have been reported from Asia (Pegler & Vanhaecke, 1994),

Africa (Otieno, 1964), Europe (Olila et al., 2007), America (Gómes, 1995; Tibuhwa et al., 2010), India (Natarajan, 1979) and from Pakistan (Ahmad et al., 1997).

Previously, six species of the genus have been reported from Pakistan based on mopho-anatomical features. In this study, T. umkowaan (Cooke & Massee) D.A.

Reid, is reported form Malakand and is a new record for Pakistan (Hussain et al.,

2015a).

Marasmiellus palmivorus (Sharples) Desjardin, and Omphalotus nidiformis (Berk.)

O.K. Mill. (Omphalotaceae Bresinsky), have been reported from Malakand, and their anatomical descriptions along with phylogenetic trees inferred from ITS region of nuclear ribosomal DNA ara provided. Marasmiellus palmivorus is a new record for Pakistan as pathogenic mushroom of sugar cane.

Pleurotus cystidiosus O.K. Mill, a highly medicinal and edible mushroom of family

Pleurotaceae Kühner, is reported from Malakand as an addition to the edible

197 mushroom flora of Pakistan. Eight species of the genus have already been reported on morpho-anatomical bases from our country.

Volvariella Speg. an important genus in family Pluteaceae, is represented by 50 species (Kirk et al., 2008). Distinguishing features of the genus are: stipe with volva at the base, free and crowded lamellae, fruiting bodies decay quickly and pinkish brown spores (Singer, 1986). Six species of this genus have been reported from

Pakistan (Ahmad et al., 1997). In the present study, Volvareilla bombycina is reported from Malakand region of Pakistan.

Psathyrellaceae Vilgalys, Moncalvo & Redhead is an important family of coprinoid mushrooms. In the present, it is study represented by four genera:

Coprinellus P. Karst., Coprinopsis P. Karst., Parasola Redhead Vilgalys and Hopple and Psathyrella (Fr.) Quel. To avoid confusion in naming, the author used Cop for

Coprinellus, Crp for Coprinopsis, Pa for Parasola and Ps for Psathyrella.

Mushrooms with deliquescent gills, dark brown to blackish spores with germ pore and thin-fleshed pileus becoming plicate on opening are commonly called coprinoid mushrooms (Schafer, 2010). Coprinellus is an interesting genus in coprinoid mushrooms with approximately 100 species (Kirk et al., 2008; Nagy et al., 2012; Gomes & Wartchow, 2014). Taxa of this genus are divided in 3 sections on the basis of presence or absence of veil. Section Setulosi (Lange) Schaf., is characterized with the presence of hair-like setules on pileus and stipe covered with cystidia. In Micacei (Fr.) Schaf. veil is present in the form of gelatinizing meca- like granules usually washed-off by rain drops, consisting mainly of globose thin-

198 walled cells in a matrix of narrow, branched hyphae. Whereas Domestici (Sing.)

Schaf., have more persistent veil of floccose scales, including chains of cells; yellow-brown, inflated to a fusiform, ellipsoid or globose shape between the septa.

In present study, four taxa of Coprinellus, viz, Co. curtus, Co. disseminatus, Co. micaceus and Co. radians are reported. Descriptions of morpho-anatomical features and phylogenetic relationships inferred by ITS region of nuclear ribosomal DNA of these taxa were analyzed. Coprinellus curtus, a small deliquescent mushroom as a new record for Pakistan.

The genus Coprinopsis comprised of approximately 200 species (Kirk et al., 2008), classified in five sections on basis of veil structure (Schafer, 2010). Species of section Artramentarii (Fr.) Schaf., have large basidiomata, stipe with characteristic ring-like lines, veil thin and attached (sometimes hardly visible), pileus colored whitish or brown, not plicate. In section Alachuani (Singer) Schaf., veil is filamentous but branched or diverticulate, thick or thin-walled. The representative species Coprinopsis hispidus belongs to section Lanatuli due to presence of filamentous veil with chains of elongated cells, generally unbranched with pointed tips. On the basis of phylogenetic tree, the close relative of Coprinopsis hispidus is

Cop. insignis (Peck) Redhead, Vilgalys & Moncalvo. Morphologically Coprinopsis insignis has larger pileus (100 mm) with greyish veil, larger stipe (80–150 × 4–12

µm), basidiospores amygdaliform, with conspicuous warts (Gierczyk et al., 2011).

Section Narcotici (Uljé & Noordel.) Schaf., has veil cells with nipple-shaped warts/peg-like protrusions on the globose cells forming part of the cell walls.

199

Whereas Nivei (Citérin) Schaf., with rounded veil cells, smooth or encrusted with angular lumps that are not forming part of the cell wall, spores without myxosporium, and without unpleasant smell.

The genus Parasola, is an important group of collapsing coprinoid mushrooms, with 22 established species (Kirk et al., 2008; Schafer, 2014). It is considered as a fairly homogenous group of mushrooms, with deeply plicate pileus (in all species but P. conopilus) and without a veil (Doveri, 2004). These mushrooms are common decomposers of leaf-litter, wood, herbivore dung and are distributed world-wide with most of the records from Europe, North America, Africa, Lesser Antilles

(Pegler, 1966, 1983; Dennis, 1970; Orton & Watling 1979; Uljé & Bas, 1988; Uljé &

Bender, 1997; Schafer, 2014 ) and some from Asia (Ahmad, 1980; Pegler, 1986) and

Australia (Grgurinovic, 1997).

Basidioma maturation in Parasola differs from true deliquescence as in Coprinus

Pers. s.s, Coprinopsis, Coprinellus and non-deliquescent as in Psathyrella but treated as partial deliquescence or collapsing (Nagy et al., 2009, 2010).

Previously, based on morphology, only three species [Pa. auricoma, Pa. plicatilis

(Curtis: Fr.) Redhead, Vilgalys & Hopple and Pa. setulosa (Berk. & Broome)

Redhead, Vilgalys & Hopple] of this genus have been reported from Pakistan

(Ahmad, 1980). In the present work, five species viz, Parasola auricoma, Pa. lentiformis, Pa. lilatincta, Pa. malakandensis and Pa. schroeteri are reported and their morpho-anatomical features along with phylogenetic analyses inferred by the rDNA region (ITS) are provided. Parasola lentiformis and Pa. malakandensis seem

200 new species on the basis of anatomical features and phylogenetic analyses. Parasola lilatincta and Pa. schroeteri are described here as new records for Pakistan.

The diagnostic features of Parasola malakandensis are: basidiospores 13–18 × 12–15.7

× 10–13 µm, in face view mostly ovoid, broadly ellipsoid to, subglobose, rarely heart shaped or with broad papilla, in side view ellipsoid to amygdaliform, with central germ-pore of 1.4–2.4 µm diameter; wall 1.5 µm thick; with sclerocystidia

70–165 × 5–10 µm, dark brown and thick-walled.

Using maximum likelihood phylogenetic analysis, species in the genus Parasola clustered in three clades. Clade I comprises of taxa of section Glabri, whereas clade

II and III have species of Auricomi. Both sections share plicate pileus (except P. conopilus), complete absence of any velar structure and the ability of fruitbodies to collapse (Nagy et al., 2009). However, taxa of section Glabri have no sclerocystidia on the pileipellis and have basidiospores with an eccentric germ pore, whereas species in section Auricomi have sclerocystidia and spores with a central germ pore. Anatomically, the newly described species P. malakandensis is placed in

Auricomi due to the above mentioned features. Within section Auricomi, the newly described species can be easily recognized by its spore size.

Parasola lentiformis seems another undescribed species of Parasaola, with lentiform basidiospores. Parasola lentiformis is placed in section Glabri as it has basidiospores with an accentric germ pore and piliepellis without sclerocystidia. Phylogenetic analyses inferred by ITS region of nrDNA shows that Parasola lentiformis clustered in Glabri section of Parasola.

201

Psathyrella is a larger genus in Psathyrellaceae with approximately 600 species

(Kirk et al., 2008). Important features of basidioma include: pileus mostly thin and fragile, frequently distinctly hygrophanous, often glittery when faded; veil development various; stipe central, usually tubulose, flexuous or straight, radiant or not; spore print of some shade of cocoa color to chocolate–black, dull brick red, or avellaneous; spores typically with a truncate germ pore, rarely with a non– truncate very narrow pore and in a few species without trace of a germ pore, mostly smooth, with complex wall, fading appreciably in concentrated H2SO4; hyphae usually with clamp connections (Singer, 1986; Smith, 1972). From Pakistan

16 species of Psathyrella have been reported (Ahmad, 1980).

In the present study, two taxa Psathyrella candolleana and Ps. fusiformis nom. prov.

(SH-107) are studied morpho-anatomically and phylogenetically. Psathyrella fusiformis nom. prov., is placed in section Spintrigerae on account of utriform cheilocystidia and lamellae lacking pleurocystidia (Kits and Waveren, 1985). The unique features of Psathyrella fusiformis nom. prov., are light brown to hyaline spores in water, average size of spores is 10.3 × 6 µm, and spores with rudimentary germ pore. More than 100 species of Psathyrella are described world-wide that are without pleurocystidia (Singer, 1962; Smith, 1972; Kits and Waveren, 1985). About one-third of them has a spore length of 8 µm on average. Using maximum likelihood analysis, the close relative of the new species Psathyrella fusiformis nom. prov. is Ps. sulcatotuberculosa (J. Favre) Einhell. However, the later has smaller

202 basidiospores (7.4 × 4.4 µm), germ pore indistinct or absent (Battistin et al., 2014) as compared to our species.

Family Strophariaceae Singer & A.H. Sm., is represented by two genera Agrocybe

Fayod., and Stropharia (Fr.) Quél., in this study. Anatomical descriptions and maximum likelihood phylogenetic analyses demonstrate that Agrocybe semiorbicularis and Stropharia ambigua are previously not reported from Pakistan.

Geastrum Pers. is a genus of Geastraceae (order: Geastrales), having more than 50 species worldwide (Kirk et al., 2008). In Pakistan, 28 species of Geastrum have been reported (Ahmad et al., 1997; Yousaf, 2014). In this study, Geastrum velutinum

Morgan, is reported as a new record for Pakistan.

The order Hymenochaetales is represented by a single family Hymenochaetaceae, with Phellinus badius (Cooke) G. Cunn., which is previously described on morpho- anatomical basis from Pakistan (Ahmad et al., 1997). For the first time, molecular phylogenetic relationships of this taxon are studied in the country. It is also a new record for Malakand.

The Polyporales are generally known as polypores, represented by 3 families in this study, viz., Miripelaceae, Mirulaceae and Polyporaceae. The latter is the largest family of polyporoid fungi of Pakistan with 65 described species (Ahmad et al., 1997). Three taxa, Earliella scabrosa (Pers.) Gilbn. and Ryv., Trametes cubensis

(Mont.) Sacc. and Trametes lactinae (Berk.) Sacc., of Polyoraceae are described and phylogenetic tree based on ITS region of ribosomal DNA are provided. Trametes cubensis is a new record and is an addition in the polyporoid fungi of Pakistan.

203

The Pucciniomycotina are a diverse and important group of fungi that constitutes the three subphyla of Basidiomycota. More than 8000 species of rust fungi have been described world-wide that cause a variety of diseases in cereals, vegetables and trees (Aime et al., 2006). From Pakistan, more than 446 taxa of rust fungi are reported (Fiaz, 2013; Sadiqullah et al., 2014; Hussain et al., 2015c). In the present study 11 species of rusts were studied, belonging to 3 genera, viz., Phragmidium

Link, Puccinia Pers. and Uromyces (Link) Unger.

The two species of Phragmidium, Ph. Papillatum and Ph. rubi-idaei are reported in this study from Malakand region and are new records for this area.

The genus Puccinia Pers. contains about 4000 established species (Kirk et al., 2008), although more than 5000 names of species, varieties and forms for these fungi are available in the literature (http://www.indexfungorum.org/Names/Names.asp).

Members of this genus reported from Pakistan so far are more than 200, infecting different cereals, vegetables, and fruit trees (Ahmad et al., 1997; Afshan, 2009;

Afshan & Khalid, 2013, Ishaq et al., 2013; Saba et al., 2013; Fiaz, 2013, Hussain et al.,

2015c). In the present study, 08 taxa of Puccinia are reported from Malakand region. Out of which, three species are new records for Pakistan, viz., Puccinia microspora infecting leaves of Imperata cylindrica, P. nakanishikii parasitizing

Sorghum helapense and P. melanocephala on Saccharum bengalense.

Previously four Puccinia spp. on different Saccharum taxa have been reported from

Pakistan (Afshan & Khalid, 2013). Puccinia kuehnii Butl. on Saccharum bengalense, S.

204 munja, S. officenarum and S. spontaneum; P. coronata var. avenae and P. miscanthi on

S. ravennae and P. melenocephala on S. spontaneum.

Ustilaginales is a diverse group of fungi that parasitizes different angiosperms, mostly monocots. These fungi are commonly called smuts, found throughout the world, however most of the records are found from tropical, temperate or arctic regions (Mordue & Ainsworth, 1984). More than 1650 species of smuts fungi have reported world-wide (Vanky, 2012), whereas in Pakistan, 123 species of these fungi have been found on different host plants (Ahmad et al., 1997; Fiaz, 2013; Fiaz et al.,

2013). In the present study one smut fungus Urocystis avenastri is reported infecting

Helictotrichon virescens. It is a new record for Malakand region.

205

CONCLUSION

Basidiomycota is a large and diverse assemblage of higher fungi, having more than

31000 described species (Kirk et al., 2008). Approximately 1500 taxa of this group have been reported from Pakistan.

From the present study, it can be concluded that Malakand region is very rich and diverse in mushroom forming fungi. It seems that most of the coprinoid (5 new species and 3 new records for Pakistan) and other agarics (5 new species and 5 new records) of the area are undescribed, followed by gasteroid fungi (with one new species). Similarly, in case of rust fungi, 3 new records are reported as an addition in the rust flora of Pakistan.

206

RECOMMENDATIONS

 Morphological features are still the primary tools for identification but

molecular techniques should be practiced for accurate systematic

placement of basidiomycetous fungi.

 More research explorations are needed to document the diversity of these

fungi of the district Malakand.

 Collaborative research projects with Agriculture and Forest Departments

are required to make the more efficient use of these fascinating groups of

organisms which are famous for their food values, mycorrhizal association

with forest trees and causing serious diseases in economically important

crops.

207

Chapter-5

REFERENCES

Afshan, N. S. 2009. A Contribution to the rust flora of AJ and K (Azad Jammu and

Kashmir) and Adjacent Northern Areas of Pakistan, PhD thesis,

Department of Botany, University of the Punjab, Lahore, Pakistan.

Afshan, N. S. and A.N. Khalid. 2013. Check list of the rust fungi on Poaceae in

Pakistan. Mycotaxon, 125: 17.

Afshan, N. S. and A.N. Khalid. 2014. New Records of Phragmidium species from

Pakistan. Mycotaxon, 128: 63-70.

Afshan, N.S. and A.N. Khalid. 2008. New rust fungi on noxious weeds from

Pakistan. Pakistan Journal of Phytopathology, 20: 82–87.

Afshan, N.S., A.N. Khalid, A.R. Niazi and S.H. Iqbal. 2011. New records of

Uredinales from Fairy Meadows, Pakistan. Mycotaxon, 115: 203–213.

Afshan, N.S., A.N. Khalid and A.R. Niazi. 2012. Some new rust fungi (Uredinales)

from Fairy Meadows, Northern Areas, Pakistan. Journal of Yeast and Fungal

Reasearch, 3: 65–73.

Afshan, N.S., A.N. Khalid, M. Abbasi and A.R. Niazi. 2007. New records of rust

fungi form Pakistan. Mycotaxon, 101: 233–237.

Ahmad, S. 1952. Gasteromycetes of West Pakistan. Punjab University Press, Lahore

pp. 1-92.

Ahmad, S. 1955. Pezizales of Pakistan. Biologia 1: 1–24.

Ahmad, S. 1956a. Fungi of Pakistan. Biol. Soc. Pak. Lahore, Monogr. 1: 1–126.

208

Ahmad, S. 1956b. Uredinales of Pakistan. Biologia, 2: 29–101.

Ahmad, S, 1956c. Ustilaginales of West Pakistan. Mycological Papers, 64: 1–17.

Ahmad, S. 1967. Contributions to the fungi of Pakistan. VI. Biologia, 13: 15−42.

Ahmad, S. 1969a. Contributions to the fungi of Pakistan. IX. Biologia, 15: 1−10.

Ahmad, S. 1969b. Fungi of Pakistan. Biol. Soc. Pak. Lahore, Monogr. 5, Suppl. I,

Pp. 110.

Ahmad, S. 1972a. Contributions to the fungi of Pakistan. XIII. Biologia, 18: 1−6.

Ahmad, S. 1972b. Basidiomycetes of Pakistan. Soc. Pak. Lahore, Monogr. 6, Pp.

141.

Ahmad, S. and N. Ahmad. 1982. Contribution to the fungi of Pakistan. XX. Bull

Mycology, 2: 79−86.

Ahmad, S., S.H. Iqbal and A.N. Khalid. 1997. Fungi of Pakistan. Sultan Ahmad

Mycological Society of Pakistan, Department of Botany, University of the

Punjab, Lahore, Pakistan. ISBN 969-8368.

Ahmad. S. 1980. A contribution to the Agaricales of Pakistan. Bull Mycology, 1: 35–

90.

Aime, M.C., P.B. Matheny, D.A. Henk, E.M. Frieders, R.H. Nilsson, M.

Piepenbring, D.J. McLaughlin, L.J. Szabo, D.J Begerow, P. Sampaio, R.

Bauer, M. Weiss, F. Oberwinkler and D.S. Hibbett. 2006. An overview of

the higher-level classification of Pucciniomycotina based on combined

analyses of nuclear large and small subunit of rDNA sequences. Mycologia,

98: 896–905.

209

Anonymous. 2010. Crop statistics report for the year 2010-11, Department of

Agriculture, Govt of KP, Pakistan. Pp. 12–15.

Anwar, M. and C.C. Shank. 2002. Pakistan. In: Jeremy, C., (ed), Biodiversity

Planning in Asia. IUCN, Gland, Switzerland and Cambridge, UK. ISBN 2-

8317-0643-2. Pp. 430–447.

Bagyanarayana, G. and E.J. Ravinder. 1988. Puccinia microspora Diet. (Uredinales)-

-a new record for India from Andhra Pradesh State. Acta Botanica Indica, 16:

101−102.

Barkatullah and M. Ibrar. 2011. Plants profile of Malakand Pass Hills, District

Malakand, Pakistan. African Journal of Biotechnology, 10: 16521–16535.

Bass, T. and A. Richards. 2011. Three reasons to re-evaluate fungal diversity ‘on

Earth and in the ocean’. Fungal Biology Review, 25: 159-164.

Battistin, E., O. Chiarello, A. Vizzini, L. Örstadius and E. Larsson. 2014.

Morphological characterisation and phylogenetic placement of the very

rare species Psathyrella sulcatotuberculosa. Sydowia, 66: 171–181.

Binder, M. and D.S. Hibbett. 2002 Higher-level phylogenetic relationships of

homobasidiomycetes inferred from four rDNA regions. Molecular

Phylgenetics and Evolution, 22: 76–90.

Binder, M., D.S. Hibbett, K.H. Larsson, E. Larsson and E. Langer. 2005. The

phylogenetic distribution of resupinate forms in the homobasidiomycetes.

Systematics and Biodiversity, 3: 113–157.

210

Blackwell, M. 2011. The fungi: 1, 2, 3 … 5.1 million species? American Journal of

Botany, 98: 426–438.

Bon, M. 1996. Die Großpilzflora von Europa 3 Lepiotaceae. Eching, Germany:

IHW-Verlag. Pp. 153.

Buller, A.H.R. 1931. Researches on Fungi Vol. IV. Longmans Green & Co. London,

New York & Toronto, Pp 33–62.

Burni, T., H. Kiran, F. Hussain and Uzma. 2006. Some Macrofungi (Basidiomycota)

of District Abbottabad. Pakistan Journal of Plant Sciences, 12: 13–20.

Butler, E. J. and G. R. Bisby. 1933. The Fungi of India. Imp. Council Agric. Res. Sci.

Monogr. 1. Calcutta. Pp. 337.

Caffot, M.L.H., L.S. Dominguez, K. Hosaka and E.M. Crespo. 2011. Tulostoma

domingueziae sp nov from Polylepis australis woodlands in Cordoba

Mountains, central Argentina. Mycologia, 103: 1047–1054.

Candusso, M. and G. Lanzoni. 1990. Fungi Europaei 4. Lepiota s.l. Saronno, Italy:

Giovanna Biella. Pp. 743.

Cummins, G.B. 1971. The rust fungi of cereals, grasses and bamboos. Springer, New

York. http://dx.doi.org/10.1007/978-3-642-88451-1.

Denchev, C. M., M. Fiaz, T.T. Denchiv, A.N. Khalid and H. Ahmad. 2013.

Additions to the smut fungi of Pakistan 2. Mycotaxon, 123: 255-260.

Denchev, C.M., M. Fiaz, T.T. Denchiv, H. Ahmad and A.N. Khalid. 2012. Addition

to the smut fungi of Pakistan. Mycotaxon, 121: 165–170.

211

Dennis, R.W.G. 1970. Fungus flora of Venezuela and adjacent countries. Kew Bulletin

Additional Series, 3: 1–531.

Doveri, F. 2004. Fungi Fimicoli Italici: A guide to the recognition of basidiomycetes

and ascomycetes living on faecal material. AMB, Trento.

Drummond, A.J. and A. Rambaut. 2007. BEAST: Bayesian evolutionary analysis

by sampling trees. BMC Evolutionary Biology, 7: 214.

Eastwood, D.C., D. Floudas, M. Binder, A. Majcherczyk, P. Schneider, A. Aerts, F.

O. Asiegbu, S.E. Baker, K. Barry, M. Bendiksby, M. Blumentritt, P.M.

Coutinho, D. Cullen, R. P. de Vries, A. Gathman, B. Goodell, B. Henrissat,

K. Ihrmark, H. Kauserud, A. Kohler, K. LaButti, A. Lapidus, J.L. Lavin,Y-H.

Lee, E. Lindquist, W. Lilly, S. Lucas, E. Morin, C. Murat, J.A. Oguiza, J. Park,

A.G. Pisabarro, R. Riley, A. Rosling, A. Salamov, O. Schmidt, J. Schmutz, I.

Skrede, J. Stenlid, A. Wiebenga, X. Xie, U. Kües, D.S. Hibbett, D.

Hoffmeister, N. Högberg, F. Martin, I.V. Grigoriev, S.C. Watkinson. The

Plant Cell Wall–Decomposing Machinery Underlies the Functional

Diversity of Forest Fungi. Science, 333: 762–765.

Edgar, R.C. 2004. MUSCLE: multiple sequence alignment with high accuracy and

high throughput. Nucleic Acids Research, 32: 1792–1797.

Esqueda-Valle, M., E. Perez-Silva, T. Herrera, M. Coronado-Andrade and A.

Estrada-Torres. 2000. Composición de gasteromicetos en un gradiente de

vegetación de Sonora, México. Anales del Instituto de Biología Serie Botánica,

71: 39–62.

212

Fan, L. and B. Liu. 2005. Two new species of Tulostoma from China. Mycosystema,

24: 159–61.

Fiaz, M. 2013. Species Diversity of Basidiomycetes of District Mansehra, PhD

thesis, Department of Botany, Hazara University Mansehra, Khyber

Pakhtunkhwa, Pakistan.

Fiaz, M., A.N. Khalid and H. Ahmad. 2013. Sporisorium linderi, a new record for

Asia. Mycotaxon, 123: 229–231.

Fiaz, M., H. Ahmad, N.S. Afshan and A.N. Khalid. 2015. Some new records

of Uredinales from Khyber Pakhtunkhwa (KP), Pakistan. Mycotaxon, 130:

569–575.

Floudas, D., M. Binder, A. Majcherczyk, P. Schneider, A. Aerts, F.O. Asiegbu, S.E.

Baker, K. Barry, M. Bendiksby, M. Blumentritt, P.M. Coutinho, D. Cullen,

R.P. de Vries, A. Gathman, B. Goodell, B. Henrissat, K. Ihrmark, H.

Kauserud, A. Kohler, K. LaButti, A. Lapidus, J.L. Lavin, Y.H. Lee, E.

Lindquist, W. Lilly, S. Lucas, E. Morin, C. Murat, D. Floudas, M. Binder, R.

Riley, K. Barry, R.A. Blanchette, B. Henrissat, A.T. Martı´nez, R. Otillar, J.W.

Spatafora, J.S. Yadav, A. Aerts, I. Benoit, A. Boyd, A. Carlson, A. Copeland,

P.M. Coutinho, R.P. de Vries, P. Ferreira, K. Findley, B. Foster, J. Gaskell, D.

Glotzer, P. Go´recki, J. Heitman, C. Hesse, C. Hori, K. Igarashi, J.A. Jurgens,

N. Kallen, P. Kersten, A. Kohler, U. Ku¨es, T.K. Kumar, A. Kuo, K. LaButti,

L.F. Larrondo, E. Lindquist, A. Ling, V. Lombard, S. Lucas, T. Lundell, R.

Martin, D.J. McLaughlin, I. Morgenstern, E. Morin, C. Murat, L.G. Nagy, M.

213

Nolan, R.A. Ohm, A. Patyshakuliyeva, A. Rokas, F.J. Ruiz-Duen˜as, G.

Sabat, A. Salamov, M. Samejima, J. Schmutz, J.C. Slot, F. St John, J. Stenlid,

H. Sun, S. Sun, K. Syed, A. Tsang, A. Wiebenga, D. Young, A. Pisabarro,

D.C. Eastwood, F. Martin, D. Cullen, I.V. Grigoriev and D.S. Hibbett. 2012.

The Paleozoic origin of enzymatic lignin decomposition reconstructed from

31 fungal genomes. Science, 336: 1715–1719.

Gardes, M. and T.D. Bruns. 1993. ITS primers with enhanced specifity for

Basidiomycetes: application to identification of mycorrhizae and rusts.

Molecular Ecology, 2: 113–118.

Gardezi, S. R. A. 1998. Taxonomy, Morphology and Biochemical analysis of

Mushrooms of Azad Jammu and Kashmir. Ph.D. Thesis Dept. of Biological

Sciences, Quaid-e-Azam University, Islamabad, Pakistan Pp. 287.

Gardezi, S. R. A. and A. Najma. 2003. Mushrooms of Kashmir VII. Asian Journal of

Plant Sciences, 2: 464–452.

Gardezi, S.R.A. 2007. New and unreported species of mushrooms of Azad Jammu

and Kashmir, Pakistan. Archives of Phytopathology and Plant Protection, 38:

41–51.

Ge, Z.W., Z.L. Yang, D.H. Pfister, M. Carbone, T. Bau and M.E. Smith. 2014.

Multigene molecular phylogeny and biogeographic diversification of the

earth tongue fungi in the genera Cudonia and Spathularia (Rhytismatales,

Ascomycota). PLoS ONE, 9: e103457, doi: 10.1371/journal.pone.0103457.

214

Ge, Z.W., Z.L. Yang, T. Qasim, R. Nawaz, A.N. Khalid and E.C. Vellinga. 2015.

Four new species in Leucoagaricus (Agaricaceae, Basidiomycota) from Asia.

Mycologia, 107: 1033–1044.

Gierczyk, B., A. Kujawa, T. Pachlewski, A. Szczepkowski and M. Wójtowski. 2011.

Rare species of the genus Coprinus Pers. s. lato. Acta Mycologica, 46: 27–73.

Gomes, A.R.P. and F. Wartchow. 2014. Coprinellus arenicola, a new species from

Paraíba, Brazil. Sydowia, 66: 249–256.

Gómes, L.D. 1995. Una nueva specie neotropical de Termitomyces (Agricales:

Termitomycetaceae). Rev. Biol. Trop., 42: 439−451.

Grgurinovic, C.A. 1997. Larger fungi of Australia. Botanic Garden of Adelaide,

Australia.

Hall, T.A. 1999. BioEdit: a user-friendly biological sequence alignment editor and

analysis program for Windows 95/98/NT. Pp. 95–98.

Hanif, M., A.N. Khalid and R.L. Exeter. 2014. Clavariadelphus pakistanicus sp. nov.,

a new club fungus (Basidiomycota: Gomphales) from Himalayan moist

temperate forests of Pakistan. Canadian Journal of Botany, 92: 471–476,

10.1139/cjb-2013-0073

Hausknecht, A. and L.H. Nagy. 2007. Notes on some taxa of Conocybe (Bolbitiaceae,

Agaricales) from Hungary. Austrain Journal of Mycology, 16: 147–156.

Heim, R. 1977. Termites et Champignons. Les termitophiles d'Afrique Noire at d'Asie

Meridionale. Paris, France: Societe Novelle des Edition. 205 pp. Boubee,

Paris.

215

Heinemann, P. and S.R. Little-Flower. 1984. Hymenagaricus (Agaricaceae) de

Kerala (Inde) et de Sri Lanka. Bulletin du Jardin botanique National de Belgique,

54: 151–182.

Hibbett, D.S., M. Binder, J.F. Bischoff, M. Blackwell and P.F. Cannon. 2007. A

higher level phylogenetic classification of the Fungi. Mycological Research,

111: 509–547.

Hofstetter, V., J. Miadlikowska, F. Kauff and F. Lutzoni. 2007. Phylogenetic

comparison of protein-coding versus ribosomal RNA-coding sequence

data: A case study of the Lecanoromycetes (Ascomycota). Molecular

Phylogenetics and Evolution, 44: 412–426.

Hongo, T. 1987. Coprinaceae. In: Imazeki R, Hongo T (eds), Colored Illustrations of

Mushrooms of Japan, Vol. I, Hoikusha, Osaka, pp 162–180.

Hussain, S., N.S. Afshan, H. Ahmad and A.N. Khalid. 2015a. New Report of edible

mushroom, Termitomyces umkowaan from Pakistan. Sylwan, 159: 185–197.

Hussain, S., N.S. Afshan, H. Ahmad and A.N. Khalid. 2015b. New Report of the

edible mushroom Pleurotus cystidiosus from Pakistan. Austrian Journal of

Mycology, 24: 23–30.

Hussain, S., H. Ahmad, N.S. Afshan and A.N. Khalid. 2015c. New reports of rust

fungi from Malakand, Khyber Pakhtunkhwa, Pakistan. Mycotaxon, 130:

647–651.

216

Hussain, S., N. Yousaf, N.S. Afshan, A.R. Niazi, H. Ahmad, A.N. Khalid. 2016.

Tulostoma ahmadii sp. nov. and T. squamosum from Pakistan. Turkish Journal

of Botany, 40: 218–225.

Ishaq, A., N.S. Afshan and A.N. Khalid. 2013. New records of Puccinia on Poaceae

from Khyber Pakhtunkhwa, Pakistan. Mycotaxon, 126: 177–182.

Isikhuemhen, O.S., J-M. Moncalvo, F. Nerud and R. Vilgalys. 2000. Mating

compatibility and phylogeography in Pleurotus tuberregium. Mycological

Research, 104: 732–737.

Izumi, O., M. Kakishima and Y. Ono. 1992. Uredinales collected in the Murree

Hills, Pakistan. In: Cryptogamic flora of Pakistan 1: 185–196.

Justo, A., C. Angelini, A. Bizzi and A. Vizzini. 2015. Leucoagaricus sabinae

(Agaricaceae), a new species from the Dominican Republic. North American

Fungi, 10: 1–15.

Kakishima, M., I. Okane and Y. Ono. 1993. Rust fungi (uredinales) of Pakistan

collected in 1991. In: Cryptogamic flora of Pakistan 2: 169–179.

Karim A. 2008. Constituency NA 35, Malakand. Monthly Magazin, Nazar, 1: 9–14.

Kerrigan, R.W., P. Callac, J. Guinberteau, M.P. Challen and L.A. Parra. 2005.

Agaricus section Xanthodermatei: a phylogenetic reconstruction with

commentary on taxa. Mycologia, 97: 1292–1315.

Kirk, P.M., P.F. Cannon, D.W. Minter and J.A. Stalpers. 2008. Dictionary of the

Fungi, 10th ed. CABI, Wallingford, UK.

217

Kits van Waveren, E. 1985. The Dutch, French and British species of Psathyrella.

Persoonia, 2: 1–300.

Larkin, M.A., G. Blackshields, N.P. Brown, R. Chenna, P.A. McGettigan, H.

McWilliam, F. Valentin, I.M. Wallace, A. Wilm, R. Lopez, J.D. Thompson,

T.J. Gibson and D.G. Higgins. 2007. Clustal W and Clustal X version 2.0.

Bioinformatics, 23: 2947–2948.

Larsson, K.H., E. Larsson and U. Köljalg. 2004. High phylogenetic diversity among

corticioid basidiomycetes. Mycological Research, 108: 983–1002.

Lawrey, J.D., R. Lücking, H.J.M. Sipman, J.L. Chaves, S.A. Redhead, F. Bungartz,

M. Sikaroodi and P.M. Gillevet. 2009. High concentration of basidiolichens

in a single family of agaricoidmushrooms (Basidiomycota: Agaricales:

Hygrophoraceae). Mycological Research, 113: 1154–1171.

Lee, S.C., N. Corradi, S. Doan, F.S. Dietrich, P.J. Keeling and J. Heitman. 2010.

Evolution of the sex-related locus and genomic features shared in

Microsporidia and Fungi. PLoS ONE 5: e10539.

10.1371/journal.pone.0010539.

Liang, J.F., Z.L. Yang, J. Xu and Z.W. Ge. 2010. Two new unusual Leucoagaricus

species (Agaricaceae) from tropical China with blue-green staining

reactions. Mycologia, 102: 1141–1152.

Lim, Y.W. and H.S. Jung. 2003. Irpex hydnoides, sp. nov. is new to science, based on

morphological, cultural and molecular characters. Mycologia, 95:

694−699.

218

Liu, Y.J., S. Wheelen and B.D. Hall. 1999. Phylogenetic relationships among

ascomycetes: evidence from an RNA polymerase II subunit. Molecular

Biology and Evolution, 16: 1799–1808.

Lodge, D.J., M. Padamsee, P.B. Matheny, M.C. Aime, S.A. Cantrell, D. Boertmann,

A. Kovalenko, A. Vizzini, B.T.M. Dentinger, P.M. Kirk, A.M. Ainsworth, J-

M. Moncalvo, R. Vilgalys, E. Larsson, R. Lücking, G.W. Griffith, M.E. Smith,

L.L. Norvell, D.E. Desjardin, S.A. Redhead, C.L. Ovrebo, E.B. Lickey, E.

Ercole, K.W. Hughes, R. Courtecuisse, A. Young, M. Binder, A.M. Minnis,

D.L. Lindnerm, B. Ortiz-Santana, J. Haight, T. Læssøe, T.J. Baroni, J. Geml

and T. Hattori. 2014. Molecular phylogeny, morphology, pigment

chemistry and ecology in Hygrophoraceae (Agaricales). Fungal Diversity,

64: 1–99.

Lutzoni, F.M., M. Pagel and V, Reeb. 2001. Major fungal lineages are derived from

lichen symbiotic ancestors. Nature, 411: 937–940.

Malysheva, E.F., T.Y. Svetasheva and E.M. Bulakh. 2013. Fungi of the Russian Far

East I. New combination and new species of the genus Leucoagaricus

(Agaricaceae) with red-brown basidiomata. Mikol Fitopatol, 47: 169–179.

Manoharachary, C., K. Sridhar, R. Singh, A. Adholeya, T.S. Suryanarayanan, S.

Rawat and B.N. Johri. 2005. Fungal biodiversity: Distribution, conservation

and prospecting of fungi from India. Current Science, 89: 58–71.

Matheny, P.B., J.M. Curtis, V. Hofstetter, M.C. Aime, J-M. Moncalvo, Z.W. Ge, J.C.

Slot, J.F. Ammirati, T.J. Baroni, N.L. Bougher, K.W. Hughes, D.J. Lodge,

219

R.W. Kerrigan, M.T. Seidl, D.K. Aanen, M. DeNitis, G.M. Daniele, D.E.

Desjardin, B.R. Kropp, L.L. Norvell, A. Parker, E.C. Vellinga, R. Vilgalys

and D.S. Hibbett. 2006. Major clades of Agaricales: a multilocus

phylogenetic overview. Mycologia, 98: 982–995.

McLaughlin, D.J., D.S. Hibbett, F. Lutzoni, J.W. Spatafora and R. Vilgalys. 2009.

The search for the fungal tree of life. Trends in Microbiology, 17: 488–497.

Miller, M.A., W. Pfeiffer and T. Schwartz. 2010. “Creating the CIPRES Science

Gateway for inference of large phylogenetic trees” in Proceedings of the

Gateway Computing Environments Workshop (GCE), 14 Nov. 2010, New

Orleans, LA Pp 1–8.

Moncalvo, J-M., R. Vilgalys, S.A. Redhead, J.E. Johnson, T.Y. James, M.C. Aime, V.

Hofstetter, S.J.W. Verduin, E. Larsson, T.J. Baroni, R.G. Thorn, S. Jacobsson,

H. Clémençon and O.K. Miller. 2002. One hundred and seventeen clades of

euagarics. Molecular Phylogenetic and Evolution, 23: 357–400.

Mordue, J.E.M. and G.C. Ainsworth. 1984. Ustilaginales of the British Isles. Published

by Commonwealth Mycological Inst., Kew.

Moreno, G., A. Altés and J.E. Wright. 1992. Tulostoma pseudopulchellum sp. nov:

(Tulostomatales, Gasteromycetes) and allied species. Mycotaxon, 43: 479–86.

Moreno, G., A. Altés, C. Ochoa and J.E. Wright. 1995. Contribution to the study of

the Tulostomataceae in Baja. California, Mexico. Mycologia, 87: 96–120.

220

Moreno, G., E. Horak and A. Altés. 2002. Tulostoma kreiselii, a new species from

Tunisia, northern Africa. Feddes Repertorium Specierum Novarum Regni

Vegetabilis, 113: 7–10.

Moreno, G., F. Esteve-Raventós, C. Illana and M. Heykoop. 1990. More agarics

from xerophytic grasslands in central Spain. Mycological Research, 94: 781–

788.

Moreno, G., M. Heykoop, M. Esqueda and I. Olariaga. 2015. Another lineage of

secotioid fungi is discovered: Psathyrella secotioides sp. nov. from Mexico.

Mycological Progress, 14:34. http://dx.doi.org/10.1007/s11557-015-1057-8.

Mundkar, B.B. 1938. Fungi of India. Suppl. I. Imp. Counci. Agri. Res. Inida. Sci. Mon.

12: 1–54.

Murad, W., A. Ahmad, G. Ishaq, M.S. Khan, A.M. Khan, I. Ullah and A.I. Khan.

2012. Ethnobotanical studies on plant resources of Hazar Nao forest, district

Malakand, Pakistan. Pakistan Journal of Weed Science Research, 18: 509–527.

Nagy, G.L., C. Vagvolgyi and T. Papp. 2010. Type studies and nomenclatural

revisions in Parasola (Psathyrellaceae) and related taxa. Mycotaxon, 112: 103–

141.

Nagy, G.L., C. Vagvolgyi and T. Papp. 2013. Morphological characterization of

clades of the Psathyrellaceae (Agaricales) inferred from a multigene

phylogeny. Mycological Progress, 12: 505–517.

221

Nagy, G.L., G. Walther, J. Házi, C. Vágvölgyi and T. Papp. 2011. Understanding

the evolutionary processes of fungal fruiting bodies: correlated evolution

and divergence times in the Psathyrellaceae. Systematic Biology, 60: 303–317.

Nagy, G.L., J. Hazi, C. Vagvolgyi and T. Papp. 2012. Phylogeny and species

delimitation in the genus Coprinellus with special emphasis on the haired

species. Mycologia, 104: 254–275.

Nagy, G.L., S. Kocsube, T. Papp and C. Vagvolgyi. 2009. Phylogeny and character

evolution of the coprinoid mushroom genus Parasola as inferred from LSU

and ITS of nrDNA sequence data. Persoonia, 22: 28–37.

Natarajan, N.K. 1979. South Indian Agaricales V: Termitomyces heimii. Mycologia,

71: 853–855.

Nawaz, R., A.N. Khalid, M. Hanif and A. Razaq. 2013. Lepiota vellingana sp. nov

Basidiomycota, Agaricales, A new species from Lahore Pakistan,

Mycological Progress. DOI 10.1007/s11557-012-0884-0.

Niazi, A. R., S. H. Iqbal and A. N. Khalid. 2006. Biodiversity of Mushrooms and

Ectomycorrhiza. 1. Russula brevipes Peck. and its ectomycorrhiza, a new

record from Himalayan Moist Temperate Forests of Pakistan. Pakistan

Journal of Botany, 38: 1271-1277.

Niazi, A.R. 2008. Biodiversity of ectomycorrhizae in conifers from Himalayan

Moist temperate forests of Pakistan, PhD thesis, University of the Punjab,

Lahore, Pakistan.

222

Niazi, A.R., A.N. Khalid and S.H. Iqbal. 2010. New records of ectomycorrhizae

from Pakistan. Pakistan Journal of Botany, 42: 4335–4343.

Okane, I., M. Kakishima and Y. Ono. 1992. Uredinales collected in Murree Hills,

Pakistan. In: Cryptogamic flora of Pakistan, 1: 185-196 (Eds. T. Nakaike and S.

Malik). Nat. Sci. Mus., Tokyo.

Olila, D., G. Kyeyune, J.D. Kabasa, I. Kisovi and P.K.T. Munishi. 2007. Assessment

of Potential for Domestication of Termitomyces microcarpus: An indigenous

Edible and Medicinal Mushroom from Lake Victoria Basin. Agricultural

Journal, 2: 627−631.

Ono, Y. 1992. Uredinales collected in Kaghan Valley, Pakistan. In: Cryptogamic flora

of Pakistan 1: 217–240.

Ono, Y. and M. Kakishima. 1992. Uredinales collected in swat Valley, Pakistan. In:

Cryptogamic flora of Pakistan 1: 197–216.

Ono, Y. and M. Kakishima. 1993. Smut Fungi (Ustilaginales) Collected in Pakistan.

In: Cryptogamic flora of Pakistan 2: 187–214.

Örstadius, L., M. Ryberg and E. Larsson. 2015. Molecular phylogenetics and

taxonomy in Psathyrellaceae (Agaricales) with focus on psathyrelloid

species: introduction of three new genera and 18 new species. Mycological

Progress, 14: 25. http://dx.doi.org/10.1007/s11557-015-1047-x.

Orton, P.D. and R. Watling. 1979. Coprinaceae Part 1: Coprinus. British Fungus

Flora. Agarics and Boleti: Part 2. Royal Botanic Garden, Edinburgh, UK.

223

Otieno, N.C. 1964. Contributions to knowledge of Termite fungi in East Africa.

Proceedings of the East African Academy, 11: 108−120.

Parra, L.A. 2013. Agaricus L., Allopsalliota Nauta & Bas. Alassio, Italia: Fungi

Europaei 1A. Candusso Edizioni.

Peay, K.G., P.G. Kennedy and T.D. Bruns. 2008. "Fungal community ecology: a

hybrid beast with a molecular master". BioScience, 58: 799–810.

Pegler, D.N. 1966. Tropical African Agaricales. Persoonia, 4: 73–124.

Pegler, D.N. 1983. Agaric flora of the Lesser Antilles. Kew Bulletin Additional Series

9: 1–668.

Pegler, D.N. 1986. Agaric flora of Sri Lanka. Kew Bulletin Additional Series. 12: 1–

519.

Pegler, D.N. and M. Vanhaecke. 1994. Termitomyces of Southeast Asia. UK: Kew

Bulletin.

Porebski, S., L.G. Bailey and B.R. Baum. 1997. Modification of a CTAB DNA

extraction protocol for plants containing high polysaccharide and

polyphenol components. Plant Molecular Biology Reporter, 15: 8‒15.

Qasim. T., T. Amir, R. Nawaz, A.R. Niazi and A.N. Khalid. 2015. Leucoagaricus

lahorensis, a new species of L. sect. Rubrotincti. Mycotaxon, 130: 533–541.

Rambaut, A. 2012. Software distributed by the author at

http://tree.bio.ed.ac.uk/software/figtree/.

Rambaut, A. and A. Drummond. 2008. Tracer v 1.4.1. Software distributed by the

authors at http://beast.bio.ed.ac.uk/.

224

Razaq, A., A.N. Khalid and S. Ilyas. 2012. Tricholomopsis flammula Métrod ex Holec

(Basidiomycota, Agaricales) an addition to the mushroom flora of Pakistan

based on molecular identification. Pakistan Journal of Botany, 44: 413‒416.

Redhead, S.A., R. Vilgalys, J.M. Moncalvo, J. Johnson and J.S. Hopple 2001.

Coprinus Persoon and the disposition of Coprinus species sensu lato. Taxon,

50: 203–241.

Rehner, S. 2001. Primers for Elongation Factor 1-α (EF1-α).

http://ocid.NACSE.ORG/research/deephyphae/EF1primer.pdf.

Reid, D.A. and A. Eicker. 1995. The genus Hymenagaricus Heinem. in South Africa.

South African Journal of Botany, 61: 293–297.

Romagnesi, H. 1975. Description de quelques espèces de Drosophila Quél.

(Psathyrella ss. dilat.). Bulletin de la Société Mycologique de France, 91: 137–

224.

Romagnesi, H. 1982. Études complémentaires de quelques espèces de Psathyrella

.ss. Lato (Drosophila Quélet). Bulletin de la Société Mycologique de France, 98:

5–68.

Saba, M., A.R. Niazi and A.N. Khalid. 2013. New records of Uredinales

(Basidiomycota) from Azad Jammu and Kashmir and adjacent Northern

Areas of Pakistan. International Journal of Agriculture and Biology, 15: 878‒

884.

Sabir, A. A., S. M. Khan and S. M. Khan. 2001. Studies on taxonomy of fleshly fungi

(Agaricus spp.) of Changa Manga forest. Integrated plant disease

225

management. Proceedings of 3rd National Conference of Plant Pathology,

NARC, Islamabad, 1-3 Oct. 2001. ISBN. 969-8306-01-3.

Sadiqullah, A. Ishaq, M. Fiaz, N.S. Afshan and A.N. Khalid. 2014. A new report of

Uromyces ambiens on box plant from Pakistan. Mycotaxon 129: 429–432.

Sarwar, S. and A.N. Khalid. 2012. Check list of Boletales of Pakistan. Mycotaxon,

121: 12.

Sarwar, S., M. Saba, A.N. Khalid and B.M. Dentinger. 2015. Suillus marginielevatus,

a new species and S. triacicularis, a new record from Western Himalaya,

Pakistan. Phytotaxa, 203: 169‒177

Schafer, D.J. 2010. Keys to sections of Parasola, Coprinellus, Coprinopsis and Coprinus

in Britain. Field Mycology, 11: 44–51.

Schafer. D.J. 2014. The genus Parasola in Britain including Parasola cuniculorum sp.

nov. Field Mycology, 15: 77–99.

Schoch, C.L., K.A. Seifert, S. Huhndorf, V. Robert, J.L. Spouge, C.A. Levesque, W.

Chen, E. Bolchacova, K. Voigt and P.W. Crous. 2012. Nuclear Ribosomal

Internal Transcribed Spacer (ITS) Region as a Universal DNA Barcode

Marker for Fungi. Proceedings of the National Academy of Sciences, 109: 6241–

6246.

Segedin, B.P., P.K. Buchanan and J.P. Wilkie. 1995. Studies in the Agaricales of

New Zealand: new species, new records and renamed species of Pleurotus

(Pleurotaceae). Australian Systematics Botany. 8: 453–482.

226

Seitzman, B.H., A. Ouimette, R.L. Mixon, A.E. Hobbie and D.S. Hibbett. 2011.

Conservation of biotrophy in Hygrophoraceae inferred from combined

stable isotope and phylogenetic analysis. Mycologia, 103: 280–290.

Sheikh, M.I. 1993. Trees of Pakistan. Pictorial Printers (Pvt.) Ltd., Islamabad,

Pakistan. Pp. 8.

Simpson, E. H. 1949. Measurement of diversity. Nature, 163: 688.

Singer, R. 1986. The Agaricales in Morden taxonomy. Germany Konigstein.

Smith, A.H. 1972. The North American species of Psathyrella. Memoirs of the New

York Botanical Garden, 24: 1–633.

Sultan, A., K. Nazir and N. Ayub. 2001. Some common species fleshy

macromycetes (Discomycetes, Gasteromycetes and Agaricales) from

Margalla Hills national park and adjacent areas. Pakistan Journal of Botany,

33: 709–721.

Sultan, M. A., C. M. Denchev, I. Haq & A. N. Khalid. 2007. A new record of

Bauhinus piperi (Microbotryales) from Pakistan. Mycotaxon, 100: 79-83.

Sultana, K., C. Abdul Rauf, A. Riaz, F. Naz, G. Irshad and M. Irfan ul Haque. 1997.

Checklist of Agarics of Kaghan Valley-1. Pakistan Journal of Botany, 43: 1777–

1787.

Sultana, K., Z. K. Shinwari and F. Iftikhar. 1997. Diversity of edible Mushrooms in

Pakistan. Pakistan Jouranl of Agriculture Research, 20: 88–91.

Swofford, D.L. 2004. PAUP*: phylogenetic analysis using parsimony (*and other

methods). Version 4. Sunderland, Massachusetts: Sinauer Associates.

227

Tamura, K., G. Stecher, D. Peterson, A. Filipski and S. Kumar. 2013. MEGA6:

Molecular evolutionary genetics analysis version 6.0. Molecular Biology and

Evolution, 30: 2725–2729.

Taylor, A.F.S. 2008. Recent advances in our understanding of fungal ecology.

Coolia, 51: 197–212.

Tedersoo, L., T.W. May and M.E. Smith. 2010. Ectomycorrhizal lifestyle in fungi:

global diversity, distribution, and evolution of phylogenetic lineages.

Mycorrhiza, 20: 217–263.

Thongklang, N., R. Nawaz, A.N. Khalid, J. Chen, K.D. Hyde, R. Zhao, L.A. Parra,

M. Hanif, M. Moinard and P. Callac. 2014. Morphological and molecular

characterization of three Agaricus species from tropical Asia (Pakistan,

Thailand) reveals a new group in section Xanthodermatei. Mycologia, 106:

1220–1232.

Tibuhwa, D.D., A.K. Kivaisi and F.F.S. Magingo. 2010. Utility of the macro-

micromorphological characteristics used in classifying the species of

Termitomyces. Tanzania Journal of Science, 36: 3–46.

Tulloss, R. E., S. H. Iqbal, A. N. Khalid, R. P. Bhatt and V. K. Bhatt. 2001. Studies

in Amanita (Amanitaceae) from Southern Asia. I. Some species of Pakistan’s

North West Frontier Province. Mycotaxon, 77: 445–490.

Uljé, C.B. and C. Bas. 1988. Studies in Coprinus I: Subsections Auricomi and Glabri

of Coprinus section Pseudocoprinus. Persoonia, 13: 433–448.

228

Uljé, C.B. and H. Bender. 1997. Additional studies in Coprinus subsection Glabri.

Persoonia, 16: 373–381.

Vanky, K. 2012. Smut Fungi of the World. ISBN 978-0-89054-398-6, APS Press.

Vánky, K., S.H. Iqbal and A.N. Khalid. 2007. Thecaphora pakistanica sp. nov.

(Ustilaginomycetes) on Androsace (Primulaceae). Mycologia Balcanica, 4:

92–95.

Vellinga, E.C. 2001 [2000]. Notulae ad Floram Agaricinam Neerlandicam—

XXXVIII. Leucoagaricus subgenus Sericeomyces. Persoonia, 17: 473–480.

Vellinga, E.C. 2003. Phylogeny and taxonomy of lepiotaceous fungi [doctoral

dissertation]. [Leiden]: Univ Leiden Press.

Vellinga, E.C. 2004. Genera in the family Agaricaceae: evidence from nrITS and

nrLSU sequences. Mycological Research, 108: 354–357.

Vellinga, E.C. 2010. Lepiotaceous fungi in California, USA Leucoagaricus sect.

Piloselli. Mycotaxon, 112: 393–444.

Vellinga, E.C., P. Sysouphanthong and K.D. Hyde. 2011. The family of

Agaricaceae: phylogenies and two new white-spored genera. Mycologia,

103: 494–509.

Vilgalys, R. and M. Hester. 1990. Rapid genetic identification and mapping of

enzymatically amplified ribosomal DNA from several Cryptococcus

species. Journal of Bacteriology, 172: 4238-4246.

White, T.J., T.D. Bruns, S. Lee and J. Taylor. 1990. Amplification and direct

sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA,

229

Gelfand DH, Sninsky JJ, White TJ eds. PCR protocols, a guide to methods

and applications. San Diego, California: Academic Press. Pp. 315–322.

Wright, J.E. 1987. The genus Tulostoma (Gasteromycetes): a world monograph. Berlin,

Germany: J. Cramer. Pp. 1–338.

Yang, Z.L., Z.W. Ge and C.M. Chen. 2008. A new species of the genus

Hymenagaricus (Basidiomycota) from Taiwan and its phylogenetic position

inferred from ITS and nLSU sequences. Cryptogamie Mycologie, 29:259–265.

Yousaf, N. 2014. Taxonomy, Diversity and Phylogeny of some Gasteroid Fungi

from Pakistan. PhD thesis, Department of Botany, University of the Punjab,

Lahore, Pakistan.

Zabihullah, Q., A. Rashid and N. Akhtar. 2006. Ethnomedicinal survey in Kot

Manzary Baba Valley, Malakand Agency, Pakistan. Pakistan Journal of Plant

Sciences, 12: 115–121.

Zhao, R.L., S.C. Karunarathna, O. Raspe, L.A. Parra, J. Guinberteau, M. Moinard,

A.D. Kesel, R. Barroso, R. Courtecuisse, K.D. Hyde, A.K. Guelly, D.E.

Desjardin and P. Callac. 2011. Major clades in tropical Agaricus. Fungal

Diversity, 51: 279–296.

230