DOCSLIB.ORG

PROGRAMME BOOK 2 TABLE of CONTENTS Imig 2021 Sponsors

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
PROGRAMME BOOK 2 TABLE of CONTENTS Imig 2021 Sponsors iMig 2021 Sponsors iMig 2021 wishes to warmly thank the following organizations for their generous support of the Meeting. PLATINUM LEVEL DIAMOND LEVEL GOLD LEVEL SUPPORTER LEVEL COMMUNITY SUPPORTER PROGRAMME BOOK 2 TABLE OF CONTENTS iMig 2021 Sponsors ........................................................... 2 Welcome Messages .......................................................... 4 About iMig.......................................................................... 5 MEETING INFORMATION Virtual Platform .................................................................. 7 SCIENTIFIC PROGRAMME INFORMATION Programme at a Glance .................................................... 9 Scientific Programme Sunday, May 2 ............................................................ 11 Friday, May 7 .............................................................. 13 Saturday, May 8 .......................................................... 16 Sunday, May 9 ............................................................ 23 Monday, May 10 ......................................................... 29 Poster Listings ................................................................. 30 Awards iMig Wagner Medal ..................................................... 42 iMig Research Award .................................................. 42 iMig Advancement Award ........................................... 42 Developing Nations Award ......................................... 42 Young Investigator Award ........................................... 43 EXHIBITION INFORMATION Virtual Exhibit Information ................................................ 45 ABSTRACT INFORMATION Abstract Listings .............................................................. 49 PROGRAMME BOOK 3 WELCOME MESSAGE On behalf of the local organizing committee, we would th like to extend you a warm welcome to the 5 Meeting Kenneth O’Byrne of the International Mesothelioma Interest Group (iMig Australia 2021) to be held as a virtual meeting. In 2020 and 2021, iMig 2021 Conference Chair conferences around the world have been reshaped onto virtual platforms, and our meeting is, of course, one of these. Whilst we would have loved to have welcomed you to Brisbane, Australia last year, it was not to be. iMig 2020 was postponed at the last minute, as the global pandemic unfolded, and none of us had any idea what the next year would bring. It is important that our mesothelioma research and clinical community maintains our global connection, Anna Nowak and although we cannot do this face to face, we are Australia confident that our 2021 Virtual Meeting programme will be iMig 2021 Conference Chair engaging and worthwhile. Our multidisciplinary meeting brings together over 500 delegates from around the world, and features the most up-to-date research, diverse topics of interest and educational sessions with leading experts. We hope you will also take this opportunity to reach out to friends and colleagues in other ways for networking opportunities and Samuel G. Armato to discuss research and collaboration. iMig 2021 provides United States the ideal impetus to start those conversations. We may iMig President also see iMig 2021 becoming more accessible to those who would not have been able to travel or those with time constraints, and we hope you will make the most of the chance to view expert presentations from sessions you may not have attended in person. PROGRAMME BOOK 4 ABOUT IMIG INTERNATIONAL MESOTHELIOMA iMig Officers 2018 – 2021 INTEREST GROUP President: Sam Armato, PhD, Chicago, United States The International Mesothelioma Interest Group (iMig) is an independent international group of scientists and President-Elect: clinicians working to understand, cure and prevent Arnaud Scherpereel, MD, Lille, France Mesothelioma. We invite you to become a member of iMig to strengthen our international voice and to improve the Secretary: scientific exchange and knowledge about this malignancy. Jeremy Steele, MD, MRCP, London, United Kingdom Why Join iMig? Treasurer: Membership is about communication and participation. Jim teWaterNaude, MD, Cape Town, South Africa Members will have access to all features of the iMig website (iMig.org) and opportunities to contribute content there. Via email, members will receive notices of updates to the website such as those involving iMig Board Members 2018 – 2021 upcoming meetings, funding or career opportunities, new Courtney Broaddus, MD, San Francisco, United States presentations and research breakthroughs. Raphael Bueno, MD, Boston, United States Sjaak Burgers, MD, PhD, Amsterdam, The Netherlands Although no membership dues are requested at this time, Dean Fennell, MD, PhD, Leicester, United Kingdom members are asked to participate in iMig by contributing Joseph Friedberg, MD, Baltimore, United States to the website and/or participating in the biannual Rabab Gaafar, MD, Cairo, Egypt international meetings. Marie-Claude Jaurand, PhD, Paris, France Hedy Lee Kindler, MD, Chicago, United States Finally, members help iMig by being part of our Luciano Mutti, MD, PhD, Philadelphia, United States international community and showing their interest in Takashi Nakano, MD, PhD, Osaka, Japan understanding and ultimately preventing and defeating Anna Nowak, MD, PhD, Perth, Australia Mesothelioma. Isabelle Opitz, MD, Zurich, Switzerland Andreas Rimner, MD, New York, United States Bruce Robinson, MD, PhD, Perth, Australia Yoshitaka Sekido, MD, PhD, Aichi, Japan Walter Weder, MD, Zurich, Switzerland PROGRAMME BOOK 5 PROGRAMME BOOK 6 VIRTUAL PLATFORM Delegate Help Desk CME Certificate The Attendee Experience Team will assist delegates with An email with a link to the post conference evaluation form technical support and inquiries during the live broadcast will be sent to all registered delegates on May 9, 2021. days. For technical support and inquiries between April 29 Upon completing the evaluation form, the CME Certificate – May 2, 2021 and May 3 – 7, 2021, please email iMig2021- will be emailed on June 11, 2021. If not received, please [email protected]. The office is open Monday – check your spam/junk folder. The deadline to complete the Friday from 08:00 – 17:00 PDT (Pacific Daylight Time). post conference evaluation is May 24, 2021. Disclaimer: The organizers have made every attempt to ensure all information in Certificate of Attendance this publication is correct. The organizers take no responsibility for changes of the Programme or any loss that may occur as a result of changes on the Programme. An email with a link to the post conference evaluation form Some of the information provided in this publication has been provided by external sources. Although every effort has been made to ensure accuracy, currency, and will be sent to all registered delegates on May 9, 2021. reliability of the content, the organizers accept no responsibility in that regard. Upon completing the evaluation form, the Certificate of Attendance will be emailed. If not received, please check your spam/junk folder. The deadline to complete the post conference evaluation is May 24, 2021. PROGRAMME BOOK 7 PROGRAMME BOOK 8 ProgramME at a Glance Sunday, May 2, 2021 All times listed are in CEST (UTC +2) Time Pre-Conference Workshop: On-Demand The Future of Mesothelioma - What Might the Next Decade Look Like For Our Patients? Pre-Conference Workshop: 5:00 AM - 6:30 AM Mesothelioma in East Asia Pre-Conference Workshop 1:00 PM - 3:30 PM ITONF at iMig 2021 Nursing Workshop Friday, May 7, 2021 All times listed are in CEST (UTC +2) Time 12:30 PM - 1:00 PM Opening Session Plenary I: 1:00 PM - 2:30 PM Origins of Mesothelioma Parallel Mini-Symposia 03: Parallel Mini-Symposia 01: Parallel Mini-Symposia 02: 2:30 PM - 4:00 PM Local and Intrapleural Pathology Clinical Trials Therapies Saturday, May 8, 2021 All times listed are in CEST (UTC +2) Time Parallel Mini-Symposia 05: Parallel Mini-Symposia 06: Parallel Mini-Symposia 04: Cell Therapies and Nursing and Supportive Surgery Mesothelin Directed Care 12:30 AM - 2:00 AM Therapies Parallel Mini-Symposia 07: Recent Developments: Genetics and Biomarkers Plenary II: 2:00 AM - 3:30 AM Focus on the Patient 12:30 PM - 1:00 PM Morning Session I Plenary III: 1:00 PM - 2:30 PM Surgery – Individualising Care Appropriately Parallel Mini-Symposia Parallel Mini-Symposia 10: Parallel Mini-Symposia 09: 2:30 PM - 4:00 PM 08: Immunotherapy and Symptoms and Pleural Peritoneal Mesothelioma Checkpoint Blockade Management PROGRAMME BOOK 9 ProgramME at a Glance Sunday, May 9, 2021 All times listed are in CEST (UTC +2) Time Parallel Mini-Symposia 12: Parallel Mini-Symposia 11: Parallel Mini-Symposia 13: 12:30 AM - 2:00 AM Management Decisions in Biomarkers and Genetics Imaging Mesothelioma Plenary IV: 2:00 AM - 3:30 AM Immunotherapy - Checkpoint Blockade and Beyond 12:30 PM - 1:00 PM Morning Session II Plenary V: 1:00 PM - 2:30 PM Cutting Edge 2020 Parallel Mini-Symposia 15: Parallel Mini-Symposia 14: Parallel Mini-Symposia 16: 2:30 PM - 4:00 PM Epidemiology and Asbestos Biology and Novel Targets Biomarkers and Genetics II Control Monday, May 10, 2021 All times listed are in CEST (UTC +2) Time Plenary VI: 12:30 AM - 2:00 AM Towards Tomorrow 2:00 AM - 2:30 AM Closing Session PROGRAMME BOOK 10 scientific programme Sunday, May 2, 2021 All times listed are in CEST (UTC +2) Time PC01: Mesothelioma in East Asia 05:00 – 06:30 Chairs: Ken Takahashi, Asbestos Diseases Research Institute, Australia Takashi Kijima, Hyogo College of Medicine, Japan PC01.01: Keynote: Mesothelioma
Load more

Recommended publications
  • Critical Climate Change
    Telemorphosis Critical Climate Change Series Editors: Tom Cohen and Claire Colebrook The era of climate change involves the mutation of sys- tems beyond 20th century anthropomorphic models and has stood, until recently, outside representation or address. Understood in a broad and critical sense, climate change concerns material agencies that impact on biomass and energy, erased borders and microbial invention, geological and nanographic time, and extinction events. The possibil- ity of extinction has always been a latent figure in textual production and archives; but the current sense of deple- tion, decay, mutation and exhaustion calls for new modes of address, new styles of publishing and authoring, and new formats and speeds of distribution. As the pressures and re- alignments of this re-arrangement occur, so must the critical languages and conceptual templates, political premises and definitions of ‘life.’ There is a particular need to publish in timely fashion experimental monographs that redefine the boundaries of disciplinary fields, rhetorical invasions, the in- terface of conceptual and scientific languages, and geomor- phic and geopolitical interventions. Critical Climate Change is oriented, in this general manner, toward the epistemo- political mutations that correspond to the temporalities of terrestrial mutation. Telemorphosis Theory in the Era of Climate Change Volume 1 Edited by Tom Cohen OPEN HUMANITIES PRESS An imprint of MPublishing – University of Michigan Library, Ann Arbor 2012 First edition published by Open Humanities Press 2012 Freely available online at http://hdl.handle.net/2027/spo.10539563.0001.001 Copyright © 2012 Ton Cohen and the respective authors This is an open access book, licensed under Creative Commons By Attribution Share Alike license.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Biology Assessment Plan Spring 2019
    Biological Sciences Department 1 Biology Assessment Plan Spring 2019 Task: Revise the Biology Program Assessment plans with the goal of developing a sustainable continuous improvement plan. In order to revise the program assessment plan, we have been asked by the university assessment committee to revise our Students Learning Outcomes (SLOs) and Program Learning Outcomes (PLOs). Proposed revisions Approach: A large community of biology educators have converged on a set of core biological concepts with five core concepts that all biology majors should master by graduation, namely 1) evolution; 2) structure and function; 3) information flow, exchange, and storage; 4) pathways and transformations of energy and matter; and (5) systems (Vision and Change, AAAS, 2011). Aligning our student learning and program goals with Vision and Change (V&C) provides many advantages. For example, the V&C community has recently published a programmatic assessment to measure student understanding of vision and change core concepts across general biology programs (Couch et al. 2019). They have also carefully outlined student learning conceptual elements (see Appendix A). Using the proposed assessment will allow us to compare our student learning profiles to those of similar institutions across the country. Revised Student Learning Objectives SLO 1. Students will demonstrate an understanding of core concepts spanning scales from molecules to ecosystems, by analyzing biological scenarios and data from scientific studies. Students will correctly identify and explain the core biological concepts involved relative to: biological evolution, structure and function, information flow, exchange, and storage, the pathways and transformations of energy and matter, and biological systems. More detailed statements of the conceptual elements students need to master are presented in appendix A.
    [Show full text]
  • Ccnf (NM 007634) Mouse Tagged ORF Clone – MR210593 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR210593 Ccnf (NM_007634) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Ccnf (NM_007634) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Ccnf Synonyms: CycF; Fbxo1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Ccnf (NM_007634) Mouse Tagged ORF Clone – MR210593 ORF Nucleotide >MR210593 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGAGCGGCGGTGTGATCCATTGTAGGTGTGCCAAGTGTTTCTGTTATCCTACTAAACGAAGAATCA AAAGAAGACCCAGAAACTTAACCATCTTGAGTCTCCCAGAAGATGTACTCTTTCATATCCTGAAATGGCT TTCTGTTGGGGACATCCTTGCTGTCCGAGCTGTCCACTCCCACCTCAAGTACCTGGTGGACAACCATGCC AGTGTGTGGGCATCCGCCAGCTTCCAGGAGCTGTGGCCTTCTCCACAGAACCTGAAGCTCTTTGAAAGGG CTGCTGAAAAGGGAAATTTTGAAGCTGCTGTGAAGTTGGGGATTGCCTACCTCTACAATGAAGGCCTGTC TGTGTCAGATGAGGCCTGCGCAGAAGTGAACGGCTTGAAGGCCTCTCGCTTCTTCAGCATGGCTGAGAGA CTGAATACGGGTTCTGAGCCCTTCATTTGGCTCTTCATCCGCCCACCGTGGTCAGTGTCCGGAAGCTGCT GCAAGGCTGTGGTTCATGACAGCCTCCGAGCGGAGTGTCAGTTACAGAGAAGTCATAAAGCTTCCATACT ACACTGCTTGGGAAGGGTGCTAAATCTTTTTGAGGACGAAGAGAAAAGGAAGCAGGCGCGTAGCCTTTTG
    [Show full text]
  • NHSGGC Board Meeting Date of Meeting
    BOARD OFFICIAL NHS Greater Glasgow & Paper No. 20/40 Clyde Meeting: NHSGGC Board Meeting Date of Meeting: 25th August 2020 Purpose of Paper: For Noting Classification: Board Official Sponsoring Director: Medical Director and Nurse Director Clinical Governance Annual Report (including the Duty of Candour Report) 2019/2020 Recommendation The Board is asked to note the report, which has been approved for publication by the Clinical and Care Governance Committee. Purpose of Paper The Clinical Governance Annual Report provides a description of the key aspects clinical governance arrangements along with examples of improvement activities. The report contains the Duty of Candour Report, whose publication is legal requirement. The report is made publicly available via the Board’s website. Key Issues to be considered The report provides assurance of the maintenance of the clinical governance arrangements along with our Duty of Candour obligations. The report development and publication is being maintained but the process was compromised by the clinical service focus the pandemic response during the normal reporting period over April and May. 1 BOARD OFFICIAL Any Patient Safety /Patient Experience Issues Data on patient safety and experience is included in the report with assurance of learning and improvements Any Financial Implications from this Paper None specified Any Staffing Implications from this Paper None Specified Any Equality Implications from this Paper None Specified Any Health Inequalities Implications from this Paper None Specified Has a Risk Assessment been carried out for this issue? If yes, please detail the outcome. No Highlight the Corporate Plan priorities to which your paper relates Author – Head of Clinical Governance Date – August 2020 2 BOARD OFFICIAL Clinical Governance Annual Report 2019-2020 NHS GREATER GLASGOW & CLYDE Custodian: Head of Clinical Governance Issue date: July 2020 Status: Draft Version: Draft 3.0 1 BOARD OFFICIAL Section Title Page Front Page 1 Table of Contents 2 1.
    [Show full text]
  • Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells
    Cancer Therapeutics, Targets, and Chemical Biology Research Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells Mary Zhang1, Aarti Mathur1, Yuwei Zhang1, Sichuan Xi1, Scott Atay1, Julie A. Hong1, Nicole Datrice1, Trevor Upham1, Clinton D. Kemp1, R. Taylor Ripley1, Gordon Wiegand2, Itzak Avital2, Patricia Fetsch3, Haresh Mani6, Daniel Zlott4, Robert Robey5, Susan E. Bates5, Xinmin Li7, Mahadev Rao1, and David S. Schrump1 Abstract Cigarette smoking at diagnosis or during therapy correlates with poor outcome in patients with lung and esophageal cancers, yet the underlying mechanisms remain unknown. In this study, we observed that exposure of esophageal cancer cells to cigarette smoke condensate (CSC) led to upregulation of the xenobiotic pump ABCG2, which is expressed in cancer stem cells and confers treatment resistance in lung and esophageal carcinomas. Furthermore, CSC increased the side population of lung cancer cells containing cancer stem cells. Upregulation of ABCG2 coincided with increased occupancy of aryl hydrocarbon receptor, Sp1, and Nrf2 within the ABCG2 promoter, and deletion of xenobiotic response elements and/or Sp1 sites markedly attenuated ABCG2 induction. Under conditions potentially achievable in clinical settings, mithramycin diminished basal as well as CSC- mediated increases in AhR, Sp1, and Nrf2 levels within the ABCG2 promoter, markedly downregulated ABCG2, and inhibited proliferation and tumorigenicity of lung and esophageal cancer cells. Microarray analyses revealed that mithramycin targeted multiple stem cell–related pathways in vitro and in vivo. Collectively, our findings provide a potential mechanistic link between smoking status and outcome of patients with lung and esophageal cancers, and support clinical use of mithramycin for repressing ABCG2 and inhibiting stem cell signaling in thoracic malignancies.
    [Show full text]
  • The Tumor Suppressor Notch Inhibits Head and Neck Squamous Cell
    The Texas Medical Center Library DigitalCommons@TMC The University of Texas MD Anderson Cancer Center UTHealth Graduate School of The University of Texas MD Anderson Cancer Biomedical Sciences Dissertations and Theses Center UTHealth Graduate School of (Open Access) Biomedical Sciences 12-2015 THE TUMOR SUPPRESSOR NOTCH INHIBITS HEAD AND NECK SQUAMOUS CELL CARCINOMA (HNSCC) TUMOR GROWTH AND PROGRESSION BY MODULATING PROTO-ONCOGENES AXL AND CTNNAL1 (α-CATULIN) Shhyam Moorthy Shhyam Moorthy Follow this and additional works at: https://digitalcommons.library.tmc.edu/utgsbs_dissertations Part of the Biochemistry, Biophysics, and Structural Biology Commons, Cancer Biology Commons, Cell Biology Commons, and the Medicine and Health Sciences Commons Recommended Citation Moorthy, Shhyam and Moorthy, Shhyam, "THE TUMOR SUPPRESSOR NOTCH INHIBITS HEAD AND NECK SQUAMOUS CELL CARCINOMA (HNSCC) TUMOR GROWTH AND PROGRESSION BY MODULATING PROTO-ONCOGENES AXL AND CTNNAL1 (α-CATULIN)" (2015). The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access). 638. https://digitalcommons.library.tmc.edu/utgsbs_dissertations/638 This Dissertation (PhD) is brought to you for free and open access by the The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences at DigitalCommons@TMC. It has been accepted for inclusion in The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access) by an authorized administrator of DigitalCommons@TMC. For more information, please contact [email protected]. THE TUMOR SUPPRESSOR NOTCH INHIBITS HEAD AND NECK SQUAMOUS CELL CARCINOMA (HNSCC) TUMOR GROWTH AND PROGRESSION BY MODULATING PROTO-ONCOGENES AXL AND CTNNAL1 (α-CATULIN) by Shhyam Moorthy, B.S.
    [Show full text]
  • Mammalian Atypical E2fs Link Endocycle Control to Cancer
    Mammalian Atypical E2Fs Link Endocycle Control to Cancer DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Hui-Zi Chen Graduate Program in Integrated Biomedical Science Program The Ohio State University 2011 Dissertation Committee: Gustavo Leone, PhD, Advisor Michael Ostrowski, PhD Clay Marsh, MD Tsonwin Hai, PhD Kathryn Wikenheiser-Brokamp, MD PhD Copyright by Hui-Zi Chen 2011 Abstract The endocycle is a developmentally programmed variant cell cycle consisting of successive S (DNA synthesis) and G (Gap) phases without an intervening M phase or cytokinesis. As a consequence of the regulated “decoupling” of DNA replication and mitosis, which are two central processes of the traditional cell division program, endocycling cells acquire highly polyploid genomes after having undergone multiple rounds of whole genome reduplication. Although essential for metazoan development, relatively little is known about the regulation of endocycle or its physiologic role in higher vertebrates such as the mammal. A substantial body of work in the model organism Drosophila melanogaster has demonstrated an important function for dE2Fs in the control of endocycle. Genetic studies showed that both endocycle initiation and progression is severely disrupted by altering the expression of the fly E2F activator (dE2F1) or repressor (dE2F2). In mammals, the E2F family is comprised of nine structurally related proteins, encoded by eight distinct genes, that can be classified into transcriptional activators (E2f1, E2f2, E2f3a and E2f3b) or repressors (E2f4, E2f5, E2f6, E2f7 and E2f8). The repressor subclass may then be further divided into canonical (E2f4, E2f5 and E2f6) or atypical E2fs (E2f7 and E2f8).
    [Show full text]
  • Cyclin F-Chk1 Synthetic Lethality Mediated by E2F1 Degradation
    bioRxiv preprint doi: https://doi.org/10.1101/509810; this version posted January 2, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Cyclin F-Chk1 synthetic lethality mediated by E2F1 degradation Kamila Burdova1, Hongbin Yang1, Roberta Faedda1, Samuel Hume1, Daniel Ebner2, Benedikt M Kessler2, Iolanda Vendrell1,2, David H Drewry3, Carrow I Wells3, Stephanie B Hatch2, Vincenzo D’Angiolella1* 1Medical Research Council Institute for Radiation Oncology, Department of Oncology, University of Oxford, Old Road Campus Research Building, Roosevelt Drive, Oxford OX3 7DQ, UK 2Target Discovery Institute, Nuffield Department of Medicine, University of Oxford, Old Road Campus, Roosevelt Drive, Oxford OX3 7FZ, UK 3Structural Genomics Consortium, UNC Eshelman School of Pharmacy, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States of America * Corresponding Author: [email protected] Summary Cyclins are central engines of cell cycle progression when partnered with Cyclin Dependent Kinases (CDKs). Among the different cyclins controlling cell cycle progression, cyclin F does not partner with a CDK, but forms an E3 ubiquitin ligase, assembling through the F-box domain, an Skp1-Cul1-F-box (SCF) module. Although multiple substrates of cyclin F have been identified the vulnerabilities of cells lacking cyclin F are not known. Thus, we assessed viability of cells lacking cyclin F upon challenging cells with more than 200 kinase inhibitors. The screen revealed a striking synthetic lethality between Chk1 inhibition and cyclin F loss.
    [Show full text]
  • Nursing and the Development of Neonatal Intensive Care Units in the United States, 1955-1982
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2015 "We Were the Eyes and Ears...": Nursing and the Development of Neonatal intensive Care Units in the United States, 1955-1982. Briana Ralston University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the History Commons, and the Nursing Commons Recommended Citation Ralston, Briana, ""We Were the Eyes and Ears...": Nursing and the Development of Neonatal intensive Care Units in the United States, 1955-1982." (2015). Publicly Accessible Penn Dissertations. 1122. https://repository.upenn.edu/edissertations/1122 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1122 For more information, please contact [email protected]. "We Were the Eyes and Ears...": Nursing and the Development of Neonatal intensive Care Units in the United States, 1955-1982. Abstract ABSTRACT "WE WERE THE EYES AND EARS...": NURSING AND THE DEVELOPMENT OF NEONATAL INTENSIVE CARE UNITS IN THE UNITED STATES, 1955-1982. Briana Ralston, MS, RN Julie Fairman, PhD, RN, FAAN In the 1960s and 1970s, neonatal intensive care units (NICUs) became the standard of care for critically ill newborns in hospitals across the United States. Though work has been done to examine how nurses participated in the development of ICU's for adult populations, scholarship related to the formation of NICUs is sparse. Using historical methodology to examine hospital archival data, oral history interviews, and scholarly literature, this work examines the roles nurses played in the development of NICUs as technological systems between 1955 and 1982 in the United States.
    [Show full text]
  • Notes and Data Sources
    Notes and Data Sources Chapter 1 Page 10 Exercise 1.1: From “About six-in-ten Americans support marijuana legal­ Page 3 Data on climate change due to human activ­ ization”; available online at http://www ity is from “Public and scientists’ views on .pewresearch.org/fact-tank/2018/01/05 science and society,” Pew Research Cen­ /americans-support-marijuana-legalization/. ter report by Cary Funk and Lee Rainie, Page 11 The estimates of the census overcount and January 29, 2015; available online at https:// undercount are available online at http:// www.pewresearch.org/science/2015/01/29 www.census.gov/newsroom/releases /chapter-3-attitudes-and-beliefs-on /archives/2010_census/cb12-95.html. -science-and-technology-topics/. This survey contains data on the Page 15 Exercise 1.3: This problem is based on opinions about several other issues of information in the article, “The racial con­ U.S. adults and AAAS scientists. fidence gap in police performance”; avail­ able online at http://www.pewsocialtrends Page 3 The MLive.com poll is described in the .org/2016/09/29/the-racial-confidence-gap article “Take our online poll: Should Mich­ -in-police-performance/. igan legalize marijuana”; available online at http://www.mlive.com/news/kalamazoo Page 15 Exercise 1.5: Richard Westfall, Murray /index.ssf/2014/02/take_our_poll_should Millar, and Mandy Walsh, “Effects of _michigan.html. instructor attractiveness on learning,” Journal of General Psychology, 143 (2016), Page 5 Example 1 is suggested by Maxine pp. 161–171. Pfannkuch and Chris J. Wild, “Statistical thinking and statistical practice: themes Page 17 Exercise 1.12: Jeffrey M.
    [Show full text]
  • Copyright 2017 Laura Atkins
    Copyright 2017 Laura Atkins ADAPTABLE LIVES: AGENCY AND ACCOUNTABILITY IN A CANCER CLUSTER TOWN BY LAURA ATKINS DISSERTATION Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Sociology in the Graduate College of the University of Illinois at Urbana-Champaign, 2017 Urbana, Illinois Doctoral Committee: Professor Moon-Kie Jung, Chair Professor Assata Zerai Professor Lisa Marie Cacho Professor Norman K. Denzin ABSTRACT This dissertation provides an ethnographic account of the experiences of residents living within the cancer cluster town of Clyde, Ohio, where over 50 children have been diagnosed with or have died of cancers of the brain and central nervous system since the mid-1990s. My entry into the field coincided with the filing of a lawsuit against the town’s largest employer, a Whirlpool Corporation plant, after the discovery of nine feet of toxic PCB sludge at a former community recreational park built by the company. Drawing on in-depth interviews, archival documents, and government reports, I examine systems of power at work within the community that hamper a collective sense of community subpolitics. Using a grounded theoretical approach to analysis informed by risk theory, I discovered that community-level responses to risk echo national logics that promote the concepts of deterrence and avoidance of harm as matters of individual preventive choice. Within a cultural context where efforts towards pinpointing the toxins responsible for the elevated cancer rates in Clyde have failed and there exists an imperative for self-protection that is impossible to achieve, residents experience serious psychosocial and practical conflicts as they adapt to the impact of cancer on their families.
    [Show full text]