Muhammad Salah-Ud-Din Shah

Development of recombinant proteins for the control and diagnosis of Hydropericardium syndrome

Muhammad Salah-ud-Din Shah

School of Biotechnology, National Institute for Biotechnology and Genetic Engineering (NIBGE), Faisalabad & Quaid-i-Azam University, Islamabad, Pakistan 2014

Development of recombinant proteins for the control and diagnosis of Hydropericardium syndrome

A dissertation submitted for partial fulfillment of the degree of

DOCTOR OF PHILOSOPHY IN BIOTECHNOLOGY

Muhammad Salah-ud-Din Shah

School of Biotechnology, National Institute for Biotechnology and Genetic Engineering (NIBGE), Faisalabad & Quaid-i-Azam University, Islamabad, Pakistan 2014

Declaration

I hereby declare that the work presented in the following thesis is my own effort, except where otherwise acknowledged, and that the thesis is my own composition. No part of this thesis has been previously presented for any other degree.

M. Salah-ud-Din Shah

“In the Name of Allah, the Most Gracious, the Most Compassionate!”

Certificate

This Thesis submitted by Muhammad Salah-ud-Din Shah, is accepted in its present form by the School of Biotechnology at National Institute for Biotechnology and Genetic Engineering (NIBGE), Faisalabad and Quaid-i-Azam University, Islamabad, Pakistan, as satisfying the requirement for the degree of Doctor of Philosophy in Biotechnology.

Supervisor: ……………………………..

Dr. Javed Anver Qureshi

Co-Supervisor: ……………………………..

Dr. Moazur Rahman

Director NIBGE: ………………………………

Dr. Shahid Mansoor (S.I)

Examiner 1: ………………………………

Examiner 2: ……………………………….

Dated: ……………………………….

Dedicated to My beloved Parents for their magnificent devotion and inspiration to higher ideas of life & My wife and Kids (Abiha, Umna, Ibrahim and Omar)

Table of Contents

Acknowledgements……………………………………………………………… I List of Tables…………………………………………………………………….. III List of Figures……………………………………………………………………… IV List of Abbreviations…………………………………………………...... V Abstract…………………………………………………………………………… VII 1. Introduction and Review of Literature...... …………………………. 1 1.1. Introduction ………………..……………………………………………….. 1 1.2. Review of Literature ………....…………………………………………….... 2 1.2.1. Hydropericardium syndrome ...…...……………………….…….... 2 1.2.2. Clinical signs/ Pathology ...…………………………….….….….... 3 1.2.3. Necropsy Findings ………………………………………………… 3 1.2.4. Etiology ….………………………………………………………. 4 1.2.5. Natural Transmission …………….…………………….……….. . 5 1.2.6. Experimental Transmission …….……………….………………. 6 1.2.7. Epidemiology………….…………………………………...... 6 1.3. Viruses……………………………………………………………………….. 8 1.3.1. Adenoviruses………………………..……………………………… 9 1.3.2. Aviadenoviruses…………………..………………………………... 9 1.3.3. Morphological characteristics ……………………………...... 10 1.3.4. Molecular characteristics…………………………………………… 10 1.3.5. Phylogeny and genetic organization……………………………….. 12 1.4. Proteins encoded by Adenoviruses ……………………………………….…. 15 1.4.1. Hexon …………………………………………………………….. 16 1.4.2. Penton …………………………………………………………….. 17 1.4.3. Fiber …...………………………………………………………….. 17 1.4.4. 100K …..………………………………………………………….. 18 1.5. Diagnosis ………………………………….…………………………….…... 18 1.5.1. Conventional microbiological techniques …………………………. 19 1.5.2. Molecular diagnostic techniques ………………………………….. 20 1.6. Prevention and Control ………………………….…………………………. 21 1.7. Conventional Vaccines………………………………………………………. 21 1.7.1. Parenteral inactivated whole-cell vaccines ….……………………. 21 1.7.2. Oral live attenuated vaccine...……………………………………. 25 1.8. Recombinant vaccine ………………………………………………………. 27 1.9. Aims of this study …………….…………………………………………... 27 2. Material and Methods………………………………………………... 28 2.1. Chemicals and Reagents……………………………………………………. 28 2.2. Bacterial Strains/ Plasmids /Vectors……………………..……………….… 28 2.3. Bacterial media and cultivation conditions…………………………………. 29 2.4. Collection and selection of samples ...... …………………………..……….. 29 2.5. Extraction of Semi purified viral particle…………………………………… 30 2.6. Electron microscopy …………………………………………………………. 31 2.7. Selection and designing of primers ………………………………………..… 31 2.8. Viral DNA Isolation and DNA concentration ……………………………….. 32 2.9. PCR amplification reactions ……………………………………………..….. 33 2.9.1. Amplification of 730bp variable region of Hexon gene...... 33 2.9.2. Amplification of full length target genes ...... 33 2.9.3. Purification of amplified DNA fragments …………………………. 34 2.10. Analysis of PCR products ………………………….………………………. 35 2.11. DNA sequencing ………...………………………………………………… 35 2.12. Phylogenetic analysis ……………………...…………….………………….. 36 2.13. Construction of plasmids/ vectors …………………….…………….………. 36 2.13.1. pSMJ-1………………………….………….…………………….. 36 2.13.2. pSMJ-2………………………….………………………………… 37 2.13.3. pSMJ-3……………………………………….…………………… 38 2.14. Transformation and selection of transformants ……….…….……………....39 2.15. Plasmid DNA analysis …………………………………….………………… 40 2.16. Expression of cloned amplified DNA products ……………..……………… 41 2.17. Purification of recombinant proteins …………………….………………… 41 2.18. Determination of protein concentrations …………………..….…………… 42 2.19. SDS-PAGE analysis ………………………………..………….…………… 42 2.20. Immunoblotting ……………………….…………………………….……… 44 2.20.1. Detection of Histidine tagged recombinant proteins …………….. 44 2.21. Immunization studies ………………………………………………………. 45 2.21.1. Enzyme Linked Immunosorbent Assay (ELISA) ………………... 45 2.22. Challenge protection test …………………………………………………... 48

3. Results …………………………………………………………………… 49 3.1. Analysis and evaluation of samples ……………….…………………………. 49 3.2. Ultra structure of viral particle ……………………………………………… 50 3.3. Molecular Detection and Analysis of Hexon gene …………………………. 51 3.3.1. Multiple sequence alignment...... 53 3.3.2. Phylogenetic analysis ………………………………………………. 56 3.4. Generation of expression constructs .………………………………………… 57 3.4.1. PCR amplification of target genes ………………………………… 57 3.5. Restriction Analysis of Recombinant Plasmids ……………………………… 58 3.6. PCR Amplification of Inserts from recombinant plasmids ………………….. 60 3.7. DNA sequence analysis of the inserts …………………………………….… 61 3.7.1. Short fiber gene, 1437bp ……….…………………………………. 61 3.7.2. Penton base gene, 1587bp ……….………………………………. 63 3.7.3. 100K gene, 2397bp ………………………………………………… 65 3.8. Prokaryotic expression of recombinant viral proteins ……….……………….. 67 3.8.1. SDS-PAGE analysis of transformants ……………………………… 67 3.9. Western blot analysis …………………………………………………………. 71 3.10. Purification of recombinant proteins ………………………………………... 71 3.11. Immunogenicity of purified recombinant proteins ………………………….. 78 3.12. Challenge protection test …………………………………………………….. 81 4. Discussion ………………………………………………………………... 83 4.1. Molecular characterization of Fowl adenovirus causing HPS …….…... 83 4.2. Phylogenetic Analysis ………………………………………………… 84 4.3. Development of expression constructs ………………………….…….. 85 4.4. Evaluation of recombinant proteins ………………………………….... 87 5. References ………………………………………………………….…… 91

Appendix ………………………………………………………………………….. i Acknowledgements

I humbly acknowledge with thanks to the Almighty Allah for His grace, love and strength to do this research. All blessings and respect are for the last Holy Prophet Muhammad (peace be upon him), who is forever a torch of guidance and the city of knowledge for humanity as a whole. I gratefully acknowledge the funding source Higher Education Commission (HEC), Pakistan that made my Ph.D. work possible.

I pledge my special dedication and acknowledge with thanks to all who have strengthen me and guided me in connection with research work and thesis write up. Dr. Shahid Mansoor, Director, NIBGE, Faisalabad and Dr. Shahid Mahmood Baig, Head, Health Biotechnology Division, NIBGE, for their support and providing excellent research facilities to complete this research work, members of faculty at NIBGE for imparting their scientific knowledge and enabling me to take part in scientific research.

My supervisor, Dr. Javed Anver Qureshi, Deputy Chief Scientist, and former Head Health Biotechnology Division, for his affectionate supervision, help and support to complete this study. I appreciate all his contributions of time and ideas to make my Ph.D. experience productive. The members of Gene cloning lab have contributed immensely to my personal and professional time at HBD. This group has been a source of friendship as well as good advice. I am extremely thankful to Dr. Moazur Rahman for his help, guidance and encouragement during entire research work. I am especially grateful for the Naveed Altaf Malik for organizing the Lab, Dr. Muhammad Naeem Riaz, Fozia Nasreen, Imran Riaz, Abdul Ghaffar, M. Ismail and Rahat Ali for their help and encouragement to complete my research work.

I am deeply indebted to Dr. Mazhar I. Khan, Professor, Molecular Microbiology, Department of Pathobiology and Veterinary Science, University of Connecticut, Storrs, CT. USA for his hospitality, guidance and useful training during my 6 months stay there. This visit was funded by an International Research Support Initiative Program of Higher Education Commission, Islamabad. Dr. Mazhar I. Khan helped me to develop a range of new skills in relation to molecular microbiology with a special focus on Recombinant DNA technology and optimizing

ELISA test to detect antibodies of Fowl adenovirus using recombinant viral proteins. I am also thankful to Dr. Sankhiros Babapoor, Ph.D fellow in Molecular Microbiology Lab, who helped me during my research work in Lab and made my stay comfortable at the campus as well.

Thanks to Asif and Ali Imran, University Cell, NIBGE for managing all the paper work for QAU and HEC and making my reports, funds and all other documents in time.

I would like to thank for the love, patience and understanding of my colleagues, whose presence made the completion of my work possible. I am really thankful to Dr. Shahnaz A. Khanum and Mr. Mujahid Hussain Head, Animal Sciences Division, NIAB, for their guidance, help and encouragement at each step of my PhD. I am also thankful to Dr. Mudessar Habib, Group Leader, Vaccine Development Group for his guidance and expert opinions during whole research work. Other colleagues include Dr. Tarique Hussain Rahu, Hafiz Noubahar, Hafiz Muzammel and Mr. Shakur. I would like to thank all whose direct and indirect support helped me completing my thesis in time.

Lastly and most importantly, I wish to thank my parents Mr. and Mrs. Prof. M. Asghar Shah, who raised me with a love of science and supported me at each step of my life. I am thankful to my brothers Dr. Muhammad Fuad Shah, Hafiz Muhammad Jawwad Shah and sister, Javaria Asghar, for all their love and encouragement.

Muhammad Salah-ud-Din Shah

List of Tables

Table 1.1: List of licensed vaccines available against HPS / IBH in different countries 26 Table 2.1: List of bacterial strains, standard plasmids and constructed vectors 29 Table 2.2: Details of samples collected from field outbreaks 30 Table 2.3: List of primers along with sequences used in this study 32 Table 2.4: Composition of buffers used for purification under denaturing conditions 42 Table 2.5: Composition of separating and stacking SDS-PAGE gel 43 Table 2.6: Composition of sample loading (4X) and running buffer (10X) 44 Table 2.7: Plate layout for optimization of protein and serum dilutions for ELISA 47 Table 2.8: Experimental design for immunization studies in broilers 48 Table 3.1: List of effected broiler flocks with mortality rates and age 49 Table 3.2: Results of ELISA (O.D values) for optimization of protein and serum 79 Table 3.3: Post challenge morbidity, mortality and percent protection in different groups 82

III

List of Figures Fig 1.1: Worldwide distribution of Hydropericardium syndrome. 8 Fig 1.2: Electron micrograph of Adenovirus showing typical morphology 9 Fig 1.3: Distance tree summarizing the phylogeny of adenovirus 14 Fig 1.4: Structure of adenovirus, a schematic diagram showing structural proteins 15 Fig 1.5: Facets of icosahedrons describing different types of Hexons 16 Fig 1.6: Penton base along with two fibers of CELO virus 18 Fig 2.1: Cloning strategy for amplified DNA fragment of 100K 37 Fig 2.2: Cloning strategy for amplified DNA fragment of Penton base 38 Fig 2.3: Cloning strategy for amplified DNA fragment of Short fiber 39 Fig 3.1: Typical lesions of heart & liver observed during necropsy 50 Fig 3.2: Scanning Electron micrograph of FadV-4 51 Fig. 3.3: Agarose gel electrophoresis of 730bp PCR product 52 Fig. 3.4: Nucleotide and deduced amino acid sequence of partial Hexon gene 52 Fig. 3.5: Multiple sequence alignment (MSA) of 730bp variable region of Hexon gene 55 Fig. 3.6: Phylogenetic tree based on 730bp variable region of Hexon gene 56 Fig. 3.7: Analysis of amplified PCR products on 1.5% agarose gel 57 Fig. 3.8: Confirmation of expression vector (constructs) by restriction analysis 59 Fig. 3.9: PCR based confirmation for the integration of vector and insert 60 Fig. 3.10: Nucleotide and deduced amino acid sequence of short fiber gene 62 Fig. 3.11: Nucleotide and deduced amino acid sequence of penton base gene 64 Fig. 3.12: Nucleotide and deduced amino acid sequence of 100K gene 66 Fig. 3.13: SDS-PAGE analysis of of E. coli Rosetta (DE3)/pSMJ-3 68 Fig. 3.14: SDS-PAGE analysis of of E. coli Rosetta (DE3)/pSMJ-2 69 Fig. 3.15: SDS-PAGE analysis of of E. coli Rosetta (DE3)/pSMJ-1 70 Fig. 3.16: Expression analysis and western blot analysis of short fiber recomb. protein 72 Fig. 3.17: Expression analysis and western blot analysis of penton base recomb. protein 73 Fig. 3.18: Expression analysis and western blot analysis of 100K recomb. protein 74 Fig 3.19: SDS-PAGE gel representing purification of His+Thrombin+Short fiber 75 Fig 3.20: SDS-PAGE gel representing purification of His+Thrombin+Penton base 76 69 Fig 3.21: SDS-PAGE gel representing purification of His+Thrombin+100K 77 Fig 3.22: Post immunization antibody response in treatment and control groups 80

List of Abbreviations

A Adenine AdVs Adeno viruses AHG Aluminium hydroxide gel ALT Alanine transaminase AST Aspartate transaminase BCIP Bromo chloro indolyl phosphate bP base pair BSA Bovine serum albumin C Cytosine

CaCl2 Calcium chloride CAV Chicken anemia virus CELO Chicken embryo lethal orphan CIA Chicken infectious anemia CPK Creatine phosphokinase DNA Deoxyribonucleic acid EDS Egg drop syndrome EDTA Ethylenediaminetetraacetic acid ELISA Enzyme linked immuno-sorbent assay FAdV Fowl adeno virus FCA Freund’s complete adjuvant FESEM Field emission scanning electron microscope G Guanine GON Group of nine HCl Hydrochloric acid HPS Hydropericardium syndrome IBD Infectious bursal disease IBH Inclusion body hepatitis IHA Indirect haemagglutination assay IPTG Isopropyl β-D-1-thiogalactopyranoside

ITR Inverted terminal repeats kDa Kilo Daltons LB Luria Bertani LD Lethal Dose

MgCl2 Magnesium chloride mM milli molar M Molar NaCl Sodium Chloride NaOH Sodium Hydroxide NBT nitro blue tetrazolium Ni-NTA Nickle nitrilotriacetic acid OD Optical Density PBS Phosphate Buffered Saline PCR polymerase chain reaction pH Power of Hydrogen PVDF Polyvinylidene fluoride RFLP Restriction fragment length polymorphism RNA Ribonucleic acid rpm Revolutions per minute SEM Scanning Electron Microscope SDS Sodium dodecyl sulfate SDS-PAGE Sodium dodecyl sulfate poly acrylamide gel electrophoresis SPF Specific pathogen free T Thiamine TBE Tris/Borate/EDTA TBST Tris-Buffered Saline Tween-20 TCID Tissue culture infective dose TP Terminal protein UV Ultra violet W/V Weight/Volume

Abstract

Hydropericardium syndrome (HPS) is a viral disease of poultry which is caused by Fowl adenovirus (FAdV). This virus belongs to family Adenoviridae and genus Aviadenovirus. In recent years, Hydropericardium syndrome (HPS) has emerged as one of the important diseases occurring in Pakistan and has caused heavy economic loss. Efforts have been made to develop conventional vaccines against this disease. These vaccines were formulated from infected liver homogenate. Unfortunately, formalin-inactivated liver organ vaccines failed to protect the poultry industry in the country. Hence, there is a need to develop a suitable vaccine to combat this disease. Currently, recombinant vaccine candidates are being developed for the prevention and control of some infectious diseases in several laboratories elsewhere. The present work is an effort to develop a recombinant protein, using molecular biology, biotechnological and immunological approaches for effective control and diagnosis of HPS. In the present study, the viral particle was isolated from natural outbreak of Hydropericardium syndrome in broilers, Punjab province of Pakistan using conventional methods. The existence of the virus was initially observed by Scanning Electron Microscopic examination. Icosahedral shaped viral particles of 70 – 80 nm in diameter were observed. Further, the presence of FAdV was confirmed by Polymerase Chain Reaction (PCR) by amplification of 730 bp variable region (L1 and part of P1 loop) of hexon gene. DNA sequence analysis and Phylogenetic analysis of the PCR product revealed that isolate is closely related with Indian fowl adenovirus – 4 isolate. To investigate which gene product encoded by fowl adenovirus plays vital role in immune response against the disease, two genes representing structural proteins of the virus (Penton base & short fiber) and one gene representing non structural protein (100K) were selected to develop recombinant constructs. To achieve this, the Penton base (1587bp), Short fiber (1437bp) and 100K (2397bp) genes were amplified by PCR and cloned in an expression vector (pET28a). The histidine residues along with thrombin protease site were engineered upstream to inserts (viral genes). The presence of recombinant DNA fragments were confirmed by double digestion method, PCR amplification of insert using gene specific primers and DNA sequencing of the inserts. Nucleotide sequences of inserts revealed that two genes (Penton base

VII and Short fiber) of local isolate have >98% homology with the Indian FAdV-4 isolates, while one gene (100K) has 96% homology with the Russian FAdV-10 isolate. The recombinant constructs were expressed in E. coli. The expression of recombinant proteins was assessed by SDS-PAGE. Western blot analysis confirmed the presence of histidine tagged recombinant proteins i.e. short fiber (60Kda), penton base (65Kda) and 100K (95Kda) using anti His tag antibody. The three recombinant proteins were purified by Nickle affinity chromatography. The biological and immunological activity of recombinant proteins were assessed for potential use as antigen in vaccine and diagnostic (ELISA). The purified recombinant proteins were adjuvanted separately with Freund’s complete adjuvant and broilers were immunized. ELISA test was performed and antibody titers were determined against the respective recombinant proteins. The results indicated that protein constructs pSMJ-2 (penton base) and pSMJ-3 (short fiber) are more immunogenic antigens as compared to protein construct pSMJ-1 (100K) and commercial vaccine. Challenge protection test also proved that penton base (pSMJ-2) and short fiber (pSMJ- 3) protein constructs conferred 90% and 80% protection respectively against pathogenic virus challenge. Whereas 100K (pSMJ-1) protein construct and commercial inactivated vaccine provided 50% and 70% protection respectively. The results obtained by ELISA and challenge test in this study indicated that the constructed recombinant proteins are suitable candidates to develop subunit vaccine and diagnostic kit (strip test) thereby can be used for prevention and control of this disease.

VIII

The work presented in this thesis is based on the following papers:

 Shah, MS., Ashraf, A., Khan, MI., Rahman, M., Habib, M., Babapoor, S., Ghaffar, A., Malik, IR., Khannum, SA. and Qureshi, JA. Molecular characterization of fowl adenoviruses associated with hydropericardium syndrome in broilers. African J. Microbiol. Res. 2011; 5(30): 5407-5414.  Shah, MS., Ashraf, A., Khan, MI., Rahman, and Qureshi, JA. A subunit vaccine against hydropericardium syndrome using adenovirus penton capsid protein. Vaccine. 2012; 30: 7153 – 7156.  Shah, MS., Ashraf, A., Khan, MI., Rahman, M., Habib, M., Khannum, SA, and Qureshi, JA. Expression, purification and characterization of 100K protein of fowladenovirus-4 associated with hydropericardium syndrome. Submitted for publication.

GenBank submissions:  Shah, M.S., Khan, M.I., Babapoor, S., Rahman, M.U., Khannum, S.A., Habib, M. and Qureshi, J.A. Nucleotide sequence of 730 bp variable part of Hexon gene associated with Hydropericardium syndrome (FR686931)  Shah, M.S., Khan, M.I., Babapoor, S., Rahman, M., Khannum, S.A., Habib, M., Ashraf, A. and Qureshi, J.A. Identification of a unkhown gene of Fowl adenovirus 1 serotype 4 isolated from Pakistan, having sequence homology with the 100K gene of the Fowl adenovirus 10 (FR693741)  Shah, M.S., Khan, M.I., Babapoor, S., Rahman, M., Khannum, S.A., Habib, M., Ashraf, A. and Qureshi, J.A. Nucleotide sequence of Penton base gene of fowl adenovirus 4 isolated from Pakistan, associated with hydropericardium syndrome in broilers (HE653773)  Shah, M.S., Khan, M.I., Babapoor, S., Rahman, M., Khannum, S.A., Habib, M., Ashraf, A. and Qureshi, J.A. Nucleotide sequence of short fiber gene of fowl adenovirus 4 associated with hydropericardium syndrome in broilers (HE649966)

Chapter 1 Introduction & Review of Literature

1.1 Introduction

The poultry industry has emerged as one of the largest and fastest growing public sector among the developed and developing countries. Unfortunately, this industry has major threat from diseases, which are viral (Newcastle disease, Infectious bursal disease, Influenza, Hydropericardium syndrome), bacterial (Colibacillosis, Pasteurellosis, Salmonellosis, Mycoplasmosis), parasitic (Coccidiosis, Histoplasmosis) or nutritional (Dyschonroplasia, Osteoperosis). Among these diseases, Hydropericardium syndrome (HPS) is one of the important emerging diseases occurring in the specific areas of the world, where boilers are reared under intensive conditions. HPS was first observed in 1987 at Angara Goth, a broiler growing area near Karachi, Pakistan. Since then, HPS has been reported in many countries of the world. From these reported cases, an adenovirus, which was either isolated from, or visualized electron microscopically, in the liver of affected boilers (chickens) has been implicated in the syndrome (Anjum et al., 1989, Cheema et al., 1989, Gowda, 1994, Kataria et al., 1996, Rabbani et al., 1998a, Vairamuthu et al., 2002). The syndrome has been reproduced by inoculation of isolated Fowl adenovirus (FAdV) strains (Anjum, 1990), hence, the syndrome is also called infectious hydropericardium syndrome.

To our knowledge HPS has not been recorded in humans, so it is not considered as a zoonotic disease. This disease has been found to be of economic importance as it caused huge economic losses to poultry industry in Pakistan. Abidi (1988) reported that during 1st year after appearance of the disease (1987-88) approximate losses of more than 330 million rupees were recorded.

Efforts have been made to develop conventional vaccines against this disease. These vaccines were formulated from infected liver homogenate. Formalin-inactivated liver organ vaccines failed to protect the poultry industry in the country (Khan et al., 2005, Ahmad et al., 2011). Hence, it is dire need to develop a suitable vaccine to combat this disease.

Previously immunogenic proteins of FAdV have been detected by Balamurugan et al., (2002), Kumar and Chandra (2004). Hexon, Penton base and Fiber were detected among immuno- reactive proteins during western blot analysis of proteins of semi purified HPS virus using polyclonal antibodies. So, they suggested that immunogenicity of these proteins may be evaluated to be used as subunit vaccine.

Chapter 1 Introduction & Review of Literature

Currently, recombinant vaccine candidates are being developed for the prevention and control of some infectious diseases in several laboratories elsewhere. The present work is an effort to develop recombinant proteins, using molecular biology and biotechnological approaches for effective control and diagnosis of this disease.

1.2 Review of Literature

Sufficient literature on the subject matter is available, only the pertinent literature is cited as below.

1.2.1 Hydropericardium syndrome

Initially, Hydropericardium syndrome (HPS) was reported during 1987 in broiler chickens having 3-6 weeks of age from Karachi, Pakistan (Jaffery, 1988 and Khawaja et al., 1988a). The HPS was further described by the accumulation of a straw colored “jelly” like fluid in pericardial sac, discolored and enlarged liver with basophilic intranuclear inclusion bodies. Kidneys were congested and high mortality rates (up to 70%) were observed (Ahmad et al., 1989, Anjum et al., 1989, Cheema et al., 1989, Hassan, 1989). The disease was observed in rapidly growing broilers at 3-6 weeks of age (Jaffery, 1988, Cheema et al., 1989, Akhtar, 1994). Mortalities started from 3rd week of age and reached at its peak at 4 to 5 weeks of age (Anjum et al., 1989, Muneer et al., 1989, Gowda and Satyanarayana, 1994, Abdul-Aziz and Al-Attar, 1991, Asrani et al., 1997, Kumar et al., 1997, Voss et al., 1996). The unique features of this disease were sudden, onset of high mortality (greater than 70%), hydropericardium, hepatitis with basophilic intra-nuclear inclusion bodies in hepatocytes (Khawaja, 1988b, Tariq, 1988 and Niazi et al., 1989). Occasionally, the disease was also reported in layers and breeders of 20 weeks of age (Jaffery, 1988, Ahmad et al., 1989, Cheema et al., 1989, Akhtar, 1992, Javeed et al., 1994, Asrani et al., 1997, Shukla et al., 1997a, 1997b). Naeem and Akram, (1995) found the HPS in wild pigeons.

Inclusion body hepatitis (IBH) had previously been reported in United States during 1963, having some clinical similarities with this emerging syndrome but the accumulation of fluid in pericardial sac was not found in inclusion body hepatitis. So researchers differentiated this syndrome form inclusion body hepatitis and a new name “Infectious Hydropericardium” was given (Abdul-Aziz and Hassan, 1995, Mazaheri et al., 1998). Later HPS was observed in various parts of the world and few other names were coined for this syndrome i.e. Angara disease

Chapter 1 Introduction & Review of Literature

(Jaffery, 1988), Litchi heart disease (Gowda and Satyanarayana, 1994) and Hydropericardium syndrome (Cheema et al., 1989, Abdul-Aziz and Hassan, 1995).

1.2.2 Clinical signs/ Pathology

Clinical signs exhibited by the diseased birds include lethargy, huddling with ruffled feathers, loss of appetite and mucoid yellow droppings. Reduced weight gain was recorded in infected flocks which results in bad feed conversion ratio (Anjum et al., 1989). Jaffery (1988) found that during natural outbreaks, no clinical signs were exhibited by chicks. Asrani et al., (1997) indicated that the birds remained active till death and at the terminal stages of infection the chicks were dull, depress with ruffled feathers, reluctant to move and tend to gather in the corners.

Parameters of clinical pathology indicate severe anemia and significant reduction of all hematological values in birds having infection of HPS (Niazi et al., 1989, Asrani et al., 1997). Schonewille et al., (2008) found immunosupresion in specific pathogen free (SPF) chickens after experimental infection with fowl adenovirus type 4 (FAdV-4), which was evident from depletion of B and T cells in lymphoid organs. Serum protein profiles were also found altered as decrease in albumin and increase in β-globulins (Mahmood et al., 1995), which results in reduction of colloidal plasma osmotic pressure and it allows the leakage of fluid into pericardial sac. Blood glucose and plasma protein levels were decreased while serum uric acid, potassium, calcium and triglycerides levels were significantly increased, which appears to be due to accumulation of fluid in pericardial sac and abdomen (Bhatti et al., 1989). Serum enzyme activities of AST, ALT and CPK were lowest in normal birds, intermediate in vaccinated birds and highest in HPS infected birds (Iqbal et al., 1994, Zaman and Khan, 1991). All these changes are indicating the involvement of liver, kidney and heart in HPS.

1.2.3 Necropsy Findings

Gross lesions found during necropsy include enlarged, pale, friable liver occasionally with necrotic foci. Accumulation of fluid in pericardium was found as most prominent macroscopic lesion (Anjum et al., 1989, Cheema et al., 1989, Qureshi, 1989). Lesions in vital organs were observed including liver, heart, kidneys and lungs. In addition enlarged spleen and atrophy of thymus could be observed in most of the dead birds. Clear straw colored fluid was observed in

Chapter 1 Introduction & Review of Literature pericardial sac up to 20ml, giving it a balloon like shape (Cheema et al., 1989, Gowda and Satyanarayana, 1994, Abdul-Aziz and Hassan, 1995, Asrani et al., 1997, Kumar et al., 1997). Liver was found swollen, congested, friable and yellow colored with areas of necrosis and patechial hemorrhages. Kidneys were pale, swollen and friable with urates in tubules (Qureshi, 1988). Edematous lungs were observed (Anjum et al., 1989, Cheema et al., 1989, Muneer et al., 1989, Gowda and Satyanarayana, 1994, Abdul-Aziz and Hassan, 1995, Asrani et al., 1997, Kumar et al., 1997, Nakamura et al., 1999). Shafique et al., (1993) reported that mortality and severity of the lesions were more in immunocompromised chickens. Researchers observed the same lesions during experimental induction of HPS, (Anjum, 1990, Deepak, 1998). Asrani et al., (1997) found yellow colored subcutaneous and pericardial fat with patechial hemorrhages. Similar findings were also reported by Roy et al., (2004).

1.2.4 Etiology

Initially nutritional disorder was considered to be the cause of HPS. The causative factors considered to be the cause of disease were fishmeal, rancid fat, vitamin and mineral imbalances (Jaffery, 1988, Qureshi, 1989). Anjum, 1988 and Anjum 1990 attempted to reproduce the disease using various strategies including feed samples from farms facing natural outbreaks of the disease, feed having high levels of mycotoxins (100 ppm). But subcutaneous inoculation of the infected liver homogenate was able to transmit the disease successfully which supported the possibility of infectious nature of disease (Anjum, 1990, Khawaja et al., 1988b, Ahmad et al., 1989). A viral etiology of the disease was indicated by the presence of basophilic intranuclear inclusion bodies in hepatic cells (Anjum et al., 1989, Niazi et al., 1989, Afzal et al., 1991, Cheema et al., 1989, Abdul-Aziz and Al-Attar, 1991, Gowda, 1994, Gowda and Satyanarayana, 1994). The detection of icosahedral shaped adenovirus in liver extract during electron microscopy also verified the viral etiology (Cheema et al., 1989). Kataria et al., (1995) investigated cases of HPS in India and found adenovirus as causative agent. Isolation and identification of fowl adenovirus was also reported by other researchers (Kataria et al., 1996, Oberoi et al., 1996, Vairamuthu et al., 2002). Standard techniques were used for serotyping of field isolates and fowl adenovirus 4 was detected (Jadhao et al., 1997) and it was identified as HPS virus (Vairamuthu et al., 2002). Mazaheri et al., (1998) reported biotypes of fowl adenovirus 4 as cause of the disease. It was found that fowl adenovirus 12 alone or in

Chapter 1 Introduction & Review of Literature association with fowl adenovirus 4 was responsible of inclusion body hepatitis/ hydropericardium syndrome among poultry flocks in India (Rahul et al., 2005). In Pakistan fowl adenovirus 4 was found associated with hydropericardium syndrome (Voss et al., 1996). Voss (1989) isolated adenovirus (K31/89) from field cases of HPS in Pakistan that was identified as adenovirus serotype 4 and causative agent of HPS (Voss et al., 1996). The virus was purified from field outbreaks and the disease was successfully reproduced in Specific Pathogen Free chickens (Cowen et al., 1996, Mazaheri et al.,1998). Therefore it was proved that the fowl adenovirus 4 was the sole causative agent of this disease. The experimental transmission of the disease along with serological and electron microscopical investigations have confirmed the fowl adenovirus 4 as causative agent of HPS (Naeem et al., 1995a, Ganesh et al., 2002a). 1.2.5 Natural Transmission

Hydropericardium Syndrome was found as a highly pathogenic disease (Khawaja et al., 1988a), that can spread rapidly from flock to flock and farm to farm (Cowen, 1992). HPS was also reported as a contagious disease and it was found that its horizontal transmission occurs mechanically or through oral-fecal route (Abdul-Aziz and Hassan, 1995, Akhtar et al., 1992, Akhtar, 1995, Shafique and Shakoori, 1994, Chandra et al., 2000, Roy et al., 2004). Hafez, (2011) found that most common way of the viral transmission was vertical transmission, which occur through eggs and the virus can spread from parent to progeny.

Cowen et al., (1996) described the possible mechanism of the spread of the disease by oral-fecal route under field conditions. However, Anjum (1990) could not transmit the disease by oral inoculation or by direct contact of healthy and infected birds. It was also found that the disease can be transmitted in broilers by inoculation of liver homogenate from infected pigeons in this way the role of wild birds was found in the spread of disease.

Toro et al., (2001) described that the infection of fowl adenovirus (FAdV) and chicken anemia virus (CAV) together was not necessary to induce the HPS in chickens. It was emphasized that fowl adenovirus 4 causes immune-suppression by damaging lymphoid tissues, the presence of infectious bursal disease (IBD) virus and chicken infectious anemia (CIA) virus may predispose the chicks for HPS or HPS may predispose chicks for other viral infections (Balamurugan and Kataria, 2006).

Chapter 1 Introduction & Review of Literature

1.2.6 Experimental Transmission

Infectious nature of the disease was proved by transmission of disease by subcutaneous inoculation of the infected liver homogenate (Anjum, 1990, Khawaja et al., 1988b, Ahmad et al., 1989, Gowda and Satyanarayana, 1994, Asrani et al., 1997, Chandra et al., 1997). Anjum (1990) attempted to reproduce the disease experimentally using infected liver homogenate via subcutaneous route, oral route and by direct contact of infected birds. Successful experimental reproduction of disease was noticed within 2-5 days by subcutaneous inoculation with typical symptoms of the disease. While successful transmission of the disease could not be achieved by oral inoculation or by direct contact. Moreover, inoculation of pericardial fluid or homogenates of organs other that liver could not be able to transmit the disease (Anjum et al., 1989). Abdul- Aziz and Hassan (1995) used infected liver homogenates to inoculate one day old chicks through intramuscular or oral route, mortality rates recorded were 100% and 30%. Naeem et al., (2001) reported that the disease can be transmitted within 12 to 36 hours by inoculation of kidney, heart or lungs homogenate with typical signs of HPS. It was concluded by Naeem et al., (2001) that subcutaneous inoculation can be used for experimental transmission of disease at any age while the oral route can be used only up to 7th day of age. He described the oral route as the natural route of infection.

Shafique and Shakoori (1994) found that the disease can be transmitted successfully by inoculation of pellet obtained after ultracentrifugation of liver homogenate and mortalities were high in chicks which were injected with the suspension of pellet as compared to chicks injected with the supernatant. Fowl adenovirus 4 was propagated on chicken embryo liver cell cultures and the disease was reproduced in broiler chickens of 1-3 weeks of age (Kataria et al.,1997a, Deepak, 1998, Balamurugan et al., 2001). Subcutaneous or oral inoculation of purified fowl adenovirus 4 was also used for experimental transmission in 28 days old broilers which resulted in successful transmission of disease with typical signs and basophilic intra-nuclear inclusion bodies in hepatic cells (Dahiya et al., 2002).

1.2.7 Epidemiology

First epidemic of Hydropericardium Syndrome was reported in 1987 from poultry farms at Angara Goth, which is an extensive broiler producing area near Karachi, Pakistan (Jaffery, 1988, Khawaja et al., 1988a, Cheema et al., 1989, Hassan, 1989). After wards the disease was reported

Chapter 1 Introduction & Review of Literature from different countries e.g. Iraq (Abdul-Aziz and Al-Attar, 1991), India (Gowda and Satyanarayana, 1994), Mexico, Ecuador, Peru, Chile (Cowen et al., 1996), South and Central America (Shane, 1996), Russia (Borisov et al., 1997) and Japan (Abe et al., 1998). In Pakistan Hydropericardium Syndrome has been reported from various areas which are extensively used for poultry production. This disease has a great impact directly and indirectly on the poultry industry & economy of the country (Khan et al., 2005).

Hydropericardium Syndrome was found as a disease effecting broiler chickens ranging from 3-6 weeks of age (Cheema et al., 1989, Kumar et al., 1997, Singh et al., 1997, Khawaja et al., 1988a, Anjum et al., 1989, Niazi et al., 1989, Abdul-Aziz and Al-Attar, 1991, Gowda and Satyanarayana, 1994, Javed et al., 1994). Occasionally the disease was reported in layers and breeders of 20 weeks of age (Jaffery, 1988, Ahmad et al., 1989, Cheema et al., 1989, Akhtar, 1992, Javed et al., 1994, Asrani et al., 1997, Shukla et al., 1997a, 1997b) and in broilers of more than 5 weeks of age (Ahmad et al., 1989, Muneer et al., 1989, Akhtar and Cheema, 1990).

Apart from the broilers rare outbreaks were also reported in other avian species like pigeons and quails (Naeem and Akram, 1995, Karunamoorthy and Manickam, 1998). It was suggested that in field conditions different lines of broilers are equally susceptible (Anjum et al., 1989, Akhtar and Cheema, 1990, Afzal and Hussain, 1993). Khan et al., (1995) suggested that Hubbard x Hubbard broiler lines were relatively more susceptible to HPS as compared to Indian River and Lohman lines of chickens.

Akhtar et al., (1992) studied various epidemiological factors associated with the transmission of the disease. They found that the frequent visits of vaccinators were source of the spread of the disease. Pakistan, Russia and India have reported mortality rates upto 20-75%, 3-30% and 30- 80% respectively (Anjum et al., 1989, Cheema et al., 1989, Kumar et al., 1997, Singh et al., 1997, Borisov et al., 1997).

HPS is also known by different names i.e. Angara disease in Pakistan (Jaffery, 1988), Litchi heart Disease in India due to the appearance of heart similar to litchi fruit (Gowda and Satyanarayana, 1994), inclusion body hepatitis hydropericardium syndrome (Abdul-Aziz and Al- Attar, 1991, Jadhao et al., 1997, Balamurugan et al., 2001) or Hydropericardium-Hepatitis Syndrome (Shane, 1996, Ganesh et al., 2002a).

Chapter 1 Introduction & Review of Literature

Fig. 1.1: Worldwide distribution of Hydropericardium syndrome. Countries having prevalence of disease are marked red.

1.3 Viruses

A ‘virus’ (Latin word having meanings of toxin or poison) is an infectious agent that is unable to generate energy, grow or reproduce outside the host cells (Sano et al., 2004). Luria et al., (1978) defined viruses as “entities whose genomes are elements of nucleic acid that replicate in living cells using cellular synthetic machinery and causing the synthesis of specialized elements that can transfer the viral genome to other cells”. Viruses are the cause of diseases of humans, animals and plants. They induce heavy economic losses by devastating animal herds and agricultural crops. A typical virus particle consists of protective protein coat (capsid) containing genetic material (DNA or RNA). Capsid proteins are coded by the viral genome. Except few enveloped viruses which are covered by membrane most of the viruses are non-enveloped. It was also found that bacteriophages and other viruses are the most abundant biological entities on the earth (Breitbart and Rohwer, 2005).

Chapter 1 Introduction & Review of Literature

1.3.1 Adenoviruses

Nicklin et al., (2005) described that Adenoviruses (Ads) are non enveloped virions having 70-90 nm in diameter size. Adenoviruses were discovered in 1950s from outgrowths of human adenoid and tonsil. It was found that human and other vertebrates are infected by adenoviruses. Different isolates have different ability to agglutinate rat and rhesus erythrocytes. Depending on these properties Adenoviruses were initially classified into four subgroups (Rose and Morgan, 1960).

Fig 1.2: Electron micrograph of Adenovirus showing typical icosahedral particle morphology.

1.3.2 Aviadenoviruses

Aviadenoviruses are diverse group of pathogens, which cause variety of infections in avian species (Fadly and Winterfield, 1973, Rosenberger et al., 1974). The aviadenoviruses are further divided into three groups. The group I comprised of 12 serotypes of avian adenoviruses from chickens, geese, turkeys and other species, which have a common group of antigens (Kawamura et al., 1964, Mcferran et al., 1975, Zask and Kisary 1984, Cowen and Naqi, 1982, Xie et al., 1999, Toro et al., 2000). The causative agent (virus) of Hydropericardium syndrome is classified

Chapter 1 Introduction & Review of Literature as group I, serotype 4 (Cowen, 1992, Naeem et al., 1995a, Cowen et al., 1997, Mazaheri et al., 1998, Hess et al., 1999, Nakamura et al., 2000, Toro et al., 2001, Dahiya et al., 2002). The virus responsible of acute inclusion body hepatitis infection is classified as group I, serotype 8 (Reece et al., 1987, Christensen and Saifuddin, 1989, Erny et al., 1991, Grimes, 1992).

The second group of avian adenoviruses is known as group II, which causes infections such as hemorrhagic enteritis in turkeys, marble spleen disease in pheasants and spleenomegaly in chickens. The group II viruses also share a common group of antigen that distinguishes them from other groups (Domermuth et al., 1980).

The third group of avian adenoviruses is known as group III that is responsible of egg drop syndrome infection in laying chickens (Mcferran et al., 1978).

1.3.3 Morphological characteristics

Size and shape, chemical composition, structure of the genome and mode of replication are main criteria for classification. For example, the genome DNA or RNA, single stranded or double stranded, linear or circular, positive sense or negative sense and monopartite or multipartite. Similarly nucleocapsids may have helical or Icosahedral morphology. Icosahedral morphology is characteristic of the nucleocapsids of many “spherical” viruses. This symmetry is typical for members of the adenovirus family.

On the basis of shared properties, viruses are grouped at different levels i.e. order, family, subfamily, genus and species. International committee on taxonomy of viruses (ICTV) in its 8th report on classification and nomenclature of viruses approved 3 orders, 73 families, 9 subfamilies, 287 genera and 1950 species (Fauquet et al., 2005). Viral morphology provides the basis for grouping of the viruses into families. A virus family may contain members that replicate only in vertebrates, only in invertebrates, only in plants, or only in bacteria. Some families have viruses that replicate in more than one host.

1.3.4 Molecular characteristics

Rekosh et al., (1977) and Davison et al., (2003) defined that the virus has a linear, double stranded DNA having approximate size of 26-46 kbp and a terminal protein is covalently

Chapter 1 Introduction & Review of Literature attached to the 5’ end. Russell, (2000, 2009) described that genome of adenovirus encodes about 13 structural proteins. He found that the capsid of the viral particle consists of three major proteins i.e. hexon, penton base and a knobbed fiber. Remaining are minor proteins including cement proteins (VI, VIII, IX, IIIa) and core proteins (V, VII, Mu, terminal protein, IVa2, protease). Nicklin et al., (2005) and Laver et al., (1971) found that adenovirus particles have 70 to 90nm diameter.

Rabbani and Naeem (1996) studied the protein profiles of various field isolates and they reported that all isolates have similar profiles. Izhar et al., (1997) used sodium dodecyl sulphate gel electrophoresis (SDS-PAGE) to study the polypeptides of HPS virus. They observed eight polypeptides ranging in molecular weight from 15.7 to 119 kDa. Rabbani et al., 1998a separated seven bands of polypeptides ranging in molecular weight from 24 to 120 kDa. Similarly three Indian field isolates of HPS were subjected to SDS-PAGE anlaysis and the results revealed eight polypeptides with molecular weights ranging from 20-107 kDa.

Balamurugan et al., (2002), Kumar and Chandra (2004) studied the protein profiles of the virus and they found eight to twelve protein fractions of FAdV-4 isolates, having molecular weights between 13.8 and 110 kDa. Among these protein fractions seven immunogenic polypeptides were detected (having molecular weights from 15.8 to 110 kDa) during western blotting against FAdV-4 serum. Hexon, Penton base and fiber were found among highly immuno-reactive fractions. Fingerut et al., (2003) and Jucker et al., (1996) found that structural capsid proteins of adenovirus i.e. penton and fiber interact with cell receptors during penetration of virus into the cell. Among non structural proteins, 100K has importance because Hong et al., (2005) described that this protein may have some role in intracellular transport & folding of viral proteins during viral replication.

Indian isolate from field outbreaks of IBH-HPS from different areas were types as fowl adenovirus 4 (Jadhao et al., 1997) and its genomic DNA was characterized by restriction enzyme (RE) analysis of (Jadhao, 1998). Field isolates of fowl adenovirus were characterized from several outbreaks of HPS and their serum neutralization test showed positive reaction against the antibodies of serotype 4 and 10 (Mazaheri et al., 1998). It was found during immunological and molecular analytical techniques that fowl adenovirus 4 and 10 are closely related (Erny et al.,

Chapter 1 Introduction & Review of Literature

1991). Toro et al., (1999) also characterized three field isolates of IBH-HPS as fowl adenovirus 4 by virus neutralization and RE analysis.

Afzal et al., (1991) found that HPS virus withstands heating to 60 ºC for 30 minutes and 50 ºC for one hour. However the virus was inactivated by heating to 60 ºC for one hour, 80 ºC for 10 minutes and 100 ºC for 5 minutes. Moreover, the chloroform or ether treatment was appeared to be detrimental for HPS virus. Hussain et al., (1996) and Roy et al., (2004) used chloroform treatment for the purification of HPS virus. Hafez (2011) described that adenoviruses are resistant to several disinfectants and relatively tolerant to heat and pH changes. Khawaja et al., (1988a), Kumar et al., (1997) found that HPS agent can be filtered through a Seitz Filter or membrane filter having average pore diameter of 0.1 um. It has further been reported that the HPS virus agglutinated red blood cells in the same way like other adenovirus.

1.3.5 Phylogeny and genetic organization

Davison et al., (2003) described that adenoviruses are non-enveloped, icosahedral viruses, belongs to family Adenoviridae which is classified into four genera i.e. Atadenovirus, Siadenovirus, Mastadenovirus and Aviadenovirus while the only confirmed Fish adenovirus is in fifth clade (Ichtadenovirus). They replicate inside the nucleus. They have double stranded, linear DNA having size approximately about 26-46kbp. They are classified as medium sized DNA viruses. The genomes have inverted terminal repeats (ITR) ranging from 36 to 200bp and the 5’ ends have terminal protein (TP). Phylogenetic relationship between adenoviruses infecting vertebrates (fish to human) based on hexon gene has been described in figure 1.7.

Masaji et al., (2010) compared the nucleotide sequence of short fiber gene from various Fowl adenovirus-4 isolates of Japan, India and Pakistan. During phylogenetic analysis it was found that the Fowl adenovirus-4 isolated from HPS infected chickens were grouped into a different cluster from Fowl adenovirus-4 strains isolated from non HPS cases. So it was suggested that Fowl adenovirus-4 strains can be distinguished on the basis of nucleotide sequence of short fiber gene.

Harrach et al., (2011) suggested new classification for adenoviruses after placing the Turkey adenovirus species into genus Aviadenovirus and rename the species in the family Adenoviridae

Chapter 1 Introduction & Review of Literature by adding letter designation “Possum adenovirus A, Goose adenovirus A, Canine adenovirus A, Tree shree adenovirus A and frog adenovirus A”.

Thakor et al., (2012) isolated and characterized Avian adenovirus from naturally infected broilers. The presence of the virus in samples was confirmed by amplification of approximately 890 bp DNA fragment of Hexon gene. Phylogenetic analysis revealed three major branches of the proposed genera, Avi-adenovirus (FAdV 1-12), Atadenovirus (EDS virus) and Siadenovirus. They observed seven minor branches within Avi-adenovirus branch. Their isolates were found to have close relation with Fowl adenovirus 12 and Fowl adenovirus 11 strains.

Chapter 1 Introduction & Review of Literature

Fig 1.3: Distance tree summarizing the phylogeny of adenovirus based on hexon gene, indicating four major groups (clades) of adenoviruses, which correspond to the four accepted genera while the fifth group is proposed to be added as fifth genus.

Chapter 1 Introduction & Review of Literature

1.4 Proteins encoded by Adenoviruses

Viral genome codes for only a few structural proteins (besides non-structural regulatory proteins involved in virus replication) because of its limited size. Capsids are formed as single or double protein shells and consist of only one or a few structural protein species. Therefore, multiple protein copies must self assemble to form the continuous three-dimensional capsid structure. The capsid consists of three major structural proteins, the hexon, fiber, and penton base (Fig. 1.4a). Hexon forms the majority of the structural components of the capsid, which has 240 trimeric hexon capsomeres and 12 pentameric penton bases. The trimeric fiber protein protrudes from the penton base at each of the 12 vertices of capsid and has a knobbed rodlike structure (Fig. 1.4b). The major difference in the surface of adenovirus capsids as compared with most of other icosahedral viruses is the presence of the long, thin fiber protein. The main role of the fiber protein is the tethering (attachment) of the viral capsid to the cell surface by its interaction with cellular receptors (Nicklin et al., 2005, Russell, 2009).

Fig. 1.4: (a) Structure of adenovirus, a schematic diagram showing different structural proteins (b) The adenovirus fiber, Fiber trimers (green) protrude from each penton complex (yellow) of the icosahedral capsid of adenovirus. The fiber trimer comprises N-terminal tails (thin tubes), a central shaft, and a globular knob (ovals).

Chapter 1 Introduction & Review of Literature

1.4.1 Hexon

Icosahedral capsid of adenovirus is composed mainly of hexon protein. There are four types of Hexon designated as H1, H2, H3 and H4 (Burnett, 1985). H1 type of hexons are sixty in number and they are associated with pentons at the 12 apices, so they are also called as peripentonal hexons. The remaining hexon are designed as ‘group of nine’ (GON) on the 20 faces of the icosahedrons and described in Fig. 1.5. The H2 type of hexon are on the two fold axes, H3 are on the three fold axes while the remaining are H4. The size of Hexon is different in different serotypes, the largest hexon comprises of 967 amino acids. Each hexon has up to nine hypervariable regions and they are situated at top of the molecule (Saban et al., 2006). These regions represent the type specific antigens of the hexon and at least one of them has major role in virus neutralizing activity (Rux et al., 2003, Roberts et al., 2006).

Fig. 1.5: Facets of the adenovirus icosahedrons describing different types of Hexons. The GON hexons are coloured and the H1 peripentonal hexons are either lettered in black when they are on the same plane as the GONs or lettered in orange where they are associated with GONs on a different facet. Similarly, the H2 hexons lettered in orange are associated with GONs on a different facet.

Chapter 1 Introduction & Review of Literature

1.4.2 Penton base

The penton base monomer approximately comprises of 471 amino acids. The covalent complex of two proteins (homopentameric penton base and homotrimeric fiber protein) forms the penton capsomere. The penton base is situated on strategic position at the apices of the icosahedral capsid and it plays a key role in stabilization of the capsid as it interacts with the neighbouring capsomeres, peripentonal hexons and other associated proteins. More over the penton base is sensitive to heat, trypsin, pH and changes in ionic strength (Wiethoff et al., 2005). It is found that Penton base in association with some other proteins play major role during penetration and entry of virion in the cells (Fender et al., 2005). At post entry stage the role of penton base is not clear whereas it has been found that penton base protein interact with the cellular components and the neutralizing antibodies against the penton base have been detected in the sera of the patients (Hong et al., 2003).

1.4.3 Fiber

The fiber polypeptide comprises of approximately 582 amino acids and it binds non covalently to penton base from its N terminal side (Zubieta et al., 2005). The fiber has three regions including tail, shaft and knob. The fiber is the first component of the virus which interacts with host cell/tissue. The ability of the virus to bind the host cell is the key feature of the infection process and it mainly affects the pathogenecity of the virus. The variable sequences on the fiber knob determine the haemagglutinating properties of adenoviruses and these properties of adenoviruses are used to classify the species from A to F (Pehler-Harrington et al., 2004). The fiber knob also has important role in fiber protein synthesis and encapsidation (Henning et al., 2006).

Studies on morphology of the penton of CELO virus revealed that Avian adenoviruses has a different structure of Pentameric base which is associated with two fibers, one long and one short (Fig. 1.6). It was found that both fibers have different receptors so it was suggested that both fibers are required, one for virus attachment and other for internalization (Hess et al., 1995, Tan et al., 2001). Masaji et al., (2010) determined the nucleotide sequence of Short fiber from Fowl adenovirus serotype 4 and its amino acid sequence was deduced. They found that short fiber comprises of 479 amino acids and its nucleotide sequence can be used to differentiate various

Chapter 1 Introduction & Review of Literature

Fowl adenovirus serotype 4 strains. It was also found that epitopes of virulence determinant, cell surface binding receptors and receptors for tissue tropism exist within the fiber.

Fig. 1.6: Penton base along with two fibers of CELO virus (FAdV-1). (a) Schematic diagram of the CELO virus penton having two fibers (long and short). (b) Electron micrographs of negatively stained pentons of CELO virus.

1.4.4 100K

100K is one of the important non structural proteins (NSP) of the virus. This protein is found to play an important role in transport of viral protein during viral replication in the host cells. 100K protein has been identified as a chaperone protein in subgroup C and B adenoviruses, which assists in trimerization and nuclear localization of hexons. Experiments were conducted to express Hexon protein in insect cells alone and it was also co-expressed in the presence of 100K protein. Hexon protein when expressed alone was detected in cytoplasm as inclusion bodies. When the Hexon and 100K were co-expressed, surprisingly the Hexon was found in soluble trimeric form. So it was suggested that 100K protein acts as scaffold protein for Hexon because evidences suggested its role in folding, self assembly and nuclear import of Hexon in insect cells (Hong et al., 2005).

1.5 Diagnosis

Different techniques were used by various researchers for accurate and precise diagnosis of the disease, which include conventional microbiological as well as molecular biological techniques.

Chapter 1 Introduction & Review of Literature

1.5.1 Conventional microbiological techniques

Clinical diagnosis of hydropericardium syndrome was considered to be a difficult task because of sudden onset and acute nature of the disease (Ganesh et al., 2001, Ganesh, 1998, Mahmood et al., 2011). In Pakistan it was revealed that initial diagnosis was made only by gross lesions and presence of intra-nuclear inclusion bodies in hepatocytes during histopathology (Anjum et al., 1989). Diagnostic significance of electron microscopy was emphasized by Cheema et al., (1989). The presence of icosahedral viral particle detected by negative staining electron microscopy in infected liver homogenate supported the view that the disease was caused by avian adenovirus (Cheema et al., 1989). Isometric, roughly spherical particles, resembling the morphology of adenovirus were also found during transmission electron microscopy (Chandra et al., 1997, Ganesh et al., 2002a).

Microbiological and serological methods used for diagnosis of subclinical infection of Hydropericardium syndrome includes Agar gel precipitation test (Hassan et al., 1994), Indirect Haemagglutination assay (Rehman et al., 1989, Manzoor and Hussain, 2003), dot immunobinding assay (Rabbani et al., 1998b), Enzyme linked immunosorbent assay (Hassan et al., 1994, Saifuddin and Wilks, 1990), Immunoperoxidase test (Roy et al., 2001), Tissue culture and embryonated hen egg culture along with virus neutralization test (Rabbani and Naeem, 1996).

The successful attempts were made for the propagation of virus in embryonated hen eggs further strengthened the viral etiology of the disease (Cheema et al., 1989, Shafique et al., 1993, Mahmood and Hassan, 1995, Naeem et al., 1995b, Kataria et al., 1996, 1997a). Afzal et al., (1990) reported that fowl adeno virus can be cultured in embryonated hen eggs by inoculation through different routes. They found that inoculation through chorioallantoic membrane, yolk sac and chorioallantoic sac can be used for the virus and embryos were died 4-9 days post inoculation. They found that dead embryos had stunted growth and hemorrhages. Mahmood and Hassan (1995) propagated the fowl adeno virus on duck embryonated eggs. They inoculated the virus through yolk sac and chorioallantoic sac. Death of embryos along with stunted growth and hemorrhages were reported by both routes. They also reported the intra nuclear inclusion bodies in hepatocytes of inoculated embryos.

Chapter 1 Introduction & Review of Literature

The virus was also propagated and isolated from cell culture (Khawaja et al., 1988a, Afzal et al., 1990, Oberoi et al., 1996, Balamurugan, 1999, Chandra et al., 2000, Balamurugan et al., 2001, 2002). Khawaja et al., (1988a) propagated and isolated the virus in cell culture of chicken embryo kidney cells. They reported cytopathic effects in cell culture e.g. degeneration, detachment of cells from the surface and basophilic intra-nuclear inclusion bodies. Afzal et al., (1990) made some efforts to propagate the HPS virus in QT 35 and vero cell lines but the virus could not be successfully cultured from these cell lines as virus was unable to produce any cytopathic effects. Roy et al., (2001) adapted the HPS virus in VERO cell line after four blind passages. Later on they observed characteristic cytopathogenic effects (CPE) after 96 hours of inoculation in VERO cells. Kumar et al., (2003) and Mehmood et al., (2011) cultivated the HPS virus in chicken embryo 3.6 hepatocyte suspension and found a biological titer of 10 per ml units of LD50 while the same 5.6 virus showed biological titer of 10 units of LD50 per gram of infected liver homogenate. So it was found that 100 times more virus can be harvested from infected liver homogenate.

1.5.2 Molecular diagnostic techniques

In case of adenoviruses problem with serological techniques is associated with interpretation of results, as the antibodies are commonly present in both healthy and infected birds (Hafez, 2011, Thakor et al., 2012). Molecular techniques target and detect the pathogen itself rather than the antibodies induced by it in this way early detection of the disease is ensured. The invention of polymerase chain reaction (PCR) technique has provided high sensitivity and specificity for the diagnosis of HPS virus by targeting the Hexon gene (Toro et al., 1999, Dahiya et al., 2002, Ganesh et al., 2002b, Thakor et al., 2012). Ganesh et al., (2002b) extracted the viral DNA from infected liver tissue or purified virus and subjected to PCR for amplification of variable part of Hexon gene using specific primers. Results revealed the successful amplification of 700bp fragment of Hexon gene. Later on this fragment of Hexon gene was also used as a probe for detection of the virus by dot blot hybridization of viral DNA (Ganesh et al., 2002b). Raue and hess (1998), Hess (2000) amplified the partial hexon gene having 1319 bp size using specific primers. They also studied the Restriction Fragment Length polymorphism (RFLP) of the PCR product after digestion of the PCR product with Hpa II enzyme. After digestion with restriction enzyme five DNA fragments were found on agarose gel having approximate sizes of 150, 200,

Chapter 1 Introduction & Review of Literature

250, 300 and 500bp (Raue and Hess, 1998, Toro et al., 1999, Xie et al., 1999, Swati et al., 2002). Masaji et al., (2010) found that PCR-RFLP analysis of short fiber gene using Alu I enzyme was useful to distinguish various Fowl adenovirus-4 strains. Thakor et al., (2012) amplified the 890bp DNA fragment of the Hexon using gene specific primers for detection of HPS-IBH virus in field samples.

In Pakistan, in spite of keeping in view the economic importance of the disease none of the techniques mentioned above were adapted in field for diagnosis and control of disease (Khan et al., 2005).

1.6 Prevention and Control

Various strategies were adapted by the researchers regarding the prevention and control of disease after the initial outbreaks of hydropericardium syndrome during 1987 in Pakistan. It was suggested that by maintaining good husbandry practices like disinfection, maintaining strict biosecurity and proper ventilation may significantly reduce the chances of infection (Akhtar et al., 1992). The addition of iodophor solution to drinking water at concentration of 0.07- 0.1% was found to be efficacious in reducing the course and mortality of HPS in broilers (Abdul-Aziz and Al-Attar, 1991, Abdul-Aziz and Hassan, 1995). In case of an outbreak there is no specific treatment available against this viral disease however antibiotics are used for prevention of secondary bacterial infection (Merck and Dohme, 2011).

1.7 Conventional Vaccines

Standard vaccines are available against many other poultry diseases but available vaccines against HPS are scanty. Two types of vaccines are currently reported in literature against HPS, including parenteral inactivated (killed) whole-cell vaccine and oral live attenuated vaccine. List of various types of available licensed vaccines against HPS are given in table 1.1.

1.7.1 Parenteral inactivated (killed) whole-cell vaccines

Initially the disease was controlled by an inactivated liver homogenate vaccine which was formulated after the first outbreak of the disease and many researchers reported that the vaccine has successfully prevented the disease (Cheema et al., 1989, Chishti et al., 1989, Afzal and Ahmad, 1990, Afzal et al., 1990, Ahmad et al., 1990, Anjum 1990, Mashkoor et al., 1994a,

Chapter 1 Introduction & Review of Literature

1994b, Shane, 1996, Kumar et al., 1997, Hussain et al., 1996, 1999, Roy et al., (1999), Akhtar et al., 2000, Chandra et al., 2000, Ahmad and Hassan, 2004).

Chishti et al., (1989) formulated and tested oil based vaccine and formaldehyde vaccine by using liver homogenate. Humoral immune response and protection against HPS virus challenge was determined after 30 days of vaccination. Oil emulsion vaccine induced significantly higher levels of immunity and protection as compared to formaldehyde vaccine. Khushi et al., (1996) and Manzoor et al., (2003) also found that oil based HPS vaccine was more effective against the disease in broilers. Akhtar et al., (2000) evaluated the immune response induced by formalin inactivated and binary ethylene imine inactivated liver homogenate vaccines against the disease in field conditions. It was found that antibody titer of group vaccinated with binary ethyleneimine inactivated vaccine was detected at 10th day post vaccination and it was at peak at 25th day post vaccination while antibody titer of group vaccinated with formalin inactivated vaccine was at peak at 20th day post vaccination and it started to decline at 25th day post vaccination. The results of challenge test revealed that the maximum protection was achieved with binary ethylene imine inactivated vaccine.

Afzal and Ahmad (1990) conducted field trials and evaluated the efficacy of inactivated liver homogenate vaccine on thirty broiler farms with a total population of 1,05,900 broiler chickens. All the flocks were vaccinated at the age of 10 to 12 days and control birds were unvaccinated in each shed separated from the vaccinated birds. During the trials 0.52% mortality was observed in vaccinated birds compared with 5.34% mortality in unvaccinated control birds. Out of these 30 vaccinated flocks, the disease outbreak was noticed in vaccinated chicks on 15 farms. No mortalities were observed in vaccinated birds among four of these farms. While in remaining flocks during 4th and 5th week post vaccination, the mortality was significantly lower (1.08%) in vaccinated birds as compared to unvaccinated control birds (10.7%). Moreover, in infected flocks the vaccinated birds gained more weight than the unvaccinated birds. In case of an outbreak, vaccination significantly (P<0.01) reduced the mortality in the infected flocks. Mortality due to HPS among the vaccinated birds was reported up to five days with occasional deaths and among the unvaccinated birds mortality was reported up to 16 days with total losses of 10.3%. They recommended that the vaccination at 15-18 days or two vaccinations at 10 and 21 days of age should be done for better protection.

Chapter 1 Introduction & Review of Literature

Zia et al., (2001) evaluated formalin killed vaccine (Group A), oil emulsion vaccine (Group B) and commercial oil emulsion vaccine (Group C). After vaccination humoral immunity and protection against challenge was determined. Antibody titer of group B was significantly higher as compared to group A and C after 14th day of vaccination. Groups A, B and C exhibited 40%, 0% and 20% mortalities respectively during challenge protection test.

Ahmad et al., (1990) found that a single dose of vaccine was effective at 15th to 18th day of age. Whereas Hassan et al., (1994) found that two doses of vaccine conferred 90-100% protection while single dose of vaccine conferred 80-100% protection during an experimental challenge protection test.

Kumar et al., (1997) observed that a single dose of 0.25ml/bird of the vaccine at 10th to 12th day of age conferred 100% protection in vaccinated chickens during severe outbreaks of HPS in India. They also found that heating of infected liver homogenate at 56ºC for 60 minutes followed by overnight inactivation with 0.1% formalin was proved more efficacious.

Naeem et al., (1995b) developed vaccine using SPF embryonated eggs and tissue cultures. They propagated the virus on SPF embryonated eggs and chicken embryo liver cell cultures and formulated the vaccines. The vaccines were tested for their ability to confer protection against viral challenge. It was found that vaccines have induced partial protection against subcutaneous challenge by 1ml of a 20% liver homogenate.

Kataria et al., (1997b) isolated adenovirus in cell culture and formulated inactivated oil based vaccine. Efficacy of this vaccine was tested by challenge protection test and 100% protection against challenge was found at 42nd day of age. Broilers of 21st day of age were vaccinated with 5.5 0.5ml dose of vaccine having 10 TCID50 /0.5ml of virus. Challenge protection test revealed that the vaccine has conferred 100% protection against challenge with HPS virus up to 6 weeks post vaccination. Chandra et al., (2000) reported that HPS can be brought under control by inactivated liver homogenate vaccines (0.25 ml/bird) or by inactivated cell culture vaccines (103.5

LD50 / bird) injected subcutaneously at 10 – 15 days of age. Moreover they found that vaccine is effective in case of outbreak and it significantly reduces the mortalities.

Shane (1996) evaluated the efficacy of inactivated vaccines which were used in Mexico. Each vaccine was injected into SPF chicks and a dose of 0.5ml/chick was used. The challenge

Chapter 1 Introduction & Review of Literature

3.5 protection test with 10 LD50 of adenovirus revealed 100% protection with no histological changes in hepatocytes.

Icochea et al., (2001) evaluated the efficacy of inactivated vaccines in Peru. They found that oil adjuvanted cell culture IBH vaccine was providing better protection as compared to the autogenous vaccine.

Toro et al., (2002) vaccinated brown leghorn pullets of 17th week of age using different schedules for vaccination. Single FAdV (inactivated), single CAV (attenuated), FAdV and CAV combined vaccines were used. They checked that whether effective protection of progeny chickens against inclusion body hepatitis/ hydropericardium syndrome (IBH/HPS) can be achieved or not. Progenies of these breeders were challenged with the pathogenic viral strains of FAdV and CAV. Both groups vaccinated against FAdV and CAV were having virus neutralizing antibodies. Challenge protection test revealed 26.6% mortality in control progeny chickens and 13.3 % mortality in the progeny of FAdV vaccinated breeders. Histopathology of hepatocytes from these groups revealed hepatic inclusion bodies in 94% of dead birds.

Khan et al., (2005) suggested that outbreaks of HPS are mostly post-vaccination in Pakistan. Due to this reason the local vaccine production has been minimized. The poultry industry in Pakistan is still at the same risk as it was in 1987. It was suggested that the virus should be propagated on specific pathogen free embryonated hen eggs and cell cultures to produce killed and live attenuated vaccines. They also suggested that the unhealthy liver homogenate vaccine should not be used.

Mahmood et al., (2011) described that HPS is common in commercial flocks even after vaccination using infected liver homogenate vaccines. They found that during liver homogenization for vaccine production some of in process quality control factors mitigate its quality and efficacy. More over it was found that addition of adjuvant like oil base (Montanide ISA 70) or aluminum hydroxide gel (AHG) in the vaccine has additive effects on its efficacy. It was concluded that gel based vaccines freshly prepared from infected liver homogenate are effective and economical.

Chapter 1 Introduction & Review of Literature

1.7.2 Oral live attenuated vaccine

Mansoor et al., (2011) developed a live attenuated vaccine against HPS. They adapted a field isolate of HPS virus in chicken embryonated eggs after four blind passages. The chicken embryo adapted virus was further passaged up to 12 times for its complete attenuation. They tested this attenuated virus by giving through oral and parenteral routes to broilers at 14th day of age. They compared this attenuated vaccine with old liver homogenate vaccines. It was revealed that antibody response measured by ELISA was significantly higher in group of broilers which was immunized with 16th passage attenuated HPS virus at 7th, 14th and 21st days post immunization. During challenge protection test at 24th day post immunization it was found that broilers immunized with 16th passage attenuated virus were conferred with 94.73% protection while the broilers immunized with liver homogenate vaccine were showing significant low protection i.e 55%. Broilers of unvaccinated control group were showing 70% mortality and only 10% protection was recorded. So the newly developed attenuated vaccine was found to be more immunogenic and effective against HPS virus in broilers.

Chapter 1 Introduction & Review of Literature

Table 1.1: List of licensed vaccines available against HPS / IBH in different countries

Product Name Type Strain / Adjuvant Licensed Company Subtype countries

Avi-Hydro Killed Not Available Not Pakistan Avicenna Available Laboratories

HP Vac Killed Type 4 Oil India INDOVAX Pvt.Ltd.

Hepavac IBH Killed Not Available Aluminum Peru Innova hydroxide Andina gel

Hydrofas Killed Not Available Not Pakistan Intervac Available (PVT) Ltd.

Emulmax EDS Killed LaSota (ND) Oil Mexico Investigación (Newcastle Disease, Serotype 4 Aplicada, Hydropericardium (HPS) S.A. de C.V. Syndrome)

Emulmax IBH + ND Killed Serotype 4 Oil Mexico (Hydropericardium (HPS) Syndrome, LaSota (ND) Newcastle Disease)

Emulmax IBH Killed Serotype 4 Oil Mexico

Emulmax-C IBH Killed Serotype 4 Oil Mexico

Emulmax-C IBH + Killed Serotype 4 Oil Mexico ND (HPS) (Hydropericardium LaSota (ND) Syndrome, Newcastle Disease)

NOBILIS® EDS- Killed BC-14/127 Oil Mexico MSD Animal ADENO 4 INAC (EDS) Health Serotype 4 (Merck) (HPS)

NOBILIS® Killed Group 1, Not Peru Hepatitis+ND INAC Serotype 4 Available (HPS) Clone 30 (ND)

(Source: www.cfsph.iastate.edu)

Chapter 1 Introduction & Review of Literature

1.8 Recombinant (subunit) vaccine

Currently inactivated vaccines (Anjum, 1990) or attenuated vaccines (Mansoor et al., 2011) are available against Hydropericardium syndrome. Lack of full attenuation or inactivation and the oncogenic potential of the adenoviruses have prevented their use in routine vaccines. A subunit vaccine has the advantage that it eliminate the danger of disease outbreak caused by incomplete inactivation or attenuation (Fingerut et al., 2003).

Effectiveness of subunit vaccines against Infectious bursal disease (IBD) virus in chicken (Pitcovski et al., 2003), Egg drop syndrome (EDS) virus in chicken (Fingerut et al., 2003), Hemorrhagic enteritis virus (HEV) in turkeys (Pitcovski et al., 2005) and hepatitis B virus in humans (McAleer et al., 1984) have previously been proven. Balamurugan and Kataria (2004) suggested that recombinant DNA technology has advantages over other approaches in development of safe vaccines that can induce a strong active immunity to protect broilers from adenovirus infection. Khan et al., (2005) suggested that modern practices of recombinant DNA technology should be adapted to meet the need of present era for diagnosis and prevention of Hydropericardium syndrome. Pitcovski et al., (2005) also suggested that concept of subunit vaccines may be use full to develop vaccines against adenoviruses.

1.9 Aims of this study

The present project was designed to develop viral recombinant proteins for diagnosis and control of Hydropericardium syndrome.

The special aims of present study are as follows:

1. Identification and molecular characterization of fowl adenovirus causing Hydropericardium syndrome in broilers.

2. Development and characterization of viral recombinant proteins for immunization against HPS and evaluation of their immunogenicity in broilers.

Chapter 2 Materials and Methods

Materials and Methods

2.1 Chemicals and Reagents

All the molecular biology reagents and general laboratory chemicals used in this study were of a high purity ‘or its equivalent. General laboratory materials and biochemical reagents were obtained from:

 Sigma-Aldrich Chemical Company Ltd., http:/ www.sigmaaldrich.com  Bio-Rad Laboratories, http:/ www.bio-rad.com  Roth, http:// www.roth.com Reagents for molecular biology and protein purification were purchased from:

 Sigma-Aldrich Chemical Company Ltd., http:// www.sigmaaldrich.com  Bio-Rad Laboratories, http:/ www.bio-rad.com  Fermentas, http:/ www.fermentas.com  New England Biolab, http:/ www.neb.com  Promega, http:/ www.promega.com  Qiagen, http:/ www.qiagen.com  Roche Diagnostics, http:/ www.roch.com  Invitrogen Life Technologies, http:/ www.invitrogen.com  Clontech, http:// www.clontech.com

2.2 Bacterial Strains/Plasmids/Vectors

Bacterial strains, standard plasmids, constructed plasmids/vectors and transformed bacterial strains used in this study are listed in Table 2.1.

Chapter 2 Materials and Methods

Table 2.1: List of Bacterial strains, Standard plasmids and Constructed Vectors

Bacterial Strains Description Source/reference

Top 10 E.coli F-, mcrA, ∆(mrr-hsdRMS-mcrBC), ᵩ 80 lacZ ∆M15,∆lac Invitrogen, UK X74, deoR, recA1, araD139∆(ara-leu) 7697, galU, galK, rpsL( StrR), endA1 nupG

BL21(DE3)E.coli F-, ompT, hsdS(rB- mB-), gal, dcm, λ(DE3) Novagen,UK

Rosetta(DE3)E.coli Cam, Derived from BL21, Facilitates gene expression Novagen,UK

Standard Plasmids pET28a KanR expression vector, N term thrombin cleavage site, f1 Invitrogen,UK origin, T7 promoter.

Constructed Plasmids/ vectors pSMJ-1 pET28a carrying full length 100K gene (2397 bp) This study expression vector under T7 promoter pSMJ-2 pET28a carrying full length Penton base gene (1587 bp) This study expression vector under T7 promoter pSMJ-3 pET28a carrying full length Short fiber gene (1437 bp) This study expression vector under T7 promoter

Transformed bacterial strains BL21(DE3)/pSMJ-1 BL21(DE3)E.coli harboring pSMJ-1 vector This study

BL21(DE3)/pSMJ-2 BL21(DE3)E.coli harboring pSMJ-2 vector This study

BL21(DE3)/pSMJ-3 BL21(DE3)E.coli harboring pSMJ-3 vector This study

2.3 Bacterial media and cultivation conditions

Luria Bertani (LB) medium was used for growth of bacterial strains as described by Miller (1972). LB broth and 1.5% LB-agar plates were prepared and autoclaved. (See appendix 1). Filter sterilized, kanamycin was added (50µg/ml) to LB broth and LB agar as required.

2.4 Collection and selection of samples

Samples were collected from Government and Private Poultry farms/ Institutes, located in Faisalabad, Lahore and Rawalpindi, Punjab, Pakistan. Broiler chickens were examined for signs and symptoms of Hydropericardium syndrome. Details of samples are listed in Table 2.2.

Chapter 2 Materials and Methods

Table 2.2: Details of samples collected from field outbreaks.

No. Site of collection No. of No. of birds Samples collected 1 Abbaspur, Faisalabad 5000 10 2 Abbaspur, Faisalabad 8000 10 3 Theekri wala, Faisalabad 5000 10 4 Satiana, Faisalabad 5000 10 5 Satiana, Faisalabad 6000 10 6 Samundri, Faisalabad 9000 10 7 Poultry Research Institute, 5000 10 Rawalpindi 8 Samundri, Faisalabad 7000 10 9 Poultry Research Institute, 8000 10 Rawalpindi 10 University of veterinary & animal 8000 10 sciences, Lahore Total 66,000 100

The diseased chicken broilers were selected for postmortem examination. After conducting postmortem examination on each boiler chicken, total liver tissue was transferred to a sterile container with ice for further studies.

2.5 Extraction of Semi purified viral particle

1 – 2 gram of liver tissue (collected from infected birds) was homogenized in 10 ml of phosphate buffer saline (3.2 mM Na2HPO4, 0.5 mM KH2PO4, 1.3 mM KCl, 135 mM NaCl, pH 7.4). The homogenized solution was transferred into 20 ml falcon tube and centrifuged at 3000 rpm for 15 min at 4 0C. The supernatant was collected and filtered through 0.2 µm filter. The filtrate was subjected to sucrose density gradient ultra centrifugation as described by Ganesh et al., (2001). The pellet containing the viral particle was collected and re-suspended in 0.5 ml of PBS and stored at -200C to perform Electron microscopic studies and viral DNA isolation.

Chapter 2 Materials and Methods

2.6 Electron microscopy

Studies were carried out on semi purified virus particles (from section 2.5). Surface structure of the virus was analyzed under Field Emission Scanning Electron Microscope (FESEM) as described by Hong et al., (2005) with some modifications. For this, viral particles were adsorbed on the surface of Carbon coated grids by placing a drop of the semi purified viral suspension on the grid and drained out extra fluid with filter paper. Specimens were negatively stained by adding a drop of 2% Uranyl acetate stain for few seconds and extra stain was drained. Specimens were air dried and observed under Scanning Electron Microscope (Model No: JEOL JFM 7500 F) placed at NIBGE, Faisalabad. Micrograph was taken under low-dose conditions at 3.0 KV and at magnification of 30,000 X.

2.7 Selection and designing of primers

Primers or oligonucleotides used in the study are listed in Table 2.3. The Variable region (L1 and part of P1) of Hexon gene primers FAVHL and FAVHR designed and reported by Ganesh et al., (2001) were to detect the fowl adenovirus-4 Hexon gene. The other three sets of primers i.e SMJ-1F and SMJ1R; SMJ-2F and SMJ-2R & SMJ-3F and SMJ3R were designed after devising the cloning strategies of three target genes (100Ks , Penton base and Short fiber) with the help of computer program of Vector NTI and Primer 3 software. The primers were verified for specificity using National center for Biotechnology Information (NCBI) BLAST server. Nucleotide sequences of corresponding genes (100K, Penton base and short fiber) of various isolates were retrieved from Genbank and consensus sequences were obtained which were used for primer designing of each gene. All primers were synthesized from Fermentas / Molecular Biology Products and were obtained in the lyophilized form. Stock solutions of primers were prepared in concentration of 100 µM while working solution of each primer was formulated in concentration of 10 µM by diluting the stocks in nuclease free deionized distill water. All the stocks and working solutions were stored at - 20ºC

Chapter 2 Materials and Methods

Table 2.3: List of primers along with sequences used in this study

Gene Name of Length (DNA) primer Sequence of PCR Reference fragment product Variable FAVHL 5”- GACATGGGGTCGACCTATTTCGACAT-3” region of 730 bp Ganesh et Hexon FAVHR 5”- AGTGATGACGGGACATCAT-3” al., 2001 (L1 & P1) 100K SMJ-1F 5’CAATTCCATATGGAAAGCACCGCCGACGGGGAT 3’ SMJ-1R 5’ GCCGGAATTCTCAGGTCGACCATTCTCTGG 3’ 2397 bp This study Penton SMJ-2F 5’ CAATTCCATATGATGTGGGGGTTGCAGCCGCC 3’ base SMJ-2R 5’ GCCGGAATTCCTACTGCAAGGTCGCGGAACTCAG 3’ 1587 bp This study Short SMJ-3F 5’CAATTCCATATGCTCCGAGCCCCTAAAAGAAGAC 3’ fiber SMJ-3R 5’CCCAAGCTTTTACGGGAGGGAGCCCGCTGGACAGC 3’ 1437 bp This study

2.8 Viral DNA Isolation and DNA concentration

Viral DNA was extracted from semi purified viral suspension as described by Ganesh et al., (2001). For this equal amount (200 µl) of lysis buffer (Tris-HCl 25mM, NaCl 100mM, SDS 0.5% and Proteinase K 25µg/ml) was added to 200 µl semi purified viral suspension in 1.5 ml eppendorff tube. The tube was incubated at 37 0C for 60 minutes. After bringing the sample to the room temperature, equal volume of Phenol-chloroform (400 µl) was added, mixed well, then centrifuged at 13000 rpm for 5 minutes. The supernatant (clear solution) was transferred into new eppendorf tube and concentration of NaCl was adjusted at 0.2M. For this, total volume of the supernatant was estimated and its 1/10th volume of 2M NaCl solution was added in it. DNA was precipitated with 2 volume of chilled ethanol at -20 0C for 30 minutes. The DNA was recovered by centrifugation at 13000rpm for 10 minutes. Supernatant was discarded carefully and pellet of DNA was dried and dissolved in sterile water.

DNA concentrations were determined by Nanodrop spectrophotometer (Thermo scientific). DNA was diluted in sterile water and absorbance at 260 nm and 280 nm was measured. The concentrations were calculated on the assumption that an absorbance of 1 at 260 nm corresponds to 50 mg/ml double stranded DNA (Sambrook et al., 1989). Purity of DNA samples were

estimated by comparison of 260A/280A ratio, as this ratio for pure DNA preparation should be about 1.8 – 1.9.

Chapter 2 Materials and Methods

2.9 PCR amplification reactions

Generally, all the PCR amplification reactions were carried out as described by Saiki et al., (1985). The PCR was performed in a reaction volume of 50 µl in 100 µl PCR reaction tube. Standard amplification was consisted of 35 cycles of denaturing, annealing and extension steps. Initial denaturation of 94ºC for 5 minutes was followed by 35 cycles and final extension of 72ºC for 10 minutes was given. The final concentrations of reagents used were 5 – 50 ng/µl of template DNA for plasmids and 50 – 100 ng/µl for genomic templates. 0.2 mM dNTPs, 1 X PCR buffer, 0.9 mM MgCl2, 0.5 µM of primers, 5 units of Taq polymerase (Fermentas) and sterile Distilled water to make up the volume. All PCR assays were performed in master cycler (Eppendorf, Germany).

2.9.1 Amplification of 730bp variable region of Hexon gene

Variable region (L1 and part of P1) of Hexon gene fragment was amplified to confirm the presence of Fowl adenovirus 4. Presence of viral DNA in suspected samples was detected by amplification of variable region of Hexon gene (730bp) by PCR technique using specific primers (FAVHL & FAVHR) as described by Ganesh et al., (2001). 35 amplification cycles consisted of 94ºC for 1 minute, 57ºC for 1 minute and 72ºC for 2 minutes. The sequence of primers used to amplify this DNA fragment is described in Table 2.3. Details about PCR reactions are given in Appendix 2.

2.9.2 Amplification of full length target genes (Penton base, Short fiber & 100K)

Genes (Penton base & Short fiber) representing two structural proteins and one non structural protein (100K) were amplified from viral DNA using specific primers. For amplification of 100K gene, 35 amplification cycles were carried out consisting of 95ºC for 30 seconds, 59ºC for 45 seconds and 72ºC for 2.5 minutes. Similarly, amplifications of Penton base and short fiber were carried out by 35 amplification cycles which consisted of 95ºC for 30 seconds, 58ºC for 45 seconds and 72ºC for 1.5 minutes. Details of the primers and expected DNA fragments size are given in Table 2.2. Details of the PCR reactions are given in Appendix 3.

Chapter 2 Materials and Methods

2.9.3 Purification of amplified DNA fragments

The amplified PCR products having size of 1437bp, 1587bp and 2397bp representing short fiber, penton base and 100K were purified individually by Promega SV PCR purification kit. For this purpose PCR product was mixed with equal amount of membrane binding solution in a microfuge tube. One SV mini column was fitted into collection tube and transferred the solution from microfuge into the mini column. Column was incubated for 1 minute at room temperature and centrifuged at 14000 rpm for 1 minute. Flow through was discarded. Column was washed by adding 700 µl of membrane wash solution and centrifugation at 14000 rpm for 1 minute. Repeat the washing by adding 500 µl membrane wash solution and centrifugation at 14000 rpm for 5 minutes. Flow through was discarded and column was centrifuged with open lid for 1 minute at 14000 rpm to evaporate the ethanol. The column was fixed into a clean 1.5 ml microfuge tube and added 50 µl of Nuclease free water at the center of the column. Column was incubated at room temperature for 1 minute and centrifuged at 14000 rpm for 1 minute. Purified PCR product was collected into the microfuge tube.

The purified PCR products and vector (pET28a) were digested with respective restriction enzymes. For a 50 µl restriction reaction, 1 µg of DNA was taken in a microfuge tube. Compatible buffer for both restriction enzymes was added in 1X concentration (10X NEB buffer, 5µl). Restriction enzymes were added 10 units (1 µl) each. Total volume 50 µl was made with nuclease free sterile water. The reaction mix was placed at optimum temperature conditions of both enzymes for 1 – 2 hours. For all restriction reactions enzymes and buffers of New England Biolab were used.

Digested DNA fragments and vectors were separated by electrophoresis. Appropriate gel bands having DNA were extracted by gel extraction method using the QIAquick gel extraction kit (Qiagen, Inc. USA). The agarose gel was excised with sharp clean scalpel having required DNA fragments. Each gel slice was separately weighed in microfuge tube. Three volume of buffer QG was added to one volume of gel (100mg = 100µl). Microfuge was incubated at 50ºC for 10 minutes (till gel slice dissolved). Then isopropanol equal to 1 gel volume was added and mixed well. QIAquick spin column was placed in provided 2 ml collection tube and sample was applied to column to bind DNA. Column was centrifuged for 1 minute and flow through was discarded. The column was placed back in collection tube. Buffer PE (750 µl) was added and column was

Chapter 2 Materials and Methods washed by centrifugation for 1 minute. Flow through was discarded. Column was placed in collection tube and centrifuged for 1 additional minute to remove residues of ethanol. Then column was placed in 1.5 ml clean microfuge tube. DNA was eluted by addition of 50 µl buffer EB to centre of the column. Column was centrifuged for 1 minute to collect the purified DNA in microfuge tube. (Details are given in appendix 8).

Linearized vector and the insert DNA fragments carrying compatible termini in equimolar ratio were mixed along with 10 X ligation buffer & T4 DNA ligase. Standard ligation reaction was formulated in 20 µl volume. Nuclease free sterile water was added to make up the volume. The reaction mixture was incubated overnight at 16ºC. For all ligation reactions enzymes and buffers of Fermentas were used.

2.10 Analysis of PCR products

DNA fragments were separated by electrophoresis on 1.5% (w/v) agarose gel in 1 X TAE buffer containing ethidium bromide. For this, agarose was mixed in TAE buffer and boiled in microwave oven for 2 to 5 minutes. The gel was slowly cooled up to the temperature of 40 to 50ºC and ethidium bromide was added to final concentration of 0.5 µg/ml. poured the melted agarose in tray and fixed the comb. The gel was allowed to solidify at room temperature. PCR products were mixed bromophenol blue loading dye having 40% sucrose solution and 0.25% bromophenol blue dye. Comb was removed after solidification of the gel and samples were loaded in wells along with 1Kb DNA Ladder. The electrophoresis was performed at 100 Volts for 30 to 40 minutes in 1 X TAE buffer. After electrophoresis, PCR products were visualized by placing the gel on ultra violet light transluminator. Size of each fragment was estimated by comparison with 1 Kb DNA Ladder.

2.11 DNA sequencing

DNA sequences of PCR products/ constructs were analyzed on an ABI 3100 capillary sequencer, using BigDye. DNA sequencing was performed at Department of Biotechnology and cell biology, University of Connecticut, Storrs, CT. USA. Amino acid sequence was deduced and analyzed using programs in the ExPASy (Expert Protein Analysis System).

Chapter 2 Materials and Methods

2.12 Phylogenetic analysis

Phylogenetic analysis of the variable part of Hexon gene was performed on observed divergence basis by multiple sequence alignment program of “DNA MAN, Lynnon Biosoft” (Lynnon Corporation, Quebec, Canada). A rooted genetic dendrogram was constructed by neighbor- joining method and phylogenetic relationships of our isolate with other reported isolates were determined.

2.13 Construction of plasmids/ vectors

Cloning strategies for recombinant vectors/plasmids were devised and recombinant vectors/plasmids (pSMJ-1, pSMJ-2 & pSMJ-3) were constructed using Vector NTI soft ware. For this purpose available nucleotide sequences of target genes (100K, Penton base & Short fiber) were retrieved from Genbank and each DNA sequence was analyzed insilico for restriction enzyme sites and two restriction enzymes were selected among the multiple cloning site of the vector (pET28a). Selected restriction sites should not be present within the target sequence. These restriction sites were incorporated at both ends of the sequence by designing the primers with these sites and amplifying the sequence by PCR. Genes were cloned in fusion with 5’- upstream nucleotide sequences coding for six histidine residues and thrombin protease site. Details about cloning strategies and designed vectors are shown below.

2.13.1 pSMJ-1

The amplified PCR product of 100k gene of Hydropericardium syndrome virus (HPSV) having Nde I and EcoR I restriction sites was cloned into pET28a expression vector. This vector is under control of T7 promoter and it has Kanamycin resistance for selection. Standard cloning procedures were used as described in cloning guide of Promega Inc. USA. The construct is diagrammatically shown in Figure 2.1 and it was named as pSMJ-1.

Chapter 2 Materials and Methods

Fig 2.1: Cloning strategy for amplified DNA fragment (100K, 2397bp) into prokaryotic expression vector (pET28a) at Nde-1 and EcoR-I restriction sites to form pSMJ-1 vector.

2.13.2 pSMJ-2

The amplified PCR product of Penton base gene of HPSV having Nde I and EcoR I restriction sites was cloned into pET28a expression vector. This vector is under control of T7 promoter and it has Kanamycin resistance for selection. Standard cloning procedures were used as described in cloning guide of Promega Inc. USA. The construct is diagrammatically shown in Figure 2.2 and it was named as pSMJ-2.

Chapter 2 Materials and Methods

Fig 2.2: Cloning strategy for amplified DNA fragment (Penton base, 1587bp) into prokaryotic expression vector (pET28a) at Nde-1 and EcoR-I restriction sites to form pSMJ-2 vector.

2.13.3 pSMJ-3 The amplified PCR product of Short fiber gene of HPSV having Nde I and Hind III restriction sites was cloned into pET28a expression vector. This vector is under control of T7 promoter and it has Kanamycin resistance for selection. Standard cloning procedures were used as described in cloning guide of Promega Inc. USA. The construct is diagrammatically shown in Figure 2.3 and it was named as pSMJ-3.

Chapter 2 Materials and Methods

Fig 2.3: Cloning strategy for amplified DNA fragment (Short fiber, 1437bp) into prokaryotic expression vector (pET28a) at Nde-1 and Hind-III restriction sites to form pSMJ-3 vector. 2.14 Transformation and selection of transformants

The CaCl2 competent cells were prepared as described by Cohen et al., (1972). Details are given in appendix 4. For the purpose the cultures of the cells were grown by selecting single colonies from a streaked LB agar plate and inoculating 5 ml LB broth. The culture was incubated overnight at 37ºC with 200 rpm shaking. One ml of this overnight culture was used as pre-culture to inoculate 100 ml pre-warmed LB broth in a 500 ml conical flask and incubated at 37ºC with

Chapter 2 Materials and Methods shaking till mid log phase. The culture was transferred to 2 X 50 ml capped centrifuge tube and chilled on ice for 30 minutes. The cells were pelleted at 4000 rpm for 5 minutes at 4ºC and resuspended by gentle vortexing in 40 ml ice cold 0.1 M MgCl2 . 6H2O solution. The cells were again pelleted by centrifugation at 4000 rpm for 5 minutes at 4ºC and resuspended in 40 ml ice cold 0.1 M CaCl2 . 2H2O solution. The cells were placed on ice for 30 minutes and pelleted by centrifugation at 4000 rpm for 5 minutes at 4ºC. The pellet of each tube was dissolved in 2 ml ice cold 0.1 M CaCl2.2H2O solution having 15 % glycerol. These cells were divided into 200µl aliquots in 1.5ml microfuge tubes and stored at -80ºC till use.

Transformation of CaCl2 competent cells (E. coli Top 10 and BL21, DE3) was carried out using methods described by Sambrook et al., (1989). For this purpose frozen microfuge tube having 200 µl competent cells was thawed on ice for 10 minutes. Competent cells were transformed by adding 5 µl of ligation reaction (0.2 – 0.5 µg DNA) in the competent cells and mixed gently. The vial was placed on ice for 30 minutes. Heat shock was given by placing the vial in water bath at 42ºC for 30 seconds and replaced on ice for 2 minutes. Then 500 µl of LB broth was added in the vial and incubated at 37ºC for 1 hr with 250 rpm shaking. The mixture was spreaded on pre- warmed LB agar plates containing selective antibiotic (Kanamycin, 50µg/ml) by sterilized glass spreader. The plates were incubated at 37ºC for 16 hrs. Colonies of positive transformants were selected. The transformed E. coli cells were named as E. coli: SMJ1.100k, SMJ2.PB. and SMJ3.SF.

2.15 Plasmid DNA extraction and analysis

Plasmid DNA was prepared using Gene Jet plasmid miniprep kit as described by manufacturer. For this single colony containing recombinant plasmids were selected to inoculate 5 ml LB broth containing selective antibiotic and incubated overnight at 37ºC with 250 rpm shaking. The cells were collected by centrifugation at 13000 rpm for 1 minute. The pellet of cells from 5 ml culture was processed for plasmid DNA isolation. Details are given in appendix 5.

DNA of constructed plasmids was digested by respective enzymes for confirmation. Constructs were digested with 1 – 10 units of restriction endonucleases in 20 µl of appropriate 1 X reaction buffer. Digestions were carried out for 1 – 2 hrs at 37ºC. In case of double digestion, a suitable buffer that gave maximum activity for both enzymes was used. PCR amplifications of inserts

Chapter 2 Materials and Methods were also done for confirmation of constructs using plasmid DNA as template. Details of PCR assays for all inserts are described in section 2.9.

2.16 Expression of recombinant genes

Plasmid constructs (pSMJ1, pSMJ2 and pSMJ3) were transformed into E. coli, host BL21 (DE3) as described in section 2.14. Strains harboring relevant plasmids were recovered from frozen glycerol stocks (-80ºC) by streaking LB agar plates having kanamycin (50µg/ml) and incubated overnight at 37ºC. Subsequently single colony was selected from agar plate and transferred to LB broth containing 50µg/ml kanamycin in 10ml falcon tubes. These falcon tubes were incubated at

37ºC for 2 to 3 hours with 250 rpm shaking until O.D600 value reached up to 0.5 – 0.6. These freshly grown cultures were induced by 1mM IPTG and again incubated at 370C with 250 rpm shaking till the end of log phase (approximately for 3 hours). The cells were harvested by centrifugation at 5000 rpm for 20 minutes at 4ºC.

2.17 Purification of recombinant proteins

Recombinant proteins expressed in E. coli were purified using Nickle affinity chromatography. For this purpose, cell pellets of expressed proteins were resuspended in 5 ml of 1X Ni-NTA bind/ lysis buffer (Novagen) and lysozyme, 0.15 mg was added. Cells were lysed by sonication (10 cycles of 30 sec on and 20 sec off). The samples were incubated on ice for 10 to 15 minutes and centrifuged at 13000rpm for 15 minutes at 4ºC. Supernatants were separated and each pellet was dissolved in 1 ml of denaturing bind/ lysis buffer containing 8M urea. Composition of all buffer used are given in table 2.4.

Added 300µl of 50% slurry of Ni-NTA resin (Novagen) to chromatographic columns and placed the cap on the lower end of column. Samples were added to the columns and caps were removed. Flow through was collected in falcon tubes and again loaded to the columns and allowed it to pass through to ensure maximum binding. Columns were washed with 5.25 ml of the 1 X Ni-

NTA wash buffer (Novagen) and flow through was collected as W1, W2 & W3. Bounded fractions of proteins were eluted by 1 ml of 1 X Ni-NTA elute buffer (Novagen) and fractions were collected as E1, E2, E3 & E4 in clean microfuge tubes. The 10 µl of each of washing and final proteins elution fractions were subjected to SDS-PAGE analysis.

Chapter 2 Materials and Methods

Table 2.4: Composition of buffers for protein purification

No. Type of buffer Native conditions Denaturing conditions

NaH2PO4: 50mM, pH: 8, NaCl: Urea: 8M, NaH2PO4: 0.1M, 1 Bind/ lysis buffer 300mM, imidazole: 10mM Tris HCl: 0.01M, pH: 8

NaH2PO4: 50mM, pH: 8, NaCl: Urea: 8M, NaH2PO4: 0.1M, 2 Wash buffer 300mM, imidazole: 20mM Tris HCl: 0.01M, pH: 6.3

NaH2PO4: 50mM, pH: 8, NaCl: Urea: 8M, NaH2PO4: 0.1M, 3 Elute buffer 300mM, imidazole: 250mM Tris HCl: 0.01M, pH: 4.5 2.18 Determination of protein concentrations

Bradford Protein Assay (Bradford, 1976) was performed to quantify the protein contents in the samples. Maximum absorbance of an acidic solution of coomassie brilliant blue G-250 dye shifts from 465nm to 595nm wave length upon binding with protein. For this purpose 1µl of each protein sample was added in 800µl of distill water and 200µl of dye reagent was mixed gently in each sample. The samples were incubated at room temperature for 5 minutes. Absorbance was measured at 595nm and standard curve was plotted using bovine serum albumin as standard. Later on concentration of protein in samples was calculated with the help of standard curve (Appendix 13). 2.19 SDS-PAGE analysis

Poly acrylamide gel electrophoresis was performed as described by Laemmli (1970). A discontinuous buffer system was used for analysis and separation of cellular proteins using 10 – 15% SDS PAGE gels. Acryl amide gel composition is given in Table 2.5. Gel was prepared by mixing the reagents 1, 2 and 3A in a flask. Reagents 5 and 6 were added and mixed gently. The gel was poured and allowed to solidify for 30 minutes. Then 3% stacking gel was formulated in the same way using the reagents 1, 2 and 3B. Stacking gel was poured and a 10 lane 0.75 mm thick comb was inserted. The gel was allowed to solidify for 60 minutes. The electrophoresis tank was filled with running buffer and gel was properly fixed in it.

Protein samples were mixed with 4 X loading buffer and β- mercaptoethanol was added. Samples were heated at 80ºC for 10 minutes and allowed to cool at room temperature. Then samples were loaded separately in each well of the gel. Electrophoresis was performed at

Chapter 2 Materials and Methods constant voltage (100V) till the dye reached at the bottom of the gel. Composition of loading buffer and running buffer is given in Table 2.6.

Gels were stained by Coomassie Blue stain (65: 25: 10 water/2-propanol/glacial acetic acid containing 0.025% Coomassie Brilliant Blue R-250) to visualize the protein bands. First of all the gel was washed with Distilled water after complete running. Then staining solution was added and gel was gently shaked in a shaking platform for 16hrs. After 16 hrs of staining gels were washed with distilled water and de-staining solution (90:10 water/glacial acetic acid) was added and gels were gently shaked on shaking platform for 16 hrs or until the background became transparent and protein bands were visible. Photographs of gels were taken with the help of gel documentation system

Table 2.5: Composition of separating and stacking SDS-PAGE gel

No Component Separating gel Stacking gel

12% 15% 3%

1 H2O 3.34ml 2.35ml 6.35ml 2 Acrylamide (30%) 4ml 5ml 1ml

3A Separating gel buffer 2.5ml 2.5ml Tris-HCl (1.5M, pH 8.8)

3B Stacking gel buffer 2.5ml Tris-HCl (0.5M, pH 6.8)

4 20%SDS 50ul 50ul 50ul

5 TEMED 5ul 5ul 5ul

6 Ammonium persulphate 100ul 100ul 100ul

Total Volume 10ml 10ml 10ml

Chapter 2 Materials and Methods

Table 2.6: Composition of sample loading (4X) and running buffer (10X)

Sample loading buffer 4x(10ml) Running buffer (10x)

Components Quantity; Components Quantity; Final concentration Final concentration Glycerol 5.0g ( 5.4M) Glycine 144g(190mM)

SDS 1.0g (10%) Tris-HCl 30.0g(25mM)

EDTA 37.2mg(10mM) SDS 1g (0.1%)

Dissolve in Tris-HCl( 0.5M, pH 6.8) and adjust pH to 6.8 Adjust volume to 1 litre with with 1M NaOH. Commassie Brilliant Blue dye was added to millliQ water give a deep color. Stored at -20ºC.

2.20 Immunoblotting Protein expression of plasmid constructs (pSMJ-1, pSMJ-2 and pSMJ-3) were analyzed by Sodium dodecyle sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting was performed by standard technique. E. coli cells harboring the constructs were grown overnight from single colony as starter culture using 10 ml LB media having Kanamycin. On next day, 100 ml LB media containing kanamycin was inoculated by the starter culture and grown till mid log phase at 37ºC. The rapidly growing culture was induced by IPTG and the viable cell phase was confirmed by spectrophotometeric methods (section 2.16). The cells were harvested by centrifugation, resuspended and lysed as described earlier (section 2.17). The supernatant and pellet fractions of all constructs along with – ve control were analyzed on 10% SDS-PAGE gel as described in section 2.19. For immunoblotting, proteins were transferred to PVDF membrane using semi-dry blotter (Trans blot SD – Biorad system) as described by Fingerut et., al (2003).

2.20.1 Detection of Histidine tagged recombinant proteins After successful transfer of Blot, the PVDF membrane was blocked for 1hr with 3% BSA & 0.05% Tween 20. Incubated the membrane for 1 hr with mouse anti histidine antibody diluted

Chapter 2 Materials and Methods

1:3000 in TBST having 3% BSA. The membrane was washed thrice with TBST and once with TBS. Membrane was incubated for 1 hr with alkaline phosphatase conjugated with anti-mouse IgG (Sigma) used in 1:10,000 dilution in TBST with 3% BSA. Subsequently, the blot was washed 4 times with TBST. After washing, immune complexes were detected using bromochloroindolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Sigma). After five minutes, stop solution (2mM EDTA) was added when purple colored Histidine tagged protein fractions became visible on PVDF membrane. At the end photograph was taken and molecular weights of the stained bands were estimated.

2.21 Immunization studies

One hundred and eighty broiler chickens were reared under standard managemental conditions. Feed and water was provided ad-libitum. Broiler chickens were divided into six groups having thirty birds in each group. Three groups (A, B, C & D) were immunized by subcutaneous injection at neck against recombinant proteins (short fiber, penton base & 100k) and commercial vaccine as described by Fingerut et al., (2003). Blood was collected from wing vein of the chickens pre-immunization and at 7th, 14th, 21st and 28th day after immunization for antibody titer determination. Complete experimental design is shown in table 2.8.

2.21.1 Enzyme Linked Immunosorbent Assay (ELISA)

An Indirect ELISA assay was optimized by using the purified recombinant proteins as described by Ojkic and Nagy (2003). Details of plate layout for optimization of protein and serum dilutions are shown in Table 2.7. ELISA plates were incubated at 40C overnight. The plates were blocked with 200µl blocking buffer (PBS containing 10% foetal calf serum) for 1 hr at 37ºC. After incubation blocking buffer was discarded and plate was washed four times with washing buffer (PBS containing 0.05% Tween 20). Positive and negative serum against FAdV-4 was obtained from Charles River, SPAFAS (Storrs, CT) USA. Serum was diluted 1:50 in dilution buffer (PBS, 10% Foetal calf serum and 0.05% Tween 20). Two fold serial dilutions were made (1:100, 1:200, 1:400 till 1:6400). All dilutions were added to ELISA plate (200µl/well) and the plates were incubated at room temp for 1hr. After incubation the plate was washed four times with washing buffer (PBS containing 0.05% Tween 20). The plates were incubated for 1 hrs at 37ºC with 100µl/well of a 1:25,000 dilution of alkaline phosphatase conjugated anti chicken IgG. After

Chapter 2 Materials and Methods incubation the plates were washed four times with washing buffer and developed using P- nitrophenyl phosphste (Sigma) according to the manufacturer’s instructions. The optical density at 405 nm was measured by a micro-plate reader after 1hr incubation at 37ºC. Net optical density (O.D) values were calculated by subtracting the O.D values of the negative control from the corresponding test sample values. After optimization of ELISA using recombinant proteins, the antibody titers of chickens immunized against these proteins were determined using the suitable dilutions of protein and serum. The data expressed as antibody titer representing the highest dilution yielding three times the optical density of the negative control sera (Reed and Muench, 1938).

Chapter 2 Materials and Methods

Table 2.7: Plate layout for optimization of protein and serum dilutions for ELISA

Semi purified Inactivated Purified recombinant proteins virus (as control) Short fiber Penton base 100K

Serum -ve control +ve control +ve serum dilution (-ve serum) (+ve serum)

1 2 3 4 5 6 7 8 9 10

1:50 1:100 1:50 1:100 5µg/ml 10µg/ml 5µg/ml 10µg/ml 5µg/ml 10µg/ml

1:50 a 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl

1:100 b 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl

1:200 c 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl

1:400 d 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl

1:800 e 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl

1:1600 f 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl

1:3200 g 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl

1:6400 h 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl 200µl

+ve and –ve serum: Obtained from SPAFAS, CT USA +ve control: Inactivated FAdV-4 was coated and known positive serum against FAdV-4 added -ve control: Inactivated FAdV-4 was coated and known negative serum against FAdV-4 added

Chapter 2 Materials and Methods

2.22 Challenge protection test

The capability of serum antibodies produced against recombinant proteins (short fiber, penton base & 100k) to confer protection against pathogenic viral infection was evaluated by giving experimental infection to immunized broilers. For the purpose challenge inoculums (semi purified virus suspension from section 2.5) containing the pathogenic virus was injected (0.5ml) subcutaneously to broilers of all treated and challenge control groups (A to E) at 42nd day of age. Group F was injected with sterile PBS at 42nd day of age and it was treated as –ve control. After challenge of pathogenic virus, the birds were kept under observation for 7 days and data regarding pathological signs, symptoms, mortalities and postmortem lesions in various groups was recorded.

Table 2.8: Experimental design for immunization and challenge studies in broilers

No. Groups Treatment Age in Dose/bird Route of days injection (n = 30)

1 A Recombinant short fiber with FCA 14 days 200 µl Subcutaneous

2 B Recombinant penton base with FCA 14 days 200 µl Subcutaneous

3 C Recombinant 100K with FCA 14 days 200 µl Subcutaneous

4 D Commercial inactivated vaccine 14 days 200 µl Subcutaneous

5 E Sterile PBS (challenge control) 14 days 200 µl Subcutaneous

6 F Sterile PBS (negative control) 14 days 200 µl Subcutaneous

Commercial inactivated vaccine: Avi-Hydro vaccine Challenge control: Group which was not immunized at 14th day but challenged at 42nd day Negative control: Group which was neither immunized nor challenged

Chapter 3 Results

Results 3.1 Analysis and evaluation of samples

Samples were collected during April to September, 2009. The infected broilers observed at selected poultry farms/ institutes located in Faisalabad, Lahore and Rawalpindi (See Table 2.2) were found dull, depressed, off feed with high mortality rate ranging from 20 – 35% (Table 3.1). Diseased birds were of 26 – 38 days of age. Postmortem examination revealed that liver and kidney from each infected broiler were swollen, friable, discolored and congested. Balloon like appearance of pericardial sac (most prominent lesion of the disease) was observed with straw color fluid (Fig. 3.1). All these signs and symptoms indicated the presence of Hydropericardium syndrome.

Table 3.1: List of effected broiler flocks with mortality rates and age

No. Site of collection Month of No. of Age of birds Mortality collection birds (Days) rate % (2009) 1 Abbaspur, Faisalabad April 5000 30 30 2 Abbaspur, Faisalabad April 8000 35 25 3 Theekri wala, Faisalabad May 5000 30 25 4 Satiana, Faisalabad June 5000 28 30 5 Satiana, Faisalabad June 6000 26 32 6 Samundri, Faisalabad, July 9000 38 20 7 Poultry Research Institute, July 5000 32 35 Rawalpindi 8 Samundri, Faisalabad August 7000 30 25 9 Poultry Research Institute, August 8000 35 25 Rawalpindi 10 University of veterinary & animal September 8000 30 30 sciences, Lahore Total April – Sep. 66,000 26 – 38 20 – 35

Chapter 3 Results

Fig 3.1: Typical lesions of heart & liver observed during necropsy. (Straw colored Fluid in pericardium giving it balloon like shape & congested, enlarged liver indicating hepatitis)

3.2 Ultra structure of viral particle

The filtrate of homogenized liver suspension (having virus) was centrifuged at 80,000 rpm for 2 hrs at 40C (Beckman ultracentrifuge). The collected pellet was re-suspended in 500 µl of phosphate buffer saline (PBS) and centrifuged at 3000 rpm for 10 min at 40C. The supernatant was collected again and layered onto 15 – 35 % preformed sucrose gradients prepared in 0.1 M PBS and centrifuged at 80,000 rpm for 2 hrs at 40C. An opaque band appeared between 25 % and 35 % sucrose gradients was collected carefully by the help of a syringe with long needle and resuspended in PBS. Finally the suspension containing the opaque band was centrifuged at 80,000 rpm for 2 hrs at 40C and pellet of the virus was collected.

Chapter 3 Results

Structure of the semi purified virus was observed under Field Emission Scanning Electron microscope (JEOL, JFM 7500F). Uranyl acetate negatively stained viral particles revealed typical icosahedral capsids of the virus under low dose condition at 30,000 X magnification. The diameter of each capsid was estimated to 70 – 80 nm. Ultra structure of viral particle is presented in Fig. 3.2.

Fig 3.2: Scanning Electron micrograph of intact FAdV-4 showing icosahedral shape capsids, indicated by long arrows. Hexons found in back ground from disrupted viral particles indicated by small arrows. The scale bar represents 100 nm.

3.3 Molecular detection and analysis of Hexon gene

Variable region (L1 and P1 loop) of Hexon DNA fragment was amplified from extracted viral DNA using FAVHL and FAVHR primers (Table 2.3), as described in section 2.9.1. PCR amplification produced 730bp DNA fragment as judged by agarose gel electrophoresis (Fig. 3.3). Nucleotide sequence analysis of PCR product revealed that isolated virus belong to FAdV-4 and its DNA can be used for amplification of various viral genes such as 100K, Penton base and Short fiber.

The Nucleotide sequence and deduced Amino acid sequence of partial Hexon gene is presented in Fig. 3.4.

Chapter 3 Results

Fig 3.3: Agarose gel electrophoresis of 730 bp PCR product of variable region of Hexon gene, Lane 1, 3 and 4. Lane 2 is negative control while Lane 5 is 1Kb molecular weight marker.

1–gacatggggtcgccctatttcgacatcaagggaatcctagaccgagggccgtccttcaag-60 1- D M G S P Y F D I K G I L D R G P S F K -20 61-ccctactgcggcacggcttacaacccgctggctcccaaggagtccatgtttaacaactgg-120 21- P Y C G T A Y N P L A P K E S M F N N W -40 121-tcggagacggcacccgggcagaacgtgtccgcctccggtcagctgtccaacgtctatacc-180 41- S E T A P G Q N V S A S G Q L S N V Y T -60 181-aacacgagcacctccaaagacacgacggcggcgcaggtgacgaagatttccggcgtcttc-240 61- N T S T S K D T T A A Q V T K I S G V F -80 241-cccaatcccaaccagggacccggaagaaatcctctgcgacgggtagaaaacgccaacacc-300 81- P N P N Q G P G R N P L R R V E N A N T -100 301-ggcgtgctcggtcgcttcgccaagtctcagtacaattacgcttacggtgcctacgtcaag-360 101- G V L G R F A K S Q Y N Y A Y G A Y V K -120 361-cccgtcgccgccgacggttcccagtccctcacgcagaccccctactggatcatggataac-420 121- P V A A D G S Q S L T Q T P Y W I M D N -140 421-acgggcaccaattacctgggagcggtggccgtcgaggactacaccaacagcctctcgtac-480 141- T G T N Y L G A V A V E D Y T N S L S Y -160 481-ccagataccatagtcgtgccgcctcccgaggactacgacgattataacataggcaccacg-540 161- P D T I V V P P P E D Y D D Y N I G T T -180 541-cgtgcgctcaggcccaactacatcgggttcagggataaattcattaacctgctgtatcac-600 181- R A L R P N Y I G F R D K F I N L L Y H -200 601-gactccggcgtgtgctcgggcaccctcaactcggagcgttcgggcatgaacgtggtggtc-660 201- D S G V C S G T L N S E R S G M N V V V -220 661-gagctgcccgaccggaataccgagctcagctaccagtacatgctggccgacatgatgtcc-720 221- E L P D R N T E L S Y Q Y M L A D M M S -240 721-cgccatcact -730 241- R H H -243

Fig 3.4: Nucleotide and deduced amino acid sequence of partial Hexon gene of isolated virus (FAdV-4 NIAB/NIBGE-01)

Chapter 3 Results

Nucleotide Sequence of amplified partial Hexon DNA fragment of isolate (FAdV-4 NIABNIBGE – 01) has been submitted to the GenBank with an accession no. FR686931.1. BLAST analysis of amplified partial Hexon DNA fragment revealed 99% identity with Indian isolates (Haryana, Hemachal Perdesh, Izetnagar; accession no. EU847626.1, FN394664.1, AY581275.1) of FAdV-4, while 98% identity was found with a Pakistani FAdV-4 isolate (accession no. DQ264728.1). Identity values with a German psittacine AdV (accession no. EF442329.1) and FAdV-1 (CELO) (accession no.DM380829.1) were found to be 65% and 70% respectively.

3.3.1 Multiple sequence alignment

Multiple Sequence Alignment (MSA) of the 730-bp variable region of the hexon gene with the corresponding gene fragment from other AdVs is presented in Figure 3.5. MSA revealed that this region of human adenovirus serotype 45 contains 847 bp, and thus is longer than the corresponding part of other Mastadenoviruses (equine or bovine). It was also found that the (L1 – P1) region of Hexon gene is variable in the middle while both the ends are conserved.

Chapter 3 Results

AF207659.1_BAdV- GATTTGGGAAGTGCTTATTTTGATATAGAAGGATTTTTAGACCGAGGTTTTTCTTTTAAACCATATGGAGGAACTGCTTATAATC 85 L80007.1_EAdV-2 GACATGGGAAGAACTTACTTTTACATCCGCGGGACCCTAGACCGCGGACCCAGCTTCAAGCCTTACAGCGGGACGCAGTACAACC 85 DQ149638.1_HAdV- GACATGGCCAGCACTTACTTTGACATCCGCGGCGTCCTGGACCGCGGTCCCAGCTTCAAACCCTACTCGGGCACAGCTTACAACA 85 EF442329.1_Psitt ...... CGTGGACCATCCTTCAAACCGTATGGTGGTACAGCGTATAATC 43 DM380829.1_CELO_ GACATGGGGGCGACCTACTTCGACATAAAGGGTGTGCTGGACCGCGGACCTTCCTTCAAGCCGTACGGCGGAACGGCTTATAATC 85 EF685395.1_Fowl_ GACATGGGGTCGACCTATTTCGACATCAAGGGAATCCTAGACCGAGGGCCGTCCTTCAAGCCCTACTGCGGCACGGCTTACAACC 85 AY581275.1_FAdV GACATGGGGTCGACCTATTTCGACATCAAGGGAATCCTAGACCGAGGGCCGTCCTTCAAGCCCTACTGCGGCACGGCTTACAACC 85 AF339923.1_FAdV- GACATGGGGTCGACCTATTTCGACATCAAGGGAATCCTAGACCGAGGGCCGTCCTTCAAGCCCTACTGCGGCACGGCCTACAACC 85 FN394664.1_FAdV- GACATGGGGTCGACCTATTTCGACATCAAGGGAATCCTAGACCGAGGGCCGTCCTTCAAGCCCTACAGCGGCACGGCTTACAACC 85 EU847626.1_FAdV- GACATGGGGTCGACCTATTTCGACATCAAGGGAATCCTAGACCGAGGGCCGTCCTTCAAGCCCTACTGCGGCACGGCTTACAACC 85 DQ264728.1_FAdV- GACATGGGGTCGACCTATTTCGACATCAAGGGAATCCTAGACCGAGGGCCGTCCTTCAAGCCCTACTGCGGCACGGCTTACAACC 85 FAdV-4_NIABNIBGE GACATGGGGTCGCCCTATTTCGACATCAAGGGAATCCTAGACCGAGGGCCGTCCTTCAAGCCCTACTGCGGCACGGCTTACAACC 85 Consensus cg gg tt aa cc ta gg ac ta aa

AF207659.1_BAdV- CCCTCGCTCCTAAATCAGCTATGCCTAATATGGCTTTTC...... AA...AATAACGAGGATA 139 L80007.1_EAdV-2 AATTGGCTCCCAAGGGCGCGCCAAACCCATGTCAGTA...... CCAAA...AAAATAATACTAC 140 DQ149638.1_HAdV- GCCTGGCCCCCAAGAGCGCTCCCAATCCCAGCCAGTGGGATGCAAAGGAAAAGGAAGGAGTTGCCCAAACAGAAAAAAATGTTTT 170 EF442329.1_Psitt CTCTGGCTCCTAAGGAAGCCATCTTTAACAGTTGGGCCG...... T....AA...... GCGGGACAA 94 DM380829.1_CELO_ CCCTTGCGCCAAGAGAAGCTATTTTCAACACCTGGGTGG...... A....GA...GCACT.GGTCCTC 139 EF685395.1_Fowl_ CGCTGGCTCCCAAGGAGTCCATGTTTAACAACTGGTCGG...... A....GAC.GGCGCCCGGGCAGA 142 AY581275.1_FAdV CGCTGGCTCCCAAGGAGTCCATGTTTAACAACTGGTCGG...... A....GAC.GGCACCCGGGCAGA 142 AF339923.1_FAdV- CGCTGGCTCCCAAGGAGTCCATGTTTAACAACTGGTCGG...... A....GAC.GGCGCCCGGACAAA 142 FN394664.1_FAdV- CGCTGGCTCCCAAGGAGTCCATGTTTAACAACTGGTCGG...... A....GAC.GGCACCCGGGCAGA 142 EU847626.1_FAdV- CGCTGGCTCCCAAGGAGTCCATGTTTAACAACTGGTCGG...... A....GAC.GGCACCCGGGCAGA 142 DQ264728.1_FAdV- CGCTGGCTCCCAAGGAGTCCATGTTTAACAACTGGTCGG...... A....GAC.GGCACCCGGGCAGA 142 FAdV-4_NIABNIBGE CGCTGGCTCCCAAGGAGTCCATGTTTAACAACTGGTCGG...... A....GAC.GGCACCCGGGCAGA 142 Consensus t gc cc a c a

AF207659.1_BAdV- CAGTTTATTTAGCTCAATTGCCTCAAATTTATTCTGCTAATGGAAAAGGAGTTGAACAAGCTATGGCTATAAA...... 212 L80007.1_EAdV-2 AGTGACCTTTGGCCAAGCGGCATTCGAAGGTGTCGAGATCACCGCTAGCGGGCTGCGCATCGCCGTCGACAAA...... 213 DQ149638.1_HAdV- AAAAACATTTGGTGTTGCCGCTACAGGTGGTTTTAATATTACAGATCAGGGTTTGTTACTTGGAACTGAGGAAACAGCTGAAAAC 255 EF442329.1_Psitt ACACTACCGTAGTCGGGCAGATGCCCAATGTCTACACGAACGACACAAACACCACCCCCGGTGCCACCGCTAC...... 167 DM380829.1_CELO_ AGACCAATGTGGTGGGACAGATGACCAACGTGTACACAAATCAGACCAGGAACGACAAGACGGCCACGCTTCA...... 212 EF685395.1_Fowl_ ACGTGTCCGCCTCCGGTCAGCTGTCCAATGTCTATACCAACACGAGCACCACCAAAGACACGACGGCGGC...... 212 AY581275.1_FAdV ACGTGTCCGCCTCCGGTCAGCTGTCCAATGTCTATACCAACACGAGCACCTCCAAAGACACGACGGCGGC...... 212 AF339923.1_FAdV- ACGTGACCGCCTCCGGACAGCTGTCCAATGTCTATACCAACACGAACACCTCCAAAGCCACGACGGCGGC...... 212 FN394664.1_FAdV- ACGTGTCCGCCTCCGGTCAGCTGTCCAATGTCTATACCAACACGAGCACCTCCAAAGACACGACGGCGGC...... 212 EU847626.1_FAdV- ACGTGTCCGCCTCCGGTCAGCTGTCCAATGTCTATACCAACACGAGCACCTCCAAAGACACGACGGCGGC...... 212 DQ264728.1_FAdV- ACGTGTCCGCCTCCGGTCAGCTGTCCAATGTCTATACCAACACGAGCACCTCCAAAGACACGACGGCGGC...... 212 FAdV-4_NIABNIBGE ACGTGTCCGCCTCCGGTCAGCTGTCCAACGTCTATACCAACACGAGCACCTCCAAAGACACGACGGCGGC...... 212 Consensus g t

AF207659.1_BAdV- ...... TGTAACTGCTACTACTCCTAATCCACAGACTGGTAGGA..CAGATGACTATTCTGGACCCAATGATAT.. 278 L80007.1_EAdV-2 ...... TACTGCGACCCAACTTACCAGCCAGAACCTCAGATTGG...AATCGACTCGTGGGA...... GCCC... 270 DQ149638.1_HAdV- GTTAAAAAGGATATCTATGCAGAGAAAACTTTCCAGCCTGAACCTCAAGTTGGTGAAGAAAACTGGCAGGAAAGTGAAGCCTTTT 340 EF442329.1_Psitt ...... CATCATTGCCAACTTTTCTGGCATAAATCCCAATGTCAATTCAGGACCCGGCAT.ATCAGAATACAC... 233 DM380829.1_CELO_ ...... GCAGGTCAATAGCATCTCCGGGGTGGTTCCCAACGTCAACCTGGGACCCGGCCTCAGTCAACTAGCAT.. 280 EF685395.1_Fowl_ ...... GCAGGTGACGAAGATTTCCGGCGTCTTTCCCAACCCCAACCAGGGACCCGGAATAAATCCTCTGCGG... 279 AY581275.1_FAdV ...... GCAGGTGACGAAGATTTCCGGCGTCTTCCCCAATCCCAACCAGGGACCCGGAAGAAATCCTCTGCGA... 279 AF339923.1_FAdV- ...... GCAGGTGACGAAGATTTCCGGCGTCTTCCCCAATCCCAACCAGGGACCCGGAGTAAATCCTCTGCGG... 279 FN394664.1_FAdV- ...... GCAGGTGACGAAGATTTCCGGCGTCTTCCCCAATCCCAACCAGGGACCCGGAAGAAATCCTCTGCGA... 279 EU847626.1_FAdV- ...... GCAGGTGACGAAGATTTCCGGCGTCTTCCCCAATCCCAACCAGGGACCCGGAAGAAATCCTCTGCGA... 279 DQ264728.1_FAdV- ...... GCAGGTGACGAAGATTTCCGGCGTCTTCCCCAATCCCAACCAGGGACCCGGAAGAAATCCTCTGCGA... 279 FAdV-4_NIABNIBGE ...... GCAGGTGACGAAGATTTCCGGCGTCTTCCCCAATCCCAACCAGGGACCCGGAAGAAATCCTCTGCGA... 279 Consensus c c

AF207659.1_BAdV- ...... TGATTCTGCAAAAAATGGAGGCTATGGGCGAATTCTTAGTGCTGAAA...... GCCAGGGTGATAAATTTCCAGCT 348 L80007.1_EAdV-2 .....GGAACGACGCTTAGCGACGACAT.....TGCCGCCGTGGGAGGGCGCGTTCTTAACAATCAGCAGAACCCCACCCCGTGT 345 DQ149638.1_HAdV- ATGGAGGAAGGGCTATTAAGAAAGACACCAAAATGAAGCCATGCTATGGTTCATTTGCCAGACCCACTAATGAAAAAGGAGGACA 425 EF442329.1_Psitt ...... CCTAGCGGGTAACACCAACGTTAATGCCATAGGAGTATCGGCCAAGTTCGC.ACAGACGGCTGGTACTAACTTAG.CT 309 DM380829.1_CELO_ ...C...CCGGGCCGACGTGGATAATATTGGCGTGGTGGGACGTTTCGCCAAGGTAG....ACTCAGCGGGCGTGAAGCAGG.CG 354 EF685395.1_Fowl_ ...... CAGGTAGAAAACGCCAACACCGGCGTGCTCGGTCGCTTCGCCAAGT...... CTCAGTAC.....AATTACG.CT 342 AY581275.1_FAdV ...... CAGGTAGAAAACGCCAACACCGGCGTGCTCGGTCGCTTCGCCAAGT...... CTCAGTAC.....AATTACG.CT 342 AF339923.1_FAdV- ...... CAGGTAGAAAACGACAACACCGGCGTGCTCGGTCGCTTCGCCAAGT...... CTCGGTAC.....AAATACG.CT 342 FN394664.1_FAdV- ...... CGGGTAGAAAACGCCAACACCGGCGTGCTCGGTCGCTTCGCCAAGT...... CTCAGTAC.....AATTACG.CT 342 EU847626.1_FAdV- ...... CGGGTAGAAAACGCCAACACCGGCGTGCTCGGTCGCTTCGCCAAGT...... CTCAGTAC.....AATTACG.CT 342 DQ264728.1_FAdV- ...... CAGGTAGAAAACGCCAACACCGGCGTGCTCGGTCGCTTCGCCAAGT...... CTCAGTAC.....AATTACG.CT 342 FAdV-4_NIABNIBGE ...... CGGGTAGAAAACGCCAACACCGGCGTGCTCGGTCGCTTCGCCAAGT...... CTCAGTAC.....AATTACG.CT 342 Consensus g c

Chapter 3 Results

AF207659.1_BAdV- TACGGATCTTATGTTAAACCTCAAAGTGTACAGGGA....AATATTTCCACTACTGCTGCCGAGAAAGTTTACTTAAATAGTACT 429 L80007.1_EAdV-2 TACGGAAGCTACG.CACCCCCTACCAACGTCGATGGAGGACAGGGCGATGGCAACCCAACCCTTAAATTCTTTAAGACTGGAACC 429 DQ149638.1_HAdV- GGCTAAATTTAAAACACTAGATGGGCAAGTTACAAAAGATCCAGATATTGACTTTGCTTACTTTGACGTCCCTGGCGGAAAAGCT 510 EF442329.1_Psitt TACGGAGCCTACGTCCCTCCGGTGAACGACCAGGGGGCGCAGTCTCTGCAGCAGACCGGATACTACCTCATGAATGGAGCGGGTA 394 DM380829.1_CELO_ TACGGAGCCTATGTCAAGCCCGTGAAGGACGACGGGTCTCAGTCTCTGAACCAGACCGCGTACTGGCTGATGGACAACGGAGGTA 439 EF685395.1_Fowl_ TACGGTGCCTACGTCAAGCCCGTCGCCGCCGACGGTTCCCAGTCCCTCACGCAGACCCCCTACTGGATCATGAATAACGCGGGCA 427 AY581275.1_FAdV TACGGTGCCTACGTCAAGCCCGTCGCCGCCGACGGTTCCCAGTCCCTCACGCAGACCCCCTACTGGATCATGGATAACACGGGCA 427 AF339923.1_FAdV- TACGGGGCCTACGTCAAGCCCGTCGCCGCCGACGGTTCCCAGTCCCTCACGCAGACCCCATACTGGATCATGGATAACGCGGGCG 427 FN394664.1_FAdV- TACGGTGCCTACGTCAAGCCCGTCGCCGCCGACGGTTCCCAGTCCCTCACGCAGACCCCCTACTGGATCATGGATAACACGGGCA 427 EU847626.1_FAdV- TACGGTGCCTACGTCAAGCCCGTCGCCGCCGACGGTTCCCAGTCCCTCACGCAGACCCCCTACTGGATCATGGATAACACGGGCA 427 DQ264728.1_FAdV- TACGGTGCCTACGTCAAGCCCGTCGCCGCCGACGGTTCCCAGTCCCTCACGCAGACCCCCTACTGGCAAGACGATAACACGGGCG 427 FAdV-4_NIABNIBGE TACGGTGCCTACGTCAAGCCCGTCGCCGCCGACGGTTCCCAGTCCCTCACGCAGACCCCCTACTGGATCATGGATAACACGGGCA 427 Consensus c ta c

AF207659.1_BAdV- GAAACTGACGATAG...... AGTATCAGGATTTGTTGCTGTAGATACAGTAAATCGTTTACATCCTGATTGTC 496 L80007.1_EAdV-2 CAAGCCGCCAG...... GCCGGATATCGTCTTGTATTCTGAGAACGTGAACTTAATGATGCCAGACAGCC 493 DQ149638.1_HAdV- CCAACAGGCAGTAGTCTACCGGAAGAATACAAAGCAGATATAATTTTGTACACAGAAAATGTTAATCTGGAAACACCAGATACTC 595 EF442329.1_Psitt CTAACTACTTG...... G.GAGGCGTATCCGTGGAAGACTACAGCAACACCCTCGTCTATCCCGACACGA 457 DM380829.1_CELO_ CCAACTATCTG...... G.GTGCCCTGGCTGTGGAAGACTACACTCAGACCCTGAGTTACCCCGATACCG 502 EF685395.1_Fowl_ CCGAATACCTG...... G.GGGCGGTAGCCGTCGAGGACTACACCAACAGCCTCTCGTACCCAGATACCA 490 AY581275.1_FAdV CCAATTACCTG...... G.GAGCGGTGGCCGTCGAGGACTACACCAACAGCCTCTCGTACCCAGATACCA 490 AF339923.1_FAdV- CCAAATACCTG...... G.GAGCGGTAGCTGTCGAGGACTACACCAACAGCCTCTCGTACCCAGATACCA 490 FN394664.1_FAdV- CCAATTACCTG...... G.GAGCGGTGGCCGTCGAGGACTACACCAACAGCCTCTCGTACCCAGATACCA 490 EU847626.1_FAdV- CCAATTACCTG...... G.GAGCGGTGGCCGTCGAGGACTACACCAACAGCCTCTCGTACCCAGATACCA 490 DQ264728.1_FAdV- TATCGTACCTG...... G.GAGCGGTGGCCGTCGAGGACTACACCAACAGCCTCTCGTACCCAGATACCA 490 FAdV-4_NIABNIBGE CCAATTACCTG...... G.GAGCGGTGGCCGTCGAGGACTACACCAACAGCCTCTCGTACCCAGATACCA 490 Consensus t a a a cc ga

AF207659.1_BAdV- ATTATGTTGAA...... TATACAGGTGATGCTAATTCTACTGCTAGTG...... GAAACAGACCAAATTATAT 557 L80007.1_EAdV-2 ATATAGTATATAAAGTGGGTACCGACGAAGAACAGTCGCGCGCGGCTCTCGCTCAGCAAGCCGCACCAAACAGACCTAACTACGT 578 DQ149638.1_HAdV- ACATAGTGTATAAACCTGGCAAAGAAGATGACAATTCTGAAATTAACTTAACACAACAGTCCATGCCAAACAGACCCAACTACAT 680 EF442329.1_Psitt TTAACATTCCT...CCTCCCTCCGGCCTAACTACTGTGAGCAACGGTGTGCAGAAAG...... CACTACGACCCAACTACAT 530 DM380829.1_CELO_ TGCTCGTGACC...CCTCCCACCGCTTACCAGCAAGTCAACTCCGGCACCATGCGGG...... CATGCAGGCCCAACTACAT 575 EF685395.1_Fowl_ TGATCGTGCCG...CCTCCCGAGGATTACGACGATTATAACATAGGCACCACGCGTG...... CGCTCAGGCCCAACTACAT 563 AY581275.1_FAdV TAGTCGTGCCG...CCTCCCGAGGACTACGACGATTATAACATAGGCACCACGCGTG...... CGCTCAGGCCCAACTACAT 563 AF339923.1_FAdV- TGATCGTGCCT...CCTCCCGACGACTACGATGATTATAACATAGGCACCACGCGTG...... CGCTCAGGCCCAACTACAT 563 FN394664.1_FAdV- TAGTCGTGCCG...CCTCCCGAGGACTACGACGATTATAACATAGGCACCACGCGTG...... CGCTCAGGCCCAACTACAT 563 EU847626.1_FAdV- TAGTCGTGCCG...CCTCCCGAGGACTACGACGATTATAACATAGGCACCACGCGTG...... CGCTCAGGCCCAACTACAT 563 DQ264728.1_FAdV- TAGTCGTGCCG...CCTCCCGAGGACTACGACGATTATAACATAGGCACCACGCGTG...... CGCTCAGGCCCAACTACAT 563 FAdV-4_NIABNIBGE TAGTCGTGCCG...CCTCCCGAGGACTACGACGATTATAACATAGGCACCACGCGTG...... CGCTCAGGCCCAACTACAT 563 Consensus t g g cc aa ta t

AF207659.1_BAdV- TGGTTTCAGAGATAATTTTGTAGGCTTAATGTACTACAATAATGGGTCAAATGCTGGAACATTTTCTTCTCAAACTCAGCAATTA 642 L80007.1_EAdV-2 GGCCTTCAGAGACAATTTCATAGGACTGCTTTACTACAACAGCAACGGCAATCTAGGCGTGTTGGCCGGCCAGGCGTCCCAGCTG 663 DQ149638.1_HAdV- TGGCTTTAGGGACAACTTTGTAGGTCTCATGTACTACAACAGTACTGGCAACATGGGTGTGCTGGCTGGTCAGGCCTCTCAGTTG 765 EF442329.1_Psitt CGGATTCAGGGACAACTTCATTAACTTGCTGTACCACGATACTGGAGTGTGTTCCGGTACTTTGAACTCTGAGAGGTCCGGCATG 615 DM380829.1_CELO_ CGGCTTCCGAGACAACTTTATCAACCTACTGTACCACGACTCGGGCGTCTGCAGCGGAACGCTCAACTCCGAGCGCTCCGGCATG 660 EF685395.1_Fowl_ CGGGTTCAGGGATAACTTCATTAACCTGCTGTATCACGACTCCGGCGTGTGCTCGGGCACCCTCAACTCGGAGCGTTCGGGCATG 648 AY581275.1_FAdV CGGGTTCAGGGATAACTTCATTAACCTGCTGTATCACGACTCCGGCGTGTGCTCGGGCACCCTCAACTCGGAGCGTTCGGGCATG 648 AF339923.1_FAdV- CGGGTTCAGGGATAACTTCATTAACCTGCTGTATCACGACTCCGGCGTGTGCTCGGGCACCCTCAACTCGGAGCGTTCGGGCATG 648 FN394664.1_FAdV- CGGGTTCAGGGATAACTTCATTAACCTGCTGTATCACGACTCCGGCGTGTGCTCGGGCACCCTCAACTCGGAGCGTTCGGGCATG 648 EU847626.1_FAdV- CGGGTTCAGGGATAACTTCATTAACCTGCTGTATCACGACTCCGGCGTGTGCTCGGGCACCCTCAACTCGGAGCGTTCGGGCATG 648 DQ264728.1_FAdV- CGGGTTCAGGGATAACTTCATTAACCTGCTGTATCACGACTCCGGCGTGTGCTCGGGCACCCTCAACTCGGAGCGTTCGGGCATG 648 FAdV-4_NIABNIBGE CGGGTTCAGGGATAAATTCATTAACCTGCTGTATCACGACTCCGGCGTGTGCTCGGGCACCCTCAACTCGGAGCGTTCGGGCATG 648 Consensus g tt g ga aa tt t t t ta ac a gg t a t

AF207659.1_BAdV- AATGTAGTTTTAGACTTAAACGACAGAAATAGTGAACTAAGTTATCAATACTTGCTAGCAGAAATTAGTAGCAGGTATAAAT 724 L80007.1_EAdV-2 AACGCCGTAGTGGATTTACAGAACCGCAACACAGAATTGTCCTATCAATTGCTGCTCGACAGCTTGGTAGATCGTAACCGTT 745 DQ149638.1_HAdV- AATGCTGTGGTGGACTTGCAAGACAGAAACACCGAGCTGTCTTACCAGCTCTTGCTAGATTCTCTGGGTGACAGAACCAGAT 847 EF442329.1_Psitt AACGTTGTGGTGGAACTGCAAGACCGTAACACGGAACTGAGCTACCAGTACATGCTGGCCGACATGATGAGCCGTCATCATT 697 DM380829.1_CELO_ AACGTGGTCGTGGAACTCCAGGACAGAAACACAGAACTGAGTTACCAGTACATGCTGGCGGACATGATGTCCCGTCATCACT 742 EF685395.1_Fowl_ AACGTGGTGGTCGAGCTGCCCGACCGGAACACCGAGCTCAGCTACCAGTACATGCTGGCG...... 708 AY581275.1_FAdV AACGTGGTGGTCGAGCTGCCCGACCGGAATACCGAGCTCAGCTACCAGTACATGCTGGCCGACATGATGTCCCGTCATCACT 730 AF339923.1_FAdV- AACGTGGTGGTCGAGCTGCCCGACCGGAATACCGAGCTCAGCTACCAGTACATGTTGGCCGATATGATGTCCCGTCATCACT 730 FN394664.1_FAdV- AACGTGGTGGTCGAGCTGCCCGACCGGAATACCGAGCTCAGCTACCAGTACATGCTGGCCGACATGATGTCCCGTCATCACT 730 EU847626.1_FAdV- AACGTGGTGGTCGAGCTGCCCGACCGGAATACCGAGCTCAGCTACCAGTACATGCTGGCCGACATGATGTCCCGTCCTCACT 730 DQ264728.1_FAdV- AACGTGGTGGTCGAGCTGCCCGACCGGAATACCGAGCTCAGCTACCAGTACATGCTGGCCGACATGATGTCCCGTCATCACT 730 FAdV-4_NIABNIBGE AACGTGGTGGTCGAGCTGCCCGACCGGAATACCGAGCTCAGCTACCAGTACATGCTGGCCGACATGATGTCCCGCCATCACT 730 Consensus aa g gt t ga t ac g aa a ga t ta ca tg t g

Fig 3.5: Multiple Sequence Alignment (MSA) of 730-bp variable region of Hexon gene of FAdV-4 NIABNIBGE – 01 with different Adenovirus isolates. Consensus nucleotide sequence of variable region of Hexon gene from various Adenovirus isolates is shown below the alignment.

Chapter 3 Results

3.3.2 Phylogenetic analysis

Phylogenetic analysis of sequenced variable region of Hexon gene is presented in Fig. 3.6. It is clearly evident that isolate has close relationship with other FAdV-4 regional isolates from India and Pakistan. So it is inferred that isolates of FAdV in India and Pakistan had a common ancestor, which can be differentiated from other FAdV isolates of Canada, Belgium and Germany.

Fig 3.6: Phylogenetic tree based on a 730-bp variable region of the hexon gene from a FAdV isolate (FAdV- 4 NIABNIBGE – 01) a rooted genetic distance dendrogram.

Chapter 3 Results

3.4 Generation of expression constructs (pSMJ-1, pSMJ-2 and pSMJ-3) The amplified PCR products of 100k, Penton base and short fiber genes having selected restriction site at each end were cloned into pET28a expression vector. These DNA fragments were cloned in fusion with 5’- upstream nucleotide sequences coding for six histidine residues and thrombin protease site. This vector is under control of T7 promoter and it has Kanamycin resistance for selection. Details are shown in section 2.13. 3.4.1 PCR amplification of target genes (Short fiber, Penton base & 100K)

The target genes (Short fiber, Penton base and 100K) were amplified using PCR technology, primers and experimental procedures (see table 2.3, section 2.9.2 and appendix 3). The results are presented in Figure 3.7. Analysis of PCR amplicons revealed the product size of 1437 bp (Fig. 3.7A), 1587 bp (Fig. 3.7 B) and 2397bp (Fig. 3.7C) DNA fragments.

Fig 3.7: Analysis of amplified PCR products on 1.5 % agarose gel. Fig A: Lane 1 & 2: 1437 bp PCR products (Short fiber), Fig B: Lane 1 & 2: 1587 bp PCR products (Penton base) and Fig C: Lane 1 & 2: 2397 bp PCR products (100 K). Lane M: 1Kb DNA ladder.

Chapter 3 Results

3.5 Restriction Analysis of Recombinant Plasmids

Recombinant plasmids were isolated from selected transformants and the constructs were confirmed by respective restriction enzyme digestion for the presence of inserted DNA fragments. The generated restricted DNA fragments from recombinant plasmids were analyzed on 1 % agarose gel and results obtained are shown in Figure 3.8.

Double digest of the pSMJ-1 showed the two distinct bands having 5300bp representing the vector and 2397bp representing the 100K insert. Double digest of the pSMJ-2 revealed two bands representing the vector (5300bp) and 1587bp Penton base insert. Similarly pSMJ-3 revealed the bands of vector (5300bp) and 1437bp shrort fiber.

Chapter 3 Results

Fig 3.8: Confirmation of expression vectors (constructs) by restriction analysis. Fig A: Lane 2 & 4: Nde I and Hind III restriction digestion pattern of pSMJ-3, Lane 1 & 3: undigested DNA. Fig B: Lane 2 & 4: Nde I and EcoR I restriction digestion pattern of pSMJ-2, Lane 1 & 3: undigested DNA. Fig C: Lane 2 & 4: Nde I and EcoR I restriction digestion pattern of pSMJ-1, Lane 1 & 3: undigested DNA. Lane M: 1 Kb DNA ladder.

Chapter 3 Results

3.6 PCR Amplification of inserts from recombinant plasmids (pSMJ-1, pSMJ-2 and pSMJ-3)

The amplification of 1437bp, 1587bp and 2397bp fragments of Short fiber, Penton base and 100K using gene specific primers (Table 2.3) from the E. coli transformants further confirmed the presence of recombinant genes in pSMJ-1, pSMJ-2 & pSMJ-3. The results are shown in Figures 3.9.

Fig 3.9: PCR based confirmation for the integration of vector and insert using gene specific primers. Fig A: Lane 1 to 3: 1437 bp PCR product (Short fiber), Fig B: Lane 1 to 3: 1587 bp PCR product (Penton base) and Fig C: Lane 1 to 3: 2397 bp PCR product (100 K). Lane M: 1 Kb DNA ladder.

Chapter 3 Results

3.7 DNA sequence analysis of the inserts

The DNA sequence of cloned genes (Short fiber, Penton base and 100K) were analyzed on ABI 3100 analyzer. Choromatograms obtained were evaluated using computer program sequence scanner v 1.0 (Applied Biosystems). The determined DNA sequence of each cloned gene was compared with gene sequences available in Genbank for confirmation of their identity using program Clustal W and they were found homologous to their respective nucleotide sequences. The nucleotide sequence of cloned genes were translated into amino acid sequence using computer programe ExPasy server and Justbio.com.

3.7.1 Short fiber gene, 1437bp

It was found that Short fiber gene of our isolate has 99% similarity with fiber gene of Fowl adenovirus 4 bareilly, an indian isolate (accession no. FJ949088.1). Sequence alignment results are shown in appendix. 10. The DNA sequence of short fiber gene of our isolate was submitted to the GenBank with accession no. HE649966.1. Complete nucleotide sequence and deduced amino acid sequence are shown in fig. 3.10.

Chapter 3 Results

1-atgctccgagcccctaaaagaagacattccgaaaacgggaagcccgagaccgaagcggga-60 1- M L R A P K R R H S E N G K P E T E A G -20 61-ccttccccggctccaatcaagcgcgccaaacgcatggtgagagcatcccagcttgacctg-120 21- P S P A P I K R A K R M V R A S Q L D L -40 121-gtttatcctttcgattacgtggccgaccccgtcggagggctcaacccgccttttttggga-180 41- V Y P F D Y V A D P V G G L N P P F L G -60 181-ggctcaggacccctagtggaccagggcggacagcttacgctcaacgtcaccgatcccatc-240 61- G S G P L V D Q G G Q L T L N V T D P I -80 241-atcatcaagaacagatcggtggacttggcccacgaccccagtctcgatgtcaacgcccaa-300 81- I I K N R S V D L A H D P S L D V N A Q -100 301-ggtcaactggcggtggccgttgaccccgaaggggccctggacatcacccccgatggactg-360 101- G Q L A V A V D P E G A L D I T P D G L -120 361-gacgtcaaggtcgacggagtgaccgtaatggtcaacgatgactgggaactggccgtaaaa-420 121- D V K V D G V T V M V N D D W E L A V K -140 421-gtcgacccgtccggcggattggattccaccgcgggtggactgggggtcagcgtggacgac-480 141- V D P S G G L D S T A G G L G V S V D D -160 481-accttgctcgtggatcagggagaactgggcgtacacctcaaccaacaaggacccatcact-540 161- T L L V D Q G E L G V H L N Q Q G P I T -180 541-gccgatagcagtggtatcgacctcgagatcaatcctaacatgttcacggtcaacacctcg-600 181- A D S S G I D L E I N P N M F T V N T S -200 601-accggaagcggagtgctggaactcaacctaaaagcgcagggaggcatccaagccgacagt-660 201- T G S G V L E L N L K A Q G G I Q A D S -220 661-tcgggagtgggcgtttccgtggatgaaagcctacagattgtcaacaacactctggaagtg-720 221- S G V G V S V D E S L Q I V N N T L E V -240 721-aaaccggatcccagcggaccgcttacggtctccgccaatggcctagggctgaagtacgac-780 241- K P D P S G P L T V S A N G L G L K Y D -260 781-actaataccctagcggtgaccgcgggcgctttaaccgtggtcggaggggggagcgtctcc-840 261- T N T L A V T A G A L T V V G G G S V S -280 841-acacccatcgctacttttgtctcgggaagtcccagcctcaacacctacaatgccacgacc-900 281- T P I A T F V S G S P S L N T Y N A T T -300 901-gtcaattccagcgcgaacgccttctcttgcgcctactaccttcaacagtggaacatacag-960 301- V N S S A N A F S C A Y Y L Q Q W N I Q -320 961-gggctccttgttacctccctctacttgaaattggacagcgccaccatggggaatcgccct-1020 321- G L L V T S L Y L K L D S A T M G N R P -340 1021-ggggacctcaactccgccaatgccaaatggttcaccttttgggtgtccgcctatctccag-1080 341- G D L N S A N A K W F T F W V S A Y L Q -360 1081-caatgcaactccgggattcaagcgggaacggtcagcccctccaccgccaccctcacggac-1140 361- Q C N S G I Q A G T V S P S T A T L T D -380 1141-tttgaacccatggccaataggagcgtgaccagcccatggacgtactcggccaatggatac-1200 381- F E P M A N R S V T S P W T Y S A N G Y -400 1201-tatgaaccatccatcggggaattccaagtgttcagcccggtggtaacaggtgcctggaac-1260 401- Y E P S I G E F Q V F S P V V T G A W N -420 1261-ccgggaaacatagggatccgcgtcctccccgtgccggttccggcctccggagagcgatac-1320 421- P G N I G I R V L P V P V P A S G E R Y -440 1321-acccttctatgctatagtctgcagtgcacgaacgcgagcatttttaatccaaacaacagc-1380 441- T L L C Y S L Q C T N A S I F N P N N S -460 1381-ggaaccatgatcgtgggacccgtgctctacagctgtccagcgggctccctcccgtaa -1437 461- G T M I V G P V L Y S C P A G S L P - -479

Fig 3.10: Nucleotide and deduced amino acid sequence of short fiber gene, 1437bp (starting from 5' as 1 to 3' 1437bp)

Chapter 3 Results

3.7.2 Penton base gene, 1587bp

It was found that Penton base gene of our isolate has 99% similarity with penton base gene of Fowl adenovirus 4 isolate KC from india (accession no. EU925581.1). Sequence alignment results are shown in appendix. 11. The DNA sequence of Penton base gene of our isolate was submitted to the GenBank with accession no. HE653773.1. Complete nucleotide sequence and deduced amino acid sequence are shown in fig. 3.11.

Chapter 3 Results

1-atgtgggggttgcagccgccgacgtcgattccgccgcctcctccgccgaccgagttaacg-60 1- M W G L Q P P T S I P P P P P P T E L T -20 61-ccctcgacctatccggcgatggtgaacggctatccgcctccggccgcgtccgcgcagagc-120 21- P S T Y P A M V N G Y P P P A A S A Q S -40 121-tgtccctctagcgacggtcagagcgagctgtatatgccccttcagcgggtgatggcccct-180 41- C P S S D G Q S E L Y M P L Q R V M A P -60 181-acggggggacggaacagcattaagtatcgcgattacacgccgtgtcgtaacaccaccaag-240 61- T G G R N S I K Y R D Y T P C R N T T K -80 241-ctgttttacgtagacaacaaggctagcgatatcgatacgtataacaaagacgccaaccat-300 81- L F Y V D N K A S D I D T Y N K D A N H -100 301-agcaatttccgcaccacggtgatccataaccaggatctggacgcggacacggccgccacc-360 101- S N F R T T V I H N Q D L D A D T A A T -120 361-gagtccatccagttggacaaccgctcctgctggggcggcgacctaaaaacagccgtgcgc-420 121- E S I Q L D N R S C W G G D L K T A V R -140 421-accaactgcccgaacgtgagcagttttttccagagtaacagcgtgcgcgtgcgcatgatg-480 141- T N C P N V S S F F Q S N S V R V R M M -160 481-tggaagcgcgacccgccgactagcacggctcctccgagcgcggtaggcagcggctattcg-540 161- W K R D P P T S T A P P S A V G S G Y S -180 541-gtgcccggcgcgcagtacaagtggtacgacctgacgatacccgagggtaactacgcgctg-600 181- V P G A Q Y K W Y D L T I P E G N Y A L -200 601-tgcgaactgatagacctgctcaacgagggcatcgtgcagctctacctgagcgaggggcac-660 201- C E L I D L L N E G I V Q L Y L S E G H -220 661-cagaacaacgtgcaaaaatcggacatcggggtcaagttcgacacgcgcaacttcggcttg-720 221- Q N N V Q K S D I G V K F D T R N F G L -240 721-ctccgcgaccccgtgacgggactggtaactccgggcacgtacgtgtacaagggttaccac-780 241- L R D P V T G L V T P G T Y V Y K G Y H -260 781-cccgacatcgtgctgctgcccggatgcgcgatcgactttacgtacagccgcctgagcctg-840 261- P D I V L L P G C A I D F T Y S R L S L -280 841-ctcctgggcatagggaagcgcgagccctactcgaaggggttcgttattacctacgaggat-900 281- L L G I G K R E P Y S K G F V I T Y E D -300 901-ctgcagggaggggatatcccggctctgctggacctcgactccgtcgacgtgaacgacgct-960 301- L Q G G D I P A L L D L D S V D V N D A -320 961-gacggtgaagtgatcgagctcgacaacgctgctccccttttacatgacagcgcgggcgtg-1020 321- D G E V I E L D N A A P L L H D S A G V -340 1021-tcgtataacgtcatttacgaccaggtgacgggtaaacccgtgacggtgtatcgatcgtgg-1080 341- S Y N V I Y D Q V T G K P V T V Y R S W -360 1081-atgttggcttacaacgtgcctaactcgccggccaatcagacgaccttgctgacggtgccc-1140 361- M L A Y N V P N S P A N Q T T L L T V P -380 1141-gatatggcgggcgggatcggggcgatgtacacgtccctgcccgatacctttatcgcgcct-1200 381- D M A G G I G A M Y T S L P D T F I A P -400 1201-accgggttcaaggaagataacacgaccaacctttgcccggtcgtcggcatgaacctgttc-1260 401- T G F K E D N T T N L C P V V G M N L F -420 1261-cccacctacaataaaatttattaccaggcggcgtccacgtacgtgcagcgcctggaaaat-1320 421- P T Y N K I Y Y Q A A S T Y V Q R L E N -440 1321-tcctgccagtcggccacagccgccttcaaccgctttcccgaaaacgagattctgaagcaa-1380 441- S C Q S A T A A F N R F P E N E I L K Q -460 1381-gcgccccccatgaatgtttcgtccgtgtgcgataaccaacccgccgtcgttcagcagggt-1440 461- A P P M N V S S V C D N Q P A V V Q Q G -480 1441-gtgttgcctgtgaagagctcgctccccggactgcaggactgcaggcgcgtgctgatcaca-1500 481- V L P V K S S L P G L Q D C R R V L I T -500 1501-gacgaccagcgtcgtccgataccctacgtgtataagtctatcgcgacggttcagccgacc-1560 501- D D Q R R P I P Y V Y K S I A T V Q P T -520 1561-Gttctgagttccgcgaccttgcagtag -1587 521- V L S S A T L Q - -529 Fig 3.11: Nucleotide and deduced amino acid sequence of Penton base gene, 1587bp (starting from 5' as 1 to 3' 1587bp)

Chapter 3 Results

3.7.3 100K gene, 2397bp

100K gene of our isolate has 98% similarity with 100K gene of FAdV-10, which is a Russian isolate (accession no. LO7890.1). Sequence alignment results are shown in appendix. 12. 100K gene of FAdV-4 is showing similarity with 100K gene of Russian isolate FAdV-10 because previously there was no sequencing data of this region of FAdV-4 available in the database. So during this study it was found that this region of FAdV-4 has 98% similarity with FAdV-10. The DNA sequence of 100K gene of our isolate was submitted to the GenBank with accession no. FR693741. Complete nucleotide sequence and deduced amino acid sequence are shown in fig. 3.12.

1-atggaaagcaccgccgacggggataaagcccgtggcgaggagcccgcagctgagcgcgag-60 1- M E S T A D G D K A R G E E P A A E R E -20 61-gccagcgacaccgccggcgccgacggcgagttccccgcgccggaagacgagcatccggac-120 21- A S D T A G A D G E F P A P E D E H P D -40 121-gatggggaaccggatgaaccggccgacagagacgaccgatcgggcgaaccggacgcggat-180 41- D G E P D E P A D R D D R S G E P D A D -60 181-agcggttactattcggcagatgggggacgcgatgcaggctacgacggagaggccgctcga-240 61- S G Y Y S A D G G R D A G Y D G E A A R -80 241-cccgacacccctacggacgagtctagcgcgccgactactccatccacagcagtgcgacgc-300 81- P D T P T D E S S A P T T P S T A V R R -100 301-tcatcgggcgagtctagccccgatcgcggtggctgctttagccactctagcgactctgag-360 101- S S G E S S P D R G G C F S H S S D S E -120 361-ctcggctgtgctactgagactcgcgatccgtttgctgcagggctgcgcaagtgcatcgaa-420 121- L G C A T E T R D P F A A G L R K C I E -140 421-cggcaagccatgatcctaacgggagccctcaaagacgcgcagctcgacccgcccctcgac-480 141- R Q A M I L T G A L K D A Q L D P P L D -160 481-agcatgccacttaccgtagacgcggtgcagagacagttagagcgctttctcttcaacccc-540 161- S M P L T V D A V Q R Q L E R F L F N P -180 541-gacccgaaagtgccgcgcgagcacgtagagctcgctacaacttttatgccgcccttcatg-600 181- D P K V P R E H V E L A T T F M P P F M -200 601-acgcctaaagccatcgcaaactaccacatcttttgcggtaaccgccccatcccgcctagc-660 201- T P K A I A N Y H I F C G N R P I P P S -220 661-cgcaaggccaaccggagcggatccgaggtgctccgtgccgcggagaacgctcgcttcttc-720 221- R K A N R S G S E V L R A A E N A R F F -240 721-aaacgcttacctcgctggaagcagggcgtgacggtcgacgacggtctgggagacgaggtg-780 241- K R L P R W K Q G V T V D D G L G D E V -260 781-tcgcctataacagagctgaaagacgccaaattagtgccgttgcgcgatgacacctcccgt-840 261- S P I T E L K D A K L V P L R D D T S R -280 841-ctcgagtgggccaaaatgcgcggcgaacacgtacgctatttttgctacccctccctccac-900 281- L E W A K M R G E H V R Y F C Y P S L H -300 901-atgcctcccaaaatatcccgcatgctcatggaggtactgctccagccattcgctcaagag-960 301- M P P K I S R M L M E V L L Q P F A Q E -320 961-gtagcgagcggtggcgatcaagaagaccccgagcccgtgtttccgacagcggaactggcg-1020 321- V A S G G D Q E D P E P V F P T A E L A -340 1021-tgcatcgtcgatccggagggcgtgatgcaaccacacgcgctagctagagcgatagaggtc-1080 341- C I V D P E G V M Q P H A L A R A I E V -360

Chapter 3 Results

1081-gacgggcatggtagcgcaggccgtccgctataccgctcagctagagcttatggaagcgta-1140 361- D G H G S A G R P L Y R S A R A Y G S V -380 1141-ttccgcgagccttcctcgatcaaaaaggcacaagaagtgctccatcacaccttccaccac-1200 381- F R E P S S I K K A Q E V L H H T F H H -400 1201-ggtttcgtggcgctcattcgggaaaccgccaaagtcaatctaagcaactatgccaccttc-1260 401- G F V A L I R E T A K V N L S N Y A T F -420 1261-cacgggatcacgtacaacgacccgctcaacaactgcatgctagccaagttgatggaaggc-1320 421- H G I T Y N D P L N N C M L A K L M E G -440 1321-tcggacaagcgagattacgtggtggacagcatctacctcttcttggtgctcacgtggcaa-1380 441- S D K R D Y V V D S I Y L F L V L T W Q -460 1381-acggctatgggcatgtggcagcaagccatccaggaggaggccatcgaggcttatcgggag-1440 461- T A M G M W Q Q A I Q E E A I E A Y R E -480 1441-gcctttactcggctccgaagagctatttacgctctcgaaacacccaccgagatctccaaa-1500 481- A F T R L R R A I Y A L E T P T E I S K -500 1501-gccatcgtagacgtgctcatggacggagaccgactgtgcgccgaaatgccaaagctcccc-1560 501- A I V D V L M D G D R L C A E M P K L P -520 1561-aacttcaccaatggcagccaaatcagcgcctttaggcagtttatcatggagcgcagtaac-1620 521- N F T N G S Q I S A F R Q F I M E R S N -540 1621-attcccaccacggccgcccccttcctaccctccgactttgtgccgctctccttccgacaa-1680 541- I P T T A A P F L P S D F V P L S F R Q -560 1681-gcccagcctctgctctgggaccaggtgtacctcctccaaaccgcctttttcctctgcaac-1740 561- A Q P L L W D Q V Y L L Q T A F F L C N -580 1741-cacggaggatacctgtgggagcccgaggaaaccgagaatcccaaccctcgcgatcgcacc-1800 581- H G G Y L W E P E E T E N P N P R D R T -600 1801-tactgtccgtgcaacttgtgcagtccgcaccggatgccccaacacaacgtgcctctgcac-1860 601- Y C P C N L C S P H R M P Q H N V P L H -620 1861-aacgaactgctcgccatcgacacgtttgaaatccgcacggacgacggcaagaccttcaaa-1920 621- N E L L A I D T F E I R T D D G K T F K -640 1921-ttgactcccgaactgtgggccaacgcctacctagacaaattcgaacccaaagactaccac-1980 641- L T P E L W A N A Y L D K F E P K D Y H -660 1981-cctttcgaagtggtgcacctccctcaacacgaggaagcgttctctagagacctcacggcc-2040 661- P F E V V H L P Q H E E A F S R D L T A -680 2041-tgcgtcaccaaaagccccgaaatcctcagtctgattcgtcaaattcaggcttcgagggag-2100 681- C V T K S P E I L S L I R Q I Q A S R E -700 2101-gagttcctcctcacgcggggtaagggcgtatacaaagaccccgacaccggcgaggtcctc-2160 701- E F L L T R G K G V Y K D P D T G E V L -720 2161-actccgcagccagatctccaagctggagcagcccggcgacaagctctaccaaccgcttac-2220 721- T P Q P D L Q A G A A R R Q A L P T A Y -740 2221-gccgatcacgccagaggagctgcgacgtcggcagagccttctcgagctctacggcctacc-2280 741- A D H A R G A A T S A E P S R A L R P T -760 2281-agcgtcgcaaccgccgccggaaaccgaacacgggggtgctcttcggcgcgctatcggctc-2340 761- S V A T A A G N R T R G C S S A R Y R L -780 2341-ggtccaaccctccgtcgcaggagcaactcctcatggcccagagaatggtcgacctga -2397 781- G P T L R R R S N S S W P R E W S T - -799

Fig 3.12: Nucleotide and deduced amino acid sequence of 100K gene, 2397bp (starting from 5' as 1 to 3' 2397bp)

Chapter 3 Results

3.8 Prokaryotic expression of recombinant viral proteins

For expression of 100K, Penton base and Short fiber genes, corresponding constructs pSMJ-1, pSMJ-2 and pSMJ-3 were transformed into E. coli, BL21 (DE3) strain. E. coli cells harboring respective recombinant plasmids were cultured in LB media containing Kanamycin (50 µg/ml) at

37ºC with constant shaking until reached mid log phase (O.D600 0.5). IPTG was used for induction of rapidly growing culture. The viable cell phase confirmed using spectrophotometeric method. The bacterial cells were harvested by centrifugation and pellet was resuspended in lysis buffer, ultrasonicated and fractioned into supernatants and inclusion bodies. Total protein content of each fraction was estimated by Bradford assay. Uninduced fractions were also collected and analyzed in the same way as negative controls.

3.8.1 SDS-PAGE analysis of recombinant proteins

SDS-PAGE was performed to examine the protein profiles of transformed E. coli strains. The analysis of protein profiles revealed that expression of proteins was observed both in supernatant and pellet fractions of E. coli strains harboring recombinant constructs. It was also observed that recombinant proteins were highly expressed in pellet fractions. The SDS-PAGE analysis of recombinant proteins also revealed that recombinant Short fiber, Penton base and 100K have approximate sizes of 60Kda, 65kda and 95kda. Whereas these bands were absent in uninduced E. coli. It was also observed that recombinant short fiber and penton base were highly expressed in pellet fractions as inclusion bodies. Results are shown in Fig. 3.13, 3.14 and 3.15.

Chapter 3 Results

60kDa

Fig. 3.13: SDS-PAGE analysis of soluble and pellet of E. coli Rosetta (DE3)/pSMJ-3 expressing His+Thrombin+Short fiber (60 kDa) protein along with molecular weight marker. Lane 1 and 2: Pellet and supernatant fractions of Uninduced culture. Lane 3 and 4: Pellet and supernatant fractions of Induced culture. Lane M: protein molecular weight marker

Chapter 3 Results

65kDa

Fig. 3.14: SDS-PAGE analysis of soluble and pellet of E. coli Rosetta (DE3)/pSMJ-2 expressing His+Thrombin+penton base (65 kDa) protein along with molecular weight marker. Lane 1 and 2: Supernatant and pellet fractions of Uninduced culture. Lane 3 and 4: Supernatant and pellet fractions of Induced culture. Lane M: protein molecular weight marker

Chapter 3 Results

95kDa

Fig. 3.15: SDS-PAGE analysis of soluble and pellet of E. coli Rosetta (DE3)/pSMJ-1 expressing His+Thrombin+100K (95 kDa) protein along with molecular weight marker. Lane 1 and 2: Pellet and supernatant fractions of Uninduced culture. Lane 3 and 4: Pellet and supernatant fractions of Induced culture. Lane M: protein molecular weight marker

Chapter 3 Results

3.9 Western blot analysis Considering the specificity and sensitivity of the western blot technique the expressed proteins were confirmed by using western blot analysis. For this purpose prior to SDS-PAGE, samples having recombinant proteins were subjected to Bradford assay for quantification of protein contents. Standard curve was plotted (Appendix 13) using Bovine serum albumen and protein contents of the samples were estimated. Mouse anti His antibody was used to probe the blotting membrane. Histidine residues along with the recombinant proteins having affinity of anti His antibody were detected. While there was no protein fraction detected among the protein profile of negative control which was indicative of the absence of recombinant protein in negative control. The recombinant proteins were detected at their approximate expected sizes. The detection of His tagged protein bands having approximate sizes of 60, 65 and 95Kda, during western blot analysis confirmed that the viral genes were successfully expressed in E. coli cells. Results of the western blot are shown in Fig. 3.16, 3.17 and 3.18.

3.10 Purification of recombinant proteins The expressed recombinant proteins were purified by metal affinity chromatography using nickel nitrilotriacetic acid (Ni-NTA) resins. Proteins having 6 X His tag expressed in E. coli can be purified using Ni-NTA resins. Clear lysates of transformants having recombinant protein, were subjected to Ni-NTA column. Recombinant proteins were purified as described in section 2.17. All wash fractions and final protein elution fractions were subjected to SDS-PAGE analysis. The recombinant proteins of approximate desired sizes were present in the elution fractions whereas they were absent in wash fractions, which was evident of successful elution of His tagged proteins. The purified recombinant proteins of His+Thrombin+Short fiber, His+Thrombin+Penton base and His+Thrombin+100K were found having the size of 60kDa, 65kDa and 95kDa respectively. Figures of gels representing the protein purification of recombinant Short fiber, Penton base and 100K are shown in Fig. 3.19, 3.20 and 3.21 respectively. Fractions 6, 7 & 8 in each gel represent eluted purified recombinant proteins.

Chapter 3 Results

Fig 3.16: A: Expression analysis of soluble and pellet fractions of E. coli BL21 (DE3)/pSMJ-3 expressing Short Fiber recombinant proteins along with molecular weight marker. B: Western blot analysis of soluble and pellet fractions of E. coli BL21 (DE3)/pSMJ-3 expressing Short Fiber recombinant proteins. Lane 1 & 2: Supernatant & pellet fractions of uninduced culture (-ve control), Lane 3 & 4: Supernatant & pellet fractions of induced culture expressing S.F, Lane M: Molecular weight marker.

Chapter 3 Results

Fig 3.17: A: Expression analysis of soluble and pellet fractions of E. coli BL21 (DE3)/pSMJ-2 expressing Penton Base recombinant proteins along with molecular weight marker. B: Western blot analysis of soluble and pellet fractions of E. coli BL21 (DE3)/pSMJ-2 expressing Penton Base recombinant proteins. Lane 1 & 2: Supernatant & pellet fractions of uninduced culture (-ve control), Lane 3 & 4: Supernatant & pellet fractions of induced culture expressing P.B, Lane M: Molecular weight marker.

Chapter 3 Results

Fig 3.18: A: Expression analysis of soluble and pellet fractions of E. coli BL21 (DE3)/pSMJ-1 expressing 100K recombinant proteins along with molecular weight marker. B: Western blot analysis of soluble and pellet fractions of E. coli BL21 (DE3)/pSMJ-1 expressing 100K recombinant proteins. Lane 1 & 2: Supernatant & pellet fractions of uninduced culture (-ve control), Lane 3 & 4: Supernatant & pellet fractions of induced culture expressing 100K, Lane M: Molecular weight marker.

Chapter 3 Results

Fig 3.19: SDS-PAGE gel representing purification of His+Thrombin+Short fiber protein (60kDa) by Ni affinity chromatography. Lane 1: Uninduced culture. Lane 2: Induced culture. Lane 3 to 5: Wash fractions. Lane 6 to 9: Elution fractions. Lane M: Protein molecular weight marker

Chapter 3 Results

Fig 3.20: SDS-PAGE gel representing purification of His+Thrombin+Penton base protein (65kDa) by Ni affinity chromatography. Lane 1: Uninduced culture. Lane 2: Induced culture. Lane 3 to 5: Wash fractions. Lane 6 to 9: Elution fractions. Lane M: Protein molecular weight marker

Chapter 3 Results

Fig 3.21: SDS-PAGE gel representing purification of His+Thrombin+100K protein (95kDa) by Ni affinity chromatography. Lane 1: Uninduced culture. Lane 2: Induced culture. Lane 3 to 5: Wash fractions. Lane 6 to 9: Elution fractions. Lane M: Protein molecular weight marker

Chapter 3 Results

3.11 Immunogenicity of purified recombinant proteins Recombinant proteins were adjuvanted with Frueund’s complete adjuvant (FCA) according to instructions of the manufacturer (Sigma) and a quantity of 25 µg/ bird was injected on 14th day of age. A total dose of 200µl/bird was injected subcutaneously in two equal parts i.e. 100 µl/injection site on the body, to avoid or minimize the adverse effects of excessive inflammation at the site of injection. Three groups (A, B & C) were immunized with three recombinant proteins, while one group (D) was immunized with inactivated commercial vaccine (Avi-Hydro). Two groups (E & F) were injected with saline and they were treated as challenge +ve and –ve controls.

Considering the sensitivity of the ELISA technique compared to other serological techniques, serum antibody titers against 6X His-tagged recombinant proteins were determined by ELISA. For this purpose recombinant proteins were expressed in E. coli and purified by affinity chromatography. Procedure of ELISA was optimized using the different concentrations of purified recombinant proteins. For this purpose flat bottom micro-titer plate was coated with 5µg/ml and 10µg/ml of the purified recombinant proteins in carbonate buffer. Three recombinant proteins along with 1:50 and 1:100 dilutions of inactivated FAdV-4 (from section 2.5) as control were added individually 200µl/well. It was found that 10µg/ml concentration of purified recombinant proteins and 1:100 dilution of inactivated virus were suitable for coating micro-titer plate. Moreover 1:100 dilution of serum was found suitable to detect antibodies. So it was found that recombinant proteins can be used to develop a diagnostic ELISA. Moreover 100K protein being a non-structural protein (NSP) is a potential candidate to develop a NSP ELISA kit. Results of ELISA for optimization are given in Table 3.2.

After optimization of conditions for ELISA, serum samples of broilers immunized by the various recombinant proteins and commercial vaccine were analyzed by indirect ELISA for quantification of serum antibodies against respective recombinant protein. It was found that subcutaneous immunization of broilers with purified recombinant proteins induced a strong immune response. Results are shown in Fig 3.22.

Chapter 3 Results

Table 3.2: Results of ELISA (O.D values) for optimization of protein and serum dilutions

Semi purified Inactivated Purified recombinant proteins virus (as control) Short fiber Penton base 100K

Serum -ve control +ve control +ve serum dilution (-ve serum) (+ve serum)

1 2 3 4 5 6 7 8 9 10

1:50 1:100 1:50 1:100 5µg/ml 10µg/ml 5µg/ml 10µg/ml 5µg/ml 10µg/ml

1:50 a 0.086 0.054 2.01 1.55 0.80 1.12 0.87 1.26 0.55 0.69

1:100 b 0.084 0.048 1.95 1.35 0.76 0.98 0.80 1.13 0.53 0.63

1:200 c 0.055 0.047 1.94 1.24 0.64 0.76 0.73 0.86 0.38 0.43

1:400 d 0.053 0.045 1.54 1.15 0.40 0.57 0.66 0.77 0.27 0.35

1:800 e 0.051 0.045 1.46 1.03 0.26 0.46 0.49 0.63 0.18 0.19

1:1600 f 0.051 0.044 1.23 0.91 0.17 0.25 0.38 0.53 0.13 0.15

1:3200 g 0.049 0.044 1.13 0.78 0.13 0.15 0.17 0.35 0.09 0.09

1:6400 h 0.048 0.041 0.89 0.51 0.08 0.10 0.09 0.11 0.06 0.05

Chapter 3 Results

Fig 3.22: Post immunization antibody response in treatment and control groups. Group A was immunized with Short fiber, Group B was immunized with Penton base, Group C was immunized with 100K, Group D was immunized with commercial inactivated vaccine, Group E was control and it was injected with sterile PBS.

Chapter 3 Results

3.12 Challenge protection test The antibody response against various recombinant proteins along with commercial inactivated vaccine was evaluated for their protection against pathogenic virus challenge. For the purpose 0.5ml of semi purified virus suspension, having biological titer 105.5 units of lethal dose 50 nd (LD50) per ml was injected subcutaneously to each bird except birds of negative control at 42 day of age. Challenge protection test revealed that recombinant penton base conferred maximum protection (90%) against pathogenic FAdV-4 challenge followed by short fiber (80%) and inactivated vaccine (70%). The recombinant 100K protein was found least effective (50%) against pathogenic challenge as it is a non structural protein. Results are shown in Table 3.3. While the penton base and short fiber are structural proteins, so they were found as highly immuno-reactive against pathogenic virus. Data regarding morbidity, mortality and percent protection after challenge in each group is shown in Table 3.3. Dead birds were examined and postmortem examinations were conducted which were evident of typical signs, symptoms & postmortem lesions of the disease. Lesion score was determined by giving score according to accumulation of fluid in pericardial sac (Table 3.3). Other Lesions comprised of congestion and edema in lungs, swollen friable enlarged liver and pale kidneys. Birds of each group survived after challenge, were slaughtered and postmortem examinations were conducted. Signs, symptoms and postmortem lesions of the disease were not observed in these birds. From this study, it was concluded that Fowl Adenovirus-4 was responsible of Hydropericardium syndrome outbreaks. Nucleotide sequence analysis of L1 and part of P1 region of Hexon gene (730bp) revealed that our isolate has close phylogenetic relationship with Indian FAdV-4 isolates. Prokaryotic expression of viral genes representing short fiber (1437bp), penton base (1587bp) and 100K (2397bp) yielded 60kDa, 65kDa and 95kDa recombinant proteins which were tagged with Histidine residues and thrombin site at N terminal. Out of these proteins Penton base and short fiber were more immuno-reactive as they conferred good protection against pathogenic FAdV-4 challenge.

Chapter 3 Results

Table 3.3: Post challenge morbidity, mortality and percent protection in treatment and control groups

Group Treatment Age at Morbidity Mortality Post Survived Protection at 14th day challenge mortem of age (days) Lesions

A Recombinant 42 6/30 6/30 ++ 24/30 80 % short fiber with FCA

B Recombinant 42 3/30 3/30 ++ 27/30 90 % penton base with FCA

C Recombinant 42 15/30 15/30 +++ 15/30 50 % 100K with FCA

D Commercial 42 9/30 9/30 ++ 21/30 70 % inactivated vaccine

E Sterile PBS 42 27/30 27/30 ++++ 3/30 10 % (Challenge control)

F Sterile PBS (sterile 0/30 0/30 _ 30/30 100 % (Negative PBS) control)

Lesions score: ++++ = Pericardial fluid > 8ml, +++ = Pericardial fluid > 5ml, ++ = Pericardial fluid > 3ml

% Protection: (Number of protected chicken / Number of total chicken in each group) X 100

Challenge control: Chicken in this group were not immunized at 14th day and it was challenged at 42nd day of age

Negative control: Chicken in this group were neither immunized at 14th day nor challenged at 42nd day of age

PBS: Phosphate Buffer Saline injected to control group at 14th day and 42nd day.

Chapter 4 Discussion

Discussion

Poultry sector is one of the most organized branches of the agro based sector in Pakistan. Its annual growth rate is 10-12%. This sector generates direct and indirect employment for about 1.5 million people. Pakistan produces about 530 million birds annually out of these 434 millions are broiler birds. In spite of this, annual percapita consumption of meat and eggs are only 7 Kg and 60-65 eggs respectively in Pakistan (Talha et al., 2011). Major diseases that affect this industry include viral (Newcastle disease, Infectious bursal disease, Influenza, Hydropericardium syndrome), bacterial (Colibacillosis, Pasteurellosis, Salmonellosis, Mycoplasmosis), parasitic (Coccidiosis, Histoplasmosis) or nutritional (Dyschonroplasia, Osteoperosis).

Hydropericardium syndrome (HPS) is one of the important viral diseases occurring in the specific areas of the world. According to the reports, HPS was first observed in 1987 at Angara Goth, near Karachi, Pakistan. Since then, HPS has been reported in Iraq, Kuwait, India, Ecuador, Chile, Korea and Japan (Abdul Aziz and Alattar, 1991, Cowen, 1992, Survashi et al., 1997, Toro et al., 1999, Bergmann et al., 1999).

In the present study fowl adenovirus causing Hydropericardium syndrome (HPS) around districts of Faisalabad, Rawalpindi and Lahore were characterized and an attempt has been made to develop a recombinant subunit vaccine candidate that should be able to induce a humoral immune response. To achieve this objective three recombinant expression constructs pSMJ-1, pSMJ-2 and pSMJ-3 were developed having two structural (penton base and short fiber) and one non structural (100k) viral proteins (Fig 2.1, 2.2 and 2.3).

4.1. Molecular characterization of Fowl adenovirus

In the present study local isolate of fowl adenovirus causing hydropericardium syndrome was isolated from infected broiler birds during field outbreaks from April to September 2009. Infected broiler birds were found dull, depressed, off feed with high mortalities. Postmortem examinations revealed typical balloon like appearance of pericardial sac with straw colored fluid, which is the typical sign of the disease. Anjum et al., (1989) & Shivachandra et al., (2003) also found similar signs, symptoms and postmortem lesions in broilers which were infected with 83

Chapter 4 Discussion

Hydropericardium syndrome. Presence of the fowl adenovirus was supported by scanning electron microscopy as negatively stained viral particles revealed typical icosahedral capsids of the virus. The diameter of each capsid was estimated to 70 – 80 nm. Laver et al., (1971) also found capsids of same shape and size of Chicken Embryo Lethal Orphan (CELO) Virus, which is an avian adenovirus. The background of the photograph has small white particles which likely represent the group of hexons from disrupted viral particles as previously found by Hong et al., (2005). McFerran (1998) suggested that due to the characteristic morphology, adenovirus infection can be diagnosed easily by Electron microscopy.

DNA based confirmation of the virus was achieved by the PCR amplification of a 730 bp fragment from the hexon gene using FAVHL (forward primer) and FAVHR (reverse primer). Ganesh et al., (2001) also detected Fowl adenovirus 1 type 4 by PCR amplification of same region of Hexon gene. Nucleotide sequence of the PCR product revealed that the nucleotide sequence of our isolate has 99% identity with several Indian isolates (Haryana, Hemachal Perdesh, Izetnagar; accession no. EU847626.1, FN394664.1, AY581275.1) of FAdV-4, while 98% identity was found with a Pakistani FAdV-4 isolate (accession no. DQ264728.1). The identity values with a German psittacine adenovirus (accession no. EF442329.1) and FAdV-1 (CELO) (accession no. DM380829.1) were found to be 65% and 70% respectively. Multiple sequence alignment (MSA) of the 730 bp variable region of the hexon gene with the corresponding gene fragment from other adenovirus revealed that this region of human adenovirus serotype 45 contains 847 bp, and thus is longer than the corresponding part of other mastadenoviruses (equine or bovine). The results obtained are in line with the findings of Harrach et al. (2011) who found that, adenoviruses which infect the birds are classified into three genera including Atadenovirus, Mastadenovirus and Aviadenovirus. It was also found that the L1 – P1 region of the hexon gene is hypervariable in the middle both; the ends are more conserved thus being suitable for PCR primer design. 4.2. Phylogenetic Analysis Phylogenetic analysis helped to examine the diversity within particular viral groups. In the past phylogenetic groups were determined by PCR amplification followed by denaturing gradient gel electrophoresis (Fuller et al., 1998) and random amplified polymorphic DNA (Berg et al., 1994), 84

Chapter 4 Discussion

these were very complex and time consuming techniques. However, due to the extreme variability among viruses, there is no universal target sequence for viruses available comparable to the rRNA genes used for classification of all other living organisms. In this study phylogenetic analysis was done by targeting variable region (730bp) of Hexon gene as described by Ganesh et al., (2001). The results of phylogenetic analysis revealed close relation with regional (Indian and Pakistani) FAdV-4 isolates. The high levels of nucleotide sequence similarity between isolates indicate that isolates of FAdV-4 in India and Pakistan had a common ancestor, which can be differentiated from other FAdV isolates of Canada, Belgium and Germany. Similarly, Meulemans et al., (2004) and Masaji et al., (2009) suggested that FAdV-4 isolates in Japan were identical but they were different from the isolates of India and Pakistan. Hence studies have confirmed that isolated virus belongs to FAdV-4 and its DNA can be used for amplification of various viral genes i.e. 100K, Penton base and Short fiber to develop expression constructs. 4.3. Development of expression constructs

A gene can be defined as the unit of heredity in an organism, that expresses itself in the form of protein and it plays its role. The study described in this section was designed to investigate the possible roles of individual genes encoded by fowl adenovirus in the immunity against the disease. Three distinct proteins of the virus including two structural proteins (Penton base & Short fiber) and one non structural protein (100K) were selected for evaluation of their antigenic characteristics. Antigens are Bacterial/ viral proteins against which the host immune system reacts and antibodies are developed.

Since last few decades the proteins are thought to be essential for treatment and control of diseases. Earlier the proteins were conventionally extracted from natural resources and used in medicine, research and industry. The proteins obtained in this way rarely met the need; Moreover it has certain risks and difficulties (Ma et al., 2003). Biotechnological approaches are considered to the only solution to meet the demand of pure and functional proteins (Sorensen and Mortensen, 2005). Recombinant DNA technology has offered alternative system to express foreign genes in bacteria (Maeda et al., 1980), yeast (Venkat et al., 2003) and baculo virus (Maeda et al., 1985) to fulfill the requirements as well as production upscale and efficacy

Chapter 4 Discussion

(Gasdaska, 2003). Foreign gene expression in prokaryotic system (E. coli) is a technology which has various applications for diagnostics, vaccines and therapeutics. E. coli has been considered as the ‘factory of choice’ for expression of many proteins because this organism has been fully characterized, easy to handle, grow rapidly, requires an inexpensive and easy to prepare medium for growth (Maeda et al., 1980). Recombinant DNA technology is convenient, safe and easy to handle as compared to conventional microbiological techniques like procedures for virus isolation and cell culture techniques because handling of genetic material of the pathogenic organism is considered to be safe rather than live pathogenic organism. More over there is no risk of a reversion to virulence, as in case of attenuated vaccines and there is no need to propagate virulent viruses, as in case of inactivated vaccines (Pitcovski et al., 2005). While in case of Hydropericardium syndrome, there is another benefit, as no need to infect and kill thousands of broilers for the purpose of collecting their livers as a source of virus.

Considering the aforementioned reasons E. coli as prokaryotic system was used to express the genes encoding viral proteins. pET expression vector was used to express these genes, which is under control of T7 promoter and it has Kanamycin resistant gene as selectable marker. The vector has His tag and thrombin site at 5’ prime end of inserted gene to facilitate the detection and purification of these recombinant proteins. Two structural protein genes (Penton base and Short fiber) were selected for cloning in expression vector. These proteins were selected because previously Balamurugan et al., (2002) and Kumar and Chandra (2004) studied the protein profiles of the virus and they found eight to twelve protein fractions of FAdV-4 isolates, out of these protein fractions Penton base and fiber were found among highly immuno- reactive fractions during western blotting against FAdV-4 serum. One non structural protein (NSP) gene (100K) was selected for cloning because Hong et al., (2005) described that this protein may have some role in intracellular transport & folding of viral proteins during viral replication.

Full length coding sequences of penton base, short fiber and 100K genes (Fig 3.10, 3.11 and 3.12) were sequenced and amino acid sequences were deduced using EXpasy program. The results indicate that sequence of constructs belong to fowl adenovirus – 4 which is prevalent in

Chapter 4 Discussion

Pakistan and India. Therefore these are suitable to develop recombinant subunit vaccine candidates. Prokaryotic expression of viral genes representing short fiber (1437bp), penton base (1587bp) and 100K (2397bp) yielded 60Kda, 65Kda and 95Kda recombinant proteins which were tagged with Histidine residues and thrombin site at N terminal. All three recombinant proteins were highly expressed in the form of inclusion bodies (Fig 3.13, 3.14 and 3.15). Conditions were optimized to purify the recombinant proteins having six histidine residues at the N terminal. Efforts were made to purify the recombinant proteins under native/ denaturing conditions using nickle affinity chromatography. It was found that after lysis of E. coli cells, recombinant proteins were present in both soluble form and insoluble precipitate of cell lysate. However the precipitated fraction was solubilized in 8M Urea and the histidine residues were exposed for efficient binding of the nickle affinity column. By combining denaturation, affinity purification based on histidine residues and renaturation processes, methods were optimized for the purification of each recombinant protein. Recombinant penton base and short fiber proteins were successfully purified under native conditions as Sorensen and Mortensen (2005) found that the proteins expressed in soluble form are functional. Recombinant 100K protein was successfully purified under denaturing conditions. Purified fractions of the recombinant proteins yielded the required protein bands having approximate sizes of 60Kda, 65Kda and 95Kda representing short fiber, penton base and 100K respectively (Fig 3.19, 3.20 and 3.21). These protein fractions were used to investigate their immunogenicity in broilers.

4.4. Evaluation of recombinant proteins

Serum samples of broilers immunized by the various recombinant proteins and commercial vaccine were analyzed by indirect ELISA for quantification of serum antibodies. A strong immune response against recombinant proteins was detected as the antibody titers are at base line prior to immunization (0 day), while at 28th days post immunization antibody titers are at peak level. During whole experiment the antibody titers of the negative control remained at basal level (Fig 3.22).

During challenge protection test recombinant penton base conferred maximum protection against pathogenic FAdV-4 challenge followed by short fiber and inactivated vaccine. The 87

Chapter 4 Discussion

recombinant 100K protein was found least effective against pathogenic challenge as it is a non structural protein (Hong et al., 2005). So it was suggested that in-spite of having an important role in intracellular transport & folding of viral capsid protein during viral replication, 100K protein is not exposed on the surface of the virus at any stage. Being structural proteins penton base and short fiber are more immunoreactive (Balamurugan et al., 2002 and Kumar & Chandra 2004) as they interact with the cell receptors during penetration of virus into the cell (Fingerut et al., 2003) so they were found as highly immuno-reactive against pathogenic virus. Birds of positive control were evident of high mortality (9/10) because they were not immunized prior to challenge. The birds of negative control were remained healthy because they were not challenged. Dead birds were examined and postmortem examinations were conducted which were evident of typical signs, symptoms & postmortem lesions of the disease as described by Anjum et al., (1989). Lesion score was determined by giving score according to accumulation of fluid in pericardial sac. Lesions comprised of congestion and edema in lungs, swollen friable enlarged liver and pale kidneys. Same lesions were also reported by other researchers (Ganesh et al., 2002a, Mansoor et al., 2011, Ahmad et al., 2011).

Recombinant DNA technology has advantages over other approaches in development of safe vaccines that can induce a strong active immunity to protect broilers from adenovirus infection (Balamurugan and Kataria, 2004). Khan et al., (2005) suggested that modern practices of recombinant DNA technology should be adapted to meet the need of present era for diagnosis and prevention of Hydropericardium syndrome. Effectiveness of subunit vaccines against Infectious bursal disease (IBD) virus in chicken (Pitcovski et al., 2003), Egg drop syndrome (EDS) virus in chicken (Fingerut et al., 2003), Hemorrhagic enteritis virus (HEV) in turkeys (Pitcovski et al., 2005) and hepatitis B virus in humans (McAleer et al., 1984) have been proven. Pitcovski et al., (2005) also suggested that concept of subunit vaccines may be useful to develop vaccines against adenoviruses. Subunit vaccines are safe as compared with inactivated or attenuated vaccines because there is no need to propagate virulent viruses and there is no risk of reversion to virulence. Currently the vaccines available against Hydropericardium syndrome are inactivated vaccines (Anjum, 1990) or attenuated vaccines (Mansoor et al., 2011). Incomplete attenuation or inactivation and the oncogenic potential/ genetic instability of the adenoviruses 88

Chapter 4 Discussion

have prevented their use in routine vaccines. A subunit vaccine has the advantage that it eliminate the danger of disease outbreak caused by incomplete inactivation or attenuation (Fingerut et al., 2003).

Natural recombination is recognized as a driving force for the evolutionary process of not only Adenovirus (DNA virus) but also for other viruses. In-fact RNA viruses have the ability to evolve rapidly due to high mutation rate. Among AdVs recombination occurs between strains of the same species (Lukashev et al., 2008). Viral genome has variable and conserved region, among variable regions hexon has recombination hot spot. It was found that hexon has eight conserved domains and seven hyper-variable regions (Philipson & Pettersson, 2004, Robinson et al., 2011). Scientists have suggested that recombination events may lead to genetic recombination of the neutralization epitope which may results in immune escape and increase in number of outbreaks in future. For viral identification it was recommended to characterize not only (variable) hexon gene, but also penton base and fiber genes (Matsushima et al., 2011). On the basis of these studies we have selected penton base and short fiber proteins to avoid hypervariable regions that might lead to rapid immune escape.

The results of this study have shown that all three proteins encoded by fowl adenovirus have, to some extent, the capacity to affect immune response. However it is evident that the major role in immune response against the disease was observed against penton base and short fiber. These proteins are structural proteins of fowl adenovirus and they are important parts of the viral capsid. While 100K is one of the important non structural protein (NSP) of the virus and it is a potential candidate to develop NSP ELISA against FAdV. In a previous study it was found that Non-structural protein (100K and 33K) based enzyme linked immunosorbent assays (ELISAs) can differentiate FAdVs infected and vaccinated chickens, because antibodies specific to the 100K and 33K proteins were detected in chickens experimentally infected with FAdVs, but not in chickens vaccinated with inactivated FAdVs (Xie et al., 2013).

Chapter 4 Discussion

Further studies are required to determine whether immunizing the chickens with two/ more proteins simultaneously will be more successful then the single protein approach. More over field trials are needed to determine minimum effective dose of recombinant protein that can confer protection against the disease.

In summary, molecular characterization of FAdV-4 isolates revealed that these isolates were identical to each other but they were considerably different from isolates of other countries like Belgium and Canada. It was also determined that Pakistani isolates had nearest phylogenetic relationship with Indian. From this study, it was also concluded that prokaryotic expression of penton base gene (1587bp) yielded 65Kda recombinant protein tagged with Histidine residues and thrombin site at N terminal. The recombinant protein was found immuno-reactive and conferred good protection (90%) against pathogenic FAdV-4 challenge. So Penton base recombinant protein of FAdV-4 has the potential to be used as subunit vaccine candidate against HPS as it elicited higher antibody response in chicken and conferred higher protection as compared to other types of protein/vaccine.

Chapter 5 References

References

Abdul-Aziz, T. A., and Al-Attar, M. A., (1991). New syndrome in Iraqi chicks. The Veterinary Record, 129 (12): 272.

Abdul-Aziz, T. A., and Hassan, S. Y., (1995). Hydropericardium syndrome in broiler chickens: its contagious nature and pathology. Research in Veterinary Science, 59: 219-221.

Abe, T., Nakamura, K., Tojo, H., Mase, M., Shibahara, T., Yamaguchi, S., and Yuasa, N., (1998). Histology, immunohistochemistry and ultra structure of hydropericardium syndrome in adult broiler breeders and broiler chicks. Avian Diseases, 42: 606-612.

Abidi, M.H., (1988). Hydropericardium syndrome in the eyes of a poultry farmer. Proc. Natl. Seminar on Hydropericardium syndrome. Poultry Development Centre, PRI, Rawalpindi, Pakistan. pp 5 – 7.

Afzal, M. and Ahmad, I., (1990). Efficacy of an inactivated vaccine against hydropericardium syndrome in broilers. The Veterinary Record, 126: 59-60.

Afzal, M., Muneer, R. Stein, G., and Cowen, B. S., (1990). Etiology and control of hydropericardium syndrome in broilers of Pakistan. In: Proceedings of 3 rd International Veterinary Congress, Islamabad, Pakistan 218-228.

Afzal, M., and Hussain, A., (1993). Age susceptibility of different commercial broiler strains to Angara disease (hydropericardium syndrome). Pakistan Journal of Agricultural Research, 14: 387-392.

Afzal, M., Muneer, R., Stein, G., (1991). Studies on the etiology of hydropericardium syndrome (Angara disease) in broilers. The Veterinary Record, 128: 591-593.

Ahmad, I., Afzal, M., Malik, M. I., Hussain, Z. and Hanif, W. (1989). Studies on the disease pattern and etiology of hydropericardium syndrome (Angara disease) in broiler chickens in Pakistan. Pakistan Journal of Agricultural Research, 10: 195- 199.

Ahmad, I., Malik, M. I., Iqbal, K., Ahmad, K., and Naz, S., (1990). Efficacy of formalized liver organ vaccine against Angara disease in broilers. Veterinarski Arkhiv, 60: 131-138.

Ahmad, K. and Hasan, S., (2004). The efficacy of experimental Angara disease vaccines. Pakistan Veterinary Journal, 24: 101-103.

Ahmad, M.D., Zaman, S., Mushtaq, M.H., Anjum, A.A. and Akram, M. (2011). Comparative pathogenicity of liver homogenate and cell culture propagated Hydropericardium syndrome virus in broiler birds. Pakistan Veterinary Journal, 31(4):321-326.

Chapter 5 References

Akhtar, S., and Cheema, A. H., (1990). Some epidemiological characteristics of hydropericardium syndrome outbreaks among commercial broiler flocks in Karachi. In: Proceedings of 3 rd International Veterinary Congress, Islamabad, Pakistan, 228-234.

Akhtar, S., (1992). Studies on the rate of lateral spread of hydropericardium syndrome agent(s). In: Etiology, Pathogenesis and Control of Hydropericardium Syndrome in Poultry, (Board on Science and Technology for International Development (BOSTID), Washington, DC.

Akhtar, S., Zahid, S., and Khan, M. I., (1992). Risk factors associated with hydropericardium syndrome in broiler flocks. The Veterinary Record, 131: 481- 484.

Akhtar, S., (1994). Hydropericardium syndrome in broiler chickens in Pakistan. World’s Poultry Science Journal, 50: 177-182.

Akhtar, S., (1995). Lateral spread of the etiological agent(s) of hydropericardium syndrome in broiler chickens. The Veterinary Record, 136: 118-120.

Akhtar, M., Ahmad, R., Hayat, C. S., Hussain, I., and Ashfaque, M., (2000). Comparative immune response of formalin inactivated and binary ethyleneimine inactivated Angara disease vaccines. Pakistan Journal of Biological Sciences, 3: 1313-1314.

Anjum, A. D., (1988). Study of pathogenicity of the hydropericardium syndrome agent. In: Proceedings of the National Seminar on Hydropericardium Syndrome in Chicken in Pakistan, Rawalpindi, 111-115.

Anjum, A. D., (1990). Experimental transmission of hydropericardium syndrome and protection against it in commercial broiler chickens. Avian Pathology, 19: 655- 660.

Anjum, A. D., Sabri, M. A. and Iqbal, Z., (1989). Hydropericardium syndrome in broiler chickens in Pakistan. The Veterinary Record, 124: 247-248.

Asrani, R. K., Gupta, B. K., Sharma, S. K., Singh, S. P., Katoch, R. C., (1997). Hydropericardium hepatopathy syndrome in Asian poultry. The Veterinary Record, 141: 271-273.

Balamurugan, V., (1999). Characterization of fowl adenovirus serotype 4 associated with hydropericardium syndrome in chicken and evaluation of serological techniques for detection of virus, MVSc Thesis, Deemed University, IVRI, Izatnagar, India.

Balamurugan, V., Kataria, J. M., Kataria, R. S., Verma, K. C., and Nanthakumar, T., (2002). Characterization of fowl adenovirus 4 associated with hydropericardium syndrome in chicken. Comparative Immunology, Microbiology and Infectious Diseases, 25: 139-147.

Chapter 5 References

Balamurugan, V., Kataria, J. M., Tiwari, A. K., Ver ma, K. C., Toroghi, R., and Jadhao, S. J., (2001). Development of sandwich ELISA for the detection of fowl adenovirus 4 associated with hydropericardium syndrome in experimentally infected chickens. Acta Virologica, 45: 95-100.

Balamurugan, V., and Kataria, J. M., (2004). The hydropericardium syndrome in poultry: a current scenario. Veterinary Research Communications, 28: 127-148.

Balamurugan, V., and Kataria, J. M., (2006). Economically important non-oncogenic immunosuppressive diseases of chicken – current status. Veterinary Research Communications, 30(5): 541-566.

Berg, D.E., Akopyants, N.S. and Kersulyte, D. (1994). Fingerprinting microbial genomes using the PAPD or AP-PCR method. Methods Mol. Cell Biol. 5: 13-24.

Bergmann, V., K. Muller Molenar and H. Birnbaum (1999). Occurrence of Hydropericardium ascities syndrome (oedema disease) in broiler flocks. Monatshefte-fur-veterinarmedizin, 34(16):626-628.

Bhatti, B. M., Qureshi, M. S., and Bajwa, T. M., (1989). Hematology and clinical chemistry values in broiler chicken affected with hydropericardium syndrome prevalent in Pakistan. Veterinarski Arkhive , 50: 107-111.

Borisov, V. V., Borisov, A. V., and Gusev, A. A., (1997). Hydropericardium syndrome in chicken in Russia. In: Proceedings of the Tenth International Congress of World Veterinary Poultry Association, Budapest, Hungary, 258.

Bradford, M. (1976). A rapid and sensitive method for quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72: 258 – 254.

Breitbart, M. and Rohwer, F. (2005) Here a virus, there a virus, everywhere the same virus? Trends in Microbiol. 13, 278-284.

Burnett, R. M. (1985). The structure of the adenovirus capsid. II. The packing symmetry of hexon and its implications for viral architecture. J. Mol. Biol. 185, 125–143.

Chandra, R., Shukla, S. K., Kumar, M., and Garg, S. K., (1997). Electron microscopic demonstration of an adenovirus in the hepatocytes of birds experimentally infected with hydropericardium syndrome. The Veterinary Record, 140: 70-71.

Chandra, R., Shukla, S. K. and Kumar, R., (2000). The hydropericardium syndrome and inclusion body hepatitis in domestic fowl. Trop. Anim. Hlth. Prod., 32:99-111.

Cheema, A. H., Ahmad, J. and Afzal, M., (1989). An adenovirus infection of poultry in Pakistan. Revue Scientifique et Technique de l’ Office International des Epizooties, 8: 789-795.

Chapter 5 References

Chishti, M. A., Afzal, M., and Cheema, A. H., (1989). Preliminary studies of the development of vaccine against the hydropericardium syndrome. Revue Scientifique et Technique de l’Office International des Epizooties, 8: 797-801.

Christensen, N. H., and Saifuddin, M., (1989). A primary epidemic of inclusion body hepatitis in broiler. Avian Diseases, 33: 622-630.

Cohen, S. N., Chang, A. C. Y. and Hsu, L. (1972). Non chromosomal antibiotic resistance in bacteria: genetic transformation of E. coli by R factor DNA. Proc. Natl. Acad. Sci. USA. 69, 2110-2114.

Cowen, B. S., (1992). Inclusion body hepatitis anemia and hydropericardium syndromes: aetiology and control. World’s Poultry Science Journal, 48: 247-254.

Cowen, B. S., and Naqi, S. A., (1982). Classification of avian adenoviruses. Journal of American Veterinary Medicine Association, 181: 283.

Cowen, B. S., Lu, H., Weinstock, D., and Castro, A. E., (1996). Pathogenicity studies of fowl adenoviruses isolated in several regions of world. In: Proceedings of International Symposium on Adenovirus and Reovirus Infections in Poultry, Rauischholzhauzen, Germany, 79-88.

Cowen, B. S., Lu, H., Weinstock, D., Castro, A. E., (1997). A report on the characterization of fowl adenoviruses associated with hydropericardium hepatitis syndrome in chickens. In: Proceedings of XV Congreso Latinoamericano de Avicultura, Mexico, 68-69.

Dahiya, S., Srivastava, R. N., Hess, M., and Gulati, B. R., (2002). Fowl adenovirus serotype 4 associated with outbreaks of infectious hydropericardium in Haryana, India. Avian Diseases, 46: 230-233.

Davison AJ, Benko M, Harrach B (2003). Genetic content and evolution of adenoviruses. J. Gen. Virol., 84 (11): 2895- 2908.

Deepak, J. N., (1998). Studies on pathogenicity and immunosuppressive effects of fowl adenovirus serotype 4 isolated from hydropericardium syndrome in chicken, MVSc Thesis, Deemed University, IVRI, Izatnagar, India.

Domermuth, C. H., Weston, C. R., Cowen, B. S., Colwell, W. M., Gross, W. B., and DuBose, R. T., (1980). Incidence and distribution of avian adenovirus group II splenomegaly of chickens. Avian Diseases, 24: 591-594.

Erny, K. M., Barr, D. A., and Fahey, K. J., (1991). Molecular characterization of highly virulent fowl adenoviruses associated with outbreaks of inclusion body hepatitis. Avian Pathology, 20: 597-606.

Chapter 5 References

Fadly, A. M., and Winterfield, R. W., (1973). Isolation and some characteristics of an agent associated with inclusion body hepatitis, hemorrhages and aplastic anemia in chickens. Avian Diseases, 17: 182-193.

Fauquet, C. M., Mayo, M. A., Maniloff, J., Desselberger, U. & Ball, L. A. (2005). Virus Taxonomy: Seventh Report of the International Committee of Viruses. San Diego: Academic Press.

Fender, P., Boussaid, A., Mezin, P. & Chroboczek, J. (2005). Synthesis, cellular localization, and quantification of pentondodecahedron in serotype 3 adenovirus-infected cells. Virology, 340: 167–173.

Fingerut, E., Gutter, B., Gallili, G., Michael A., & Pitcovski, J. (2003). A subunit vaccine against the adenovirus egg-drop syndrome using part of its fiber protein. Vaccine, 21: 2761-2766.

Fuller NJ, Wilson WH, Joint IR, Mann NH (1998). Occurrence of a sequence in marine cyanophages similar to that of T4 g20 and its application to PCR-based detection and quantification techniques. Appl. Environ. Microbiol. 64:2051-2060.

Ganesh, K., (1998). Molecular studies on hexon gene fragment of fowl adenovirus associated with hydropericardium hepatitis syndrome. Ph.D. thesis, University of Agricultural sciences, Banglore, India.

Ganesh K, Suryanarayana V, Raghavan R, Gowda S (2001). Nucleotide sequence of L1 and part of P1 of hexon gene of fowl adenovirus associated with hydropericardium syndrome differs with the corresponding region of other fowl adenoviruses. Vet. Microbiol., 78:1– 11.

Ganesh, K., Raghvan, R., Gowda, R. N. S., Satyanarayana, M. L., and Suryanarayana, V. V. S., (2002a). Purification and characterization of the etiological agent of hydropericardium hepatitis syndrome from infected liver tissues of broiler chickens. Tropical Animal Health and production, 34: 7-17.

Ganesh, K., Suryanarayana, V. V. S., and Raghaven, R., (2002b). Detection of fowl adenovirus associated with hydropericardium hepatitis syndrome by polymerase chain reaction. Veterinary Research Communications, 26: 73-80.

Gasdaska, J. R., Spencer, D. and Dickey, L. (2003). Advantages of Therapeutic protein production in the aquatic plant Lemna. Bio Processing Journal. 3: 50-56.

Gowda, R. N. S., (1994). Leechi disease (hydropericardium syndrome), a mysterious and an emerging threat to poultry industry in India. Poultry Advisor, 27: 53-61.

Gowda, R. N. S., and Satyanarayana, M. L., (1994). Hydropericardium syndrome in poultry. Indian Journal of Veterinary Pathology, 18: 159-161.

Chapter 5 References

Grimes, T. M., (1992). Cause and control of a peracute form of inclusion body hepatitis. In: Proceedings of 40 th Western Poultry Disease Conference, Sacramento, CA, 42-43.

Hafez, H.M., (2011). Avian adenoviruses infection with special attention to Inclusion body hepatitis/ Hydropericardium syndrome and Egg drop syndrome. Pak. Vet. J., 31(2):85-92.

Harrach B, Benkı M, Both GW, Brown M, Davison AJ, Echavarría M, Hess M, Jones MS, Kajon A, Lehmkuhl HD, Mautner V, Mittal SK, Wadell G (2011). Family Adenoviridae. King AMQ, Adams MJ, Carstens EB, Lefkowitz EJ (eds) Virus Taxonomy: Classification and Nomenclature of Viruses. 9th report of the International Committee on Taxonomy of Viruses. Elsevier, San Diego pp. 95-111.

Henning, P., Lundgren, E., Carlsson, M., Frykholm, K., Johannisson, J., Magnusson, M. K., Tang, E., Franqueville, L., Hong, S. S. & other authors (2006). Adenovirus type 5 fiber knob domain has a critical role in fiber protein synthesis and encapsidation. J Gen Virol. 87: 3151–3160.

Hong, S. S., Habib, N. A., Franqueville, L., Jensen, S. & Boulanger, P. A. (2003). Identification of adenovirus (Ad) penton base neutralizing epitopes by use of sera from patients who had received conditionally replicative Ad (Addl1520) for treatment of liver tumors. J. Virol. 77: 10366–10375.

Hong SS, Szolajska E, Schoehn G, Franqueville L, Myhre S, Lindholm L, Ruigrok RW, Boulanger P, Chroboczek J (2005). The 100Kchaperone protein from Adenovirus serotype 2 (Subgroup C) assists in trimerization and nuclear localization of Hexons from Subgroups C and B Adenoviruses. J. Mol. Biol., 352: 125 – 138.

Hassan, N. U., Afzal, M., Hameed, A. and Khan, A. R., (1994). Immune response to inactivated hydropericardium syndrome vaccine in broilers. Pakistan Veterinary Journal, 14: 5-10.

Hassan, S. A., (1989). Pakistan is mystified by hydropericardium syndrome. Poultry Misset, 5: 35-37.

Hess, M., Alain, C., Rob, W.H.R., Jadwiga, C. and Bernard, J. (1995). The Avian adenovirus Penton: two fibers and one base. J. Mol. Biol. 252: 379-385.

Hess, M., Raue, R., and Prusas, C., (1999). Epidemiological studies on fowl adenoviruses isolated from cases of infectious hydropericardium. Avian Pathology, 28: 433-439.

Hess, M., (2000). Detection and differentiation of avian adenoviruses: a review. Avian Pathology, 29: 195-206.

Hussain, I., Aujum, A. A. and Khan, I. U. H., (1996). An oil emulsion vaccine against hydropericardium syndrome in broiler chickens. Pakistan Veterinary Journal, 16: 125- 127.

Chapter 5 References

Hussain, I., Munir, R., Akhtar, M. and Ahmad, R., (1999). Evaluation and comparison of hydropericardium syndrome vaccines in broiler chicks. Pakistan Veterinary Journal, 19: 88-90.

Icochea, E., Alba, M., Fiory, L., and Ramirez, A., (2001). Efficacia de tres vacunas inactivades contra la hepatitis a corpusculos de inclusion y syndrome de hidropericardio en el Peru. Revue Scientifique et Technique de Office International des Epizooties, 115: 1025-1030.

Iqbal, M. J., Bhatti, B. M. and Khan, K. M., (1994). Studies on serum enzymes in hydropericardium syndrome (Angara disease) of broilers. Pakistan Veterinary Journal, 14: 83-85.

Izhar-ul-Haq, Hussain, I. and Anjum, A. A., (1997). Polypeptides and nucleic acid identification of hydropericardium syndrome agent. Pakistan Veterinary Journal, 17:21-23.

Jadhao, S. J., Kataria, J. M., Verma, K. C., and Shah, R. L., (1997). Serotyping of Indian isolates of fowl adenovirus recovered from inclusion body hepatitis hydropericardium syndrome (Litchi disease) in chickens. Indian Journal of Comparative Microbiology, Immunology and Infectious Diseases, 18: 33-37.

Jadhao, S. J., (1998). Molecular characterization of FAdV associated with inclusion body hepatitis-hydropericardium syndrome in chicken. Ph.D. Thesis, Deemed University, IVRI, Izatnagar, India.

Jaffery, M. S., (1988). A treatise on Angara disease (hydropericardium-pulmonary oedema- hepatonephritis syndrome). Journal of the Pakistan Veterinary Medical Association, 34: 1-33.

Javed, T., Khan, M. A., and Khan, A. G., (1994). Epidemiological investigation and economic losses due to hydropericardium syndrome in layer and parent flocks in Lahore district. In: Proceedings of the 8 th International Congress on Animal Hygiene, Saint Paul, Minnesota, USA, 516-519.

Jucker MT., McQuiston JR., van den Hurk JV., Boyle SM., Pierson FW., (1996). Characterization of the haemorrhagic enteritis virus genome and the sequence of the putative penton base and core protein genes. J. Gen. Virol. 77(3):469–79.

Karunamoorthy, G., and Manickam, R., (1998). Hydropericardium syndrome in quails. Poultry Times of India, 2: 1-3.

Kataria, J. M., Shah, R. L., Verma, K. C., and Bansal, M. P., (1995). Studies on inclusion body hepatitis in chickens. In: Proceedings of the National Symposium on the Impact of Disease on Livestock/Poultry Production and Wildlife Conservation, Bhubaneswar, Indian Association of Veterinary Pathologists, pp: 75.

Chapter 5 References

Kataria, J. M., Verma, K. C., Jadhao, S. J., and Shah, R. L., (1996). Studies on virus isolated from cases of inclusion body hepatitis in chickens. In: Proceedings of the 17th Annual Conference of the Indian Association of Veterinary Microbiologists, Immunologists and Specialists in Infectious Diseases, Bhubaneswar, pp: 24.

Kataria, J. M., Verma, K. C., Shah, R. L., and Jadhao, S. J., (1997a). Experimental studies with fowl adenovirus serotype 4 isolated from cases of IBH-HPS in chicks. In: Proceedings of the 18 th Conference of Indian Association of Veterinary Microbiologists, Immunologists and Specialists in Infectious Diseases, Ludhiana, Pp: 69.

Kataria, J. M., Verma, K. C., Jadhao, S. J., Deepak, J. N., and Shah, R. L., (1997b). Efficacy of an inactivated oil emulsified vaccine against inclusion body hepatitishydropericardium syndrome (litchi disease) in chicken prepared from cell culture propagated fowl adenovirus. Indian Journal of Comparative Microbiology, Immunology and Infectious Diseases, 18: 38-42.

Kawamura, H., Shimizu, F., and Tsubahara, H., (1964). Avian adenovirus: its properties and serological classification. National Institute of Animal Health Q (Tokyo), 4: 183-193.

Khan, S. A., Zaidi, F. H., Chaudhry, R. A., Ashraf, S. K., Mian, M. S., and Qureshi, I. R., (1995). Comparative study on pathology of haemic system of three broiler chicken strains suffering from experimental hydropericardium syndrome. Asian- Australian Journal of Animal Science, 8: 325-328.

Khan, A. A., Sabri, A. N., Mansoor, M. K., and Hussain, I., (2005). Hydropericardium syndrome in Pakistan: a review. World’s Poultry Science Journal, 61: 647-653.

Khawaja, D. A., Ahmad, S., Rauf, M. A., Zulfiqar, M. Z., Mahmood, S. M. I. and Hassan M., (1988a). Isolation of an adenovirus from hydropericardium syndrome in broiler chicks. Pakistan Journal of Veterinary Research, 1: 2-17.

Khawaja, D. A., Sattar, A., Anwar, M. A., Hassan, M., and Ahmad, S., (1988b). A report on cross protection of IBD vaccine strain D78 against adenovirus isolated from hydropericardium syndrome in broiler chicks. Pakistan Journal of Veterinary Research, 1: 51-52.

Khushi, M., Chaudry, H. M., and Vanmarcke, J., (1996). Efficacy trial with an inactivated oil adjuvant vaccine against hydropericardium syndrome. In:Proceedings of the XXth World’s Poultry Congress, New Delhi, pp: 347.

Kumar, R., Chandra, R., Shukla, S. K., Agrawal, D. K., and Kumar, M., (1997). Hydropericardium syndrome in India: a preliminary study on the causative agent and control of the disease by inactivated autogenous vaccine. Tropical Animal Health and Production, 29: 158-164.

Chapter 5 References

Kumar, R., Chandra, R., and Shukla, S. K., (2003). Isolation of etiological agent of hydropericardium syndrome in chicken embryo liver cell culture and its serological characterization. Indian Journal of Experimental Biology, 41: 821-826.

Kumar, R., and Chandra, R., (2004). Studies on structural and immunogenic polypeptides of hydropericardium syndrome virus by SDS-PAGE and western blotting. Comparative Immunology, Microbiology and Infectious Disease, 27(3):155-161.

Laemmli UK. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227(259):680–5.

Laver WG, Younghusband HB, Wrigley NG (1971). Purification and properties of chick embryo lethal orphan virus (an avian adenovirus). Virology, 45: 598–614.

Lukashev A. N., Ivanova O. E., Eremeeva T. P., Iggo R. D. (2008). Evidence of frequent recombination among human adenoviruses. J Gen Virol. 89: 380–388.

Luria, S. E., Darnell, J. E. J., Baltimore, D. and Cambell, A. (1978). General Virology, pp: 1-7 John Willey and Sons.

Ma. J.K.C., Drake, P.M.W and Christon, P. (2003). The production of recombinant pharmaceutical proteins in plants. Nature reviews. 4:794-805.

Maeda, S., McCandliss, R., Gross, M., Sloma, A., Familletti, P. C., Tabor, J. M., Evinger, M., Levy, W. P., Pestka, S. (1980). Construction and identification of bacterial plasmids containing nucleotide sequence for human leukocyte interferon. Proc. natn. Acad. Sci. U.S.A. 77, 7010−7013.

Maeda, S., Kawai, T., Obinata, M., Fujiwara, H., Horiuchi, T., Sacki, Y., Sato, Y. and Furusawa, M. (1985). Production of human alpha interferon in silk worm using baculovirus vector. Nature. 13: 592-94.

Mahmood, F., Shahid, R. U., Khan, M. Z. Khan, A., and Khan, H. A., (1995). Serum protein fractions in broiler chicks affected with hydropericardium syndrome. Pakistan Veterinary Journal, 15: 9-11.

Mahmood, T. and Hassan, Z., (1995). Propagation of Angara disease virus in duck’s embryonated eggs. Pakistan Journal of Livestock and Poultry, 1: 104-105.

Mahmood, M. D., Khushi, M., Masood, R., Atif, H. and Irshad, H., (2011). In process quality control factors affecting efficacy of Hydropericardium syndrome virus vaccine. Pak. J. Zool. 43(1): 73-77.

Mansoor, M.K., I. Hussain, M. Arshad and G. Muhammad, (2011). Preparation and evaluation of chicken embryo-adapted fowl adenovirus serotype 4 vaccine in broiler chickens. Trop. Anim. Health. Prod., 43:331-338.

Chapter 5 References

Manzoor, R., Asim, M., Manzoor, S., and Muneer, M A., (2003). Efficacy of angavac oil based hydropericardium syndrome vaccine against HPS in broilers. Pakistan Journal of Scientific Research, 55: 76-80.

Manzoor, S., and Hussain, I., (2003). Reverse passive haemagglutination (RPHA) test for the detection and quantification of hydropericardium syndrome virus. Pakistan Journal of Life and Social Sciences , 1: 141-143.

Masaji M, Masaki C, Toshikazu I, Kikuyasu N, Shigeo Y, Tadao I (2009). Genetic Characterization of Fowl Adenoviruses Isolated from Chickens with Hydropericardium Syndrome in Japan. J. Vet. Med. Sci., 71(11): 1455–1458.

Masaji Mase, Kikuyasu N, Tadao I. (2010). Characterization of fowl adenovirus serotype 4 isolated from chicken with hydropericardium syndrome based on analysis of the short fiber protein gene. J. Vet. Diagn. Invest. 22: 218-223.

Matsushima Yuki, Hideaki Shimizu, Tung Gia Phan and Hiroshi Ushijima. (2011). Genomic characterization of a novel human adenovirus type 31 recombinant in the hexon gene. J Gen Virol. 92 (12): 2770 – 2775.

Merck Sharp, and Dohme Corp., (2011). Inclusion Body Hepatitis/hydropericardium Syndrome: Introduction. The Merck veterinary manual, 10th Ed. A subsidiary of Merck & Co., Inc. Whitehouse Station, NJ. USA. (http://www.merckvetmanual.com/mvm/index.jsp?cfile=htm/bc/200400.htm)

Meulemans G, Couvreur B, Decaesstecker M, Boschmans M, vanden Berg TP (2004). Phylogenetic analysis of fowl adenoviruses. Avian Pathol., 33:164–170.

Mashkoor, S., Hameed, A., Ahmad, K. and Qureshi, M. S. (1994a). Immune response of Angara disease (hydropericardium syndrome) vaccines in broiler. Veterinarski Arkhiv , 64: 103- 107.

Mashkoor, S., Hameed, A., Ahmad, K. and Qureshi, M. S. (1994b). Improved angara disease vaccine for broiler chicks. Veterinarski Arkhiv , 64: 103-107.

Mazaheri, A., Prusas, C., Vob, M., and Hess, M., (1998). Some strains of serotype 4 fowl adenoviruses cause inclusion body hepatitis and hydropericardium syndrome in chickens. Avian Pathology, 27: 269-276.

McAleer, W.J., Eugene, B., Buynak, R.Z., Maigetter, D., Eugene, W., William, J.M., Maurice, R.H. (1984). Human hepatitis B vaccine from recombinant yeast. Nature. 307, 178 – 180.

Mcferran, J. B., Adair, B., and Connor, T. J., (1975). Adenoviral antigens (CELO, QBV, GAL). American Journal of Veterinary Research, 36: 527-529.

100

Chapter 5 References

Mcferran, J. B., Connor, T. J., and Adair, B. M., (1978). Studies on the antigenic relationship between an isolate (127) from the egg drop syndrome 1976 and a fowl adenovirus. Avian Pathology, 7: 629-639.

McFerran J.B. (1998). Adenoviruses. In A laboratory manual for the isolation and identification of avian pathogens, 4th Ed. (D.E. Swayne, J.R. Glisson, M.W. Jackwood, J.E. Pearson & W.M. Reed, eds). American Association of Avian Pathologists, Kennett Square, Pennsylvania, 100-106.

Miller. (1972). Experiments in molecular genetics. Cold spring harbor, NY. USA.

Muneer, M. A., Ajmal, M., Arshad, M., Ahmad, M. D., Chaudhary, Z. I. and Khan, T. M., (1989). Preliminary studies on hydropericardium syndrome in broilers in Pakistan. Zootecnica International , 5: 46-48.

Naeem, K., and Akram, H. S., (1995). Hydropericardium outbreaks in pigeon flock. The Veterinary Record, 138: 296-297.

Naeem, K., Niazi, T., Malik, S. A., Cheema, A. H., (1995a). Immunosuppressive potential and pathogenicity of an avian adenovirus isolate involved in hydropericardium syndrome in broilers. Avian Diseases, 39: 723-728.

Naeem, K., Rabbani, M., Hussain, M. and Cheema, A. H. (1995b). Development of cell culture vaccine against HPS in poultry. Pakistan Veterinary Journal, 15: 150-151.

Naeem, K., Rahim, K., and Majeed, I. U., (2001). Post infection dissemination pattern of avian adenovirus involved in hydropericardium syndrome. Pakistan Veterinary Journal, 21: 152-156.

Nakamura, K., Mase, M., Yamaguchi, S., Shibahara, T., and Yuasa, N., (1999). Pathologic study of specific pathogen free chicks and hens inoculated with adenovirus isolated from hydropericardium syndrome. Avian Diseases, 43: 414- 423.

Nakamura, K., Mase, M., Yamaguchi, S., and Yuasa N., (2000). Induction of hydropericardium in one day old specific pathogen free chicks by adenovirus from inclusion body hepatitis. Avian Diseases, 44: 192-196.

Niazi, A. K., Khan, M. Z. and Siddique, M., (1989). Haematological studies on naturally occurring hydropericardium syndrome in broiler chicks. The Veterinary Record, 125: 400.

Nicklin, S. A., Wu, E., Nemerow, G. R. & Baker, A. H. (2005). The influence of adenovirus fiber structure and function on vector development for gene therapy. Mol. Ther. 12, 384– 393.

101

Chapter 5 References

Oberoi, M. S., Singh, A., and Singh, B., (1996). Isolation of avian adenovirus from outbreaks of inclusion body hepatitis hydropericardium syndrome in poultry. Indian Journal of Virology, 12: 123-124.

Ojkic, D. and Nagy, É. (2003). Antibody response and virus tissue distribution in chickens inoculated with wild-type and recombinant fowl adenovirus. Vaccine. 22:42-48.

Pehler-Harrington, K., Khanna, M., Waters, C. R. & Henrickson, K. J. (2004). Rapid detection and identification of human adenovirus species by adenoplex, a multiplex PCR–enzyme hybridization assay. J. Clin. Microbiol. 42, 4072–4076.

Philipson L. and Pettersson R. F. (2004). The coxsackie–adenovirus receptor – a new receptor in the immunoglobulin family involved in cell adhesion. Curr Top Microbiol Immunol. 273: 87–111.

Pitcovski, J., Bezalel, G., Gilad, G., Martin, G., Beny, P., Gideon, G., Simha, K., Marisa, B., Amnon, M., (2003). Development and large-scale use of recombinant VP2 vaccine for the prevention of infectious bursal disease of chickens. Vaccine. 23: 4736–4743.

Pitcovski, J., Fingerut, E., Gallili, G., Eliahu, D., Finger, A., Gutter B., (2005). A subunit vaccine against hemorrhagic enteritis adenovirus. Vaccine. 38: 4697–4702.

Qureshi, A. A., (1988). Hydropericardium and kidney lesions. Poultry International, 27: 48-50.

Qureshi, A. A., (1989). Hydropericardium and ascites. Poultry International, 28: 44-48.

Rabbani, M., and Naeem, K., (1996). In vitro and in vivo evaluation of avian adenovirus isolates from outbreaks of hydropericardium syndrome. In:Proceedings of International Symposium on Adenovirus and Reovirus Infections in Poultry, Rauischholzhauzen, Germany, 26-31.

Rabbani, M., Muneer, M.A., and Naeem, K., (1998a). Characterization of avian adenovirus associated with hydropericardium. In: Proceedings of the Second Pan Commonwealth Veterinary Conference, Bangalore, India, 1318-1324.

Rabbani, M., Muneer, M.A., and Naeem, K., (1998b). A dot immunobinding assay on nitrocellulose for the detection of antigens and antibodies of avian adenovirus PARC 1. In: Proceedings of the Second Pan Commonwealth Veterinary Conference, Bangalore, India, 1325-1331.

Rahul, S., Kataria, J. M., Senthilkumar, N., Dhama, K., Sylvester, S. A., and Uma, R., (2005). Association of fowl adenovirus serotype 12 with hydropericardium syndrome of poultry in India. Acta Virologica, 49(2): 139-143.

102

Chapter 5 References

Rau, R. and Hess, M. (1998). Hexon based PCRs combined with restriction enzyme analysis for rapid detection and differentiation of fowl adenoviruses and egg drop syndrome virus. Journal of Virological Methods, 73:211-217.

Reece, R. L., Barr, D. A., and Grix, D. C., (1987). Pathogenicity studies with a strain of fowl adenovirus serotype 8 (VRI-33) in chickens. Australian Veterinary Journal, 64: 365-367.

Reed, L. J., and Muench, H., (1938). A simple method for estimating fifty percent end points. American Journal of Hygiene, 27: 493-497.

Rehman, S. U., Ashfaque, M., Anjum, A. D. and Sandhu, T. A., (1989). Indirect haemagglutination test for detecting Angara disease (hydropericardium) agent antibody. In: Proceedings of the International Conference and Trade Show on Poultry Production, 73-74.

Rekosh, D.M., Russell, W.C., Bellet, A.J. and Robinson, A.J. (1977). Identification of a protein linked to the ends of adenovirus DNA. Cell, 11: 283-295.

Roberts, D. M., Nanda, A., Havenga, M. J., Abbink, P., Lynch, D. M., Ewald, B. A., Liu, J., Thorner, A. R., Swanson, P. E. & other authors (2006). Hexon-chimaeric adenovirus serotype 5 vectors circumvent pre-existing anti-vector immunity. Nature, 441: 239–243.

Robinson C. M., Singh G., Henquell C., Walsh M. P., Peigue-Lafeuille H., Seto D., Jones M. S., Dyer D. W., Chodosh J. (2011). Computational analysis and identification of an emergent human adenovirus pathogen implicated in a respiratory fatality. Virology, 409:141–147.

Rose, H. M., and Morgan, C., (1960). Fine structure of virus infected cells. Annual Review of Microbiology, 14: 217-240.

Rosenberger, J. K., Eckroade, R. J., Klopps, S., and Krauss, W. C., (1974). Characterization of several viruses isolated from chickens with inclusion body hepatitis and aplastic anemia. Avian Diseases, 18: 399-409.

Roy, P., Kotteeswaran, A., and Manickam, R., (1999). Efficacy of an inactivated oil emulsion vaccine against hydropericardium syndrome in broilers. The Veterinary Record , 145: 458-459.

Roy, P., Kotteeswaran, A., and Manickam, R., (2001). Serological, cytopathological and cytochemical studies on hydropericardium syndrome virus. Veterinarski Arhiv, 71(2): 97- 103.

Roy, P., Muralimanohar, B., Kotteeswaran, A., and Omparkash, A. V., (2004). Experimental studies on hydropericardium syndrome in two different synthetic lines of broiler chickens. Veterinarski Arhiv, 74: 157-164.

103

Chapter 5 References

Russel, W. C., (2000). Update on adenovirus and its vectors. Journal of General Virology, 81: 2573-2604.

Russel, W. C., (2009). Adenoviruses: update on structure and function. Journal of General Virology, 90: 1-20.

Rux, J. J., Kuser, P. R. & Burnett, R. M. (2003). Structural and phylogenetic analysis of adenovirus hexons by use of high-resolution X-ray crystallographic, molecular modeling, and sequence-based methods. J. Virol. 77: 9553–9566.

Saban, S. D., Silvestry, M., Nemerow, G. R. & Stewart, P. L. (2006). Visualization of a-helices in a 6-A° ngstrom resolution cryoelectron microscopy structure of adenovirus allows refinement of capsid protein assignments. J. Virol. 80: 12049–12059.

Saifuddin, M., and Wilks, C. R., (1990). Development of an enzyme linked immunosorbent assay to detect and quantify adenovirus in chicken tissue. Avian Diseases, 34: 239-245.

Saiki, R.K., Sckarf, S., Faloona, F., Mullis, K.B, Horn, G.T., Erlich, H.A. and Arnheim, N. (1985). Enzymatic amplification of betaglobulin genomic sequence and restriction site analysis for diagnosis of sickle cell anemia. Science. 230: 1350-1354.

Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989). Molecular cloning: A laboratory Manual, 2nd edition, Cold spring harbor laboratory press, New York. USA.

Sano, E., Carlson, S., Wegley, L. and Rohwer, F. (2004). Movement of viruses between biomass, Applied and Environmental Microbiology, 70:5842-5846.

Schonewille, E., Singh, A., Gobel, T. W., Gerner, W., Saalmuller, A., and Hess, M., (2008). Fowl adenovirus (FAdV) serotype 4 causes depletion of B and T cells in lymphoid organs in specific pathogen free chickens following experimental infection. Veterinary Immunology and Immunopathology, 121(1-2): 130-139.

Shafiq, M., Khan, M. Z., Javed, M. T., and Khan, A., (1993). Lesions of hydropericardium syndrome in ebmbryonating eggs and in broiler chicks under immunosuppression. Singapore Veterinary Journal, 17: 58-64.

Shafiq, M., and Shakoori, A. R., (1994). Transmission of hydropericardium syndrome in poultry. Pakistan Journal of Zoology, 26: 145-148.

Shane, S. M., (1996). Hydropericardium hepatitis syndrome, the current world situation. Zootecnica International, 18: 20-27.

Shivachandra, S.B., Sah, R.L., Singh, S.D., Kataria, J.M. and Manimaran, K., (2003). Immunosupression in broiler chicks fed aflatoxin and inoculated with fowl adenovirus serotype-4 (FAdV-4) associated with hydropericardium syndrome. Vet. Res. Commun. 27:39-51.

104

Chapter 5 References

Shukla, S. K., Chandra, R., and Kumar, M., (1997a). Outbreaks of hydropericardium syndrome in layer flocks of poultry in India. Indian Journal of Veterinary Medicine, 17: 61-64.

Shukla, S. K., Chandra, R., Kumar, M., and Dixit, P. V., (1997b). Hydropericardium syndrome in India: a report. Indian Journal of Animal Science, 67: 28-29.

Singh, R., Singh, D., and Sadhan, N. A., (1997). Hydropericardium syndrome in broilers: countdown to reality. Pashudhan, 12: 1-8.

Sorensen, H.P., and Mortensen, K.K. (2005). Soluble expression of recombinant proteins in the cytoplasm of Escherichia coli, Microbial cell factories. 4:1-8.

Survashi, B.D., G.R. Ghalsasi, S.V. Pandit, R. Verma, S.N. Singh and K.R. Shinghal (1997). Leechy heart disease (IBH/HPS) Inclusion body hepatitis/ Hydropericardium syndrome in broilers and hazardous emerging disease: Biotechnology in animal Health and production for economic development in Asia in respect of global Scenario, pp: 156-158.

Swati, D., Ravinder, S.N., Hess, M. and Baldev, R.G. (2002). Fowl adenovirus serotype 4 associated with outbreaks of infectious hydropericardium in Haryana, India. Avian Dis. 46: 230-233.

Talha, K., Moid, S., Ahmad, M., Hassaan, H. and Moazzam, A., (2011). Poultry Industry; API presentation. (www.slideshare.net/msaadafridi/poultry-industry-of-pakistan).

Tan PK., Michou AI., Bergelson JM., Cotton M., (2001). Defining CAR as a cellular receptor for avian adenovirus CELO using a genomic analysis of the two viral fiber proteins. J. Gen. Virol. 82:1465–1472.

Tariq, M. A., (1988). Preliminary studies on hydropericardium syndrome in broiler chicks and its control measures in Pakistan. In: Proceedings of the National Seminar in Hydropericardium Syndrome, Rawalpindi, Pakistan, 49-57.

Thakor, K. B., Dave, C. J., Prajapati, K. S., Fefar, D. T. and Jivani, B. M. (2012). Molecular characterization of Avian adenovirus causing Inclusion body hepatitis – Hydropericardium syndrome in broiler chicken of Anand, Gujarat, India. Vet. World. 5(3): 178-182.

Toro, H., Gonzalez, C., Cerda, L., Hess, M., Reyes, F., Geisse, C., (2000). Chicken anemia virus and fowl adenoviruses: association to induce the inclusion body hepatitis / hydropericardium syndrome. Avian Disease, 44: 51-58.

Toro, H., Gonzalez, C., Cerda, L., Morales, M. A., Dooner, P., and Salamero, M., (2002). Prevention of inclusion body hepatitis/hydropericardium syndrome in progeny chickens by vaccination of breeders with fowl adenovirus and chicken anemia virus. Avian Diseases, 46: 547-554.

105

Chapter 5 References

Toro, H., Gonzalez, O., Escobar, C., Cerda, L., Morales, M. A., and Gonzalez, C., (2001). Vertical induction of inclusion body hepatitis / hydropericardium syndrome with fowl adenovirus and chicken anemia virus. Avian Diseases, 45: 215-222.

Toro, H., Prusas, C., Raue, R., Cerda, L., Geisse, C., Gonzalez, C., Hess, M., (1999). Characterization of fowl adenovirus from outbreaks of inclusion body hepatitis/ hydropericardium syndrome in Chile. Avian Diseases, 43: 262-270.

Vairamuthu, S., Raja, A., Balasubramanian, G. A., and Manohar, B. M., (2002). Isolation and identification of hydropericardium syndrome virus from outbreak in Tamilnadu. Indian Veterinary Journal, 79: 1145.

Venkat, S. K., Revathi, J. C., Venkata, S. A., Narayana, P. K. S. and Venkata, R. K. (2003). A process for the production of human interferon alpha from genetically engineered yeast. European patent EP: 1272624. www.freepatentsonline.com.

Voss, M., (1989). Evaluation of field serology and isolation and identification of an agent from Pakistani field cases of hydropericardium syndrome. In: Proceedings of Lohman Symposium on the Hydropericardium Syndrome, Cuxhaven, Germany, 27-31.

Voss, M., Vieltz, E., Hess, M., Prusas, C. H., and Mazaheri, A., (1996). Etiological aspects of hepatitis and hydropericardium syndrome caused by pathogenic adenoviruses in different countries. In: Proceedings of the International Symposium on Adenovirus and Reovirus Infections in Poultry, Rauischholzhauzen, Germany, 75-78.

Wiethoff, C. M., Wodrich, H., Gerace, L. & Nemerow, G. R. (2005). Adenovirus protein VI mediates membrane disruption following capsid disassembly. J. Virol. 79, 1992–2000.

Xie, Z., Fadl, A. A., Girshick, T., and Khan, M. I., (1999). Detection of avian adenoviruses by polymerase chain reaction. Avian Diseases, 43: 98-105.

Xie, Z., Luo S, Fan Q, Xie L, Liu J, Xie Z, Pang Y, Deng X, Wang X. (2013). Detection of antibodies specific to the non-structural proteins of fowl adenoviruses in infected chickens but not in vaccinated chickens. Avian Pathol. 42(5):491-6.

Zaman, T., and Khan, M. Z., (1991). Serum enzyme profiles in hydropericardium affected broiler chicks. Pakistan Veterinary Journal, 11: 50-52.

Zask, L., and Kisary, J., (1984). Characterization of adenovirus isolated from geese. Avian Pathology, 13: 253-264.

Zia, M. R., Rehman, S. U., Siddique, M. and Sandhu, M. A., (2001). Comparative efficiency of two oil emulsion hydropericardium/hepatitis syndrome. International Journal of Agriculture and Biology, 3: 436-438.

Zubieta, C., Schoehn, G., Chroboczek, J. & Cusack, S. (2005). The structure of the human adenovirus 2 penton. Mol. Cell. 17, 121–135.

106

Appendix 1 LB (Luria-Bertani) Medium Trypton 10 g Yeast Extract 5 g NaCl 5 g

D.D. H2O up to 1 liter pH was adjusted at 7.5 with 1 N NaOH and autoclaved for 20 minutes at 15 lb/sq. pressure.

Appendix 2 PCR mixture 1. 10 X PCR buffer (- MgCl) = 2.5ul 2. 4 dNTPs mix (2.5mM each) = 2.5ul

3. MgCl2 (25mM) = 2ul 4. Forward primer (FAVHL) 10µM = 0.5ul 5. Reverse primer (FAVHR) 10µM = 0.5ul 6. Taq polymerase = 0.3ul 7. DNA = 4ul

8. D.D. H2O = 12.7ul Total Volume = 25ul

Thermal cycler conditions Lid temperature: 105ºC 1- Denaturation at 94 0C for 4 min 2- Denaturation at 94 0C for 1 min 3- Anealing at 57 0C for 1 min 4- Extension at 72 0C for 2 min 5- Repeat 2 - 4 for 35 cycles 6- Final extension at 72 0C for 4 min 7- Hold at 4 0C

Appendix 3 PCR mixture for 100K (2300bp) 1. 10 X PCR buffer (- MgCl) = 2.5ul 2. 4 dNTPs mix (2.5mM each) = 2.5ul

3. MgCl2 (25mM) = 2ul 4. Forward primer 10µM = 0.5ul 5. Reverse primer 10µM = 0.5ul 6. Taq polymerase = 0.3ul 7. DNA = 4ul

8. D.D. H2O = 12.7ul Total Volume = 25ul

Thermal cycler conditions Lid temperatue: 105ºC 1- Denaturation at 95 0C for 2 min 2- Denaturation at 95 0C for 30 Sec 3- Anealing at 59 0C for 45 Sec 4- Extension at 72 0C for 2.5 min 5- Repeat 2 - 4 for 35 cycles 6- Final extension at 72 0C for 10 min 7- Hold at 4 0C

PCR mixture for Penton base (1600bp) & Short fiber (1400bp) 1. 10 X PCR buffer (- MgCl) = 2.5ul 2. 4 dNTPs mix (2.5mM each) = 2.5ul

3. MgCl2 (25mM) = 2ul 4. Forward primer 10µM = 0.5ul 5. Reverse primer 10µM = 0.5ul 6. Taq polymerase = 0.3ul 7. DNA = 4ul

8. D.D. H2O = 12.7ul Total Volume = 25ul

Thermal cycler conditions Lid temperatue: 105ºC 1. Denaturation at 95 0C for 2 min 2. Denaturation at 95 0C for 30 Sec 3. Anealing at 58 0C for 45 Sec 4. Extension at 72 0C for 1.5 min 5. Repeat 2 - 4 for 35 cycles 6. Final extension at 72 0C for 10 min 7. Hold at 4 0C

iii

Appendix 4 Competent cells preparation 1. LB agar plates were streaked from glycerol stock of the competent cells. 2. Agar plates were observed after 16 hrs of incubation and good sized, single colonies were selected. 3. Each selected colony was cultured in 10 ml of broth in falcon tubes. 4. Incubated all falcons for 16 hrs at 37 0C with 250 rpm shaking.

5. 0.1 M Solutions of CaCl2 . 2H2O and MgCl2 . 6H2O (100 ml each) and LB broth was prepared and autoclaved. 6. 100 ml of LB broth was cultured with 1 ml of the starter culture from 10 ml of falcons.

7. 20 ml solution of 0.1 M CaCl2 . 2H2O with 15 % glycerol was also prepared and autoclaved. 8. Observed the O.D value of 100 ml culture 9. When O.D value reaches 0.4 to 0.5, culture was poured in 50 ml falcon tubes and placed on ice for 30 min. 10. Centrifuged at 2000 rpm for 8 minutes at 4 0C. 11. Media was discarded and pellet was collected.

12. Added 2 ml of 0.1 M MgCl2 . 6H2O (ice cold) and pellet was dissolved then total Vol. of each falcon was made up to 20 ml with the same solution. 13. Centrifuged at 2000 rpm for 7 min. at 4 0C and discarded the supernatant, pellet was collected.

14. Dissolved the pellet in 2 ml of 0.1 M CaCl2 . 2H2O (ice cold) then total Vol. of each falcon was made up to 20 ml with the same solution. 15. Placed on ice for 30 minutes. 16. Centrifuged at 3000 rpm for 6 min. and collected the pellet.

17. Pellet of each falcon was dissolved in 2 ml of 0.1 M CaCl2 . 2H2O having 15 % glycerol (ice cold). 18. Aliquoted 200 ul of cells in pre-cold eppendroffs. 19. Stored at – 20 0C or – 80 0C.

Appendix 5 Miniprep using GeneJet plasmid miniprep kit Resuspension Added 250 ul of resuspension solution in pellets and mixed by pipetting Added 250 ul of lysis solution and inverted 4 – 6 times Added 350 ul of Neutralization solution and inverted 4 – 6 times Centrifuged at 13000 rpm for 5 minutes DNA Binding Loaded the supernatant to genejet spin column and centrifuged at 13000 rpm for 1 min. Column washing Washed the columns by adding 500 ul of wash solution and centrifugation at 13000 rpm for 30 – 60 seconds Repeat this step (washing) once Centrifuged the empty columns at 13000 rpm for 1 min. Elution of purified DNA Placed both columns in autoclaved eppendrofs (1.5 ml) Added 50 ul of elution buffer to both columns and incubated at room temperature for 2 min Centrifuged the columns at 13000 rpm for 2 min and collected the flow through in eppendrofs which had purified plasmid DNA. Stored at -20 0C.

Appendix 6 Bradford reagent (50 ml) Commassie brilliant blue G-250 5 mg 95% Ethanol 2.5 ml 85% Phosphoric acid 5 ml Distilled water up to volume 50 ml

Appendix 7 Preparation of buffers for Western blotting Transfer buffer Tris base 25mM Glycine 190mM Methanol 20% (V/V)

TBST (Tris buffer saline – Tween 20) Tris HCl (pH 7.5) 20mM (20ml of 1M stock solution for 1 liter total buffer vol) NaCl 150mM (37.5ml of 4M stock solution for 1 liter total buffer vol) Tween 20 0.05% (50 ul per 1L) TBS (Tris buffer saline) Tris HCl 20mM NaCl 150mM

Dilution of primary antibody (1:3000) (anti His tag) 1ul of antibody in 3ml of TBST containing 3% BSA (3.3ul in 10ml of TBST + 0.3g of BSA) Dilution of secondary antibody (1:10,000) (anti mouse IgG AP conjugate) 1ul of antibody in 10ml of TBST containing 3% BSA (1ul in 10ml of TBST + 0.3g of BSA)

Alkaline Phosphatase substrate sol. 1 tablet of AP in 5ml of D. water

Appendix 8 Elution of bands cut from agarose gel using QIAGEN, QIAquick Gel extraction Kit

 Weighed the eppendrofs having gel cut bands & estimated the weight of gel (2.1 – 2.0 = 0.1g)  Added 3 volumes (300 ul) of buffer QG to 1 volume (100ul/0.1g) of gel bands  Incubated at 50 0C for 10 min. and checked the color of the solution it should be yellow.  Added 1 gel volume (100 ul) of isopropanol to the solution and mixed well  Spin columns were fitted in the collection tubes and whole volume of the solution was put in each spin column separately.  Columns were centrifuged at 13000 rpm for 1 min.  Discarded the follow-through and again put the columns in collection tubes.  Added 0.5 ml of buffer QG to column and centrifuged at 13000 rpm for 1 min.  Added 0.75 ml of buffer PE (having ethanol) to column, left the column for 2 – 5 min and centrifuged at 13000 rpm for 1 min.  Discarded the follow-through and centrifuged again for 1 min at 13000 rpm to remove residual ethanol.  Placed the each column in 1.5 ml eppendrof separately  DNA was eluted by adding 40 ul of buffer EB to centre of each column and incubated at room temp. for 30 seconds then centrifuged for 1 min at 13000 rpm .  Stored the eppendrofs containing purified DNA at – 20 0C.

Appendix 9 1M stock solution of IPTG (F.W: 238.31) Dissolved 0.23g/ml IPTG in Distilled water and filtered from syringe filter.

vii

Appendix 10 Sequence alignment results of short fiber gene

Accession no. FJ949088.1, Fowl adenovirus 4 isolate Bareilly fiber protein gene, complete Cds, Length = 1437, Score = 2638 bits (1428), Expect = 0.0 Identities = 1435/1438 (99%), Gaps = 2/1438 (0%) Strand=Plus/Plus

Query 1 ATGCTCCGAGCCCCTAAAAGAAGACATTCCGAAAACGGGAAGCCCGAGACCGAAGCGGGA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 ATGCTCCGAGCCCCTAAAAGAAGACATTCCGAAAACGGGAAGCCCGAGACCGAAGCGGGA 60

Query 61 CCTTCCCCGGCTCCAATCAAGCGCGCCAAACGCATGGTGAGAGCATCCCAGCTTGACCTG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 CCTTCCCCGGCTCCAATCAAGCGCGCCAAACGCATGGTGAGAGCATCCCAGCTTGACCTG 120

Query 121 GTTTATCCTTTCGATTACGTGGCCGACCCCGTCGGAGGGCTCAACCCGCCTTTTTTGGGA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 GTTTATCCTTTCGATTACGTGGCCGACCCCGTCGGAGGGCTCAACCCGCCTTTTTTGGGA 180

Query 181 GGCTCAGGACCCCTAGTGGACCAGGGCGGACAGCTTACGCTCAACGTCACCGATCCCATC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 GGCTCAGGACCCCTAGTGGACCAGGGCGGACAGCTTACGCTCAACGTCACCGATCCCATC 240

Query 241 ATCATCAAGAACAGATCGGTGGACTTGGCCCACGACCCCAGTCTCGATGTCAACGCCCAA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 ATCATCAAGAACAGATCGGTGGACTTGGCCCACGACCCCAGTCTCGATGTCAACGCCCAA 300

Query 301 GGTCAACTGGCGGTGGCCGTTGACCCCGAAGGGGCCCTGGACATCACCCCCGATGGACTG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 GGTCAACTGGCGGTGGCCGTTGACCCCGAAGGGGCCCTGGACATCACCCCCGATGGACTG 360

Query 361 GACGTCAAGGTCGACGGAGTGACCGTAATGGTCAACGATGACTGGGAACTGGCCGTAAAA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 361 GACGTCAAGGTCGACGGAGTGACCGTAATGGTCAACGATGACTGGGAACTGGCCGTAAAA 420

Query 421 GTCGACCCGTCCGGCGGATTGGATTCCACCGCGGGTGGACTGGGGGTCAGCGTGGACGAC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 421 GTCGACCCGTCCGGCGGATTGGATTCCACCGCGGGTGGACTGGGGGTCAGCGTGGACGAC 480

Query 481 ACCTTGCTCGTGGATCAGGGAGAACTGGGCGTACACCTCAACCAACAAGGACCCATCACT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 481 ACCTTGCTCGTGGATCAGGGAGAACTGGGCGTACACCTCAACCAACAAGGACCCATCACT 540

Query 541 GCCGATAGCAGTGGTATCGACCTCGAGATCAATCCTAACATGTTCACGGTCAACACCTCG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 541 GCCGATAGCAGTGGTATCGACCTCGAGATCAATCCTAACATGTTCACGGTCAACACCTCG 600

Query 601 ACCGGAAGCGGAGTGCTGGAACTCAACCTAAAAGCGCAGGGAGGCATCCAAGCCGACAGT 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 601 ACCGGAAGCGGAGTGCTGGAACTCAACCTAAAAGCGCAGGGAGGCATCCAAGCCGACAGT 660

Query 661 TCGGGAGTGGGCGTTTCCGTGGATGAAAGCCTACAGATTGTCAACAACACTCTGGAAGTG 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 661 TCGGGAGTGGGCGTTTCCGTGGATGAAAGCCTACAGATTGTCAACAACACTCTGGAAGTG 720

viii

Query 721 AAACCGGATCCCAGCGGACCGCTTACGGTCTCCGCCAATGGCCTAGGGCTGAAGTACGAC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 721 AAACCGGATCCCAGCGGACCGCTTACGGTCTCCGCCAATGGCCTAGGGCTGAAGTACGAC 780

Query 781 ACTAATACCCTAGCGGTGACCGCGGGCGCTTTAACCGTGGTCGGAGGGGGGAGCGTCTCC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 781 ACTAATACCCTAGCGGTGACCGCGGGCGCTTTAACCGTGGTCGGAGGGGGGAGCGTCTCC 840

Query 841 ACACCCA-TCGCTACTTTTGTCTCGGGAAGTCCCAGCCTCAACACCTACAATGCCACGAC 899 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct 841 ACACCCAATCGCTACTTTTGTCTCGGGAAGTCCCAGCCTCAACACCTACAATGCCACG-C 899

Query 900 CGTCAATTCCAGCGCGAACGCCTTCTCTTGCGCCTACTACCTTCAACAGTGGAACATACA 959 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 900 CGTCAATTCCAGCGCGAACGCCTTCTCTTGCGCCTACTACCTTCAACAGTGGAACATACA 959

Query 960 GGGGCTCCTTGTTACCTCCCTCTACTTGAAATTGGACAGCGCCACCATGGGGAATCGCCC 1019 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 960 GGGGCTCCTTGTTACCTCCCTCTACTTGAAATTGGACAGCGCCACCATGGGGAATCGCCC 1019

Query 1020 TGGGGACCTCAACTCCGCCAATGCCAAATGGTTCACCTTTTGGGTGTCCGCCTATCTCCA 1079 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1020 TGGGGACCTCAACTCCGCCAATGCCAAATGGTTCACCTTTTGGGTGTCCGCCTATCTCCA 1079

Query 1080 GCAATGCAACTCCGGGATTCAAGCGGGAACGGTCAGCCCCTCCACCGCCACCCTCACGGA 1139 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1080 GCAATGCAACTCCGGGATTCAAGCGGGAACGGTCAGCCCCTCCACCGCCACCCTCACGGA 1139

Query 1140 CTTTGAACCCATGGCCAATAGGAGCGTGACCAGCCCATGGACGTACTCGGCCAATGGATA 1199 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1140 CTTTGAACCCATGGCCAATAGGAGCGTGACCAGCCCATGGACGTACTCGGCCAATGGATA 1199

Query 1200 CTATGAACCATCCATCGGGGAATTCCAAGTGTTCAGCCCGGTGGTAACAGGTGCCTGGAA 1259 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1200 CTATGAACCATCCATCGGGGAATTCCAAGTGTTCAGCCCGGTGGTAACAGGTGCCTGGAA 1259

Query 1260 CCCGGGAAACATAGGGATCCGCGTCCTCCCCGTGCCGGTTCCGGCCTCCGGAGAGCGATA 1319 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Sbjct 1260 CCCGGGAAACATAGGGATCCGCGTCCTCCCCGTGCCGGTTTCGGCCTCCGGAGAGCGATA 1319

Query 1320 CACCCTTCTATGCTATAGTCTGCAGTGCACGAACGCGAGCATTTTTAATCCAAACAACAG 1379 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1320 CACCCTTCTATGCTATAGTCTGCAGTGCACGAACGCGAGCATTTTTAATCCAAACAACAG 1379

Query 1380 CGGAACCATGATCGTGGGACCCGTGCTCTACAGCTGTCCAGCGGGCTCCCTCCCGTAA 1437 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1380 CGGAACCATGATCGTGGGACCCGTGCTCTACAGCTGTCCAGCGGGCTCCCTCCCGTAA 1437

Appendix 11

Sequence alignment results of Penton base gene

Accession no. EU925581.1 Fowl adenovirus 4 isolate KC penton base protein gene, complete cds, Length=1676, Score = 2861 bits (1549), Expect = 0.0 Identities = 1576/1587 (99%), Gaps = 9/1587 (1%), Strand=Plus/Plus Query 1 ATGTGGGGGTTGCAGCCGCCGACGTCGATTCCGCCGCCTCCTCCGCCGACCGAGTTAACG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 84 ATGTGGGGGTTGCAGCCGCCGACGTCGATTCCGCCGCCTCCTCCGCCGACCGAGTTAACG 143

Query 61 CCCTCGACCTATCCGGCGATGGTGAACGGCTATCCGCCTCCGGCCGCGTCCGCGCAGAGC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 144 CCCTCGACCTATCCGGCGATGGTGAACGGCTATCCGCCTCCGGCCGCGTCCGCGCAGAGC 203

Query 121 TGTCCCTCTAGCGACGGTCAGAGCGAGCTGTATATGCCCCTTCAGCGGGTGATGGCCCCT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 204 TGTCCCTCTAGCGACGGTCAGAGCGAGCTGTATATGCCCCTTCAGCGGGTGATGGCCCCT 263

Query 181 ACGGGGGGACGGAACAGCATTAAGTATCGCGATTACACGCCGTGTCGTAACACCACCAAG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 264 ACGGGGGGACGGAACAGCATTAAGTATCGCGATTACACGCCGTGTCGTAACACCACCAAG 323

Query 241 CTGTTTTACGTAGACAACAAGGCTAGCGATATCGATACGTATAACAAAGACGCCAACCAT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 324 CTGTTTTACGTAGACAACAAGGCTAGCGATATCGATACGTATAACAAAGACGCCAACCAT 383

Query 301 AGCAATTTCCGCACCACGGTGATCCATAACCAGGATCTGGACGCGGACACGGCCGCCACC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 384 AGCAATTTCCGCACCACGGTGATCCATAACCAGGATCTGGACGCGGACACGGCCGCCACC 443

Query 361 GAGTCCATCCAGTTGGACAACCGCTCCTGCTGGGGCGGCGACCTAAAAACAGCCGTGCGC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 444 GAGTCCATCCAGTTGGACAACCGCTCCTGCTGGGGCGGCGACCTAAAAACAGCCGTGCGC 503

Query 421 ACCAACTGCCCGAACGTGAGCAGTTTTTTCCAGAGTAACAGCGTGCGCGTGCGCATGATG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 504 ACCAACTGCCCGAACGTGAGCAGTTTTTTCCAGAGTAACAGCGTGCGCGTGCGCATGATG 563

Query 481 TGGAAGCGCGACCCGCCGACTAGCACGGCTCCTCCGAGCGCGGTAGGCAGCGGCTATTCG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 564 TGGAAGCGCGACCCGCCGACTAGCACGGCTCCTCCGAGCGCGGTAGGCAGCGGCTATTCG 623

Query 541 GTGCCCGGCGCGCAGTACAAGTGGTACGACCTGACGATACCCGAGGGTAACTACGCGCTG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 624 GTGCCCGGCGCGCAGTACAAGTGGTACGACCTGACGATACCCGAGGGTAACTACGCGCTG 683

Query 601 TGCGAACTGATAGACCTGCTCAACGAGGGCATCGTGCAGCTCTACCTGAGCGAGGGGCAC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct 684 TGCGAACTGATAGACCTGCTCAACGAGGGCATCGTGCAGCTCTACCTGAGCGAGGGGCGC 743

Query 661 CAGAACAACGTGCAAAAATCGGACATCGGGGTCAAGTTCGACACGCGCAACTTCGGCTTG 720 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 744 CAGAACAGCGTGCAAAAATCGGACATCGGGGTCAAGTTCGACACGCGCAACTTCGGCTTG 803

Query 721 CTCCGCGACCCCGTGACGGGACTGGTAACTCCGGGCACGTACGTGTACAAGGGTTACCAC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 804 CTCCGCGACCCCGTGACGGGACTGGTAACTCCGGGCACGTACGTGTACAAGGGTTACCAC 863

Query 781 CCCGACATCGTGCTGCTGCCCGGATGCGCGATCGACTTTACGTACAGCCGCCTGAGCCTG 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 864 CCCGACATCGTGCTGCTGCCCGGATGCGCGATCGACTTTACGTACAGCCGCCTGAGCCTG 923

Query 841 CTCCTGGGCATAGGGAAGCGCGAGCCCTACTCGAAGGGGTTCGTTATTACCTACGAGGAT 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 924 CTCCTGGGCATAGGGAAGCGCGAGCCCTACTCGAAGGGGTTCGTTATTACCTACGAGGAT 983

Query 901 CTGCAGGGAGGGGATATCCCGGCTCTGCTGGACCTCGACTCCGTCGACGTGAACGACGCT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 984 CTGCAGGGAGGGGATATCCCGGCTCTGCTGGACCTCGACTCCGTCGACGTGAACGACGCT 1043

Query 961 GACGGTGAAGTGATCGAGCTCGACAACGCTGCTCCCCTTTTACATGACAGCGCGGGCGTG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1044 GACGGTGAAGTGATCGAGCTCGACAACGCTGCTCCCCTTTTACATGACAGCGCGGGCGTG 1103

Query 1021 TCGTATAACGTCATTTACGACCAGGTGACGGGTAAACCCGTGACGGTGTATCGATCGTGG 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1104 TCGTATAACGTCATTTACGACCAGGTGACGGGTAAACCCGTGACGGTGTATCGATCGTGG 1163

Query 1081 ATGTTGGCTTACAACGTGCCTAACTCGCCGGCCAATCAGACGACCTTGCTGACGGTGCCC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1164 ATGTTGGCTTACAACGTGCCTAACTCGCCGGCCAATCAGACGACCTTGCTGACGGTGCCC 1223

Query 1141 GATATGGCGGGCGGGATCGGGGCGATGTACACGTCCCTGCCCGATACCTTTATCGCGCCT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1224 GATATGGCGGGCGGGATCGGGGCGATGTACACGTCCCTGCCCGATACCTTTATCGCGCCT 1283

Query 1201 ACCGGGTTCAAGGAAGATAACACGACCAACCTTTGCCCGGTCGTCGGCATGAACCTGTTC 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1284 ACCGGGTTCAAGGAAGATAACACGACCAACCTTTGCCCGGTCGTCGGCATGAACCTGTTC 1343

Query 1261 CCCACCTACAATAAAATTTATTACCAGGCGGCGTCCACGTACGTGCAGCGCCTGGAAAAT 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| bjct 1344 CCCACCTACAATAAAATTTATTACCAGGCGGCGTCCACGTACGTGCAGCGCCTGGAAAAT 1403

Query 1321 TCCTGCCAGTCGGCCACAGCCGCCTTCAACCGCTTTCCCGAAAACGAGATTCTGAAGCAA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1404 TCCTGCCAGTCGGCCACAGCCGCCTTCAACCGCTTTCCCGAAAACGAGATTCTGAAGCAA 1463

Query 1381 GCGCCCCCCATGAATGTTTCGTCCGTGTGCGATAACCAACCCGCCGTCGTTCAGCAGGGT 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1464 GCGCCCCCCATGAATGTTTCGTCCGTGTGCGATAACCAACCCGCCGTCGTTCAGCAGGGT 1523

Query 1441 GTGTTGCCTGTGAAGAGCTCGCTCCCCGGACTGCAGGACTGCAGGCGCGTGCTGATCACA 1500 |||||||||||||||||||||||||||||||||||| | || | ||||||||||| Sbjct 1524 GTGTTGCCTGTGAAGAGCTCGCTCCCCGGACTGCAG--C-GC-G-----TGCTGATCACA 1574

Query 1501 GACGACCAGCGTCGTCCGATACCCTACGTGTATAAGTCTATCGCGACGGTTCAGCCGACC 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1575 GACGACCAGCGTCGTCCGATACCCTACGTGTATAAGTCTATCGCGACGGTTCAGCCGACC 1634

Query 1561 GTTCTGAGTTCCGCGACCTTGCAGTAG 1587 ||||||||||||||||||||||||||| Sbjct 1635 GTTCTGAGTTCCGCGACCTTGCAGTAG 1661

Appendix 12 Sequence alignment results of 100K gene

Accession no. LO7890.1, Fowl adenovirus 10 unknown gene, Length=2397, Score = 4222 bits (2286), Expect = 0.0, Identities = 2364/2401 (98%), Gaps = 8/2401 (0%), Strand=Plus/Plus Query 1 ATGGAAAGCACCGCCGACGGGGATAAAGCCCGTGGCGAGGAGCCCGCAGCTGAGCGCGAG 60 |||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| Sbjct 1 ATGGAAAGCACCGCCGACGGGGATAAAGCCCGTGGCGAGGAGCCCGTAGCTGAGGGCGAG 60

Query 61 GCCAGCGACA-CCGCCGGCGCCGACGGCGAGTTCCCCGCGCCGGAAGACGAGCATCCGGA 119 |||||||||| ||||| ||| |||||||||||||||||| |||||||||||||||||||| Sbjct 61 GCCAGCGACATCCGCC-GCGGCGACGGCGAGTTCCCCGCACCGGAAGACGAGCATCCGGA 119

Query 120 CGATGGGGAACCGGATGAACCGGCCGACAGAGACGACCGATCGGGCGAACCGGACGCGGA 179 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct 120 CGATGGGGAACCGGATGAACCGGCCGACAGAGACGACCGATCGGGCGAATCGGACGCGGA 179

Query 180 TAGCGGTTACTATTCGGCAGATGGGGGACGCGATGCAG-GCTACGACGGAGAGGCCGCTC 238 |||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||| Sbjct 180 TAGCGGTTACTATTCGGCAGATGGGGGACGCGATGCAGAG-TGCGACGGAGAGGCCGCTC 238

Query 239 GACCCGACACCCCTACGGACGAGTCTAGCGCGCCGACTACTCCATCCACAGCAGTGCGAC 298 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 239 GACCCGACACCCCTACGGACGAGTCTAGCGCGCCGACTACTCCATCCACAGCAGTGCGAC 298

Query 299 GCTCATCGGGCGAGTCTAGCCCCGATCGCGGTGGCTGCTTTAGCCACTCTAGCGACTCTG 358 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 299 GCTCATCGGGCGAGTCTAGCCCCGATCGCGGTGGCTGCTTTAGCCACTCTAGCGACTCTG 358

Query 359 AGCTCGGCTGTGCTACTGAGACTCGCGATCCGTTTGCTGCAGGGCTGCGCAAGTGCATCG 418 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Sbjct 359 AGCTCGGCTGTGCTACTGAGACTCGCGATCCGTTTGCTGCGGGGCTGCGCAAGTGCATCG 418

Query 419 AACGGCAAGCCATGATCCTAACGGGAGCCCTCAAAGACGCGCAGC-TCGACCCGCCCCTC 477 ||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| Sbjct 419 AACGGCAAGCCATGATCCTAACGGGAGCCCTCAAAGACGCGCA-CGTCGACCCGCCCCTC 477

Query 478 GACAGCATGCCACTTACCGTAGACGCGGTGCAGAGACAGTTAGAGCGCTTTCTCTTCAAC 537 ||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 478 GACAGCATGCCGCTTACCGTAGACGCGGTCCAGAGACAGTTAGAGCGCTTTCTCTTCAAC 537

Query 538 CCCGACCCGAAAGTGCCGCGCGAGCACGTAGAGCTCGCTACAACTTTTATGCCGCCCTTC 597 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 538 CCCGACCCGAAAGTGCCGCGCGAGCACGTAGAGCTCGCTACAACTTTTATGCCGCCCTTC 597

Query 598 ATGACGCCTAAAGCCATCGCAAACTACCACATCTTTTGCGGTAACCGCCCCATCCCGCCT 657 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 598 ATGACGCCTAAAGCCATCGCAAACTACCACATCTTTTGCGGTAACCGCCCCATCCCGCCT 657

Query 658 AGCCGCAAGGCCAACCGGAGCGGATCCGAGGTGCTCCGTGCCGCGGAGAACGCTCGCTTC 717 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 658 AGCTGCAAGGCCAACCGGAGCGGATCCGAGGTGCTCCGTGCCGCGGAGAACGCTCGCTTC 717

Query 718 TTCAAACGCTTACCTCGCTGGAAGCAGGGCGTGACGGTCGACGACGGTCTGGGAGACGAG 777 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 718 TTCAAACGCTTACCTCGCTGGAAGCAGGGCGTGACGGTCGACGACGGTCTGGGAGACGAG 777

xii

Query 778 GTGTCGCCTATAACAGAGCTGAAAGACGCCAAATTAGTGCCGTTGCGCGATGACACCTCC 837 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 778 GTGTCGCCTATAACAGAGCTGAAAGACGCCAAATTAGTGCCGTTGCGCGATGACACCTCC 837

Query 838 CGTCTCGAGTGGGCCAAAATGCGCGGCGAACACGTACGCTATTTTTGCTACCCCTCCCTC 897 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 838 CGTCTCGAGTGGGCCAAAATGCGCGGCGAACACGTACGCTATTTTTGCTACCCCTCCCTC 897

Query 898 CACATGCCTCCCAAAATATCCCGCATGCTCATGGAGGTACTGCTCCAGCCATTCGCTCAA 957 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct 898 CACATGCCTCCCAAAATATCCCGCATGCTCATGGAGGTACTGCTCCAGCCCTTCGCTCAA 957

Query 958 GAGGTAGCGAGCGGTGGCGATCAAGAAGACCCCGAGCCCGTGTTTCCGACAGCGGAACTG 1017 ||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| Sbjct 958 GAGGTAGCGAGCGGTCCCGATCAAGAAGACCCCGAGCCCGTGTATCCGACAGCGGAACTG 1017

Query 1018 GCGTGCATCGTCGATCCGGAGGGCGTGATGCAACCACACGCGCTAGCTAGAGCGATAGAG 1077 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Sbjct 1018 GCGTGCATCGTCGATCCGGAGGGCGTGATGCAACCACACGGGCTAGCTAGAGCGATAGAG 1077

Query 1078 GTCGACGGGCATGGTAGCGCAGGCCGTCCGCTATACCGCTCAGCTAGAGCTTATGGAAGC 1137 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1078 GTCGACGGGCATGGTAGCGCAGGCCGTCCGCTATACCGCTCAGCTAGAGCTTATGGAAGC 1137

Query 1138 GTATTCCGCGAGCCTTCCTCGATCAAAAAGGCACAAGAAGTGCTCCATCACACCTTCCAC 1197 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1138 GTATTCCGCGAGCCTTCCTCGATCAAAAAGGCACAAGAAGTGCTCCATCACACCTTCCAT 1197

Query 1198 CACGGTTTCGTGGCGCTCATTCGGGAAACCGCCAAAGTCAATCTAAGCAACTATGCCACC 1257 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1198 CACGGTTTCGTGGCGCTCATTCGGGAAACCGCCAAAGTCAATCTAAGCAACTATGCCACC 1257

Query 1258 TTCCACGGGATCACGTACAACGACCCGCTCAACAACTGCATGCTAGCCAAGTTGATGGAA 1317 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1258 TTCCACGGGATCACGTACAACGACCCGCTCAACAACTGCATGCTAGCCAAGTTGATGGAA 1317

Query 1318 GGCTCGGACAAGCGAGATTACGTGGTGGACAGCATCTACCTCTTCTTGGTGCTCACGTGG 1377 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1318 GGCTCGGACAAGCGAGATTACGTGGTGGACAGCATCTACCTCTTCTTGGTGCTCACGTGG 1377

Query 1378 CAAACGGCTATGGGCATGTGGCAGCAAGCCATCCAGGAGGAGGCCATCGAGGCTTATCGG 1437 |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct 1378 CAAACGGCTATGGGCATGTGGCAGCAAGCCATCCAGGAGGAGACCATCGAGGCTTATCGA 1437

Query 1438 GAGGCCTTTACTCGGCTCCGAAGAGCTATTTACGCTCTCGAAACACCCACCGAGATCTCC 1497 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct 1438 GAGGCCTTTACTCGGCTCCGAAGAGCTATTTACGCCCTCGAAACACCCACCGAGATCTCC 1497

Query 1498 AAAGCCATCGTAGACGTGCTCATGGACGGAGACCGACTGTGCGCCGAAATGCCAAAGCTC 1557 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1498 AAAGCCATCGTGGACGTGCTCATGGACGGAGACCGACTGTGCGCCGAAATGCCAAAGCTC 1557

Query 1558 CCCAACTTCACCAATGGCAGCCAAATCAGCGCCTTTAGGCAGTTTATCATGGAGCGCAGT 1617 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1558 CCCAACTTCACCAACGGCAGCCAAATCAGCGCCTTTAGGCAGTTTATCATGGAGCGCAGT 1617

xiii

Query 1618 AACATTCCCACCACGGCCGCCCCCTTCCTACCCTCCGACTTTGTGCCGCTCTCCTTCCGA 1677 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1618 AACATTCCCACCACGGCCGCCCCCTTCCTACCCTCCGACTTTGTGCCGCTCTCCTTCCGA 1677

Query 1678 CAAGCCCAGCCTCT-GCTCTGGGACCAGGTGTACCTCCTCCAAACCGCCTTTTTCCTCTG 1736 |||||||| || || ||||||||| ||||||||||||||||||||||||||||||||||| Sbjct 1678 CAAGCCCAACC-CTTGCTCTGGGATCAGGTGTACCTCCTCCAAACCGCCTTTTTCCTCTG 1736

Query 1737 CAACCACGGAGGATACCTGTGGGAGCCCGAGGAAACCGAGAATCCCAACCCTCGCGATCG 1796 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1737 CAACCACGGAGGATACCTGTGGGAGCCCGAGGAAACCGAGAATCCCAACCCTCGCGATCG 1796

Query 1797 CACCTACTGTCCGTGCAACTTGTGCAGTCCGCACCGGATGCCCCAACACAACGTGCCTCT 1856 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1797 CACCTACTGTCCGTGCAACTTGTGCAGTCCGCACCGGATGCCCCAACACAACGTGCCTCT 1856

Query 1857 GCACAACGAACTGCTCGCCATCGACACGTTTGAAATCCGCACGGACGACGGCAAGACCTT 1916 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 1857 GCACAACGAACTGCTCGCCATCAACACGTTTGAAATCCGCACGGACGACGGCAAGACCTT 1916

Query 1917 CAAATTGACTCCCGAACTGTGGGCCAACGCCTACCTAGACAAATTCGAACCCAAAGACTA 1976 ||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct 1917 CAAATTGACTCCCGAACTGTGGGCCAACGCCTATCTAGACAAATTCGAGCCCAAAGACTA 1976

Query 1977 CCACCCTTTCGAAGTGGTGCACCTCCCTCAACACGAGGAAGCGTTCTCTAGAGACCTCAC 2036 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 1977 CCACCCTTTCGAAGTGGTGCACTTCCCTCAACACGAGGAAGCGTTCTCTAGAGACCTCAC 2036

Query 2037 GGCCTGCGTCACCAAAAGCCCCGAAATCCTCAGTCTGATTCGTCAAATTCAGGCTTCGAG 2096 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2037 GGCCTGCGTCACCAAAAGCCCCGAAATCCTCAGTCTGATTCGTCAAATTCAGGCTTCGAG 2096

Query 2097 GGAGGAGTTCCTCCTCACGCGGGGTAAGGGCGTATACAAAGACCCCGACACCGGCGAGGT 2156 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct 2097 GGAGGAGTTCCTCCTCACGCGGGGCAAGGGCGTATACAAAGACCCCGACACCGGCGAGGT 2156

Query 2157 CCTCACTCCGCAGCCAGATCTCCAAGCTGGAGCAGCCCGGCGACAAGCTCTACCAACCGC 2216 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2157 CCTCACTCCGCAGCCAGATCTCCAAGCTGGAGCAGCCCGGCGACAAGCTCTACCAACCGC 2216

Query 2217 TTACGCCGATCACGCCAGAGGAGCTGCGACGTCGGCAGAGCCTTCTCGAGCTCTACGGCC 2276 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2217 TTACGCCGATCACGCCAGAGGAGCTGCGACGTCGGCAGAGCCTTCTCGAGCTCTACGGCC 2276

Query 2277 TACCAGCGTCGCAACCGCCGCCGGAAACCGAACACGGGGGTGCTCTTCGGCGCGCTATCG 2336 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 2277 TACCAGCGTCGCAACCGCCGCCGGAAACCGAACACGGGGGTGCTCTTCAGCGCGCTATCG 2336

Query 2337 GCTCGGTCCAACCCTCCGTCGCAGGAGCAACTCCTCATGGCCCAGAGAATGGTCGACCTG 2396 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2337 GCTCGGTCCAACCCTCCGTCGCAGGAGCAACTCCTCATGGCCCAGAGAATGGTCGACCTG 2396

Query 2397 A 2397 | Sbjct 2397 A 2397

xiv

Appendix 13

Figure: Standard curve of Bovine Serum Albumen for quantification of proteins by Bradford assay.