SERINE/THREONINE PHOSPHATASES: ROLE IN SPERMATOGENESIS AND
SPERM FUNCTION
A dissertation submitted
to Kent State University in partial
fulfillment of the requirements for the
degree of Doctor of Philosophy
By
Tejasvi Dudiki
December, 2014
© Copyright
All rights reserved
Except for previously published materials
Dissertation written by
Tejasvi Dudiki
M.S., Osmania University, Hyderabad, India, 2008
B.S., Nizam College, Osmania University, Hyderabad, India, 2006
Approved by
Dr. Srinivasan Vijayaraghavan, Chair, Doctoral Dissertation Committee
Dr. Douglas W. Kline, Member, Doctoral Dissertation Committee
Dr. Wen- Hai Chou, Member, Doctoral Dissertation Committee
Dr. Gary Koski, Member, Doctoral Dissertation Committee
Dr. Andrea L. Case, Graduate Faculty Representative
Accepted by
Dr. Eric Mintz, Chair, Department of Biomedical Sciences
Dr. James L. Blank, Dean, College of Arts and Sciences
ii
TABLE OF CONTENTS
List of figures…………………………………………………………………………...... iv
List of tables…………………………………………………………………………...... ix
Acknowledgements……………………………………………………………………...... xii
1. Abstract……………………………………………………………………………...... 1
2. Introduction……………………………………………………………………………...... 3
2.1 Testis………………………………………………………………………………3
2.2 Spermatogenesis…………………………………………………………………..4
2.3 Spermatozoon structure…………………………………………………...………7
2.4 Epididymal maturation of spermatozoa and initiation of sperm motility….…….13
2.5 Serine threonine protein phosphatases…………………………………………...19
2.6 Regulation of gene expression during spermatogenesis…………………………28
3. Materials and Methods……………………………………………………...... 44
4. Aim-I: Identification of PP2A, determination of its biochemical modulations and its role
in sperm maturation.……………….……………………………….…………....………57
4.1 Background and Rationale……………………………………..……………….57
4.2 Results for Aim I (A)……………………………...…………………………….59
4.3 Results for Aim I (B)……...……………………………………………….……74
4.4 Discussion………………………………………………………………………87
iii
5. Aim-II: Can PP1 substitute PP1 in spermatogenesis and sperm function if expressed
in germ cells?...... 93
5.1 Background and Rationale……………………………………………………….93
5.2 Results for Aim II………………………………………………………………102
5.3 Discussion………………………………………………………………………160
6. Conclusion..………………………………………………………………………..…..169
7. Future perspectives…………………………………………………………………….170
8. Bibliography……………………………………………………………………………174
iv
LIST OF FIGURES
Figure 2.1. Sequential stages in the process of spermatogenesis………………...……………….5
Figure 2.2. Sperm structure……………………………………………………………………….7
Figure 2.3. Features of sperm head…………………………………………………………...…10
Figure 2.4. Features of sperm tail……………………………………………………………….12
Figure 2.5. Regions of the epididymis……………….…………………………….……………15
Figure 2.6. Classification of serine/threonine phosphatases………………………………...... 20
Figure 2.7. Conservation among PP1 catalytic subunits……………………………….……..…23
Figure 2.8. Hormonal control of spermatogenesis ………………………………….…………..30
Figure 2.9. Intrinsic regulators of spermatogenesis……………………………………………..31
Figure 2.10. Comparison of alternately spliced (AS) genes across various tissues……………..37
Figure 4.1. Anti-PP2A-C antibody analysis by western blot……………………………………63
Figure 4.2. Immunoprecipitation of PP2A with purified Anti-PP2A antibody…………….…..64
Figure 4.3. Microcystin pull down of PP2A…………………………………………………….64
Figure 4.4. Detection of PP2A in bovine sperm………………….……………………..………65
Figure 4.5. Methylation and tyrosine phosphorylation status of sperm PP2A………………….67
v
Figure 4.6. Microcystin pulldown of sperm PP2A………………………………………….…..68
Figure 4.7. Demethylation of PP2A by alkali treatment……………………………………...…70
Figure 4.8. Phosphatase activity of PP2A……………………………………………………….71
Figure 4.9. PME1 and LCMT1 in sperm………………………………………………………..73
Figure 4.10. Possible mechanism for regulation of PP2A methylation in sperm…………..…...75
Figure 4.11. In vivo demethylation sperm PP2A………………………………. ………....……76
Figure 4.12. Timecourse demethylation of PP2A by L-homocysteine and adenosine treatment of sperm………………………………………………………………………………………..……77
Figure 4.13. Progressive demethylation of PP2A by 5nM OA treatment of bovine caudal sperm……………………………………………………………………………………………..78
Figure 4.14. Computer assisted motility analysis of sperm……………………………………..81
Figure 4.15. Catalytic activity of PP2A following its demethylation by L-homocysteine and adenosine treatment……………………………………………………………………………...82
Figure 4.16. Demethylation of PP2A in Distal caput sperm with L-homocysteine and adenosine…………………………………………………………………………………………83
Figure 4.17. Demethylation of PP2A in hyperactivation induced sperm……………………….84
vi
Figure 4.18. Western blot to detect tyrosine phosphorylated proteins in 1mM L-homocysteine and adenosine or 5nM OA treated sperm…………………………………….………………….85
Figure 4.19. Serine phosphorylation of GSK3α/β by treatment that results in demethylation of
PP2A…………………………………………………………………………………………..…86
Figure 4.20. Proposed model for PP2A regulation of PP1…………………………………...92
Figure 5.1. Schematic of generation of the two PP1γ isoforms…………………………………94
Figure 5.2. Developmental expression of PP1γ1 and PP1γ2 mRNA……………………………97
Figure 5.3. Design of PP1γ1 Rescue constructs…………………………………………………99
Figure 5.4. Breeding scheme of transgenic mouse lines…………………………...………….101
Figure 5.5. Coomassie stained SDS PAGE of expression and purification of His-PP1 and His-
PP1…………………………………………………………………………...………………103
Figure 5.6. Western blot analysis for quantification of PP1 in testis………………………..104
Figure 5.7. Western blot analysis for quantification of PP1 in mouse sperm……………….105
Figure 5.8. Western blot comparing PP1 and its interacting proteins in wild type (+/+) and
Ppp1cc +/- testis………………………………………………………………………………..107
Figure 5.9. PP1 and PP1 expression ratio in testis of Ppp1cc +/+ and Ppp1cc +/- mice…108
Figure 5.10. Western blot of PP1 levels in Ppp1cc +/- and Ppp1cc +/- brain…………………109
vii
Figure 5.11. Western blot comparing Ppp1cc +/+ and Ppp1cc +/- sperm……………………110
Figure 5.12. Western blot analysis of supernatant and pellet fractions of sperm……...……...112
Figure 5.13. PP1 in Rescue I testis and sperm……………………………………………....114
Figure 5.14. Rescue I sperm DIC………………………………………………………………115
Figure 5.15. Western blot analysis for PP1 levels in Rescue II………………………………..116
Figure 5.16. Rescue II sperm morphology………………………………………………… ….117
Figure 5.17. Western blot analysis for quantification of PP1in Rescue testis…………….…118
Figure 5.18. Western blot analysis of Rescue testis and sperm…………………………...…...120
Figure 5.19. Predicted miRNA target sequences of PP1γ1 mRNA……………………………123
Figure 5.20. Conservation of miR449 and miR34 target sequence……………………………125
Figure 5.21. QPCR expression profile of miR449 and miR34……………………………...…128
Figure 5.22. Design of PP1γ1 Rescue IV construct……………………………………………129
Figure 5.23. Western blot analyses of Rescue IV testes……………………………………….132
Figure 5.24. Comparison of PP1γ1 mRNA and protein levels in Rescue lines…………...…...134
Figure 5.25. Western blot analysis of immuno precipitation………………………………..…135
Figure 5.26. Phosphatase activity of PP1 in testis…………………………………………..…137
viii
Figure 5.27. PP1γ levels in sperm…………………………………………………………...…141
Figure 5.28. Sperm DIC……………………………………………………………………..…143
Figure 5.29. Immunocytochemistry of sperm……………………………………………….…145
Figure 5.30. Rescue IV sperm motility parameters……………………………………………148
Figure 5.31. Flagellar beat wave form of Rescue IV mice………………………………..…...149
Figure 5.32. Comparision of phoshatase activity in sperm among Ppp1cc +/- and PP1γ
Rescues…………………………………………………………………………………….…...151
Figure 5.33. Western blot analyses of Tg; +/+ and Tg; +/- mice testis...……………………..153
Figure 5.34. PP1γ levels in sperm of Tg; +/- mice ……...…...………………………………..154
Figure 5.35. Phosphatase activity in sperm………………………..………...... 155
Figure 5.36. Sperm motility parameters………………………………………....…………….158
Figure 5.37. Flagellar beat wave form of sperm…………………………………………….…159
Figure 5.38. Design for generating PP1γ1 Knock-in mouse model……………………………172
ix
List of Tables
Table 2.1. Protein phosphatase 1 regulatory subunits in mammals……………………………..25
Table 2.2. Protein phosphatase 1 inhibitor proteins in mammals……………………………….26
Table 2.3. List of testis specific genes…………………………………………………………..33
Table 2.4. List of miRNA in mammals………………………………………………………….40
Table 2.5. Comparison of properties of small non-coding RNA……………………………….42
Table 3.1. List of primary antibodies used for western blot analysis……………………………51
Table 3.2. List of primers used for genotyping PCR and RT-qPCR…………………………….55
Table 4.1. Motility analysis of sperm……………………………………………………..……..80
Table 5.1. Levels of PP1 in testis……………………………………………………………104
Table 5.2. Levels of PP1 in sperm…………………………………………………………...106
Table 5.3. Comparitive phenotypic values of Ppp1cc +/+ and Ppp1cc +/- mice……………..108
Table 5.4. Phenotypes of PP1γ1 Rescue mice lines………………………...………………….138
Table 5.5. Fertility results of PP1γ1 Rescue mice lines…………………………………..……139
Table 5.6. Quantitated levels of PP1γ1 incorporated in Rescue sperm……...…………………141
Table 5.7. Phenotypes of Tg; +/- and Tg; +/+ mice ………………………………………….156
x
Table 5.8. Fertility results of Tg; +/- and Tg; +/+ mice lines……..…………..…………….156
xi
Acknowledgements
My journey of becoming a doctorate is not complete without expressing my sincere gratitude to everyone who has been a part of it and made it a little easier and helped me reach my goals. First and foremost I want to thank my mentor and PhD advisor Dr. Srinivasan Vijayaraghavan for providing me with all the help, support, critique, and ideas to perform my research. He has always been there when I needed him and provided me with all the resources necessary. His excellent knowledge in science has challenged me and helped me grow as a researcher. He has been a source of inspiration for me. I cannot thank you enough for everything and will always be indebted to you for your support.
I am grateful to Dr. Douglas Kline for his constant inputs helping to me improvise my research and my writing skills. I am also thankful to my other committee members Dr Gary Koski, Dr.
Wen-Hai Chou and Dr. Andrea Case for providing me with your invaluable time, help and support. I am grateful to Dr. Yijing Chen for providing me her excellent scientific ideas and inputs helping me to improvise my knowledge and projects.
I thank my present and past lab members Dr. Pawan Puri, Dr. Nilam Sinha, Dr. David Soler, Dr.
Shandilya Ramdas, Dr. Suraj Kadunganattil, Sabyasachi Sen, Nidaa J Awaja, Rahul
Bhattacharya, Suranjana Goswami, and Shawn Davis for their help and for creating a friendly stress free working environment. I thank Dr. Santanu De for being a wonderful friend and for providing me with his guidance, support and help in and outside the lab.
xii
I am grateful to Ms. Donna Warner and Ms. Judith Wearden for providing me with guidelines and helpful information required in fulfilling my degree successfully. I also thank Jennifer Kipp,
Robin Wise for helping me whenever I have reached out to them.
I am thankful to my parents Dr. Venkateswara Rao Dudiki and Usha Rani Dudiki for carving a nice pathway for my future and providing me with all the necessary support to pursue my goals. I owe every accomplishment to them. I can never thank you enough for all that you have done for me.
Finally I would like to give very special thanks to my fiancée Sromona for always being there for me with her love, support, encouragement and friendship.
xiii
1. Abstract
In mammals, sperm attain motility and the ability to fertilize eggs during their passage through the epididymis. Changes in motility characteristics, called hyperactivation, occur in the female reproductive tract. Serine/threonine protein phosphorylation controlled by protein kinases and protein phosphatases has been identified as an important mechanism involved in sperm maturation and function including motility. This study focuses on the serine/threonine phosphatases present in mammalian spermatozoa, PP2A and PP12. The first part of this study confirms the presence of PP2A in sperm and shows that it undergoes marked changes in methylation (Leu 309), tyrosine phosphorylation (Tyr 307) and catalytic activity during epididymal sperm maturation. Catalytic activity of PP2A declined as PP2A was demethylated during epididymal sperm maturation. Further, inhibition/demethylation of PP2A in caudal sperm resulted in increased phosphorylation of glycogen synthase kinase-3 and sperm motility parameters resembling hyperactivation. The results of this study show for the first time that changes in PP2A activity due to methylation and tyrosine phosphorylation occur in sperm and that these changes may play an important role in the regulation of sperm function.
The second part of the study focuses on unraveling the significance of the testis specific PP1γ2 in spermatogenesis and sperm function. PP1γ1 and PP1γ2 are alternately spliced transcripts of the same gene Ppp1cc and are identical except at their extreme C-termini. While PP1γ1 is ubiquitous in somatic cells, PP1γ2 is expressed exclusively in male germ cells. Ppp1cc knockout male mice
(-/-) are sterile due to severely impaired sperm morphogenesis. Fertility can be restored in
Ppp1cc -/- mice by high levels of transgenic PP1γ2 expression in germ cells of testis. Similarly, we wanted to determine if PP1γ1 is capable of restoring sperm morphogenesis and sperm
1
function in Ppp1cc -/- mice. We generated four different transgenic Rescue mice lines. The first three transgenic lines were generated using cDNA of PP1γ1 mRNA including the initial sequence or entire intron 7. Lack of fertility in these three lines was attributed to low levels of transgenic PP1γ1 in testis probably due to instability of the PP1γ1 mRNA containing intron 7 in testis. Testis expression of PP1γ1 occurred at significant levels only when the transgene lacked the intron7. Levels of the PP1γ1 transgene in this line (Rescue IV) were comparable to PP1γ2 levels in Ppp1cc +/- mice testes. Sperm morphogenesis was restored with the PP1γ1 transgene in
Ppp1cc -/- mice but small percentage of these males remained infertile due to altered sperm motility. The findings of this study suggests that despite the ability of PP1γ1 to support sperm morphogenesis, it is detrimental for male fertility and hence excluded in differentiating spermatogenic cells by alternate splicing and miRNA mediated instability of its transcript.
2
2. Introduction
2.1 Testis
Testis, the male gonad in animals serves to produce sperm and androgens. It is covered by a tough membranous structure called the tunica albuginea that encloses finely coiled tubular structures, the seminiferous tubules. These tubules contain layers of germ cells that are responsible for producing sperm/spermatozoa by a process known as spermatogenesis. The spermatozoa thus produced travel through the rete testis, efferent ducts and finally into the epididymis to mature. The mature spermatozoa exit the epididymis via the vas deferens to be ejaculated. The major cell types in the testis include the Leydig cells, Sertoli cells, germ cells and peritubular myoid cells. The Leydig cells are located between the seminiferous tubules and in adults they are responsible for production of androgens such as testosterone, essential for male sexual development and spermatogenesis [1]. Peritubular myoid cells surround the seminiferous tubules to provide structural support to the tubules and transport spermatozoa within the tubules
[2]. The Sertoli cells and germ cells are contained in the seminiferous tubules with the germ cells responsible for production of spermatozoa. Sertoli cells also referred to as nurse cells of testes surround and nourish the developing germ cells during spermatogenesis. Sertoli cells also serve as phagocytes by engulfing the residual cytoplasm during spermiation. Adjacent Sertoli cells form tight junctions known as blood-testis barrier that prevents large molecules such as antibodies in blood from entering the lumen of seminiferous tubule thereby preventing auto immune reaction [3,4].
3
2.2 Spermatogenesis
Reproductive development in males initiates with spermatogenesis, the transformation of primordial germ cells into spermatozoa. Unlike the female gamete generation occurring entirely before birth, maturation of the germ cells in males takes place in a cyclical manner at the onset of puberty. At puberty the spermatogonia produce bone morphogenetic protein 8B (BMP8B) that is thought to stimulate differentiation of germ cells (spermatogenesis). Disruption of BMP8B in mice resulted in male sterility due to lack of spermatogenesis [5]. Spermatogenesis persists for the rest of the male reproductive life along with continued ejaculation of the sex cells in semen.
Stages of Spermatogenesis
The process of spermatogenesis can be categorized into three broad phases involving generation of the male gametes in different stages of development (Figure 2.1):
A. Proliferation phase: The primordial germ cells on reaching the gonad divide into type A spermatogonia that are harbored in the basal lamina of the tubular epithelium. The type A spermatogonia are the undifferentiated stem cells that undergo division to produce intermediate cells that further differentiate into type B spermatogonia. In rodents, four different phases have been identified in the type A spermatogonia, A1-A4. The type A1 spermatogonia sequentially divide to produce types A2, A3 and A4 spermatogonia. The population of types A1-A4 cells was observed to remain constant in testis of rat indicating they are stem cell renewing population.
The type A4 can undergo three fates: i) differentiate into intermediate cells, ii) produce more of type A1 for renewing the stem cell population, iii) undergo apoptosis [6]. The molecular
4
mechanisms that commit the type A spermatogonia to differentiation are not yet known. The intermediate cells undergo one mitotic division to produce type B spermatogonia. These type B spermatogonia undergo one last mitotic division to produce primary spermatocytes that eventually enters meiosis. During all these divisions, the cells never go through cytokinesis and all the cells remain connected with each other by cytoplasmic bridges forming a syncytium [7,8].
Figure 2.1. Sequential stages in the process of spermatogenesis. Representation of cross section of a seminiferous tubule with germ cells at all stages of spermatogenesis starting with spermatogium (at the top) to the differentiated spermatozoa released into the lumen (bottom).
5
B. Meiotic phase: The largest cells in the spermatogenic lineage are primary spermatocytes situated about midway in the epithelium of seminiferous tubules. Division of each primary spermatocyte generates two secondary spermatocytes by meiosis I, each of which is further divided by meiosis II into two haploid spermatids. Meiosis is a prolonged process, with prophase of the first meiotic division continuing for three weeks. The haploid spermatids still remain connected by syncytium allowing for diffusion of gene products between neighboring cells [8,9].
C. Differentiation phase: During this phase, also termed ‘spermiogenesis’, each spermatid matures into a spermatozoon (plural: spermatozoa). The morphological changes taking place during this stage can be observed in sections of different seminiferous tubules. The stage is characterized by several changes in the cells, outlined below: i. Production of the acrosome, a cap-like structure covering the head of the developing sperm cell. The acrosome contains hydrolytic enzymes to enable union of sperm and an egg during fertilization. ii. Chromatin condensation occurring in the nucleus by replacement of histones with sperm specific protamines. iii. Arrangement of mitochondria in a two stranded helical structure called ‘nebenkern’ along the middle piece to supply the energy for movement of the sperm. iv. Growth of the tail, and removal of redundant cytoplasmic material as a residual body that is phagocytosed by the Sertoli cells [9].
6
2.3 Spermatozoon structure
The spermatozoon is a unique and highly specialized cell designed for the purpose of transporting a haploid set of male chromosomes through the female reproductive tract to the egg.
It occurs in various shapes and sizes. The cell can be divided into two main segments: head and tail/flagellum held together by the connecting piece (Figure 2.2C).
Figure 2.2. Sperm structure. (A, B) DIC image of mouse and bovine sperm used in this study, showing falciform (hook) and spatulate (paddle) shaped head respectively. (C) Schematic
7
showing the various structures of sperm broadly divided into two regions, head and tail. The head consists of nucleus and acrosome surrounded by plasma membrane. The tail, responsible for motility is divided into mid piece, principal piece and end piece.
A. Spermatozoon head
The sperm head can be found in various shapes across the animal species. For example bovine, human and rabbit sperm have spatulate (paddle shaped) head, rodents have falciform
(hook shaped) head and chicken have spindle shaped head. Even with different shapes all sperm share the same basic architecture. The head consists of the nucleus, acrosome, cytoskeletal elements and cytoplasm enclosed by a plasma membrane (Figure 2.3). The cytoskeletal components of head are responsible for the shape of the head and penetration of egg [9]. The major cytoskeletal elements in sperm head include actin, tubulin and spectrin. Several of the cytoskeletal proteins have been implicated with acrosome reaction and capacitation but their roles are still poorly understood [10]. The nucleus holds a haploid set of chromosomes highly condensed by sperm specific nuclear proteins called protamines. The protamine transcripts are synthesized in the round spermatid stage but their translation is regulated by existing as untranslated RNP until they enter elongating spermatid stage [11]. At this point the histones are shed and replaced by protamines. They form covalent disulphide links with the DNA thereby stabilizing it and packaging it 10 fold more compactly than histones. This aids in the formation of compact size and shape of the sperm head while also protecting the genome from physical and chemical shearing during maturation and fertilization. It has been shown that a small percentage of DNA (~15% in humans and 1% in mouse) remains associated with histones. It is hypothesized that these regions of DNA harbor genes required for early development [12,13]. The nucleus is enclosed by a nuclear envelope with significantly fewer nuclear pores compared to somatic cells.
8
Another unique structure of sperm cell is the acrosome. It is a membranous sac derived from the Golgi complex and is situated as a cap in the anterior of the sperm head over the nucleus. Acrosome contains enzymes necessary for penetration of egg during fertilization. It has two segments, the anterior acrosome (cap) and the posterior acrosome (equatorial segment).
During fertilization the acrosome undergoes acrosome reaction that involves fusion of the outer acrosomal membrane with the sperm plasma membrane, thereby releasing the acrosomal enzymes to penetrate the zona pellucida of egg. Some of the notable acrosomal enzymes include acid hydrolases (found in lysosomes), acrosin, acrogranin, zonadhesin, acid and alkaline phosphatase, hyaluronidase and other sperm specific enzymes [14,15]. Acrosin, an endoprotease has been well studied and is known to be involved in proteolysis of zona pellucida. However, disruption of acrosin in mouse models showed only a delay in the fertilization process after insemination but the fertility was unaffected [16]. Other studies have shown that acrosin also accelerates the dispersal of arosomal proteins during acrosome reaction to penetrate the egg [17].
The acrosome also contains non-enzymatic components whose roles are poorly understood. The final structure associated with head is the posterior ring also called the nuclear ring is located at the junction of the head and connecting piece forming a tight seal between the cytoplasmic compartments of head and tail.
9
Figure 2.3. Features of sperm head. A spatulate (left) and falciform (right) sperm head showing acrosome at the anterior, equatorial segment in the middle and post acrosomal region towards the base of the head. A posterior ring is present at the region connecting head to the tail. Adapted from [9].
B. The tail/flagellum
The tail region extends beyond the connecting piece and is sub-divided into three segments in mammals: middle piece, principal piece and end piece (Figure 2.2). The structural components of the flagellum include axoneme, outer dense fibers, fibrous sheath and mitochondrial sheath. The axoneme (axial filament) extends throughout the length of the flagellum and is structurally similar to the cilia or flagella seen in other cell types. It has the
“9+2” arrangement of the microtubules, two central and nine outer doublet. The outer doublet
10
consists of two microtubules A and B. The B microtubule is ‘C’ shaped and is attached onto the
A microtubule (see Figure 2.4). Two dyenin arms (outer and inner) extend from the A tubule toward the B tubule of the adjacent doublet. Dyenin proteins utilize ATP to generate sliding force between adjacent microtubules for flagellar movement. Radial spikes arise from the outer microtubule doublet extending toward the central pair microtubules and together they regulate dyenin activity and flagellar movement. The microtubules are composed of α-tubulin, β-tubulin and tektins. Tektins are thought to play a role in assembly, stability and function of microtubules
[18].
The outer dense fibers (ODFs) are cytoskeletal elements that are characteristic of sperm flagellum. Nine outer dense fibers surround the axoneme in a “9 + (9+2)” fashion extending from the start of middle piece to about half way through the principal piece. They vary in size and shape across the mammalian species but usually have a tear drop shape with the peripheral boundary being rounded. Among the nine outer dense fibers, fibers 1, 5 and 6 are larger. They are composed of 10 major proteins ODF1, ODF2, ODF3, ODF4 and ODF2 related proteins, and
15 minor proteins [19]. Functionally the ODFs provide elasticity to sperm flagellum and influence the waveform of flagellar beat. Structurally they provide added strength to the flagellum during sperm maturation, ejaculation and sperm motility [20].
11
Figure 2.4. Features of sperm tail. Cross-section of sperm tail at the principal piece region showing axoneme as the innermost structure. The axoneme on magnification shows microtubules arranged in “9+2” pattern. The axoneme is surrounded by tear shaped sperm specific outer dense fibers that are in turn surrounded by the fibrous sheath.
Another sperm unique cytoskeletal structure is the fibrous sheath that extends throughout the length of the mid piece. It lies underneath the plasma membrane and has two longitudinal columns joined by circumferential ribs. The longitudinal columns are formed by loosely packed filaments oriented longitudinally while the ribs are formed of tightly packed filaments oriented circumferentially. Several fibrous sheath proteins have been identified including three members of cAMP dependent protein kinase anchoring proteins (AKAP) specific to testis that are AKAP4,
AKAP3 and TAKAP-80. AKAP4 is a major fibrous sheath protein found in both the longitudinal columns and the ribs. AKAP4 has two protein kinase A (PKA) binding domains, one domain for binding both RIα and RIIα subunits of PKA while the other binds only RIα. Knock-out of
AKAP4 leads to improper fibrous sheath development resulting in impaired motility and
12
infertility [21]. AKAP4 also binds AKAP3 that in turn binds testis specific ropporin and AKAP- associated sperm protein (ASP). Ropporin and ASP have N-termini similar to RIIα subunit of
PKA and competes with PKA for binding of AKAP’s. This is thought to be involved in regulation of motility [22]. AKAP3 and TAKAP-80 are also involved with formation of fibrous sheath. The fibrous sheath has an important function of anchoring proteins involved in regulation of motility i.e. AKAP4, AKAP3 and TAKAP-80 of the fibrous sheath anchor PKA that is activated by cAMP. PKA in its active form then phosphorylates Ser and Thr residues on proteins that are involved with various sperm functions including motility. This cAMP signaling is essential for sperm maturation, motility and capacitation [23].
2.4 Epididymal maturation of spermatozoa and initiation of sperm motility
In mammals, testicular spermatozoa are immotile and incapable of binding to and fertilizing eggs. Motility initiation and the ability to fertilize eggs occur during the passage of spermatozoa through the epididymis. The epididymis can be divided into various segments based on their structure and function, with each segment having a unique microenvironment. Broadly, the epididymis can be divided into three regions: caput, corpus and cauda (Figure 2.5). Sperm from caput region of the epididymis are immotile but attain motility as they reach the caudal region of the epididymis. Each segment of the epididymis shows a specific pattern of gene expression to synthesize proteins that are involved with sperm maturation. This regulation of epididymal function is controlled by androgens, other hormones and local testicular factors. The composition of the epididymal fluid changes constantly within each segment. Several epididymal proteins have been identified and some of them are present in very high levels. These epididymal
13
proteins could be signaling molecules, receptors, regulatory proteins and transporters [24,25].
Some of the examples include clusterin (most abundant), albumin (HSA), lactoferrin (LF), extracellular matrix protein (1ECM1), α1-antitrypsin (A1AT), actin binding protein (ABP), glutathione S transferase (GST), gelsolin (Gsn), actin, etc. These proteins are secreted by the epididymal epithelium in segment specific pattern. A large number of enzymes such as glycosidases, proteases (kallikrein, cathepsin, ADAM etc.) and several protease inhibitors
(serpin, eppin, CRES, etc.) are present in the epididymal fluid [24,26].
Certain epididymal proteins associate with surface of sperm membrane thereby changing its composition, serving various functions including protection during transit through the epididymis. The epididymis secretes both proteases and proteolytic inhibitors suggesting that the proteolytic inhibitors could be protecting sperm from proteases while passage through certain segments of the epididymis. Proteins such as GPX5 have been known to protect sperm by decreasing the reactive oxygen species in the epididymal fluid [27]. Lipocalins and CRES protect sperm against bacteria [28].
14
Figure 2.5. Regions of the epididymis. Testicular spermatozoa produced in the seminiferous tubule are pushed through the rete testis into the epididymis. The epididymis can be divided into three regions. The initial region called proximal caput that leads to distal caput (second region) with both regions harboring immotile spermatozoa. As the sperm progress from caput to the final region of the epididymis called the cauda they attain motility.
A. Motility initiation
Most significant and visible change in sperm during epididymal maturation is the activation of motility. Sperm isolated from the cauda epididymis have a symmetric and uniform flagellar waveform indicative of progressive motility. The key factors involved in this process
2+ - are calcium ions (Ca ), bicarbonate (HCO3 ) and cyclic adenosine monophosphate (cAMP). The
15
other factors that influence motility are motility inhibitors such as immobilin, inhibin and a high molecular weight glycoprotein present in epididymal fluid.
Calcium plays a significant role in sperm function. The calcium concentration in the epididymal fluid decreases from 0.8mM to 0.5mM in caput to cauda, respectively [29]. The immotile caput sperm contain high levels of intracellular calcium at six times that of caudal sperm [30]. Well characterized calcium channels in sperm, CatSper1, CatSper2, CatSper3,
CatSper4, Cav2.3 and PMCA4 have been shown to be important for sperm motility. PMCA4 is a plasma membrane associated Ca2+-ATPase found in the principal piece that is highly active in caudal sperm decreasing intracellular Ca2+ ion levels. Knock-out of PMCA4 results in male infertility [31]. CatSper is a sperm specific voltage gated Ca2+ channel also located in the principal piece of sperm flagellum. Disruption/Knock-out of CatSper has led to male infertility due to the inability of sperm cell to hyperactivate [32,33]. Ca2+ activates sperm specific soluble adenylyl cyclase (sAC) that leads to increased cAMP levels necessary to stimulate motility. In vitro, Ca2+ influx increases sperm flagellar beat while efflux decreases it. The Ca2+ concentration in cauda is maintained at levels low enough to activate sperm motility and yet keep the mature sperm quiescent.
- - Bicarbonate (HCO3 ) levels within sperm are regulated by HCO3 transporters (SLC4,
- SLC26 families), HCO3 permeable transmembrane proteins (AE2 and CFTR) and by carbonic
- anhydrase. HCO3 directly increases the activity of sAC in two ways, by increasing the enzyme velocity of sAC and by decreasing substrate inhibition at high levels of the sAC substrate (ATP-
2+ - Mg ) concentration. It has been shown that addition of HCO3 to mature caudal sperm increases flagellar beat by raising cAMP levels and activating PKA mediated protein phosphorylation.
16
- HCO3 levels in the epididymal fluid vary across the regions of epididymis with low levels seen
- in the cauda compared to caput. Because of low concentration of HCO3 in cauda, it is assumed
- that sAC activity would be limited. On the other hand, the high concentration of HCO3 in caput
2+ - and its effect on sAC is still unclear. Several studies have demonstrated that Ca and HCO3 act synergistically on sAC to stimulate motility [34,35].
Cyclic adenosine monophosphate (cAMP) is a key mediator for motility activation generated by adenyl cylase from ATP. The adenyl cyclases in somatic cells are usually membrane bound (mAC) and regulated by G-proteins. However, sperm being a specialized cell has its unique adenyl cyclase that lacks the trans-membrane domain and is soluble. It is hence
2+ - called the soluble adenyl cyclase (sAC) that is regulated by Ca and HCO3 . Knock-out of sAC gene leads to defects in sperm motility and male infertility [36]. The increased cAMP levels activate cAMP-dependent protein kinase A (PKA) that phosphorylates Ser and Thr residues on proteins that are involved with various sperm functions including motility. The downstream targets of PKA are protein tyrosine kinases. This entire process occurs in the principal piece of sperm flagellum [37,38].
B. Phosphorylation and motility
Protein kinase A (PKA) holoenzyme is composed of two regulatory subunits (R) and two catalytic (C) subunits. In human and mouse genes have been identified that encode the regulatory subunits RIα, RIβ, RIIα, and RIIβ. Mouse expresses two catalytic subunits (Cα and Cβ) while humans express three (Cα, Cβ and C). The Cα subunit of mouse has two isoforms, Cα1 and Cα2
17
(generation of these isoforms is explained later under alternate splicing in testis). Both R and C subunits have cAMP binding domain but R subunits also have an additional AKAP binding domain. AKAP3, AKAP4 and TAKAP-80 are major fibrous sheath proteins that anchor PKA at binding domains for RI and RII subunits of PKA. cAMP once synthesized by sAC from ATP, binds the R subunits aiding in their binding to AKAP. This results in the release of C subunits that too get activated by binding of cAMP. The free and activated C subunits induce rapid
Ser/Thr phosphorylation of proteins involved in progressive motility of sperm. The Cα2 subunit is testis specific and its isoform specific knock-out mouse model showed normal sperm counts with progressive motility but are infertile due to inability of sperm to hyperactivate [9,37].
Changes in motility characteristics called hyperactivation occur in the female reproductive tract. Hyperactivation is characterized by high amplitude, asymmetrical beat pattern of sperm tail. Immotile sperm or motile sperm that cannot undergo hyperactivation cannot penetrate and fertilize eggs. While intra-sperm cAMP and Ca2+ are known to be indispensible for basal and hyperactivated motility [39,40], biochemical mechanisms underlying how these intracellular messengers act to regulate sperm motility are still barely understood. Since little or no protein synthesis occurs in spermatozoa, initiation of motility and hyperactivation among other sperm functions must occur through post-translational modification of pre-existing proteins with protein phosphorylation being the most common [41,42]. Protein phosphorylation is controlled by protein kinases and protein phosphatases. The focuses of this study are the roles of serine /threonine phoaphatases in sperm.
18
2.5 Serine threonine protein phosphatases
Protein phosphorylation is a reversible mechanism that is essential for most cellular functions including transcription, translation, cell division, metabolism, signal transduction, apoptosis, intracellular communication, migration/motility etc. Reversible protein phosphorylation involves addition of phosphate to an existing protein by protein kinases and its removal by protein phosphatases. Phosphorylation of a protein can induce conformational changes that can either activate or deactivate it. Phosphorylation can occur on serine, threonine and tyrosine residues with serine phosphorylation being the most common. It is estimated that
30% of the cellular proteins are phosphoproteins of which ~98% are serine threonine phosphoproteins and less than 2% are tyrosine phosphoproteins [43,44]. Eukaryotes encode a diverse range of kinases as seen in C. elegans, approximately 2.6% of the genome encodes kinases [45]. In homosapiens, 518 kinase encoding genes have been identified of which 428 are serine/threonine kinases (PSKs) and 90 are tyrosine kinases (PTKs). However the protein phosphatases encoded are far fewer at ~150, of which 107 are tyrosine phosphatases (PTPs) and fewer than 40 are serine/threonine phosphatases (PSPs). With the ratio of PTKs to PSPs being so high, the PSPs keep on par with the kinases for cellular functions by interacting with a wide range of regulatory subunits [46,47]. These regulatory subunits provide the phosphatases with the ability to act on a diverse range of substrates and perform cell functions. The PSPs can be divided into three families. The first of these are the phospho protein phosphatases (PPP) consisting of PP1, PP2A, PP2B, PP4, PP5, PP6 and PP7 (Figure 2.6). The second are the metal dependent protein phosphatases (PPMs) consisting PP2C and pyruvate dehydrogenase phosphatase that require Mn2+or Mg2+. The third family constitutes aspartate-based phosphatases
(FCP/SCP).
19
Figure 2.6. Classification of serine/threonine phosphatases. The PSPs of interest for this study are highlighted in red boxes.
A. Protein phosphatase 2A
The serine-threonine protein phosphatase, protein phosphatase 2A (PP2A), is constitutively expressed in all eukaryotes. This phosphatase is implicated in diverse functions such as metabolism, DNA replication, transcription, RNA splicing, translation, cell-cycle progression, morphogenesis, development, and transformation [48,49]. Protein phosphatase 2A is composed of three subunits, the catalytic subunit PP2A-C, scaffolding subunit PP2A-A, and the regulatory subunit PP2A-B. The catalytic subunit has two isoforms, PP2A-Cα and PP2A-Cβ, which are 97% identical with a conserved C-terminus end. The A (or PR65) subunit is the scaffolding or the structural subunit that anchors the other two subunits together. It also exists in two isoforms, PP2A-Aα and PP2A-Aβ, both with a molecular weight of 65 kDa. PP2A is known
20
to exist as a hetero-dimer or a hetero-trimer. The 36 kDa catalytic subunit (PP2A-C) is tightly bound to the 65 kDa A scaffolding subunit (PR65) forming a heterodimer (AC). This dimer binds to a regulatory (B) subunit from one of four gene families designated as B/PR55,
B'/PR61/B56, B'', and B''' to form a hetero-trimer (ABC). The B and B' family contains α, β, γ and δ isoforms with the B' family including an extra ε isoform. The B'' family includes the isoforms PR48, PR59 and the splice variants PR72 and PR130, while the B''' family includes striatin and SG2NA [49]. Both A and B subunits have been shown to play a role in controlling the substrate specificity of PP2A. The B subunits appear to determine substrate specificity and sub-cellular localization of PP2A [50-53].
The catalytic subunit of PP2A (PP2A-C) can be covalently modified at the C-terminus by carboxymethylation [54] and tyrosine phosphorylation [55]. Leu 309, the C-terminal amino acid residue of PP2A, is highly conserved among all mammals [56]. Carboxymethylation of the Leu
309 is thought to be essential for B subunit binding and formation of the hetero-trimeric holoenzyme complex [57-59]. Methylation is catalyzed by a protein phosphatase methyl- transferase (LCMT) and demethylation by a protein phosphatase methyl-esterase (PME1)
[54,60] which are each specific for PP2A as a substrate. Methylation of the PP2A catalytic subunit was observed to increase its activity toward phosphorylase a, a substrate which was used to measure its catalytic activity [56]. However, recent evidence suggests that methylation of the catalytic subunit affects PP2A activity by enhancing the association of the regulatory B subunits to the core AC dimer [58]. Phosphorylation of the catalytic subunit of PP2A (PP2A-C) on Tyr
307 reduces its catalytic activity [55,61]. Therefore enzymatic activity following methylation of the catalytic subunit is regulated depending on the nature of the B-subunit in the holoenzyme and phosphorylation of the catalytic subunit. Among the protein kinases known to phosphorylate
21
PP2A-C on tyrosine include p60v-src from v-scr transfected fibroblasts, p56lck from transformed T cells, and the receptor kinases, for epidermal growth factor and insulin [55].
Reversible PP2A methylation is essential for life since targeted disruption of PME or PPMT in mice is embryonic lethal [62,63].
B. Protein phosphatase-1
Serine threonine protein phosphates 1 (PP1) are known to be involved in diverse cellular functions such as transcription, replication, cell division, glycogen metabolism, muscle contraction and cell survival. PP1 consists of two subunits, a catalytic subunit and a regulatory subunit. PP1 has four catalytic subunits PP1α, PP1β, PP1γ1 and PP1γ2 that are highly conserved
(Figure 2.7). They are identical for over 90% of their amino acid sequence with complete homology in their catalytic domain [44,64]. They differ only in their extreme N or C-termini.
These isoforms PP1α, PP1β and PP1γ1 are present in several tissues and are localized to different regions of the cell. PP1α and PP1β are ubiquitous in somatic cells but abundant levels of PP1α detected in brain, and PP1β in liver and kidney. PP1γ1 is ubiquitous and over expressed in brain and intestine, however it is undetected in the differentiating male germ cells [65]. The only PP1 in mammalian differentiating germ cells is PP1γ2, which is germ cell specific but detected at low levels in brain as well [66].
22
Figure 2.7. Conservation among PP1 catalytic subunits. ClustalW alignment of PP1α, PP1β, PP1γ1 and PP1γ2 amino acid sequence in mouse. * indicates conservation across all the isoforms and : indicates variation in one or two isoforms. The only difference between the isoforms is seen at the C-termini. PP1γ2 has a unique extended C-terminus tail of 22 amino acids (highlighted by box).
PP1 catalytic subunits are always associated with its regulatory subunits forming a multimeric enzyme. Greater than 100 regulatory subunits of PP1 have been identified with some of them shown in the table 2.1 below. These regulatory subunits regulate the enzyme activity and
23
are also involved with localizing the subunits to specific regions of the cell and targeting the catalytic subunits to its target substrates [67]. Some of the regulatory subunits act as PP1 inhibitors by blocking the active site of the catalytic subunit. Some examples include PPP1R1A
(I-1), PPP1R1B (DARP 32), PPP1R2 (I-2) and PPP1R11 (I-3). A detailed list of these inhibitors is shown in table 2.2. The PP1 regulatory subunits consist of RVxF/W motif (R, arginine; V, valine; x, any amino acid; F, phenylalanine; W, tryptophan) that binds the hydrophobic groove of
PP1. Recent studies have shown more specific sequence for the binding motif that is being used to identify newer PP1 regulators [44,46].
24
25
The isoforms PP11 and PP12 are splice variants of the same gene Ppp1cc. These two splice variants are identical except for the unique 22 amino acid C-terminus tail of PP1. PP1 is expressed ubiquitously except in developing male germ cells and spermatozoa. It is observed to be present in the Sertoli cells, Leydig cells and spermatogonia of the testis. PP1 however is expressed at very high levels only in the differentiating male germ cells of testis and is incorporated in spermatozoa [68-70]. The reason for this shift in isoforms specific to mammalian testis is still unknown. The non-mammalian species such as xenopus, turkey and sea urchin bear
PP1γ1 or PP1α in sperm [71].
It has been shown that the testis isoform of protein phosphatase 1, PP12, is essential for spermatogenesis and is also involved in sperm motility regulation [68,69]. The Ppp1cc knockout mice lacking both PP11 and PP12 generated by Dr. S. Varmuza were male sterile but had no
26
phenotype in females. The Ppp1cc knockout male mice lacked sperm morphogenesis with negligible number of testicular sperm bearing several morphological abnormalities [64,72]. From the recent studies in our lab it is observed that PP12 alone in the absence of PP11 in testis can restore sperm morphogenesis and sperm function [73]. PP12 also has an established role in sperm motility initiation and regulation. Immotile caput epididymal sperm have high PP12 activity whereas motile caudal epididymal sperm have low PP12 activity. Furthermore, inhibition of phosphatase activity with compounds such as okadaic acid (OA) and calyculin A results in initiation of motility in immotile caput epididymal spermatozoa [68,69]. These compounds also stimulated caudal sperm motility and induce changes in flagellar beat parameter.
Motility initiation was suggested to be due to PP1 inhibition [42,74]. These inhibitors not only suppress PP12 activity, but also that of protein phosphatase 2A (PP2A). In Chlamydomonas flagellar axoneme, PP1 was detected primarily on the central pair apparatus implicating its role in regulating dyenins for controlling the flagellar motility. PP2A however was detected in the outer microtubule doublets probably regulating the inner dyenin arm during flagellar motility
[75]. In subsequent studies, sperm PP12 was purified to identify sds22, I-2, I-3 and 14-3-3 as its interacting/regulatory proteins [76-78]. The aims of this study are focused to gain a better understanding of the role of PP1 isoforms and PP2A in spermatogenesis and sperm function along with the biochemical mechanisms regulating these phosphatases.
27
2.6 Regulation of gene expression during spermatogenesis
Genes are continually expressed during various stages of spermatogenesis for proteins that are essential in the process of spermatogenesis itself and also in housekeeping functions of the cells. The proteins essential for spermatogenesis are involved in processes unique to sperm cell such as meiosis, acrosome formation, nuclear chromatin condensation, replacement of histone by protamine, tail formation etc. The genes of these proteins transcribed specifically in male germ cells are called chauvinist genes and their pattern of expression is highly coordinated with the stages of spermatogenic cells. The pattern of their expression is regulated primarily by the intrinsic genetic program of spermatogenic cell (intrinsic factors). The secondary governing factors are the extrinsic regulators, the hormones.
A. Extrinsic/Hormonal Regulation of Spermatogenesis
The two primary hormones essential for regulation of spermatogenesis are testosterone and Follicle Stimulating Hormone (FSH). The mechanism of control of spermatogenesis by hormones (Figure 2.8) occurs through a negative feedback loop known as hypothalamic– pituitary–gonadal (HPG) axis involving the hypothalamus, anterior pituitary and testes. The hypothalamus produces Gonadotropin Releasing Hormone (GnRH) in a pulsatile fashion that moves through portal vessels and stimulates gonadotrophic cells in anterior pituitary, to specifically secrete FSH or Luteinizing Hormone (LH).
Blood carries LH and FSH to the testes where LH stimulates Leydig cells to secrete testosterone and other androgens. The androgens then help to activate the Sertoli cells. On the other hand, FSH works together with testosterone to bind to the receptors of Sertoli cells and
28
stimulate different functions such as synthesis and release of estrogen, inhibin and various other products, meiosis, Leydig cell function and maturation of sperms. Estrogen, inhibin and testosterone inhibit the anterior pituitary and hypothalamus to block further secretion of gonadotrophic hormones [79].
Other extrinsic factors known to influence spermatogenesis are retinol and epidermal growth factors (EGF). Rats deprived of vitamin A had impaired spermatogenesis but it is restored on treatment with retinol. Retinoid receptors RARα and RXRβ are present on spermatogenic cells and Sertoli cells respectively, were identified to be essential for spermatogenesis by gene knockout studies. EGF receptors were identified on Sertoli, Leydig and peritubular cells. Lowered EGF levels have been known to effect sperm count and fertility.
However, this decrease in spermatogenesis is assumed to be an indirect effect of EGF on Sertoli cells [80].
29
Figure 2.8. Hormonal control of spermatogenesis. Gonadotropin releasing hormone (GnRH) from the hypothalamus stimulates the anterior pituitary to release LH and FSH. LH is carried to testis where it stimulates testosterone production by Leydig cells that in turn regulates spermatogenesis. At threshold levels, testosterone negatively regulates (dotted lines) production of GnRH and LH by hypothalamus and anterior pituitary respectively. FSH stimulates Sertoli cells located within the seminiferous tubules to regulate spermatogenesis along with production of inhibin.
B. Intrinsic regulation of spermatogenesis
Gene expression during spermatogenesis is regulated at transcription, translation and post-translation (represented in Figure 2.9).
30
Figure 2.9. Intrinsic regulators of spermatogenesis. Various modes of gene expression regulation: i) Transcriptional regulation by promoter elements such as enhancers and repressors. ii) Post-translational regulation by alternate splicing of mRNA. iii) Transcriptional regulation by RNA binding proteins or long poly(A) tail of mRNA.
i. Transcriptional regulation
Transcriptional regulation is the primary mechanism for regulation of gene expression in spermatogenesis. This mechanism involves chromatin remodeling or binding of transcription factors, enhancers, repressors, activators and silencers to the DNA sequence of the gene.
Spermatogenic cells consist of general transcription factors such as TFIID, TFIIB, TBP and RNA
Polymerase II that are ubiquitous. In addition these cells also contain unique transcription factors expressed in high levels such as HSF-2, SPRM1, OCT-2, OVOL1, TAK-1, ZFY-2, etc
[80,81].
31
CREB (cAMP response element-binding protein) and CREM (cAMP response element modulator) are two best studied transcription factors in testis known for binding the cAMP response elements in the promoter regions of genes. CREB and CREM are closely related in structure and function that are activated by the protein kinase A (PKA) pathway. CREM is highly expressed in testis and considered to be the master controller of spermatogenesis.
Knockout studies of CREM gene results in arrest of spermatogenesis at the round spermatid stage leading to infertility in mice. The function of CREB in spermatogenesis is unknown.
However knock-out of CREB in mouse models did not affect fertility [80,82].
High transcriptional levels of several genes are observed in testis with the onset of spermatogenesis. These include transcripts that are testis specific with somatic homologues, unique to testis and that are predominant in testis compared to other tissues. A list of testis specific genes are shown in the table 2.3 below and several of these genes are involved with glycolysis and pyruvate metabolism during spermatogenesis [83].
32
33
ii. Translational regulation
As the spermatogonial cells enter the meiotic phase to produce haploid cells, they undergo a series of structural and morphological changes. During the course of these changes transcription levels progressively decreases and ceases completely toward the later stages of meiosis. The primary reason for transcriptional ablation is nuclear condensation. About the midway of haploid phase, histones are shed and replaced first by transition proteins TSP1 and
TSP2 and finally by protamines [80,84]. Packaging of DNA by protamines results in a tighter condensation of DNA thereby becoming inaccessible to transcription factors for continued transcription. The later stages of spermatogenesis that occurs over a period of few days require proteins essential for formation of spermatozoon. This requires the spermatogonial cells to either synthesize the proteins required for the spermatozoon ahead of nuclear condensation or synthesize transcripts of these proteins and keep them in an inactive state until required at the later stages. This translational regulation of transcripts keeping them inactive can occur in two ways: a) inactivation by mRNA binding proteins, b) translational delay by variable poly (A) length.
Inactivation by mRNA binding proteins: The mRNA binding (masking) proteins have been shown to interact with specific sequences on the 3’ or 5’ UTR regions of mRNA preventing access to the translational machinery. These are called transcriptionally silent messenger ribonucleoprotein (mRNP) particles. One of the well characterized examples is the testis specific phosphoglycerte kinase 2 (PGK-2). High levels of PGK-2 mRNA are detected in the pachytene spermatocytes but its translation is activated only after two weeks in the spermatid stage.
34
Polypyrimidine tract binding protein 2 (PTBP2) was identified to bind the specific regions of 3’
UTR of PGK-2 mRNA thereby stabilizing it and keeping it in an inactive state [85]. Another example is proacrosin with its transcripts detectable at the pachytene spermatocyte stage but the protein is detected only in the round spermatid stage. It has been shown to be regulated by binding of stabilizing proteins in its 5’ UTR region [84]. A recent addition to the RNA masking proteins is a Y-box protein MSY2 and MSY4. They have been known to silence protamine 1
(Prm1) mRNA by binding to specific sequence in its 3’UTR region [86].
Translational delay by variable poly(A) length: Some transcripts are synthesized and stored in the spermatogenic cells but are not associated with ribosomes. They show an elongated poly(A) tail of approximately 150 nucleotides or greater. During the later stages of spermatogenesis the poly(A) tail is shortened to approximately 30 nucleotides and associate with ribosomes to be transcribed. Prm2 transcribed in the early haploid stage exists untranscribed as RNP molecule with ~160 nucleotide long poly(A) tail. In approximately 7 days, the poly(A) tail is shortened and the transcript associates with polysomes to be translated [87].
iii. Post-transcriptional regulation
The other ways in which gene expression is regulated during spermatogenesis is by alternate splicing and mRNA silencing by miRNA/ siRNA/piRNA.
35
Alternate splicing: It results in generation of two or more isoforms of a protein encoded by the same gene. This mechanism allows synthesis of a diverse range of proteins from a limited number of protein coding genes. Alternate splicing occurs at a relatively higher rate in testis compared to other tissues only next to brain and liver [88]. The basic modes of alternate splicing in testis include:
Exon skipping: This is the most common mechanism of alternate splicing in all tissues including testis (see Figure 2.10). The process of exon skipping in some cases leads to premature stop site resulting in degradation of the transcript. The gene mHK1 encodes for Hexokinase 1 (Hk1) mRNA in somatic cells but in testis it encodes for an alternately spliced spermatogonial cell specific mHk1-S mRNA. The somatic isoform of Hexokinase 1 contains a porin binding region
(PBR) that is absent in the testis specific isoform, instead it contains a spermatogonial cell specific sequence (SSR) [89].
Alternate 3’ or 5’ splice site: Utilization of alternate 3’ splice donor site or 5’ splice acceptor site within an intron can lead to shift in reading frame. This results in proteins with different amino acid sequences with significantly different biochemical properties. In some instances, change in reading frame can lead to premature stop site resulting in degradation of the transcript.
36
Figure 2.10. Comparison of alternately spliced (AS) genes across various tissues. A) Percentage of genes that undergo alternate splicing in various tissues. B) Shows the percentage of genes that have skipped exons, alternative 3' splice site exons and 5' splice site exons. C) Percentage of genes that have alternative 3' splice site exons. D) Percentage of genes that have alternative 5' splice site exons. Figure adapted from [88].
Intron retention: Carcinoembryonic antigen related cell adhesion molecule 6 (Ceacam6) and
Ceacam6-L are splice variants generated by retention of 67 nucleotide long intron 3 producing the longer Ceacam6-L. This alternately spliced Ceacam6 is testis specific and is first detected at
37
5 weeks postnatal [90]. A similar example is the gene Ppp1cc. It encodes two isoforms, Ppp1cc1 the somatic isoform and Ppp1cc2 a testis specific isoform. Ppp1cc1 is generated by retention of intron 7 while it is spliced out specifically in testis to generate Ppp1cc2 isoform. This is shown in more detail in aim-II of this study.
Alternate promoter start site: Two splice variants Cα-1 and Cα-2 of the α-catalytic subunit of protein kinase A (PKA) are observed in testis. While Cα-1 is ubiquitous, Cα-2 is unique to testis.
Both variants are encoded by the same gene PRKACA but using alternate promoter sites in intron
1. This results in inclusion of alternate exons (1a and 1b) in the two isoforms respectively. Cα-1 has a unique 14 amino acid N-terminus generated from exon 1a and Cα-2 with a unique 7 amino acid N-terminus form exon 1b. The unique N-terminus of Cα-1 is known to harbor three sites for posttranslational modifications that include myristoylation at Gly1, Asp-specific deamination at
Asn2 and autophosphorylation at Ser10. The function of the 7 amino acid N-terminus of Cα-2 is unknown [91].
Alternate polyadenylation sites: Poly(A) tail on mRNA is essential for its stability and translatability. The Poly(A) accomplishes this by preventing access of the transcript to degradation complexes. The strength of a poly(A) tail signal plays a critical role in gene expression of any tissue including testis in a development stage specific manner. Several genes in various tissues have been shown to utilize alternative polyadenylation sites in their 3’ UTR with testis as a predominant location. Alternate polyadenylation can be achieved by: 1) differential processing of 3’ terminal exon, 2) use of alternate exons at the 3’ end in a tissue specific or developmental stage specific manner (e.g. spermatogenesis). A few examples of genes with alternate polyadenylation in testes include: 1) ADP ribosylation factor (ARF). ARF 1
38
has two poly(A) sites while the variant ARF 4 is a short, testis specific mRNA produced by alternative polyadenylation. 2) eIF-2α (translation initiation factor 2α) has two poly(A) sites that are expressed in different ratio in different tissues. The longer mRNA is more stable in T cells and the shorter mRNA has increased translatability. In testes however, a third poly(A) site is used indicating the presence of a different set of polyadenylation factors recognizing different cis acting elements on the mRNA compared to other tissues [92].
Micro RNA mediated gene regulation: Micro RNA (miRNA) is a short non-coding RNA usually 19-23 nucleotides long observed in all mammalian cell types. They have an established role in regulation of gene expression by either silencing mRNA or by promoting mRNA degradation. The majority of the miRNA are conserved in mammals and expressed in a tissue specific manner. It is estimated that 30% of the genes are regulated by miRNA [93]. The miRNA have complementary sequences with the mRNA resulting in complementary base pairing. This leads to cleavage or destabilizing of mRNA (degradation) by shortening its poly(A) tail and in some cases obstructing translation by ribosomes. The miRNA in testis have been shown to play a significant role in gene expression regulation during spermatogenesis. Disruption of this miRNA regulation can lead to abnormalities in spermatogenesis and more commonly testicular tumors.
For example high levels of miR-17-92 is detected in cancer [94]. Current studies are focused on identifying more of these miRNA and their targeted knock-down as anti-oncogenic and contraceptive possibilities.
39
40
Small interfering RNA mediated gene regulation: Small interfering RNA (siRNA) are small double stranded RNA molecules about 21 nucleotides long derived from cleavage of double stranded RNA (dsRNA). Double stranded RNAs are produced by RNA dependent RNA polymerase (RdRP) that synthesizes RNA from RNA. These dsRNA are cleaved by DICER thus producing single stranded mature siRNA. These mature siRNA then bind Argonaute protein as a complex to either degrade mRNA or suppress their translation. Hence they play an important role in gene expression regulation. These siRNA have previously been detected only in murine oocytes and embryonic cells. However recent studies show several siRNA are produced in murine testis and could have potential role in regulation gene expression during spermatogenesis
[95].
Piwi-interacting RNA mediated gene regulation: Piwi-interacting RNA (piRNA) is the largest class of small non coding RNA. They are ~24-31 nucleotides long and bind with PIWI proteins.
PIWI proteins belong to the Argonaute class of proteins seen only in testis. MILI, MIWI, and
MIWI2 are mouse PIWI proteins with essential role in spermatogenesis. MIWI2 knock-out studies in mice show arrest of spermatogenesis at pachytene spermatocyte stage. PiRNA are thought to be essential for silencing of gene expression with majority of the targets being transposons [96,97]. Very little is known about the biogenesis and function of these small RNA and are currently being investigated with implications in regulation of spermatogenesis.
41
42
Specific Aims:
Aim I: Identification of PP2A, determination of its biochemical modulations and its role in sperm maturation.
A. To determine the post translational modifications of PP2A associated with epididymal sperm maturation and sperm function.
B. To determine the role of PP2A in sperm maturation and motility.
Aim II: Determine the reason for the essential requirement of PP1 for spermatogenesis and sperm function.
Can PP1 substitute PP1 in spermatogenesis and sperm function if expressed in germ cells?
43
3. Materials and Methods
3.1 Mouse genomic DNA isolation i. Alkali lysis method: Fresh ear punches from mice were resuspended in 50µl of Alkali lysis buffer (25 mM NaOH and 2 mM EDTA) and denatured at 950 C for 1 hr. Next, 50 µl of 40 mM Tris-HCl was added to neutralize it. The samples were centrifuged at 1000 x g and the supernatant was collected for genotyping PCR. ii. Tail DNA extraction: Gentra pure gene mouse tail kit from Qiagen was used. 5 mm (5–10 mg) mouse tail was cut into small pieces and put into 300 µl cell lysis solution in a 1.5 ml micro centrifuge tube. 1.5 µl Puregene protease K was added to the lysate, and mixed by inverting 25 times and incubated at 55°C overnight or until the tissue has completely lysed. After the incubation, undigested vertebrae and hair were removed from the tube by centrifugation. Next,
100 µl of protein precipitation solution was added, vortexed and centrifuged at 16,000 x g for 3 min. The supernatant was collected and added to 300 µl of isopropanol into a clean 1.5 ml micro centrifuge tube. It was mixed by inverting the tube several times and centrifuged at 16,000 x g for 1 min. The supernatant was discarded and washed with 300 µl of 70% ethanol. The DNA pellet was finally dissolved in 50 µl of autoclaved Tris-EDTA (TE) buffer.
3.2 Bovine Sperm isolation
Bovine testes with intact epididymes were bought from slaughter house immediately after sacrificing the animal and utilized within two to three hours. The epididymis was dissected into
44
the proximal caput region identified as the initial region of epididymis next to rete testis, the late caput i.e. the segment just ahead of corpus epididymis, and finally the caudal region (terminal region of epididymis) intact with vas deferens. Bovine spermatozoa from the proximal caput and distal caput were obtained by cutting open the caput laterally and gently slicing the tubules within, using a surgical blade forcing the sperm to ooze out. This sperm was collected by gently washing the caput in HEPES buffer, pH 7.0 (10 mM HEPES, 135 mM NaCl, 5 mM KCl, 5 mM
MgSO4) [69]. Caudal sperm was isolated by pushing HEPES buffer into the vas deferens using a syringe and making an incision the cauda so the sperm ooze out. The collected sperm was washed twice in HEPES buffer by centrifugation, resuspended in the same buffer and counted.
3.3 Mouse sperm isolation
Mice were euthanized in the carbon dioxide chamber and the cauda epididymis and vas deferens were isolated together. The artery of the deferens was carefully removed to avoid blood contamination. The tissue was then washed in phosphate buffered saline (PBS) before being placed in Human Tubal Fluid (HTF) media (Millipore, Embryo Max) in 60mm X 15mm petri
0 dish. The HTF media had been buffered in a 5% CO2 chamber at 37 C for 2 hrs prior to sperm isolation. The cauda epididymis while in HTF media was punctured with a 26G (45mm) needle and the sperm were squeezed out from the cauda epididymis and the vas deferens using surgical tweezers. Sperm were allowed to disperse in the media for 5-10 min at 370 C aided with occasional swirling. Upon complete dispersion, the sperm were transferred to 1.5 ml centrifuge tube using a cut tip 1 ml pipette tip to avoid shearing of sperm.
45
3.4 Sperm count
Following sperm isolation, a small volume (usually 10 µl) was diluted 20 times (mouse) or 100 times (bovine) in water. 8 µl of diluted sperm was loaded under the cover slip of hemocytometer to fill up the chamber and allowed to sit for 5 minutes to settle the sperm. The hemocytometer was placed under 25X phase contrast objective lens of a microscope and the sperm heads in 5 squares (4 corners and 1in the middle) were counted. The following equation was used to convert the counts from 5 squares to concentration of sperm per milliliter: Conc/ml =
(Count in 5 squares) (Dilution Factor) (5 X 104).
3.5 Sperm extract preparation
After sperm counting, the sperm were pelleted down by centrifuging at 700 x g at 40C and the HTF media was carefully removed. The protein from pelleted sperm was extracted in the following ways according to each experimental requirement: i. Whole sperm extract: Sperm pellet was resuspended in 1% sodium dodecyl sulphate
(SDS) in water, boiled in water bath for 7 min and centrifuged at 16000 x g at room temperature for 20 min. The supernatant was collected and boiled with Laemmli buffer ready to be loaded for western blot analysis. ii. Sonicated sperm extract: Sperm pellets were resuspended in homogenization buffer
(HB+) containing protease inhibitors (10 mM Tris [pH 7.2], 1 mM EDTA, 1 mM EGTA, 10 mM benzamidine-HCl, 1 mM PMSF, 0.1 mM N-p-tosyl-L-phenylalanine chloromethyl ketone
[TPCK], 0.1% (V/V) β-mercaptoethanol and 1 mM sodium orthovanadate). The sperm
46
suspension was sonicated on ice with three 10-sec bursts of a Microson ultrasonic cell disruptor
(Misonix incorporated) set at level three. The suspension was then centrifuged at 16,000 x g for
20 min. at 4ºC. The supernatants were supplemented with 5% glycerol and stored at -20ºC.
3.6 Testis protein extract preparation
The mouse testes were isolated, weighed and placed into test tube with 1ml HB+ and homogenized using tissue tearor homogenizer on ice at level 4 for three 10 second bursts. The suspension was then centrifuged at 16,000 x g for 20 min. at 4ºC. The supernatants were collected and stored at -20ºC.
3.7 Protein estimation
Protein concentration in tissue and cell extracts prepared in HB+ were estimated using
DC protein assay kit II from Bio-Rad. Simultaneous to tissue extract preparation, bovine serum albumin (BSA) standards for protein estimation were prepared by dissolving 100mg of BSA in
1ml of HB+ and then serially diluting down to a concentration of 8mg/ml. BSA from the standard and proteins from extracts were precipitated with equal volumes of 20% trichloroacetic acid (TCA) overnight to eliminate Benzamidine and β-mercaptoethanol that interfere with spectrophotometric reading of protein. They were then centrifuged at 12000 x g for 15 min at
40C and the protein pellets were air dried to be dissolved in 0.1 N NaOH. The BSA standard was serially diluted with 0.1 N NaOH to obtain concentration ranging from 8 mg/ml to 0.0625
47
mg/ml. Reagent A’ was prepared by mixing 1ml of reagent A with 20µl of reagent S. 5µl of extract (unknown) and BSA standards (known) were loaded in triplicates for each sample in a
90 well plate and mixed with 25µl reagent A’ and 200µl reagent B. the samples were incubated at room temperature for 15 min with gentle rocking and their OD was measured using a spectrophotometer at 630nm. The OD of unknown was then converted to protein concentration in terms of mg/ml by plotting a standard graph with the standards (known).
3.8 Pull-down with Microcystin-Agarose.
Microcystin-agarose (Upstate) was washed two times with an equal volume of HB+ buffer supplemented with 5% BSA to prevent nonspecific binding. The Microcystin-agarose pellet was mixed with 100 µl of sonicated sperm extract (bovine or mouse) at 4ºC with rotation overnight. Following this incubation the flow-through (unbound) fraction was collected by centrifugation at 12, 000 x g for 5 min. The pellet was washed once with TTBS (0.2 M Tris [pH
7.4], 1.5 M NaCl, 0.1% thimerosol and 0.5 % Tween 20) and three times with HB+ buffer. The flow-through and pellet fractions were boiled with Laemmli sample buffer and stored at -20ºC for Western blot analysis.
For alkali mediated PP2A demethylation, PP2A in sperm extracts was first bound to microcystin. 10 ul of microcystin bead slurry (prepared as described above) was incubated with sperm extracts prepared from the proximal caput, distal caput and caudal regions of the epididymis. The extracts were incubated for 150 min, washed in TTBS twice and in HB+ twice.
The washed microcystin beads were then resuspended in HB+ (30 µl). Microcystin bound PP2A
48
from each of these three regions was divided into two equal aliquots; one part was treated with
0.2 M NaOH while the other was left untreated as control. After 8 minutes at 40C the alkali was neutralized with 0.2 M Tris-HCl (pH 6.8). An equal volume of neutralized alkali was added to the control suspension. Microcystin beads were pelleted and boiled with Laemmli sample buffer followed by western blot analysis.
3.9 Immunoprecipitation
Tissue or cell extracts were freshly prepared in lysis buffer (HB+) and 200 µl of it was incubated with approximately 5-6 µg of antibody and another 200 µl with diluted pre-immune serum of the antibody (negative control) for 1 hr on rotator at 40C. During this period 40 µl of protein G-coupled sepharose beads (for monoclonal antibody) or protein A-coupled sepharose beads slurry was washed with HB+ buffer three times. The beads are split into two aliquots for positive and negative control. Following incubation with antibody, the extracts are added to the beads and incubated on rotor at 40C for 4 hrs. The beads were centrifuged at 1000 x g for 5 min at 40C and the supernatant is collected as flow through (FT). The beads were washed with TTBS three times and once with HB+ by centrifugation at 40C. The washed sepharose beads were then resuspended in HB+ (50µl) and boiled with laemmli buffer.
49
3.10 Western blot analysis
Sperm extracts denatured by boiling for 3 min in Laemmli sample buffer were separated by SDS-gel electrophoresis using 12% polyacrylamide slab gels in a Mini-Protean II system
(Bio-Rad Laboratories, Hercules, CA). After electrophoresis, proteins were electrophoretically transferred to Immobilon-P, PVDF membrane (Millipore Corp., Bedford, MA). Nonspecific protein binding sites on the membrane were blocked with 5% nonfat dry milk in TTBS. The blots were washed with TTBS and then incubated overnight with primary antibody at 40C. The primary antibodies used in this study are shown in table 3.1. After washing with TTBS the blots were incubated with the appropriate secondary antibody (Amersham, Piscataway, NJ) conjugated to horseradish peroxidase at 1:5000 dilution for 1 hr at room temperature. Blots were then washed with TTBS twice 15 min each and four times 5 min each. Blots were then developed with Enhanced chemiluminescence kit (Amersham).
50
3.11 Protein phosphatase assay
Radio labeled phosphorylase a was used as a substrate to measure activities of PP2A by procedures reported in [68]. The substrate and sperm extracts were incubated (in a total volume
51
of 30 µl) at 30ºC with or without inhibitors for 10 min. Recombinant I-2 was added to inhibit
PP12 and 2 nM Okadaic acid to inhibit PP2A. The reaction was terminated by addition of 90 µl
10% trichloroacetic acid (TCA). Samples were then centrifuged for 5 min. at 12,000 x g.
Supernatants were analyzed for 32P released from phosphorylase a. Enzyme activity is expressed in mU which is the release of 1 mmole of 32P per minute.
3.12 Sperm motility analysis i. Bovine sperm: Sperm from the epididymis were isolated and washed twice by centrifugation with HEPES buffer. Sperm were then incubated at a concentration of 2X107/ml at
370C in HEPES buffer containing 20 mM glucose and 20% BSA for control and along with 1 mM L-homocysteine and adenosine to elevate intracellaur S-adenosyl homo cysteine (SAH).
Motility was analyzed on 20 µm capillary chamber slides by the Computer assisted analyzer
(CASA) of Hamilton Thorne Biosciences installed with the CEROS version 12.2g software.
Three random fields each of 90 frames at 60 frames/second were chosen for each sample and analyzed with the following settings: minimum contrast 30, minimum cell size 4 pixels, static cell size 8 pixels, static cell intensity 60, low size gate 0.17, high size gate 2.26, low intensity gate 0.35, high intensity gate 1.84,minimum static elongation gate 0, maximum static elongation gate 90, minimum VAP 50μ/s, minimum STR 50%, VAP cut off 10μ/s and VSL cut off 10μ/s.
ii. Mouse sperm: Sperm from the caput or cauda epididymis were isolated into CO2- buffered HTF media and diluted to a concentration of 2X107 sperm/ml. After incubation for 5
52
minutes at 370C, motility was analyzed on the 100 µm capillary chamber slides (Leja slides) by
CASA. Three to five random fields each of 60 frames at 60 frames per second were chosen for each sample and analyzed with the following settings: minimum contrast 35, minimum cell size
5 pixels, static cell size 7 pixels, static cell intensity 40, low size gate 0.17, high size gate 2.26, low intensity gate 0.35, high intensity gate 1.84, minimum static elongation gate 0, maximum static elongation gate 90, minimum VAP 50μ/s, minimum STR 50%, VAP cut off 10 μ/s and
VSL cut off 0 μ/s.
3.13 Total RNA isolation
Prior to isolation all the instruments utilized were cleaned with RNAase AWAY (from
Sigma) to get rid of RNases. Each freshly isolated mouse testis was homogenized in 1ml cold
Trizol. 200 µl chloroform was added and incubated for 15 min on ice. It was next spun down at
12000 x g at 40C for 15 min and the top layer was collected for RNA (middle layer could be collected for DNA and the bottom layer for protein). 500 µl of isopropanol was added and let to sit at room temperature for 10 prior to centrifugation at 10000 x g for 10 min at 40C. Supernatant was collected and added to 1ml of 75% ethanol and vortexed gently. The mixture was centrifuged at 7500 x g for 7 min at 40C and the supernatant was discarded. The pellet was semi dried and resuspended in approximately 50 µl of RNase free water. Lastly the RNA concentration was measured using Nanodrop spectrophotometer (ND-1000; Nanodrop technologies).
53
3.14 Quantitative reverse transcription PCR
The RNA was diluted to a concentration of 200 ng/µl with RNase free water and cDNA was prepared using Qiagen RT-PCR kit. The genomic DNA was eliminated by incubating 600 ng of RNA with RNase free DNase for 2 min at 420C. It was then mixed with reverse transcriptase and random hexamers, and incubated in the PCR machine at 420C for 15 min.
Finally the reverse transcriptase was inactivated at 950C for 3 min. The cDNA concentration was measured and its purity was estimated by its 260/280 nm absorbance ratio using Nanodrop spectrophotometer (ND-1000; Nanodrop technologies). The cDNA was diluted to a concentration of 300 ng/µl. 600 ng of cDNA was used per reaction with 12.5 µl of SYBR green master mix (Qiagen) with custom designed and standardized primers at a concentration of 50 nM. The RNA concentration was estimated by comparing the CT value of the target mRNA with that of the GAPDH mRNA (reference mRNA).
54
3.15 Immunocytochemistry
Mouse or bovine sperm were isolated and washed with PBS by centrifugation at 700 x g at 40C for 10 min. The sperm pellet was resuspended in 4% paraformaldehyde and incubated at
40C for 15 min. The sperm were next resuspended in 4% paraformaldehyde with 0.1% triton X and overlaid onto poly-L-lysine coated cover slip for 20 min to let the sperm suspend and stick to
55
the cover slip. Extra parafomaldehyde was discarded and the cover slips containing the sperm were blocked with TTBS containing BSA and goat serum (blocking solution) at room temperature for 1hr. The cover slips were then coated with primary antibody diluted in blocking solution for overnight at 40C. Two primary antibodies raised in rabbit, anti-PP1γ2 and anti-
PP1γ1 were used at 1:250 and 1:100 dilution respectively. Next, the cover slips were washed in
TTBS twice for 10 min each and incubated with Cy3-conjugated secondary antibody (1:250) for
1hr at room temperature. Finally the cover slips were washed in TTBS thrice for 10 min each, laid onto a slide with VECTASHIELD mounting media and observed with a confocal microscope.
56
4. Aim I: Identification of PP2A, determination of its biochemical modulations and its role in sperm maturation.
4.1 Background and Rationale
Testicular spermatozoa in mammals are immotile and lack the ability to fertilize eggs in vitro. Sperm motility initiation and fertilizing ability develop during their passage through the epididymis [98]. Despite a large body of knowledge, it is not completely understood how changes in the epididymis lead to metabolic competence, motility development, and the ability of spermatozoa to bind and fertilize the egg. The capacity for motility already exists in testicular sperm, demonstrated by the fact that motility can be induced in demembranated testicular and caput epididymal sperm in the presence of ATP, cAMP, appropriate calcium levels, and proper pH [99,100]. It is well known that motility stimulation can be affected by cAMP-mediated PKA activation [101-103]. A role for PKA necessarily implies a function for a protein phosphatase.
Protein phosphatases can significantly modify and restrict PKA action. Inhibition of protein phosphatase activity results in initiation and stimulation of motility [68,69]. Inclusion of protein phosphatases in reactivation media prevents PKA-mediated motility initiation in demembranated sperm [69,104].
Sperm being a highly compact cell carries only essential proteins some of which undergo various post translational modifications during sperm maturation in epididymis. PP2A, being one
57
of the two major serine/threonine phosphatases in sperm and the other being PP1, I wanted to identify if PP2A underwent post translational modifications in sperm similar to somatic cells. It has been shown that the testis isoform of protein phosphatase 1, PP12, is essential for spermatogenesis and is also involved in sperm motility regulation [68,69]. While the 36 kDa catalytic subunit of PP2A in bovine spermatozoa has been reported [68], the role of PP2A in sperm function was not explored.
The first objective of this aim (Aim I- A) is to ascertain the presence of PP2A in sperm and its post translational modifications during sperm maturation through the epididymis. Further, determine the presence of all the enzymes involved with PP2A modifications. The second objective of the aim (Aim I- B) is to determine role of PP2A and its modifications in sperm motility initiation and sperm function after ejaculation.
58
4.2 Results for Aim-I (A):
To determine the post translational modifications of PP2A
associated with epididymal sperm maturation and sperm function.
A. Anti-PP2A-C antibody purification
Custom Anti-PP2A antibody was generated by immunizing two rabbits with the peptide
corresponding to human PP2A-Cα amino acids 288-306 (QFDPAPRRGEPHVTRRTPD). The
antibody was purified from the serum of these two rabbits separately by affinity purification
using the SulfoLink coupling resin from Thermo scientific. The lyophilized peptide (7mg) used
for immunization was resuspended in 35µl of DMSO to a final concentration of 1mg/5µl. 10µl of
peptide was added to 1990µl of coupling buffer for a final volume of 2ml with a concentration of
1mg/ml of the peptide. The SulfoLink column was prepared at room temperature by equilibration
with 12ml of SulfoLink coupling buffer. The peptide mixture was loaded on to the column and
mixed using a rotator/shaker for 15min followed by incubation without shaking at room
temperature. Next the buffer was drained and the column was washed with 6ml SulfoLink
coupling buffer. The flow through was collected and its absorbance was measured to check for
efficiency of peptide coupling.
The non-specific binding sites on the column were blocked by adding 0.05M cysteine
solution (15.8 mg of L-cysteine HCl to 2ml of SulfoLink coupling buffer). The column was
59
incubated by rotating/shaking at room temperature for 15min and then for 30min without shaking. The column was drained and washed with 4ml phosphate buffered saline (PBS) four times and stored with PBS containing 0.05% sodium azide at 40C.
Prior to purification the column was drained of sodium azide and equilibrated with
10ml PBS. 50ml of serum from one rabbit was spun down at 5000 x g for 5min at 40C to precipitate the fats. The fat free serum was passed through the column and the flow through collected on ice and stored at 40C. Column was washed with 30 ml PBS. The bound antibody was eluted with 10 ml of 3 M KSCN (pH of 7.0) and 1 ml of eluted fractions were collected and immediately checked for absorbance using Nanodrop. Fractions with similar OD values were pooled to be further dialyzed. (Fractions with OD of 2.5, 4.6 and 2.8 from rabbit 1 and 4.0, 5.7 and 3.0 from rabbit 2 were pooled).
The column was next eluted with glycine for the remaining bound antibody. 100 mM glycine was first titrated with 1 M Tris to to arrive at pH 7.0 (volume of Tris required was noted). This specific volume of Tris was first aliquoted into 1 ml eppendorfs. The column was then eluted with glycine and the eluent was collected into the Tris eppendorfs to a final volume of 1 ml. The absorbance of the fractions was estimated with the Nanodrop. The fractions with similar OD were pooled. (Fractions with OD of 1.9, 2.5 and 1, 25 from rabbit 1 and 2.47, 2.5 and
0.6 from rabbit 2 were pooled).
The pooled KSCN and glycine fractions of the antibody were separately dialyzed in dialysis tubes with 1 liter PBS with 0.05% sodium azide at 40C overnight. The dialysis was repeated for another 5 hours with fresh PBS containing sodium azide. The final purified antibody concentrations estimated by Nanodrop were observed as following:
60
Rabbit 1 KSCN fraction: 1.28mg/ml (total volume 10ml)
Rabbit 1 Glycine fraction: 0.86 mg/ml (total volume 8ml)
Rabbit 2 KSCN fraction: 0.9mg/ml (total volume 10ml)
Rabbit 2 Glycine fraction: 0.4 mg/ml (total volume 8ml)
The specificity of the antibodies was analyzed by their immuno reactivity to PP2A in bovine and mouse sperm extract by western blotting analysis (Figure 4.1). The KSCN and glycine fractions from both rabbits showed an immunoreactive band at 36 kDa corresponding to
PP2A-C. However, all fractions except Rabbit 1 glycine showed a non specific band at approximately 30 kDa. The specificity of the antibody was further confirmed by immunoprecipitation of PP2A in bovine caudal sperm supernatant extract with rabbit 2 glycine fraction and probing the western blot with Anti-PP2A antibody obtained from BD laboratories
(Figure 4.2). In addition a microcystin pulldown of sperm supernatant extracts showed that microcystin bound PP2A was detected by rabbit 2 glycine antibody (Figure 4.3). The rabbit 2 glycine antibody was used in the following study to detect total PP2A levels by western blot analysis (control blots).
61
62
Figure 4.1. Anti PP2A-C antibody analysis by western blot. Bovine and mouse caudal sperm extract from 2.5X106 prepared by sonication in HB+ was loaded per lane in SDS PAGE gel as multiple replicates and subjected to western blot. The blots were independently probed with increasing dilutions (1:500, 1:1000 and 1:2000) of the purified antibody Rabbit 1 KSCN fraction (A), Rabbit 1 glycine (B), Rabbit 2 KSCN fraction (C) and Rabbit 2 glycine fraction (D).
63
Figure 4.2. Immunoprecipitation of PP2A with purified Anti-PP2A antibody. 200 ul of bovine sperm supernatant extract was incubated with ~6 ug of Anti-PP2A rabbit 2 glycine antibody and protein G sepharose beads. The bound PP2A (PP2A IP), unbound PP2A in the flow though (IP FT) and the original extract (input) were subjected to western blot analysis and probed with Anti-PP2A antibody from BD laboratories. Negative control of IP was performed with pre-immune serum of rabbit 2 (-ve IP) does not pull down any PP2A and it seen only in the flow through of negative control (-ve FT).
Figure 4.3. Microcystin pull down of PP2A. Bovine sperm supernant extract was incubated with microcystin sepharose beads. The bound PP2A (MC), unbound PP2A in the flow though (FT) and the original extract (input) were subjected to western blot analysis and probed with Anti-PP2A rabbit 2 glycine antibody. The entire PP2A is pulled down by microcystin as seen by an intense immunoreactive band at approximately 36 kDa in the MC lane.
64
B. Identification and characterization of PP2A as a cytosolic protein in spem
Western blot analysis of supernatant fraction of sperm sonicate extracts isolated from proximal caput, distal caput, and caudal regions of the epididymis when probed with anti-PP2A-
C (BD Biosciences) antibody each showed one immunoreactive band identifying PP2A.
There was equal PP2A immunoreactivity in the three extracts (Figure 4.4A). Little or no PP2A immunoreactivity was observed in pellets of sperm sonicates (Figure 4.4B). Since the supernatant fraction constitutes both cytosolic and membrane proteins, the supernatant fraction was further centrifuged at 100,000 g to obtain cytosolic proteins in the supernatant and membrane proteins in the pellet. Western blot analysis of these fractions shows PP2A in the cytosolic protein while absent in the membrane fraction (Figure 4.4C).
Figure 4.4. Detection of PP2A in bovine sperm. A) Presence of immunoreactive PP2A in sperm from different regions of epididymis. Equal sperm numbers (4X106) were loaded in each lane for SDS-PAGE followed by western blot analysis with anti-PP2A antibody. The same blot was re-probed with anti β-Tubulin antibody as loading control. B) Sperm sonicate pellets prepared in 1% SDS were analyzed by western blot with Anti-PP2A antibody (4X106 65
sperm/lane). C) Western blot of the membrane and cytosolic fractions prepared from late caput and caudal sperm to detect PP2A using the anti-PP2A antibody.
C. Changes in PP2A methylation and tyrosine phosphorylation in bovine epididymal spermatozoa
The methylation status of the PP2A catalytic subunit in sperm from the three regions of the epididymis was determined using a mouse monoclonal antibody anti-PP2A 4B7 raised against the amino acid sequence (RGEPHVTRRTPDYFL) corresponding to residues 295-309 in human PP2A-C is demethyl-sensitive. This antibody is documented to react with PP2A-C in its demethylated form, that is, when the terminal leucine residue is not methylated [105]. This antibody is referred as “demethyl-sensitive antibody or anti-demethyl PP2A” in this report. The demethyl-sensitive 4B7 antibody detects a band at ~36 kDa in bovine sperm extracts (Figure
4.5A) prepared from all three regions of the epididymis. However, based on densitometry analysis from four sets of experiments, immunoreactivity to the demethyl-sensitive antibody was on an average threefold higher intensity in proximal caput sperm compared to that in extracts of sperm from late caput and caudal regions of the epididymis. This indicates that PP2A is less methylated (more demethylated) in sperm from the proximal caput epididymis and that it is more methylated in sperm from the distal caput and caudal epididymis. Each of the experimental blots included immune detection of tubulin as a protein loading control.
Since PP2A, in somatic cells is known to undergo tyrosine phosphorylation [58], we next examined whether a similar situation existed with sperm PP2A. Western blot analysis was performed using a rabbit monoclonal antibody specific to tyrosine phosphorylated (Tyr 307)
PP2A. Immunoreactivity to this antibody revealed that PP2A in proximal caput but not distal
66
caput sperm extracts was tyrosine phosphorylated (Figure 4.5B). Caudal sperm show a slight increase in levels of PP2A tyrosine phosphorylation compared to sperm isolated from distal caput region of the epididymis.
Figure 4.5. Methylation and tyrosine phosphorylation status of sperm PP2A. A) Western blot showing the methylation status of PP2A in supernatant of HB+ sonicated sperm extracts from different regions of the epididymis, using anti-demethyl PP2A antibody (4B7). An equal number of sperm (4X106) were loaded in each lane. The blot was reprobed with anti-β-tubulin antibody as loading control. B) An equal number of sperm (8X106) were loaded in each lane, subjected to western blot, and probed with anti-PP2A Y307 antibody. The β-tubulin control from panel A is used as control in panel B aswell since they are both identical blots.
D. Microcystin-agarose binding confirms the presence and methylation status of sperm PP2AC
Data from figures 4.4 and 4.5 show that PP2A is present in equal amounts in developing epididymal sperm but it appears to be more methylated in sperm isolated from distal caput and caudal compared to sperm from early caput region of the epididymis. We used microcystin pull
67
down to further confirm that the immuno-reactive bands seen in western blot of sperm extracts are indeed due to PP2A. The cyclic peptide microcystin, a potent phosphatase inhibitor, covalently binds to the catalytic subunits of PP1 and PP2A [106,107]. Microcystin was able to almost completely pull-down PP2A, but not PP1γ2, from sperm extracts (Figure 4.6B). The inability of microcystin to completely pull down PP1γ2 in sperm extracts is previously documented [76] seen in figure 4.6A. Differences in immuno-reactivity to the demethyl-sensitive
PP2A-C antibody seen in sperm extracts are also observed in western blots of PP2A isolated by microcystin, indicating again that PP2A is less methylated in proximal caput sperm (Figure
4.6C).
Figure 4.6. Microcystin pulldown of sperm PP2A. A and B) Caudal sperm extracts (2X108 sperm/ml) were incubated with microcystin- sepharose beads. The microcystin- bound proteins were eluted by boiling with Laemmli buffer and analyzed by western blot with Anti-PP2A antibody (MC). 10 µl of the input caudal sperm extract was loaded as a positive control (Input). Flow through (FT) obtained following the pull down, i.e. sperm extract left behind after incubation with microcystin sepharose beads, shows negligible levels of PP2A at the same control input loading volume. A duplicate blot was probed Anti-PP1γ2 as a control for microcystin pull down. (C) Extracts from 5X107 sperm from each region of epididymis were
68
subjected to microcystin pull down. Equal amounts of the microcystin bound proteins boiled in SDS sample buffer were loaded in each lane and probed with anti-demethyl PP2A antibody. A duplicate blot was probed with anti-PP2A antibody as control.
E. Demethylation of methyl-PP2A by alkali treatment.
Though demethyl PP2A antibodies are well characterized, an independent method was desired to show that sperm PP2A methylation is different in the three regions of the epididymis.
Carboxy-methyl groups in proteins can be removed by sodium hydroxide treatment [63,108].
PP2A was first isolated from extracts of sperm from proximal caput, distal caput and caudal regions of the epididymis with microcystin-agarose. Microcystin-bound PP2A was then treated with 0.2 N NaOH. The extracts treated with NaOH were then neutralized with HCl. The methylation status of PP2A in control and NaOH treated samples was determined by western blot analysis. Results in Figure 4.7A show that sodium hydroxide treatment increased immuno- reactivity of PP2A to the demethyl-PP2A antibody in sperm extracts from distal caput and caudal regions, presumably due to demethylation of PP2A. Extracts from proximal caput epididymis were unaffected by sodium hydroxide because PP2A in this extract was not methylated.
Immuno-reactivity to the methyl-insensitive antibody was the same in alkali-treated and control samples showing equal amounts of PP2A in the samples. The methylation of PP2A was confirmed in mouse sperm as well by alkali lysis (Figure 4.7B).
69
Figure 4.7. Demethylation of PP2A by alkali treatment. A) Sperm extracts from proximal caput, distal caput and caudal regions of epididymis were subjected to NaOH treatment (+). Equal amounts incubated without NaOH are untreated controls (-). Details of the procedure are described in materials and methods. For each epididymal sperm extract, duplicate blots were processed, one was probed with anti-demethyl PP2A antibody and the other was probed with anti-PP2A antibody. B) Western blot showing demethylation of PP2A in mouse caudal sperm following NaOH treatment (+). A duplicate blot probed with anti-PP2A antibody as loading control.
F. Sperm PP2A activity during passage of sperm through the epididymis
We measured catalytic activity of PP2A in sperm extracts using phosphorylase a, which is a substrate for both PP1 and PP2A [109]. The total phosphatase activity expressed as a mean of n=5 ± SEM in proximal caput, distal caput, and caudal sperm extracts was 5.8, 2.1 and 1.4 mmol of PO4 released/minute/2x105 sperm, respectively. The heat-stable protein phosphatase
Inhibitor-2 (I-2) inhibits PP1 (IC50 of 1 nM) but not PP2A [110]. Sperm extracts contain both
PP1 and PP2A. Thus phosphatase activity measured in the presence of I-2 is due to PP2A. The
70
mean PP2A activity (obtained from three experiments) in proximal caput, distal caput, and caudal sperm extracts was 4.96, 1.24 and0.52 mmol of PO4 released/minute/2x105 sperm, respectively. As seen in Figure 4.8, PP2A activity in sperm from the proximal caput region is approximately fourfold higher compared to sperm from late caput or nine-fold higher compared to sperm from the caudal region of the epididymis.
Figure 4.8. Phosphatase activity of PP2A. Sperm extracts from proximal caput, distal caput and caudal regions of epididymis were prepared by sonication. The supernatant fraction of the extracts that has been previously shown to contain the majority of sperm PP2A was analyzed for phosphatase activity with phosphorylase a as the substrate. The mean phosphatase activity (of n=5 experiments ±SEM) is expressed as mmol of PO4.
71
G. Detection of PME1, LCMT1 and SAH hydrolase in sperm
The carboxy-methylation of PP2A is catalyzed by the PP2A specific methyl transferase
(LCMT1) in presence of S-adenosyl methionine (SAM) converting it to S-adenosyl homocysteine (SAH). S-adenosyl homocysteine hydrolase then converts SAH to homocysteine and adenosine in a reversible reaction. The demethylation of PP2A is carried out by PP2A specific methylesterase (PME1) (Figure 4.10). The enzyme PP2A methyl esterase, PME1 with a molecular weight of approximately 40 kDa was detected in sperm and testis of bovine by western blot using the Anti-PME1 (Millipore) antibody (Figure 4.9A). Mouse testis and sperm extracts were analyzed on western blot analysis along brain extracts and NIH 3T3 cell lysate as positive controls for Anti-PME1 antibody [111].
Western blot analysis of mouse testis and sperm extracts probed with Anti-LCMT1 antibody detected LCMT1 at ~38 kDa (Figure 4.9B) [112]. However, no immunoreactive band could be detected in the bovine testis or sperm supernatant extracts. This could be explained by the inability of the antibody to recognize bovine LCMT1 as the antibody was raised against
6His-tagged full-length mouse PP2A-methyltransferase/LCMT1 antigen. The bovine LCMT1 varies by 8 amino acids compared to human or mouse. Mouse brain known to harbor high levels of LCMT1 [60] and NIH3T3 cell lysate were loaded as positive controls for detection with Anti-
LCMT1 antibody.
The enzyme S-adenosyl homocystinase also referred to as S-adenosyl homocysteine hydrolase (SAH hydrolase) was also detected in mouse sperm by mass spectrometry of sperm proteins in an independent study at our laboratory (data not shown). This enzyme plays a key role in regulating the S-adenosyl homocysteine levels and could be directly or indirectly
72
involved in regulation of PP2A demethylation. The presence of these three enzymes will need to be ascertained.
Figure 4.9. PME1 and LCMT1 in sperm. A) Presence of immunoreactive PME1 (indicated by arrow) in HB+ sonicated supernatant fraction of sperm extracts from bovine caudal epididymis shown with Anti-PME1 antibody. However, several other non-specific bands were seen as well. B) Western blot showing detectable levels of LCMT 1 in mouse whole sperm extracts prepared in 1%SDS and testis extracts. Mouse brain and NIH 3T3 cell lysate were loaded as positive control for both Anti-PME1 and Anti-LCMT1 antibodies.
73
4.3 Results for Aim-I (B)
To determine the role of PP2A in sperm maturation and motility
A. Demethylation and tyrosine phosphorylation of PP2A following sperm incubation
with L-homocysteine and adenosine
S-Adenosyl-L-methionine (SAM) is a universal methyl donor in methylation reactions.
Following transfer of its methyl group SAM is converted to S-adenosylhomocysteine (SAH).
Cellular SAH is broken down to homocysteine and adenosine by the enzyme SAH hydrolase.
homocysteine and adenosine are further metabolized or transported out of the cell. Elevated
intracellular SAH is a feedback inhibitor of methyl transferases preventing methylation reactions.
Incubation of cells including spermatozoa with adenosine and homocysteine results in increased
intracellular SAH levels. L-homocysteine by itself also increases the intracellular SAH levels but
to a lesser extent than when adenosine is also present [113]. A proposed mechanism is shown
below in figure 4.10.
74
Figure 4.10. Possible mechanism for regulation of PP2A methylation in sperm. PP2A methyl transferase (LCMT1) carboxy-methylates PP2A utilizing S-Adenosyl-L-methionine (SAM) as the methyl donor converting it to S-adenosyl homocysteine (SAH). Simultaneously, PP2A is demethylated in the reverse reaction by the enzyme PP2A methyl esterase (PME1). SAH is further broken down to homocysteine and Adenosine by SAH hydrolase in a reversible reaction. High levels of SAH in sperm can inhibit LCMT1 thereby increasing the levels of demethyl-PP2A.
Caudal spermatozoa (108/ml) were incubated at 370C with 1 mM L-homocysteine with 1 mM adenosine, 1 mM L-homocysteine alone, or 1 mM adenosine alone for 10 min in a suspension buffer containing glucose and BSA. Western blot analysis of extracts of sperm following this incubation is shown in Figure 4.11A. In a parallel experiment (Fig. 11B), PP2A in extracts of untreated control sperm and sperm incubated in the presence of L-homocysteine and adenosine was concentrated by microcystin pull down followed by western blot analysis with the anti-phosphotyrosine-PP2A (Y307) antibody. Increased PP2A concentration by microcystin pulldown is required because of the lower affinity of the anti-phosphotyrosine-PP2A (Y307)
75
antibody. Incubation with L-homocysteine and adenosine results in demethylation (Figure
4.11A) and a corresponding increase in tyrosine phosphorylation of PP2A (Figure 4.11B).
Figure 4.11. In vivo demethylation of sperm PP2A. (A) Caudal sperm were incubated with 1 mM each of L-homocysteine and Adenosine (L-Hcy + Ado), 1 mM L- homocysteine (L-Hcy) or 1 mM adenosine (Ado) for 10 min. Sperm extracts were prepared by sonication and analyzed by western blot (2X106 sperm/lane) with anti-demethyl PP2A antibody and a duplicate blot probed with anti-PP2A antibody. Significant increase in levels of demethyl PP2A is observed on treatment with L-homocysteine and adenosine (L-Hcy + Ado) compared to the untreated control sperm. (B) PP2A in extracts of L-homocysteine and adenosine treated sperm was concentrated by microcystin pull down followed by western blot analysis of with anti-phosphotyrosine-PP2A (Y307) antibody shows increased levels of phosphorylated PP2A. C) Demethylation of PP2A in mouse caudal sperm on treatment with L-homocysteine and adenosine (L-Hcy + Ado).
A. Time course of SAH induced demethylation of PP2A in sperm.
Bovine caudal sperm were incubated at 370C with 0.5 mM L-homocysteine and adenosine or 1mM L-homocysteine and adenosine in HEPES buffer with glucose and BSA. 1 ml samples of the incubations were taken at various time points, spun down and extracts were made by sonication in HB+. Western blot analysis of sperm extracts following this incubation is shown
76
in Figure 4.12 (A, B). As seen in figure 4.12 (A), 0.5 mM L-homocysteine and adenosine takes a longer time period of 1-2 hrs for noticeable demethylation of PP2A and 3 hrs for significant demethylation. However, L-homocysteine and adenosine at a higher concentration of 1 mM induces significant demethylation of PP2A with in 10 min of treatment and progressively increases until complete PP2A demethylation at 2 hrs (Figure 4.12 B). This shows the concentration dependent and time course demethylation of PP2A by 1 mM L-homocysteine and adenosine in sperm.
Figure 4.12. Timecourse demethylation of PP2A by L-homocysteine and adenosine treatment of sperm. A) Sperm incubated with 0.5 mM L-homocysteine and adenosine for 0hr, 0.5hr, 1hr, 2hrs and 3hrs were subjected to western blot analysis with Anti- demethyl PP2A antibody. An equal number of sperm (4X106) were loaded in each lane. A duplicate blot was probed with Anti-PP2A antibody as control. B) Western blot analysis with Anti- demethyl PP2A antibody of sperm post 0hr, 10minutes, 0.5hr, 1hr, 2hrs and 3hrs incubation with 1mM L- homocysteine and adenosine (4X106 sperm loaded per lane). Incresead immunoreactivity is observed from 10min onward with Anti- demethyl PP2A antibody indicating higher levels of demethylation of PP2A.
77
B. Inhibition of PP2A by Okadaic acid.
Okadaic acid (OA) is known to inhibit PP1 and PP2 by covalently binding them. I was curious as to how pharmacologic inhibition of PP2A may affect its methylation. I had used okadaic acid (OA), which at nanomolar levels is known to inhibit PP2A but not PP1 [68]. Caudal sperm (108/ml) were incubated at 370C with 5 nM okadaic acid in HEPES buffer supplemented with glucose and BSA. Western blot analysis of these sperm extracts show inactivation of PP2A by demethylation induced under 10 minutes of incubation followed by progressive demethylation for 3hrs with 5 nM OA (Figure 4.13). Control sperm incubated at 370C in suspension buffer supplemented with glucose and BSA did not show any change in PP2A methyl status. The demethylation of PP2A is presumably due to increased hydrolysis of the methyl group on Leu 309 of PP2A.
Figure 4.13. Progressive demethylation of PP2A by 5nM OA treatment of bovine caudal sperm. Sperm incubated with 5nM OA for 0hr, 0.5hr, 1hr, 2hrs and 3hrs were subjected to western blot analysis with Anti- demethyl PP2A antibody. Control sperm incubated without OA for 0hr, 30min and 3hrs were also loaded in the last three lanes as control. An equal number of
78
sperm (4X106) were loaded in each lane. A duplicate blot was probed with Anti-PP2A antibody as control.
C. Hyperactivation like motility in caudal sperm induced by PP2A demethylation
The correlation of PP2A post translational modifications with sperm motility initiation is indicative of a possible role for PP2A in sperm motility. Hence it was examined if demethylation or inhibition of PP2A could initiate sperm motility in distal caput sperm. Distal caput sperm were treated with 1 mM L-homocysteine and 1 mM adenosine to demethylate PP2A or 5 nM okadaic acid to inhibit PP2A. These treatments could not initiate motility in immotile caput epididymal sperm even when L-homocysteine and adenosine concentrations were increased to 10 mM with up to four hours of incubation. However, as previously reported, higher concentration of the okadaic acid (1uM), a concentration that inhibits both PP1 and PP2A was able to initiate motility in immotile distal caput sperm [68].
While treatment with L-homocysteine and adenosine or okadaic acid did not stimulate motility in caput sperm, these compounds could affect the motility of caudal sperm. Caudal epididymal sperm (5X107/ml) were incubated with 5 nM okadaic acid or 1 mM L-homocysteine and adenosine in HEPES buffer supplemented with glucose and BSA at 370C. Motility was quantified with a Computer Assisted Sperm motility Analyzer (CASA) system. For the L- homocysteine and adenosine or okadaic acid treated sperm, all motility parameters were increased compared to control. The percent motility, path velocity (VAP), track speed (VCL), progressive velocity (VSL) and lateral amplitude (ALH) were increased. Results obtained from one of nine similar experiments are shown in table 4.1 and Figure 4.14. The motility stimulation by L-homocysteine and adenosine was surprising suggesting that increased levels of S-
79
adenosylhomocysteine inside the sperm cell may have decreased rather than increased phosphatase activity. Indeed, phosphatase activity measurement of L-homocysteine and adenosine-treated sperm had lowered PP2A activity compared to control sperm (Figure 4.15).
Table 4.1. Motility analysis of sperm. Caudal sperm treated with 1 mM L-homocysteine and adenosine or 5 nM OA for 10 min at 37oC were analyzed by CASA. Treated sperm show increased motility, Path velocity (VAP), Straight line velocity (VSL), Track speed (VCL) and lateral amplitude (ALH) compared to the control.
80
Figure 4.14. Computer assisted motility analysis of sperm. (A) Caudal sperm treated with 1 mM L-homocysteine and adenosine or 5 mM okadaic acid show increased percentage motility and progressive motility after 10 min of incubation. (B, C) Sperm velocity parameters such as path velocity (VAP), Straight line velocity (VSL), Track speed (VCL) and lateral amplitude (ALH) are also increased compared to the control. The data shown is a representation of nine similar experiments.
81
Figure 4.15. Catalytic activity of PP2A following its demethylation by L-homocysteine and adenosine treatment. Caudal sperm incubated with 1 mM L-homocysteine and adenosine were sonicated and the supernatant protein fraction was collected. Protein phosphatase activity in this fraction was measured with phosphorylase a as the substrate. Demethylation of sperm PP2A by L-homocysteine and adenosine resulted in decreased total phosphatase and PP2A catalytic activity. The mean phosphatase activities from five sets of experiments are represented as mmol of PO4 released/minute/2x105 sperm ± SEM. ‘*’ denotes significant difference with P< 0.05. The demethylation in each experiment was confirmed by western blot analysis of the sperm extract.
D. Effect of L-homocysteine and adenosine on distal caput sperm PP2A
To see if demethylation of PP2A could initiate sperm motility, immotile bovine distal caput sperm were incubated with 1 M L-homocysteine and adenosine. Western blot analysis of extracts from these treated sperm showed demethylation of PP2A (Figure 4.16). However this could not initiate motility in the caput sperm. Higher concentrations of L-homocysteine and
82
adenosine (2M, 5M and 10M) for various time points were examined but none initiated sperm motility.
Figure 4.16. Demethylation of PP2A in distal caput sperm with L-homocysteine and adenosine. Sperm incubated with 1mM L-homocysteine and adenosine were subjected to western blot analysis with Anti- demethyl PP2A antibody. An equal number of sperm (4X106) were loaded in each lane. A duplicate blot was probed with Anti-PP2A antibody as control.
E. PP2A demethylation in hyperactivated sperm.
Since demethylation of PP2A was observed to induce hyperactivation like-motility in caudal sperm, it is hypothesized that PP2A is demethylated in hyperactive sperm. Incubation of
3- sperm with bicarbonate (H2CO ) or calcium ionophore ionomycin in a 5% CO2 environment results in hyperactivation [40]. Bovine caudal spermatozoa (5X107 /ml) were incubated at 370C with 10 mM sodium bicarbonate in HEPES buffer supplemented with glucose and BSA in a 5%
CO2 incubator. Independently sperm were also incubated with calcium (0.5 mM) and ionomycin
83
(7 uM) in the 5% incubator. Hyperactivation of sperm by the two treatments was confirmed by their hyperactive motility analyzed by CASA. However, based on CASA analysis the efficiency of hyperactivation was less than ~60%. Western blot analysis of the hyperactivated sperm extracts with Anti- demethyl PP2A antibody showed increased demethylation of PP2A (Figure
4.17A). Hyperactivation induced demethylation of PP2A is reproduced in mouse caudal sperm as well (Figure 4.17B).
Figure 4.17. Demethylation of PP2A in hyperactivation induced sperm. A) Western blot of bovine caudal sperm hyperactivated by calcium ionophore ionomycin (Ca2+ + iono), bicarbonate 3- (H2CO ) and a combination of bicarbonate, L-homocysteine and adenosine (L-Hcy + Ado + 3- 6 H2CO ). An equal number of sperm (4X10 ) were loaded in each lane for SDS-PAGE followed by western blot analysis with anti- demethyl PP2A antibody. A duplicate blot was probed with Anti-PP2A as loading control. B) Western blot of mouse caudal sperm hyperactivated by 3- 6 bicarbonate (H2CO ). 2X10 sperm were loaded in each lane.
84
F. Tyrosine phosphorylation status is unaltered in PP2A demethylated sperm.
Hyperactivation of sperm is characterized by increase in tyrosine phosphorylation of sperm proteins [42]. Bovine caudal sperm incubated with 1mM L-homocysteine and adenosine or 5nM OA were subjected to western blot analysis with Anti-tyrosine phosphorylation antibody
(4G10; Santa Cruz biotechnology Inc). The phospho tyrosine profile of sperm proteins in treated sperm was similar to control sperm in HEPES indicating the inability of PP2A demethylation to induce protein tyrosine phosphorylation associated with hyperactivation in sperm.
Figure 4.18. Western blot to detect tyrosine phosphorylated proteins in 1mM L- homocysteine and adenosine or 5nM OA treated sperm. Bovine caudal sperm treated with 1mM L-homocysteine and adenosine or 5nM OA and control sperm from various time points of incubation were boiled with 1X Laemmli buffer, centrifuged and supernatant was collected. This supernatant was analyzed by western blot with Anti-tyrosine phosphorylation antibody diluted in 0.1% BSA. An equal number of sperm (4X106) were loaded in each lane.
G. Phosphorylation of GSK3 by PP2A demethylation in caudal sperm.
GSK3 is a cytosolic protein in sperm known to be involved in sperm motility. It exists as an active form when dephosphorylated in the caput sperm but inactivated due to phosphorylation at
85
the serine residues in the motile caudal sperm [68,114]. GSK3 is a known substrate of PP2A in other cells [115] and moreover the phosphorylation status of GSK3 correlates with the activity pattern of PP2A in maturing sperm. To investigate GSK3 as a possible substrate for PP2A in sperm, HB+ sonicated supernatant extracts of L-homocysteine and adenosine or OA treated sperm were subjected to western blot analysis with Anti-Phospho GSK3α/β (Ser 21/9) antibody. It is observed that demethylation of PP2A by either 1mM L-homocysteine and adenosine or 5nM OA results in increased serine phosphorylation of GSK3 (Figure 4.19).
Figure 4.19. Serine phosphorylation of GSK3α/β by treatment that results in demethylation of PP2A. Western blot analysis with anti-phospho GSK3α/β (pSer 21/9) antibody of a sperm supernatant fraction (2X106 sperm/lane) from sperm treated with 1 mM L-homocysteine and adenosine or 5 nM okadaic acid show increased immunoreactivity at 55 kDa and 47 kDa corresponding to phosphorylated GSK3α and GSK3 respectively. The same blot was re-probed with Anti-PP2A antibody showing equal protein loading.
86
4.4 Discussion for aim I
PP2A is one of the two serine/threonine phosphatases in sperm. The other is PP1γ2,
which is present both in the supernatant and pellet fractions of sperm sonicates [116]. This study
shows that sperm PP2A is almost entirely cytosolic, with negligible amounts in the pellet
fraction of sperm sonicates. Western blot analysis, using a demethyl-sensitive PP2A antibody,
indicates that PP2A is in its demethylated form in sperm from the proximal caput region of
epididymis. As sperm mature and progress to the distal caput region PP2A undergoes
methylation on its carboxy terminus with a corresponding reduction in tyrosine phosphorylation.
These changes in the methylation state of PP2A were deduced by the use of the demethyl-
sensitive and methyl-insensitive PP2A antibodies. PP2A in sperm from distal caput and caudal
regions underwent an apparent increase in methylation resulting in decreased immuno-reactivity
to the demethyl-sensitive antibody. The methylation status of PP2A was further confirmed by
demonstrating that microcystin-bound PP2A can be demethylated by alkali treatment. Proximal
caput sperm PP2A was unaffected by alkali treatment suggesting it was in its demethylated form.
It may be noted that the proportion of the PP2A protein that is methylated in distal caput and
caudal epididymal sperm is not known.
Reversible methylation of PP2A requires the presence of leucine carboxyl methyl
transferase 1 (LCMT1) and PP2A specific methyl esterase 1 (PME1) [112]. The enzymes PME1
and LCMT1 are present in testis and sperm. PME 1 was detected in both mouse and bovine testis
and sperm extracts. Western blot analysis of mouse testis and sperm SDS extracts probed with
Anti-PPMT1 antibody detected LCMT1 at ~38 kDa (Figure 4.9 B). However no immunoreactive
band could be detected in bovine testis or sperm supernatant extracts. This could be explained as
87
the antibody was raised against mouse LCMT1 and is reactive specifically to mouse and rat.
Bovine LCMT1 protein sequence being only 85% similar to that of mouse may not be recognized by this antibody. Mouse brain a tissue known to contain high levels of LCMT1 [60] and NIH3T3 cell lysate were loaded as positive controls for identifying LCMT1in western blots.
The fact that PP2A methylation changes in vivo and in vitro (Figures 4.5 and 4.11) also implies the presence of LCMT1 and PME1 in sperm. Phosphorylation of PP2A-C occurs on Tyr307
[55,61]. The protein kinases thought to tyrosine phosphorylate PP2A-C are: pp60c-src, p56lck, epidermal growth factor receptors, and insulin receptors [55]. The enzyme responsible for tyrosine phosphorylation of sperm PP2A is not known.
The universal methyl donor in methylation reactions is S-adenosyl methionine (SAM).
Following donation of the methyl group SAM is converted to S-adenosyl-homocysteine (SAH).
SAH in turn can be hydrolyzed to homocysteine and adenosine by the enzyme SAH-hydrolase.
Intracellular SAH is a feedback inhibitor of methylation. Intriguingly, SAH-hydrolase contains an allosteric binding site for cAMP, which activates the enzyme [117,118]. This action of cAMP on SAH-hydrolase activity would be independent of PKA activation. The ability of PP2A to associate with a variety of regulatory subunits and/or the essential requirement for reversible methylation of the catalytic subunit suggests - multiple mechanisms for regulating PP2A activity in cells.
PP2A methylation is associated with lower catalytic activity (Figure 4.8) as sperm traverse the epididymis. That is, catalytic activity is high when PP2A is in its demethylated form in immature proximal caput epididymal sperm. Given this situation in vivo it is puzzling that the activity of PP2A is lowered (Figure 4.15), rather than increased, in caudal epididymal sperm
88
following incubation of sperm with adenosine and homocysteine in vitro which results in demethylation of PP2A. It is possible that SAH is both an inhibitor of methyl transferase and of
PP2A activity. It is interesting in this regard that pharmacological inhibition with okadaic acid also causes demethylation of PP2A (Figure 4.13). Indirect evidence correlating increased SAH levels with increased tau-phosphorylation in the brain may support the notion that SAH may also inhibit PP2A catalytic activity [119]. Alternatively it is possible that demethylated PP2A is less active in caudal epididymal by virtue of the differences in the composition of the PP2A holoenzyme in early caput compared to caudal sperm. Virtually nothing is known about the components of the PP2A holoenzyme in sperm. Formation of the PP2A holoenzyme is one of the consequences of PP2A methylation. Further insights into the catalytic activity of PP2A in relation to its methylation must await information about the regulatory proteins associated with
PP2A in developing sperm.
Efforts to increase PP2A methylation in early caput epididymal sperm by incubation with methionine and adenosine were unsuccessful. Why and how methylation occurs in vivo during sperm maturation and whether sperm contain sufficient levels of intracellular SAM are not known. The relationship between PP2A methylation and PP2A catalytic activity can be better understood when specific approaches to alter the methylation status of PP2A become available.
A series of studies in the 1980s with human, mouse and hamster sperm suggested that protein carboxy-methylation was involved in sperm motility [113,120-124]. At that time, the identities of the macromolecules modified by methylation in sperm were not known. The assays for methylation in these early reports used BSA as a methyl acceptor. We suggest that the results of these early studies can be re-interpreted in light of the discovery that sperm PP2A is regulated
89
by methylation. It is possible that the motility effects observed in these earlier studies attributed to changes in sperm protein carboxy-methylation might well be due to PP2A regulation.
The down-stream targets of PP2A are yet to be determined. One of the substrates of sperm PP2A is the signaling enzyme glycogen synthase kinase 3, GSK-3. The role of PP2A in dephosphorylating GSK3 in somatic cells is documented [115]. It has been previously shown that, during passage through the epididymis, as sperm gain the capacity for motility, sperm GSK-
3 is phosphorylated on a serine residue leading to a reduction in its catalytic activity [114]. Based on the observations in this study, it can be speculated that the catalytically active PP2A dephosphorylates GSK-3 in immotile distal caput sperm and as the sperm reach the caudal epididymis PP2A is inactivated allowing serine phosphorylation of GSK-3. A substrate of GSK-
3 in epididymal sperm is the PP1 regulatory subunit, PPP1R2 (inhibitor I-2) [68,125]. The inhibitor I-2 in its dephosphorylated state binds to PP1γ2 and inhibits its catalytic activity in caudal epididymal sperm. Phosphorylated I-2 dissociates from PP1γ2, leading to stimulation of the catalytic activity of PP1γ2 in caput epididymal sperm. Interestingly, the PP1γ2 - I-2 complex appears to be localized exclusively in the pellet fraction of the caudal sperm axoneme. Thus, changes in PP2A activity may influence PP1γ2 activity in the flagellum through its regulation of
GSK3 which in turn regulates phosphorylation of I-2. This proposed mechanism is shown in figure 4.20.
Demethylation of PP2A in caput sperm either with 1mM SAH or 5nM OA could not initiate motility. Thus, inhibition of PP2A by itself cannot initiate sperm motility. It has been previously shown that motility initiation requires conditions that inhibit PP1 [126]. However in motile sperm inhibition of PP2A, either by L-homocysteine and adenosine or OA by incubation
90
leads to significant stimulation of sperm motility. We believe that the motility patterns exhibited by sperm resemble hyperactivation. Others have made similar observations with porcine sperm using differential inhibition of PP1 and PP2A. Whether PP2A undergoes changes in its methylation and catalytic activity in sperm during hyperactivation in the female reproductive tract prior to fertilization merits investigation.
In summary the data from this study shows that PP2A is present in spermatozoa and document for the first time that changes in its catalytic activity occurs during passage of sperm through the epididymis. PP2A from distant caput sperm is methylated probably to facilitate the binding of the B-regulatory subunit and to localize the PP2A trimer to its specific substrate molecules. This active PP2A regulates these substrate proteins which could be a subset of proteins involved in a pathway controlling motility initiation in the immotile sperm of distal caput region. However, inhibition of PP2A alone is not sufficient for motility initiation but stimulates motility in sperm that are already motile. This implicates a role for PP2A in stimulating hyperactive motility of sperm either directly or indirectly. One of the targets of PP2A is GSK3 since its phosphorylation is increased by inhibition of PP2A. The relationship between
PP2A, GSK3 phosphorylation, PP1γ2 activity and sperm PKA in regulating sperm function during initiation of sperm motility and during fertilization of eggs is being investigated in our laboratory.
91
Figure 4.20. Proposed model for PP2A regulation of PP1 PP2A methyl transferase (LCMT1) carboxy-methylates PP2A utilizing S-Adenosyl-L-methionine (SAM) as the methyl donor converting it to S-adenosyl homocysteine (SAH). Simultaneously, PP2A is demethylated in the reverse reaction by the enzyme PP2A methyl esterase (PME1). SAH is further broken down to homocysteine and Adenosine by SAH hydrolase in a reversible reaction. Methylated PP2A localizes to one of its substrates GSK3 and dephosphorylates it, resulting in increased GSK3 activity in distal caput sperm. GSK3 in its active form phosphorylates Inhibitor 2 (I-2) of the PP1-I2 complex resulting in its disassociation from PP1. Free PP1unbound by I-2 is highly active preventing motility initiation of caput sperm.
92
5. Aim II: Determine the reason for the isoform specific requirement of PP1 for spermatogenesis and sperm function.
5.1 Background and Rationale
In non-mammalian species three PP1 isoforms are observed, PP1α, PP1β and PP1γ1 expressed by three genes. The spermatozoa of these animals utilize any of these three isoforms for their sperm function. For example, xenopus sperm was shown to contain PP1γ1 while turkey and sea urchin sperm contain PP1α [71]. With the evolution of mammals we observe two PP1γ isoforms, PP1γ1 and PP1γ2 derived from the same gene Ppp1cc by alternate splicing predominantly in testis. The Ppp1cc pre-mRNA of approximately 16.91 kb constitutes 5’ UTR,
3’ UTR, 8 exons and 7 introns. The PP1γ1 mature mRNA of approximately 2.4 kb is generated by splicing of introns 1 through 6. The intron 7 is retained in the mature transcript along with exon 8 and its downstream sequence as 3’ UTR. Only in the mammalian male germ cells, the
Ppp1cc pre-mRNA is alternately spliced to produce the PP1γ2 transcript by splicing out introns 1 through 6 along with the 1kb long intron 7. This generates a shorter transcript of approximately
1.4 kb. The exon 8 of PP1γ2 transcript gives PP1γ2 its unique 22 amino acid C-terminus
[127,128] (Figure 5.1). PP1γ1 and PP1γ2 are identical in structure and their catalytic domain except for the extra C-terminus tail in PP1γ2. The 22 amino acids at C-terminus of PP1γ2 is highly conserved among mammalian species [73] indicative of its essential role in the functioning of PP1γ2. The splice donor and splice acceptor sites for exon 8 and its flanking regions are also well conserved. 93
Figure 5.1. Schematic of generation of the two PP1γ isoforms. The mature PP1γ1 mRNA encodes a protein containing 314 amino acids derived from the seven exons and 8 amino acids from the extended exon 7. In mammalian testicular germ cells intron 7 is spliced out giving rise to the unique 22 amino acid C-terminus encoded by exon 8 in PP1γ2.
PP1 is expressed constitutively except in the differentiating male germ cells and spermatozoa, where PP1 the splice variant of PP1 is expressed in high levels. PP1γ2 has been shown to be expressed specifically in meiotic cells of adult rat testis [129]. It is highly expressed during meiosis in testis i.e. in spermotocytes and is also incorporated in spermatozoa.
However the expression levels of PP1α, PP1β and PP1γ1 were observed to be constant through all the stages of spermatogenesis [70].This suggests an essential role for high levels of PP1γ2 in later steps of spermatogenesis including meiosis and sperm morphogenesis. This was confirmed
94
with generation of Ppp1cc null mice that showed male infertility due to impairment of spermatogenesis from the stage of round spermatids. The epididymis of these mice lacked mature sperm but showed sloughed immature germ cells that primarily included round spermatids [64,72].
PP1is also the only PP1 incorporated into sperm of many mammalian species. As described previously PP1γ2 was shown to be a very important regulator of sperm motility.
Inhibition of PP1 activity with compounds such as okadaic acid and calyculin A results in initiation of motility in immotile caput spermatozoa or stimulate motility in motile caudal sperm
[68,69]. Hence PP1enzyme appears to have an irreplaceable role in mammalian spermatogenesis and sperm function even though it is catalytically identical to other PP1 isoforms.
To show the onset of high PP1γ2 expression level during meiosis of germ cells in testis,
RT-qPCR was performed with RNA isolated from testis of 10, 15, 20, 25 and 60 days postpartum mice (Figure 5.2). The forward primer 5’CCCATCAGGTGGTTGAAG3’ spanning the junction of exons 5-6 and the reverse primer 5’CTTGCTTTGTGATCATACCC3’ spanning the 3’ end of exon 7 that gives PP1γ1 its unique C-terminus were used to detect PP1γ1 transcript specifically. PP1γ2 transcript was detected with forward primer
5’CCACCACGGGTTGGATCAG3’ and reverse primer 5’GTATAAACCGGTGGACGGCA3’ spanning the junction of exons 7-8 and 3’UTR respectively. It is observed that PP1γ1 is detected in the 5 and 10 day old mice testis that consist of mainly Sertoli cells and spermatogonia. No increase is observed even at day 15 with onset of meiosis and emergence of secondary spermatocytes. There is a negligible increase in PP1γ1 expression levels post weaning after 25
95
days but stays constant through the adult age. This reinforces the previous observation that
PP1γ1 is expressed only in Sertoli, Leydig and spermatogonial of testis [130]. In contrast, PP1γ2 transcript levels increase by 5-6 times by day 15 with the onset of meiosis II as the secondary spermatocytes emerge. We observe a sudden spike by 40 times in PP1γ2 levels by day 25 in the presence of post meiotic round spermatids and is maintained at high levels in the adult testis (60 days). This is in support of the developmental northern blot and western blot analysis showing that the levels of PP1 increases drastically while the other PP1 isoforms remain constant at basal levels in the testis of 15 days old mice. Interestingly, the PP1 regulators sds22, I-3 and I-2 paralleled PP1γ2 expression pattern in testis [70,72]. This phenomenon of synchronized expression of PP12 and its regulatory proteins is indicative of a common mechanism regulating/controlling the transcription of these molecules. In addition to the essential role of
PP1γ2 in sperm morphogenesis and sperm function, it could also be regulating the expression or stability of sds22, I-3 and I-2 in testis that can probably be substituted by PP1. PP1 being identical to PP1for ~90% of the sequence including the catalytic region should be able to substitute for PP1 The highly conserved C-terminus tail of PP1in mammals does not appear to influence the catalytic activity of PP1It is hence hypothesized that the reason for PP1γ2 evolution is to meet the requirement of high PP1 levels in testis and not for its unique
C-terminus. This hypothesis was tested by expressing transgenic PP1γ1 in the germ cells of
Ppp1cc-/- mice. This study aims to provide insights into the evolutionary requirement of PP1γ2 in mammals and its regulation.
96
Figure 5.2. Developmental expression of PP1γ1 and PP1γ2 mRNA: RT-qPCR of mRNA from testis of 10, 15, 20, 25 and 60 postnatal day old mice using PP1γ1 specific and PP1γ2 specific primers showing exponential increase of PP1γ2 mRNA from day 15 with the onset of secondary spermatocytes. PP1γ1 however is expressed only at basal levels throughout indicating it is restricted to Sertoli cells, leydig cells and spermatogonia in testis.
Transgene constructs:
In an effort to express transgenic PP1in differentiating male germ cells of Ppp1cc -/- mice, the following transgene constructs were generated. The mice lines carrying these constructs are referred to as Rescues as they were intended to Rescue sperm morphogenesis and sperm function in Ppp1cc -/- mice.
97
i. Rescue I: Testis specific promoter, Pgk2 driven PP1 cDNA (N-line)
The construct was made with the cDNA of PP1lacking the 5’ and 3’UTR’s followed by a SV40 polyadenylation tail. This construct was driven by the testis specific Pgk2 promoter that will express PP1 only in the developing male germ cells from the secondary spermatocyte stage (Figure 5.3A). The highest expressing line (N-line) of all the transgenic founder lines delivered to us after microinjection was retained for detailed analysis [132]. Rescue mice were obtained by crossing the transgene positive animals with Ppp1cc-/- mice on the CD1 background.
ii. Rescue II: Pgk2 driven PP1 cDNA with 3’ and 5’UTR transgene (AK line)
The transgene constituted cDNA of PP1along with intron 7, 5’ UTR and part of
3’UTR’ followed by a SV40 polyadenylation tail. However the 3’ splice site on exon 8 was mutated to prevent splicing. This transgene is driven by the testis specific Pgk2 promoter (Figure
5.3B). This construct was prepared in the lab by Nilam Sinha. Of all the transgenic lines delivered to us after microinjection only the highest expressing line (AK-line) was retained for detailed analysis. Rescue mice were obtained by crossing the transgene positive animals with
Ppp1cc -/- mice on the CD1 background (Figure 5.4).
98
iii. Rescue III: Endogenous Ppp1cc promoter driven PP1cDNA with 3’ and 5’UTR.
This construct consisted of the entire PP1γ1 cDNA (including the whole of intron 7 and
3’ UTR region). However the splice donor site on exon 7 and splice acceptor site on exon 8 have been mutated to prevent splicing (Figure 5.3C). This would ensure production of only PP1γ1 and not PP1γ2 in testis. The transgene is controlled by a 1.5kb region upstream of the Ppp1cc gene that has shown to consist of promoter activity [73]. This construct was prepared in the lab by
Nilam Sinha.
Figure 5.3. Design of PP1γ1 Rescue constructs. A) Driven by the Pgk2 promoter is Rescue I construct consisting of PP1γ1 cDNA including a part of intron 7. B & C) Constructs of Rescues II and III consist whole of intron 7, and 3’ and 5’ UTR’s driven by Pgk2 and Ppp1cc (Endo) promoters respectively. The arrows indicate mutation of the splice donor and acceptor sites.
99
Breeding and genotyping mice
The mice were ear punched to tag them and simultaneously the ear tissue was utilized to isolate genomic DNA by alkaline lysis for genotyping. Transgenic mice produced by microinjection and embryo transfer were genotyped for the presence of the transgene (founders).
Three sets of primers (sequences shown in table 3.2) were utilized to confirm the presence of transgene as follows:
1) Exon 6 forward and SV40 internal reverse generating ~ 0.5 Kb fragment.
2) SV40 For and SV40 Rev producing a 0.2 Kb fragment.
3) Pgk2 For and SV40 Rev: producing a 1.6 Kb fragment.
Each founder was then used to establish individual transgenic lines. Transgenic lines from male founder were established by crossing male founders (Tg; +/+) with Ppp1cc null (-/-) females. The obtained litters were genotyped and the males bearing the transgene (Tg; +/- genotype) were further mated with Ppp1cc null females to obtain males of Tg; -/- genotype
(Rescue). Transgenic lines from female founder were established by crossing the female founders (Tg; +/+) with males heterozygous for Ppp1cc (+/-). These Tg; +/- males were crossed with Ppp1cc null females to obtain male Rescues (Tg; -/-). For maintenance, the transgene (Tg) was detected with Exon 6 forward and SV40 internal reverse primers. The absence of endogenous Ppp1cc gene (-/-) was identified with intron 4 forward and intron 6 reverse or Neo cassette reverse (MA) primers.
100
Figure 5.4. Breeding scheme of transgenic mouse lines.
101
5.2 Results for Aim-II:
Can PP1 substitute PP1 in spermatogenesis and sperm function if expressed in germ cells?
5.2.1 Quantitation and comparison of PP1γ isoforms in testis and sperm
of Ppp1cc +/+ and Ppp1cc +/- mouse
A. Expression of Recombinant PP1 and PP1 protein.
PP1 and PP1 cDNA were cloned into pTACTAC vector containing a 6 histidine
amino acid tag and expressed in BL21 strain of E.Coli. Following induction and expression, the
bacterial cells were lysed by sonication and recombinant proteins were purified using nickel
column. The column bound recombinant proteins were eluted with increasing concentrations of
immidazole and subjected to SDS PAGE with coomassie staining to check for purity (Figure
5.5). His- PP1 and PP1 fraction eluted with 300mM immidazole (lane 3) were further
purified by centrifugation (lane 5) and protein estimated. His-PP1 and His-PP1 protein
concentrations were estimated with Bradford assay and confirmed by intensity comparison with
99.6% pure BSA on a SDS PAGE. This purified and protein estimated fractions (from lane 5) of
His- PP1 and PP1were used in the further experiments.
102
Figure 5.5. Coomassie stained SDS PAGE of expression and purification of His-PP1 and His-PP1. Lane 1 is the wash fraction of the recombinant protein bound nickel beads with 60mM immidazole. Lanes 2, 3 and 4 are the fractions eluted with 100mM, 300mM and 500mM immidazole respectively. Lane FT is the cell lysate flow through after passing through the nickel column. Lane 5 is the purified sample of 300mM eluate.
B. PP1 quantification in wild type mouse testis.
Known protein concentrations of recombinant His-PP1 and CD1 wild type (Ppp1cc
+/+) mouse testis extracts were subjected to western blot analysis with Anti-PP1 antibody. The immunoreactivity of the bands following western blot analysis was measured by densitometry with the Multiguage software and confirmed by Image J. The PP1 protein levels were then quantified in nanogram (ng) levels by comparison of the immunoreactivity intensity ratios of
PP1 in testis with standard curve generated from known concentrations of His-PP1. This was repeated on three different Ppp1cc +/+ mice by three separate western blots and the mean
103
PP1 levels expressed in testis was obtained (Table 5.1). A representation of the three experiments is shown in figure 5.6. From the quantification studies, CD1 wild type mouse testis expresses an average of 5ng PP1γ2 per every 5µg of testis extract.
Figure 5.6. Western blot analysis for quantification of PP1 in testis. Serial diluted samples of His-PP1 (10ng, 5ng and 2.5ng) and CD1 wild type mouse extracts (2.5μg, 5μg and 10μg) were loaded and subjected to SDS PAGE followed by western blot analysis with Anti-PP1 antibody.
His-PP1γ2 His-PP1γ2 His-PP1γ2 Testis Testis Testis 10ng 5ng 2.5ng 2.5µg 5 µg 10 µg
Band intensity 22.61 16.7 9.4 11.5 16 18.3
PP1γ2 levels in ng 10 5 2.5 2.9 5.7 7 from figure 5.6
Mean PP1γ2 levels 10 5 2.5 2.57 ± 5.38 ± N/A from 3 mice (n=3) 0.12 0.31 ± SEM
Table 5.1. Levels of PP1 in testis. The intensity of the PP1 immunoreactive bands were measured and recorded. The PP1 levels were calculated based on the intensity ratios for various testis protein amounts. The levels of PP1γ2 protein obtained for 10µg of testis extract is erroneous and not considered as the immunoreactive band at this concentration is saturated giving a lower than expected intensity.
104
C. Quantification of PP1 in wild type mouse sperm.
Caudal sperm were collected from two mice individually (mouse 1 and 2), sperm counted and whole sperm extracts were made by boiling with Laemmli buffer. Sperm extracts were serially diluted, and 105 and 106 sperm of each mouse-1(sperm 1) and mouse-2 (sperm 2) were loaded per lane for SDS PAGE. Serial diluted recombinant His-PP1 was loaded along the sperm samples on the SDS PAGE and subjected to western blot analysis with anti-PP1 antibody. The intensity of the immunoreactive bands was measured to quantitate the PP1 levels in sperm as shown in table 5.2 below. The analysis was repeated with four CD1 wild type
(Ppp1cc+/+) sperm extracts to obtain the mean PP1γ2 levels incorporated in sperm. A representative blot is shown in figure 5.7. From the quantitative analysis 106 sperm has 7.85 ±
0.1 ng of PP1.
Figure 5.7. Western blot analysis for quantification of PP1 in mouse sperm. Serial diluted His-PP1 (10ng, 5ng and 2.5ng) and whole perm sperm extracts prepared from two individual CD1 wild type mice were subjected to western blot analysis with Anti-PP1 antibody. 105 and 106 sperm from mouse 1 (sperm 1) and mouse 2 (sperm 2) were loaded per lane.
105
His- His- His- Sperm (1) Sperm (1) Sperm (2) Sperm (2) PP1γ2 PP1γ2 PP1γ2 105 106 105 106 10ng 5ng 2.5ng
Band intensity 24.2 12.3 6.5 2.2 19.6 1.8 19.1
PP1γ2 levels in 10 5 2.5 0.7 8 0.65 7.9 ng from fig 5.7
Table 5.2. Levels of PP1 in sperm. The intensity of the bands from figure 5.7 were measured and recorded. PP1 levels were calculated based on the intensity ratios for 105 and 106 sperm from mouse 1 (sperm 1) and mouse 2 (sperm 2).
D. Comparison of PP1 and PP1 among CD1 Ppp1cc +/+ and Ppp1cc +/- mouse testis
Mice lacking both the PP1 isoforms due to the targeted knockout of the Ppp1cc gene (-/-
) results in male sterility [64]. However, mice heterozygous for the Ppp1cc gene (+/-) are fertile but have decreased testis weight and sperm number by 10%, compared to wild type as shown in table 5.3 below. To check for dosage dependent expression of the Ppp1cc gene, equal protein from age matched Ppp1cc +/+ and +/- mice testis extracts were loaded and analyzed by western blot analysis for PP1 and PP1 levels (Figure 5.8). The intensity of the immunoreactive bands was measured with the Multiguage software and was also confirmed with Image J software. It is observed that there is a 48 ± 4.4 % decrease in PP1 and 28 ± 5.1 % decrease in PP1 expression of a Ppp1cc +/- testis (Figure 5.9). This data was reproduced with six sets of mice and a representative western blot is shown as figure 5.8. The decreased PP1 expression levels in testis are reflected phenotypically as decreased sperm number and testis size (table 5.3). sds22 a binding partner of PP1 was unaltered in its protein levels by the change in PP12 levels.
106
However, inhibitor I-3 showed a change with two close immunoreactive bands seen in Ppp1cc
+/+ and only one band when PP12 levels were lowered (Ppp1cc +/-) or in absence of PP12
(Ppp1cc-/-). The doublet could be slow migrating phosphorylated I-3 and a faster migrating unphosphorylated I-3 occurring in wild type while the Ppp1cc +/- and -/- mice have only the unphosphorylated I-3.
Figure 5.8. Western blot comparing PP1 and its interacting proteins in wild type(+/+) and Ppp1cc +/- testis. Testis of 4 month old mice were homogenized in HB+ and the extracts were protein estimated by Bradford assay. Serially diluted extracts boiled with laemmli buffer were subjected to western blot analysis. Wildtype (+/+) and Ppp1cc heterozygous (+/-) extracts were serially diluted and loaded in sets of 2.5ug, 5ug, 10ug and 15ug protein per lane. 15ug of Ppp1cc knock out (-/-) testis extract was also loaded as negative control for PP1 and for comparision of the PP1 interacting proteins. Replicates of the blot were probed with PP1, PP1, sds22, I-3 antibody and lastly with β-tubulin antibody for loading control.
107
Figure 5.9. PP1 and PP1 expression ratio in testis of Ppp1cc +/+ and Ppp1cc +/- mice. From the western bot analysis, PP1 and PP1immunoreactivity ratios were measured by Multiguage software from six sets of Ppp1cc +/+ and Ppp1cc +/- mice. The immunoreactive band intensity (expression level) of PP1 and PP1was considered to be 100% for each set of Ppp1cc +/+ mice compared. The mean comparitive expression levels of PP1and PP1 in Ppp1cc +/- were calculated and shown in A and B respectively. Unpaired t-test was used to compare the levels (*** indicates significant difference with P value ≤ 0.0002).
Ppp1cc +/+ Ppp1cc +/- Mean % decrease in Ppp1cc +/-
Mean testis weight (mg) ± SEM 121.3 ± 5.4 110.7 ± 1.1 10 ± 1.7 (n=11) (n=11)
Mean sperm count (X107) ± SEM 4.97 ± 0.32 4.62 ± 0.25 10 ± 0.43 (n=11) (n=11) Mean ng of PP1γ1/10µg testis ± 1 (n=6) 0.52 ± 0.44 48 ± 4.4 SEM (n=6)
Mean ng of PP1γ2/10µg testis ± 10 (n=6) 7.2 ± 0.5 28 ± 5.1 SEM (n=6)
Table 5.3. Comparitive phenotypic values of Ppp1cc +/+ and Ppp1cc +/- mice. Testis weights were measured with tunica intact. Sperm isolated from both cauda and vas deferns of each mouse were counted and represented in multiples of 107. The mean difference in testis weight and sperm count between Ppp1cc +/+ and Ppp1cc +/- mice is expressed as percentage decrease in Ppp1cc +/- mice. The age of mice sets compared varied from 2-5 months. The levels of PP1γ1 and
108
PP1γ2 expression in Ppp1cc +/- testis was calculated based on densitrometry comparision values of PP1γ1 and PP1γ2 expression between Ppp1cc +/+ and Ppp1cc +/- mice.
E. Comparison of PP1 and PP1 in Ppp1cc +/+ and Ppp1cc +/- mice brain.
Ubiquitously expressed PP1 can be detected along with basal level of PP1 expression in the mouse brain. In comparison to testis, very high levels of brain protein (~16 fold) were required for detection of PP1 and PP1on western blot. Comparison of PP1 and PP1 expression levels in brain of Ppp1cc +/+ and +/- duplicated the pattern observed in testis.
Figure 5.10. Western blot of PP1 levels in Ppp1cc +/- and Ppp1cc +/- brain. Whole brain extracts from two Ppp1cc +/+ and Ppp1cc +/- mice aged 3.5 months were protein estimated and 30ug of protein was loaded in each lane for detection with Anti-PP1 antibody. A duplicate blot with 80ug protein per lane was probed with Anti-PP1 antibody. The blot probed with Anti- PP1 was reprobed with β-tubulin for equal loading control.
F. Comparison of PP1 and PP1 in Ppp1cc +/+ and Ppp1cc +/- mouse sperm.
Caudal sperm of Ppp1cc +/- mice showed lower levels of PP1 maintaining the pattern observed in the testis. This implicates that testis expressing low levels of PP1 produces sperm
109
that incorporate lower levels of PP1. The levels of I-3 were also diminished as observed in the testis. However, sperm have normal morphology, sperm function and ability to fertilize.
Figure 5.11. Western blot comparing Ppp1cc +/+ and Ppp1cc +/- sperm. Whole sperm extracts from two Ppp1cc +/+ and Ppp1cc +/- mice aged 3.5months were sperm counted and 5X105 of sperm were loaded in each lane for detction with Anti-PP1 antibody. Ppp1cc knockout (-/-) testis extract was also loaded as negative control for PP1 antibody. A duplicate blot was probed with anti-I-3 antibody. The blot probed with Anti-PP1 was reprobed with β- tubulin for equal loading control.
G. Distribution of PP1 and its regulators in sperm.
PP1 in spermatozoa is known to exist in phosphorylated and unphosphorylated forms
[77]. Bovine spermatozoa at various stages of maturation from proximal caput and caudal region of epididymis were isolated and subjected to sonication followed by centrifugation to obtain the tail fraction as a pellet (pelt) and cytosolic fraction as supernatant (sup). Western blot analysis of these fractions with antibodies against PP1 revealed presence of lower levels of PP1 suspected to be unphosphorylated form (observed as the faster migrating band) in
110
cytosol/supernatant. The tail however contains larger proportion of sperm PP1 suspected to be both the phosphorylated (observed as the slower migrating band) and unphosphorylated forms
(Figure 5.12A). Analysis of the PP1 interacting proteins in these fractions indicate to the existence of two pools of PP1 binding proteins. The suspected unphosphorylated PP1 with sds22, I-3 and 14-3-3 is present in cytosol (sup) while the Phospho –PP1 and I-2 in the tail fraction (pelt) (Figure 5.12B). This is supported by previous findings that PP1, sds22 and I-3 exist as a complex in sperm [133]. We hypothesize that the activity of PP1 is regulated by its phosphorylation and by binding its regulatory proteins for its role in sperm maturation and function. We expect to observe the same pattern of distribution in the sperm of PP1 transgenic mice where PP1 would be incorporated instead of PP1.
Figure 5.12. Western blot analysis of supernatant and pellet fractions of sperm. A) Supernatant (sup) and pellet (pelt) fractions of bovine spermatozoa isolated from three regions of epididymis were analyzed by western blot analysis with Anti-PP1 antibody. The higher band
111
labeled pPP1 is the suspected phosphorylated form and the lower band labeled PP1 could be the unphosphorylated form. B) Western blot analysis of supernatant and pellet fractions of mouse caudal sperm prepared as mentioned in materials and methods. Replicates of the blot were probed with antibodies against PP1, sds22, I-3 and 14-3-3.
Summary
PP1γ1 that is expressed specifically in somatic cells and spermatogonia of testis was quantitated by western blot utilizing recombinant His-PP1γ1 and estimated to be expressed at the level of 1ng for every 10μg of testis extract from Ppp1cc +/+ mice. Quantitation with recombinant His-PP1γ2 show that Ppp1cc +/+ mice express 10ng of PP1γ2/10μg of testis extract and ~8ng PP1γ2 per 106 sperm. In the mice bearing only one copy of Ppp1cc gene (+/-) it was expected that the levels of PP1γ isoforms in testis would be halved. On comparison of testis extracts of Ppp1cc +/+ and +/- mice, the PP1γ1 levels were halved to ~0.5ng/10μg of testis extract in +/- mice as expected. However the PP1γ2 levels decreased only by ≤ 28% to
~7.5ng/10μg of testis extract in Ppp1cc +/- mice indicating a possible feedback mechanism regulating the PP1γ2 levels in spermatocytes. Further, the Ppp1cc +/- sperm incorporate lower levels of PP1γ2. Finally, the distribution of PP1γ2 and it regulatory proteins in the head (soluble) and tail (insoluble) fractions show PP1γ2 in both fractions but at higher levels in the tail.
112
5.2.2 Analysis of low expressing PP1 transgenic Rescue mice lines.
A. Characterization of Rescue I: Pgk2 driven PP1 transgenic Rescue (N-line)
The Pgk2 promoter of the transgene forces the expression of PP1 in the developing
male germ cells in place of PP1. Results show low levels of PP1 expression in the Rescue
mice testis hemizygous for the transgene on Ppp1cc null background (Tg; -/-) (Figure 5.13A)
and is associated with partial recovery in spermatogenesis. Each Rescue mouse had a testis
weight similar to Ppp1cc -/- mice at 74.4 ± 1.2 mg producing an average of 4X105 ± 0.01 (n=9)
caudal epididymal sperm compared to 4X107 sperm in Ppp1cc +/- mice. These sperm were
completely immotile with severe morphological abnormalities including bent heads, missing
mitochondrial sheath, missing fibrous sheath and pin head (Figure 5.14B).
Homozygous transgenic mice for this Rescue line were generated to increase the levels of
PP1. The transgene homozygous mice were identified by southern blot analysis and further
confirmed by test crossing with transgene negative animals. These Rescue mice homozygous for
the transgene on Ppp1cc null background (Tg/Tg;-/-) showed higher levels of PP1 in testis and
an increased testis weight of 83.3 ± 2.4 mg and caudal epididymal sperm count of 1.85X106
(n=7) per mouse. As in the previous experiment with Rescue mice hemizygous for the transgene,
the sperm were immotile with similar morphological abnormalities. Another significant
observation is incorporation of PP1 into sperm at higher levels of testis PP1 of homozygous
Rescue (Tg/Tg;-/-) mice (Figure 5.13B).
113
Figure 5.13. PP1 in Rescue I testis and sperm. A) Testis extracts of Ppp1cc +/-, single copy transgene Rescues (Tg; -/-) and a homozygous transgene Rescue (Tg/Tg;-/-) mice all aged 4 months were protein estimated and subjected to western blot analysis with Anti-PP1 antibody. 80ug of protein was loaded in each lane. The blot was reprobed with β-actin as loading control. B) Western blot analysis of whole sperm extracts prepared with 1% SDS from two single copy transgene Rescues (Tg; -/-) and homozygous transgene Rescue (Tg/Tg;-/-) mice with Anti-PP1 antibody shows immuno-reactive band only in Tg/Tg;-/-.
114
Figure 5.14. Rescue I sperm DIC. A) DIC images of Rescue sperm at low magnification show very few spermatozoa surrounded by clusters of round cells. B) Sperm at magnification show several morphological abnormalities such as bent heads, missing mitochondrial sheath, missing firous sheath and pin heads indicated by arrows.
B. Characterization of Rescue II: Pgk2 driven PP1 with 3’ and 5’UTR transgenic lines (AK-line)
Nine founder lines were established for the Rescue II and analyzed for PP1expression, testis architecture, sperm numbers and sperm morphology. Following a thorough analysis of all the lines (data not shown) only the highest expressing AK line was retained for further studies.
115
This Rescue has higher levels of testis PP1 (Figure 5.15A) and a higher sperm count of
1.07X107 per mouse (n=7) compared to the Rescue I. The caudal epididymal sperm lacked motility but showed morphological abnormalities less severe compared to recue I sperm (Figure
5.15). In addition to PP1, negligible level of PP1 was expressed due to splicing out of intron
7. Sperm showed no detectable levels of PP1 but had traces of PP1 (Figure 5.15B).
Figure 5.15. Western blot analysis for PP1 levels in Rescue II. A) Testis extracts of Ppp1cc heterozygous (+/-), Rescue I (N-line) and the higher expressing lines of Rescue II (AQ, AC, AA, AK and AU1) were protein estimated and subjected to western blot analysis. 80ug and 160ug of protein was loaded to detect PP1 and PP1 respectively. The PP1 blot was reprobed with β- actin as loading control. AU1, AU2 and AU3 are mice of the AU line at 3, 4 and 6 months age showing increased expression with age. B) Western blot analysis of whole sperm extracts (107/lane) probed with Anti-PP1 and Anti PP1 antibodies. Testis extracts were also loaded as control for the antibodies. No detectable levels of PP1 were observed in sperm.
116
Figure 5.16. Rescue II sperm morphology. DIC of sper showing morphological abnormalities such as bent heads, missing mitochondrial sheath, missing fibrous sheath exposing the sperm tail fibres and pin head sperm indicated by arrows.
C. Characterization of Rescue III: Ppp1cc promoter driven PP1 cDNA with 3’ and
5’UTR transgenic lines
Assuming that the pgk2 promoter of the two previous two constructs was inefficient in expressing the transgene, we had generated Rescue III. This contruct was driven by the endogenous Ppp1cc promoter (2.6 kb upstream region from transcription start site) to express high levels of PP1. However this line (Rescue III) had the least PP1 expression and was barely detected by western blot. The phenotype was similar to Ppp1cc -/- mice. This Rescue line was generated and characterized by Nilam Sinha [70].
117
D. Quantification of PP1 in Rescue I and II mice.
Serially diluted recombinant His-PP1 and testis extracts of Rescue I and II mice were subjected to western blot analysis with Anti-PP1 antibody. The immunoreactivity of the bands following western blot analysis (Figure 5.17) was measured with the Multiguage software. The
PP1 protein levels were then quantified by comparison of the intensity ratios of PP1 in testis with known concentrations of His-PP1recombinant protein. From the quantification studies,
100ug of PP1 Rescue I testis with single copy transgene (Tg; -/-) constitutes less than 1ng of
PP1 and transgene homozygous Rescue (Tg/Tg; -/-) constitutes 3ng of PP1. PP1 Rescue II also contains less than 3ng of PP1 per 100ug of testis extracts. Hence the level of PP1 expressed in the developing male germ cells of PP1 Rescue II is approximately 50 times and
20 times lower than the levels of PP1 expressed in wild type and Ppp1cc +/- testis respectively.
Figure 5.17. Western blot analysis for quantification of PP1in Rescue testis. Serial diluted samples of His-PP1 (50ng and 10ng), Ppp1cc+/+ (10μg), PP1 Rescue I with single copy of transene (Tg; -/-) (80ug and 160ug), PP1 Rescue I homozygous for the transgene (Tg/Tg; -/-) (80ug) and PP1 Rescue II (80ug) testis extracts were loaded and subjected to SDS PAGE followed by western blot analysis with Anti-PP1 antibody.
118
E. Comparison of low expressing transgenic PP1γ1 with low expressing PP1γ2 Rescue mice
Two lines of PP1 Rescues (A and G lines) driven by the Pgk2 promoter had been generated in the lab to investigate if PP1 alone could restore spermatogenesis the absence of
PP1 in testis. However due to low levels of PP1 expression, spermatogenesis was rescued only partially with morphologically defective sperm lacking motility similar to the PP1 Rescue sperm [134]. The PP1 Rescues (A and G lines) produced an average of 2X 107 sperm and expressed approximately 1/5th the levels of PP1 of a Ppp1cc +/- in testis i.e. 1ng of PP1γ2 per
10µg of testis extract. Hence a comparative study of all the Rescue lines was performed to better understand if low levels of PP1 functions similar to low levels of PP1. Western blot analysis shows no detectable differences in the levels of PP1 regulating proteins I-3 and sds22 in testis either among the PP1γ1 and PP1γ2 Rescues in comparison to the Ppp1cc +/- mice (Figure
5.18A). However western blot analysis of supernatant and pellet fractions (pelt) of caudal sperm extracts showed a considerable decrease in the levels of I-3 and sds22 in PP1γ1 and PP1γ2
Rescue sperm. This indicates that sperm with lower levels of PP1 contain lower levels of their binding/interacting proteins. One possible explanation for this could be that the unbound I-3 and sds22 are excised into the cytoplasmic droplet during spermiation. The second explanation could be that I-3 and sds22 are unstable and get degraded if not bound to PP1.
119
Figure 5.18. Western blot analysis of Rescue testis and sperm. A) Testis extracts from age matched Ppp1cc +/- and, PP1γ1 and PP1γ2 Rescue mice (Tg; -/-) were protein estimated and 80ug was loaded per lane. Extracts from two mice were analysed as duplicates for PP1 Rescue II, PP1 Rescue I and PP1 Rescue lines (A and G-lines). Replicates of the blot were probed
120
with antibodies against PP1, PP1, PP1, sds22, I-3and β-actin. B) Supernatant (sup) and pellet (pelt) extracts of HB+ sonicated sperm of Ppp1cc +/- and PP1γ1 and PP1γ2 Rescue mice were subjected to western blot analysis with PP1, PP1, sds22 and I-3 antibodies. An equal number of sperm (4X106)were loaded in each lane.
Summary
To test if PP1γ1 is equivalent to PP1γ2 in spermatocytes, the transgenic lines required to express 7 ng of PP1γ1 per 10µg of testis extract. In an effort to increase PP1γ1 expression, three different transgenic mice lines (Rescue I, II and III) were generated in the lab each with PP1γ1 cDNA containing various lengths of intron 7. Rescue III showed the least expression at negligible amounts. Rescue I with single copy transgene showed 0.1 ng of PP1γ1 per 10 µg of testis extract could not rescue spermatogenesis and sperm had gross morphological abnormalities. Rescue I made homozygous for the transgene showed improved spermatogenesis but still had morphologically abnormal and immotile sperm. Rescue II was the highest expressing line so far with 0.3 ng of PP1γ1 per 10 µg of testis extract. It was observed that with increasing levels of PP1γ1 expression in these lines there was increased spermatogenesis.
Further, comparison of PP1γ1 Rescue with low expressing PP1γ2 Rescues show similar phenotypes. This supports the hypothesis that PP1γ1 can restore spermatogenesis but higher levels of expression were required to rescue complete spermatogenesis. Learning from these
PP1γ1 Rescue lines we predicted that that presence of intron 7 in the transgene constructs could be making the PP1γ1 transgene mRNA unstable in testis.
121
5.2.3 Instability of PP1γ1 transcript in the spermatocytes of testis
A. Presence of miR-449 and miR-34 binding sites in intron 7 of mammalian Ppp1cc
mRNA
Presence of Intron 7 is the only difference between the PP1γ1 and PP1γ2 transcripts.
Exclusion of intron 7 by splicing only in spermatocytes stipulates that its elimination could be
essential for the stability of Ppp1cc transcript in spermatocytes. Further, incorporation of any
part of intron 7 in the transgene constructs of Rescues I, II and III resulted in low PP1γ1
expression. Thus, the whole of 3’UTR region of PP1γ1 mRNA with intron 7 was analyzed as a
possible target for miRNA mediated degradation. Bioinformatic analysis by- miRanda, an
algorithm to predict the targets for miRNA showed the 1.1 kb 3’ UTR consisted of several
miRNA binding sites with majority of them in intron 7 as seen in figure 5.19. These predicted
miRNA were further investigated and miR 34 and miR449 had been identified as the possible
candidates as they had been predicted to degrade Ppp1cc mRNA in male germ cells and proven
in hela cells [135]. The target site of miR 449 and 34 is located at the beginning of intron 7. It is
also the region that was included in all of the low expressing PP1γ1 Rescue constructs.
122
Figure 5.19. Predicted miRNA target sequences of PP1γ1 mRNA. The target sequences on the 3’ UTR of PP1γ1 mRNA were identified using the miRanda algorithm on the microRNA.org website. This algorithm predicts the mir target sequences based on the rules of miRNA binding and an up to date compendium of miRNAs identified in mammals. The target sequence of mir49 and mir34 family members high lightened in red box is seen the beginning of intron 7 i.e.
123
immediate to the splice acceptor site on exon 7. Also shown in the 3’ UTR is exon 8 having two predicted miR target sequences but lack any evidence that they are involved with degrading the Ppp1cc mRNA.
B. miR-449 and miR-34 binding sites in intron 7 of mammalian Ppp1cc mRNA are highly conserved
The miR449 consists of three highly conserved family members miR449a, miR449b, and miR449c in mammals encoded by second intron of Cdc20b gene. miR34 is also highly conserved consisting of the family members miR34a, miR34b and miR34c in mammals that arise from an intergenic region on chromosome 9. These miRNA target the 8mer sequence 5’-
ACACUGCC-3’ that is seen in intron 7 and is conserved in several mammals Figure 5.20A. It should be noted that in some species the target sequence varies by one nucleotide but would still bind the miRNA resulting in the silencing of mRNA. None of the other predicted miRNA target sequences on intron 7 were conserved to be considered significant (data not shown). ClustalW alignment of intron 7 shows conservation of mir449 and mir34 target sequence within the mammals but not in the non-mammalian species (Figure 5.20 B) such as xenopus that express
PP1γ1 in spermatozoa [71].
124
Figure 5.20. Conservation of miR449 and miR34 target sequence. A) Multiple alignment of intron 7 from Ppp1cc gene from 25 mammalian species showing high degree of conservation for the mir449 and miR34 targeting sequence 5’GACACTGCCTA3’. The species with conserved sequence is highlighted in yellow and remaining show a difference of only one nucleotide. B) ClustlW alignment of intron 7 comparing common mammalian and non-mammalian species. The mir449 and miR34 targeting sequence is conserved in mammals while it is virtually absent in xenopus (laevis and tropicalis species), salmon and chicken.
125
C. miR-449 and miR-34c are expressed at high levels in spermatocytes of testis
Next, the expression profile of all the family members of miR449 and miR 34 in different tissues was examined. Quantitative PCR expression profile obtained from the resource miRNAMap [136] shows all the miR449 and miR34 members ( miR449a/b and miR34b/c) are expressed at very high levels in comparison to other tissues (Figure 5.21).The same was also shown by several other independent studies [94,135,137,138]. Studies in mouse testis have shown upregulation of miR449 and miR34b/c levels from day 14 i.e. with onset of meiosis and emergence of pachytene spermatocytes. This is the same stage at which PP1γ1 disappears and
PP1γ2 expression levels increase. Levels of miR449 are upregulated by 400 fold by day 14 and keep increasing to 1400 fold in adult testis. Expression of miR34b/c is also upregulated from day
14 by about 100 fold and in an adult by 400 fold. It was also observed by in-situ hybridization that the expression of miR449 and 34b/c was localized to cytoplasm of spermatocytes and spermatids. No signal was observed in the somatic cells or spermatogonia of testis [135,137] where PP1γ1 is expressed. This supports the hypothesis that with the expression of high levels of miR449 and miR34b/c in the pachytene spermatocytes could be causing instability of PP1γ1 transcript. Thus it could be one of the factors limiting PP1γ1 expression to somatic cells and spermatogonia of testis.
126
127
Figure 5.21. QPCR expression profile of miR449 and miR34. A) Expression profiles obtained from miRNAMap show high levels of miR449a expression at 16X104 copies per ng of RNA with
128
trachea and lung showing the next highest expression. B) miR449b also shows high levels specifically in testis at 3X104 copies per ng of RNA compared to other tissues. C) Ovary and testis showing the highest expression of miR34c at 20 X104 and 15 X104 copies/ng RNA respectively. miR34b was also detected at high levels in testis but much lower than its family member miR34c (D).
D. Generation of PP1γ1 Rescue mice with a novel cDNA construct resembling PP1γ2 cDNA (Rescue IV)
Poor transgenic expression of PP1γ1 may be due to instability of PP1γ1 message in developing germ cells in testis. A fourth line of Rescue mice was generated with PP1γ1 cDNA lacking intron 7 driven by Pgk2 promoter (Figure 5.22). Splice donor and acceptor sites were also mutated to prevent possible splicing. This construct mimics the PP1γ2 transcript but in translation will generate PP1γ1 protein.
Figure 5.22. Design of PP1γ1 Rescue IV construct. The transgene bears exons 1-7 of PP1γ1 and exon 8 of PP1γ2 with 5’ and 3’UTRs. The region between the arrows (in red) is the extended exon 7 sequence specific to PP1γ1 mRNA. Its driven by the Pgk2 promoter for testis specific expression.
E. High levels of PP1γ1 transgenic expression in two founder lines (L & T)
We had quantified the expression level of transgenic PP1γ1 expressed in two of the high expressing lines (L-line and T-line) of Rescue IV in comparison to levels of PP1γ2 expressed in control mice (Ppp1cc +/- and pTg-M26) using western blot. pTg-M26 is Pgk2 promoter driven
129
PP1γ2 transgenic Rescue mice line proven to express threshold levels of PP1γ2 that can rescue sperm morphogenesis on Ppp1cc -/- background [73]. The western blot shown below is a representation of one of several blots (Figure 5.23A). Testis extracts from Ppp1cc +/-, pTg-M26, and two Rescue mice each of L-line and T-line along with nanogram levels of recombinant His-
PP1γ1 and His-PP1γ2 were run as replicate blots. They were probed with anti-PP1γ1 and anti-
PP1γ2 antibodies respectively. The intensity of immunoreactive bands of the known quantity of recombinant PP1γ1/PP1γ2 proteins was compared with the immunoreactivity of the PP1γ isoforms expressed in testis as described before. The average expression levels obtained per
10µg of testis extract from several mice is shown in figure 5.23 B. Rescue mice of L-line expressed varying levels of PP1γ1 in testis with an average of 4ng/10µg. The reason for varying levels of transgenic PP1γ1 expression is unknown but is assumed to be due to the incorporation of the transgene in close proximity to heterochromatin region (position effect). The T-line
Rescue mice expresses ~8ng of PP1γ1 protein per 10µg of testis extract on par with the threshold levels of PP1γ2 levels expressed in pTg-M26 required for restoring fertility in Ppp1cc -/- mice.
The PP1γ1 levels expressed in T-line are also similar to PP1γ2 levels in Ppp1cc +/- mice. Thus, attaining the high levels of transgenic PP1γ1 protein desired. The comparison of these expression values in terms of percentage are represented in the graph below (Figure 5.23 C). The western blot also shows the levels of PP1 regulator Inhibitor 3 (I-3) decrease in PP1γ1 Rescue while
Inhibitor 2 (I-2) and sds22 levels remain constant.
130
131
Figure 5.23. Western blot analyses of Rescue IV testis A) 10µg of testis extracts from Ppp1cc +/-, pTg-M26, two mice each of L and T lines (Tg; -/-) along with 10 and 5ng of His-PP1γ1 and His-PP1γ2 were analyzed by western blot in duplicate and probed with anti-PP1γ1 and anti- PP1γ2 antibodies, respectively. The blots were re-probed with antibodies against I-2, I-3 and sds22 and finally with anti β-Actin to show equal protein loading. B) Levels of PP1 expressed per 10ug of testis extract of control and Rescue mice were obtained by quantification of intensity of immunoreactive bands of western blot. Average values obtained from sample size (n) ± standard error of mean (SEM) are shown. C) Comparative PP1 levels in testis expressed in terms of percentage compared to PP1γ2 levels expressed in Ppp1cc +/- mice testis.
F. Transgenic PP1γ1 protein levels mirror mRNA levels in the PP1γ1 Rescue lines
RNA isolated from testis of PP1γ1 transgenic Rescues (I, II, III and IV) and pTg-M26 were converted to cDNA and analyzed by Quantitative PCR as described in the methods section.
Transgene specific primers SV40 forward and SV40 reverse were used to detect the levels of transgene mRNA since all the transgenic constructs contained the same 0.2kb SV40 poly(A)
132
signal sequence. The PP1γ1 Rescue mice lines I, II and III that consist intron 7 in their construct show very low levels of transgenic PP1γ1 mRNA. With the exclusion of intron 7 in Rescue IV transgenic construct, the levels of transgenic PP1γ1 mRNA are on par with the transgenic PP1γ2 mRNA in pTg-M26 mouse line (Figure 5.24 A). The levels of transgenic PP1γ1 mRNA are translated equally into transgenic PP1γ1 protein in these Rescue lines (Figure 5.24B).
133
Figure 5.24. Comparison of PP1γ1 mRNA and protein levels in Rescue lines. A) Results of RT-qPCR showing very low levels of PP1γ1 mRNA in Rescues I, II and III in comparison to the Rescue IV lines. Among the Rescue IV, T-line has the highest expression. The mRNA expression levels are shown as relative levels compared to Rescue I. The relative levels are mean of two sets of mice (n=2) except for L and T-lines (n=4) all of the same age. B) Levels of PP1γ1 protein in testis expressed as ng of PP1γ1/10ug were estimated with known amounts of recombinant PP1γ2 protein following western blot analysis and densitometry analysis with Multiguage software.
G. Transgenic PP1γ1 in testis binds PP1γ2 interacting proteins
PP1γ2 in testis is known to interact with proteins such as I-2, sds22 and I-3 that could be essential for spermatogenesis [133]. Hence, the interaction of transgenic PP1γ1 with PP1γ interacting proteins in germ cells is essential if it has to substitute for PP1γ2 in regulating spermatogenesis. Freshly prepared testis extract from Ppp1cc +/- mouse was split into three
200µl aliquots and subjected to immune precipitation with Anti-PP1γ1, Anti-PP1γ2 antibodies
134
and pre immune serum of PP1γ1 antibody. Simultaneously, testis extracts of Rescue IV (T-line) mouse was immuno precipitated with PP1γ1 antibody and for negative control with pre immune serum of PP1γ1 antibody. Following immunoprecipitation, the samples were subjected to western blot analysis and consecutively probed with antibodies against PP1γ1 and its regulatory proteins. As shown in the earlier work in our lab, PP1γ2 in the germ cells of testis pulls down I-
2, sds22 and I-3 [139]. Similarly transgenic PP1γ1 in germ cells of T-line Rescue mice testis also pulls down I-2, sds22 and I-3. This shows that PP1γ1 functions similar to PP1γ2 in interacting with PP1 regulatory proteins in germ cells.
Figure 5.25. Western blot analysis of immunoprecipitation. 200µl of testis extract was immune precipitated and the beads were boiled with 50µl of laemmli buffer. Left panel) 10µg of testis extract from Ppp1cc +/- was loaded as input (Inp) and 15µl of PP1γ2 IP, PP1γ1 IP and pre- immune serum IP (-ve IP) samples were loaded in duplicate blots. Right panel) Duplicate western blots were loaded with 10µg of testis extract along with 15µl of PP1γ1 IP and –ve IP sample from T-line Rescue mouse. All the above blots were probed with Anti-PP1γ1 and Anti-I- 2 antibodies. They were then reprobed with antibodies against sds22 and I-3.
135
H. Phosphatase activity is restored in tests of PP1γ1 Rescue mice lines
Protein phosphatase activity due to PP1 in testis extracts was measured using phosphorylase a, a substrate for PP1 and PP2A [109]. Testis extracts contain all isoforms of PP1 including PP1, PP1 PP11, PP12 and PP2A. Since the heat-stable protein phosphatase inhibitor-2 (I-2) inhibits all PP1 catalytic activity but not PP2A [110], phosphatase activity in testis extracts measured in the presence of I-2 was assumed to be due to PP2A. The PP1 activity is measured as the difference between total phosphatase activity and PP2A activity.
Simultaneously, PP1 activity was also measured as the activity remaining after inhibition of
PP2A activity with 2 nM okadaic acid. Ppp1cc +/- mice show a total phosphatase activity of
1mM/min/ug testis extract contributed by PP1γ1, PP1γ2 from germ cells, PP1α and PP1β. The
PP1γ2 Rescue pTg-M26 lacking PP1γ1 shows a total phosphatase activity of 0.8µM/min/ug contributed by PP1γ2, PP1α and PP1β. PP1γ1 Rescue mice of L-line even at low levels of PP1γ1 expression show a phosphatase activity similar to pTg-M26. The T-line expressing high levels of transgenic PP1γ1 in the male germ cells show that the phosphatase activity is restored to the levels seen in Ppp1cc +/- mice (Figure 5.26).
136
Figure 5.26. Phosphatase activity of PP1 in testis. Protein phosphatase activity in testis from Ppp1cc +/-, pTg-M26, and PP1γ1 Rescue IV mice (L and T-lines) expressed in mmoles/minute/µg of testis extract. Total phosphatase activity represented as black bars is the combined phosphatase activity of PP1s and PP2s. Activity of PP1 was measured by inhibiting PP1 activity with recombinant Inhibitor 2. The phosphatase activity values shown are the mean of three experiments except pTg-M26 (n=2).
I. Sperm morphogenesis is restored in Ppp1cc -/- mice with high transgenic expression of PP1γ1
With high levels of transgenic PP1γ1 expressed in testis of Rescue IV mice, testis weight is restored due to rescue of differentiating spermatogonia. Sperm counts are restored with 70-
80% morphologically normal sperm as seen in table 5.4 below. The Rescue IV male mice were set up for fertility testing at the age of approximately 8-9 weeks with CD1 wild type female mice that were between the ages 8-16 weeks. However, only 60–70 % of the Rescue mice were fertile producing an average of 3 litters over three months of fertility testing (Table 5.5). The Rescue
137
male mice observed to be infertile after two months of fertility testing were set up with another
CD1 wild type female mouse to ascertain the infertility. The size of the litters produced in both L and T-lines varied largely ranging from four to 11 mice with average of five to six mice. The average time for developing pregnancy averaged 3-4 weeks however a small percentage of them required upto six weeks.
Table 5.4. Phenotypes of PP1γ1 Rescue mice lines. Comparison of testis weight, sperm number, sperm phenotypes, and fertility status of Rescue I, II, II and IV (L- and T) lines with control mice pTg-M26 and Ppp1cc +/-. The mean values obtained for each phenotype of a sample size (n) ± standard error of mean (SEM) are shown.
138
Table 5.5. Fertility results of PP1γ1 Rescue mice lines. Comparison of fertility tested males, average litter size produced by the fertile males and number of litters analyzed of Rescue I, II, II and IV (L- and T) lines with control mice pTg-M26 and Ppp1cc +/-. The infertility of males was ascertained by testing with two females. Only the first litter from each fertile male was considered to obtain the average litter size. The mean values obtained for a sample size (n) ± standard error of mean (SEM) are shown.
J. High levels of transgenic PP1γ1 detected in sperm of the two Rescue IV trangenic mice lines
Sperm isolated from the cauda epididymis and vas deferens of Ppp1cc +/-, pTg-M26 and
Rescue IV mice (L and T-line) were sperm counted and protein extracts were prepared by sonication in HB+. The extracts were then spundown to obtain the cytoplasmic and membrane fraction was as supernantant (Sup) and the tail fraction as pellet. The extracts along with recombinant His tagged PP1γ1 and PP1γ2 were subjected to western blot analysis in duplictes and probed with Anti-PP1γ1 and Anti-PP1γ2 respectively. As seen in the figure 5.27 A, transgenic PP1γ1 expressed in germ cells of Rescue IV mice is not only incorporated into sperm
139
but is also distibuted similar to PP1γ2 i.e. into the cytoplasm (Sup) and tail (Pellet) fractions. On quatification of six mice it is seen that on an average the L-line incorporate ~2.6 ng PP1γ2/106 sperm in comparision to ~6.4 ng of PP1γ2 in Ppp1cc +/- and ~5 ng in pTg-M26 mice respectively per 106 sperm. The T-line has the best PP1γ1 incorporation at ~7.8 ng/106 sperm that is higher than PP1γ2 levels in the pTg-M26 mice but is on par with the levels of PP1γ2 in
Ppp1cc +/- sperm. The blots were reprobed with antibodies against I-3 and sds22. I-3 is observed in the supernatant fraction but at lowered levels in the PP1γ1 Rescue mice. sds22 levels remain unchanged and is also observed in supernatant. The distribution of I-3 and sds22 in the
PP1γ1 Rescues is maintained similar to control mice indicating that PP1γ1 probably interacts with I-3 and sds22 similar to PP1γ2 in sperm.
140
Figure 5.27. PP1γ levels in sperm. A) Supernatant (sup) and pellet (pelt) extracts of HB+ sonicated sperm of Ppp1cc +/-, pTg-M26 (PP1γ2 Rescue), L-line and T-line PP1γ1 Rescue mice (Tg; -/-) were subjected to western blot analysis along with 5ng of His-PP1γ1 or His-PP1γ2 and probed with antibodies against PP1 and PP1 respectively. The blots were later reprobed with anti-sds22, anti-I-3 and anti-β-tubulin antibodies. An equal number of caudal epididymal sperm (2X106) were loaded per lane. The L and T-lines show incorporation of PP1γ1 in both sup and pellet fraction of sperm. B) Levels of PP1γ protein incorporated in sperm/106 sperm based on densitometry estimation of western blots. The values are shown in table 5.6 below.
Table 5.6. Quantitated levels of PP1γ1 incorporated in Rescue sperm. 141
K. Small percentage of PP1γ1 resue IV sperm show morphalogical abnormalities
The morphology of sperm from the PP1γ1 Rescue mice was determined by differential interface contrast (DIC) microscopy. Sperm isolated from cauda and vas deferns of Ppp1cc +/-, pTg-M26 and T-line Rescue mice were fixed in 4% paraformaldehyde at 40C for 1hr and mounted onto poly-L-lysine coated slides. The slides were either stored at 40C or observed immediately with a 70X Olympus microscope. As seen in th figure 5.28 A, almost no abnormalities were observed in the Ppp1cc +/- sperm while the pTg-M26 and T-line Rescue
(Figure 5.28 B,C) show morphologically abnormal sperm with bent heads, bent midpiece, abnormal shape of head and pinhead sperm as indicated by arrows. These abnormal sperm account to 35% obtained by counting a total of 1000 sperm from three L-line mice. With higher levels of PP1γ1 in testis of T-line the percentage of abnormal sperm dropped to 22% (values obtained from 1000 sperm from three mice). This abnomal to normal sperm ratio is also evident in DIC micrographs shown below (Figure 5.28 A-C). The commonly seen morphological abnormalities are bent head, bent mid piece, abnormal head and pin head sperm are shown in detail in figure 5.28 (F-I).
142
Figure 5.28. Sperm DIC. Micrographs taken at low magnification of caudal sperm from Ppp1cc +/- mice (A), pTg-M26 Rescue (B) and T-line Rescue (C). The sperm bearing morphological abnormalities have been indicated by arrow heads. The same field of pTg-M26 and T-line had been digitally magnified to show the morphologically defective sperm in detail (D, E). Abnormalities of Rescue sperm such as bent head, bent midpiece, abnormal shape of head and pin head sperm at high magnification (F-I).
143
L. Localization of PP1γ1 in Rescue IV sperm
One of the initial assumptions for PP1γ2 in mammals was that its unique C-terminus was required for the localization of PP1γ2 to the flagellum for its role in sperm motility. Hence, immunocytochemistry was performed to identify if PP1γ1 in Rescue IV sperm localized similar to PP1γ2 in control sperm. Immunostaining of sperm from Ppp1cc +/- with anti-PP1γ2 antibody shows that PP1γ2 is localized to the equatorial segment of head and the entire flagellum (Figure
5.29 A-C). PP1γ2 is not seen in the acrosome, post acrosomal region or the mitochondrial sheath.
PP1γ1 in the Rescue IV sperm was also detected in the entire flagellum similar to localization of
PP1γ2. This was expected since the Rescue IV sperm are motile and that requires PP1γ1 in flagellum. However, it was surprising to notice that PP1γ1 in the Rescue IV sperm was detected only in post acrosomal region of the head (Figure 5.29 H, J) unlike PP1γ2.
144
Figure 5.29. Immunocytochemistry of sperm. Confocal fluorescence microscopy of caudal sperm from Ppp1cc +/- mouse stained with anti-PP1γ2 antibody seen at low magnification (A,
145
B) and sperm head at 60X (C). Bright field image of the head is shown in (D). (E-G) Fluorescence images of caudal sperm from Rescue IV stained with anti-PP1γ1 antibody. (H, J) Rescue IV sperm head show localization of PP1γ1 to post acrosomal region. Their corresponding bright field images are shown respectively (I, K). (L) Negative control; sperm were incubated with Cy3-conjugated secondary antibody alone without primary antibody.
M. Sperm bearing transgenic PP1γ1 show altered motility.
Since the fertility was not completely restored in the Rescue IV mice, we performed motility analysis on sperm from these mice to see if PP1γ1 had efficiently substituted PP1γ2 for sperm function. Caudal sperm isolated into HTF media were analyzed by computer assisted motility analysis (CASA). Among the controls Ppp1cc +/- and pTg-M26, it is seen that percentage motility and velocity parameters decreased with lower levels of PP1γ2 expressed in testis and sperm i.e. in pTg-M26. The same phenomenon is seen in L-line sperm that incorporate low levels of PP1γ1. However, the T-line sperm bearing PP1γ1 at levels similar to PP1γ2 in
Ppp1cc +/- mice still show a significant decrease in percentage of motile and progressively motile sperm. The most significant difference observed in the sperm bearing PP1γ1 (L and T- line) is the pattern of motility i.e. their velocity (VAP, VCL and VSL) is lowered drastically.
This is probably due their lowered amplitude of lateral head movement (ALH) and tail beat amplitude (Figure 5.30C and 5.31). This is also reflected as increase in the tail beat cross frequency (BCF) in the L and T-line sperm.
146
147
Figure 5.30. Rescue IV sperm motility parameters. A) Computer assisted sperm motility analysis (CASA) shows a significant decrease in percentage motile sperm (black bars) and progressively motile sperm (grey bars) in the L and T-line rescue (Tg; -/-) sperm. Sperm with a velocity greater than 50µm/sec were considered to be progressively motile. B) The velocity parameters: velocity average path (VAP), velocity curve line (VCL) and velocity straight line (VSL) are significantly lowered in L and T-lines. C) The lateral head amplitude (ALH) is also decreased in sperm containing PP1γ1. The values of all the parameters are a mean of n=9 for Ppp1cc +/-, n=2 for pTg-M26, n=8 for L-line and n=7 for T-line.
148
Figure 5.31. Flagellar beat wave form of Rescue IV mice. Sperm motility was recorded on DVC high speed camera with 2 milli second exposure to obtain recording speeds of 100 frames/sec. Sperm flagellar beat of a single sperm from these recordings were traced and shown above. The Ppp1cc +/- sperm show flagellar beat symbolic of progressive motility with an amplitude of 20.9m (left panel). However the Rescue IV (Tg; -/-) sperm show significantly decreased amplitude of 9.4 m (right panel). The tracings were provided by Dr. Donner Babcock.
N. Phosphatase activity is restored in Rescue IV sperm
Protein phosphatase activity due to PP1 in sperm extracts was measured using phosphorylase a, a substrate for PP1 and PP2A [109]. Supernatant and pellet fractions of caudal sperm extracts were prepared by sonication within an hour of isolation from the epididymis and
149
phosphatase activity was measured the same day. Since the heat-stable protein phosphatase inhibitor-2 (I-2) inhibits all PP1 catalytic activity but not PP2A [110], phosphatase activity in sperm extracts measured in the presence of I-2 was assumed to be due to PP2A. The PP1 activity is measured as the difference between total phosphatase activity and residual activity (PP2A activity) following incubation with I-2. Simultaneously, PP1 activity was also measured as the activity remaining after inhibition of PP2A activity with 5nM okadaic acid. Ppp1cc +/- mice show a mean total phosphatase activity of 1.3 mmol/min/2X105 sperm in the cytosolic
(supernatant) fraction of which 0.8 mmol/min/2X105sperm is contributed by PP1γ2. The pellet containing greater levels of PP1γ2 shows a mean of 3.61 mmol/min/2X105 sperm. Almost all the activity observed in pellet (3.2 mmol/min/2X105 sperm) is due to PP1γ2 as PP2A is a cytosolic protein (Figure 5.32A). This is evident from the small decrease in phosphatase activity when incubated with 5nM OA and simultaneously ablation of 85-90% of activity with I-2. The PP1γ2 activity in both supernatant and pellet fractions of pTg-M26 was similar to that of Ppp1cc +/-.
PP1γ1 Rescue mice of L-line even with low levels of transgenic PP1γ1 in sperm show a phosphatase activity similar to pTg-M26 and Ppp1cc +/-. As previously stated, L-line showed variable levels of PP1γ1 incorporation into sperm that resulted in a large deviation in the values of its phosphatase activity. Statistical analysis by either paired or unpaired t-test showed that the
PP1γ1 activity in both supernatant and pellet of L-line sperm are not significantly different from
PP1γ2 activity in supernatant and pellet activity of pTg-M26 and Ppp1cc +/- sperm. The high expressing T-line Rescue sperm incorporate PP1γ1 at levels similar to PP1γ2 in sperm of Ppp1cc
+/-. The sperm PP1γ1 in this line show equal phosphatase activity as PP1γ2 in supernatant but a showed a significantly (P<0.01) higher activity in pellet than its corresponding PP1γ2 in pellet of pTg-M26 and Ppp1cc +/- sperm.
150
Figure 5.32. Comparison of phosphatase activity in sperm among Ppp1cc +/- and PP1γ Rescues. A) Protein phosphatase activity in the cytosolic fraction (supernatant) of sperm from Ppp1cc +/-, pTg-M26, and PP1γ1 Rescue mice (L and T-lines) expressed in 151
mmoles/minute/2X105 sperm. Total phosphatase activity represented as black bars is the combined phosphatase activity of PP1γ and PP2A. Activity of PP1 was measured by deducting the activity remaining after incubation with recombinant I-2 from total activity. The phosphatase activity values shown are the mean of sample size (n) along with their standard error of mean (SEM) obtained from multiple animals aged 3-5 months. Ppp1cc +/- (n=6), pTg-M26 (n=2), L- line (n=5) and T-lines (n=5). B) The phosphates activity in the pellet fraction was measured similar to supernatant. A significant increase (p<0.01) in total and PP1 activity is seen for T-line sperm (indicated by **).
5.2.4 Effect of PP1γ1 expression in addition to PP1γ2 in male germ cells
A. Transgenic PP1γ1 is expressed in addition to endogenous PP1γ2 in testis
As shown earlier there exists a possible feedback mechanism to maintain the threshold
levels of PP1γ2 in testis of Ppp1cc +/- mice. To confirm the existence of such a regulatory
mechanism we tried to increase the levels of PP1γ2 in mouse testis. However, if the PP1γ2 levels
were not regulated in these mice then we would study the effects of high levels of phosphatase
(PP1γ2) in testis and sperm. For this reason we had generated a mouse line homozygous for the
PP1γ2 transgene (driven by the Pgk2 promoter) on Ppp1cc +/+ background. These mice did not
show any phenotype or increase in levels of PP1γ2. This adds to the earlier observation that
PP1γ2 levels are tightly regulated. We next tried to over-express PP1γ by incorporating T-line
PP1γ1 transgene on Ppp1cc +/- and Ppp1cc +/+ background. In these mice lines (Tg; +/-) and
Tg; +/+) we could express PP1γ1 in germ cells in addition to PP1γ2 in testis as seen in the
western blot in figure 5.33. With increased PP1γ levels in testis of both Tg; +/- and Tg; +/+
mice, we also saw an increase in the levels of phospho-PP1γ along with I-2, SD22 and GSK3β.
152
Figure 5.33. Western blot analysis of Tg; +/+ and Tg; +/- mice testis. 10µg of testis extracts from Ppp1cc +/+, Ppp1cc +/-, two mice each of L and T lines (Tg; -/-) along with the PP1γ over- expressers Tg; +/- and Tg; +/+ were analyzed by western blot in duplicate and probed with anti- PP1γ1 and anti-PP1γ2 antibodies, respectively. The blots were re-probed with antibodies against I-3, sds22, GSK3- β and finally with anti β-Actin to show equal protein loading. A separate blot was run and probed for Phospho PP1γ (p-PP1).
B. Levels of PP1γ2 are altered by incorporation of PP1γ1 in sperm
In the PP1γ over-expresser mice Tg; +/- and Tg; +/+, sperm incorporate both PP1γ2 as well as PP1γ1. Interestingly it was observed that the PP1γ2 levels in sperm of these mice is lowered in both supernatant (sup) and pellet fractions. Experiments repeated with whole sperm extracts from four different Tg; +/+ mice showed similar decrease in PP1γ2 levels in presence of
PP1γ1 in sperm. Thus PP1γ1 incorporates itself in sperm by displacing a fraction of sperm
PP1γ2. This suggests that the total level of PP1γ incorporated into sperm is crucial and hence
153
regulated. However, the presence of PP1γ1 in addition to PP1γ2 in sperm results in increased phosphatase activity in both the supernatant and pellet fractions (Figure 5.35).
Figure 5.34. PP1γ levels in sperm of Tg; +/- mice. Supernatant (sup) and pellet (pelt) extracts of HB+ sonicated sperm of Ppp1cc +/- and two Tg; +/- mice were subjected to western blot analysis with antibodies against PP1 and PP1. An equal number of caudal epididymal sperm (2X106) were loaded per lane. The Tg; +/- mice show incorporation of PP1γ1 in both sup and pellet fraction of sperm. In comparison to Ppp1cc +/- mice the Tg; +/- sperm show decreased levels of PP1γ2. The blot was reprobed with β-tubulin to shows equal loading.
154
Figure 5.35. Phosphatase activity in sperm. A) Protein phosphatase activity in the cytosolic fraction (supernatant) of sperm from Ppp1cc +/- and Tg; +/+ expressed in mmoles/minute/2X105sperm. Total phosphatase activity represented as black bars is the combined phosphatase activity of PP1γ and PP2A. Activity of PP1 was measured by deducting the activity remaining after incubation with recombinant I-2 from total activity. The phosphatase activity values shown are the mean of sample size (n) along with their standard error of mean (SEM) obtained from animals aged 3-5 months. Ppp1cc +/- (n=6) and Tg; +/+ (n=3). B) The phosphatase activity in the pellet fraction was measured similar to supernatant. A significant increase (p<0.01) in total and PP1 activity is seen in Tg; +/+ sperm (indicated by *).
C. Expression of transgenic PP1γ1 in addition to PP1γ2 results in sub-fertility
Presence of transgenic PP1γ1 in addition to PP1γ2 in the germ cells of testis did not affect the average testis weight or sperm count of these mice (Table 5.7). It did however affect the fertility of these mice as only ~70% of the Tg; +/- and Tg; +/+ could successfully produce litters (Table 5.8). All the males tested were 2-4 months old. The sterile males were tested with a second female to confirm their fertility status. The fertile males produced smaller litters that are on average two pups smaller. On further investigation, we observe a decrease in sperm motility.
155
Table 5.7. Phenotypes of Tg; +/- and Tg; +/+ mice. Comparison of testis weight, sperm number, and sperm phenotypes of Tg; +/- and Tg; +/+ with the control mice Ppp1cc +/+ and Ppp1cc +/-. The mean values obtained for each phenotype are represented along with their standard error of mean and sample size (n).
Table 5.8. Fertility results of Tg; +/- and Tg; +/+ mice lines. Comparison of fertility tested males, average litter size produced by the fertile males and number of litters analyzed of Tg; +/- and Tg; +/+ mice with Ppp1cc +/+ and Ppp1cc +/-. The infertility of males was ascertained by testing with two females. Only the first litter from each fertile male was considered to obtain the average litter size. The mean values obtained for a sample size (n) ± standard error of mean (SEM) are shown.
D. Sperm motility is altered by presence PP1γ1 in addition to PP1γ2 in sperm
Sperm bearing PP1γ1 in the Rescue IV lines had shown a significant decrease in motility parameters. Hence we investigated the affect of PP1γ1 in sperm that already consist of PP1γ2.
156
Mature caudal sperm isolated in HTF media were analyzed by CASA and the mean parameter values are shown in figure 5.36. A significant decrease was observed in the total number of motile sperm (% motility) for both Tg; +/- and Tg; +/+ lines. Of the total motile sperm in Tg;
+/- line only 25% of sperm showed progressive motility with a velocity of ≥50µm/sec. This is a significant drop in comparison to the 40% progressively motile sperm seen in Ppp1cc +/- control mice. The Tg; +/+ line also showed decreased number of progressively motile sperm at 28% but was statistically not considered significantly (p.0.05) different from the Ppp1cc +/- control mice
(by unpaired t-test). The next significant difference was seen as decrease in flagellar beat amplitude (Figure 5.36 C and 5.37). This in turn negatively affects average path velocity (VAP) and curvilinear velocity (VCL). The anomalies in sperm morphology combined with altered motility could be contributing to decreased fertility.
157
Figure 5.36. Sperm motility parameters. A) Computer assisted sperm motility analysis (CASA) shows a significant decrease in percentage motile sperm (black bars) and progressively motile sperm (grey bars) in the Tg; +/- and Tg; +/+ sperm. B) The velocity parameters: velocity average path (VAP) and velocity straight line (VSL) are significantly lowered in Tg; +/- and Tg; +/+. C) The lateral head amplitude (ALH) is also decreased in sperm bearing PP1γ1. The values of all the parameters are a mean of n=8 for Ppp1cc +/-, n=3 for Tg; +/- and n=4 for Tg; +/+.
158
Figure 5.37. Flagellar beat wave form of sperm. Tracings of caudal sperm flagellar beat of single sperm recorded at 2 milli second exposure and 100 frames/sec. The control, Ppp1cc +/- sperm show flagellar beat symbolic of progressive motility with an amplitude of 20.9m (left panel). However sperm bearing both PP1γ2 and PP1γ1 (Tg; +/+) show significantly decreased amplitude of 12.6m (right panel). The tracings were provided by Dr. Donner Babcock.
159
5.3 Discussion of aim II
PP1γ2 has been previously shown to be essential for sperm morphogenesis and sperm motility. Its alternate isoforms, PP1γ1 however is restricted to somatic cells and spermatogonia of testis. Targeted disruption of the Ppp1cc gene results in male sterility due to severely impaired sperm morphogenesis. PP1γ1 though involved in several crucial functions of cells from various tissues, showed no phenotype in its absence in the Ppp1cc knockout mice. This is explained by the elevated levels of PP1α and PP1β isoforms compensating for the loss of PP1γ1 as all PP1 isoforms are nearly identical with highly conserved catalytic domain. The elevated levels of
PP1α was observed even in testis but again restricted to non-germ cells [64,72] indicating their substitution for PP1γ1 in testis. Surprisingly, they could not substitute for the nearly identical
PP1γ2 in sperm morphogenesis. Recent studies have shown that PP1γ2 alone in absence of
PP1γ1 can restore sperm morphogenesis proving its irreplaceable value [73]. In this study we determine the reason for the switch in PP1γ isoforms to PP1γ2 in spermatocytes and the mechanisms regulating it by force expressing transgenic PP1γ1 in spermatocytes.
5.3.1 Quantitation of PP1γ isoforms in testis and sperm
The first step was to evaluate the levels of PP1γ2 expressed in testis and sperm. This would give us the benchmark against which the levels of transgenic PP1γ1 expressed in the
Rescue mice will be compared. The ideal and easiest approach would have been to compare the
PP1γ1 and PP1γ2 levels in the transgenic and control mice respectively with an antibody recognizing the peptide sequence common to both the PP1γ isoforms. However this antibody
160
would also detect PP1α and PP1β that are of the same molecular weight. The only other method to compare the levels of two different proteins was to measure their absolute values in nanogram amounts of protein expressed per specific amount of testis or sperm extract. Using His- PP1 we had quantified the PP1 protein levels as ~10 ng in Ppp1cc +/+ and ~7 ng in Ppp1cc +/- mice per 10 ug of total testis extract. The Ppp1cc +/- mice, though have only one copy of Ppp1cc gene were still fertile. In accordance with the gene dosage hypothesis, lack of one allele in
Ppp1cc +/- decreased the PP1γ1 levels to half in testis as expected. This rule however did not apply to PP1γ2 as we observed only a 28% decrease in its level in the Ppp1cc +/- mice. This indicates to a possible compensation mechanism regulating PP1γ2 levels for the haploinsufficiency of Ppp1cc gene essential for spermatogenesis. The decrease in PP1γ2 levels in testis of Ppp1cc +/- mice affected testis weight indicating decrease in the number of spermatogonia entering meiosis I. This is also reflected as decrease in sperm count. Another important observation is that the Ppp1cc +/- testis with low PP1γ2 levels incorporated lowered levels of PP1γ2 into sperm. The overall affect of decreased PP1γ2 levels was a ~30% decrease in litter size. Supporting this is recent work with transgenic PP1γ2 mice lines (including pTg-M26 mouse line) that showed a requirement for threshold levels of PP1γ2 expression in testis for fertility. Mice lines expressing threshold or lower levels of transgenic PP1γ2 showed lowered sperm count, smaller litter size and sub-fertility [73].
Next to the expression levels of PP1γ isoforms in testis and sperm, the other crucial factor is their regulation by binding and targeting proteins. PP1γ2 is known to bind inhibitor I-2
(PPP1R2), sds22 (PPP1R7), I-3 (PPP1R11) and 14-3-3 [76-78]. Further, the expression of I-2, I-
3 and sds22 mRNA parallels the expression of PP1γ2 in testis as observed from our recent work in the lab [133]. Sperm PP1γ2 is regulated probably by binding and disassociation of these
161
proteins that are in turn governed by their phosphorylation status. The interaction of PP1γ2 with its regulatory proteins requires localization of these proteins to the same region of the cell. PP1γ2 is detected in both the soluble (head) and insoluble (tail) fractions of sperm RIPA or Triton X extracts but at higher levels in the insoluble fraction. The soluble PP1γ2 is isolated along with sds22, I-3 and 14-3-3 while I-2 is seen with the insoluble PP1γ2 (Figure 5.12). For PP1γ1 to substitute PP1γ2 in sperm, it should be localized to head and tail fractions similar to PP1γ2 along with its regulatory proteins. The initial assumption was that the unique C-terminus of PP1γ2 is essential for its localization to the sperm tail and binding the regulatory proteins. In addition we also speculated that the unbound regulatory subunits would get degraded as shown previously with I-3 in testis [133]. However results show that transgenic PP1γ1 distributes itself similar to transgenic PP1γ2 along with the regulatory subunits in sperm (Figure 5.27). This showed us that the unique C-terminus of PP1γ2 is probably not essential for localization to the sperm tail or binding of sds22, I-3 and I-2.
5.3.2 Generation and characterization of PP1γ1 Rescue mice
We had generated two Pgk2 promoter driven PP1 Rescue transgenic mice lines [132].
The first line referred to as Rescue I was created with the PP1 cDNA lacking the 5’ and most of the 3’ UTR followed by a SV40 polyadenylation signal sequence. It did consist of the initial region of its 3’ UTR i.e. intron 7. This line had very low levels of PP1 expression in testis resulting in partial rescue of sperm morphogenesis with very low sperm counts and morphologically defective sperm. Based on these observations we had attributed the low levels of PP1 to lack of expression or instability of transgenic mRNA due to the absence of the 5’
162
UTR and intron 7 in 3’ UTR. Studies have shown that mRNA or transgenes bearing certain introns could increase the expression of mRNA or provide stability [140-142].
So a second PP1 Rescue transgenic line was developed referred to as Rescue II with the PP1 cDNA consisting of the entire 5’ and 3’UTR (inclusive of complete intron 7) followed by a SV40 polyadenylation tail. This line was expected to express high levels of transgenic
PP1γ1. It showed higher levels of PP1 expression in testis compared to the Rescue I but that was still much lower in comparison to PP1 levels of Ppp1cc +/- testis (Figure 5.17). With this increase in levels of PP1 protein in Rescue II we had observed a better rescue of sperm morphogenesis with a significant increase in sperm number compared to the Rescue I but still had morphologically defective sperm. Further, a third PP1 Rescue line (Rescue III) was generated in the lab by Nilam Sinha with the endogenous PP1 promoter expecting to boost up the
PP1 expression [70]. This line had shown the least levels of PP1 expression among all the
PP1 Rescue lines thus far. All these three Rescue lines point toward the instability of the
PP1 mRNA.
5.3.3 Instability of PP1 transcript in testis
The PP1 and PP1 transcripts are identical for exons 1-6 but differ in their splicing of exons 7 and 8. The PP1 transcript retains the intron 7 while the PP1 transcript splices out the intron 7 (Figure 5.1). Since the differentiating male germ cells are going through such an effort to splice out intron 7 and include exon 8, we investigated intron 7 as a cause for mRNA instability specifically in germ cells probably mediated by miRNA. In silico studies predicted the
163
presence of several miRNA target sites in 3’ UTR including intron 7 of PP1 transcript (Figure
5.19). All the predicted miRNA were next screened for their tissue specific expression using mirbase.org, microrna.org, mirdb.org and miRTarBase. The miRNA thus identified to be high expressing in testis were analyzed for their spatio-temporal expression. This had lead to identification of miR449 and miR34 as the possible candidates targeting PP1γ1 mRNA. miR449 family is highly conserved in vertebrates and expressed highly in multicilliated cells [143]. miR34 are involved in various cellular process including cell cycle, apoptosis and senescence
[144]. It consists of three members: mir34a, miR34b and miR34c. While miR34a is expressed in all tissues, mir34c is highly up regulated in testis. Recent studies show a crucial role for miR449 and miR34 in regulating accurate spatio-temporal expression of target genes for spermatogenesis. Knock out of all the members of miR449 and miR34 leads to male sterility due to lack of spermatogenesis [145]. Ppp1cc transcript is shown as predicted target by several miRNA databases and has been confirmed as a target for mir449 and mir34. The target site for miR449 and miR34 sits at the beginning of intron 7 that was included in all three PP1γ1 Rescue constructs that showed very low PP1γ1 levels. Both mir449 and 34c were observed to be under- expressed in sexually immature mice testis (7 day old) during which only PP1γ1 mRNA is detected. From day 14 with the onset of meiosis and arrival of secondary spermatocytes, there is an exponential increase in levels of mir449 and 34c that parallels the expression of PP1γ2.
Further mir449 and 34c have been shown to be expressed specifically in pachytene spermatocytes [135,137] along with appearance of PP1γ2, where we do not observe the presence of PP1γ1. This could be explained as combination of 1) Splicing of the PP1γ pre mRNA to produce PP1γ2 mRNA and 2) elimination of remnant PP1γ1 mRNA by mir449 and 34c.
164
5.3.4 Generation and characterization of transgenic Rescue IV lacking intron 7
To increase the stability of PP1 mRNA, intron 7 was excluded and exon 8 of the
Ppp1cc gene was included in the PP1 cDNA along with the 3’ and 5’UTR driven by the Pgk2 promoter (Rescue IV). However the splice donor site GU on exon 7 has been mutated to GA so that only PP1 is made. The rationale for this construct is that the similarity of this PP1 transgene mRNA to the PP1 transcript might trick the cell into expressing high levels of PP1 protein. This Rescue line (Rescue IV) if expresses high levels of PP1 mRNA would indicate that either absence of intron 7 or presence of exon 8 is responsible for stability of PP1 mRNA.
From the mice received after microinjection, 19 were found to bear the transgene that were bred independently as 19 different mice lines of Rescue IV. Of the 19, 8 mice lines expressed transgenic PP1γ1 levels higher than the previous Rescues (I, II, and III). This showed the PP1γ1 transcript is stable in absence of intron 7 in the spermatocytes.
Two of the highest expressing lines (L and T-lines) were further analyzed. The L-line achieved transgenic PP1γ1 expression equal to 50% of PP1γ2 in Ppp1cc +/- mice. T-line equaled the PP1γ1 expression to PP1γ2 expression in Ppp1cc +/- mice (Figure 5.23). In both the lines, sperm morphogenesis was rescued and we observed testis weight and sperm count comparable to
Ppp1cc +/- mice (table 5.4). Transgenic PP1γ1 appears to have successfully substituted for
PP1γ2 in testis at both biochemical and molecular level by showing normal PP1 phosphatase activity and binding to the known PP1 regulatory subunits in testis. Even with sperm morphogenesis rescued, we observed that 11 out of the 29 fertility tested males were incapable of producing litters. This decrease of fertility in males was probably due to the combination of abnormal sperm motility and a small percentage of morphologically abnormal sperm. The two
165
common sperm abnormalities observed were the bent head and bent midpiece. These abnormalities were also common in transgenic mice expressing threshold or lower levels of
PP1γ2 including the successful Rescue, pTg-M26 [73] (Figure 5.28). L-line Rescue mice showed a large variance in the levels of PP1γ1 expressed in testis. Some expressed as low as 2ng or as high as 6ng per 10ug of testis extract. This was assumed due to incorporation of the transgene in close affinity to a heterochromatin region of a chromosome. Effort to make L- line homozygous for the transgene to obtain higher levels of PP1γ1 failed as these mice did not express PP1γ1 and were sterile. The reason for lack of expression is unknown.
The most distinctive phenotype of Rescue IV mice is their altered sperm motility. These sperm show significantly decreased flagellar beat amplitude with high frequency. The affects of this altered tail beat are lowered velocity parameters, decrease in percentage of total motile and progressively motile sperm (Figure 5.30 and 5.31). This could probably be the consequence of higher phosphatase activity of transgenic PP1γ1 compared to PP1γ2 in sperm (Figure 5.32). This is supported by the knowledge that high PP1 activity can lead to decreased motility parameters.
Among the fertility tested Rescue males, it was usually observed that the infertile males incorporated lower levels of PP1γ1 in comparison to fertile Rescues. Associated with low levels of PP1γ1 the infertile Rescues we observed higher percentage of abnormal sperm with significantly lowered motility. PP1γ1 even though substitutes for PP1γ2 in testis, it shows differences in regards to sperm motility and its localization in sperm head. It thus appears PP1γ1 though efficient in testis could be inefficient in sperm function.
When the phenotype for the Ppp1cc knockout mouse was identified to be male infertile, the first assumption was that PP1γ2 could not be replaced for its role in sperm morphogenesis
166
and sperm function. However it is remarkable to see that PP1γ1, the somatic isoform of PP1γ2 is able restore most phenotypes in otherwise infertile Ppp1cc -/- mice. A similar study with male germ cell specific lactate dehydrogenase c (LDHC) demonstrated that LDHC knockout mice are male infertile. The phenotype was rescued but with sub-fertility when the somatic isoform
LDHA was transgenically expressed at high levels in LDHC-null mice [146]. It thus appears that the somatic isoforms can substitute to some extent for their testicular isoforms if expressed in high amounts.
5.3.5 Effect of transgenic PP1γ1 expression in addition to PP1γ2 in male germ cells
An interesting finding during the course of this study was the decreased fertility in T-line males of the genotype Tg; +/-. These mice expressed transgenic PP1γ1 in addition to endogenous PP1γ2. To study the effect of PP1γ1 in addition to PP1γ2 in testis, we bred T-line mice bearing the PP1γ1 transgene with CD1 wild type to obtain mice of genotype Tg; +/+.
Analysis of mice with the genotypes Tg; +/+ and Tg; +/- showed decreased fertility and altered sperm motility. Testis extracts from these mice showed that PP1γ1 was expressed in addition to
PP1γ2 without regulation in its levels (Figure 5.33). This is a significant observation as our efforts in the lab to over-express PP1γ2 protein in mice with two copies of transgenic PP1γ2 over wild type (Tg/Tg; +/+) were unsuccessful. The expression of PP1γ2 in these mice was regulated by a molecular mechanism yet unknown, reinforcing the value of regulating PP1γ2 levels in testis for normal fertility. This regulatory mechanism was inefficient/ circumvented if transgenic
PP1γ1 is expressed along with PP1γ2 in testis that resulted in compromised male fertility. Sperm from these mice incorporate both PP1γ1 and PP1γ2 but the levels of PP1γ2 are down regulated
167
(Figure 5.34). This implies that PP1γ1 is incorporated by displacing a portion of PP1γ2. The presence of PP1γ1 in sperm in addition to PP1γ2 contributes to high phosphatase activity and altered motility. The motility can be characterized by decreased flagellar beat amplitude (Figure
5.37) that in some extent similar to Rescue IV motility and could be responsible for their compromised fertility. Thus the possible reasons for ablation of PP1γ1 in developing male germ cells is because of its detrimental effect on fertility of mammals and hence replaced by PP1γ2 for better fertility success.
168
6. Conclusion
This study provides insights into the roles of serine/threonine phosphatases detected in mammalian sperm, PP2A and PP1γ2. The results of this study show for the first time that changes in PP2A activity due to methylation and tyrosine phosphorylation occur in sperm and that these changes may play an important role in the regulation of sperm function. Though PP2A alone is insufficient to initiate sperm motility, it can stimulate hyperactive motility that is essential for fertilization either directly or indirectly through GSK3 and PP1γ2.
We suggest that PP1γ1 in mammals is excluded in differentiating spermatogenic cells due to alternate splicing and miRNA mediated instability of its transcript. The instability of the transcript is probably due to intron 7 of PP1γ1 that is spliced out giving rise to testis stable PP1γ2 transcript. The levels of PP1γ2 in germ cells seem to be regulated tightly that is essential normal fertility. However, PP1γ1 if expressed at high levels could substitute PP1γ2 for sperm morphogenesis but is inefficient for sperm function resulting in lower fertility. Unlike PP1γ2,
PP1γ1 expression cannot be regulated in germ cells and is also detrimental to male fertility in mammals. This makes PP1γ2 evolutionarily favorable for better reproductive success in mammals. From a clinical perspective, PP1γ2 and PP2A having major implications in sperm function and fertility, could serve as biomarkers for male infertility or alternately, as potential targets for male contraception.
169
7. Future perspective
With PP2A shown to be crucial for sperm function in aim I of this study, it is essential to gain an in depth knowledge of the molecular machinery regulating it. Virtually nothing is known about the components of the PP2A holoenzyme in sperm. Formation of the PP2A holoenzyme is one of the consequences of PP2A methylation. Further insights into the catalytic activity of
PP2A and its methylation in relation to its association with regulatory subunits that are yet to be identified in developing sperm will be interesting. Since this study was limited to analysis of caput and caudal sperm in vitro, it is important to identify the PP2A methylation status and activity in ejaculated sperm and sperm that have undergone capacitation in the female reproductive tract. Another important molecule, GSK3 that was previously assumed to be involved with sperm maturation was identified in this study as a target of PP2A during motility stimulation. This provides high value to investigate the role of GSK3 in sperm motility and male fertility. Studies with knockout of GSK3α and GSK3β are currently being pursued in our laboratory. Finally, PP2A methylation and GSK3 phosphorylation status in infertile human sperm samples with asthenozoospermia could be analyzed as potential biomarkers for infertility.
The aim II of this study provides convincing evidence of detrimental effects of PP1γ1 to male fertility. However due to the drawbacks of a standard transgenic approach, a knock-in mouse model approach by targeted insertion of PP1γ1 encoding transgene into the Ppp1cc locus is better desired. This would confirm the phenotypes observed in the PP1γ1 transgenic Rescue
IV mice and eliminate the possibility that these phenotypes could in part be a consequence of disruption of a crucial locus. It further eliminates the complications involved in estimating expression levels of the transgene due to its incorporation in multiple copies/ multiple locations.
170
The design of the knock-in construct includes a proximal (long) homology arm, the sequence coding for the unique PP1γ1 C-terminus, a neomycin cassette flanked by loxP sites and a distal
(short) homology arm (Figure 5.38). The unique C-terminal coding sequence of PP1γ1 in the construct will consist of a splice donor site CAG similar to 3’ splice site of exon 8. This linearized target vector when introduced into ES cells will replace exon 8 of Ppp1cc gene with the unique C-terminus coding region of PP1γ1. The rationale for this construct is that it would produce only PP1γ1 coding transcript at high levels even after splicing of intron 7 in testis. The embryonic cells detected to be positive for successful insertion of the synthesized DNA fragment into the genome by homologous recombination are injected into inner cell mass blastocyst and implanted into surrogate female. The chimeric progeny from the female are screened for germ line transmitters and bred with Cre expressing mice. This would finally result in mice with knock-in allele lacking the neomycin cassette. Male mice homozygous for the knock-in allele will only express PP1γ1 in all tissues including testis.
171
Figure 5.38. Design for generating PP1γ1 knock-in mouse model. PP1γ1 is encoded by seven exons with its 8 amino acid unique C-terminus encoded by initial region of intron 7 (shown in orange) that is retained in the mature PP1γ1 transcript. The stop codon TAG (indicated by arrow) marks the end of PP1γ1 C-terminus coding region. The 5’ splice site GT on exon 7 and 3’ splice site CAG on exon 8 are indicated by arrows mark the length of intron 7. The knock-in construct will consist of ~3.5Kb long homology arm extending from intron 3 to middle of intron 7. This is followed by the PP1γ1 C-terminus coding sequence with a 3’ splice site CAG at its 5’end to facilitate for splicing of intron 7 in testis. The neomycin cassette flanked by loxP sites will serve as a marker for identification of ES cells successful for recombination. The short arm of ~2kb is homologus to the region downstream of exon 8. Successful recombination in ES cells will produce Ppp1cc knock-in allele with exon 8 replaced by PP1γ1 C-terminus coding sequence followed by neomycin cassette. The chimeric mice obtained post injection of these ES cells into surrogate female are further crossed with Cre expressing mice to remove the neomycin cassette.
172
Even though PP1γ2 has been studied extensively, very little is known about its substrate specificity. It would also be interesting to compare phospho proteome of sperm having only
PP1γ2 (Ppp1cc +/+), only PP1γ1 (Rescue IV ro PP1γ1 knock-in) and sperm having both PP1γ1 and PP1γ2 (Tg; +/+). This would provide insights into difference in substrate specificity between PP1γ1 and PP1γ2 in sperm. The identification of differentially phosphorylated proteins could provide us with the reason for essential requirement of PP1γ2 for mammalian sperm at the molecular level.
173
Bibliography
1. Shima Y, Miyabayashi K, Haraguchi S, Arakawa T, Otake H, et al. (2013) Contribution of
Leydig and Sertoli cells to testosterone production in mouse fetal testes. Mol Endocrinol
27: 63-73.
2. Maekawa M, Kamimura K, Nagano T (1996) Peritubular myoid cells in the testis: their
structure and function. Arch Histol Cytol 59: 1-13.
3. Griswold MD (1995) Interactions between germ cells and Sertoli cells in the testis. Biol
Reprod 52: 211-216.
4. Wright WW, Musto NA, Mather JP, Bardin CW (1981) Sertoli cells secrete both testis-
specific and serum proteins. Proc Natl Acad Sci U S A 78: 7565-7569.
5. Zhao GQ, Deng K, Labosky PA, Liaw L, Hogan BL (1996) The gene encoding bone
morphogenetic protein 8B is required for the initiation and maintenance of
spermatogenesis in the mouse. Genes Dev 10: 1657-1669.
6. Dym M (1994) Spermatogonial stem cells of the testis. Proc Natl Acad Sci U S A 91: 11287-
11289.
7. Dym M, Fawcett DW (1971) Further observations on the numbers of spermatogonia,
spermatocytes, and spermatids connected by intercellular bridges in the mammalian
testis. Biol Reprod 4: 195-215.
174
8. Gilbert SF (2003) Developmental biology. Sunderland, Mass.: Sinauer Associates. xvii, 838 p.
p.
9. Knobil E, Neill JD (1994) The Physiology of reproduction. New York: Raven Press.
10. Dvorakova K, Moore HD, Sebkova N, Palecek J (2005) Cytoskeleton localization in the
sperm head prior to fertilization. Reproduction 130: 61-69.
11. Kleene KC, Distel RJ, Hecht NB (1984) Translational regulation and deadenylation of a
protamine mRNA during spermiogenesis in the mouse. Dev Biol 105: 71-79.
12. Zhang X, San Gabriel M, Zini A (2006) Sperm nuclear histone to protamine ratio in fertile
and infertile men: evidence of heterogeneous subpopulations of spermatozoa in the
ejaculate. J Androl 27: 414-420.
13. Brunner AM, Nanni P, Mansuy IM (2014) Epigenetic marking of sperm by post-translational
modification of histones and protamines. Epigenetics Chromatin 7: 2.
14. Mack S, Bhattacharyya AK, Joyce C, van der Ven H, Zaneveld LJ (1983) Acrosomal
enzymes of human spermatozoa before and after in vitro capacitation. Biol Reprod 28:
1032-1042.
15. Dunbar BS, O'Rand MG (1991) A Comparative overview of mammalian fertilization. New
York: Plenum Press. xx, 457 p. p.
16. Baba T, Azuma S, Kashiwabara S, Toyoda Y (1994) Sperm from mice carrying a targeted
mutation of the acrosin gene can penetrate the oocyte zona pellucida and effect
fertilization. J Biol Chem 269: 31845-31849.
175
17. Yamagata K, Murayama K, Okabe M, Toshimori K, Nakanishi T, et al. (1998) Acrosin
accelerates the dispersal of sperm acrosomal proteins during acrosome reaction. J Biol
Chem 273: 10470-10474.
18. Inaba K (2011) Sperm flagella: comparative and phylogenetic perspectives of protein
components. Mol Hum Reprod 17: 524-538.
19. Petersen C, Fuzesi L, Hoyer-Fender S (1999) Outer dense fibre proteins from human sperm
tail: molecular cloning and expression analyses of two cDNA transcripts encoding
proteins of approximately 70 kDaa. Mol Hum Reprod 5: 627-635.
20. Si Y, Okuno M (1993) The sliding of the fibrous sheath through the axoneme proximally
together with microtubule extrusion. Exp Cell Res 208: 170-174.
21. Miki K, Willis WD, Brown PR, Goulding EH, Fulcher KDA, et al. (2002) Targeted
disruption of the Akap4 gene causes defects in sperm flagellum and motility. Dev Biol
248: 331-342.
22. Brown PR, Miki K, Harper DB, Eddy EM (2003) A-kinase anchoring protein 4 binding
proteins in the fibrous sheath of the sperm flagellum. Biol Reprod 68: 2241-2248.
23. Brokaw CJ (1987) Regulation of sperm flagellar motility by calcium and cAMP-dependent
phosphorylation. J Cell Biochem 35: 175-184.
24. Carrell DT (2007) The genetics of male infertility. Totowa, N.J.: Humana Press. xv, 337 p. p.
25. Brooks DE (1983) Epididymal functions and their hormonal regulation. Aust J Biol Sci 36:
205-221.
176
26. Dacheux JL, Dacheux F (2014) New insights into epididymal function in relation to sperm
maturation. Reproduction 147: R27-42.
27. Taylor A, Robson A, Houghton BC, Jepson CA, Ford WC, et al. (2013) Epididymal specific,
selenium-independent GPX5 protects cells from oxidative stress-induced lipid
peroxidation and DNA mutation. Hum Reprod 28: 2332-2342.
28. Wang L, Yuan Q, Chen S, Cai H, Lu M, et al. (2012) Antimicrobial activity and molecular
mechanism of the CRES protein. PLoS One 7: e48368.
29. Jenkins AD, Lechene CP, Howards SS (1980) Concentrations of seven elements in the
intraluminal fluids of the rat seminiferous tubules, rate testis, and epididymis. Biol
Reprod 23: 981-987.
30. Vijayaraghavan S, Bhattacharyya A, Hoskins DD (1989) Calcium uptake by bovine
epididymal spermatozoa is regulated by the redox state of the mitochondrial pyridine
nucleotides. Biol Reprod 40: 744-751.
31. Schuh K, Cartwright EJ, Jankevics E, Bundschu K, Liebermann J, et al. (2004) Plasma
membrane Ca2+ ATPase 4 is required for sperm motility and male fertility. J Biol Chem
279: 28220-28226.
32. Ren D, Navarro B, Perez G, Jackson AC, Hsu S, et al. (2001) A sperm ion channel required
for sperm motility and male fertility. Nature 413: 603-609.
177
33. Qi H, Moran MM, Navarro B, Chong JA, Krapivinsky G, et al. (2007) All four CatSper ion
channel proteins are required for male fertility and sperm cell hyperactivated motility.
Proc Natl Acad Sci U S A 104: 1219-1223.
34. Wennemuth G, Carlson AE, Harper AJ, Babcock DF (2003) Bicarbonate actions on flagellar
and Ca2+ -channel responses: initial events in sperm activation. Development 130: 1317-
1326.
35. Liu Y, Wang DK, Chen LM (2012) The physiology of bicarbonate transporters in
mammalian reproduction. Biol Reprod 86: 99.
36. Hess KC, Jones BH, Marquez B, Chen Y, Ord TS, et al. (2005) The "soluble" adenylyl
cyclase in sperm mediates multiple signaling events required for fertilization. Dev Cell 9:
249-259.
37. Nolan MA, Babcock DF, Wennemuth G, Brown W, Burton KA, et al. (2004) Sperm-specific
protein kinase A catalytic subunit Calpha2 orchestrates cAMP signaling for male fertility.
Proc Natl Acad Sci U S A 101: 13483-13488.
38. Si Y, Okuno M (1995) Activation of mammalian sperm motility by regulation of microtubule
sliding via cyclic adenosine 5'-monophosphate-dependent phosphorylation. Biol Reprod
53: 1081-1087.
39. Suarez SS, Pacey AA (2006) Sperm transport in the female reproductive tract. Hum Reprod
Update 12: 23-37.
178
40. Ishijima S, Mohri H, Overstreet JW, Yudin AI (2006) Hyperactivation of monkey
spermatozoa is triggered by Ca2+ and completed by cAMP. Mol Reprod Dev 73: 1129-
1139.
41. Visconti PE, Kopf GS (1998) Regulation of protein phosphorylation during sperm
capacitation. Biol Reprod 59: 1-6.
42. Si Y, Okuno M (1999) Role of tyrosine phosphorylation of flagellar proteins in hamster
sperm hyperactivation. Biol Reprod 61: 240-246.
43. Barford D (1995) Protein phosphatases. Curr Opin Struct Biol 5: 728-734.
44. Shi Y (2009) Serine/threonine phosphatases: mechanism through structure. Cell 139: 468-
484.
45. Plowman GD, Sudarsanam S, Bingham J, Whyte D, Hunter T (1999) The protein kinases of
Caenorhabditis elegans: a model for signal transduction in multicellular organisms. Proc
Natl Acad Sci U S A 96: 13603-13610.
46. Cohen PT (2002) Protein phosphatase 1--targeted in many directions. J Cell Sci 115: 241-
256.
47. Johnson LN (2009) The regulation of protein phosphorylation. Biochem Soc Trans 37: 627-
641.
48. Sontag E (2001) Protein phosphatase 2A: the Trojan Horse of cellular signaling. Cell Signal
13: 7-16.
179
49. Janssens V, Goris J (2001) Protein phosphatase 2A: a highly regulated family of
serine/threonine phosphatases implicated in cell growth and signalling. Biochem J 353:
417-439.
50. Zolnierowicz S, Van Hoof C, Andjelkovic N, Cron P, Stevens I, et al. (1996) The variable
subunit associated with protein phosphatase 2A0 defines a novel multimember family of
regulatory subunits. Biochem J 317 ( Pt 1): 187-194.
51. Turowski P, Favre B, Campbell KS, Lamb NJ, Hemmings BA (1997) Modulation of the
enzymatic properties of protein phosphatase 2A catalytic subunit by the recombinant 65-
kDaa regulatory subunit PR65alpha. Eur J Biochem 248: 200-208.
52. Strack S, Chang D, Zaucha JA, Colbran RJ, Wadzinski BE (1999) Cloning and
characterization of B delta, a novel regulatory subunit of protein phosphatase 2A. FEBS
Lett 460: 462-466.
53. McCright B, Rivers AM, Audlin S, Virshup DM (1996) The B56 family of protein
phosphatase 2A (PP2A) regulatory subunits encodes differentiation-induced
phosphoproteins that target PP2A to both nucleus and cytoplasm. J Biol Chem 271:
22081-22089.
54. Lee J, Stock J (1993) Protein phosphatase 2A catalytic subunit is methyl-esterified at its
carboxyl terminus by a novel methyltransferase. J Biol Chem 268: 19192-19195.
55. Chen J, Martin BL, Brautigan DL (1992) Regulation of protein serine-threonine phosphatase
type-2A by tyrosine phosphorylation. Science 257: 1261-1264.
180
56. Favre B, Zolnierowicz S, Turowski P, Hemmings BA (1994) The catalytic subunit of protein
phosphatase 2A is carboxyl-methylated in vivo. J Biol Chem 269: 16311-16317.
57. Wei H, Ashby DG, Moreno CS, Ogris E, Yeong FM, et al. (2001) Carboxymethylation of the
PP2A catalytic subunit in Saccharomyces cerevisiae is required for efficient interaction
with the B-type subunits Cdc55p and Rts1p. J Biol Chem 276: 1570-1577.
58. Tolstykh T, Lee J, Vafai S, Stock JB (2000) Carboxyl methylation regulates phosphoprotein
phosphatase 2A by controlling the association of regulatory B subunits. Embo J 19: 5682-
5691.
59. Bryant JC, Westphal RS, Wadzinski BE (1999) Methylated C-terminal leucine residue of
PP2A catalytic subunit is important for binding of regulatory Balpha subunit. Biochem J
339 ( Pt 2): 241-246.
60. Lee J, Chen Y, Tolstykh T, Stock J (1996) A specific protein carboxyl methylesterase that
demethylates phosphoprotein phosphatase 2A in bovine brain. Proc Natl Acad Sci U S A
93: 6043-6047.
61. Guo H, Damuni Z (1993) Autophosphorylation-activated protein kinase phosphorylates and
inactivates protein phosphatase 2A. Proc Natl Acad Sci U S A 90: 2500-2504.
62. Ortega-Gutierrez S, Leung D, Ficarro S, Peters EC, Cravatt BF (2008) Targeted disruption of
the PME-1 gene causes loss of demethylated PP2A and perinatal lethality in mice. PLoS
One 3: e2486.
181
63. Lee JA, Pallas DC (2007) Leucine carboxyl methyltransferase-1 is necessary for normal
progression through mitosis in mammalian cells. J Biol Chem 282: 30974-30984.
64. Varmuza S, Jurisicova A, Okano K, Hudson J, Boekelheide K, et al. (1999) Spermiogenesis
is impaired in mice bearing a targeted mutation in the protein phosphatase 1cgamma
gene. Dev Biol 205: 98-110.
65. Takizawa N, Mizuno Y, Ito Y, Kikuchi K (1994) Tissue distribution of isoforms of type-1
protein phosphatase PP1 in mouse tissues and its diabetic alterations. J Biochem 116:
411-415.
66. Strack S, Kini S, Ebner FF, Wadzinski BE, Colbran RJ (1999) Differential cellular and
subcellular localization of protein phosphatase 1 isoforms in brain. J Comp Neurol 413:
373-384.
67. Chun YS, Shima H, Nagasaki K, Sugimura T, Nagao M (1994) PP1 gamma 2, a testis-
specific protein-serine/threonine-phosphatase type 1 catalytic subunit, is associated with a
protein having high sequence homology with the 78-kDaa glucose-regulated protein, a
member of the 70-kDaa heat shock protein family. Proc Natl Acad Sci U S A 91: 3319-
3323.
68. Vijayaraghavan S, Stephens DT, Trautman K, Smith GD, Khatra B, et al. (1996) Sperm
motility development in the epididymis is associated with decreased glycogen synthase
kinase-3 and protein phosphatase 1 activity. Biol Reprod 54: 709-718.
182
69. Smith GD, Wolf DP, Trautman KC, da Cruz e Silva EF, Greengard P, et al. (1996) Primate
sperm contain protein phosphatase 1, a biochemical mediator of motility. Biol Reprod 54:
719-727.
70. Sinha N (2012) Mammal specific protein phosphatase isoform, PPP1CC2, is essential for
sperm function and male fertility: Kent State University.
71. Chakrabarti R, Cheng L, Puri P, Soler D, Vijayaraghavan S (2007) Protein phosphatase PP1
gamma 2 in sperm morphogenesis and epididymal initiation of sperm motility. Asian J
Androl 9: 445-452.
72. Chakrabarti R, Kline D, Lu J, Orth J, Pilder S, et al. (2007) Analysis of Ppp1cc-null mice
suggests a role for PP1gamma2 in sperm morphogenesis. Biol Reprod 76: 992-1001.
73. Sinha N, Pilder S, Vijayaraghavan S (2012) Significant expression levels of transgenic
PPP1CC2 in testis and sperm are required to overcome the male infertility phenotype of
Ppp1cc null mice. PLoS One 7: e47623.
74. Si Y (1999) Hyperactivation of hamster sperm motility by temperature-dependent tyrosine
phosphorylation of an 80-kDaa protein. Biol Reprod 61: 247-252.
75. Yang P, Fox L, Colbran RJ, Sale WS (2000) Protein phosphatases PP1 and PP2A are located
in distinct positions in the Chlamydomonas flagellar axoneme. J Cell Sci 113 ( Pt 1): 91-
102.
183
76. Huang Z, Khatra B, Bollen M, Carr DW, Vijayaraghavan S (2002) Sperm PP1gamma2 is
regulated by a homologue of the yeast protein phosphatase binding protein sds22. Biol
Reprod 67: 1936-1942.
77. Huang Z, Vijayaraghavan S (2004) Increased phosphorylation of a distinct subcellular pool
of protein phosphatase, PP1gamma2, during epididymal sperm maturation. Biol Reprod
70: 439-447.
78. Mishra S, Somanath PR, Huang Z, Vijayaraghavan S (2003) Binding and inactivation of the
germ cell-specific protein phosphatase PP1gamma2 by sds22 during epididymal sperm
maturation. Biol Reprod 69: 1572-1579.
79. Walker WH, Cheng J (2005) FSH and testosterone signaling in Sertoli cells. Reproduction
130: 15-28.
80. Eddy EM (1998) Regulation of gene expression during spermatogenesis. Semin Cell Dev
Biol 9: 451-457.
81. Ozer J, Moore PA, Lieberman PM (2000) A testis-specific transcription factor IIA
(TFIIAtau) stimulates TATA-binding protein-DNA binding and transcription activation.
J Biol Chem 275: 122-128.
82. Kimmins S, Kotaja N, Davidson I, Sassone-Corsi P (2004) Testis-specific transcription
mechanisms promoting male germ-cell differentiation. Reproduction 128: 5-12.
83. Liu F, Jin S, Li N, Liu X, Wang H, et al. (2011) Comparative and functional analysis of
testis-specific genes. Biol Pharm Bull 34: 28-35.
184
84. Schafer M, Nayernia K, Engel W, Schafer U (1995) Translational control in
spermatogenesis. Dev Biol 172: 344-352.
85. Xu M, Hecht NB (2011) Polypyrimidine tract-binding protein 2 binds to selective, intronic
messenger RNA and microRNA targets in the mouse testis. Biol Reprod 84: 435-439.
86. Giorgini F, Davies HG, Braun RE (2001) MSY2 and MSY4 bind a conserved sequence in
the 3' untranslated region of protamine 1 mRNA in vitro and in vivo. Mol Cell Biol 21:
7010-7019.
87. Iguchi N, Tobias JW, Hecht NB (2006) Expression profiling reveals meiotic male germ cell
mRNAs that are translationally up- and down-regulated. Proc Natl Acad Sci U S A 103:
7712-7717.
88. Yeo G, Holste D, Kreiman G, Burge CB (2004) Variation in alternative splicing across
human tissues. Genome Biol 5: R74.
89. Mori C, Nakamura N, Welch JE, Gotoh H, Goulding EH, et al. (1998) Mouse spermatogenic
cell-specific type 1 hexokinase (mHk1-s) transcripts are expressed by alternative splicing
from the mHk1 gene and the HK1-S protein is localized mainly in the sperm tail. Mol
Reprod Dev 49: 374-385.
90. Kurio H, Murayama E, Kaneko T, Shibata Y, Inai T, et al. (2008) Intron retention generates a
novel isoform of CEACAM6 that may act as an adhesion molecule in the ectoplasmic
specialization structures between spermatids and sertoli cells in rat testis. Biol Reprod 79:
1062-1073.
185
91. Vetter MM, Zenn HM, Mendez E, van den Boom H, Herberg FW, et al. (2011) The testis-
specific Calpha2 subunit of PKA is kinetically indistinguishable from the common
Calpha1 subunit of PKA. BMC Biochem 12: 40.
92. Edwalds-Gilbert G, Veraldi KL, Milcarek C (1997) Alternative poly(A) site selection in
complex transcription units: means to an end? Nucleic Acids Res 25: 2547-2561.
93. Yan N, Lu Y, Sun H, Tao D, Zhang S, et al. (2007) A microarray for microRNA profiling in
mouse testis tissues. Reproduction 134: 73-79.
94. McIver SC, Roman SD, Nixon B, McLaughlin EA (2012) miRNA and mammalian male
germ cells. Hum Reprod Update 18: 44-59.
95. Song R, Hennig GW, Wu Q, Jose C, Zheng H, et al. (2011) Male germ cells express
abundant endogenous siRNAs. Proc Natl Acad Sci U S A 108: 13159-13164.
96. He Z, Kokkinaki M, Pant D, Gallicano GI, Dym M (2009) Small RNA molecules in the
regulation of spermatogenesis. Reproduction 137: 901-911.
97. Yang Q, Hua J, Wang L, Xu B, Zhang H, et al. (2013) MicroRNA and piRNA profiles in
normal human testis detected by next generation sequencing. PLoS One 8: e66809.
98. Bedford JM, Hoskins, D. D., and Lamming, G. E. (1990) The mammalian spermatozoon:
morphology, biochemistry and physiology. Marshall's Physiology of Reproduction,
Churchill Livingstone.
186
99. Mohri H, Yanagimachi R (1980) Characteristics of motor apparatus in testicular, epididymal
and ejaculated spermatozoa. A study using demembranated sperm models. Exp Cell Res
127: 191-196.
100. H YC (1984) Effects of cyclic AMP on the motility of mature and immature hamster
epididymal spermatozoa studied by reactivation of the demembranated cells. Gamete
Research 9: 99-114.
101. Vijayaraghavan S, Critchlow LM, Hoskins DD (1985) Evidence for a role for cellular
alkalinization in the cyclic adenosine 3',5'-monophosphate-mediated initiation of motility
in bovine caput spermatozoa. Biol Reprod 32: 489-500.
102. San Agustin JT, Witman GB (1994) Role of cAMP in the reactivation of demembranated
ram spermatozoa. Cell Motil Cytoskeleton 27: 206-218.
103. Vijayaraghavan S, Goueli SA, Davey MP, Carr DW (1997) Protein kinase A-anchoring
inhibitor peptides arrest mammalian sperm motility. J Biol Chem 272: 4747-4752.
104. Takahashi D, Murofushi H, Ishiguro K, Ikeda J, Sakai H (1985) Phosphoprotein
phosphatase inhibits flagellar movement of Triton models of sea urchin spermatozoa.
Cell Struct Funct 10: 327-337.
105. Moreno CS, Park S, Nelson K, Ashby D, Hubalek F, et al. (2000) WD40 repeat proteins
striatin and S/G(2) nuclear autoantigen are members of a novel family of calmodulin-
binding proteins that associate with protein phosphatase 2A. J Biol Chem 275: 5257-
5263.
187
106. Guo CY, Brautigan DL, Larner JM (2002) ATM-dependent dissociation of B55 regulatory
subunit from nuclear PP2A in response to ionizing radiation. J Biol Chem 277: 4839-
4844.
107. Thompson LJ, Bollen M, Fields AP (1997) Identification of protein phosphatase 1 as a
mitotic lamin phosphatase. J Biol Chem 272: 29693-29697.
108. Yu XX, Du X, Moreno CS, Green RE, Ogris E, et al. (2001) Methylation of the protein
phosphatase 2A catalytic subunit is essential for association of Balpha regulatory subunit
but not SG2NA, striatin, or polyomavirus middle tumor antigen. Mol Biol Cell 12: 185-
199.
109. Killilea SD, Cheng Q, Wang Z (1998) Protein phosphatase type 1 and type 2A assays;
Ludlow J, editor. New Jersey Humana Press Inc. 23-33 p.
110. Connor H, Quan H, Oliver C, Shenolikar S (1998) Inhibitor-1, a regulator of protein
phosphatases 1 function. In: Ludlow J, editor. Protein phosphatase protocols. New Jersey
Humana Press Inc. pp. 41-58
111. Ogris E, Du X, Nelson KC, Mak EK, Yu XX, et al. (1999) A protein phosphatase
methylesterase (PME-1) is one of several novel proteins stably associating with two
inactive mutants of protein phosphatase 2A. J Biol Chem 274: 14382-14391.
112. Wu J, Tolstykh T, Lee J, Boyd K, Stock JB, et al. (2000) Carboxyl methylation of the
phosphoprotein phosphatase 2A catalytic subunit promotes its functional association with
regulatory subunits in vivo. EMBO J 19: 5672-5681.
188
113. Goh P, Hoskins DD (1985) The involvement of methyl transfer reactions in s-
adenosylhomocysteine in the regulation of bovine sperm motility. Gamete Res 12: 399-
409.
114. Somanath PR, Jack SL, Vijayaraghavan S (2004) Changes in sperm glycogen synthase
kinase-3 serine phosphorylation and activity accompany motility initiation and
stimulation. J Androl 25: 605-617.
115. Hernandez F, Langa E, Cuadros R, Avila J, Villanueva N (2010) Regulation of GSK3
isoforms by phosphatases PP1 and PP2A. Mol Cell Biochem 344: 211-215.
116. Huang Z, Somanath PR, Chakrabarti R, Eddy EM, Vijayaraghavan S (2005) Changes in
intracellular distribution and activity of protein phosphatase PP1gamma2 and its
regulating proteins in spermatozoa lacking AKAP4. Biol Reprod 72: 384-392.
117. Kloor D, Hermes M, Kirschler J, Muller M, Hagen N, et al. (2009) Determinants for the
cAMP-binding site at the S-adenosylhomocysteine-hydrolase. Naunyn Schmiedebergs
Arch Pharmacol 380: 215-222.
118. Kloor D, Osswald H (2004) S-Adenosylhomocysteine hydrolase as a target for intracellular
adenosine action. Trends Pharmacol Sci 25: 294-297.
119. Yoon SY, Choi HI, Choi JE, Sul CA, Choi JM, et al. (2007) Methotrexate decreases PP2A
methylation and increases tau phosphorylation in neuron. Biochem Biophys Res
Commun 363: 811-816.
189
120. Fisher-Fischbein J, Gagnon C, Bardin CW (1985) The relationship between glycolysis,
mitochondrial respiration, protein-carboxyl methylation and motility in hamster
epididymal spermatozoa. Int J Androl 8: 403-416.
121. Castaneda E, Bouchard P, Saling P, Phillips D, Gagnon C, et al. (1983) Endogenous protein
carboxyl methylation in hamster spermatozoa: changes associated with capacitation in
vitro. Int J Androl 6: 482-496.
122. Gagnon C, Sherins RJ, Phillips DM, Bardin CW (1982) Deficiency of protein-carboxyl
methylase in immotile spermatozoa of infertile men. N Engl J Med 306: 821-825.
123. Williams-Ashman HG, Hatch R, Harvey SE (1985) Protein O-carboxylmethylation in
relation to male gamete production and function. Adv Enzyme Regul 23: 389-416.
124. Gagnon C, Harbour D, De Lamirande E, Bardin CW, Dacheux JL (1984) Sensitive assay
detects protein methylesterase in spermatozoa: decrease in enzyme activity during
epididymal maturation. Biol Reprod 30: 953-958.
125. Park IK, Roach P, Bondor J, Fox SP, DePaoli-Roach AA (1994) Molecular mechanism of
the synergistic phosphorylation of phosphatase inhibitor-2. Cloning, expression, and site-
directed mutagenesis of inhibitor-2. J Biol Chem 269: 944-954.
126. Vijayaraghavan S, Stephens DT, Trautman K, Smith GD, Khatra B, et al. (1996) Sperm
motility development in the epididymis is associated with decreased glycogen synthase
kinase-3 and protein phosphatase 1 activity. Biol Reprod 54: 709-718.
190
127. Okano K, Heng H, Trevisanato S, Tyers M, Varmuza S (1997) Genomic organization and
functional analysis of the murine protein phosphatase 1c gamma (Ppp1cc) gene.
Genomics 45: 211-215.
128. Barker HM, Craig SP, Spurr NK, Cohen PT (1993) Sequence of human protein
serine/threonine phosphatase 1 gamma and localization of the gene (PPP1CC) encoding it
to chromosome bands 12q24.1-q24.2. Biochim Biophys Acta 1178: 228-233.
129. Sasaki K, Shima H, Kitagawa Y, Irino S, Sugimura T, et al. (1990) Identification of
members of the protein phosphatase 1 gene family in the rat and enhanced expression of
protein phosphatase 1 alpha gene in rat hepatocellular carcinomas. Jpn J Cancer Res 81:
1272-1280.
130. Sinha N, Puri P, Nairn AC, Vijayaraghavan S (2013) Selective ablation of Ppp1cc gene in
testicular germ cells causes oligo-teratozoospermia and infertility in mice. Biol Reprod
89: 128.
131. Gibbons JA, Kozubowski L, Tatchell K, Shenolikar S (2007) Expression of human protein
phosphatase-1 in Saccharomyces cerevisiae highlights the role of phosphatase isoforms in
regulating eukaryotic functions. J Biol Chem 282: 21838-21847.
132. Soler D (2009) The PP1 gamma isoforms restore spermatogenesis but not fertility in PP1
gamma null mice.: Kent State University.
133. Cheng L, Pilder S, Nairn AC, Ramdas S, Vijayaraghavan S (2009) PP1gamma2 and
PPP1R11 are parts of a multimeric complex in developing testicular germ cells in which
their steady state levels are reciprocally related. PLoS One 4: e4861.
191
134. Soler DC, Kadunganattil S, Ramdas S, Myers K, Roca J, et al. (2009) Expression of
transgenic PPP1CC2 in the testis of Ppp1cc-null mice rescues spermatid viability and
spermiation but does not restore normal sperm tail ultrastructure, sperm motility, or
fertility. Biol Reprod 81: 343-352.
135. Bouhallier F, Allioli N, Lavial F, Chalmel F, Perrard MH, et al. (2010) Role of miR-34c
microRNA in the late steps of spermatogenesis. RNA 16: 720-731.
136. Hsu SD, Chu CH, Tsou AP, Chen SJ, Chen HC, et al. (2008) miRNAMap 2.0: genomic
maps of microRNAs in metazoan genomes. Nucleic Acids Res 36: D165-169.
137. Bao J, Li D, Wang L, Wu J, Hu Y, et al. (2012) MicroRNA-449 and microRNA-34b/c
function redundantly in murine testes by targeting E2F transcription factor-
retinoblastoma protein (E2F-pRb) pathway. J Biol Chem 287: 21686-21698.
138. Liang Y (2008) An expression meta-analysis of predicted microRNA targets identifies a
diagnostic signature for lung cancer. BMC Med Genomics 1: 61.
139. Cheng L (2008) Regulation of Protein Phosphatase 1, PP1γ2, in Testis/Spermatozoa by
PPP1r11, PPP1r7 and PPP1r2.
http://rave.ohiolink.edu/etdc/view?acc_num=kent1208813693: Kent State University.
140. Wang HF, Feng L, Niu DK (2007) Relationship between mRNA stability and intron
presence. Biochem Biophys Res Commun 354: 203-208.
141. Grier JD, Xiong S, Elizondo-Fraire AC, Parant JM, Lozano G (2006) Tissue-specific
differences of p53 inhibition by Mdm2 and Mdm4. Mol Cell Biol 26: 192-198.
192
142. Duncker BP, Davies PL, Walker VK (1997) Introns boost transgene expression in
Drosophila melanogaster. Mol Gen Genet 254: 291-296.
143. Song R, Walentek P, Sponer N, Klimke A, Lee JS, et al. (2014) miR-34/449 miRNAs are
required for motile ciliogenesis by repressing cp110. Nature 510: 115-120.
144. Hermeking H (2010) The miR-34 family in cancer and apoptosis. Cell Death Differ 17:
193-199.
145. Wu J, Bao J, Kim M, Yuan S, Tang C, et al. (2014) Two miRNA clusters, miR-34b/c and
miR-449, are essential for normal brain development, motile ciliogenesis, and
spermatogenesis. Proc Natl Acad Sci U S A 111: E2851-2857.
146. Tang H, Duan C, Bleher R, Goldberg E (2013) Human lactate dehydrogenase A (LDHA)
rescues mouse Ldhc-null sperm function. Biol Reprod 88: 96.
193