Integrated Computational and NMR Studies in the Exploration of Therapeutics for Cancer

Medical University of South Carolina MEDICA

MUSC Theses and Dissertations

2019

Xiojuan Wang Medical University of South Carolina

Follow this and additional works at: https://medica-musc.researchcommons.org/theses

Recommended Citation Wang, Xiojuan, "Integrated Computational and NMR Studies in the Exploration of Therapeutics for Cancer" (2019). MUSC Theses and Dissertations. 238. https://medica-musc.researchcommons.org/theses/238

This Dissertation is brought to you for free and open access by MEDICA. It has been accepted for inclusion in MUSC Theses and Dissertations by an authorized administrator of MEDICA. For more information, please contact [email protected]. INTEGRATED COMPUTATIONAL AND NMR STUDIES IN THE EXPLORATION OF

THERAPEUTICS FOR CANCER

A Dissertation Presented in partial Fulfillment of the Requirements for the Degree Doctor

Philosophy in Drug Discovery and Biomedical Sciences

Medical University of South Carolina

Xiaojuan Wang

2019

To the Graduate Council: I am submitting here with a thesis written by Xiaojuan Wang entitled ― Integrated Computational and NMR Studies in the Exploration of Therapeutics for Cancer. I have examined the final copy of this thesis for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Drug Discovery and Biomedical Sciences.

______Mark T. Hamann Professor of Drug Discovery and Biomedical Science. We have read this thesis and recommend its acceptance: ______Dr. Patrick M. Woster Professor of Drug Discovery and Biomedical Science.

______Dr. Alan J. Diehl Professor of Biochemistry and Molecular Biology

______Dr. Craig Cano Beeson Professor of Drug Discovery and Biomedical Science.

______Dr. Sherine Chan Associate Professor of Drug Discovery and Biomedical Science.

Accepted for the Council: ______Dean of the Graduate School

TABLE OF CONTENTS

ABSTRACT……………………………………………………………………………..….. 4

DEDICATION...…………………………………………………………………………..… 11

LIST OF ABBREVIATION AND SYMBOLS ………………………………………..…... 12

ACKNOWLEDGEMENTS ……………………………………………………………..….. 14

CHAPTER ONE 23 COMPUTATIONALLY-ASSISTED DISCOVERY AND ASSIGNMENT OF A HIGHLY STRAINED AND PANC-1 SELECTIVE ALKALOID FROM ALASKA’S DEEP OCEAN……………………………………………………………………………………….

CHAPTER TWO 54 THE MICROBIOME OF AMERICAN SYCAMORE PRODUCES RAPAMYCIN AS PART OF A UNIQUE SYMBIOTIC PLANT-ENDOPHYTE RELATIONSHIP……………

CHAPTER THREE 79 ASSIGNMENT OF THE ABSOLUTE CONFIGURATION OF HEPATOPROTECTIVE HIGHLY OXYGENATED TRITERPENOIDS AND DIBENZOCYCLOOCTADIENE LIGNANS USING X-RAY, ECD, NMR J-BASED CONFIGURATIONAL ANALYSIS AND HSQC OVERLAY EXPERIMENTS……………………………………………………

VITA……………………………………………………………………………………..……. 155

ABSTRACT

Pancreatic cancer (PC) is the 4th leading cause of cancer in the US and the survival rate beyond 5 years is below 9%; the lowest of any cancer1. Pancreas and liver cancers are projected to surpass breast, prostate, and colorectal cancers to become the second and third leading causes of cancer-related death by 2030, respectively2. There are two types of pancreatic cancer: exocrine tumors (the tumor happens where the cells produce enzyme to digest food) and endocrine tumors

(the tumor happens where the cells produce insulin to regulate blood sugar). About 95 percent of pancreatic cancers begin in the exocrine cells of the pancreas3.

The causes of pancreatic cancer remain unknown, tobacco, alcohol, family history and high

-cholesterol diet are contributing factors. The progression from normal epithelium to pancreatic cancer begins with the accumulation of activation of oncogene KRAS and then inactivation of tumor suppressor genes—for example p16 (also known as CDKN2A), SMAD4 (also known as

DPC4), and p53 (also known as TP53)4-5 evolve via pancreatic intraepithelial neoplasias (PanINs).

KRAS mutations is responsible for 75-90% of pancreatic cancer patients and start very early in the development of pancreatic cancer6-9. The well-validated role of mutationally activated RAS genes in driving cancer development and growth has stimulated comprehensive efforts to develop therapeutic strategies to block mutant RAS function for cancer treatment. Disappointingly, despite more than three decades of research effort, clinically effective anti-RAS therapies have remained elusive, prompting a perception that RAS may be undruggable10.

PC is usually diagnosed by a combination of medical imaging techniques such as ultrasound computed tomography, CT scan with IV contrast, blood tests, and examination of tissue samples (biopsy). At this time, the best progress for this disease is to diagnose in the early stages. Phenomics is an branch of biology responsible for the measurement of phenomes—the

4 physical and biochemical characteristic of organisms as they change correlated to genetic environmental factors11. Traditional biological experiments, such as GWA (genome-wide association) studies, is selecting a phenotype and then attempting to associate biological differences within a population. The unequivocal phenotype is what patients and clinicians wish to predict. At present, none phenomics studies have been applied to drug therapy. Detailed electronic medical record (EMR) data will allow for large-scale phenomics studies, when paired with GWA studies or other biological databases12. Metabolomes are defined as all compounds generated by living organisms during their life cycles and reflect the function of the organisms as a whole13. Metabolomics analysis can be applied to both in vitro and in vivo specimens by using body fluids, cells or tissues. Comparing the different result of metabolomics analysis of the pancreatic cancer patient and healthy people can provide the reference of the detection of pancreatic cancer. The two most popular techniques are nuclear magnetic resonance spectroscopy

(NMR) and mass spectrometry (MS) coupled with gas chromatography, liquid chromatography or capillary electrophoresis.14-16 Although cross sectional imaging tests such as abdominal ultrasound

(US), computerized tomography (CT-scan), magnetic resonance imaging (MRI), endoscopic ultrasound (EUS) and endoscopic retrograde cholangiopancreatography (ERCP) have been developed to detect the disease, none of them works for the early stage tumor.17-19 Biomarkers lack enough specificity to make difference between PC and diseases such as pancreatitis and cholangitis.17 Since no single molecule has been shown to be specific enough for the discrimination of patients with early PC, some study groups have used multiple logistic regression analysis to compare PC patients with healthy controls. a statistical diagnostic model was generated.20 In addition to serum, other biofluids such as bile and pancreatic fluids have been used to study metabolic profiles for the diagnosis of early PC.21 The saliva metabolites profiles showed higher

5 concentrations of most of the metabolites detected in pancreatic, breast and oral cancer compared with those with periodontal disease and control diseases. This result indicates that cancer-specific signatures are contained in saliva metabolites. Multiple logistic regression models showed high area under the receive operating characteristic curves (AUCs) to discriminate healthy controls from each disease. The AUCs were 0.993 for pancreatic cancer, and 0.969 for periodontal diseases.

The accuracy of the models was also high, with cross-validation AUCs of 0.994, and 0.954, respectively. Even these correlations significant and promising, but they are small and not sufficient to change current clinical practice and more studies are needed.21-22 No diagnostic tests for the screening of pancreatic cancer has been identified thus far and none of the biomarkers has yet to be proven useful for this purpose17. Genomics is a discipline in genetics that applies recombinant DNA, DNA sequencing methods, and bioinformatics to sequence, assemble, and analyze the function and structure of genomes.23 Genetics represents a constant in any biological system compared with metabolomes and phenomics. DNA of the healthy individuals and pancreatic cancer patients were analyzed, and it was found that pancreatic cancers contain an average of 63 genetic alterations, most of them point mutations. These alterations defined a core set of 12 cellular signaling pathways and processes that were each genetically altered in 67 to 100% of the tumors24.

Surgery is the only possibility for a curative treatment but is a limited option only available to 15-20% of PC patients present with localized and potentially curable tumors25. As a result, chemotherapy and radiation therapy plays an important role throughout PC treatment. Radiation therapy is quite helpful for treating the exocrine cancer and, it can help relieve the patients’ pain.

In patients not suitable for curative surgery, chemotherapy and radiationtherapy are primary ways to extend life or improve its quality. Endocrine cancer does not respond well to radiation therapy.

What is more it will cause unpleasant side effects such as skin changes, fatigue, nausea, and other side-effects26. Currently, there are four major first-line drugs approved for the treatment of pancreatic cancer: FOLFIRINOX, erlotinib, gemcitabine, and mitomycin C. There are also other drugs, like Platinum agents (Cisplatin and Oxaliplatin), humanized antibody Keytruda, and

Taxanes. FOLFIRINOX and gemcitabine act by replacing pyrimidine and cytidine, respectively, during the biosynthesis of nucleic acids and DNA replication. As a result, tumor growth is arrested by false nucleoside incorporation induced cell death. As compared with gemcitabine,

FOLFIRINOX was associated with a survival advantage and had increased toxicity.

FOLFIRINOX is an option for the treatment of patients with metastatic pancreatic cancer and good performance status26. Mitomycin C, oxaliplatin and cisplatin are DNA cross-linking agents, which can react with two different positions in DNA, halt DNA synthesis and lead to apoptosis27.

Erlotinib is a small molecule human epidermal growth factor receptor 1/epidermal growth factor receptor (HER1/EGFR) tyrosine kinase inhibitor, preventing the growth factor and receiver from being phosphorylated, effectively disrupting the signaling pathway28. The molecular action of irinotecan occurs by trapping a subset of topoisomerase-1-DNA cleavage complexes, leading to inhibition of both DNA replication and transcription29. The principal mechanism of action of the taxane class of drugs is the disruption of microtubule function27. Keytruda used in cancer immunotherapy, can block protective mechanism of cancer cells and thereby, allows the immune system to destroy them30. However, regardless of whether these drugs are used alone or in combination, none have been effective in significantly improving overall survival rates. This disparity, compared to other cancer types, has led to the projection that pancreatic cancer will become the second most deadly cancer in the United States by 2030, surpassed only by lung cancer31. Any improvements in treatment will come as a much-needed reprieve to patients

7 diagnosed with this uniquely-challenging and lethal disease. Advances will come from more effective and specific chemotherapeutic agents. The marine environment with its exceptional biodiversity has yielded diverse chemical space and serves as a rich source of novel compounds with significant therapeutic promise. Discorhabdin alkaloids are the main metabolites of

Latrunculia sponge and all the published discorhabdins showed different ranges of cytotoxicity to different cancer cells.32 Thus, we hypothesis that new discorhabdins from Latrunculia sponge could be a lead for pancreatic cancer. Instead of isolating strictly using other low-throughput chemical techniques or bioassays alone which is time consuming, Molecular Ion

Networking (MoIN) to isolate new and novel compounds was applied. A new class of pyrroloiminoquinone alkaloids possessing a highly strained multi-bridged ring system, discovered from Latrunculia (Latrunculia) austini Samaai, Kelly & Gibbons, 2006 (class Demospongiae, order Poecilosclerida, family Latrunculiidae) recovered during a NOAA deep-water exploration of the Aleutian Islands. The molecule was identified with the guidance of MS, NMR, and

Molecular Ion Networking (MoIN) analysis. The structure of aleutianamine was determined using extensive spectroscopic analysis in conjunction with computationally-assisted quantifiable structure elucidation tools. Aleutianamine exhibited potent and selective cytotoxicity toward solid tumor cell lines including PC(PANC-1) with an IC50 of 25 nM and colon cancer (H116) with IC50 of 1 µM and represents a potent and selective candidate for advanced preclinical studies.

Plant-microbiome association studies have revealed a unique relationship between the host plants and their microbiome. This relationship involves significant benefits for the plant through protection from fungi, bacteria, herbivores and insects; however, at the same time overgrowth of an endophyte can cause harm to the plant33. The role of natural products in microbiome-plant associations and the overall success of plants remains a highly complex and relatively unexplored

8 field34-35. We serendipitously discovered that plant microbiome Bacillus. amyloliquefaciens cultured from American sycamore produced rapamycin and was regulated seasonally and plant organ specific differently by platanoside isolated from American sycamore (Platanus occidentalis

L.). Although that B. amyloliquefaciens generates diversity of metabolites from polyketides to triterpenes, influence many expects from pathogenic defense to growth promotion, B. amyloliquefaciens generating rapamycin and regulated by host metabolites was expected. Here, we show that previously characterized rapamycin was generated by B. amyloliquefaciens inhabiting in xylem of American sycamore. We demonstrate that the potent antibiotics platanosides found in the healthy sycamore leaves appear to play a clear regulator function of the

B. amyloliquefaceins. It has been reported that when the Target of Rapamycin (TOR) is inhibited in plants treated with rapamycin, it will promote autophagy of the cells and differentiation of xylem tracheary elements as well as extend the life-expectancy of the plant36. These results revealed that rapamycin generated by B. amyloliquefaciens appears to play a key role in the development of vascular tissue to transport water in this species of tree, promote autophagy of autumn leaves thus recovering nutrients and contribute to sycamore unique longevity. It also displayed how P. occidentalis controls the growth of B. amyloliquefaciens subsp. plantarum through the concentration of platanoside to avoid the potential harm caused by the overgrowth of B. amyloliquefaciens subsp. plantarum. The metabolites from endophytes and hosts mediate the interaction to realize the success of this species.

The chronic liver disease caused by xenobiotics and viral infection will eventually lead to liver cancer; the second most common cancer in the world. In 2018, WHO reported that around

788,000 people die from primary liver cancer every year. It is also reported that from 1999 to 2015, deaths from liver cancer in the US increased by 60% while deaths from other cancers decreased

9 by 26%. Levels of both hepatitis testing and treatment are still extremely low in most regions of the world drugs still play a vital role in controlling liver disease. Highly oxygenated triterpenoids and dibenzocyclooctadiene lignans isolated from plants of the genera Schisandra and Kadsura have revealed a variety of important biological activities including potent anti-HIV 37, anti-HBV

38, and cytotoxic properties39-42. Two clinically used drugs for liver disease dimethyl bicarboxylate and bicyclol are the structurally modified molecules isolated from Schisandra and Kadsura. We hypothesized that unreported hepatoprotective triterpenoids and dibenzocyclooctadiene lignans from Kadsura can be drug candidates for the liver disease. Their 2D structures and relative configurations have been successfully elucidated by NMR spectroscopic methods. Assignment of their absolute configurations is critical since it influences their bioactivities and is essential for future efforts focused on synthesis and medicinal chemistry applications. Herein, we report an integrated analysis to comprehensively assign the absolute configurations of four new schiartane- type nortriterpenoids and three novel dibenzocyclooctadiene lignans using a combination of methods.

DEDICATION

This work is dedicated to my country and family

LIST OF ABBREVIATION AND SYMBOLS

CDC: Centers for Disease Control

DCM: dichloromethane

IR: Infrared

LC-MS: Liquid Chromatography–Mass Spectrometry

HRMS: High Resolution Mass Spectrometry

EtOH: ethanol

EtOAc: ethyl acetate

FDA: U.S. Food and Drug Administration

HMBC: heteronuclear multiple bond correlation

HP-20: high porous styrenic adsorbent resin

HPLC: high performance liquid chromatography

HRMS: high resolution mass spectrometry

HSQC: heteronuclear single quantum coherence

IC : the half maximal inhibitory concentration 50

MALDI: matrix-assisted laser desorption/ionization

MeCN: acetonitrile

MeOH: methanol

MRSA: methicillin-resistant Staphylococcus aureus

NMR: nuclear magnetic resonance

Rt: retention time

SAR: structure-activity relationship

TOF: time-of-flight

VLC: vacuum-liquid chromatography

WHO: World Health Organization

PC: Pancreatic Cancer

ACKNOWLEDGEMENTS

I would like to gratefully acknowledge my advisor, Professor Mark T. Hamann for his professional guidance, continuous support and understanding towards earning my doctoral degree.

I would like to thank my committee members: Dr. Patrick Woster, Dr. Sherine Chan, Dr.

Alan Diehl, and Dr. Craig Beeson for their valuable scientific discussion.

I would like to thank Dr. Daneel Ferreira, and Dr. Jiabao Liu for the suggestions to write and revise papers. I would like also to acknowledge Dr. Robert Doerksen and his group members for the computational data, Dr. Stuart Parham for acquiring and teaching advanced NMR data, Dr.

Frederick Valeriote for acquiring the anti-cancer assay data, Dr. Frank Fronczek for acquiring the

X-ray data, Dr. Yike Zou to isolate and elucidate aleutianamine, Chris James to collect the MALDI and LCMS data for rapamycin.

I would like to thank my lab mates for all I have learned from them.

Many thanks to China Scholarship Council for awarding a 4 years Ph.D. scholarship.

LIST OF TABLES AND FIGURES

Figure 1. First-line drugs used for the treatment of pancreatic cancer.

Figure 2. General procedure to implement molecular networking for dereplication. Experimental

MS/MS spectra of samples, and MS/MS spectra of known molecules are analyzed by GNPS. The resultant network is visualized in Cytoscape.

Figure 3: Isolation scheme of aleutianamine and other discorhabdin analogs.

Figure 4. Annotation of discorhabdins cluster MS/MS spectra of 391.045. The MS/MS fragmentation, precursor masses, and isotopic pattern for signal of 535.135 and 336.104 were highly suggestive of the known metabolite discorhabdins H2 and discorhabdins D respectively.

The signal of 391.045 with different retention time with discorhabdins H2 and discorhabdins D suggested new analogs. Based on the fragmentations and molecular weight, the substituent group of the new discorhabdin should be -C2H4CN. The putative structure is shown above.

Figure 5. Annotation of discorhabdins cluster MS/MS spectra of 375.034, 376.04 and 376.024.

The signals of 375.034, 376.04 and 376.024. with same retention time with new discorhabdin with

MW of 391.045 suggested these signals might be the fragments of 391.045 and the high cosine value (0.96) also indicated they were almost identical. The raw MS/MS data of 391.045 also showed the signals of 375.034, 376.04 and 376.024, indicating they are fragments not the parent mass.

15 discorhabdins B suggested new analogs. Based on the fragmentations and molecular weight, there is an extra hydroxy group compared to discorhabdins B. The putative structure is shown above.

Figure 7. Structure of aleutianamine

Figure 8. Key HMBC, COSY, and ROESY correlations

Figure 9. Overlaid experimental ECD spectra with the computed ECD curves at B3LYP/6-

31G(d,p) level.

Figure 10. Total absolute deviation (TAD), mean absolute error (MAE), and DP4+ probability analyses (sarotti-nmr.weebly.com) for 1 and three of its diastereomers (Gibbs free energies at the

PCM/mPW1PW91/6-311+G(d,p) level were used for the analysis).

1 Figure 11. H NMR spectrum of aleutianamine in DMSO-d6

13 Figure 12. C NMR spectrum of aleutianamine in MeOD-d4

13 Figure 13. C NMR spectrum of aleutianamine in DMSO-d6

Figure 14. DEPT 135 NMR spectrum of aleutianamine in MeOD-d4

1 13 Figure 15. 2D H- C HSQC NMR spectrum of aleutianamine in DMSO-d6

1 13 Figure 16. 2D H- C HMBC NMR spectrum of aleutianamine in DMSO-d6

1 1 Figure 17. 2D H- H COSY NMR spectrum of aleutianamine in DMSO-d6

1 1 Figure 18. 2D H- H ROESY NMR spectrum of aleutianamine in DMSO-d6

1 15 Figure 19. 2D H- N HMBC NMR spectrum of aleutianamine in DMSO-d6

Figure 20. FT-MS spectrum of aleutianamine

Figure 21. Isolation scheme of rapamycin from sycamore leaves.

Figure 22. Rapamycin isolation from Platanus occidentalis tissue by LC-MS (A) Precursor

+ [M+NH4] ion at m/z 931.5922 (2.93 ppm) was detected from an extract of secondary growth tissue along with ions representing neutral losses of methanol and water at m/z 882.5391 (2.78 ppm) and

16 m/z 864.5289 (3.19 ppm) (B) H-NMR of purified rapamycin (red) and standard rapamycin (green).

Figure 23. Isolation scheme of platanoside from American sycamore

Figure 24. 1H-NMR of platanoside. The overlayed LC/MS chromatogram of isolated platanoside and the standard.

Figure 25. Calibration curve and the yield of platanoside.

Figure 26. MALDI-IMS of Bacillus spp. colonies in CS20 medium. Five colonies of endophytic

Bacillus sp. were plated with liquid culture and incubated at 37° C on specialized media originally developed for fastidious microbes and successively removed from incubation in 24 time point intervals. (I) MALDI-IMS shows signals correlating with [M+H]+ ion of rapamycin at m/z 914.6,

+ + [M-H2O] ion of rapamycin at m/z 896.7, [M+K] ion of rapamycin at m/z 952.3. The ionization efficiency of the dehydration product and potassium adduct corresponded with an increase in incubation time and dehydration of the solid agar.

Figure 27. MALDI-IMS of B. amyloliquefaciens. colonies in CS20 medium. (I) MALDI-IMS

+ + shows signals correlating with [M+H] ion of rapamycin at m/z 914.6, [M-H2O+H] ion of rapamycin at m/z 896.6, [M+K]+ ion of rapamycin at m/z 952.5, [M+K]+ ion of iturin A2 at m/z

1081.03, [M+K]+ ion of fengycin at m/z 1503.4, [M+H]+ ion of plantazolicin at m/z 1336.5. overlaid MALDI-IMS of fengycin (yellow) and plantazolicin (orange) as well as iturin (yellow) and rapamycin (red), clear showing that rapamycin and plantazolicin were within the bounds of the irregular-shaped colony, while fengycins and iturins were mostly excreted outside.

Figure 28. Rapamycin was present in American sycamore tissue from an ESI LC-MS injection from a methanol extraction of secondary-growth. A: A signal matching the ammonium adduct at

17 m/z 931.5922 Da (2.93 ppm) was seen, along with ions representing a neutral loss of methanol at m/z 882.5391 (3.33 ppm) and a neutral loss of methanol and water at m/z 864.5289 (3.82 ppm). B,:

An injection of a rapamycin standard from S. hygroscopicus under the same conditions yielded the same ammonium adduct at m/z 931.5907 (1.32 ppm) at approximately the same retention time with ions representing neutral losses of methanol at m/z 882.5391 (1.63 ppm) and methanol and water at m/z 864.5279 (2.66 ppm). An additional concentration of one or more M+4 ions (13C,

2D, or 15N) in rapamycin standard but not in rapamycin isolated in sycamore

Figure 29. Molecular networks obtained from B. amyloliquefaciens, American sycamore leaves and xylem. It should be noted that the metabolites of B. amyloliquefaciens are overlapped or related to the crude extract of xylem but has nothing to do with the crude extract of leaves. This can be attributed to the different concentration of platanoside which can inhibit the growth of B. amyloliquefaciens in different parts of the tree.

Figure 30. Heatmap of platanoside concentration in different part of the P. occidentalis tree, 0.5% in summer leaves, 0.15% in autumn leaves, 0.009% in xylem and 0.004% in cambium.

Figure 31. Platanoside inhibit the growth of bacillus when treated at the concentration of 0.5% and 0.4%.

Figure 32. Primary second metabolites of B. amyloliquefaciens Figure 33. antiSMASH Analysis of the gene sequence of B. amyloliquefaciens. Figure 34. the structures of compounds 1-7.

Figure 35. ORTEP drawing of micrandilactone J (2).

Figure 36. ORTEP drawing of micrandilactone I (1).

Figure 37. ORTEP drawing of micrandilactone H (4).

Figure 38. Experimental ECD spectrum of compound 2 (black), calculated averaged Boltzmann weighted ECD spectra of conformers (2a–2c and 2e) (green), and ECD spectrum of conformer 2a

(major conformer) in MeOH (red). σ-value (artificial line broadening) was set to 0.16 eV.

Figure 39. Key HMBC (A) correlations of micrandilactone I (1); HMBC (B) COSY (C), NOESY

(D) correlations of 22, 23-di-epi-micrandilactone J (3); and NOESY (E) correlations of micrandilactone J (2).

Figure 40. (A) Entire HSQC overlay. The black parts of the structures are identical and the blue parts are different based on the HSQC data. Key non-overlaid HSQC crosspeaks of micrandilactone J (2) and 22,23-di-epi-micrandilactone J (3) are shown.

Figure 41. DP4+ analysis outcome using the Excel spreadsheet available for free at sarotti-

NMR.weebly.com. Isomer 1 and Isomer 2 represents (2a) and (2b) of compound 2, respectively;

Gibbs free energy-based calculation outcomes were used for the analysis.

Figure 42. Rotamers and coupling constants for C-23–C-22(A), C-22–C-20 (B) of 2, C-23–C-

22(C), C-22–C-20 (D) of 3. Key NOESY correlations of 2 (E), (G), and 3 (F), (H).

Figure 43. Key HMBC correlations of 5.

Figure 44. The optimized conformation and the key ROESY correlations of 5.

Figure 45. X-ray ORTEP drawing of 5 revealing an unusual crystal packing (A) with eight structures in the unit cell (B).

Figure 46. Total absolute deviation (TAD), mean absolute error (MAE) and DP4+ probability analyses (sarotti-NMR.weebly.com) for 5 and three of its diastereomers (Gibbs free energies at the

PCM/mPW1PW91/6–311+G(d,p) level were used for the analysis).

Figure 47. The HSQC Overlay of of Compounds A (red) and B (gray)

Figure 48. The HSQC Overlay of of kadsuraols A (red) and C (green)

Figure 49. The experimental ECD spectrum of micrandilactone I (1).

Figure 50. The HRESIMS spectrum of micrandilactone I (1).

Figure 51. The 1H-NMR spectrum of micrandilactone I (1).

Figure 52. The 13C-NMR spectrum of micrandilactone I (1).

Figure 53. The HMBC spectrum of micrandilactone I (1).

Figure 54. The HSQC spectrum of micrandilactone I (1).

Figure 55. The experimental ECD spectrum of micrandilactone J (2).

Figure 56. The HRESIMS spectrum of micrandilactone J (2).

Figure 57. The 1H-NMR spectrum of micrandilactone J (2).

Figure 58. The 13C-NMR spectrum of micrandilactone J (2).

Figure 59. The ROESY spectrum of micrandilactone J (2).

Figure 60. HETLOC spectrum of micrandilactone J (2).

Figure 61. The experimental ECD spectrum of 22, 23-diastereoismomer-micrandilactone G (3).

Figure 62. The HR-ESI-MS spectrum of 22, 23-diastereoismomer-micrandilactone J (3).

Figure 63. The 1H-NMR spectrum of 22, 23-diastereoismomer-micrandilactone J (3).

Figure 64. The 13C-NMR spectrum of 22, 23-diastereoismomer-micrandilactone J (3).

Figure 65. The HSQC spectrum of 22, 23-diastereoismomer-micrandilactone J (3).

Figure 66. The HMBC spectrum of 22, 23-diastereoismomer-micrandilactone J (3).

Figure 67. The ROESY spectrum of 22, 23-diastereoismomer-micrandilactone J (3).

Figure 68. HETLOC spectrum of 22, 23-diastereoismomer-micrandilactone J (3).

Figure 69. The CD spectrum of Micrandilactone H

Figure 70. The HR-ESI-MS spectrum of Micrandilactone H

Figure 71. The 1H-NMR spectrum of Micrandilactone H

Figure 72. The 13C-NMR spectrum of Micrandilactone H

Figure 73. The HSQC spectrum of Micrandilactone H

Figure 74. The HMBC spectrum of Micrandilactone H

Figure 75. The NOESY spectrum of Micrandilactone H

Figure 76. The HRESI Mass Spectrum of Kadsuraol A.

Figure 77. The 1H NMR Spectrum of Kadsuraol A.

Figure 78. The 13C NMR Spectrum of Kadsuraol A.

Figure 79. The HSQC Spectrum of Kadsuraol A.

Figure 80. The HMBC Spectrum of Kadsuraol A.

Figure 81. The ROESY Spectrum of Kadsuraol A.

Figure 82. The Experimental ECD Spectrum of Kadsuraol A

Figure 83. The HRESI Mass Spectrum of Kadsuraol B

Figure 84. The 1H NMR Spectrum of Kadsuraol B.

Figure 85. The 13C NMR Spectrum of Kadsuraol B.

Figure 86. The HSQC Spectrum of Kadsuraol B.

Figure 87. The HSQC Overlay of of Kadsuraol A (red) and Kadsuraol B (gray)

Figure 88. The HMBC Spectrum of Kadsuraol B.

Figure 89. The ROESY Spectrum of Kadsuraol B.

Figure 90. The Experimental ECD Spectrum of Kadsuraol B.

Figure 91. The HRESI Mass Spectrum of Kadsuraol C.

Figure 92. The 1H NMR Spectrum of Kadsuraol C.

Figure 93. The 13C NMR Spectrum of Kadsuraol C.

Figure 94. The HSQC Spectrum of Kadsuraol C

Figure 95. The HSQC Overlay of Kadsuraol A (red) and Kadsuraol C (green)

Figure 96. The HMBC Spectrum of Kadsuraol C

Figure 97. The ROESY Spectrum of Kadsuraol C

Figure 98. The Experimental ECD Spectrum of Kadsuraol C.

Table 1. Ten Latrunculia sp collected in different places and their codes

Table 2. NMR data set of aleutianamine

Table 3: CS20 Medium.

Table 4. Different parts of sycamore tree used to analyze the yield of platanoside

Table 5. 1H and 13C NMR data for Micrandilactone I (1), Micrandilactone J (2) and 22, 23-di-epi-

Micrandilactone J (3) in pyridine-d5 using an INOVA-500 MHz spectrometer.

1 Table 6. H NMR Data of 5-7 in CDCl3, δ in ppm (J in Hz, 500 MHz).

Table 7. Hepatoprotective effect of compounds 1, 3, 4 and 5 (10 μM) against APAP-induced toxicity in HepG2 cell.

Scheme 1. Biosynthetic Conversion: Discorhabdin A to Discorhabdin B; and A or B to

Aleutianamone. Reduction of Aleutianamone leads to Aleutianamol(s) en route to Aleutianamine.

Scheme 2. Putative Biosynthesis Pathway Towards the Formation of 5–7.

Scheme 3. Biotrasformation of discorhabdin A to aleutianamine.

TABLE OF CONTENTS

CHAPTER ONE

COMPUTATIONALLY-ASSISTED DISCOVERY AND ASSIGNMENT OF A HIGHLY

STRAINED AND PANC-1 SELECTIVE ALKALOID FROM ALASKA’S DEEP OCEAN

Published in J. Am. Chem. Soc. 2019, 10, 4338; Accepted in Journal of Oncology and Cancer.

Research

Efficient Procedure to Target and Purify Active Metabolites

Latrunculia sp. MoIN directed discovery Targeted purification of potent and selective anti- PANC-1 novel compound

1. Introduction:

Distinguished by an extremely low five-year survival rate of 8% in the United States,

PC(PC) represents a significant public health issue rife with challenges43. Due to poor prognoses relative to other cancers, PC is the seventh highest cause of cancer-related death worldwide and ranks fifth in the United States based on the CDC despite being a relatively uncommon form of cancer in regard incidence rates. PC causing over 330,000 deaths worldwide in 201244-45. The efficacy of PC treatment has changed little over time as a result of difficulties in diagnosis and poor response to chemo- and radiation -therapies. This disparity, compared to other cancer types, has led to the projection that PC will become the second most deadly cancer by 2030, surpassed only by lung cancer2. Any improvements in treatment will come as a much-needed reprieve to patients diagnosed with this uniquely-challenging and lethal disease.

Treatment options for PC, as with most cancers are highly dependent on the stage at the moment of diagnosis; for PC patients, surgery is currently the only potentially curative treatment, but is limited to only 15-20% of patients, largely due to the high rate of metastasis46. As a result, chemotherapy and radiation therapy play an important role throughout PC treatment. Some of the current PC chemotherapeutics like gemcitabine were developed to target some of the very gene mutations used in tracking the disease like BRCA1 and BRCA247. For patients suitable for surgery, these treatments can be used pre- or post-operation to reduce the risk of further tumor growth, spread or recurrence. Additionally, for patients not suitable for surgery, chemo-, and radiation therapy are the primary treatment options to extend and improve the quality of life. However, the use of radiation therapy in PC patients has been controversial and is most efficacious when performed in tandem with chemotherapy, which has been shown to improve patient outcome alone48-49. This lends credence to the assertion that increasing the chemotherapeutic options for the treatment of PC is a critical strategy in addressing this global public health issue. Currently, there

24 are four major first-line drugs approved for the treatment of pancreatic cancer: fluorouracil, erlotinib, gemcitabine, and mitomycin C (Fig.1). Fluorouracil and gemcitabine act by replacing pyrimidine and cytidine, respectively, during the biosynthesis of nucleic acids and DNA replication. As a result, tumor growth is arrested by false nucleoside incorporation induced cell death. Mitomycin C is a DNA cross-linking agent, which can react with two different positions in

DNA, halt DNA synthesis and lead to apoptosis. Erlotinib is a small molecule human epidermal growth factor receptor 1/epidermal growth factor receptor (HER1/EGFR) tyrosine kinase inhibitor, preventing the growth factor and receiver from being phosphorylated, effectively disrupting the signaling pathway28. However, regardless of whether these drugs are used alone or in combination, none have been effective in significantly improving overall survival rates.

Figure 1. First-line drugs used for the treatment of pancreatic cancer4.

Natural products have provided valuable drugs to treat cancer and to assist in a better understanding of this disease.50-52 It has been estimated that up to 50% of all present medicines have been derived from natural products, and in the case of cancer, this is near 75%.53-54 The plant derived paclitaxel, one of the most highly documented chemotherapeutic from a natural source, with marine invertebrates provided lead molecules such as halichondrin B, didemnin B, and dolastatins, are in various stages of development.55-57 More recently, marine organisms have demonstrated a great potential for discovery of anticancer drugs, including bacteria and fungi

(salinosporamide A and dolastatins), tunicates (didemnin B) and sponges (halichondrin B).58

Among these marine derived anti-tumor agents, pyrroloiminoquinone alkaloids have been studied for decades.32, 59-60 The pyrroloiminoquinone alkaloids exhibit strong cytotoxicity toward different types of tumor cell lines.61-62 The potent activities and unique structures have resulted in several total syntheses63-65 and biosynthetic studies.66-69

Our recent discovery of new discorhabdins70 and related metabolites71 from the Alaskan sponge Latrunculia sp. prompted a recollection during a NOAA deep ocean survey to facilitate the discovery of natural analogues. Identification of unknown molecules, early in the NP workflow minimizes time, effort, and cost.72 Current dereplication strategies include HPLC-MS, HPLC-

NMR, and HPLC-NMR-MS.73-74 However, a full elucidation either occurs late in the workflow or otherwise remains elusive. Mass spectrometry based dereplication is critical to modern natural product dereplication pipelines which is more sensitive and easier to interpret than NMR. however, it is often difficult to reliably dereplicate a given compound when solely using precursor or parent masses because of the number of results. However, MS/MS data are definitive characteristics of a molecule and thus could be effectively used in dereplication. The underlying assumption of MS together with MS/MS-based dereplication is that structural architecture, chemical stability, and

26 functional groups combine to dictate reactivity by collision-induced dissociation As an efficient protocol recently developed for the discovery of new natural products, networking analysis enables visualization of observed molecules as familial groupings in which commonalities within the MS fragmentation data are assessed via vector correlations and displayed as an MS/MS network.75 The visualization of networks by using Cytoscape enable the direct observation of similarities as well as differences between two or more samples in which similar entities within the network are clustered together while disparate or unique entities are grouped separately.76 In this manner, initial discovery of unknown substances was facilitated.

Further exploration now calls for well-defined chemical structures. Single crystal X-ray diffraction analysis remains the most straightforward approach in the structure elucidation of novel compounds.77 However, a crystal that diffracts well is not always easily obtained. NMR spectroscopic analysis continues to be the most widely applied approach for structure elucidation albeit challenging when applied to architecturally unique molecules. In the latter cases, computational chemistry, in conjugation with spectroscopic methods, provides a powerful tool for the assignment of atom connectivity, relative, and absolute configurations of complex molecules.78-79 Highly noteworthy is the protocol developed recently by Martin, Williamson, et al.77 incorporating anisotropic NMR parameters with computational approaches to determine the structures of complex natural products. Atom connectivity and stereochemical assignment using

NMR chemical shift calculation tools, such as GIAO calculation/DP4+ probability,80-81 also allows accurate prediction of the real structure among otherwise possible constitutional isomers/diastereomers. Excited-state calculation methods such as TDDFT have been widely applied in conjunction with experimental ECD spectroscopy to determine the absolute configurations of natural products.82-84 We report herein a new protocol that involves the

27 compound discovery and orchestration of different computation methods in combination with spectroscopic analyses that together led to the establishment of a well-defined molecular structure of aleutianamine.

GNPS Sample extract “Seed” MS/MS of known

LCMS/MS analyzing Networking +

Visualize the data

Analyze data, Pick out the target and active analogs purify cluster

Figure 2. General procedure to implement molecular networking for dereplication. Experimental MS/MS spectra of samples, and MS/MS spectra of known molecules are analyzed by GNPS. The resultant network is visualized in Cytoscape.

2. Materials and Methods

2.1 Extraction and purification

Four kilograms of frozen sponge was cut into 1-2 cm3 pieces followed by extraction with ethanol assisted by ultrasonication at room temperature, affording about 225 g crude extract. This extract was directly applied to flash silica gel VLC with gradient elution of n-hexane-ethyl acetate

(50:50, 0:100) followed by ethyl acetate-methanol (75:25, 50:50, 0:100) then methanol-water

(50:50). The ethyl acetate-methanol (75:25, 50:50) fractions were combined and loaded on a

Sephadex LH-20 glass column with an elution system of dichloromethane-methanol (50:50) under normal pressure. The Sephadex LH-20 fractions with MW range from 300-700 Daltons were subjected to C18 medium pressure chromatography eluded with methanol-water (0.03% trifluoroacetic acid) for crude separation. The fractions eluted with 10-60% methanol (large sets of fractions were combined to acquire the crude mixture of different pyrroloiminoquinone alkaloids) were further purified by using preparative HPLC (Phenomenex C18 column, 21.2 × 250 mm with flow rate at 8 ml/min; or C8 column, 10.0 × 250 mm with flow rate at 4 ml/min) with a mobile phase of MeCN- H2O (0.05% trifluoroacetic acid) or MeOH- H2O (0.05% trifluoroacetic acid) to yield aleutianamine (15 mg) and other known discorhabdins. (Fig. 3) Aleutianamine was isolated as TFA salt with FTHRESIMS signals at 397.9959 [M]+ and 399.9937 [M+2]+ (calcd for

C18H13BrN3OS, 0.32 ppm) with a observed ratio of 1:1.2. CD (MeOH), λmax=224 nm (Δε +1.25),

λmax=268 nm (Δε -1.43), λmax=322 nm (Δε +0.46), λmax=378 nm (Δε -0.83), λmax=590 nm (Δε

+0.16). IR (film), v 3107, 2922, 1666, 1514, 1411, 1341, 1168, 1124, 995, 798, 718 cm-1.

Figure 3: Isolation scheme of aleutianamine and other discorhabdin analogs.

2.2 NCI samples MoIN analyzing. Each compound from six standards and the 10 crude ethanol extracts of Latrunculia sp. from NCI were solubilized in 100% MeOH to 1mg/ml. The injected samples were chromatographically separated using a Agilent analytical UHPLC (Santa Clara, CA) using a 100 X 4.6 mm Kinetex 1.7 µM, C8, chromatography column (Phenomenex Torrance, CA),

1mL/min flow rate, mobile phase A 99.9% water (VWR, LC-MS grade) 0.1% formic acid (VWR), mobile phase B 99.9% acetonitrile (VWR, LC-MS grade) 0.1% formic acid (VWR), with the following gradient: 0-1 min 5% B, 1-15 min 100% B, 15-25 min, 100% B, 26-30 min, 5% B for all samples.

Table 1. Ten Latrunculia sp collected in different places and their codes

Country Family Genus Subgenera Species

Northern New Zealand (Auckland) Latrunculiidae Latrunculia Biannulata procumbens

Northern New Zealand Latrunculiidae Latrunculia Biannulata procumbens

Southern New Zealand (Chatham) Latrunculiidae Latrunculia Latrunculia triverticillata

Southwestern Australia Latrunculiidae Latrunculia Biannulata purpurea

Northern New Zealand (Auckland) Latrunculiidae Latrunculia Biannulata kaakaariki

Antarctic (South Polar) Latrunculiidae Latrunculia Latrunculia biformis

Southwestern Australia Latrunculiidae Latrunculia Latrunculia n. sp.

Northern New Zealand Latrunculiidae Latrunculia Latrunculia fiordensis

Cape of Good Hope (Cape Province) Latrunculiidae Latrunculia Biannulata lunaviridis

Alaska Island Latrunculiidae Latrunculia

2.3 Molecular annotations. The annotation of compounds was done in two steps. First, the sample data was subjected to automated dereplication work flow situated on Global Natural Products

Social Molecular Networking (GNPS) platform online (http://gnps.uscd.edu). The output table with annotation was analyzed, annotations with corresponding retention times, m/z’s, ppm errors were recorded and summarized in table. The manual annotation of unidentified signals in the chromatogram of analyzed mixture was performed by matching of exact mass of compounds and by comparing their MS/MS fragmentation spectra to the standards.

2.4 Molecular Networking. Raw data files were converted to the .mzXML format using

ProteoWizard sorftware and uploaded to the GNPS. Molecular networking parameters were as follows: a minimum matched peaks threshold of 4, a cosine similarity score cutoff of 0.7, minimum intensity of 800 and ion tolerance of 0.5 Da. Molecular networks were visualized and mined using

Cytoscape software.

2.5 Zone assay methodology. A volume of 15 µl of aleutianamine (2 mg/ml) is dropped onto a

65 mm disk. The disks are allowed to dry overnight and then placed close to the edge of the petri dish. The plates are incubated for 7 days and examined by an inverted stereo-microscope for measurement of the zone of inhibition of the colonies measured from the edge of the filter disk to the beginning of control-size colony formation.the diameter of the disk is taken as 200 units. A zone is less than 300 units is taken as the sample is of insufficient activity to be further interest. A difference in zones between solid tumor and either normal or leukemia cell of 250 units or greater

32 defines a solid tumor selective compound. When the sample was diluted 16-fold or greater to obtain a zone of 500 units or more against any solid tumor cells, the sample is termed potent.

3. Result and discussion.

3.1 Analysis of MoIN of Latrunculia sp.

Figure Saaa Annotation of discorhabdins cluster MS/MS spectra of ten different Latrunculia sp. the pink signals are discorhabdins standard identified by NMR. The orange signal is only observed in the Latrunculia (Latrunculia) sp. nov. (Tasmania), the red signals are only observed in the

Latrunculia biformis Kirkpatrick, 1908, and the purple signal is only found in Alaska sponge

Latrunculia sp.

Figure 4. Annotation of discorhabdins cluster MS/MS spectra of 391.045. The MS/MS fragmentation, precursor masses, and isotopic pattern for signal of 535.135 and 336.104 were highly suggestive of the

33 known metabolite discorhabdins H2 and discorhabdins D respectively. The signal of 391.045 with different retention time with discorhabdins H2 and discorhabdins D suggested new analogs. Based on the fragmentations and molecular weight, the substituent group of the new discorhabdin should be -C2H4CN.

The putative structure is shown above.

c 249 535.135

b a 303 335

249 391.045 c a b 335 303

Figure 5. Annotation of discorhabdins cluster MS/MS spectra of 375.034, 376.04 and 376.024. The signals of 375.034, 376.04 and 376.024. with same retention time with new discorhabdin with MW of 391.045 suggested these signals might be the fragments of 391.045 and the high cosine value (0.96) also indicated they were almost identical. The raw MS/MS data of 391.045 also showed the signals of 375.034, 376.04 and 376.024, indicating they are fragments not the parent mass.

Figure 6. Annotation of discorhabdins cluster MS/MS spectra of 429.999. The MS/MS fragmentation, precursor masses, and isotopic pattern for signal of 416.489 were highly suggestive of the known metabolite discorhabdins B. The signal of 429.999 with different retention time with discorhabdins B suggested new analogs. Based on the fragmentations and molecular weight, there is an extra hydroxy group compared to discorhabdins B. The putative structure is shown above.

a 429.999 c 333 249 b 301 188 305 203

c a 413.988 249 333 380 b 301

218

3.2 Structure elucidation of aleutianamine

To further explore this unknown molecule, large scale extraction and purification of the sponge sample led to isolation of the potential target (m/z 398) resulted from MoIN analysis (vide supra) as a green-yellow solid with the molecular formula of C18H13BrN3OS generated by high resolution mass spectrometry analysis. The presence of 18 carbons was validated with 18 signals in a 13C-

NMR spectrum. A pyrroloiminoquinone moiety was initially proposed by comparing the aromatic region of the 13C-NMR with the known natural product discorhabdin A.i The presence of this moiety was further confirmed by the COSY correlation of H-16 with H-17, ROESY correlations of H-14 with H-13 and H-16, and HMBC correlations indicated on Fig. 8. Interestingly, H-17b

36 displayed an additional HMBC correlation with a tertiary carbon (δC 62.8) of which the attached proton (δ 5.20, t, J=2.8) also displayed a HMBC signal to C17 (Fig. 8). This evidence suggested that the later now C-3(δ 62.8) was connected to the pyrroloiminoquinone moiety likely via the imine nitrogen (N-18). The presence of this connection was secured by the 1H-15N HMBC correlation of H-4b (vide infra) to N-18 (δ 143.2). N-18 was thereby quaternary and positively charged.

The frozen Alaskan sponge Latrunculia sp. was extracted and purified to afford aleutianamine as a green-yellow TFA salt soluble in methanol and DMSO. An accurate molecular formula

C18H13BrN3OS was established based on the data acquired from FT-MS. The presence of 18 carbons was further validated with 18 signals in a 13C-NMR spectrum. The 13C NMR resonances of C10 through C21 showed the pattern corresponding to a pyrroloiminoquinone scaffold85 represented by discorhabdin A, with the exception of C17 (δ 52.5) shifted 6-10 ppm downfield which provided possible evidence for a positively charged nitrogen. The 13C NMR resonances of other signals displayed a unique pattern that is differ from any other reported pyrroloiminoquinone alkaloids.

The structure elucidation started with the arrangement of the six-membered ring constructed from

C1 through C6. COSY correlations of H4a and H4b linked H3; followed by the HMBC correlations from both H4a and H4b to C5 and C6; in addition to H4a to C2 and C3; as well as H3 to C1, C2, C4 and C5; and H1 to C2, C3, C5, C6 and C7. An overlaid 13C-NMR spectrum with a

DEPT spectrum indicated that C6 (δ 141.4) was quaternary and was connected to the quaternary

C5 to close the six-membered ring. Therefore, C1 (δ 128.4) and C2 (δ 117.2) together with C6 and

C7 (δ 111.9) generated a conjugated diene moiety, and there was no detectable homonuclear coupling constant for the H1 signal (δ 7.12). The olefinic carbon C2 (δ 117.2) was detected in the

37 high field region because of the shielding effect of the bromine substitution. This assignment was further supported by the isotope peak pattern acquired from the mass spectrum. The seven- membered ring moiety was constructed from C5 to C8, N9, C10 and C21 beginning from the

COSY correlation of H7 and H8 followed by the HMBC correlations from H7 to C6, C5, C8 and

C21; as well as H8 to C6, C7 and C10, and finally confirmed by the HMBC from H4a, b to C21.

Sulfur incorporating is common in pyrroloiminoquinone alkaloids32 and also the case here. Based on the formula generated by the FT-MS and the calculated double bond equivalent, the sulfur atom was assigned as a thioether bridge and could only be placed between C5 (δ 48.7) and C8 (δ 64.6) based on the carbon chemical shifts. This placement of the sulfur was further supported by a 3- bond HMBC correlation from H8 to C5 through the thioether-bridge. The chemical shift of C3 (δ

62.8) suggested a possible connection to a heteroatom. Based on the calculated double bond equivalent and the chemical shift, a covalent connection was established between C3 and N18 to join the six-membered ring with the iminoquinone moiety to form yet another ring. The HMBC correlations from H3 to C17 and C19 as well as H17b to C3 were detected to verify this connection.

Also, a 1H-15N HMBC experiment was performed to further confirm this connection in addition to assessing the chemical environment of the positive charged nitrogen on the bridgehead. The correlations from H4b, H16a and H17a to N18 were clearly observed. Notably, the signal of the positive charged N18 indirectly detected at 143 ppm was more shielded than the tertiary N13 (δ

168).

Table 2. NMR data set of aleutianamine

δC δH (mult, J, Hz) δC δH (mult, J, Hz) COSY HMBC ROESY 1H-15N HMBC Atom

No. (in MeOD-d4) (in MeOD-d4) (in DMSO-d6) (in DMSO-d6) (in DMSO-d6) (in DMSO-d6) (in DMSO-d6) (in DMSO-d6)

1 127.8 7.12, s 128.4 7.20, s C-2, C-3, C-5, C-6, C-7 H-4b, H-7 2 116.7 117.2 3 63.4 5.12, t, J=2.9 62.8 5.20, t, J=2.8 H-4a, H-4b C-1, C-2, C-4, C-5, C-17, C-19 H-4a, b, H-17a,b

4a 31.1 2.55, dd, J=2.2,12.7 31.4 2.50, dd, J=2.7, 12.7 H-3, H-4b C-2, C-3, C-5, C-6, C-21 H-3, H-4b

4b 2.65, dd, J=3,12.7 2.60, dd, J=2.7, 12.7 H-3, H-4a C-5, C-6, C-21 H-1, H-3, H-4a N-18

5 48.5 48.7

6 141.5 141.2 7 111.1 5.40, d, J=3.2 111.9 5.42, d, J=3.1 H-8 C-1, C-5, C-6, C-8, C-21 weak H-1, H-8

8 64.0 5.96, d, J=3.3 64.6 6.02, brd, J=3.2 H-7 C-5, C-6, C-7, C-10 H-7, H-9

NH-9 N/A 10.95, brs H-8

10 140.8 140.9

11 167.2 167.9

12 124.3 124.5

NH-13 167.8 (15N) 13.12, s H-14

14 125.2 7.07, s 126.7 7.24, s C-11 weak, C-12, C-15, C-19 weak, C-20 H-16a,b, H-13 N-13

15 118.0 117.2 16a 19.8 3.10, dt, J=4.2,16.2 20.3 3.05, m H-16b, H-17a, b C-14, C-15, C-17, C-20 H-14, H-16b, H-17a,b N-18

16b 3.22, m 3.10, m H-16a, H-17a, b C-14, C-15, C-17, C-20 H-14, H-16a, H-17a,b 17a 52.6 4.24, dd, J=4.3, 10.5 52.5 4.10, m H-17b, H-16a, b C-15, C-16, C-19 H-3, H-16a,b, H-17b N-18

17b 4.26, dd, J=4.3, 10.5 4.30, dd, J=6.0, 14.0 H-17a, H-16a, b C-3, C-15, C-16, C-19 H-3, H-16a,b, H-17a

N-18 143.2 (15N)

19 148.3 147.9

20 121.2 121.6

21 100.3 100.0

The relative configuration and the three-dimensional structure were drafted by a ROESY experiment and quantitatively trimmed by a computational approach (Fig. 8). H8 showed a strong

ROESY correlation solely with H7, and H7 showed an additional correlation with H1 verifying

H7 and H8 were vicinal to each other (J=3.1 Hz) and arranged on the seven-membered ring, and

H1 was thus located on the six-membered ring. On this bromine substituted six-membered ring moiety, the correlations of H1 with H4b, and H4a,b with H3 were clearly observed. The ROESY correlation between H4a and H1 was undetectable, which suggested H4a and H4b were placed on the equatorial and axial positions, respectively, and this ring was in a stable half-chair conformation. ROESY correlations of H3 with H17a and H17b were detected to further confirm the connection between C3 and N18. In addition, the two exchangeable protons detected at 10.95 ppm and 13.12 ppm were assigned to H9 and H13 by the observed ROESY correlations from H8 to H9, and H13 to H14, respectively.

From a computational analysis, the lowest energy conformation of aleutianamine was optimized by the density functional theory (DFT) calculation at B3LYP/6-311++G(3d,3p) level with the PCM (Polarizable Continuum solvation Model) using dielectric constant representing

DMSO. The calculation verified the half-chair conformation of the six-membered ring constructed by C1 through C6 and all other reasonable molecular geometries. As a computed result, all of the calculated distances between non-exchangeable protons were under the classified ROESY distance constraint ranges which were deduced from the signal integration values (Table S2). Highly noteworthy, the experimental values of the signal intensities were exponentially regressed with the computed distances.

The final structure was considered to be rigid and conducive for a reliable geometry optimization at acceptable computational cost due to the many ring constraints. The absolute

40 configuration of aleutianamine was then determined by overlaying the computed ECD curves with the experimental ECD spectra. Based on the elucidated relative configuration using NMR, the conformational analysis was conducted using the Amber force field method followed by the PM6 semi-empirical optimization in tandem to acquire the pre-optimized geometries. It resulted in only one local minimal in addition to the global minimal energy conformation, which were produced by the half-chair conformational interconversion on the six-membered ring formed by C15 through

C20. Acquired from a DFT calculation, the relative total energy of these two low energy conformers was about 5.3 kJ/mol. Each DFT optimized structure was then used for excited state calculations by using the TD-DFT method. The calculated excitation energies and rotatory strengths of each conformer were weighted to the Boltzmann average, and then introduced to the

Gaussian function to generate the simulated ECD curves. From the comparison (Fig. 9), the absolute configuration of aleutianamine was unambiguously assigned as 3R, 5R, 8S.

Figure 8. Key HMBC, COSY, and ROESY correlations Figure 7. Structure of aleutianamine

Figure 9. Overlaid experimental ECD spectra with the computed ECD curves at B3LYP/6-31G(d,p) level.

Differentiation of the Br-substituted sp2 13C-NMR signals from those non Br-substituted sp2 carbons, based solely on 13C or 1H chemical shifts is unreliable because of the similarity chemical shift86. However, in optical cases, Br-substituted carbon can be identified by 1H and 13C

NMR chemical shift calculations using gauge the independent atomic orbital (GIAO)87-89method at the PCM/mPW1PW91/6-311+G(d,p) level of theory89 for DP4+calculations90. two possible regioisomers of aleutianamine having the bromo substituent at C-1 and C-2 a regioisomer with swapped positions of NH and S were employed for DFT and DP4+ calculations. The calculated chemical shifts of aleutianamine-1 (3R, 5R, 8S), aleutianamine-1′ (3R, 5R, 8S), and aleutianamine-

1′′ (3R, 5R, 8R) were compared to the experimental 1H and 13C NMR chemical shifts via the corrected mean absolute error (CMAE) as well as DP4+ probability chemical shift analysis (Fig.

10). The CMAE results showed that aleutianamine-1 (3R, 5R, 8S) was the most probable isomer

(Fig. 10). These results were corroborated by the DP4+ statistical analysis, which predicted aleutianamine-1 (3R, 5R, 8S) with a probability of 100%. It is worth noting, however; that DP4+ predicted aleutianamine-1′ (3R, 5R, 8S) based on the 1H NMR data only, aleutianamine-1 (3R, 5R,

8S) based on the 13C NMR data only, and aleutianamine-1 (3R, 5R, 8S) based on 1H and 13C NMR

42 data. Collectively, the excellent agreement between NMR spectroscopic and computational data strongly supported the (3R, 5R, 8S) absolute configuration of aleutianamine.

Aleutianamine-1 Aleutianamine-1′ Aleutianamine-1′′ DP4+ CMAE TAD DP4+ CMAE TAD DP4+ CMAE TAD Proton 0.01% 1.08 14.01 Proton 99.99% 0.76 9.84 Proton 0.00% 5.75 74.80 Carbon 100.00% 2.58 46.45 Carbon 0.00% 3.26 58.63 Carbon 0.00% 5.37 96.66 Both 100.00% 3.66 60.46 Both 0.00% 4.02 68.47 Both 0.00% 11.12 171.46 Figure 10. Total absolute deviation (TAD), mean absolute error (MAE), and DP4+ probability analyses

(sarotti-nmr.weebly.com) for 1 and three of its diastereomers (Gibbs free energies at the

PCM/mPW1PW91/6-311+G(d,p) level were used for the analysis).

The unique aleutianamine ring system demonstrated solid tumor selectivity in the differential cytotoxicity zone assay used for discovery of new anticancer leads.25 Selectivity of cell killing was noted for murine colon cancer 38, human breast cancer MCF-7, human prostate cancer

LNCaP and human PCPANC-1 compared to both murine and human leukemia cells. This breadth of selectivity is unusual for active compounds which usually demonstrate selectivity to only one of the cell types tested against. The IC50 value for aleutianamine tested against human HCT-116 colon cancer cells was 0.1 uM indicating reasonably potency. Clonogenic studies were carried out using HCT-116 cells to define the concentration-survival relationship as a function of exposure

26 time. The endpoint used, tS10 (10% survival of clonogenic cells for exposure time t) provides information essential for future preclinical therapeutic studies. These clonogenic studies yielded a

2S10 value of >5 uM; a 24S10 value of 0.75 uM; and, a 168S10 value of 0.1 uM. The clonogenic data indicated that, depending upon the pharmacokinetics and maximum tolerated dose of

43 aleutianamine, a chronic treatment might be expected to be efficacious. The principal structural feature of discorhabdin is the core of a planar iminoquinone moiety which can intercalate into

DNA and cleave the DNA double helix or inhibit the action of topoisomerase II. The makaluvamines except makaluvamine B are topoisomerase II inhibitors acting via cleavable complex formation, or via the direct induction of DNA double-strand breaks. Makaluvamine A and C are reported to decrease tumor size in a solid human tumor model. However, discorhabdins

A and C exhibited no inhibition of topoisomerase II in contrast of their significant cytotoxicity

Table 3. Anti-cancer cells disk diffusion assay result.

Leukemiacells Colon 38 (coloncancer() H H MCF cell lines) LNCaP (Glioblastoma U251N MDA PANC

- -

Conc. 116 125

Compound -

(mg/ml)

DMSO 0 0 0 0 0 0 0 0 0

Ecdysone 2 0 0 0 0 0 0 0 0 0

Aleutianamine 2 950 >1000 >1000

" 0.5 700 >1000 950 >1000 >1000 >1000 >1000

" 0.125 500 900 600 900 >1000 1000 850 800 >1000

" 0.03125 250 450 250 400 600 500 700 500 650

Discor A 2 1000 750 >1000

" 0.5 300 800 900 950 800 300 1000 450

" 0.125 250 700 500 750 600 500 300 500 150

" 0.03125 100 100 400 350 250 200 300 100

Karlotoxin 2 2 150 200 200 100 200 400 150 200 200

with the same core inimoquinone skeleton suggesting a different mechanism.

Discorhabdins A and C demonstrated the highest cytotoxicities against several tumor cell lines.

Based on the data we have, aleutianamine showed higher cytotoxicity than discorhabdin A towards cancer cell lines and demonstrated selective inhibition to PCcell lines making its further development as anticancer drug.

Scheme 1. Biosynthetic Conversion: Discorhabdin A to Discorhabdin B; and A or B to Aleutianamone. Reduction of Aleutianamone leads to

Aleutianamol(s) en route to Aleutianamine.

1 Figure 11. H NMR spectrum of aleutianamine in DMSO-d6

H-1

H-14 H-16a H-8 H-7 H-3 H-16b H-17b NH-13 H-17a H-4b NH-9 H-4a

13 Figure 12. C NMR spectrum of aleutianamine in MeOD-d4

C-1 C-8 C-7 C-17 C-14 C-2 C-3 C-5 C-4 C-16 C-6 C-20 C-11 C-19 C-12 C-21 C-10 C-15

13 Figure 13. C NMR spectrum of aleutianamine in DMSO-d6

C-20 C-5 C-12 C-2 C-6 C-14 C-21 C-1 C-15 C-17 C-11 C-19 C-8 C-3 C-4 C-16 C-7 C-10

Figure 14. DEPT 135 NMR spectrum of aleutianamine in MeOD-d4

C-3 C-1 C-7 C-8 C-14

C-16 C-4 C-17

1 13 Figure 15. 2D H- C HSQC NMR spectrum of aleutianamine in DMSO-d6

1 13 Figure 16. 2D H- C HMBC NMR spectrum of aleutianamine in DMSO-d6

H-1 H-16b H-4a H-14 H-8 H-7 H-3 H-17b H-17a H-16a H-4b

C-16 C-16 C-4

C-5 C-5 C-5 C-5 C-5 C-5 C-17 C-3 C-8 C-3 C-3

C-21 C-7 C-7 C-21 C-15 C-2 C-2 C-15 C-15 C-15 C-2 C-20 C-20 C12 C-1 C-14 C-10 C-6 C-6 C-6 C-6 C-19 C-19 C-15

C-11

1 1 Figure 17. 2D H- H COSY NMR spectrum of aleutianamine in DMSO-d6

H-1 H-3 H-17a H-16b H-4a H-8 H-14 H-7 H-17b H-16a H-4b

H-4b H-4a H-16a H-16b

H-17a H-17b H-3 H-7 H-8

H-1 H-14

1 1 Figure 18. 2D H- H ROESY NMR spectrum of aleutianamine in DMSO-d6

H-1 H-14 H-3 H-16a H-8 H-7 H-17b H-16b H-17a H-4a H-4b H-4a H-4b H-16b H-16a H-17b H-17a H-3 H-7 H-8 H-1 H-14

1 15 Figure 19. 2D H- N HMBC NMR spectrum of aleutianamine in DMSO-d6

Figure 20. FT-MS spectrum of aleutianamine

CHAPTER TWO

THE MICROBIOME OF AMERICAN SYCAMORE PRODUCES RAPAMYCIN AS PART

OF A UNIQUE SYMBIOTIC PLANT-ENDOPHYTE RELATIONSHIP

Bacillus. amyloliquefaciens

Platanus. occidentalis

MS image of rapamycin

Introduction

Plant-microbiome association studies have revealed that symbiotic microorganisms are known to chemically protect the host but at the same time overgrowth of the endophyte also can cause harm to the plant. The role of natural products in microbiome-plant associations and the overall success of the host remains largely unexplored. Here, we show American sycamore

(Platanus. occidentalis L.) tissue contains rapamycin and iturin lipopeptides and that these secondary metabolites are produced by a Bacillus. amyloliquefaciens subsp. plantarum strain isolated from the plant microbiome by LC-MS, MALDI-IMS, NMR. Rapamycin and plantazolicin production were limited to within the growing colony while lipopeptides were excreted. It has been reported that when the Target of Rapamycin (TOR) is inhibited in plants treated with rapamycin,

it will promote autophagy of the cells and differentiation of xylem tracheary elements as well as extend the life-expectancy of the plant36. These results revealed that rapamycin generated by B. amyloliquefaciens appears to play a key role in the development of vascular tissue to transport water in this species of tree, promote autophagy of autumn leaves thus recovering nutrients and contribute to sycamore unique longevity. We also exhibited that American sycamore produced platanosides showed a seasonal and plant organ specific difference in concentration and dose dependent inhibition to B. amyloliquefaciens, suggesting plant host regulation of B. amyloliquefaciens subsp. plantarum. The metabolites from endophytes and hosts mediate the interaction to realize the success of this species.

Plant-microbiome symbiosis represents some of the oldest and most well established symbiotic relationships on our planet. Symbiotic microorganisms are well established promoters of plant health through the generation of natural pesticides for the plant in addition to nitrogen fixation34-35. At the same time overgrowth of endophytes can cause harm to the plant33. Plants generate structurally diverse metabolites with important functions in influencing interactions between both members of their external environment in addition to their microbiome. These antimicrobial compounds are often stored in specialized organs and tissues91. An understanding of the chemical function and the overall success of the host remains largely unexplored and challenging due to trace levels below detection, or limitations in chemoinformatics tools91.

The family Platanaceae is among the living fossils of our planet and an old family of angiosperms extending back to the Early Cretaceous92-94. The genus Platanus represents the only living member of the family and are large perennial trees growing up to 50 m high and 4 m in diameter95. The genus Plantanus is found throughout the world and the ‘Tree of Hippocrates’ is a member of this genus group. Platanoside isolated from the sycamore leaves has shown potent

antibiotic activity against Methicillin-resistant Staphylococcus aureus (MRSA)95-96 and is currently under development as a new class of antibiotics.

B. amyloliquefaciens subsp. plantarum strains have been isolated from soil as well as the inner tissue of numerous plant shoot and root anatomical structures across many species97-100. It is mainly used in agriculture, aquaculture and hydroponics to fight root pathengens101 as well as improve tolerance to salt stress102. To date, elucidated benefits of B. amyloliquefaciens to the plant host include pathogenic defense, seedling emergence and overall growth promotion, gibberellin production, plant endogenous hormone regulation, and stimulation of plant host immunity, among others97-99, 103. A comparative analysis of the genome of B. amyloliquefaciens subsp. plantarum

FZB42 to the model organism B. subtilis showed it contains an unusual proclivity for producing secondary metabolites97. B. amyloliquefaciens recently followed B. subtilis in being divided into subspecies, which distinguishes between strains that cluster with B. amyloliquefaciens DSM 7 and those that cluster with plant-associated, growth-promoting strains104. Importantly, the plant- associated types, now named B. amyloliquefaciens subsp. plantarum with an addendum of the specific isolated strain, contain more than twice the genetic capacity for non-ribosomal secondary metabolite biosynthesis97, 104. Iturin and fengycins are B. amyloliquefaciens common metabolites and possess well established anti-fungal activity against many known plant pathogens.

Rapamycin is a macrocyclic lactone first and only reported from a soil sample of Easter

Island providing the rapamycin producing bacterium Streptomyces hygroscopicus (S. hygroscopicus)105. Rapamycin has found clinical utility for the treatment of organ rejection following renal transplant surgery and the amelioration of some side effects associated with alternative treatments106. Rapamycin has been shown to have antifungal107 and antitumor activity108 and has also been reported to extend lifespan in both vertebrate and invertebrates,

including yeast, nematodes fruitflies and mice109-112. An array of studies have shown that rapamycin can induce cell autophagy, arrest plant growth, differentiate xylem tracheary elements as well as extend the life-expectancy of the plant 36. Studies in yeast into the mechanism of action of rapamycin led to the discovery of TOR proteins, serine/threonine kinases that couple cellular inputs to spatial and temporal cell growth in eukaryotes113-114. These proteins are highly conserved among all eukaryotes and much of the TOR signaling pathway evolved before the Last Eukaryotic

Common Ancestor114-116. In mammals, TORs form two distinct complexes, Target of Rapamycin

Complex (TORC) 1 and 2, and rapamycin only inhibits TORC1. Plant genomes encode orthologs of known components of TORC1 and numerous studies have shown the presence of TORC1 in plants, but not TORC2117. Arabidopsis thaliana was originally reported as insensitive to rapamycin, but later studies in showed rapamycin inhibits glucose-mediated root and leaf growth, and studies in maize (Zea mays L.) also displayed plant sensitivity to rapamycin118-119. In photosynthetic plants,

TOR signaling regulates translation, transcription, autophagy, and primary and secondary metabolism and is integral to photosynthesis, embryogenesis, meristem activation and flowering, and other aspects of plant life120.

Here we present solid evidence that the plant microbiome B. amyloliquefaciens cultured from American sycamore produce rapamycin as shown by HR-LCMS, NMR, mass imaging (MI) and molecular ion networking (MoIN). A metabolomics analysis using MoIN of sycamore tissues revealed that the vegetative state of B. amyloliquefaciens inhabits the xylem but not the healthy leaves. Published results show that inhibiting TOR in plants will promote autophagy and differentiation of xylem36, indicating that rapamycin from the microbiome helps to create vascular tissue by promoting differentiation of xylem and in the autumn assist in energy recover from leaves by promoting autophagy. Thus rapamycin appears to play a significant role in the transport of

water to the top of these tall trees as well as recovery of nutrients from leaves before they are shed in the autumn. We also found the antibiotic platanoside concentrations of summer leaves showed dose-dependent inhibition to the growth of B. amyloliquefaciens and the metagenomics results support that B. amyloliquefaciens resides in the xylem but not the summer leaves. Coupled with the reported physiological function of TOR, our experimental results demonstrate that during the summer the high yield of platanoside in the sycamore leaves prevents B. amyloliquefaciens from migrating into the leaves and are restricted to the vascular tissues of the trunk and branches. During autumn the antibiotic concentration to the leaves drops to levels that can be tolerated by the

Bacillus sp. The spores of the bacterium can then germinate in the leaves where it induces autophagy of leaf cells prior to the leaves falling from the tree. Thus the tree recovers as many key nutrients from the leaf as possible before they fall from the tree in the autumn.

Experiments and methods

Endophytes isolation and metabolites extract. American sycamore stem material was surface sterilized using 80% ethanol for 4 minutes under bio-hood under sterile conditions. Outer and inner bark tissue were peeled off and exposed inner stem were placed directly on CS20 malt agar plates which were incubated at 36 °C for 48 hours. Sub-cultured plates were used to make (10) 5 mL liquid cultures under sterile conditions. 5 mL liquid cultures were shaken at 160 RPM and

36 °C for 24 hours. Glycerol stocks were made by pipetting 600 µL of liquid culture and 400 µL of 80% glycerol into Eppendorf tubes. Tubes were placed in -80 °C freezer for storage.

Analysis of rapamycin from metabolites of endophytes: the metabolites of endophytes were extracted with hexane, dicholoromethane (DCM), and methanol successively. Extracts were evaporated and solubilized in 100% MeOH to 1 mg/ml. The injected samples were chromatographically separated using an Agilent analytical UHPLC (Santa Clara, CA) using a 100

X 4.6 mm Kinetex 1.7 µM, C8, chromatography column (Phenomenex Torrance, CA), 1 mL/min flow rate, mobile phase A 99.9% water (VWR, LC-MS grade), 0.1% formic acid (VWR); mobile phase B 99.9% acetonitrile (VWR, LC-MS grade), 0.1% formic acid (VWR); with the following gradient: 0-1 min 5% B, 1-15 min 100% B, 15-25 min, 100% B, 26-30 min, 5% B. The DCM fraction contained signals that correlated with the sodium adduct [M+Na]+ at m/z 936.6,

+ + ammonium ion [M+NH4] at m/z 931.6 and, and potassium ion [M+K] at m/z 952.6 at the same retention time as a standard rapamycin injection. The DCM fraction also contained signals that correlated with the sodium adduct [M+Na]+ at m/z 1079.6 and proton ion [M+H]+ at m/z 1057.6 at the same retention time as iturin A3 injection.

CS20 Media

Table 3 shows the components of the media that was used for all bacterial secondary metabolite production. This media was originally developed for the culturing of fastidious organisms and contains many components not usual in media used for the culturing of endophytic organisms.121

The commonly used yeast LB medium was used to culture Bacillus endophyte, but although lipopeptide production was noted by LC-MS by the presence of singly and doubly charged ions, no rapamycin was produced using this media.

Table 3: CS20 Media.

Distilled H2O 1 L

Soy peptone 2.0 g

Bacto tryptone 2.0 g

(NH4)2HPO4 0.85 g

Hemin Cl (0.1%) 15.0 mL

KH2PO4 1.0 g

MgSO4 .7H2O 0.4 g

L-glutamine 6.0 g

Dextrose 1.0 g

Starch, potato soluble 2.0 g

L-histidine 1.0 g

Phenol red (0.2%) 5.0 mL

Agar 12 g

pH 6.6-6.7

Isolation and purification of rapamycin from sycamore tissue. The air-dried and powered

American sycamore leaves (17 kg) were extracted with 190 proof ethanol at room temperature.

The extract was concentrated in vacuo to yield a residue (860 g), the residue was washed by hexane, dichloromethane and methanol successively. The dichloromethane residue was chromatographed on silica gel column eluted with a gradient hexane/ethyl acetate. Fraction rich rapamycin checked by LC-MS was further purified by semi-preparative HPLC (acetonitrile/water) to give rapamycin less than 0.4mg (Fig.21). The 1H-NMR and HSQC spectra were recorded on Bruker 850 MHz

NMR spectrometer (Fig. 22).

Figure 21. Isolation scheme of rapamycin from sycamore leaves.

+ Figure 22. Rapamycin isolation from Platanus occidentalis tissue by LC-MS (A) Precursor [M+NH4] ion at m/z 931.5922 (2.93 ppm) was detected from an extract of secondary growth tissue along with ions representing neutral losses of methanol and water at m/z 882.5391 (2.78 ppm) and m/z 864.5289 (3.19 ppm)

(B) H-NMR of purified rapamycin (red) and standard rapamycin (green). (C) Overlapped HSQC of isolated rapamycin (red) from the sycamore leaves and standard rapamycin(blue)

Characterization of rapamycin producing endophyte Because the nucleotide sequences found in 16S rRNAs vary in an orderly fashion throughout the phylogenetic tree, these sequences have been useful for the study of molecular evolution122. Now the amount of 16S rRNA sequence in

NCBI database is so many that 16S rRNA sequence for identifying species become more and more sensitive. One pair of primers is capable of amplifying nearly full-length 16S ribosomal DNA

(rDNA) from many bacterial genera; the additional primers are useful for various exceptional

sequences [2]. If researchers want to identify a bacteria strain in the level of genus, the general primer for amplifying 16S rDNA sequence is enough, and the primers are 1429R/27F123 (149R:

GGTTACCTTGTTACGACTT 27F: AGAGTTTGATCCTGGCTCAG) for 1500 bp which design in the conserved region of 16s rDNA sequence. If researchers want to further identify a bacteria strain in the level of species, the specific primer should be designed in the variable region of 16s rDNA sequence.

MALDI-IMS analysis. Seven CS20 agar plates were poured with days 1-5 poured with 10 mL of agar and plates for days 6 and 7 poured with 15 mL of agar. 5 µL of B. amyloliquefaciens. containing glycerol stock was placed in the center of each of these plates and placed in an incubator at 36˚C. One plate was removed every 24 hours and colonies were excised from the agar plate and placed on a Bruker MTP 384 steel plate. After a picture of the colony was taken for later overlay using imaging software, alpha-cyano-4-hydroxycinnamic acid matrix was shaken on top of the colony using a 20 µm sieve for even distribution of the matrix. The steel plate was then placed in an incubator at 36˚ C for four hours. Afterwards, the plate was placed in a desiccator. The desiccator was then placed under vacuum for 5 minutes and then sealed and the plate was left inside for an additional 25 minutes. The plate was then removed and placed into a Bruker Autoflex

II mass spectrometer equipped with the Compass 1.1 software suite (consisting of FlexImaging

3.0, FlexControl 2.4, and FlexAnalysis 2.4). The samples were analyzed in linear positive mode with 200 µm intervals. The spectra were collected in the m/z 700-1600 range at a 200 Hz laser frequency. After data acquisition, the data was analyzed using FlexImaging software.

Diffusion experiment. Bacillus is cultured in CS20 specific medium, Wide ranges of percent glycosides (0.5%-0.1%) have been tested, where each concentration is mixed with about 20 mL media to overcome the poor diffusion properties of theses metabolites, autoclaved (the glycosides

show recognized stability at the autoclaved temperature), cool down, and then organism followed by incubation for about 48 hrs at 37 ºC.

Purification and analyzing the yield of platanoside from P. occidentalis

Air-dried summer leaves (3.5 kg) of P. occidentalis different sizes were macerated at room temperature with ethanol, yielding 465 g of extract residue. The ethanolic extract (465 g) was washed with dichloromethane and water. The residue was subjected to reverse phase silica gel vacuum-liquid chromatography (VLC), yielding a fraction 67E with MeOH-Water (3:1) (17 g) which was chromatographed on a silica gel column, eluting with a hexane- ethyl acetate gradient system (5:1, 3:1, 2:1, 1:1, 0:1) to afford pure platanosides (2.5 g, Fig. 23) identified by NMR and

HRESIMS (Fig. 24). 200 gram of air-dried and powered P. occidentalis summer and autumn leaves as well as the xylem and cambium were extracted with hexcane, DCM and methanol separately. Extracts were evaporated. Then the methanol extracts were analyzed with an Agilent

1100 HPLC utilizing a Phenomenex Luna C18 column (4.6 x 150 mm, 5 µm, 100 Å) in-line with a Bruker microTOF ESI mass spectrometer operating in positive ion mode.

Figure 23. Isolation scheme of platanoside from American sycamore

(A)

Figure 24. 1H-NMR of platanoside. The overlayed LC/MS chromatogram of isolated platanoside and the standard.

Table 4. Different parts of sycamore tree used to analyze the yield of platanoside (The experiment was repeaated for 2 times)

P. occidentalis tissue type Hexanes ext.(g) Chloroform ext. (g) Methanol ext.(g)

Healthy summer leaves (200g) 1.3 4.5 36

Healthy autumn leaves (200g) 2.2 4.9 4

Xylem (200g) 0.54 0.21 3.6

PLATANOSIDE ITURIN A3

Summer leaves 0.5% Below detection

Autumn leaves 0.15% Below detection

Summer xylem 0.09% +

Figure 25. Calibration curve and the yield of platanoside.

In vitro Inhibition of Bacillus Assay. Bacillus is cultured in CS20 specific medium, Wide ranges of percent glycosides (0.5%-0.1%) have been tested, where each concentration is mixed with about

20 mL media to overcome the poor diffusion properties of theses metabolites, autoclaved (the glycosides show recognized stability at the autoclaved temperature), cool down, and then apply the organism followed by incubation for about 48 hrs at 37 ºC.

Results and discussion.

Bacillus amyloliquefaciens isolation from plant tissues and rapamycin expression. The first indication that rapamycin was present in American sycamore tissue was from an

ESI LC-MS injection from a methanol extraction of secondary-growth containing ground

American sycamore tissue (Fig. 22). A signal matching the ammonium adduct at m/z 931.5922

Da (2.93 ppm) was seen, along with ions representing a neutral loss of methanol at m/z 882.5391

(3.33 ppm) and a neutral loss of methanol and water at m/z 864.5289 (3.82 ppm) (Fig. 22). An injection of a rapamycin standard from S. hygroscopicus under the same conditions yielded the same ammonium adduct at m/z 931.5907 (1.32 ppm) at approximately the same retention time with ions representing neutral losses of methanol at m/z 882.5391 (1.63 ppm) and methanol and water at m/z 864.5279 (2.66 ppm) (Fig. 22). A large-scale study of American sycamore was initiated to further confirm the presence of rapamycin. Seventeen kilograms of whole leaf tissue of American Sycamore tissue including the leaf petiole was extracted to yield a total of 0.8 mg of rapamycin (Fig. 21).

B. amyloliquefaciens subsp. plantarum was isolated from secondary growth-containing

American sycamore tissue for study of its secondary metabolism. BLAST results put the American sycamore isolated species closely related to B. amyloliquefaciens subsp. plantarum AS43.3 and B. amyloliquefaciens subsp. plantarum TrigoCor 1448, which have been isolated from the wheat rhizosphere and wheat spikes, respectively124. Different media were used to study B. amyloliquefaciens subsp. plantarum secondary metabolism. Three of them, Landy’s, LB and malt have a history of use in Bacillus fermentation, while CS20 and CHARD2 do not125-127. CS20 and

CHARD2 were both created for the culturing of fastidious organisms and both contain supplemental amino acids, but CS20 combines this with plant-based carbon sources. Throughout

all experiments with the American sycamore-sourced B. amyloliquefaciens subsp. plantarum species, it was only CS20 that allowed for the detection of rapamycin.

MALDI-IMS was used to study the spatial, two-dimensional aspects of B. amyloliquefaciens subsp. plantarum secondary metabolite production. Ionic species matching rapamycin, plantazolicin, and known Bacillus lipopeptides were detected (Fig. 26). The signals matching rapamycin and plantazolicin were consistently seen within the bounds of the irregular- shaped colony, while signals matching Bacillus lipopeptides fengycins and iturins were mostly detected outside (Fig. 27), indicating they had been excreted during production (Fig. 27).

Fengycins and iturins both possess proven anti-fungal activity against many known plant pathogens. More recent studies have pointed to a role for each in the induced systemic resistance response in particular species103. Fengycins have elicited plant phenolic production in potato tuber cells and iturins upregulated defense genes in chili pepper including chitinase and peroxidase128-

129. Plantazolicin has recently been shown to be a highly selective in its antibacterial activity, discriminating even between other members of Bacillus and showing particular activity against

Bacillus anthracis130. The roles rapamycin could have in influencing plant behavior are hard to predict, simply because of the pervasive role TOR signaling in so many aspects of plant life. In A. thaliana, rapamycin inhibits glucose-induced root, root hair and leaf growth. Rapamycin has shown the ability to inhibit glucose-activated DNA synthesis in isolated nuclei from the embryonic axes of maize seedlings as well as in in vitro maize cell suspension cultures which correlated with an overall inhibition of mitosis and ribosome biogenesis119. Isotope ratio analysis was applied to show the difference between the origin of standard and isolated rapamycin from sycamore. The result demonstrated that there is clearly an additional concentration of one or more M+3 ions (13C,

2D, or 15N) in rapamycin standard but not in rapamycin isolated in sycamore (Fig 28), revealing

the two metabolites do not possess the same isotopic composition. This difference may be caused by enzyme kinetics between the Bacillus and Streptomyces product, or different concentration of heavy isotopes in the different media.

Figure 26. MALDI-IMS of Bacillus spp. colonies in CS20 medium. Five colonies of endophytic Bacillus sp. were plated with liquid culture and incubated at 37° C on specialized media originally developed for fastidious microbes and successively removed from incubation in 24 time point intervals. (I) MALDI-IMS

+ + shows signals correlating with [M+H] ion of rapamycin at m/z 914.6, [M-H2O] ion of rapamycin at m/z

896.7, [M+K]+ ion of rapamycin at m/z 952.3. The ionization efficiency of the dehydration product and potassium adduct corresponded with an increase in incubation time and dehydration of the solid agar.

Figure 27. MALDI-IMS of B. amyloliquefaciens. colonies in CS20 medium. (I) MALDI-IMS shows

+ + signals correlating with [M+H] ion of rapamycin at m/z 914.6, [M-H2O+H] ion of rapamycin at m/z 896.6,

[M+K]+ ion of rapamycin at m/z 952.5, [M+K]+ ion of iturin A2 at m/z 1081.03, [M+K]+ ion of fengycin at m/z 1503.4, [M+H]+ ion of plantazolicin at m/z 1336.5. overlaid MALDI-IMS of fengycin (yellow) and plantazolicin (orange) as well as iturin (yellow) and rapamycin (red), clear showing that rapamycin and plantazolicin were within the bounds of the irregular-shaped colony, while fengycins and iturins were mostly excreted outside.

Figure 28. Rapamycin was present in American sycamore tissue from an ESI LC-MS injection from a methanol extraction of secondary-growth. A: A signal matching the ammonium adduct at m/z 931.5922

Da (2.93 ppm) was seen, along with ions representing a neutral loss of methanol at m/z 882.5391 (3.33 ppm) and a neutral loss of methanol and water at m/z 864.5289 (3.82 ppm). B,: An injection of a rapamycin standard from S. hygroscopicus under the same conditions yielded the same ammonium adduct at m/z

931.5907 (1.32 ppm) at approximately the same retention time with ions representing neutral losses of

methanol at m/z 882.5391 (1.63 ppm) and methanol and water at m/z 864.5279 (2.66 ppm). An additional concentration of one or more M+4 ions (13C, 2D, or 15N) in rapamycin standard but not in rapamycin isolated in sycamore.

Molecular Ion Networking (MoIN) studies to show the distribution of B. amyloliquefaciens. Networking enables to visualize observed molecules as familial groupings in which commonalities within the MS fragmentation data are assessed via vector correlations and displayed as an MS/MS network. The visualization of networks by using Cytoscape enable the direct observation of similarities as well as differences between two or more samples in which similar entities within the network are clustered together while disparate or unique entities are grouped separately76.

Endophyte populations in nature are always interacting with their host. The MS/MS data were collected from the injection of the methanol extract of B. amyloliquefaciens, American sycamore summer leaves and xylem. Vector similarities are calculated for every possible pair of spectra with a minimum of six matching fragment ions (i.e., peaks) with similarity determined by using a modified cosine calculation that takes into account the relative intensities of the fragment ions as well as the precursor m/z difference between the paired spectra. Edges between spectra are retained only if in the top K for both paired spectra and the vector similarity score, represented as a cosine value, of the match is greater than the user-defined threshold. Cosine threshold values are set 0.7 whereby a cosine value of 1.0 indicates identical spectra. These data were then imported to

Cytoscape. The organized landscape of the molecular networking produced by Cytoscape (Fig. 29) shows that the platanoside as well as the analogs are localized in American sycamore summer leaves and xylem, while rapamycin compounds are present in B. amyloliquefaciens, which have been observed before by MALDI imaging. Interestingly, networking showed the metabolites of B. amyloliquefaciens are identical or related to xylem extract, but have no common molecules with

American summer leaves, indicating that B. amyloliquefaciens inhabiting in xylem instead of leaves.

Figure 29. Molecular networks obtained from B. amyloliquefaciens, American sycamore leaves and xylem.

It should be noted that the metabolites of B. amyloliquefaciens are overlapped or related to the crude extract of xylem but has nothing to do with the crude extract of leaves. This can be attributed to the different concentration of platanoside which can inhibit the growth of B. amyloliquefaciens in different parts of the tree.

Platanoside exhibited a seasonal and plant organ specific difference in concentration and dose dependent inhibition of B. amyloliquefaciens American sycamore produced antibacterial platanosides, also inhibit the growth of B. amyloliquefaciens subsp. plantarum. Inhibition of B. amyloliquefaciens by platanoside occurs in a dose-dependent manor with 0.5% platanoside concentration exhibiting complete inhibition of the endophytic species and 0.1% showing no clear inhibition (Fig. 31). There are distinct differences seen in the concentration of plant host produced antimicrobial platanosides by plant

organ and by season (Fig. 30). Leaf material consistently contained more platanosides than stem material, and autumn leaves contained less than summer leaves. This suggests American sycamore exhibiting a seasonal and plant organ specific difference in concentration of platanoside regulates

B. amyloliquefaciens endophyte and that this regulation varies based on plant-host needs.

Figure 30. Heatmap of platanoside concentration in different part of the P. occidentalis tree, 0.5% in summer leaves, 0.15% in autumn leaves, 0.009% in xylem and 0.004% in cambium.

Figure 31. Platanoside inhibit the growth of bacillus when treated at the concentration of 0.5% and 0.4%.

Convergent evolution pathway for rapamycin in B. amyloliquefaciens Bacillus sp. possess the biosynthetic genes responsible for the production of a diversity of secondary metabolites including bioactive peptides, alkaloids and polyketides using modularly organized nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKS) (Fig. 32)13.

In addition, this group of bacteria are capable of generating unusual hybrid PKS and NRPSs that are of mixed biosynthetic origin like rapamycin. Thus the potential for a convergent pathway to rapamycin by B. amyloliquefaciens is indeed plausible131. It is noteworthy that a wide variety different media were used to study B. amyloliquefaciens subsp. plantarum secondary metabolism, however, only CS20 media was successful in the generation of rapamycin. CS20 is a highly rich medium designed for the culture of bacteria from plant microbiomes potentially leading to the changes of transcripts as well as providing key biosynthetic precursors132. Based gene sequence analysis result (Fig. 33), there are unassigned type 3 PKS and "PKS-like" which size is big enough to build rapamycin. We assume it is the Non-homologous Isofunctional Enzymes (NISE) which

share no sequence similarity with each other catalyzing the same reaction that cause the different isotope ratio of Bacillus and Streptmyces rapamycin product133-134.

Figure 32. Primary second metabolites of B. amyloliquefaciens

Figure 33. antiSMASH Analysis of the gene sequence of B. amyloliquefaciens.

CHAPTER THREE

ASSIGNMENT OF THE ABSOLUTE CONFIGURATION OF HEPATOPROTECTIVE

HIGHLY OXYGENATED TRITERPENOIDS AND DIBENZOCYCLOOCTADIENE

LIGNANS USING X-RAY, ECD, NMR J-BASED CONFIGURATIONAL ANALYSIS AND

HSQC OVERLAY EXPERIMENTS

Published in Molecules 2017, 22, 65-69; BBA - General Subjects 2017, 1861, 3089–3095; Org.

Lett. 2018, 20, 5559−5563, Accepted in Nat. Prod. Commun.

Introduction:

The chronic liver disease caused by xenobiotics and viral infection will eventually lead to liver cancer; the second most common cancer in the world. In 2018, WHO reported that around

788,000 people die from primary liver cancer every year. It is also reported that from 1999 to 2015, deaths from liver cancer in the US increased by 60% while deaths from other cancers decreased by 26%. More than 60% of these deaths are caused by the long-term consequence of chronic hepatitis B (HBV) and C (HCV) infections. Exposure to certain chemicals, cirrhosis of the liver, and diabetes are additional causes for liver cancer. In 2015, more than 325 million people worldwide were living with HBV and HCV infection causing 1.34 million deaths. Levels of both hepatitis testing and treatment are still extremely low in most regions of the world reaching only

1 or 2 out of every 10 people in need.135 Traditional medicines and small molecule drugs still play a vital role in controlling liver disease.

An effective approach to chronic liver disease control is chemoprevention, which can help improve abnormal liver function and inhibit hepatitis replication and may cause fewer side effects.

Several antiviral nucleoside/nucleotide analogues including lamivudine, adefovir, dipivoxil, and entecavir have been successfully used to treat chronic hepatitis B (HBV) or chronic hepatitis C

(HCV) infections. However, the therapeutic efficacy of these drugs is still limited and side effects including serious nephrotoxicity and mitochondrial toxicity are rather frequent. The effectiveness of nucleoside/nucleotide analogues is also limited because drug resistance develops, including mutations that occur in the YMDD motif of HBV DNA polymerase, particularly for lamivudine.136

Dibenzocyclooctadiene lignans and triterpenoids are the primary hepatoprotective active ingredients of Schisandra chinensis and Kadsura longipedunculata which are known as “liver tonic” in Asian Herbal Medicine for chronic liver disease and poor liver function. Interestingly, two liver therapies have been designed using schisandrin C, a dibenzocyclooctadiene lignin isolated from S. chinensis and K. longipedunculata, as a model. These include diphenyl dimethyl bicarboxylate (DDB)137 and bicyclol.138 Clinical trials found that bicyclol is effective in improving abnormal liver function, inhibiting the replication of HBV in chronic hepatitis B patients as well as inducing differentiation of human hepatocarcinoma cells (HepG2 and Bel-7402 cells) without side effects being reported.139 These results implicate the possibility of dibenzocyclooctadiene lignans as promising chemopreventive agents active in the control of liver carcinogenesis. Their

2D structures and relative configurations have been successfully elucidated by NMR spectroscopic methods. Assignment of their absolute configurations is challenging especially for the schiartane- type nortriterpenoids due to the presence of 12 non-contiguous stereogenic centers as well as conformationally flexible side chains. Single crystal X-ray diffraction remains the gold standard in the structure elucidation of novel and known molecules. However, a crystal that diffracts well is not always easily obtained, especially for the small quantities of natural products.77 For the assignment of the relative configuration of non-crystallized , NMR-based techniques including

NOE and J-based configuration analysis (JBCA) in combination with molecular and quantum mechanics calculations including DP480 as well as DP4+ calculations140 were applied.141 For the absolute configuration, electric circular dichroism (ECD) methods, calculated ECD as well as mosher reaction have often been used.

Figure 34. the structures of compounds 1-7.

Material and methods.

General procedures.

Optical rotations were measured on a JASCO P-2000 polarimeter and UV spectra with a

JASCO V-650 spectrophotometer. ECD spectra were measured on a JASCO J-815 spectrometer.

The 1H and 13C NMR spectra were recorded on INOVA-500 and BRUKER AV500-III spectrometers. HETLOC and HSQC with decoupling were measured on a Bruker 850 MHz NMR spectrometer. The standard Bruker pulse sequences were used for each 2D measurement.

HRESIMS data were acquired using an Agilent 6520 Accurate-Mass Q-Tof LC/MS mass spectrometer. Analytical reversed-phase HPLC was performed on a COSMOSIL 5C18-PAQ

Waters column (4.6 mm I. D. × 250 mm) eluted with water/methanol (flow rate, 1 mL/min; 220 nm UV detection) at room temperature. Preparative reversed-phase HPLC was performed on a

COSMOSIL 5C18-PAQ Waters column (10 mm I. D. × 250 mm) at room temperature. Column chromatography was performed with silica gel (40-63 μm; Silicycle), C18 120 Å reversed-phase silica gel (RP-18; 50 μm; YMC), and Sephadex LH-20 (GE Healthcare Bio-Science AB). Fractions were monitored by TLC and spots were visualized by heating silica gel plates sprayed with 10%

H2SO4 in ethanol.

Hepatoprotective activity assay

Human HepG2 hepatoma cells were cultured in DMEM medium supplemented with 10% fetal calf serum, 100 U/mL penicillin, and 100 μg/mL streptomycin at 37 °C in a humidified atmosphere of 5% CO2 +95% air. The cells were then passaged by treatment with 0.25% trypsin in 0.02% EDTA. The MTT assay was used to assess the cytotoxicity of test samples. The cells were seeded in 96-well multiplates. After an overnight incubation at 37 °C with 5% CO2, 10 μM

test samples and APAP (final concentration of 8 mM) were added into the wells and incubated for another 48 h. Then 100 μL of 0.5 mg/mL MTT was added to each well after the withdrawal of the culture medium and incubated for an additional 4 h. The resulting formazan was dissolved in 150

μL of DMSO after aspiration of the culture medium. The plates were placed on a plate shaker for

30 min and read immediately at 570 nm using a microplate reader.142

Extraction and purification

The air-dried and powdered roots of Kadsura longipedunculata (34.0 kg) were percolated with 95% aqueous ethanol (48 L) at room temperature. The combined extract was concentrated in vacuo to yield a residue (2400 g). The residue (2400 g) was subjected to silica gel (200-300 mesh,

2400 g) column chromatography, eluting with a petroleum ether/acetone gradient system (100:1,

50:1, 10:1, 5:1, 3:1, 1:1), acetone, and 80% aqueous ethanol, to give fractions 1-15. Fraction 13 was chromatographed on an ODS (octadecylsilyl) column eluted with a gradient of water/methanol

(4:6 ~ 1:9) to yield four subfractions A-D. Fraction B was further chromatographed on a silica gel column eluted with a gradient of chloroform/methanol (60:1, 50:1, 30:1, 20:1) and pure methanol to yield five fractions B1-B5. Fraction B4 was purified by semi-preparative HPLC (60% methanol/water), to give micrandilactone I (1, 7 mg). Fraction 14 was partitioned between water and ethyl acetate. The ethyl acetate extract (60 g) was chromatographed on an ODS column eluted with a gradient of water/methanol (4:1, 3:2, 2:3, 1:4) and pure methanol to yield five fractions A-

E. Fraction D was chromatographed on Sephadex LH-20 (eluted with chloroform/methanol) to give five subfractions D1-D5. Fraction D1 (1.7 g) was subjected to silica gel (200-300 mesh, 3 g) column chromatography, eluting with a chloroform/methanol gradient system (20% ~ 80% methanol) to afford nine subfractions, D1.1-D1.9. Fraction D1.3 (365 mg) was purified by semi- preparative HPLC (46% methanol/water), to give micrandilactone J (2, 164 mg) and 22, 23-di-epi-

micrandilactone J (3, 1 mg), micrandilactone H (4, 2mg), Fraction D1.5 (427mg) was purified by semi-preparative HPLC (62% methanol/water) to give Kadsuraols A (5, 2mg), Kadsuraols B (6,

1mg), Kadsuraols C (7, 1mg).

Result and discussion.

Micrandilactone I (1) was obtained as white crystals. Its molecular formula was established

+ as C30H44O7 by the HRESIMS ion at m/z 539.2994 [M +Na] (calcd 539.2979), suggesting nine indices of hydrogen deficiency. The 1H, 13C, and HSQC NMR data of micrandilactone I (1) indicated the presence of two ester carbonyls, six methyl, eight methylene, eight methine (one olefinic and three oxygenated), and six non-protonated carbons (one olefinic and three oxygenated).

1 The H NMR spectra revealed three resonances at δH 4.27, 2.98, and 2.75, representing the ABX spin system of H-1, H-2α, H-2β, respectively, one olefinic proton (δH 6.43), three oxygenated methines (δH 4.50, 4.31, and 4.27), one methyl doublet (δH 0.97), five methyl singlets (δH 1.90,

1.56, 1.26, 1.10, and 0.93), and several methylene protons between δH 1.30 and 2.85. The 1D NMR data and indices of hydrogen deficiency of micrandilactone I (1) suggested that it was a highly oxygenated 3, 4: 9, 10-disecocycloartane containing six rings 143. Additionally, HMBC cross-peaks of H-27 (δH 1.90) with C-24, C-25, and C-26 at δC 140.0, 128.0 and 166.2, respectively, and of H-

24 at δH 6.43 with C-22, C-23, C-26 and C-27 at δC 80.4, 23.7, 166.2, and 17.2, respectively, revealed the presence of an α-methyl-α, β-unsaturated-γ-lactone moiety. These 1D and 2D NMR data indicated that micrandilactone I (1) had a structure closely similar to that of kadcoccilactone

A 144, but with a hydroxy group located at C-15, instead of at C-17. Crystals of X-ray diffraction quality of micrandilactone I (1) were obtained from methanol/water. The structure and absolute configuration were unambiguously determined as (1R, 5S, 8S, 9S, 10R, 14R, 15S, 17R, 20S, 22S,

23S) by X-ray crystallographic analysis (Fig. 36) based on resonant scattering of only light atoms

in both Mo and Cu radiations. Accordingly, the structure of micrandilactone I (1) was established as shown in Fig. 34.

Micrandilactone J (2) was obtained as white crystals. Its molecular formula was established

+ as C29H42O9 by the HRESIMS ion at m/z 557.2740 [M+Na] (calcd 557.2740. Micrandilactone J

(2) is an isomer of micrandilactone C, based on comparison of their 1D NMR and MS data.

Crystals of X-ray diffraction quality of micrandilactone J (2) were obtained from methanol/water.

The resulting data unambiguously permitted the assignment of its relative configuration (Fig. 35).

The negative Cotton effect around 220 nm in the ECD spectrum indicated the (23S) absolute configuration of the 3-methylfuran-2(5H)-one moiety based on comparison with the calculated

ECD spectrum (Fig. 38) as well as reported data145. Fig. 38 depicts overlays of the experimental spectrum of compound 2, the average calculated spectrum of (23S)-2 and the Boltzmann-weighted

ECD spectrum of the major conformer 2a (60.17% Boltzmann population) using B3LYP/6‐

311++G(2d,p). The calculated ECD spectrum of compound (23S)-2 shows Cotton effects characteristic of π →π* electronic transition at 221.26 nm region (Fig. 38). The electronic transitions from MO139, MO140 and MO141 (H-3) to MO145 (LUMO) involving a π→ π* transition of the enoate chromophore show negative rotatory strengths at 221.26 nm in (23S)-2

(conformer 2a), which is consistent with the strong negative Cotton effect at 217 nm in the experimental ECD spectrum of 2. These results match well with the experimental ECD curve and support the assignment of the absolute configuration of compound 2 as (1R, 5S, 8R, 9S, 10R, 13R,

14S, 15S, 17R, 20S, 22S, 23S). In addition, 1H and 13C NMR chemical shift calculations were performed to assign the relative configurations of compounds 2 (1R, 5S, 8R, 9S, 10R, 13R, 14S,

15S, 17R, 20S, 22S, 23S) and 2′ (1S, 5R, 8S, 9R, 10S, 13S, 14R, 15R, 17S, 20R, 22R, 23S) considering (23S) absolute configuration based on ECD. We used the gauge including atomic

orbital (GIAO) method at the PCM/B3LYP/ 6–311+G(d,p) level of theory for DP4+ calculations.

The computed chemical shifts of 2 and 2′ (Fig. 41) were compared with the experimental values utilizing DP4+ probability analyses. The latter yielded the structure of 2 with 100% probability, leading to unequivocal assignment of (23S) absolute configurations for compound 2. Combining the relative configuration assigned via the X-ray diffraction data, the comparison of experimental and ab initio computed ECD spectra, and the DP4+ analysis, the absolute configuration of micrandilactone J (2) was unequivocally defined as (1R, 5S, 8R, 9S, 10R, 13R, 14S, 15S, 17R, 20S,

22S, 23S). JBCA data were utilized in an attempt to determine the relative configurations at C-23,

C-22, and C-20. This method was applied to analyze the relative configurations of

3 3 141 polyhydroxylated acyclic molecules by detailed analysis of the JH, H and 2, JC, H values. The

“small” values (0 Hz) of 3J H-23, H-22 and 3J H-22, H-20 of micrandilactone J (2) indicated a structure without significant conformational changes, thus giving reliable JBCA data.138 The gauche orientations of H-22/H- 23, H-22/H-20, H-23/C-20, H-22/C-24 and H-20/C-23 were evidence of the small 3J H-22, H-23, 3J H-22, H-20, 3J H-23, C-20, 3J H-22, C-24, and 3J H-20,

C-23, respectively, and the anti H-22/C-17 orientations gave large 3J H- 22, C-17 values. These interactions established the relative configurations of C-23–C-20 as depicted in Fig. 42.

22, 23-Di-epi-micrandilactone J (3) had a molecular formula, C29H42O9, based on

HRESIMS analysis ([M+Na]+ m/z 557.2722) and its 13C NMR spectrum, indicative of it being an isomer of micrandilactone J (2). The 1D NMR data and index of hydrogen deficiency also suggested a highly oxygenated schiartane-type nortriterpenoid possessing six rings 42. Analysis of the 2D NMR data (Fig. 39 and 40) showed an identical 2D structure compared to micrandilactone

J (2). The overlaid HSQC spectra of 2 and 3 showed highly coincidental cross-peaks of the fused

5/5/7/6/5 ring systems (Fig. 40), which indicated that micrandilactone J (2) and 22, 23-di-epi-

micrandilactone J (3) had identical pentacyclic core structures. The misalignment of cross-peaks combined with the opposite Cotton effect near 220 nm in the ECD spectrum indicated that 3 and

2 had opposite absolute configurations at some of the stereocenters. The absolute configuration of

C-23 was assigned as R based on the positive Cotton effects at 217 nm in the ECD spectrum.144

The absolute configurations of the remaining stereocenters of compound 3 were established via J- based configuration analysis.

The absolute configurations of the stereogenic centers of the side chain of 22,23-di-epi- micrandilactone J (3) were deduced from the JBCA, combined HSQC overlay with 2, NOESY, as well as ECD data. The positive Cotton effect around 220 nm in the ECD spectrum indicates its

(23R) absolute configuration.146 JBCA data were utilized to determine the relative configurations at C-23, C-22, C-20 as was described for micrandilactone J (2).141 The gauche orientations of H-

22/H-23, H-22/H-20, H-22/C-17, and H-20/C-23 were suggested by the small 3J H-22, H-23, 3J

H-22, H-20, 3J H-22, C-17, and 3J H-20, C-23 values, respectively, and the anti-orientation of H-

22/C-24 by a large 3J H-22, C-24 value, and thus the relative configurations of C-22 and C-20 were as depicted in Fig. 42. However, due to the absence of key 3J C-20, H-23 and 2J C-22, H-23 couplings, the relative configurations of C-23 and C-22 as shown in Fig. 42 could not be differentiated. Also, because of the complex splitting pattern of H-17, the key 3J H, H values were unavailable. Such an absence of coupling constant data presented a significant challenge for assignment of the absolute configuration of C-22, C-20, and C-17, because NOE data could not be applied to associate the stereogenic carbons with a proton attached to the rigid ring system. Thus, the HSQC method combined with JBCA and NOESY data of a degassed sample were applied to define the absolute configuration of the remaining stereogenic carbons. The small 3J H-22, H-23,

3J H-22, C-17, 3J H-20, C-23, and 3J H-20, H-22 values (Fig. 42) of 22,23-di-epi-micrandilactone

J (3) indicated that rotation of the C-17–C-23 moiety is restricted. Thus, NOESY data of a degassed sample could be applied to determine the relative configuration of the H-17–H-23 stereocenters.

The correlation of H-23/H-22, H-22/H-20, and H-21/H-17 indicated (17R, 20S, 22R) absolute configuration. The NOESY data for C-20 and C-17 were also supported by the JBCA data. H-N

HSQC overlay is frequently applied to monitor the binding and conformational changes of proteins based on the peak shift.147 Herein, H-C HSQC overlay was used to compare the configurations of

2 and 3. In the overlaid HSQC spectrum of 2 and 3, the C-1, C-5, C-8, and C-17 resonances of the two isomers are completely overlapped, indicating that they have the same relative configurations

(Fig. 40). For the non-protonated stereogenic carbons, the signals of the adjacent carbons could be used to determine their relative configurations. The cross-peaks of C-1, C-8, C-15, and C-17 are completely overlapped, suggesting that C-10, C-9, C-14, and C-13 of 2 and 3 had the same relative configurations (Fig. 40). This is consistent with the results of the NOESY experiment (Fig. 42).

Combined with the (17R) absolute configuration, the absolute configuration of 22, 23-di-epi- micrandilactone J (3) was assigned as (1R, 5S, 8R, 9S, 10R, 13R, 14S, 15S, 17R, 20S, 22R, 23R)

(Fig. 34). The peak shifts of C-23 on the HSQC overlay spectra of the two isomers indicated different configurations, matching the opposite Cotton effects in the ECD spectra of the two compounds. However, the different C-23 configuration of the two compounds will influence the

HSQC overlay results of C-20 and C-22 (Fig. 40). Thus, the absolute configurations of C-20 and

C-22 could not be elucidated from the developed HSQC method.

Micrandilactone H (4) was isolated as colorless crystals, and gave an [M + Na]+ ion at m/z

539.2637 in the HRESIMS, consistent with a molecular formula of C29H40NaO8 (calcd 539.2615), indicating nine indices of hydrogen deficiency. The 13C and HSQC NMR spectra) revealed two lactone carbonyls resonating at δC 175.9 and 175.1; two olefinic functionalities with four carbon

3 resonances at δC 147.7, 120.9, 148.9 and 130.5; four sp non-protonated carbons (three oxygenated) resonances at δC 99.7, 85.2, 70.8 and 52.8; eight sp3 methine (three oxygenated) resonances at δC

82.5, 59.6, 58.8, 77.1, 43.3, 44.3, 74.9 and 83.0 ppm; six sp3 methylene resonances at δC 46.0,

42.7, 40.4, 36.9, 28.7, and 25.3; and five methyl resonances at δC 29.9, 26.6, 23.5, 16.1, and 10.9.

1 The H-NMR spectra revealed an ABX spin system, with δH 4.27 (d, J = 4.5 Hz), 2.94 (dd, J =

18.0, 4.5 Hz) and 2.72 (d, J = 18.0 Hz), which were assigned to H-1, H-2α and H-2β, respectively, together with four methyl singlets at δH 1.83 (3H, s), 1.27 (3H, s), 1.14 (3H, s), 1.12 (3H, s); one methyl doublet at δH 1.34 (3H, d, J = 7.0 Hz); two olefinic protons (δH 7.23, 5.76); four methine protons (δH 5.27, 4.00 and 3.31); and several methylene protons between δH 1.22 and 2.80.

According to these data, micrandilactone H is a schiartane-type nortriterpenoid whose structure is similar to micrandilactone C, except for an extra double bond, one less hydroxy group and the different location of the C-18 methyl group.144 The HMBC cross-peaks of H-18 with C-8, C-13,

C-14 and C-15, H-11 with the C-8, C-9, C-12, C-13 and C-19, and H-12 with C-9, C-14 and C-17 indicated that Me-18 was connected at C-14 and the double bond was located at C-12 and C-13.

Thus, the 2D structure of micrandilactone H was established as shown in Fig. 34. The structure and absolute configuration were unambiguously determined as (1R, 5S, 8S, 9S, 10R, 14R, 15S,

17R, 20S, 22S, 23S) by X-ray crystallographic analysis (Fig. 37) based on resonant scattering of only light atoms in both Mo and Cu radiations. These results matched the assignment of the (23S) absolute configuration based on the negative Cotton effect at 214 nm in the ECD spectrum.146 The molecular structure features an intramolecular hydrogen bond between the 15- and 9-OH groups.

However, the 22-OH group does not form an intramolecular hydrogen bond with the adjacent lactone carbonyl, instead forming an intermolecular hydrogen bond with the C-3 lactone carbonyl.

Micrandilactone H: Colorless crystals; ESIMS (m/z): 539 [M + Na]+;HRESIMS (m/z):

1 539.2637 [M + Na]+ (calcd 539.2615 for C29H40NaO8), H-NMR (500Hz, pyridine-d5), 4.27 (d,

4.5, H-1), 2.72 (d, 18.0, H-2α), 2.94 (dd, 18.0, 4.5, H-2β), 2.57 (dd, 13.0, 4.0, H-5), 1.69

(overlapped, H-6α), 1.31 (overlapped, H-6β), 2.37 (m, H-7α), 2.07 (overlapped, H-7β), 1.72

(overlapped, H-8), 2.35 (m, H-11α), 2.26 (m, H-11β), 5.76 (d, 7.0, H-12α), 4.00 (s, H-15), 2.30

(m, H-16α), 2.11 (dd, 8.5, 3.0, H-16β), 3.31 (m, H-17), 1.12 (s, H-18), 2.15 (d, 15.0, H-19α), 2.02

(d, 15.0, H-19β), 2.21(m, H-20), 1.34(d, 7.0, H-21), 4.00 (s, H-22), 5.27 (brs, H-23), 7.23 (s, H-

13 24), 1.83 (s, H-27), 1.27 (s, H-29), C-NMR (500Hz, pyridine-d5), 82.5 (C-1), 36.9 (C-2), 175.9

(C-3), 85.2 (C-4), 59.6 (C-5), 28.7 (C-6), 25.3 (C-7), 58.8 (C-8), 70.8 (C-9), 99.7 (C-10), 42.7 (C-

11), 120.9 (C-12), 147.7 (C-13), 52.8 (C-14), 77.1 (C-15), 40.4 (C-16), 43.3 (C-17), 26.6 (C-18),

46.0 (C-19), 44.3 (C-20), 16.1 (C-21), 74,9 (C-22), 83.0 (C-23), 148.9 (C-24), 130.5 (C-25), 175.1

(C-26), 10.9 (C-27), 29.9 (C-28), 23.5 (C-29).

Figure 36. ORTEP drawing of micrandilactone I (1). Figure 35. ORTEP drawing of micrandilactone J (2).

Figure 37. ORTEP drawing of micrandilactone H (4).

Figure 38. Experimental ECD spectrum of compound 2 (black), calculated averaged Boltzmann weighted

ECD spectra of conformers (2a–2c and 2e) (green), and ECD spectrum of conformer 2a (major conformer) in MeOH (red). σ-value (artificial line broadening) was set to 0.16 eV.

Figure 39. Key HMBC (A) correlations of micrandilactone I (1); HMBC (B) COSY (C), NOESY (D) correlations of 22, 23-di-epi-micrandilactone J (3); and NOESY (E) correlations of micrandilactone J (2).

Table 5. 1H and 13C NMR data for micrandilactone I (1), micrandilactone J (2) and 22, 23-di-epi- micrandilactone J (3) in pyridine-d5 using an INOVA-500 MHz spectrometer. no. 1 2 3 δH δC δH δC δH δC 1 4.27 (d, 5.0) 81.8 4.28 (d, 4.5) 82.4 4.30 (d, 4.5) 82.4 2α 2.75 (d, 17.5) 36.5 2.71 (d, 17.5) 37.3 2.73 (m) 37.3 2β 2.98 (dd, 17.5, 5.0) 2.95 (dd, 17.5, 4.5) 2.94 (dd, 18.0, 4.5) 3 175.2 176.0 176.0 4 84.8 85.3 85.4 5 2.55 (dd, 13.5, 4.0) 60.0 2.70 (dd, 13.5, 3.5) 59.0 2.70 (overlapped) 59.0 6α 1.63 (m) 28.8 1.75 (overlapped) 28.9 1.74 (m) 29.0 6β 1.32 (br t, 13.5) 1.29 (overlapped) 1.29 (overlapped) 7α 2.82 (dd, 14.0, 9.0) 24.6 2.69 (overlapped) 24.7 2.71 (overlapped) 24.8 7β 2.08 (overlapped) 2.19 (overlapped) 2.19 (m)

8 1.84 (overlapped) 53.9 2.00 (br d, 11.0) 57.0 2.02 (br d, 11.0) 56.9 9 73.8 72.4 72.3 10 100.3 100.0 100.0 11α 2.11 (overlapped) 39.5* 1.88 (m) 38.6 1.90 (m) 38.7 11β 1.70 (br d, 13.0) 1.63 (br d, 14.0) 1.65 (overlapped) 12α 2.22 (overlapped) 30.6 2.79 (m) 39.3 2.80 (t, 12.5) 39.3 12β 1.46 (br d, 13.0) 1.71 (br d, 14.0) 1.67 (overlapped) 13 46.9 46.1 46.1 14 50.9 87.0 86.8 15 4.30 (dd, 10.0, 5.0) 76.7 4.48 (s) 77.2 4.49 (s) 77.4 16α 1.99 (overlapped) 39.4* 2.53 (overlapped) 36.5 2.53 (m) 35.9 16β 1.81 (overlapped) 2.18 (overlapped) 2.25 (m) 17 1.79 (overlapped) 44.8 2.53 (overlapped) 54.6 2.53 (overlapped) 54.9 18 0.93 (s) 15.5 1.48 (s) 18.6 1.48 (s) 18.7 19α 2.03 (d, 5.0) 48.0 2.05 (d, 15.5) 47.7 2.07 (d, 15.0) 47.8 19β 2.05 (d, 5.0) 2.13 (d, 15.5) 2.14 (d, 15.0) 20 2.05 (overlapped) 39.3* 2.57 (m) 38.1 2.38 (m) 37.3 21 0.97 (d, 6.5) 13.7 1.32 (d, 6.0) 18.8 1.22 (d, 7.0) 18.9 22 4.50 (dt, 13.0, 3.0) 80.4 4.06 (br s) 73.9 4.31 (overlapped) 73.8 23α 2.18 (overlapped) 23.7 5.26 (s) 83.0 5.24 (s) 83.5 23β 1.97 (overlapped) 24 6.46 (d, 6.0) 140.0 7.19 (overlapped) 148.8 7.39 (br s) 147.8 25 128.0 130.4 131.0 26 166.2 175.1 174.7 27 1.90 (s) 17.2 1.81 (s) 10.9 1.85 (s) 11.0 28 1.56 (s) 13.0 29 1.10 (s) 22.9 1.29 (s) 30.3 1.29 (s) 30.3 30 1.26 (s) 29.4 1.08 (s) 23.9 1.08 (s) 23.9

Figure 41. DP4+ analysis outcome using the Excel spreadsheet available for free at sarotti- NMR.weebly.com. Isomer 1 and Isomer 2 represents (2a) and (2b) of compound 2, respectively; Gibbs free energy-based calculation outcomes were used for the analysis.

A: C-23~C-22 of micrandilactone J (2) C: C-23~C-22 of 22, 23-di-epi-micrandilactone J (3)

E a b F

Measured data Predicted data Measured data Predicted data

3 3 JH-23, H-22 Gauche: 0 (small) Gauche 0-3 (small) JH-23, H-22 Gauche: 0 (small) Gauche 0-3 (small)

Anti 7-10 (large) Anti 7-10 (large)

3 3 JH-23, C-20 Gauche: 3.1(small) Gauche 1-3 (small) JH-23, C-20 Not observed Gauche 1-3 (small)

Anti 5-7 (large) Anti 5-7 (large)

3 3 JH-22, C-24 Gauche: 2.6 (small) Gauche 1-3 (small) JH-22, C-24 Anti: 6.0 (large) Gauche 1-3 (small)

Anti 5-7 (large) Anti 5-7 (large)

2 2 JH-23, C-22 Anti: 2.0 (small) Gauche -4 to -6 (large) JH-23, C-22 Not observed Gauche -4 to -6

(large) Anti 2-0 (small)

Anti 2-0 (small)

2 2 JH-22, C-23 Anti: 1.9 (small) Gauche -4 to -6 (large) JH-22, C-23 Gauche: -4.2 (large) Gauche -4 to -6

(large) Anti 2-0 (small)

Anti 2-0 (small)

B: C-22~C-20 of micrandilactone J (2) D: C-22~C-20 of 22, 23-di-epi-micrandilactone J (3)

G H

Measured data Predicted data Measured data Predicted data

3 3 JH-22, H-20 Gauche: 0 (small) Gauche 1-4 (small) JH-22, H-20 Gauche: 0 (small) Gauche 1-4 (small)

Anti 8-11 (large) Anti 8-11 (large)

3 3 JH-22, C-17 Anti: 6.4 (large) Gauche 1-3 (small) JH-22, C-17 Gauche: 3.4 (small) Gauche 1-3 (small)

Anti 6-8 (large) Anti 6-8 (large)

3 3 JH-20, C-23 Gauche: 3.1 (small) Gauche 1-3 (small) JH-20, C-23 Gauche: 3.4 (small) Gauche 1-3 (small)

Anti 6-8 (large) Anti 6-8 (large)

2 2 JH-20, C-22 Anti: 2.5 (small) Gauche -5 to -7 JH-20, C-22 Anti: -2.6 (small) Gauche -5 to -7

(large) (large)

Anti 1-2 (small) Anti 1-2 (small)

2 2 JH-22, C-20 Anti: 2.7 (small) Gauche -5 to -7 JH-22, C-20 Not observed Gauche -5 to -7

(large) (large)

Anti 1-2 (small) Anti 1-2 (small)

Figure 42. Rotamers and coupling constants for C-23–C-22(A), C-22–C-20 (B) of 2, C-23–C-22(C), C-

22–C-20 (D) of 3. Key NOESY correlations of 2 (E), (G), and 3 (F), (H).

Kadsuraol A (5), obtained as yellow crystals, EtOH); mp 154−157 °C; had the molecular

+ formula C27H30O9 as determined by positive HRESIMS (m/z 521.1784 [M + Na] , calcd. 521.1782)

and 13C NMR data, indicating 13 indices of hydrogen deficiency. Its UV bands (218 and 270 nm) and IR absorptions (1712 and 1616 cm−1) indicated the presence of carbonyl and benzene

1 functionalities. The H NMR data (Table 2) displayed an aromatic proton singlet at δH 6.61, two singlets characteristic of a methylenedioxy group at δH 6.00 and 5.93 (br s), an olefinic proton signal at δH 5.86 (br q, J = 7.0 Hz), an AB quartet at δH 4.59 and 4.54 (d, J = 10.0 Hz), and two enolic methoxy singlets at δH 4.09 (3H) and 3.68 (3H). In the highfield region, a methylene (δH

1.90, dd, J = 11.0 and 13.0 Hz, and 1.48, dd, J = 7.0 and 13.0 Hz, respectively), a methine (δH 1.59, m), and four methyl groups [δH 1.84 and 0.99 (each 3H, d, J = 7.0 Hz), 1.71 and 1.12 (each 3H, s)] were observed. The 13C NMR spectrum revealed 27 carbon resonances. The 1H and 13C NMR data

(Table 2), and the HSQC spectrum exhibited the presence of an α,β-unsaturated carbonyl carbon

(δC 193.9), an ester carbonyl carbon (δC 167.7), a pentasubstituted aromatic moiety (δC 102.9,

124.3, 124.9, 130.5, 142.2, and 150.3), four olefinic carbons (δC 128.3, 135.3, 137.0, and 160.6), a methylenedioxy carbon (δC 101.5), an oxymethylene carbon (δC 81.9), two oxymethine carbons

(δC 72.7 and 75.6), two O-methyl groups (δC 59.6 and 60.3), three quaternary carbons (δC 56.6,

45.7, and 46.2), a methylene group (δC 31.8), a methine group (δC 29.9), and four methyl groups

(δC 20.2, 16.9, 15.5, and 14.1). Analysis of the 1D and 2D NMR data assigned a C18 skeleton comprising two C6·C3 constituent units for 5. The HMBC cross-peaks from H-6′ to C-1′, C-2′, and C-7′, H-7 to C-2 and C-6, H2-7′ to C-1′, C-2′, C-6′, C-8′, and C-9′, H3-9 to C-8′, C-7, and C-

8, and especially H3-9 and H-7 to C-1′ (green). Crystallization of Kadsuraols A (5) from MeOH:

H2O (10:1) afforded yellow crystals of the hemihydrate suitable for X-ray crystal structure studies.

Data at T = 100 K with Mo Kα radiation yielded R = 0.053 and a Flack parameter x = 0.2 (2), in agreement with the (7S, 8S, 1′S, 2′S, 6′R, 8′R) absolute configuration. In the crystalline hemihydrate, there are eight independent (unrelated by symmetry) molecules of 5, one of which is shown in Fig.

43, and four water molecules. The eight molecules differ somewhat in conformation, particularly for the two methoxy groups, and one of the eight exhibits disorder. In addition, 1H and 13C NMR chemical shift calculations were performed to assign the absolute configuration of compounds 5

(7S, 8S, 1′S, 2′S, 6′R, 8′R), and three other diastereomers labeled 5′ (7S, 8S, 1′S, 2′R, 6′R, 8′R), 5′′

(7R, 8S, 1′S, 2′R, 6′R, 8′R) and 5′′′ (7S, 8S, 1′S, 2′R, 6′S, 8′R) considering the positions that are readily epimerizable such as allylic alcohols, and protons near to carbonyl moieties and esters. We used the gauge independent atomic orbital (GIAO)87-89 method at the PCM/mPW1PW91/6–

311+G(d,p) level of theory89 for DP4+ calculations.90 The computed chemical shifts of 5, 5′, 5′′, and 5′′′ were compared with the experimental values utilizing total absolute deviation (TAD), mean absolute error (MAE) and DP4+ probability analyses; all three methods have been successfully applied in addressing stereochemical assignment of isomeric compounds.148-149 The

TAD and MAE values for 1H NMR and 13C NMR chemical shifts were in accordance, and clearly pointed out 5 as the most probable stereoisomer (Fig. 46). DP4+ analysis also predicted the structure of 5 to match the experimental results with 100% probability (Fig. 46). Considering the relative configuration assigned via the X-ray diffraction data, the comparison of experimental and ab initio computed ECD spectra, and the DP4+ analysis, the absolute configuration of 5 was unequivocally defined as (7S, 8S, 1′S, 2′S, 6′R, 8′R). Kadsuraol B (6) white powder, Kadsuraol C

(7) white powder, 6 and 7 were assigned molecular formulas of C29H28O9 and C24H26O9, respectively, on the basis of the sodium adduct HRESIMS ions at m/z 543.1626 and 481.1469 and

13C NMR data. The HSQC overlay (see Figures 47 and 48) showed 6 and 7 were similar to 5 except for the C-7 substituents. The 9- angelate group in 5 was replaced by a benzoate and an acetoxy group in 6 and 7, respectively. The structures of 6 and 7 were confirmed via comparison of 1H, 13C NMR, and ECD data with those of 5.

20 Kadsuraol B (6) white powder, [훼]D +62 (c = 1, MeOH); Kadsuraol C (7) white powder,

20 [훼]D +58 (c = 1, MeOH); IR (KBr) νmax 3430, 2959, 1712, 1654, 1616, 1459, 1419, 1395, 1354,

1331, 1236, 1190, 1115, 1109, 1058, 1020, 964, 937, 903, 846, 786, 756 cm-1; 6 and 7, were assigned molecular formulas of C29H28O9 and C24H26O9, respectively, on the basis of the sodium adduct HRESIMS ions at m/z 543.1626 and 481.1469 and 13C NMR data. The HSQC overlay (Fig.

47 and 48) showed 6 and 7 were similar to 5, except for the C-7 substituents. The 9-angelate group in 5 was replaced by a benzoate and an acetoxy group in 6 and 7, respectively. The structures of 6 and 7 were confirmed via comparison of 1H, 13C NMR, and ECD data with those of 5.

Compounds 1–7 were evaluated for their in vitro hepatoprotective activities against N-acetyl-p- aminophenol (APAP)-induced toxicity in HepG2 cells by means of the MTT method.142

Compounds 1, 3, 4, and 5 showed moderate hepatoprotective activity by integrated analysis against

APAP-induced toxicity in HepG2 cells (Table 7).

Four new highly oxygenated triterpenoids and three novel dibenzocyclooctadiene lignans were isolated from Kadsura longipedunculata. Their 2D structures were solved using NMR and

HRESIMS data and their absolute configurations were elucidated using X-ray diffraction analysis,

ECD experimental results compared to ab initio computed spectra, HSQC overlay, DP4+, NOESY, and J-based configuration analysis. This is the first comprehensive stereochemical assignment of a non-crystalline schiartanetype nortriterpenoid. This general protocol may contribute towards solving the problems hampering the assignment of the absolute configurations of other members of this class of nortriterpenoids. Compounds 1, 3, 4, and 5 showed moderate hepatoprotective activity against APAP-induced toxicity in HepG2 cells with cell survival rates of 53.0 and 50.2%, respectively, at 10 μM (bicyclol, 49.0%), while compound 2 was inactive.

100

Figure 43. Key HMBC correlations of 5.

Figure 44. The optimized conformation and the key ROESY correlations of 5.

101

Figure 45. X-ray ORTEP drawing of 5 revealing an unusual crystal packing (A) with eight structures in the unit cell (B).

102

DP4+ TAD MAE DP4+ TAD MAE

Proton 100% 2.46 0.14 Proton 0.0% 6.42 0.38

Carbon 100% 109.16 4.04 Carbon 0.0% 154.44 5.72

Both 100% 111.63 4.18 Both 0.0% 160.86 6.10

DP4+ TAD MAE DP4+ TAD MAE

Proton 0.0% 5.10 0.30 Proton 0.0% 7.96 0.47

Carbon 0.0% 139.30 5.16 Carbon 0.0% 148.65 5.51

Both 0.0% 144.40 5.46 Both 0.0% 156.61 5.98

Figure. 46. Total absolute deviation (TAD), mean absolute error (MAE) and DP4+ probability analyses

(sarotti-NMR.weebly.com) for 5 and three of its diastereomers (Gibbs free energies at the

PCM/mPW1PW91/6–311+G(d,p) level were used for the analysis).

103

1 Table 6. H NMR Data of 5-7 in CDCl3, δ in ppm (J in Hz, 500 MHz).

no. 5 6 7 6 6.61 (s) 6.62 (s) 6.55 (s) 7 5.38 (s) 5.62 (s) 5.22 (s) 9 1.12 (s) 1.15 (s) 1.13 (s) 6′ 4.52 (s) 4.55 (s) 4.51 (s) 7′α 1.90 (dd, 11.0, 13.0) 1.95 (dd, 11.0, 13.0) 1.90 (dd, 11.0, 13.0) 7′β 1.48 (dd, 7.0, 13.0) 1.52 (dd, 7.0, 13.0) 1.48 (dd, 7.0, 13.0) 8′ 1.59 (m) 1.68 (m) 1.56 (m)

9′ 0.99 (d, 7.0) 1.02 (d, 7.0) 0.97 (d, 7.5) 19α 6.00 (br s) 6.00 (br s) 6.00 (d, 1.5) 19β 5.93 (br s) 5.90 (br s) 5.92 (d, 1.5) 20α 4.59 (d, 10.0) 4.65 (d, 10.0) 4.62 (d, 10.0) 20β 4.54 (d, 10.0) 4.59 (d, 10.0) 4.52 (d, 10.0)

2′′ 1.87(1H, s) 3′′ 5.86 (br q, 7.0) 7.92 (br d, 7.0) 4′′ 1.84 (d, 7.0) 7.35 (t, 7.0) 5′′ 1.71 (s) 7.47 (dt, 1.5, 7.0) 6′′ 7.35 (t, 7.0)

7′′ 7.92 (br d, 7.0)

4′-OCH3 3.68 (s) 3.78 (s) 3.76 (s)

5′-OCH3 4.09 (s) 4.12 (s) 4.13 (s)

104

Table 7. Hepatoprotective effect of compounds 1, 3, 4 and 5 (10 μM) against APAP-induced toxicity in

HepG2 cell.

OD (mean ±SD) Cell survival rate (% of

normal)

Control 1.276±0.197 100.00

APAP 8mM 0.494±0.111 27.64

1 0.710±0.032 52.0

3 0.585±0.014 56.84

4 0.641±0.014 53.0

5 0.659 ± 0.023 48.22

Bicyclol 0.678±0.020 48.77

105

Figure 47. The HSQC Overlay of of Compounds A (red) and B (gray)

Figure 48. The HSQC Overlay of of kadsuraols A (red) and C (green)

106

Kadsuraols A–C (5–7)are likely biosynthesized via the phenylpropenoid pathway (Scheme

S1). Thus, one-electron oxidation of 3,4,5-trihydroxycinnamyl alcohol (6) would lead to formation of the C-8 radical 7. Dirigent protein guided C-C radical coupling150 would afford the 8,8′-linked quinone-methide 8 and subsequently the bis-phenylpropanol 9 via reduction. Phenol-oxidative formation of the biphenyl bond would lead to the dibenzocyclooctadiene intermediate 10 that may be susceptible to further oxidation and generation of the unique cyclobutane moiety in 12 via the diradical 11. Various well-established functional group manipulations would transform 12 into the target pentacyclic architecture 15 via intermediates 13 and 14. The appropriate acylations would then convert 15 into the novel kadsuraols A–C (1–3). The putative biosynthesis pathway of compound 1, 2 and 3 was represent in Scheme 2

107

Scheme 2. Putative Biosynthesis Pathway Towards the Formation of 5–7.

Conclusion

108

Natural products have provided a diversity of valuable drugs in addition to the identification of key targets for the control of cancer. It has been estimated that up to 50% of all present day therapeutics are derived from natural products, and in the case of cancer, the number is near 75%.

In this study, a series of compounds have been explored from natural resources including plants, marine sponges and microbio. Their structures and absolute configurations were established using a combination of MS, NMR, and electronic circular dichroism data and X-ray diffraction. These compounds showed different activities related to human disease.

The orchestration of molecular ion networking and a set of computationally assisted structural elucidation approaches in the discovery of a new class of pyrroloiminoquinone alkaloids that possess selective bioactivity against pancreatic cancer cell lines. Aleutianamine represents the first in a new class of pyrroloiminoquinone alkaloids possessing a highly strained multi-bridged ring system, discovered from Latrunculia (Latrunculia) austini Samaai, Kelly & Gibbons, 2006 (class

Demospongiae, order Poecilosclerida, family Latrunculiidae) recovered during a NOAA deep- water exploration of the Aleutian Islands. The molecule was identified with the guidance of mass spectrometry, nuclear magnetic resonance, and molecular ion networking (MoIN) analysis.

Importantly, we have isolated one of the unreported discorhabidins, aleutianamine, which shows potent and selective cytotoxicity toward solid tumor cell lines including pancreatic cancer (PANC-

1) with an IC50 of 25 nM and colon cancer (HCT-116) with an IC50 of 1 μM, and represents a potent and selective candidate for advanced preclinical studies. Aleutianamine is the dehydration and rearrangement product of discorhabdin A (DA) which is the highest yielding discorhabdin in

Latrunculia sp. Several groups have already successfully synthesized discorhabdins including discorhabdin A32. Due to a slow growth rate, difficulties in the collection of sponges and mass-

109

limited quantities of the drug lead, we will use synthetic methods to accumulate adequate amounts of aleutianamine for cell biology and in vivo study. We have in hand 100 mg of DA isolated as a co-occurring marine natural product during our investigations of these sponges. We hypothesize that aleutianamine is a promising drug lead for pancreatic cancer and can be made available for study by semi-synthesis from discorhabdin A. A proposed mechanism are shown below.

Scheme 3. Biotrasformation of discorhabdin A to aleutianamine.

Rapamycin

A prominent member of plant microbiomes, B. amyloliquefaciens cultured from American sycamore produce rapamycin as shown by HR-LCMS, NMR, mass imaging (MI) and the Global

Natural Products Social (GNPS) network or molecular ion networking (MoIN). A metagenomics and metabolomics of sycamore tissues revealed that the vegetative state of B. amyloliquefaciens

110

inhabits the xylem but not the healthy leaves, shown to be due to the high antibiotic concentration in the leaves. Published results show that inhibiting TOR in plants will promote autophagy and differentiation of xylem36, indicating that rapamycin from the microbiome play a role in the genesis of vascular tissue by promoting differentiation of xylem. Thus rapamycin appears to play a significant role vascularization of these tall trees that co-evolved along-side very tall herbivorous reptiles. The studies presented here serve as a platform for the further exploration of the biosynthesis pathway of ‘‘endogenous rapamycin’’ in the microbiology.

Figure 49. The experimental ECD spectrum of micrandilactone I (1).

111

Figure 50. The HRESIMS spectrum of micrandilactone I (1).

Figure 51. The 1H-NMR spectrum of micrandilactone I (1).

112

Figure 52. The 13C-NMR spectrum of micrandilactone I (1).

Figure 53. The HMBC spectrum of micrandilactone I (1).

113

Figure 54. The HSQC spectrum of micrandilactone I (1).

114

Figure 55. The experimental ECD spectrum of micrandilactone J (2).

Figure 56. The HRESIMS spectrum of micrandilactone J (2).

115

Figure 57. The 1H-NMR spectrum of micrandilactone J (2).

116

Figure 58. The 13C-NMR spectrum of micrandilactone J (2).

117

Figure 59. The ROESY spectrum of micrandilactone J (2).

118

Figure 60. HETLOC spectrum of micrandilactone J (2).

Figure 61. The experimental ECD spectrum of 22, 23-diastereoismomer-micrandilactone G (3).

Figure 62. The HR-ESI-MS spectrum of 22, 23-diastereoismomer-micrandilactone J (3).

119

Figure 63. The 1H-NMR spectrum of 22, 23-diastereoismomer-micrandilactone J (3).

120

Figure 64. The 13C-NMR spectrum of 22, 23-diastereoismomer-micrandilactone J (3).

121

Figure 65. The HSQC spectrum of 22, 23-diastereoismomer-micrandilactone J (3).

122

Figure 66. The HMBC spectrum of 22, 23-diastereoismomer-micrandilactone J (3).

123

Figure 67. The ROESY spectrum of 22, 23-diastereoismomer-micrandilactone J (3).

Figure 68. HETLOC spectrum of 22, 23-diastereoismomer-micrandilactone J (3).

124

Figure 69. The CD spectrum of Micrandilactone H

Figure 70. The HR-ESI-MS spectrum of Micrandilactone H

125

Figure 71. The 1H-NMR spectrum of Micrandilactone H

Figure 72. The 13C-NMR spectrum of Micrandilactone H

126

Figure 73. The HSQC spectrum of Micrandilactone H

Figure 74. The HMBC spectrum of Micrandilactone H

127

Figure 75. The NOESY spectrum of Micrandilactone H

Figure 76. The HRESI Mass Spectrum of Kadsuraol A.

128

Figure 77. The 1H NMR Spectrum of Kadsuraol A.

129

Figure 78. The 13C NMR Spectrum of Kadsuraol A.

130

Figure 79. The HSQC Spectrum of Kadsuraol A.

Figure 80. The HMBC Spectrum of Kadsuraol A.

131

Figure 81. The ROESY Spectrum of Kadsuraol A.

132

Figure 82. The Experimental ECD Spectrum of Kadsuraol A.

Figure 83. The HRESI Mass Spectrum of Kadsuraol B

133

Figure 84. The 1H NMR Spectrum of Kadsuraol B.

134

Figure 85. The 13C NMR Spectrum of Kadsuraol B.

135

Figure 86. The HSQC Spectrum of Kadsuraol B.

Figure 87. The HSQC Overlay of of Kadsuraol A (red) and Kadsuraol B (gray)

136

Figure 88. The HMBC Spectrum of Kadsuraol B.

137

Figure 89. The ROESY Spectrum of Kadsuraol B.

138

Figure 90. The Experimental ECD Spectrum of Kadsuraol B.

Figure 91. The HRESI Mass Spectrum of Kadsuraol C.

139

0 7 0 7 6 3 0 4 4 2 2 5 9 0 7 5 5 0 5 4 9 8 0 1 7 1 3 7 3 1 7 5 1 5 8 3

6 4 0 9 2 2 2 3 1 6 4 0 2 4 9 8 5 8 2 0 9 7 7 8 6 6 5 4 3 0 8 7 6 2 7 6

2 5 0 9 9 9 2 6 6 5 5 5 1 9 8 8 7 2 9 9 8 8 8 5 5 5 5 5 5 5 4 4 4 1 9 9

......

7 6 6 5 5 5 5 4 4 4 4 4 4 3 3 3 3 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0 0 -

7 0 3 3 8 7 3 6 5 0 2 6 6 8

9 0 0 0 0 0 0 9 9 1 9 1 9 9

......

0 1 1 1 1 1 1 2 2 4 2 1 2 2 7.0 6.5 6.0 5.5 5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0 f1 (ppm)

Figure 92. The 1H NMR Spectrum of Kadsuraol C.

3 3 3

l l l

C C C

D D D

C C C

1 3 3 8 9 5 0 2 2 1 7

8 5 2 2 2 3 5 9 3 8 5 3 7 9 4 9 8 3 4 6 5 2 7 8 3 8 6 4

......

9 4 2 0 7 3 9 7 7 6 2 5 9 4 0 9 2 2

4 0 0 0 2 5 0 4 4 2 1 ......

9 7 6 5 4 3 3 2 2 0 0 1 7 7 7 6 6 2 0 9 6 6 5 1 9 1 6 4 .

1 1 1 1 1 1 1 1 1 1 1 8 7 7 7 7 7 7 6 5 5 4 4 3 2 2 1 1 0

210 200 190 180 170 160 150 140 130 120 110 100 90 80 70 60 50 40 30 20 10 0 -10 f1 (ppm)

140

Figure 93. The 13C NMR Spectrum of Kadsuraol C.

)

p p

60 (

1 f 70

100

110

120 7.5 7.0 6.5 6.0 5.5 5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0 f2 (ppm)

Figure 94. The HSQC Spectrum of Kadsuraol C

141

Figure 95. The HSQC Overlay of Kadsuraol A (red) and Kadsuraol C (green)

142

)

m p

100 p

(

1 120 f

140

160

180

200

8.0 7.5 7.0 6.5 6.0 5.5 5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0 -0.5 f2 (ppm)

Figure 96. The HMBC Spectrum of Kadsuraol C

143

0.5

1.0

1.5

2.0

2.5

3.0 )

3.5 m

(

4.0 1 f

4.5

5.0

5.5

6.0

6.5

7.0 7.0 6.5 6.0 5.5 5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0 f2 (ppm)

Figure 97. The ROESY Spectrum of Kadsuraol C

144

Figure 98. The Experimental ECD Spectrum of Kadsuraol C.

145

References

1. Islami, F.; Goding Sauer, A.; Miller, K. D.; Siegel, R. L.; Fedewa, S. A.; Jacobs, E. J.; McCullough, M. L.; Patel, A. V.; Ma, J.; Soerjomataram, I., Proportion and number of cancer cases and deaths attributable to potentially modifiable risk factors in the United States. CA: a cancer journal for clinicians 2018, 68 (1), 31-54. 2. Rahib, L.; Smith, B. D.; Aizenberg, R.; Rosenzweig, A. B.; Fleshman, J. M.; Matrisian, L. M., Projecting cancer incidence and deaths to 2030: the unexpected burden of thyroid, liver, and pancreas cancers in the United States. Cancer research 2014, 74 (11), 2913-2921. 3. Frank, A.; Deng, S.; Huang, X.; Velidedeoglu, E.; Bae, Y.-S.; Liu, C.; Abt, P.; Stephenson, R.; Mohiuddin, M.; Thambipillai, T., Transplantation for type I diabetes: comparison of vascularized whole- organ pancreas with isolated pancreatic islets. Annals of surgery 2004, 240 (4), 631. 4. Hingorani, S. R.; Wang, L.; Multani, A. S.; Combs, C.; Deramaudt, T. B.; Hruban, R. H.; Rustgi, A. K.; Chang, S.; Tuveson, D. A., Trp53R172H and KrasG12D cooperate to promote chromosomal instability and widely metastatic pancreatic ductal adenocarcinoma in mice. Cancer cell 2005, 7 (5), 469-483. 5. Lee, J. W.; Komar, C. A.; Bengsch, F.; Graham, K.; Beatty, G. L., Genetically Engineered Mouse Models of Pancreatic Cancer: The KPC Model (LSL‐KrasG12D/+; LSL‐Trp53R172H/+; Pdx‐1‐Cre), Its Variants, and Their Application in Immuno‐oncology Drug Discovery. Current protocols in pharmacology 2016, 73 (1), 14.39. 1-14.39. 20. 6. Ghaneh, P.; Costello, E.; Neoptolemos, J. P., Biology and management of pancreatic cancer. Gut 2007, 56 (8), 1134-1152. 7. Hruban, R. H.; Van Mansfeld, A.; Offerhaus, G.; Van Weering, D.; Allison, D. C.; Goodman, S. N.; Kensler, T. W.; Bose, K. K.; Cameron, J. L.; Bos, J. L., K-ras oncogene activation in adenocarcinoma of the human pancreas. A study of 82 carcinomas using a combination of mutant-enriched polymerase chain reaction analysis and allele-specific oligonucleotide hybridization. The American journal of pathology 1993, 143 (2), 545. 8. Moskaluk, C. A.; Hruban, R. H.; Kern, S. E., p16 and K-ras gene mutations in the intraductal precursors of human pancreatic adenocarcinoma. Cancer research 1997, 57 (11), 2140-2143. 9. Waters, A. M.; Der, C. J., KRAS: the critical driver and therapeutic target for pancreatic cancer. Cold Spring Harbor perspectives in medicine 2018, 8 (9), a031435. 10. Papke, B.; Der, C. J., Drugging RAS: Know the enemy. Science 2017, 355 (6330), 1158-1163. 11. Houle, D.; Govindaraju, D. R.; Omholt, S., Phenomics: the next challenge. Nature Reviews Genetics 2010, 11 (12), 855-866. 12. Michaud, D. S.; Izard, J., Microbiota, oral microbiome, and pancreatic cancer. Cancer journal (Sudbury, Mass.) 2014, 20 (3), 203. 13. Fiehn, O., Metabolomics–the link between genotypes and phenotypes. Plant molecular biology 2002, 48 (1-2), 155-171. 14. Spratlin, J. L.; Serkova, N. J.; Eckhardt, S. G., Clinical applications of metabolomics in oncology: a review. Clinical Cancer Research 2009, 15 (2), 431-440. 15. Armitage, E. G.; Barbas, C., Metabolomics in cancer biomarker discovery: current trends and future perspectives. Journal of pharmaceutical and biomedical analysis 2014, 87, 1-11. 16. Bu, Q.; Huang, Y.; Yan, G.; Cen, X.; Zhao, Y.-L., Metabolomics: A revolution for novel cancer marker identification. Combinatorial chemistry & high throughput screening 2012, 15 (3), 266-275. 17. Ross, W. A.; Wasan, S. M.; Evans, D. B.; Wolff, R. A.; Trapani, L. V.; Staerkel, G. A.; Prindiville, T.; Lee, J. H., Combined EUS with FNA and ERCP for the evaluation of patients with obstructive jaundice from presumed pancreatic malignancy. Gastrointestinal endoscopy 2008, 68 (3), 461-466.

146

18. Savides, T. J.; Donohue, M.; Hunt, G.; Al-Haddad, M.; Aslanian, H.; Ben-Menachem, T.; Chen, V. K.; Coyle, W.; Deutsch, J.; DeWitt, J., EUS-guided FNA diagnostic yield of malignancy in solid pancreatic masses: a benchmark for quality performance measurement. Gastrointestinal endoscopy 2007, 66 (2), 277-282. 19. Gold, D. V.; Modrak, D. E.; Ying, Z.; Cardillo, T. M.; Sharkey, R. M.; Goldenberg, D. M., New MUC1 serum immunoassay differentiates pancreatic cancer from pancreatitis. Journal of clinical oncology 2006, 24 (2), 252-258. 20. Bathe, O. F.; Shaykhutdinov, R.; Kopciuk, K.; Weljie, A. M.; McKay, A.; Sutherland, F. R.; Dixon, E.; Dunse, N.; Sotiropoulos, D.; Vogel, H. J., Feasibility of identifying pancreatic cancer based on serum metabolomics. Cancer Epidemiology Biomarkers & Prevention 2011, 20 (1), 140-147. 21. Fong, Z. V.; Winter, J. M., Biomarkers in pancreatic cancer: diagnostic, prognostic, and predictive. The Cancer Journal 2012, 18 (6), 530-538. 22. Sugimoto, M.; Wong, D. T.; Hirayama, A.; Soga, T.; Tomita, M., Capillary electrophoresis mass spectrometry-based saliva metabolomics identified oral, breast and pancreatic cancer-specific profiles. Metabolomics 2010, 6 (1), 78-95. 23. Zhang, Z.; Zhao, Z.; Liu, B.; Li, D.; Zhang, D.; Chen, H.; Liu, D., Systems biomedicine: It’s your turn— Recent progress in systems biomedicine. Quantitative Biology 2013, 1 (2), 140-155. 24. Jones, S.; Zhang, X.; Parsons, D. W.; Lin, J. C.-H.; Leary, R. J.; Angenendt, P.; Mankoo, P.; Carter, H.; Kamiyama, H.; Jimeno, A., Core signaling pathways in human pancreatic cancers revealed by global genomic analyses. Science 2008, 321 (5897), 1801-1806. 25. Freelove, R.; Walling, A. D., Pancreatic cancer: diagnosis and management. Am Fam Physician 2006, 73 (3), 485-92. 26. Conroy, T.; Desseigne, F.; Ychou, M.; Bouché, O.; Guimbaud, R.; Bécouarn, Y.; Adenis, A.; Raoul, J.-L.; Gourgou-Bourgade, S.; de la Fouchardière, C., FOLFIRINOX versus gemcitabine for metastatic pancreatic cancer. New England Journal of Medicine 2011, 364 (19), 1817-1825. 27. Wang, D.; Lippard, S. J., Cellular processing of platinum anticancer drugs. Nature reviews Drug discovery 2005, 4 (4), 307. 28. Koido, S.; Homma, S.; Takahara, A.; Namiki, Y.; Tsukinaga, S.; Mitobe, J.; Odahara, S.; Yukawa, T.; Matsudaira, H.; Nagatsuma, K.; Uchiyama, K.; Satoh, K.; Ito, M.; Komita, H.; Arakawa, H.; Ohkusa, T.; Gong, J.; Tajiri, H., Current immunotherapeutic approaches in pancreatic cancer. Clinical & Developmental Immunology 2011, 2011, 267539-267539. 29. Pommier, Y., Drugging topoisomerases: lessons and challenges. ACS chemical biology 2013, 8 (1), 82-95. 30. Syn, N. L.; Teng, M. W.; Mok, T. S.; Soo, R. A., De-novo and acquired resistance to immune checkpoint targeting. The Lancet Oncology 2017, 18 (12), e731-e741. 31. Rahib, L.; Smith, B. D.; Aizenberg, R.; Rosenzweig, A. B.; Fleshman, J. M.; Matrisian, L. M., Projecting cancer incidence and deaths to 2030: the unexpected burden of thyroid, liver, and pancreas cancers in the United States. Cancer research 2014. 32. Hu, J.-F.; Fan, H.; Xiong, J.; Wu, S.-B., Discorhabdins and pyrroloiminoquinone-related alkaloids. Chemical reviews 2011, 111 (9), 5465-5491. 33. Gehring, C. A.; Whitham, T. G., Interactions between aboveground herbivores and the mycorrhizal mutualists of plants. Trends in Ecology & Evolution 1994, 9 (7), 251-255. 34. Den Camp, R. O.; Streng, A.; De Mita, S.; Cao, Q.; Polone, E.; Liu, W.; Ammiraju, J. S.; Kudrna, D.; Wing, R.; Untergasser, A., LysM-type mycorrhizal receptor recruited for rhizobium symbiosis in nonlegume Parasponia. Science 2011, 331 (6019), 909-912. 35. Kuypers, M. M.; Marchant, H. K.; Kartal, B., The microbial nitrogen-cycling network. Nature Reviews Microbiology 2018.

147

36. Ren, M.; Venglat, P.; Qiu, S.; Feng, L.; Cao, Y.; Wang, E.; Xiang, D.; Wang, J.; Alexander, D.; Chalivendra, S., Target of rapamycin signaling regulates metabolism, growth, and life span in Arabidopsis. The Plant Cell 2012, 24 (12), 4850-4874. 37. Yang, G.-Y.; Li, Y.-K.; Zhang, X.-J.; Li, X.-N.; Yang, L.-M.; Shi, Y.-M.; Xiao, W.-L.; Zheng, Y.-T.; Sun, H.- D., Three new nortriterpenoids from Schisandra wilsoniana and their anti-HIV-1 activities. Natural products and bioprospecting 2011, 1 (1), 33-36. 38. Lei, C.; Pu, J.-X.; Huang, S.-X.; Chen, J.-J.; Liu, J.-P.; Yang, L.-B.; Ma, Y.-B.; Xiao, W.-L.; Li, X.-N.; Sun, H.-D., A class of 18 (13→ 14)-abeo-schiartane skeleton nortriterpenoids from Schisandra propinqua var. propinqua. Tetrahedron 2009, 65 (1), 164-170. 39. Gao, X.-M.; Pu, J.-X.; Xiao, W.-L.; Huang, S.-X.; Lou, L.-G.; Sun, H.-D., Kadcoccilactones K–R, triterpenoids from Kadsura coccinea. Tetrahedron 2008, 64 (51), 11673-11679. 40. Xiao, W. L.; Lei, C.; Ren, J.; Liao, T. G.; Pu, J. X.; Pittman, C. U.; Lu, Y.; Zheng, Y. T.; Zhu, H. J.; Sun, H. D., Structure elucidation and theoretical investigation of key steps in the biogenetic pathway of schisanartane nortriterpenoids by using DFT methods. Chemistry–A European Journal 2008, 14 (36), 11584-11592. 41. Xiao, W.-L.; Gong, Y.-Q.; Wang, R.-R.; Weng, Z.-Y.; Luo, X.; Li, X.-N.; Yang, G.-Y.; He, F.; Pu, J.-X.; Yang, L.-M., Bioactive nortriterpenoids from Schisandra grandiflora. Journal of natural products 2009, 72 (9), 1678-1681. 42. Li, R.-T.; Han, Q.-B.; Zheng, Y.-T.; Wang, R.-R.; Yang, L.-M.; Lu, Y.; Sang, S.-Q.; Zheng, Q.-T.; Zhao, Q.-S.; Sun, H.-D., Structure and anti-HIV activity of micrandilactones B and C, new nortriterpenoids possessing a unique skeleton from Schisandra micrantha. Chemical communications 2005, (23), 2936- 2938. 43. Siegel, R. L.; Miller, K. D.; Jemal, A., Cancer statistics, 2018. CA: A Cancer Journal For Clinicians 2018, 68 (1), 7-30. 44. Bardeesy, N.; DePinho, R. A., Pancreatic cancer biology and genetics. Nature Reviews Cancer 2002, 2 (12), 897-909. 45. Wong, M. C. S.; Jiang, J. Y.; Liang, M.; Fang, Y.; Yeung, M. S.; Sung, J. J. Y., Global temporal patterns of pancreatic cancer and association with socioeconomic development. Scientific Reports 2017, 7 (1), 3165-3165. 46. Freelove, R.; Walling, A. D., Pancreatic Cancer: Diagonsis and Management. Am Fam Physician 2006, 73 (3), 485-492. 47. Lohse, I.; Borgida, A.; Cao, P.; Cheung, M.; Pintilie, M.; Bianco, T.; Holter, S.; Ibrahimov, E.; Kumareswaran, R.; Bristow, R. G.; Tsao, M. S.; Gallinger, S.; Hedley, D. W., BRCA1 and BRCA2 mutations sensitize to chemotherapy in patient-derived pancreatic cancer xenografts. British Journal of Cancer 2015, 113 (3), 425-432. 48. O'Connor, C.; Kneebone, A.; Lee, M., Radiotherapy for pancreatic cancer Cancer Forum 2016, 40 (1), 43-46. 49. Neoptolemos, J. P.; Dunn, J. A.; Stocken, D. D.; Almond, J.; Link, K.; Beger, H.; Bassi, C.; Falconi, M.; Pederzoli, P.; Dervenis, C.; Fernandez-Cruz, L.; Lacaine, F.; Pap, A.; Spooner, D.; Kerr, D. J.; Friess, H.; Buchler, M. W., Adjuvant chemoradiotherapy and chemotherapy in resectable pancreatic cancer: a randomised controlled trial. The Lancet 2001, (9293). 50. Kinghorn, A. D., Review of anticancer agents from natural products. ACS Publications: 2015. 51. Rayan, A.; Raiyn, J.; Falah, M., Nature is the best source of anticancer drugs: Indexing natural products for their anticancer bioactivity. PloS one 2017, 12 (11), e0187925. 52. Beck, A.; Goetsch, L.; Dumontet, C.; Corvaïa, N., Strategies and challenges for the next generation of antibody–drug conjugates. Nature reviews Drug discovery 2017, 16 (5), 315.

148

53. Newman, D. J.; Cragg, G. M., Natural products as sources of new drugs over the 30 years from 1981 to 2010. Journal of natural products 2012, 75 (3), 311-335. 54. Newman, D. J.; Cragg, G. M., Natural products as sources of new drugs from 1981 to 2014. Journal of natural products 2016, 79 (3), 629-661. 55. Chakraborty, T. K.; Das, S., Chemistry of potent anti-cancer compounds, amphidinolides. Current Medicinal Chemistry-Anti-Cancer Agents 2001, 1 (2), 131-149. 56. Mayer, A. M.; Gustafson, K. R., Marine pharmacology in 2003–2004: anti-tumour and cytotoxic compounds. European Journal of Cancer 2006, 42 (14), 2241-2270. 57. Alonso, D.; Khalil, Z.; Satkunanthan, N.; Livett, B., Drugs from the sea: conotoxins as drug leads for neuropathic pain and other neurological conditions. Mini reviews in medicinal chemistry 2003, 3 (7), 785- 787. 58. Grimes, D. J., Oceans and human health: risks and remedies from the sea. National Institute of Environmental Health Sciences: 2009. 59. Antunes, E. M.; Copp, B. R.; Davies-Coleman, M. T.; Samaai, T., Pyrroloiminoquinone and related metabolites from marine sponges. Natural product reports 2005, 22 (1), 62-72. 60. Lin, S.; McCauley, E. P.; Lorig-Roach, N.; Tenney, K.; Naphen, C. N.; Yang, A.-M.; Johnson, T. A.; Hernadez, T.; Rattan, R.; Valeriote, F. A., Another Look at Pyrroloiminoquinone Alkaloids—Perspectives on Their Therapeutic Potential from Known Structures and Semisynthetic Analogues. Marine drugs 2017, 15 (4), 98. 61. Radisky, D. C.; Radisky, E. S.; Barrows, L. R.; Copp, B. R.; Kramer, R. A.; Ireland, C. M., Novel cytotoxic topoisomerase II inhibiting pyrroloiminoquinones from Fijian sponges of the genus Zyzzya. Journal of the American Chemical Society 1993, 115 (5), 1632-1638. 62. Dijoux, M.-G.; Schnabel, P. C.; Hallock, Y. F.; Boswell, J. L.; Johnson, T. R.; Wilson, J. A.; Ireland, C. M.; Van Soest, R.; Boyd, M. R.; Barrows, L. R., Antitumor activity and distribution of pyrroloiminoquinones in the sponge genus Zyzzya. Bioorganic & medicinal chemistry 2005, 13 (21), 6035-6044. 63. Tohma, H.; Harayama, Y.; Hashizume, M.; Iwata, M.; Kiyono, Y.; Egi, M.; Kita, Y., The first total synthesis of discorhabdin A. Journal of the American Chemical Society 2003, 125 (37), 11235-11240. 64. Aubart, K. M.; Heathcock, C. H., A biomimetic approach to the discorhabdin alkaloids: total syntheses of discorhabdins C and E and dethiadiscorhabdin D. The Journal of organic chemistry 1999, 64 (1), 16-22. 65. Roberts, D.; Joule, J. A.; Bros, M. A.; Alvarez, M., Synthesis of Pyrrolo [4, 3, 2-de] quinolines from 6, 7-Dimethoxy-4-methylquinoline. Formal Total Syntheses of Damirones A and B, Batzelline C, Isobatzelline C, Discorhabdin C, and Makaluvamines A− D. The Journal of organic chemistry 1997, 62 (3), 568-577. 66. Lill, R. E.; Major, D. A.; Blunt, J. W.; Munro, M. H.; Battershill, C. N.; McLean, M. G.; Baxter, R. L., Studies on the biosynthesis of discorhabdin B in the New Zealand sponge Latrunculia sp. B. Journal of Natural Products 1995, 58 (2), 306-311. 67. Miyanaga, A.; Janso, J. E.; McDonald, L.; He, M.; Liu, H.; Barbieri, L.; Eustáquio, A. S.; Fielding, E. N.; Carter, G. T.; Jensen, P. R., Discovery and assembly-line biosynthesis of the lymphostin pyrroloquinoline alkaloid family of mTOR inhibitors in Salinispora bacteria. Journal of the American Chemical Society 2011, 133 (34), 13311-13313. 68. Amos, G. C.; Awakawa, T.; Tuttle, R. N.; Letzel, A.-C.; Kim, M. C.; Kudo, Y.; Fenical, W.; Moore, B. S.; Jensen, P. R., Comparative transcriptomics as a guide to natural product discovery and biosynthetic gene cluster functionality. Proceedings of the National Academy of Sciences 2017, 201714381. 69. Jordan, P. A.; Moore, B. S., Biosynthetic pathway connects cryptic ribosomally synthesized posttranslationally modified peptide genes with pyrroloquinoline alkaloids. Cell chemical biology 2016, 23 (12), 1504-1514.

149

70. Na, M.; Ding, Y.; Wang, B.; Tekwani, B. L.; Schinazi, R. F.; Franzblau, S.; Kelly, M.; Stone, R.; Li, X.- C.; Ferreira, D., Anti-infective discorhabdins from a deep-water Alaskan sponge of the genus Latrunculia. Journal of natural products 2009, 73 (3), 383-387. 71. Zou, Y.; Hamann, M. T., Atkamine: A new pyrroloiminoquinone scaffold from the cold water Aleutian Islands Latrunculia sponge. Organic letters 2013, 15 (7), 1516-1519. 72. Gerwick, W. H.; Moore, B. S., Lessons from the past and charting the future of marine natural products drug discovery and chemical biology. Chemistry & biology 2012, 19 (1), 85-98. 73. Perlman, Z. E.; Slack, M. D.; Feng, Y.; Mitchison, T. J.; Wu, L. F.; Altschuler, S. J., Multidimensional drug profiling by automated microscopy. Science 2004, 306 (5699), 1194-1198. 74. Wong, W. R.; Oliver, A. G.; Linington, R. G., Development of antibiotic activity profile screening for the classification and discovery of natural product antibiotics. Chemistry & biology 2012, 19 (11), 1483- 1495. 75. Wang, M.; Carver, J. J.; Phelan, V. V.; Sanchez, L. M.; Garg, N.; Peng, Y.; Nguyen, D. D.; Watrous, J.; Kapono, C. A.; Luzzatto-Knaan, T., Sharing and community curation of mass spectrometry data with Global Natural Products Social Molecular Networking. Nature biotechnology 2016, 34 (8), 828. 76. Watrous, J.; Roach, P.; Alexandrov, T.; Heath, B. S.; Yang, J. Y.; Kersten, R. D.; van der Voort, M.; Pogliano, K.; Gross, H.; Raaijmakers, J. M., Mass spectral molecular networking of living microbial colonies. Proceedings of the National Academy of Sciences 2012, 109 (26), E1743-E1752. 77. Liu, Y.; Saurí, J.; Mevers, E.; Peczuh, M. W.; Hiemstra, H.; Clardy, J.; Martin, G. E.; Williamson, R. T., Unequivocal determination of complex molecular structures using anisotropic NMR measurements. Science 2017, 356 (6333), eaam5349. 78. Abe, H.; Yamasaki, T.; Fujiwara, I.; Sasaki, S., Computer-aided structure elucidation methods. Analytica Chimica Acta 1981, 133 (4), 499-506. 79. Jaspars, M., Computer assisted structure elucidation of natural products using two-dimensional NMR spectroscopy. Natural Product Reports 1999, 16 (2), 241-248. 80. Smith, S. G.; Goodman, J. M., Assigning stereochemistry to single diastereoisomers by GIAO NMR calculation: The DP4 probability. Journal of the American Chemical Society 2010, 132 (37), 12946-12959. 81. Willoughby, P. H.; Jansma, M. J.; Hoye, T. R., A guide to small-molecule structure assignment through computation of (1 H and 13 C) NMR chemical shifts. Nature protocols 2014, 9 (3), 643. 82. Nugroho, A. E.; Morita, H., Circular dichroism calculation for natural products. Journal of natural medicines 2014, 68 (1), 1-10. 83. Li, X.-C.; Ferreira, D.; Ding, Y., Determination of absolute configuration of natural products: theoretical calculation of electronic circular dichroism as a tool. Current organic chemistry 2010, 14 (16), 1678-1697. 84. Breton, R. C.; Reynolds, W. F., Using NMR to identify and characterize natural products. Natural product reports 2013, 30 (4), 501-524. 85. Perry, N. B.; Blunt, J. W.; McCombs, J. D.; Munro, M. H., Discorhabdin C, a highly cytotoxic pigment from a sponge of the genus Latrunculia. The Journal of Organic Chemistry 1986, 51 (26), 5476-5478. 86. Wang, X.; Duggan, B. M.; Molinski, T. F., Mollenynes B–E from the Marine Sponge Spirastrella mollis. Band-Selective Heteronuclear Single Quantum Coherence for Discrimination of Bromo–Chloro Regioisomerism in Natural Products. Journal of the American Chemical Society 2015, 137 (38), 12343- 12351. 87. Cheeseman, J. R.; Trucks, G. W.; Keith, T. A.; Frisch, M. J., A comparison of models for calculating nuclear magnetic resonance shielding tensors. The Journal of chemical physics 1996, 104 (14), 5497-5509. 88. McWeeny, R., Perturbation theory for the Fock-Dirac density matrix. Physical Review 1962, 126 (3), 1028.

150

89. Wolinski, K.; Hinton, J. F.; Pulay, P., Efficient implementation of the gauge-independent atomic orbital method for NMR chemical shift calculations. Journal of the American Chemical Society 1990, 112 (23), 8251-8260. 90. Grimblat, N. s.; Zanardi, M. M.; Sarotti, A. M., Beyond DP4: An improved probability for the stereochemical assignment of isomeric compounds using quantum chemical calculations of NMR shifts. The Journal of organic chemistry 2015, 80 (24), 12526-12534. 91. Bednarek, P.; Osbourn, A., Plant-microbe interactions: chemical diversity in plant defense. Science 2009, 324 (5928), 746-748. 92. Crane, P. R.; Pedersen, K. R.; Friis, E. M.; Drinnan, A. N., Early Cretaceous (early to middle Albian) platanoid inflorescences associated with Sapindopsis leaves from the Potomac Group of eastern North America. Systematic Botany 1993, 328-344. 93. Kvaček, Z.; Manchester, S. R.; Guo, S.-x., Trifoliolate leaves of Platanus bella (Heer) comb. n. from the Paleocene of North America, Greenland, and Asia and their relationships among extinct and extant Platanaceae. International Journal of Plant Sciences 2001, 162 (2), 441-458. 94. Maslova, N.; Kodrul, T., New platanaceous inflorescence Archaranthus gen. nov. from the Maastrichtian-Paleocene of the Amur region. PALEONTOLOGICAL JOURNAL C/C OF PALEONTOLOGICHESKII ZHURNAL 2003, 37 (1), 89-98. 95. Ibrahim, M. A.; Mansoor, A. A.; Gross, A.; Ashfaq, M. K.; Jacob, M.; Khan, S. I.; Hamann, M. T., Methicillin-resistant Staphylococcus aureus (MRSA)-active metabolites from Platanus occidentalis (American sycamore). Journal of natural products 2009, 72 (12), 2141-2144. 96. Mitrokotsa, D.; Mitaku, S.; Demetzos, C.; Harvala, C.; Mentis, A.; Perez, S.; Kokkinopoulos, D., Bioactive compounds from the buds of Platanus orientalis and isolation of a new kaempferol glycoside. Planta Medica 1993, 59 (06), 517-520. 97. Chen, X. H.; Koumoutsi, A.; Scholz, R.; Eisenreich, A.; Schneider, K.; Heinemeyer, I.; Morgenstern, B.; Voss, B.; Hess, W. R.; Reva, O.; Junge, H.; Voigt, B.; Jungblut, P. R.; Vater, J.; Sussmuth, R.; Liesegang, H.; Strittmatter, A.; Gottschalk, G.; Borriss, R., Comparative analysis of the complete genome sequence of the plant growth-promoting bacterium Bacillus amyloliquefaciens FZB42. Nat Biotechnol 2007, 25 (9), 1007-14. 98. White, J. F., Jr.; Torres, M. S.; Sullivan, R. F.; Jabbour, R. E.; Chen, Q.; Tadych, M.; Irizarry, I.; Bergen, M. S.; Havkin-Frenkel, D.; Belanger, F. C., Occurrence of Bacillus amyloliquefaciens as a systemic endophyte of vanilla orchids. Microsc Res Tech 2014, 77 (11), 874-85. 99. Shahzad, R.; Waqas, M.; Khan, A. L.; Asaf, S.; Khan, M. A.; Kang, S.-M.; Yun, B.-W.; Lee, I.-J., Seed- borne endophytic Bacillus amyloliquefaciens RWL-1 produces gibberellins and regulates endogenous phytohormones of Oryza sativa. Plant Physiology and Biochemistry 2016, 106, 236-243. 100. Boottanun, P.; Potisap, C.; Hurdle, J. G.; Sermswan, R. W., Secondary metabolites from Bacillus amyloliquefaciens isolated from soil can kill Burkholderia pseudomallei. AMB Express 2017, 7 (1), 16. 101. Soares, M. A.; Li, H.-Y.; Bergen, M.; Da Silva, J. M.; Kowalski, K. P.; White, J. F., Functional role of an endophytic Bacillus amyloliquefaciens in enhancing growth and disease protection of invasive English ivy (Hedera helix L.). Plant and soil 2016, 405 (1-2), 107-123. 102. Chen, L.; Liu, Y.; Wu, G.; Veronican Njeri, K.; Shen, Q.; Zhang, N.; Zhang, R., Induced maize salt tolerance by rhizosphere inoculation of Bacillus amyloliquefaciens SQR9. Physiologia plantarum 2016, 158 (1), 34-44. 103. Ongena, M.; Jacques, P., Bacillus lipopeptides: versatile weapons for plant disease biocontrol. Trends Microbiol 2008, 16 (3), 115-25. 104. Borriss, R.; Chen, X. H.; Rueckert, C.; Blom, J.; Becker, A.; Baumgarth, B.; Fan, B.; Pukall, R.; Schumann, P.; Sproer, C.; Junge, H.; Vater, J.; Puhler, A.; Klenk, H. P., Relationship of Bacillus amyloliquefaciens clades associated with strains DSM 7T and FZB42T: a proposal for Bacillus amyloliquefaciens subsp. amyloliquefaciens subsp. nov. and Bacillus amyloliquefaciens subsp. plantarum

151

subsp. nov. based on complete genome sequence comparisons. Int J Syst Evol Microbiol 2011, 61 (Pt 8), 1786-801. 105. Thomson, A. W.; Turnquist, H. R.; Raimondi, G., Immunoregulatory functions of mTOR inhibition. Nature Reviews Immunology 2009, 9 (5), 324-337. 106. Kahan, B. D.; Group, R. U. S., Efficacy of sirolimus compared with azathioprine for reduction of acute renal allograft rejection: a randomised multicentre study. The Lancet 2000, 356 (9225), 194-202. 107. Shekhar-Guturja, T.; Gunaherath, G. K. B.; Wijeratne, E. K.; Lambert, J.-P.; Averette, A. F.; Lee, S. C.; Kim, T.; Bahn, Y.-S.; Tripodi, F.; Ammar, R., Dual action antifungal small molecule modulates multidrug efflux and TOR signaling. Nature chemical biology 2016, 12 (10), nchembio. 2165. 108. Cragg, G. M.; Grothaus, P. G.; Newman, D. J., Impact of natural products on developing new anticancer agents. Chemical reviews 2009, 109 (7), 3012-3043. 109. Kaeberlein, M.; Powers, R. W.; Steffen, K. K.; Westman, E. A.; Hu, D.; Dang, N.; Kerr, E. O.; Kirkland, K. T.; Fields, S.; Kennedy, B. K., Regulation of yeast replicative life span by TOR and Sch9 in response to nutrients. Science 2005, 310 (5751), 1193-1196. 110. Powers, R. W.; Kaeberlein, M.; Caldwell, S. D.; Kennedy, B. K.; Fields, S., Extension of chronological life span in yeast by decreased TOR pathway signaling. Genes & development 2006, 20 (2), 174-184. 111. Harrison, D. E.; Strong, R.; Sharp, Z. D.; Nelson, J. F.; Astle, C. M.; Flurkey, K.; Nadon, N. L.; Wilkinson, J. E.; Frenkel, K.; Carter, C. S., Rapamycin fed late in life extends lifespan in genetically heterogeneous mice. nature 2009, 460 (7253), 392. 112. Vellai, T.; Takacs-Vellai, K.; Zhang, Y.; Kovacs, A. L.; Orosz, L.; Müller, F., Genetics: influence of TOR kinase on lifespan in C. elegans. Nature 2003, 426 (6967), 620. 113. Heitman, J.; Movva, N. R.; Hall, M. N., Targets for cell cycle arrest by the immunosuppressant rapamycin in yeast. Science 1991, 253 (5022), 905-9. 114. Gonzalez, S.; Rallis, C., The TOR Signaling Pathway in Spatial and Temporal Control of Cell Size and Growth. Front Cell Dev Biol 2017, 5, 61. 115. van Dam, T. J.; Zwartkruis, F. J.; Bos, J. L.; Snel, B., Evolution of the TOR pathway. J Mol Evol 2011, 73 (3-4), 209-20. 116. Wullschleger, S.; Loewith, R.; Hall, M. N., TOR signaling in growth and metabolism. Cell 2006, 124 (3), 471-84. 117. Dobrenel, T.; Caldana, C.; Hanson, J.; Robaglia, C.; Vincentz, M.; Veit, B.; Meyer, C., TOR Signaling and Nutrient Sensing. Annu Rev Plant Biol 2016, 67, 261-85. 118. Xiong, Y.; Sheen, J., Rapamycin and glucose-target of rapamycin (TOR) protein signaling in plants. J Biol Chem 2012, 287 (4), 2836-42. 119. Sotelo, R.; Garrocho-Villegas, V.; Aguilar, R.; Calderón, M. E.; Jiménez, E. S. d., Coordination of cell growth and cell division in maize (Zea mays L.) relevance of the conserved TOR signal transduction pathway. In Vitro Cellular & Developmental Biology - Plant 2010, 46 (6), 578-586. 120. Xiong, Y.; Sheen, J., The role of target of rapamycin signaling networks in plant growth and metabolism. Plant Physiol 2014, 164 (2), 499-512. 121. Chang, C. J.; Yonce, C. E., Overwintering of Plum Leaf Scald Bacteria in Infected Trees. Japanese Journal of Phytopathology 1987, 53 (3), 345-353. 122. Matsuki, T.; Watanabe, K.; Fujimoto, J.; Kado, Y.; Takada, T.; Matsumoto, K.; Tanaka, R., Quantitative PCR with 16S rRNA-gene-targeted species-specific primers for analysis of human intestinal bifidobacteria. Applied and environmental microbiology 2004, 70 (1), 167-173. 123. Weisburg, W. G.; Barns, S. M.; Pelletier, D. A.; Lane, D. J., 16S ribosomal DNA amplification for phylogenetic study. Journal of bacteriology 1991, 173 (2), 697-703. 124. Nelson, B. A.; Ramaiya, P.; Lopez de Leon, A.; Kumar, R.; Crinklaw, A.; Jolkovsky, E.; Crane, J. M.; Bergstrom, G. C.; Rey, M. W., Complete Genome Sequence for the Fusarium Head Blight Antagonist Bacillus amyloliquefaciens Strain TrigoCor 1448. Genome Announc 2014, 2 (2).

152

125. Chang, C. J.; Walker, J. T., Bacterial leaf scorch of northern red oak: isolation, cultivation, and pathogenicity of a xylem-limited bacterium. Plant Disease 1988, 72 (8), 730-733. 126. Leite, B.; Andersen, P. C.; Ishida, M. L., Colony aggregation and biofilm formation in xylem chemistry-based media forXylella fastidiosa. FEMS Microbiology Letters 2004, 230 (2), 283-290. 127. Landy, M.; Warren, G. H.; et al., Bacillomycin; an antibiotic from Bacillus subtilis active against pathogenic fungi. Proc Soc Exp Biol Med 1948, 67 (4), 539-41. 128. Ongena, M.; Jacques, P.; Toure, Y.; Destain, J.; Jabrane, A.; Thonart, P., Involvement of fengycin- type lipopeptides in the multifaceted biocontrol potential of Bacillus subtilis. Appl Microbiol Biotechnol 2005, 69 (1), 29-38. 129. Park, K.; Park, Y.-S.; Ahamed, J.; Dutta, S.; Ryu, H.; Lee, S.-H.; Balaraju, K.; Manir, M.; Moon, S.-S.; Charles, M. T., Elicitation of induced systemic resistance of chili pepper by iturin A analogs derived fromBacillus vallismortisEXTN-1. Canadian Journal of Plant Science 2016, 564-570. 130. Molohon, K. J.; Blair, P. M.; Park, S.; Doroghazi, J. R.; Maxson, T.; Hershfield, J. R.; Flatt, K. M.; Schroeder, N. E.; Ha, T.; Mitchell, D. A., Plantazolicin Is an Ultranarrow-Spectrum Antibiotic That Targets the Bacillus anthracis Membrane. ACS Infectious Diseases 2016, 2 (3), 207-220. 131. Butcher, R. A.; Schroeder, F. C.; Fischbach, M. A.; Straight, P. D.; Kolter, R.; Walsh, C. T.; Clardy, J., The identification of bacillaene, the product of the PksX megacomplex in Bacillus subtilis. Proceedings of the National Academy of Sciences 2007, 104 (5), 1506-1509. 132. Fan, B.; Carvalhais, L. C.; Becker, A.; Fedoseyenko, D.; von Wirén, N.; Borriss, R., Transcriptomic profiling of Bacillus amyloliquefaciens FZB42 in response to maize root exudates. BMC microbiology 2012, 12 (1), 116. 133. Stallings, W. C.; Powers, T. B.; Pattridge, K. A.; Fee, J. A.; Ludwig, M. L., Iron superoxide dismutase from Escherichia coli at 3.1-A resolution: a structure unlike that of copper/zinc protein at both monomer and dimer levels. Proceedings of the National Academy of Sciences 1983, 80 (13), 3884-3888. 134. Doolittle, R. F., Convergent evolution: the need to be explicit. Trends in biochemical sciences 1994, 19 (1), 15-18. 135. Sarin, S.; Kumar, M.; Lau, G.; Abbas, Z.; Chan, H.; Chen, C.; Chen, D.; Chen, H.; Chen, P.; Chien, R., Asian-Pacific clinical practice guidelines on the management of hepatitis B: a 2015 update. Hepatology international 2016, 10 (1), 1-98. 136. Liu, G. T., Bicyclol: a novel drug for treating chronic viral hepatitis B and C. Medicinal Chemistry 2009, 5 (1), 29-43. 137. Cyong, J.-C.; Kim, S.-M.; Iijima, K.; Kobayashi, T.; Furuya, M., Clinical and pharmacological studies on liver disease treated with Kampo herbal medicine. The American journal of Chinese medicine 2000, 28 (03n04), 351-360. 138. Chiu, H. F.; Chen, T. Y.; Tzeng, Y. T.; Wang, C. K., Improvement of liver function in humans using a mixture of schisandra fruit extract and sesamin. Phytotherapy research 2013, 27 (3), 368-373. 139. Wang, T.; Jin, Y.; Zhao, R.; Wu, Y.; Zhang, Y.; Wu, D.; Kong, D.; Jin, X.; Zhang, F., High load hepatitis B virus replication inhibits hepatocellular carcinoma cell metastasis through regulation of epithelial– mesenchymal transition. International Journal of Infectious Diseases 2014, 20, 37-41. 140. Zanardi, M. M.; Suárez, A. G.; Sarotti, A. M., Determination of the relative configuration of terminal and spiroepoxides by computational methods. Advantages of the inclusion of unscaled data. The Journal of organic chemistry 2016, 82 (4), 1873-1879. 141. Matsumori, N.; Kaneno, D.; Murata, M.; Nakamura, H.; Tachibana, K., Stereochemical determination of acyclic structures based on carbon− proton spin-coupling constants. A method of configuration analysis for natural products. The Journal of organic chemistry 1999, 64 (3), 866-876. 142. Li, C.-J.; Ma, J.; Sun, H.; Zhang, D.; Zhang, D.-M., Guajavadimer A, a dimeric caryophyllene-derived meroterpenoid with a new carbon skeleton from the leaves of Psidium guajava. Organic letters 2015, 18 (2), 168-171.

153

143. Shi, Y.-M.; Xiao, W.-L.; Pu, J.-X.; Sun, H.-D., Triterpenoids from the Schisandraceae family: an update. Natural product reports 2015, 32 (3), 367-410. 144. Gao, X.-M.; Pu, J.-X.; Huang, S.-X.; Lu, Y.; Lou, L.-G.; Li, R.-T.; Xiao, W.-L.; Chang, Y.; Sun, H.-D., Kadcoccilactones A− J, triterpenoids from Kadsura coccinea. Journal of natural products 2008, 71 (7), 1182-1188. 145. Wang, X.; Fronczek, F. R.; Chen, J.; Liu, J.; Ferreira, D.; Li, S.; Hamann, M. T., Assignment of absolute configuration of a new hepatoprotective schiartane-type nortriterpenoid using X-ray diffraction. Molecules 2017, 22 (1), 65. 146. Gawronski, J. K.; van Oeveren, A.; van der Deen, H.; Leung, C. W.; Feringa, B. L., Simple circular dichroic method for the determination of absolute configuration of 5-substituted 2 (5 H)-furanones. The Journal of Organic Chemistry 1996, 61 (4), 1513-1515. 147. Le Trong, I.; Aprikian, P.; Kidd, B. A.; Forero-Shelton, M.; Tchesnokova, V.; Rajagopal, P.; Rodriguez, V.; Interlandi, G.; Klevit, R.; Vogel, V., Structural basis for mechanical force regulation of the adhesin FimH via finger trap-like β sheet twisting. Cell 2010, 141 (4), 645-655. 148. Wang, X.; Liu, J.; Pandey, P.; Chen, J.; Fronczek, F. R.; Parnham, S.; Qi, X.; Doerksen, R. J.; Ferreira, D.; Sun, H., Assignment of the absolute configuration of hepatoprotective highly oxygenated triterpenoids using X-ray, ECD, NMR J-based configurational analysis and HSQC overlay experiments. Biochimica et Biophysica Acta (BBA)-General Subjects 2017, 1861 (12), 3089-3095. 149. Bifulco, G.; Riccio, R.; Martin, G. E.; Buevich, A. V.; Williamson, R. T., Quantum chemical calculations of 1 J CC coupling constants for the stereochemical determination of organic compounds. Organic letters 2013, 15 (3), 654-657. 150. Dalisay, D. S.; Kim, K. W.; Lee, C.; Yang, H.; Rübel, O.; Bowen, B. P.; Davin, L. B.; Lewis, N. G., Dirigent protein-mediated lignan and cyanogenic glucoside formation in flax seed: integrated omics and MALDI mass spectrometry imaging. Journal of natural products 2015, 78 (6), 1231-1242.

154

VITA

I am originally from Lanzhou, China. I received my B.S. degree from China Pharmaceutical

University, China in 2011. I completed my master degree in Medicinal Chemistry (Natural

Products) in 2014. In 2014, I join Dr. Hamann’s lab as a graduate student to obtain my Ph.D. in the field of natural products. In my free time I enjoy reading books writing novels and playing games.

155