ABSTRACT

LEWIS, WANIDA. Antioxidant and Anti-inflammatory Properties of Peanut Skin Extracts. (Under the direction of Dr. Lisa Dean and Dr. Leon Boyd).

Peanut skins have been regarded as a low economic waste by-product of the peanut industry but they contain high levels of bioactive compounds including catechins and procyanidins, which could benefit human health. The antioxidant activities of peanut skins have been reported but, no attempt has been undertaken to study the relationship between antioxidant and anti-inflammatory properties of peanut skins. The purpose of this research was to (i) evaluate the antioxidant activity, (ii) investigate anti-inflammatory properties and

(iii) identify the mechanism of action that may be responsible for peanut skin’s anti- inflammatory activity in vitro. To achieve an optimized amount of phenolic compounds, polar solvents such as aqueous ethanol or acetone were used for extraction purposes.

Antioxidant activity was evaluated using Hydrophilic Oxygen Radical Absorbance Capacity

(H-ORAC) and Total Phenol analyses. Peanut skin extracts (PSE) extracted with acetone/water had similar ORAC and total phenolic values (3060 µmol Trolox/100 g and 290 mg GAE/g) than PSE extracted with ethanol/water (2620 µmol Trolox/100 g and 250 mg

GAE/g, respectively). A RAW 264.7 mouse macrophage cell line was used to examine the anti-inflammatory properties of PSE. RAW 264.7 cells were treated with three concentrations of PSE (1, 2.5 and 5% (v/v)) and induced with an inflammatory marker, lipopolysaccharide (LPS). Western blotting analysis of COX-2 expression was significantly affected by PSE. PGE2 was measured by enzyme linked immunosorbant assay (ELISA).

Increasing concentrations of PSE induced with LPS showed a decrease in PGE2 concentration. This suppression of pro-inflammatory markers was found to be dose- dependent and demonstrates that PSE has anti-inflammatory properties.

To investigate the mechanism of action, the anti-inflammatory effects of PSE on inducible nitric oxide synthase (iNOS) and nuclear factor-kappa B (NF-κB) were identified as pathways of interest, because of its role as starting the onset of inflammation. We also wanted to investigate if iNOS and NF-κB could be further inhibited at a longer incubation, 12 and 18 hours. The Greiss assay was used to determine nitrite levels in culture media. There was an increase in NO production between 12 and 18 hours when RAW 264.7 macrophages were stimulated with the positive control LPS, however, PSE reduced NO production in a dose-dependent manner suggesting that inhibition had occurred. Isolation of nuclear fractions was performed for the NF-κB transcription factor assay. PSE significantly decreased NF-κB activity between 12 and 18 hours by inhibiting the RelA (p65) heterodimer.

PCR analysis of PSE showed nucleotide changes compared to the published iNOS sequence, suggesting that a snigle nucleotide polymorphism (SNP) was present Therefore, a suggested molecular mechanism of action for PSE would be the inhibition of NF-κB activity. This study highlights the need to investigate the relationship between antioxidant and anti- inflammatory properties of a waste by-product that has a potential use as an anti- inflammatory agent.

© Copyright 2013 by Wanida Lewis

All Rights Reserved Antioxidant and Anti-inflammatory Properties of Peanut Skin Extracts

by Wanida Lewis

A dissertation submitted to the Graduate Faculty of North Carolina State University in partial fulfillment of the requirements for the degree of Doctor of Philosophy

Food Science

Raleigh, North Carolina

2013

APPROVED BY:

Dr. Lisa Dean Dr. Leon Boyd Co-Chair Committee Chair Co-Chair Committee Chair

Dr. Van Den Truong Dr. Gabriel Harris DEDICATION

I dedicate this body of work to my parents, Walter and Wanda Lewis. Thank you for your continued support throughout my graduate career to see me grow into the woman I have become.

ii BIOGRAPHY

Wanida Erin Lewis was born on August 16, 1983 in Philadelphia, Pennsylvania to Mr. and Mrs. Walter and Wanda Lewis. Wanida has one younger sister, Whitney Lewis. Wanida graduated from Glassboro High School in May 2001 and began her Bachelor’s degree in

Chemistry at Saint Augustine’s College in Raleigh, North Carolina. As a chemistry major,

Wanida received the National Science Foundation Historically Black Colleges and

Universities Undergraduate Program (NSF HBCU-UP) scholarship and was a part of the first

HBCU-UP cohort at Saint Augustine’s College. While there, she participated in an NSF funded summer internship at the Food Science Department at North Carolina State

University investigating the antioxidant capacity of muscadine grape pomace under the direction of Dr. Leon Boyd. She continued her work under Dr. Boyd from the summer of

2002 until the winter of 2003. During her summer internship at North Carolina State, Wanida gained valuable experience in problem solving at the lab bench. In the spring and fall of

2003, Wanida presented her research findings at the North Carolina OPT-ED Alliance Day held at North Carolina State as well as the Science, Technology, Engineering and

Mathematics (STEM) Undergraduate Conference at Tuskegee University.

Wanida completed her B.S. in May 2005 and moved to Durham, North Carolina to pursue her Master’s degree in Analytical Chemistry at North Carolina Central University.

After her first year, Wanida was chosen to be an NSF North Carolina Louis Stokes Alliance

Minority Participate (NC-LSAMP) Bridge to Doctorate Fellow. Her thesis research investigated the extraction and characterization of procyanidins in muscadine grape seeds.

Wanida loved conducting research and developed her career by presenting her thesis work at

iii various conferences nationally. In March 2009, Wanida presented this work at the Minorities in Agriculture Natural Resources and Related Sciences (MANRRS) National Conference and won second place in the oral competition. Wanida completed her Master’s in May 2008.

Wanida began her doctoral program in August 2008 under the direction of Drs. Lisa

Dean and Leon Boyd. Her research focuses on the anti-inflammatory properties of bioactive compounds found in peanut skins in vitro. Wanida worked diligently in the lab to be successful in her research studies. At the 2009 National Organization for the Professional

Advancement of Black Chemists and Chemical Engineers (NOBCCHE) meeting, Wanida presented her research titled: Investigation of the Anti-inflammatory and Antioxidant Effects of Bioactive Compounds in Peanut Skins. She also presented her work at the Experimental

Biology National Conference in April 2012 titled: Anti-inflammatory Effects of Peanut Skin

Extracts on COX-2 in RAW 264.7 cells and was named the 2012 DSM Nutritional Young

Minority Investigator based on her research. In July 2012, Wanida was awarded the 2012

George Washington Carver Award at the American Peanut Research and Education Society’s

(APRES) Annual Conference in Raleigh, North Carolina for her graduate work and community service.

iv ACKNOWLEDGMENTS

I would like to give great appreciation to my major professor, Dr. Lisa Dean, for giving me the opportunity to work under her direction. I would also like to thank my co- major professor, Dr. Leon Boyd, for your continuing guidance, support and encouragement throughout this project. You have seen me grow into the young woman that I am today and I thank you. I would like to thank my other committee members, Dr. Keith Harris and Dr. Den

Truong for their guidance and support of this project. I would like to thank the peanut lab for their support: Dr. Tim Sanders, Dr. Jack Davis, Keith Hedrix (thanks for the laughs, statistics, current events discussions and your lending ear. I’ll miss our talks about music, K.

WOW reality show and the “your hair smells like cake” comments), Michael Sanders,

Chellani Hathorn, Amanda Stephens, Liz Hecht, Xiaolei Shi (thanks for the tea and laughs),

Jim Schafer (thanks for the lunch and facebook talks), Kristin Price (I enjoyed our running talks), Dr. Brittany and Sabrina Whitley-Ferrell (thanks for all that you do; you are my mom away from home). I would also like to thank the Harris lab for their help and assistance with the cell culture portion of this research, more specifically: Ruth Watkins (I will miss you!),

Chad Jordan, Amanda Draut, Sanja Cvitkusic, Sarah Cohen, Julie Wasko and Josh Kellogg.

Thank you to Mara Massel for all your help with PCR and answering my cell culture questions. I will miss you! Thank you to Dr. Debra Clare for her help with Western blotting!

I am grateful to have a supportive family for all of their prayers, support and encouragement. To my mommy, there aren’t enough words to describe how much you mean to me and how your support has gotten me through many hurdles. Thank you for never letting me quit and reminding me how to be a fighter. To my daddy, thank you for always

v being there to lend an ear no matter the time of day or place. Your words of encouragement even when they were less than 10 words have kept me going through this process. When I thought I almost lost you to cancer last year, you reminded me in that moment that no matter what, you keep going until you can’t anymore. I love you both and I could not ask for better parents. To my sister, Whitney, thank you for your support and little sister love. I know it’s hard in the beginning stages of this process called graduate school but I promise it will get better. I’m so proud of you!! Thank you to the Obeng’s: Cousin Eunice (thank you for the prayers that did miracles), Dr. Kofi and the future Dr. Efua (your big day is next). Thank you to my mentors: Dr. Harold Jeffreys, Dr. Brenda Alston-Mills, Dr. Tonya Gerald, Dr. Saundra

Delauder and Dr. Tiffany Bailey-Lash for your support, prayers and lending ears when the road got rough. I would like to thank the Spencers (Jilene and Maurice) for their support and always feeding me when I couldn’t afford it. Thank you to my “PhD sisters in science” who are paving the way for others and continued to pray for me daily: Roketa Sloan, Jo-sette

Wilkes, Dr. Brandi Toliver, A’ja Duncan, Rushyannah Killens and Shaina Whitworth. Thank you to my running buddies and Black Girls Run group for their prayers and support while getting a good run or half marathon in. Thank you to my friends who believed in me: Jenise

Hudson (Dr. J. Hud!), Devena Whitley-Pelzer, Jenaya Moody, Kia Rutledge, Sheanine Allen,

LaKendra Shephard, Makita Phillips, Themba Jones Bryant, Nashima Gillespie, Hoda

Brooks, Stacee Randall, Crystal Brown, Dana Jones, Dr. Jamie Kang, Rhonda Butts, Dr.

Porche Spence, and Dr. Ramsey Smith. I would also like to thank my line sisters who have stood by me: Christine Buchanan (my sister for life), Jennifer White, Jeanette Gardner,

Delesta Hicks-Drumgoole and Tonya Bethel as well as my chapter sorors for their support.

vi TABLE OF CONTENTS

LIST OF TABLES ...... x

LIST OF FIGURES ...... xi

CHAPTER 1: INTRODUCTION...... 1 References ...... 10

CHAPTER 2: LITERATURE REVIEW ...... 12 Dietary Polyphenolics and Polyphenolic Classes ...... 16 Polyphenols and Structure-Function Relationship...... 26 Peanuts ...... 29 Polphenolic Compounds in Peanuts ...... 31 Peanut Skins ...... 32 Phenolic Composition of Peanut Skins ...... 34 Chromatography Techniques ...... 37 Solid Phase Extraction (SPE)...... 37 High Performance Liquid Chromatrography (HPLC) ...... 38 High Performance Liquid Chromatrography- Mass Spectrometry (HPLC-MS) ...... 41 Antioxidant Activity...... 41 Equation 2.12.1...... 42 Equation 2.12.2...... 43 Oxygen Radical Absorbance Capacity (ORAC) ...... 44 Equation 2.13.1...... 44 Equation 2.13.2...... 44 Total Phenols ...... 45 Oxidative Stress...... 46 Inflammation ...... 49 Eicosanoids ...... 50 Polyphenolics and Anti-inflammatory Properties ...... 54 Anti-atherosclerosis and Cardioprotection ...... 55 Effect of the Regulation of Cell Cycle Progression by Polyphenols ...... 56 Cell Based Assays ...... 57 Conclusion and Summary ...... 61 References ...... 63

CHAPTER 3: ANTI-INFLAMMATORY EFFECTS OF PEANUT SKINS EXTRACTS ON COX-2 IN RAW 264.7 CELLS ...... 80 Abstract...... 81 Introduction...... 82 Materials and Methods ...... 86

vii Results ...... 91 References ...... 98

CHAPTER 4: ENHANCED ANTI-INFLAMMATORY EFFECTS OF PEANUT SKIN EXTRACTS ON NF-KB EXPRESSION IN TREATED RAW 264.7 MACROPHAGES ...... 107 Abstract...... 108 Introduction...... 109 Materials and Methods ...... 112 Results ...... 117 References ...... 127

CHAPTER 5: CONCLUSION AND FUTURE WORK ...... 145 References ...... 152

APPENDICES ...... 155 APPENDIX A: Statistical Analysis Output of PGE2 ...... 156 APPENDIX B: Kannapolis Eicosanoid Study.…………………………………………. 158 Introduction…………………………………...……………………………………….…. 158 Materials and Methods……………………………………………………………….…. .160 Results………………………………………………………………………………….…. 164 References…….……………………………………………………………………………167

viii LIST OF TABLES

CHAPTER 2 Total Procyanidin composition of peanut skins and grape seeds ...... 23

Yield of antioxidant activity of peanut seed testa………………………………………...26

Comparison of total antioxidant activity of peanut skins and green tea extracts………36

CHAPTER 3 Total Phenols and H-ORAC activity………………………………………..……………102

CHAPTER 4 Sum of Squares…….. ……………………...... 135

APPENDIX B

UPLCMS/MS Settings..……………………...... 162

MS/MS parameters for eicosanoid detection ...... 163

ix LIST OF FIGURES

CHAPTER 2

Figure 1: Structure of Flavonoid ...... 19

Figure 2: Structure of A and B-Proanthocyanidins...... 21

Figure 3: Structure of Ethyl Protocatechate ...... 25

Figure 4: Structure of Flavonol ...... 28

Figure 5: Peanut Plant ...... 30

Figure 6: Eicosanoid Pathway ...... 51

CHAPTER 3

Figure 1: Cell Viability (MTT) of Peanut Skin Extracts (PSE) ...... 103

Figure 2a and b: COX-2 Western Blotting Analysis ...... 105

Figure 3a and b: PGE2 Activity of PSE ...... 106

CHAPTER 4

Figure 1: Cell Viability (MTT) of PSE...... 134

Figure 2: LSMEANS Plot for Cell Viability...... 136

x Figure 3a and b: Cell Viability - 12 hrs………………………………………………….137

Figure 4a and b: Cell Viability - 18 hr…………………………………………………...138

Figure 5a and b: Nitric Oxide Analysis - 12 hr………………………………………….139

Figure 6a and b: NF-kβ Analysis for EPSE- 12 and 18 hr……………………………..140

Figure 7a and b: NF-kβ Analysis for APSE- 12 and 18 hr……………………………. 141

Figure 8: Gene Sequencing for inducible nitric oxide synthase (iNOS)……..……...... 142

APPENDIX A

Figure 1: PGE2 Analysis……………………………………………………………….....157

Figure 2: Multi-variate Analysis for PGE2………………………………………………158

APPENDIX B

Figure 1: LC/MS/MS Chromatograms………………………………………………….170

xi CHAPTER1:

INTRODUCTION

1 Peanuts. Peanuts are cultivated globally with the United States, India and China being the top peanut producing countries (Maiti and Wesche-Ebeling, 2002). Peanuts are grown primarily as an oil crop in most of the world but are used primarily for the production of peanut butter in the U.S. In 2011, the United States produced 3.64 billion pounds of peanuts

(American Peanut Council 2011). The typical compositions of peanut seeds are 40-50% fat,

20-30% protein, 10-20% carbohydrates and they are a good source of potassium, phosphorus and magnesium (Francisco and Resurreccion, 2008). They also contain vitamin E, niacin, folate, calcium, sodium, zinc, iron, riboflavin and thiamine (Francisco and Resurreccion,

2008).

Peanut Skins. Currently, the seed, which only represents 40% of the entire peanut plant, is the most economically important part of the peanut plant (Dean et al. 2008). The remaining parts of the peanut plant are typically regarded as waste products and presently have very limited uses. Peanut leaves, stems, and roots are most often plowed back into the soil after digging, with peanut leaves having some use as animal hay (Almazan and Begum

1996). During peanut processing, peanut hulls and skins are removed by shelling and blanching. These two components have been restricted to usage as animal feed or mulch.

However, due to the high content of polyphenols in peanut skins (approximately 5-8%), peanut skins cannot be used in very high levels in animal feeds (Dean et al. 2008). The content of polyphenolics polymerize with dietary protein making it unavailable for absorption (Hill 2002; Sobolev and Cole 2003). Nepote et al. (2002) reported peanut skins contain ~150 mg of total polyphenols per gram of defatted dry skin. The main compounds

2 are catechins, procyanidins and the flavonoids; 5, 7-dihydroxychromone, eriodictyol, and luteolin (Bolling et al. 2010). These natural antioxidants which are found in fruits, vegetables, grape seeds, grape skins and green tea and have been studied for their potential health benefits which includes cancer inhibition, reduction of cardiovascular disease risk and anti-inflammatory activities (Bolling et al. 2010; Kim et. al, 2004). Since the same active compounds found in certain fruits and vegetables are also found in peanut skins, it is logical to assume that peanut skins would have similar health promoting properties. Total antioxidant activities of skin extracts have been reported to be chemically higher in antioxidant potential than green tea (Yu et al. 2006; Wang et al. 2007). They have also been reported to be efficient free radical scavengers and metal chelators to prevent the Fenton reaction in muscle foods (Walgren et al. 2000; Wang et al. 2007). Metal-chelating activity is important in stabilizing food materials rich in metal ions such as muscle foods, which are prone to lipid oxidation (Decker and Welch, 1990). Van Ha et al. (2007) reported that the antioxidants that are present in skins can stabilize bound ferrous ions in muscle foods causing inhibition of lipid oxidation. The metal-chelating ability of these antioxidants is related to the presence of catechol or galloyl groups (Khokar and Apenten 2003; Moran et al. 1997).

Flavonoids have been widely reported to possess metal chelation properties (Whitehead et al.

1995; Fuhrman et al. 1995; Middeton and Kondasmami 1992). However, since these compounds vary in structure, only some of these compounds have been reported to have this attribute (Perron and Brumaghim 2009). Compounds such as epicatechin, gallic acid and quercetin are well known and highly effective metal chelators (Elhabiri et al. 2007; Erdogan et al. 2005; Kipton et al. 1982). The compounds listed above have also been reported in

3 peanut skins and would suggest that peanut skins would be great candidates for the stabilization of foods containing water and transient metal ions (Van Ha et al. 2007). Despite this, peanut skins have not been exploited for their underlying potential as a source of natural antioxidants (Sanders et al. 2000).

These health-promoting compounds can be extracted and used in a variety of food and pharmaceutical applications. Extraction procedures can affect the yield of antioxidant compounds (Ballard et al 2009; Van Ha et al. 2007). Extraction of phenolic compounds usually involves the use of a weakly acidified alcoholic solvent, followed by concentration under vacuum, purification, and separation of the compounds (Mazza and Miniati, 1993). To achieve an optimized extraction of phenolic compounds, polar solvents such as aqueous methanol, ethanol or acetone have been used for extraction purposes. Skins that are extracted with methanol have been reported to contain 165.5 mg/g total phenolics, while the content of total phenols was lower when using other solvents such as ethanol (118 mg/g total phenolics)

(Van Ha et al. 2007). Ballard et al. (2009) observed a reduction in total phenolics when using water as the main solvent for extraction compared to extracts from ethanol and methanol.

Although the antioxidant activity of peanut skins has been reported (Ballard et al. 2009; Van

Ha et al. 2007; Nepote et al. 2005, 2002), there are no reports in the literature concerning the relationship between antioxidant and anti-inflammatory properties of peanut skins. The content of individual phenolics does not reflect the real antioxidant activity of total phenolics because of the synergistic interactions that can occur between the active compounds that are present (Van Ha et al. 2007; Paur et al 2011). Therefore, it is considered more important to

4 study the antioxidant and anti-inflammatory activity of the complex of phenolics in peanut skins or their extracts than the activities of single pure phenolic compounds.

Inflammatory pathways. In order to study the anti-inflammatory effects of polyphenolics, the link between inhibition of prostaglandins and antioxidant activity needs to be established. Arachidonic acid is a polyunsaturated omega-6 fatty acid that is present in cell membranes and is the precursor to Prostaglandin H2 (Matsuyama and Yoshimura, 2008).

Free arachidonic acid is released when phospholipase A2, present in most membrane cells, attacks membrane phospholipids (Davies et al. 1984). As a result, arachidonic acid is converted into prostaglandins (PGs), beginning with the formation of prostaglandin H2

(PGH2). The PGH2 is the immediate precursor of many other prostaglandins and of thromboxanes. The PGH2 can be formed by a two-step process via metabolism of the cyclooxygenase (COX) pathway (Vane et al. 1998; Davies et al. 1984). In the first step of the reaction, COX activity introduces molecular oxygen to convert arachidonate to PGG2, an unstable endoperoxide intermediate (Vane et al. 1998). The second step is catalyzed by the peroxidase activity of COX, which converts PGG2 to PGH2. PGH2 further breaks down nonenzymatically to produce prostaglandins E2 and D2 (PGE2 and PGD2).

Prostaglandins are key mediators in inflammation and are associated with cancers.

Prostaglandins (PGs) are a family of messengers that contains 20-carbon atoms and includes a 5-carbon ring (Needleman, 1986). In humans, PG’s act on an array of cells thus having a wide variety of effects including blood clotting, ovulation, initiation of labor, wound healing, immune response, nerve growth and development (Hamberg and Samuelsson, 1971).

Prostaglandin E2 (PGE2) is the major PG that is produced by macrophages. COX-2

5 expression is induced in response to intrinsic factors, such as cytokines, or extrinsic factor, such as lipopolysaccharide (LPS), therefore, leading to the production of PGE2 (Huang and

Wu, 2002). Several studies have shown that some phenolics in foods may enhance or inhibit

PG formation and potentially affect the inflammatory response (Han et al. 2007; Halliwell and Whitman 2004; Escarpa and Gonzales 2001). For example, in low doses, catechin dimers have been reported to have an anti-inflammatory effect by inhibiting PG synthesis (Damas et al. 1985). Therefore, it may be useful to investigate the effect of foods and food extracts on

COX-2 expression and PG formation in terms of the pathophysiological diseases that are strongly associated with inflammation.

The inflammatory pathway studied in this work is the nuclear factor kappaB (NF-κB) transcription factor pathway. NF-κB plays a vital role in the regulation of immune response to infections as it is the central mediator of inflammation. Incorrect regulation of NF-κB has been linked to cancer, autoimmune and inflammatory diseases (Makarov, 2001). In order for

NF-κB to function, it must move to the nucleus. Natural products including antioxidants that have been reported to exhibit anti-inflammatory activity also inhibit NF-κB activation. Paur et al. (2011) has reported that extracts from various herb and dietary plants such as oregano, walnuts and thyme are efficient inhibitors of NF-κB activation in vivo and in vitro. The NF-

κB inhibition that they observed was due to rosmarinic acid in thyme and oregano and essential fatty acids, linoleic acid, α-linoleic acid (ALA), and polyunsaturated fatty acids

(PUFA) in walnuts. Polyphenols have been reported to possess anti-inflammatory activity by altering NFκB activation (Rahman et al. 2006; 2004). Polyphenolics in green tea such as (-)- epigallocatechin-3-gallate (EGCG) has been reported to inhibit tetradecanoylphorbol 13-

6 acetate (TPA) induced DNA binding of NF-κB in vivo (Khan and Mukhtar, 2008). The assumed mechanism of action inhibited IL-1β-mediated IL-1β-receptor-associated kinase

(IRAK) degradation thereby causing a downstream effect on signaling events promoting

IRAK degradation. As a result, inhibition of nuclear factor kappa-B kinase (IKK) activation,

IκBα degradation, and NF-κB activation occurred. In addition, EGCG inhibited phosphorylation of the p65 subunit of NF-κB (Kundu and other, 2007).

In vitro approach. In order to study these effects, the LPS-induced RAW 264.7 murine macrophage cell model was used. Macrophage cells are vital to the regulation of immune responses and the development of inflammation. Previous studies of inflammation have used RAW 264.7 murine macrophage cells because of their ability to enhance inflammation by secreting pro-inflammatory factors, such as tumor necrosis factor (TNF) and interleukin 1β (IL-1β) (Pallarès et al. 2011; Permana et al. 2006). The focus of this study is to determine the anti-inflammatory and antioxidant effects of peanut skins using this cell model. The reduction of pro-inflammatory prostaglandins expressed in RAW 264.7 macrophage cells will be identified using enzyme-linked immunosorbant assays (ELISA).

Hypothesis

1. Peanut skin extracts contain bioactive compounds that have antioxidant activity and

anti-inflammatory properties.

2. An in vitro approach to studying the anti-inflammatory response of peanut skins will

provide insight into peanut skin extracts’ effectiveness as an anti-inflammatory agent

that has not been reported.

7 Objectives

The objectives of this research study were as follows:

1. Optimization of an extraction system for bioactive compounds using polar solvents,

aqueous ethanol and acetone.

2. Determination of the anti-inflammatory activity of bioactive compounds from peanut

skin by using a murine macrophage cell line induced by lipopolysachharide (LPS) to

initiate inflammation.

3. Determination of peanut skins as anti-inflammatory agents to inhibit

Cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS) expression.

4. Determination of NF-κB as the correct molecular mechanism of action to explain

anti-inflammatory effect of peanut skin extracts.

5. Comparison of the anti-inflammatory response of peanut skin extracts produced by

the solvent systems used.

Significance/Impact

Peanut skins contain high levels of bioactive compounds including catechins and procyanidins, which have been shown to have antioxidant properties in chemical assays.

However, very little evidence has been reported on peanut skins anti-inflammatory properties. Using an in vitro approach to characterize the anti-inflammatory response from peanut skin extracts will enhance our knowledge of a less well studied property of this waste by-product. This information may also answer the question whether the antioxidant activity of peanut skins is related to its effectiveness as an anti-inflammatory agent. Determination of the anti-inflammatory properties of peanut skin extracts will directly benefit the peanut

8 industry by allowing it to capitalize on the potential health benefits of this waste material while gaining additional profit from antioxidant enriched extracts useful to food and nutraceutical industries.

9 References

Almazan, A.M. and Begum, F. Nutrients and antinutrients in peanut greens. 1996. J Food Comp Anal. 9(3):75-83.

American Peanut Council. Peanut Information, 2011. http://www.peanutsusa.org.uk/Europe/index.cfm?fuseaction=home.page&pid=55. Accessed March, 2012.

Ballard T, Mallikarjunan P, Zhou K, O'Keefe S. 2009. Optimizing the extraction of phenolic antioxidants from peanut skins using response surface methodology. J Agri Food Chem. 57(8):3064-3072.

Bolling BW, McKay DL, Blumberg JB. 2010. The phytochemical composition and antioxidant actions of tree nuts. Asia Pac J Clin Nutr. 19 (1):117-123.

Damas J, Bourdon V, Remacle-Volon G, Lecomte J. 1985. Pro-inflammatory flavonoids which are inhibitors of prostaglandin biosynthesis. Prostagl Leukot Med 19, (1): 11- 24.

Davies P, Bailey PJ, Goldenberg M M. 1984. The role of arachidonic acid oxygenation products in pain and inflammation. Ann Rev Immunol. 2:335-357.

Dean LL, Davis JP, Shofran BG, Sanders TH. 2008. Phenolic profiles and antioxidant activity of extracts from peanut plant parts. Open Nat Prod J 1. (1):1-6.

Decker EA and Welch B. 1990. Role of ferritin as a lipid oxidation catalysts in muscle food. J Agric Food Chem. 38:674–677.

Elhabiri M, Carrer C, Marmolle F, Traboulsi H. 2007. Complexation of iron(III) by catecholate-type polyphenols. Inorg Chim Acta. 360:353–359.

Erdogan G, Karadag R, Dolen E. 2005. Potentiometric and spectrophotometric determination of the stability constant of quercetin (3, 3’4’,5, 7-pentahydroxyflavone) complexes with aluminium(III) and iron(II). Rev Anal Chem. 24:247–261.

Escarpa A, Gonzales MC. 2001. An overview of analytical chemistry of phenolic compounds in foods. Crit Rev Anal Chem. 31:57-139.

Fuhrman B, Lavy A, Aviram M. 1995. Consumption of red wine with meals reduces the susceptibility of human plasma and low-density lipoprotein to lipid peroxidation. Am J Clin Nutr. 61(3):549-554.

10 Francisco MLDL, Resurreccion AVA.2008. Functional components in peanuts. Crit Rev Food Sci Nutr. 48(8):715-746.

11 CHAPTER 2:

LITERATURE REVIEW

12 2.1 Introduction

Chronic or noncommunicable diseases (NCD) are one of the leading causes of mortality in the world. These diseases include diabetes, heart disease, stroke and cancer. The

World Health Organization estimated that 35 million people die from chronic disease annually (World Health Organization, 2009). Growing evidence suggests the incidence of chronic diseases can be linked to a number of factors, including tobacco smoking, lack of physical activity and an unhealthy diet consisting of high-calorie foods (Blomhoff, 2005).

Over 2.7 million deaths are attributed to low fruit and vegetable intake (World Health

Organization, 2009). Adequate consumption of fruits and vegetables reduces the risk for cardiovascular diseases and some cancers: stomach cancer and colorectal cancer (World

Health Organization, 2009; Lampe, 1999). There is evidence that the consumption of processed foods that are high in fats and sugars contributes to mortality and helps to promote obesity compared to consumption of fruits and vegetables (Blomhoff, 2005). Fruits and vegetables as part of the daily diet may help prevent NCD (World Health Organization,

2009). It has been reported that consumption of various vegetables and fruits provides an adequate intake of most micronutrients, dietary fibers and a host of essential non-nutrient substances (World Health Organization, 2009). If these major risk factors associated with

NCD’s were to be eliminated, at least 80% of heart disease, stroke and type 2 diabetes could be prevented (World Health Organization, 2009).

Research has shown that consumption of plant-based foods may have the ability to suppress the pathologies linked to several chronic diseases (Scalbert et al. 2000; Escarpa et al. 2001; Kris-Etherton et al. 2002). Moreover, plant-based compounds known as

13 polyphenols have been shown to have therapeutic properties that aid against chronic diseases mainly from their free radical scavenging and metal chelating properties as well as their effects on cell signaling pathways and gene expression (Prakash and Kumar, 2011; Tiwari,

2001).

Polyphenols have antioxidant properties as well as anti-microbial, anti-inflammatory, anti-cancer and anti-allergic properties. Over one million natural polyphenols exist but vary in chemical structure (Hermann, 1976; Wollenweber, 1981). Polyphenols are defined as a group of chemical substances characterized by the presence of having more than one phenol group. Various hypotheses have been suggested for the protective effects of polyphenols in animal models and in vitro model systems (Arts and Hollman, 2005). Some of these effects include regulation of nitric oxide, trapping and scavenging of free radicals and activation of apoptosis (Arts and Hollman, 2005). Classes of polyphenols include flavonoids, anthocyanidins, phenols, and stillbenes amongst others. Polyphenols generally occur as glycosides with sugar moieties; however, these moieties can vary with binding forms.

Bioactivity of polyphenols is attributed to agylcon structures and hydrogen-donating properties of the phenolic hydroxyl groups (Blomhoff, 2005; Sakakiara et al. 2003).

Antioxidant potency is due mainly to the catechol structure in aglycons (Ashida et al. 2000).

Therefore, specificity of interaction with proteins is contingent on the steric structures of the aglycons, which may be governed by noncovalent binding (Sakakiara et al. 2003).

Polyphenols can be found in vegetables, fruits and teas, nuts and legumes, especially peanuts (Talcott et al. 2005; Yu et al. 2005; Mazur et al. 1998). Polyphenols are classified as natural antioxidants and are shown to possess potential health benefits by preventing

14 degenerative diseases such as cardiovascular disease and cancer through antioxidant action and/or the modulation of several protein functions (Blomhoff, 2005). Natural antioxidants including resveratrol, catechins and anthocyanins found in red wine and grapes have been shown to lower the risk of cardiovascular diseases (Rice Evans et al. 1996; Renaud and de

Lorgeril, 1992).

Peanuts were once stigmatized as a high fat food and not included in diets for persons who had caloric restrictions. Many varieties of nuts and legumes have a high amount of fat

(e.g. pecan: 70%, macadamia nut: 66%, Brazil nut: 65%, peanut: 50%, peanut butter: 55%) as well as significant protein levels (10-30% range) (Blomhoff et al. 2006). In the past few decades, nuts and legumes have received a great deal of recognition for containing potentially rich antioxidant compounds as well as containing ratios of saturated, monsaturated and polyunsaturated fatty acids (MUFA’s and PUFA’s) that may have positive health effects (Kris-Etherton et al. 2008; Emekli-Alturfan et al. 2007; Alper et al. 2003; Chen et al. 2002). According to the USDA database, 100 g of peanut oil contains 16.9 g of saturated fat, 46.2 g of monounsaturated, and 32 g of polyunsaturated fat (USDA, 2011).

Jackson et al. (1978) reported that oils containing high content of MUFA’s such as oleic acid are more stable to oxidative damage during refining and storage. On the other hand, Kratz et al. (2002) describes linoleic acid, a PUFA as more susceptible to oxidative rancidity than oleic acid because it contains two double bonds. However, linoleic acid, an essential fatty acid, has been reported to lower total blood cholesterol and LDL levels, which is vital for human health (Bolling et al. 2010; Chen and Blumberg, 2008; Chen et al. 2002; Ellsworth et al. 2001; Francisco and Resurreccion, 2008; Jenkins et al. 2008; Jiang et al. 2006). The long

15 term stability of peanut oil may also be associated with the antioxidant substances

(tocopherols and polyphenols) present in peanut oil as minor components.

Researchers have found that peanut consumption provides health benefits such as prevention against cardiovascular disease and cancer inhibition (Isanga and Zhang, 2007).

Jiang et al. (2006) has addressed this issue by directly evaluating nut and peanut butter consumption on the risk of developing type 2 diabetes. This study showed that there is an inverse association between nut consumption and type 2 diabetes risks. Persons who consumed nuts five times or more per week lowered their risks of developing diabetes by

27% compared to those who rarely or never ate nuts. Consumption of peanut butter has also been shown to lower the risk of developing diabetes. Persons who had a higher intake of peanut butter, greater than five times per week, had a lower risk of diabetes. This provides even greater evidence that the ratio of monounsaturated and polyunsaturated fatty acids in peanuts may be more beneficial than originally thought.

This evidence not only shows that nuts are not detrimental but may serve a role in reducing risks of coronary heart disease and possibly diabetes. It has been reported that several important components from whole nuts such as lipids are poorly absorbed and this was attributed to the cell wall structures in nuts (Jiang et al. 2006). Therefore, it is important to investigate the relationship of nutrient bioavailability and bioaccessibility in whole nuts.

To our knowledge there is no existing knowledge documenting this relationship.

Dietary Polyphenolics and Polyphenolic Classes

Dietary polyphenols are found naturally in fruits and vegetables. They are the most abundant antioxidants in the human diet with over 8,000 structural variants (Han et al. 2007).

16 Plant phenolics are used in the defense against UV radiation as well as aggression by pathogens and parasites. However, plant phenolics also serve as a contributor to a plant’s color (Dai and Mumper 2010). They are ubiquitous in plant organs and are therefore an important part of the human diet. Phenolics are of great importance for cellular support

(Strack 1997). They form polymeric materials such as lignins and suberins for cell wall support as well as providing barriers against microbial invasion (Strack 1997). Three different routes have been reported to produce plant phenolics:

1. shikimate/arogenate pathway

2. acetate/malonate pathway (polyketide)

3. acetate/mevalonate pathway.

The skimiate/ arogenate pathway produces the majority of plant phenolics, phenylpropane derivatives (phenylpropanoids) (Strack 1997). Some phenolics, such as hydroxybenzoate gallate, are formed from intermediates of this pathway. This pathway is found only in microorganisms and plants (Herrmann and Weaver 1999). The acetate/molanate pathway leads to formation of some plant quinones and a large group of flavonoids (Strack 1997). The acetate/mevalonate pathway via dehydrogenation reactions leads to some aromatic terpenoids, mostly monoterpenes (Strack 1997). The shikimate/arogenate and polyketide pathways are the most important for the biosynthesis of plant phenolics (Strack 1997).

Polyphenols are very diverse in structure and comprised of various classes such as flavonoids, anthraquinones and simple polyphenols. The most significant function of phenolic flavonoids, in particular anthocyanins, combined with flavones and flavonols as co- pigments, is their contribution to flower and fruit colors. However, flavonoids have also been

17 reported to act as signal molecules for certain members of leguminous plants (Mandal et al.

2010). These plants secrete flavonoids, which act selectively as inducers of nodulation (nod) regulatory proteins (Fox et al 2001). As a result, nod gene products gives rise to the formation of root nodules, which enables the plant to use atmospheric nitrogen through the action of nitrogenase, a bacterial nitrogen-activating enzyme (Zawooznik et al 2001).

Phenolics are also of great importance to humans because they are good sources of natural antioxidants.

Flavonoids

Flavonoids are benzo-γ-pyrone derivatives consisting of phenolic and pyrane rings

(Heim et al 2002; Hollman et al. 2000). They are the largest class of compounds and can be found in the leaves, seeds, bark and flowers of plants distributed throughout the plant kingdom. Flavonoids are responsible for the color of fruits and vegetables and can have various functions in nature. Flavonoids are comprised of six classes: anthocyanins, a glycosylated derivative of anthocyanidin and anthoxanthins, flavones, flavanones, flavanol, flavonol and isoflavone based on its saturation level and pattern of substitution on the C ring

(Cao et al. 1997; Williams et al. 2004). Anthoxanthins are a group of colorless compounds and are further divided into several categories including flavones, flavans, flavonols, flavanols, isoflavones and their glycosides (Han et al. 2007). Representative compounds of flavanols are myricetin and quercetin. Flavonoids are classifed according to their substituents, described in Figure 1 as R1, R2 and R3. Dietary flavonoids differ in their arrangement of hydroxyl, methoxy and glycosidic side groups as well as its conjugation between the A and B-rings seen in Figure 1. During metabolism, hydroxyl groups are added,

18 methylated, sulfated or glucuronidated. In food, flavonoids primarily exist as 3-O-glycosides and polymers (Hammerstone et al. 2000). The spatial arragement of substituents is a greater determinant of antioxidant activity than the flavan backbone activity (Heim et al. 2002).

Configuration and total number of hydroxyl groups influence several mechanisms of antioxidant activity (Sekher Pannala et al. 2001; Burda and Oleszek 2001; Cao et al. 1997).

Flavones have the basic structure consisting of the three phenolic rings. Flavonols have the basic structure but differs from flavones as it has a hydroxyl group at the 3-position. The other subclasses of flavonoids have a variety of substitutions involving hydroxyl and/or methoxyl groups. Simple polyphenols include two subclasses: cinnamic and benzoic acids. A few examples of the subclass cinnamic acid are coumaric, ferulic and caffeic acids.

Protocatechuric, gallic and vanillic acids are examples of benzoic acids, respectively.

R2

OH

HO O R3

R1

OH O

Figure 1: General Structure of Flavonoid.

Flavonoids exhibit antimicrobial and antioxidant activity along with prevention of diseases especially cardiovascular disease. The ability of flavanoids to scavenge free radicals

19 is due to the multiple OH substitutions present in their structure (Cao et al. 1997). The investigation of flavonoids present in peanuts began when studies indicated that peanuts might reduce the risk of cardiovascular disease. Their biological and pharmacological effect on human physiology has been studied. Blomhoff et al. (2006) reviewed the antioxidant capacity of dietary plants including legumes. They reported that several nuts are among the dietary plants that had a high antioxidant content including walnuts, pecans and chestnuts.

However, they stated that peanuts, a legume, also contributed significantly to having a dietary intake of antioxidants by being rich in flavonoids. Yang et al. (2005) determined the total flavonoid contents of both soluble and bound forms of ten nuts (walnuts, pecans, pistachios, etc.) commonly consumed in the U. S. including peanuts. Although walnuts had the highest flavonoid content (745 ± 93 mg/100g) peanuts had a significant amount of total flavonoid content. More than 15 polyphenolics have been identified in peanuts (Duke 1992).

Fajardo, Waniska, Cuero and Petit (1995) observed a stress-elicited synthesis of free and bound phenolics in peanuts, with p-coumaric and ferulic acid as the major compounds identified. Prior and Gu (2005) further investigated the proanthocyanidins content of the ten nuts from the Yang et al. (2005) study in terms of interflavan linkage, degree of polymerization and percentage of polymers. They concluded hazelnuts had the highest amount of proanthocyanidin content (500.7 ± 152.0 mg/100 g proanthocyanidin) unlike peanuts, which were reported to contain 15.6 ± 2.7 mg/100 g proanthocyanidin. Mazur et al.

(1998) and Mazur (1998) analyzed the isoflavonoid content of food legumes, with genistein being the primary isoflavone present in peanuts (64 µg/100g). The peanut seed itself is not the only source of flavonoids. Outer layers such as the skin, shell or hull contain a larger

20 amount of polyphenolic compounds to protect the seed (Francisco and Resurreccion, 2008).

Tannins

Proanthocyanidins generally referred to as “tannins”, are responsible for the bitter or astringency taste in red wines. These compounds are noted to be especially concentrated in the skin and seeds of fruits. Proanthocyanidins are the second most abundant natural phenolic compound (Gu et al. 2003). The proanthocyanidin structure is composed of oligomers of flavan-3-ol monomer units linked mainly through C4→C8 bonds. One of the classes of proanthocyanidins is procyanidins. Procyanidins contain chains of (+)-catechin and (-)- epitcatechin units and its gallic acid esters. They are linked by carbon-carbon and occasionally carbon-oxygen-carbon bonds. A-type proanthocyanidins consist of an additional ether bond between C2→O7 (Figure 4). C4→C6 linkages are also present and are known as

B-type proanthocyanidins (Figure 2).

OH HO

OH O OH

OH OH HO OH O OH OH OH OH O HO O OH O OH

OH OH

HO HO

Figure 2: Structure of A and B-type proanthocyanidin.

Rasmussen et al. (2005) reported that most plant-based foods contain B-type procyanidins.

Gu et al. (2003) reported that A-type procyanidins could be found in peanuts, plums,

21

avocado, curry and cinnamon. Karchesy and Hemingway (1986) reported that peanut skins contain about 17% by weight of procyanidins, nearly 50% of which are low molecular weight oligomers. Lou et al. (1999) identified six water-soluble A-type procyanidins from peanut skins. Peanut skins have also been demonstrated to be a rich source of catechins, B- type procyanidin dimers, procyanidin trimers, tetramers and oligomers but with a higher degree of polymerization (Yu et al. 2006). Procyanidins and total phenolic content in peanut skins were shown to have a higher total antioxidant activity (TAA) and free radical scavenging capacity than vitamin C at equivalent concentrations. That study also indicated that due to these characteristics, peanut skins are an excellent yet inexpensive source of health promoting phenolics. Higher concentrations of these compounds have been measured in raw peanut skins compared to roasted skins (Yu et al. 2006). Isanga and Zhang (2007) reported that there is a higher amount of catechin in raw peanut skins compared to roasted skins as seen in Table 1. Total catechins, procyanidin dimers, trimers and tetramers measured in raw peanut skins as 16.1, 111.3, 221.3 and 296.1 mg/100 g compared to 8.8, 143.5, 157.53 and 203.9 mg/100 g in roasted dry skin. Constanza et al. (2012) measured antioxidant capacity in spray dried peanut skin extracts. Among the polyphenolic compounds extracted and concentrated using spray drying, procyanidins were the most abundant.

22

Table 1. Total procyanidin composition of peanut skins and grape seeds (mg/100 g dry a b sample). NR=not reported. Yu et al (2006). Fuleki and Ricardo da Silva (1997).

Source Type Procyanidin Procyanidin Procyanidin Procyani monomers dimers trimers din (catechins) tetramers

a Peanut skin Untreated 16 111 221 296 jhyh Roasted 9 144 158 204 G rape seeds Cabernet 232 169 26 NR v arieties b franc Cabernet 125 95 32 NR

Gamay 228 375 67 NR

Merlot 143 97 23 NR

Pinot noir 437 235 84 NR

Chardonnay 141 126 9 NR

Riesling 49 54 7 NR

Bagchi et al. (1998) reported that when procyanidins from grape seeds were consumed in

an animal model study, data showed that chemically induced LDL peroxidation occurred.

DNA fragmentation and subsequent apoptosis were also inhibited. Natella (2002) reported

that the same occurrence could be displayed in humans who consume a diet rich in grape

seeds. Procyanidins that were measured in grape seeds decreased lipid peroxidation of

LDL cholesterol levels while increasing radical scavenging capacity. These same

compounds are reported in peanut skins.

23

Proanthocyanidins are widely present in fruits, berries, nuts, wine and beer and have been reported to possess a variety of physiological activities such as antioxidant, antimicrobial, as well as enzyme inhibition and receptor blocking (Gu et al. 2002). These classes of compounds are often characterized as having a basic phenol ring and when present in skins, they most often are present as multiple-ring structures known as monomers, dimers, trimers, tetramers, and oligomers. Although both possess similarities in structure, these compounds are often referred to as flavonoids and further subdivided into some 14 different classes depending on the specific ring structure. All of these compounds are characterized as containing one or more attached hydroxyl group and it is the presence of multiple hydroxyl groups that designates these compounds as potent antioxidants.

As antioxidants, procyanidins have been demonstrated to solicit a variety of

biological responses associated with free radical scavenging activities including anti-

inflammatory activity, anti-tumor anti-microbial, apoptosis, angiogenesis, etc. Numerous

studies have been conducted using both in-vitro cell culture models and animal models, in

which the activities of procyanidins prevented cancer growth, were effective in preventing

the oxidation of LDL-cholesterol, protected the activity of natural in-vivo antioxidants such

as glutathione peroxidase, and prevented tumor growth in artificially induced cancers (Rice-

Evans and Packer, 2003; Rice-Evans et al. 1995). These studies have been demonstrated in a

variety of fruits and vegetables as well as documented in peanuts (Yen and Duh, 1994).

Studies on the identification of catechins have been most commonly done using tea, in

particular in green tea. Eighty percent of the total flavonoid content in tea is comprised of

24 catechins, which constitute up to 30% of dry leaf weight (Ho 1992). The catechins found in green tea include epicatechin (EC), epigallocatechin (EGC), epigallocatechin-gallate (EGCG) and epicatechin-gallate (ECG) (Yu et al. 2006; Fuleki and Ricardo da Silva, 1997). These same groups of compounds are also found in peanut skins (Table 1).

Ethyl Protocatechuate

Huang et al. (2003) isolated ethyl protocatechuate from peanut skins (Figure 3). Yen et al. (2005) observed the antioxidant activity of ethyl protocatechuate in ethanolic extracts of peanut seed testa. It was found that extracts and antioxidant potency have a dose- dependent activity on the inhibition of liposome peroxidation. This relationship was shown to be effective in protecting protein against oxidative damage when 50-500 mg/L of ethanolic extracts of peanut seed testa and ethyl protocatechuate were used (Yen et al.

2005). Both ethanolic extracts of peanut seed testa and ethyl protocatechuate showed a scavenging effect of 92.6 and 84.6 % respectively on α,α-diphenyl-β-picrylhydrazyl radical.

This would indicate that they could take on the role of primary antioxidants.

OH

OH

O

O

Figure 3: Structure of Ethyl Protocatechuate.

25 Huang et al. (2003) showed that ethyl protocatechuate plays a role in preventing lipid oxidation and contributes to the antioxidant activity of ethanol extracts of peanut seed testa.

Table 2 shows the antioxidant activity and yields of peanut seed testa extracted with various solvent systems. Out of all the solvents used, ethanol produced the highest yield followed bymethanol, acetone, ethyl acetate and hexane respectively. The antioxidant activities of each solvent extract were compared to commercial antioxidants dl-α-tocopherol (Toc) and butylhydroxl anisole (BHA), which is shown in Table 2 (Isanga and Zhang, 2007). Among the five extracts, the ethanol extract at 200 ppm was demonstrated to have the highest antioxidant activity (Huang et al. 2003). The extract was even higher than Toc at 200 ppm.

Table 2. Yield and antioxidant activity of peanut seed testa extracted with various solvents (Isanga and Zhang 2007).

B Sam Yield Antioxidant a ple (mg) c–e activity (%)

MEPST, methanol extracts of peanut seed testa 212.4 93.5

EEPST, ethanol extractsof peanut testa 252.8 95.8

AEPST, acetone extracts of peanut seed testa 199.0 3.0

HEPST, hexane extracts of peanut seed testa 35.1 3.0

EAEPST, ethyl acetate extracts of peanut seed testa 90.4 0.3

BHA 76.1

Toc 99.0

26 Hsieh et al. (2001) reported that ethyl protocatechuate was a major source of the inhibitory effect against LDL oxidative modification induced by Cu2+ ions. This role was demonstrated to be effective when ethyl protocatechuate was used as an antioxidizing agent in rat liver against diethylnitrosamine and in rat oral cavity against 4-nitroquinoline-1-oxide (Tanaka et al. 1993; Tanaka et al. 1994). Hence, this compound protects these organs against damaging effects of free radicals. Research has shown that ethyl protocatechuate could be used in food preservation and can protect lipids against oxidation (Isanga and Zhang, 2007). However, an overdose of 500 mg/kg of ethyl protocatechuate can enhance tumorigenesis, induce hypersensitivity in mouse skin, and disturb the detoxification of ultimate carcinogens

(Nakamura et al. 2001, 2003). Therefore, before the use of ethyl protocatechuate as a food additive or phytochemical agent, safety and toxicology measures should be extensively studied.

Polyphenols and Structure-Function Relationship

Free radical scavenging and antioxidant activity of phenolics is contingent on the

arrangement of functional groups in the compound (Williams et al. 2004). The number and

configuration of H-donating hydroxyl groups influences a polyphenol’s antioxidant activity

(Williams et al. 2004). For example, the antioxidant activity of proanthocyanidin dimers is

attributed to its hydroxyl groups, which can donate hydrogen electrons (Williams et al.

2004). This is also seen in flavonoids, which consists of A and C rings of benzo-1-pyran-4-

quinone and a B ring, commonly known for their antioxidant activity. Figure 4 shows the

structure of quercetin, the most common and biologically active flavonol that possesses

important features that define antioxidant activity. The presence of the B-ring is capable of

27 donating hydrogen to stabilize radical species. Other structural features that are important are the presence of unsaturation in the C-ring, the 4-keto group and the 3-hydroxyl moiety in the C-ring. These features are important for electron delocalization, especially when the o- dihydroxy group in the B-ring is present (Williams et al. 2004). Among the monomeric flavan-3-ols, a reduced number of hydroxyl groups results in lower antioxidant activity whereas; higher antioxidant activity is seen in gallate molecules. This is due to the presence of gallayl moieties that are attached to the flavan-3-ol at the 3-position (Soobrattee et al.

2005).

Figure 4: Structure of the flavonol: quercetin and highlighted features of flavonoid antioxidant activity (Soobrattee et al., 2005).

Antioxidant activity is one of the most studied areas in regards to the bioactivity of phenolic compounds. Studies have shown that the consumption of fruits and vegetables can reduce the risks of cardiovascular disease, diabetes and cancer, through the biological actions

28 of phenolic components as well as antioxidant vitamins (Proteggente et al. 2002; Ahmad et al. 2001; De Beer et al. 2003). Pure phenolic compounds have the ability to scavenge free radicals in vitro. This has been demonstrated with both synthetic free radicals such as (2, 2- diphenyl-1-picrylhydrazyl) (DPPH) as well as with relevant superoxides, peroxyl and hydroxyl radicals (Proteggente et al. 2002).

Peanuts

Peanuts (Arachis hypogea) are grown all over the world (Maiti and Wesche-Ebeling,

2002). The peanut is native to the Western hemisphere and is able to grow in tropical and subtropical regions between 25-28 °C and about 500 mm rainfall in open soil (Maiti and

Wesche-Ebeling, 2002). They have a high nutritional value and are unique in being the only legume to grow below ground as seen in Figure 5. What makes the peanut different from other nuts is its ability to adapt to a diversity of climates around the world due to its being a soil-enriching, nitrogen-fixing legume. Peanuts are an important crop in the Southeastern

United States as well as other regions worldwide. They are very inexpensive and are used as a food source for diets in rural populations, such as Nigeria (Bankole and Eseigbe, 2004).

The United States, India and China are the world’s leading peanut producers. In the

United States, nine states account for 99% of all peanut grown: Georgia, North and South

Carolina, Alabama, Florida, Virginia, Texas, Oklahoma and New Mexico. Of these nine states, Georgia accounts for 41% of the production followed by Texas (24%), Alabama

(10%), North Carolina (9%), Florida (6%), Virginia (5%) and Oklahoma (5%) (American

Peanut Council, 2006). Other countries utilize peanuts mainly for oil production while the

United States accounts for 50-60% of the edible market (Isanga and Zhang, 2007).

29

Figure 5: Peanut plant http://www.americasbestnutco.com/generalinfo.html.

Peanuts serve various purposes as food (raw, roasted or boiled seeds and oil), animal feed and industrial raw material (soap and cosmetics). In the United States edible parts of the peanut include the kernel and protective skin and are used to make roasted peanut snacks, peanut oil, and peanut butter among others. There are four market types of peanuts grown in the United States: runner, virginia, spanish and valencia (Maiti and Wesche-Ebeling, 2002).

Runner peanuts have become the dominant type since the 1940’s in the southeastern region of the United States and are used for peanut butter and salted peanuts. The virginia type is known for its large seed and accounts for most of the peanuts roasted and eaten as in-shells.

Valencia varieties may contain three or more bright red seeds in a single pod and are grown mostly in the Southwest (American Peanut Council, 2006). This variety is preferred for boiled peanuts and can be sold as roasted and salted in-shell peanuts.

30 Polyphenolic compounds in peanuts

There is evidence that peanuts could be a major food source with antioxidant potential. Peanuts are a natural source of antioxidants containing several flavonoids as well as containing resveratrol at levels comparable to tree nuts such as pistachios, therefore, providing free radical scavenging activity (Lou et al. 2004). Resveratrol levels in peanuts range from 3 to 193 μg/100g in peanuts. This range is comparable to that reported in pistachios (9 to 162 μg/100g) (Lou et al. 2004). Peanuts have also been reported to contain isoflavones (Yu et al. 2006). Other antioxidant compounds that have been reported in peanuts are proanthocyanidins. Peanut proanthocyanidins mainly consist of (+)-catechin and (-)- epicatechin and afzelechin (Liu et al. 2011; Lou et al. 1999). A-type proanthocyanidins,

4β→8 and 2β→O→7 interflavanoid bonds, have been found only in almonds and peanuts

(Bolling et al. 2010).

Stilbene phytoalexins have been isolated from the extracts of germinating seeds or from stems of peanuts. Cis- and trans-isomers of stilbene derivatives that are closely related to 3, 4, 5-trihydroxy-4- isopentenylstilbene were reported (Ingham, 1976). Two related but distinct compounds from the fungus-infected plant embryos of an African-grown cultivar of peanut and identified as cis- and trans-3,4,5-trihydroxystilbene (resveratrol).

Isopentenylstilbenes and resveratrol are stilbene phytoalexins elicited in the peanut seeds by wounding, usually by slicing, and incubating the seed slices in the dark (Hart, 1981; Dorner et al. 1989; Basha et al. 1990; Mohanty et al. 1991; Arora and Strange 1991). These compounds provide free radical scavenging activity (Chen et al. 2008). These same compounds are also found in peanut skins. Nepote et al. (2002) found that peanut skins

31 contain ~150 mg of total polyphenols per gram of defatted dry skin. In some instances, total antioxidant activities of skin extracts were reported to be higher in antioxidant potential than in green tea (Yu et al. 2006).

Blomhoff et al. (2006) analyzed total antioxidant content (TAC) in a variety of edible plants and nuts. This analysis demonstrated that although walnuts contain a high amount of antioxidants, more than 20 mmol antioxidants per 100 g, peanuts are also rich in total antioxidants with an average value of 1.3 mmol per 100 g. Most of these antioxidants are located in the skin and less than 50% of antioxidant compounds are retained when the skin is removed (Blomhoff et al. 2006). Therefore, peanuts stored without the shell contain less antioxidant than nuts with the skin (Blomhoff et al. 2006).

Peanut Skins

Edible parts of the peanut consist of the kernel and the protective skin. This coating is removed from the kernels prior to application in snack products (Van Ha, 2007). Peanuts skins or testae have long been regarded as being a low economic waste by-product of the peanut industry. Skins are used as animal feed and are sold inexpensively. Based on world in-shell peanut production, 29 million tons of peanuts are produced with an average skin content of 2.6% (Sobolev and Cole, 2003). It has been reported that peanut skins’ commercial value ranges from $12 to $20 per ton (Francisco and Resurreccion, 2008). Out of the 29 million tons that are used, world production of peanut skins can be estimated at one million tons annually. Dry blanching is the most commonly used practice to separate skins from peanut kernels (Didzbalis et al. 2004; Sobolev and Cole, 2003. Blanching temperatures can range from 94 °C (Didzbalis et al. 2004) to 175 °C (Yu et al. 2005). Heating times with

32 this range of temperatures has been observed ranging from 5 min (Yu et al., 2005) to 25 min

(Woodroof 1983). During heat treatment, the brown peanut color that is formed increases due to sugar-amino acid reactions, maillard browning, with subsequent production of melanoidins (Sobolev and Cole 2004). The products that are formed, “maillard reaction productions” (MRPS) especially melanoidins, possess antioxidant activity through scavenging oxygen radicals or chelating metals (Yilmaz and Toledo 2005). Therefore, heat increases the antioxidant capacity of peanut skins. The raw peanut skin color can be attributed to tannins and catechol-type compounds (Sobolev and Cole 2004).

Peanut skin removal as well as roasting can affect the phenolic composition. Roasting decreases the proanthocyanidin content of monomers, trimers and tetramers by 29-54% in peanut skins (Tatsuno et al. 2012; Bolling et al. 2010). Yu et al. (2006) confirmed that roasting, a common practice in the peanut industry used to remove peanut skins, yields comparable total phenolic concentration and potency in skins that are produced in the direct peeling skin method. Roasting was reported to have had the least effect on total phenolics and procyanidin composition (Hwang et al. 2001; Yu et al. 2006). Blanching had the most impact compared to direct peeling. Jean et al. (2001) reported that peanut roasting can increase the content of total phenolics in both kernels and in skins (Jianmei et al. 2005). Yu et al. (2006) reported that the concentration of total phenolics and procyanidins of indirectly peeled and roasted peanut skin are compatible to those of grape seeds. Despite this, peanut skins have not been used for their underlying potential as a natural source of antioxidants. In traditional Chinese medicine, peanut skins are used to treat chronic hemorrhage and bronchitis (Wang, 2007). Peanut skins are known for their astringent taste; however, research

33 has shown that peanut consumption provides potential health benefits (Kris-Etherton et al.

2008; Francisco and Resurreccion, 2008). Peanut skins have been reported as being efficient free radical scavengers and metal chelators making them candidates for the stabilization of foods containing water and transient metal ions (Van Ha et al. 2007).

Phenolic Composition of Peanut Skins

Extraction of phenolic compounds usually involves the use of a weakly acidified alcoholic solvent, followed by concentration under vacuum, purification, and separation of the compounds (Mazza and Miniati, 1993). Nepote et al. (2002) reported peanut skins to have a range of 144.1 to 158.6 mg/ g of total phenolics as well as various compounds including carbohydrates. Total phenolics are increased during the roasting process. Roasting results in phenolic complexes being formed from the Maillard reaction, contributing to higher absorbance readings (Yu et al. 2005). The solvents used for extraction can also affect total phenolics concentration. Ethanol and methanol have been shown to be the most effective in extracting phenolics from peanut skins than water. Yu et al. (2004) reported that

80% ethanol as being the most effective. Nepote et al. (2002) extracted peanut skins with methanol, ethanol, acetone and water. It was reported that the highest total phenolic levels were detected in the methanol (158.8 mg/g) and ethanol (144.1 mg/g) extracts, respectively.

Extraction procedures affect the yield of antioxidant compounds. To achieve an optimized extraction of phenolic compounds, polar solvents such as aqueous methanol, ethanol or acetone are used for extraction purposes. Skins that are extracted with methanol have been reported to contain 165.5 mg/g total phenolics, while the content of total phenols was lower when using other solvents (Van Ha et al. 2007). Extraction of phenolic compounds

34 using water alone is less efficient as it does not increase the total phenolic yield and free radical activity as reported by Ballard et al. (2009). Lee et al. (2006) reported that methanol extracts of peanut skins contained 165.5 mg/g total phenols while the content of total phenols was lower in other solvents. Ethyl acetate extracts have also been shown to be rich in total phenolics (Van Ha et al. 2007). That study reported that 2.3% of total phenolics were recovered from peanut skins when extracted with ethyl acetate. Nepote et al. (2005) reported that a small addition of water to the solvent during extraction could increase the yield of phenolics, which contain free phenolic acids and their esters, flavonoids and catechins.

Ballard et al. (2009) used response surface methodology to estimate the optimum extraction conditions for the following solvents: methanol, ethanol, and water. It was determined that ethanol extracts had the highest total phenol concentrations of 118 mg of gallic acid equivalents followed by methanol and water. Ballard et al. (2009) reported that fewer phenolic compounds were extracted at higher concentrations of ethanol, which affects the phenolic compounds extracted in peanut skin extract ability to scavenge peroxyl radicals. Out of all of the phenolic antioxidants, proanthocyanidins and catechins make up the bulk in peanut skins by 25.19% (Van Ha et al. 2007). Proanthocyanidins are the primary source for free radical scavenging activity in peanut skins (Hongxiang et al. 2004). Table 3 shows that regardless of the solvent system that is used for extraction, in this case ethanol and water, total antioxidant activity in skin extracts were higher than green tea extracts at equal concentrations (Yu et al. 2005).

35 Table 3: Comparison of total antioxidant activity (TAA)a of peanut skin and green tea extracts. aTAA expressed as trolox equivalent antioxidant capacity (mM Trolox per mM of total phenolics).bValues are means of 3 replications± standard deviations. (Yu et al. 2005).

b b Water extracts Ethanol extracts Directly peeled skin 3.4 4.1 Roasted skin 3.3 3.7 Green tea 1.9 2.5

The peanut kernel has been reported to have a high total antioxidant content (TAC), however, there is a higher amount in the skin (Sanders et al. 2000). Peanut skin extracts have been shown to have a higher total antioxidant activity and free radical scavenging capacity than Trolox and Vitamin C. Phenolic fractions from skins consist of phenolic acids, such as caffeic, flavonoids, procyanidins, catechins and small amounts of resveratrol (Yu et al.

2006). In some instances, the total antioxidant activities of skin extracts were demonstrated to be chemically higher in antioxidant potential than in green tea infusions (Yu et al. 2006).

Skins are rich in catechins and procyanidins and contain three flavonoids including 5, 7- dihydroxychromone, eriodictyol and luteolin (Monagas et al. 2009; Ballard et al. 2009; Yu et al. 2006; Karchesy et al, 1986). These natural antioxidants which are found in fruits, vegetables, grape seeds, grape skins and green tea have been extensively studied for their health promoting abilities including cancer inhibition, reduction against cardiovascular disease and anti-inflammatory activities. This would suggest that the same antioxidant properties found in fruits and vegetables may have the same potential effect found in peanut skins. These compounds could be extracted and potentially utilized in a variety of food and pharmaceutical applications.

36 Chromatography Techniques

Liquid chromatography (LC) is a separation technique that uses a liquid as the mobile

phase. Samples are separated into analytes by distribution between the mobile phase and the

stationary phase. Extraction techniques that utilize complete extractions of phenolic

compounds are often quite tedious (Pinelo et al. 2006). Monagas et al. (2009) used the

Sephadex LH-20 technique to extract high and low molecular weight polyphenolics in

almond, hazelnut and peanut skins. They reported that peanut skins high molecular weight

fractions were more abundant in total polyphenol and tannin content than the whole extract

compared to the other nut skins. However, whole peanut skin extracts had the highest total

polyphenol content (371 ±15 mg of GAE/g) compared to hazelnut (315 ± 4 mg of GAE/g)

and almond skins (134 ±1 mg of GAE/g), respectively. This would suggest that although

Sephadex-LH 20 could be an effiecient technique, however, the method can be time-

consuming (Pinelo et al. 2006). The use of low pressure chromatographic columns is

complex and can generate large amounts of waste. This disadvantage of using Sephadex LH-

20 has prompted researchers to use alternative methods compared to the traditional extraction

methods.

Solid Phase Extraction (SPE)

In a study conducted by Pinelo et al. (2006), extraction of phenolics resulted in the

best recovery of these compounds using Solid Phase Extraction (SPE). This technique can be

used to quickly separate phenolics based on molecular size. SPE uses commercial pre-packed

columns containing stationary phases similar to those used in high performance liquid

chromatography (HPLC). The absorbents may include silica gel, reversed-phase materials

37 such as chemically bonded octadecylsilyl or ion-exchange media. The stationary phases that

are used in HPLC encounter many problems in practice, for example, the pH range of silica,

which is from 2.0 to 7.5. If the pH is above 2.0, the silica base is liable to dissolution; below

2.0 the silyl bond can be hydrolyzed. With SPE absorbents, however, this problem is rare due

to elution times being shorter and single use columns. Lazarus et al. (1999) used SPE to

remove interfering sugars from peanut skins prior to HPLC/MS analysis. Hundreds of

monomeric and oligomeric proanthocyanidins were separated using this technique. Sobolev

et al. (1999) evaluated the resveratrol levels in roasted peanuts with and without skins using

SPE. Application of this type of chromatography allowed for a reliable method to be created

in order to quantify the amounts of resveratrol present. They reported that using this method

yielded higher recovery of resveratrol, providing accurate quantitation for peanuts and peanut

products. Peanuts with skins had higher resveratrol levels of (0.075 ± 0.003 μg/g) as opposed

to roasted peanuts without skins (0.046± 0.008 μg/g). This would suggest that when skins are

left on the kernel, there are not only higher levels of resveratrol but that the total antioxidant

content may be increased as well.

High Performance Liquid Chromatography (HPLC)

High performance liquid chromatography (HPLC) is a form of LC that uses small

particle columns through which the mobile phase is pumped at high pressure (Dong, 2006).

HPLC is widely used for the analysis of pharmaceuticals, biomolecules, and many organic

and ionic compounds (Dong, 2006). Analysis is accomplished by solubilizing samples in a

liquid that can be used as the mobile phase. Unlike other modes of chromatography such as

gas chromatography, sample components need not be volatile or derivatized, although

38 derivatization serves to enhance the detectability of the analyte. Advantages of HPLC are automated operation, high-sensitivity detection, amenable to diverse samples, and rapid and precise quantitative analysis. HPLC suffers from several well-known disadvantages such as the lack of a universal detector. In addition, the separation efficiency is substantially less than that of capillary gas chromatography (Dong, 2006).

Separation of analytes between a polar mobile phase and hydrophobic (nonpolar) stationary phase is defined as reversed-phase chromatography (RPC). This type of chromatography is the most popular HPLC mode and is used in more than 70% of all HPLC analyses (Dong, 2006; Snyder et al. 1997; Snyder et al. 1997). RPC typically uses a mixture of methanol or acetonitrile with water as a polar mobile phase. The mechanism of separation is primarily attributed to solvophobic or hydrophobic interactions. RPC mode is suitable for the analysis of water-soluble, medium-polarity and some non-polar analytes (Dong, 2006).

Francisco and Resurreccion (2009) developed a RP-HPLC method using diode array detector

(DAD) for the identification and quantification of phenolic compounds found in peanut skin extracts. A maximum of nine phenolic compounds were identified. Natural forms of the phenolics found in peanut skin extracts were identified directly without the need for hydrolysis.

Normal phase chromatography is a separation technique based on the adsorption/desorption of the analyte onto a polar stationary phase (Dong, 2006). The mobile phase is typically silica or alumina (Snyder et al. 1997; Snyder et al. 1978). Analytes that have strong interactions with the silanol 13 groups are retained longer on the column while those with little to no affinity will pass through. Normal phase chromatography is useful for

39 the separation of nonpolar compounds and isomers as well as for sample cleanup. One disadvantage is contamination of polar surfaces by sample components (Dong, 2006).

Phenolic extracts are a mixture of various phenolic classes that are soluble in the solvent (polar) system (Naczk and Shahidi, 2004). Analysis of individual phenolic compounds from solvent extracts is difficult due to the structural similarities of the extractable compounds. Phenolic compounds absorb in the ultraviolet (UV) region displaying a maxima between 246-262 nm with a shoulder at 290-315 nm (Lee, 2000).

Flavonoids have two absorption bands in the spectrum (Francisco and Resurreccion, 2009).

This is due to its structure consisting of phenolic and pyrane rings A, B and C (Francisco and

Resurreccion, 2009). The first band presumably from the B-ring has a maximum in the 300-

550 nm range (Merken and Beecher, 2000). The second band arises from the A-ring and has a maximum in the 240-285 nm range (Francisco and Resurreccion, 2009). Yu et al. (2006) identified and quantified catechins, procyanidin dimers, trimers and tetramers using reverse- phase high performance liquid chromatography (RP-HPLC).

UV-Vis and photodiode array (DAD) detectors are commonly used to detect food phenolics (Francisco and Resurreccion, 2009). Proposed methods using these detectors have not been successful due to the decomposition and polymerization of polyphenols following pretreatment of hydrolysis (Hertog et al. 1992; Crozier et al. 1997; Merken and Beecher,

2000). Therefore, not all polyphenols were recovered or identified. Sakakibara et al. (2003) devised a HPLC method that not only gives a higher level of accuracy but the use of hydrolysis is avoided. Their method can also identify aglycons and its glycosides separately as the two compounds differ in bioavailability. Sakakibara et al. (2003) simultaneously

40 determined polyphenolic compounds in fruits, vegetables and teas using HPLC-DAD, which lead to the creation of a library comprising of retention times, spectras of aglycons and calibration curves. This library, however, did not include legumes especially peanuts.

High Performance Liquid Chromatography Mass Spectrometry (HPLC-MS)

High-performance liquid chromatography mass spectrometry (HPLC-MS) comprises a high performance liquid chromatography (HPLC) attached, via a suitable interface, to a mass spectrometer (MS). The primary advantage of using HPLC/MS is its ability to analyze a wide range of components. Compounds that are “thermally labile” exhibit high polarity or molecular mass may be analyzed using HPLC/MS (Nollet, 2000; McCrae, 1988). This technique helps in quantifying polyphenolic compounds by fragmentation. Scientists have used HPLC-MS to identify and characterize polyphenolic compounds in fruits, vegetables, nuts and legumes. Sobolev et al. (2006) identified trans-reseveratrol and phenolic acids extracted from peanuts and characterized stillbenoids in peanut seeds that had anti-fungal properties using HPLC-MS (Sobolev et al. 2009). Lazarus et al. (1999) determined the location of procyandins in peanut nutmeat and skins using HPLC-MS. They found a complex series of procyanidins of oligomer in peanut skins, in particular A-type procyanidins. This study confirmed the presence of A-type procyanidins that was reported by Karchesy and

Hemingway (1986).

Antioxidant Activity

Studies have shown that antioxidant capacity of fruits and vegetables may be strongly correlated to both vitamin C concentration and total phenolic content (Proteggente et al.

2002). Antioxidant capacity methods are divided into two categories 1) hydrogen atom

41 transfer (HAT) reaction and 2) electron transfer (ET) reaction based methods (Karadag et al.

2009). An antioxidant’s efficiency is based on the bond dissociation energy and ionization potential. HAT-reaction methods measure an antioxidant’s ability to scavenge free radicals by donation of hydrogen ions to form stable compounds (Karadag et al. 2009; Prior et al.

2005). These methods correlate with an antioxidant’s reactivity to radical chain breaking.

AH + X• → XH +A• (Equation 2.12.1)

Therefore, the relative reactivity is determined by the bond dissociation energy of the hydrogen-donating group in the potential antioxidant as well as the ionization potential. HAT based reactions are solvent and pH dependent. They also monitor competitive reaction kinetics; therefore, quantitation is derived from kinetic curves. These reactions are rapid and usually come to completion in seconds to minutes. HAT methods consist of an oxidizable molecular probe, fluorescein, synthetic free radical generator (AAPH, 2,2’-azobis(2- amidinopropane) dihydrochloride (ABAP), 2,2’azobis(2,4dimethylvaleronitrile (AMVN),

2,2’-azinobis(3-ethylbenzothiazolline-6-sulfonic acid (ABTS)); and an antioxidant (Moore et al. 2006); Valkonen and Kussi, 1997).

Fluorescent probes are used in HAT based methods because of their mechanistic similarity to lipid peroxidation (Karadag et al. 2009). The concentration of the probe, however, is often smaller than antioxidant concentration making it unrealistic in real situations. In reality, HAT-based assays do not represent a food system in which the concentration of the antioxidant is much smaller than the substrate concentration (Huang et

42 al. 2005). ET-based methods use the ability of the antioxidant to transfer one electron to reduce any compound including metals, carbonyls and radicals (Karadag et al. 2009; Prior et al. 2005).

M (III) +AH → AH• + M (II) (Equation 2.12.2)

Relative reactivity of the reaction is based on the deprotonation and ionization potential of the reactive functional groups, therefore, making ET reactions pH dependent (Prior et al.

2005). These reactions are relatively slow and need a longer time for completion. ET reactions measure the relative percent decrease in product rather than total antioxidant capacity (Ozgen et al. 2006). ET reaction mechanisms are somewhat similar to HAT in which ET is solvent dependent, which is due to solvent stabilization of the charged species.

ET-based methods consist of two components, antioxidants and oxidant (probe)

(Karadag et al. 2009). The probe is an oxidant that extracts an electron from the antioxidant, which results in color changes of the probe. The antioxidant concentration is proportional to the degree of the color change. The endpoint of the reaction is reached when the color change stops. Quantitation is determined by a linear curve, which reflects the change of absorbance

(∆ A) plotted against antioxidant concentration. The slope of the curve determines reducing capacity of an antioxidant and can be expressed as Trolox equivalence or gallic acid equivalent (Karadag et al. 2009). This relationship does accept that the antioxidant capacity is equal to its reducing capacity.

43 Oxygen radical absorbance capacity

Oxygen radical absorbance capacity (ORAC) is an assay that observes antioxidant scavenging activity against peroxyl radical induced by 2,2’-azobis (2- amidinopropane)dihyrdochloride (AAPH) at 37 °C (Ou et al. 2001). This assay reflects classical radical chain breaking antioxidant activity by hydrogen atom transfer (Ou et al.

2001). Fluorescein is used as an indicator and Trolox is the control standard. AAPH is a peroxyl radical generator, which initiates the breakdown of fluorescein. The peroxyl radicals that are generated from the thermal decomposition of AAPPH react with a fluorescent probe to form a nonfluorescent product that can be quantitated by fluorescence (Karadag et al. 2009). If an antioxidant is present, it will protect the fluorescein and slow down fluorescein degradation.

The effectiveness of an antioxidant is assessed by comparison of the area under the decay curve of the sample to that of the blank, which does not contain antioxidant, by the use of a regression equation (Equation 3 and 4) (Ou et al. 2002).

AUC = 0.5 + (R2/R1) + (R3/R1) + (R4/R1) +…..+ 0.5 (Rn/R1) (Equation 2.13.1)

Net AUC = AUC sample – AUC blank (Equation 2.13.2)

ORAC takes into account antioxidant effects well beyond the early stages of oxidation by following the reaction for extended periods (≥ 30 min) (Prior et al. 2005). By allowing the reaction to run for an extended period of time, the potential effects of secondary antioxidant products can be investigated. The advantage of using this assay is that it is useful for samples containing multiple ingredients and complex reaction kinetics. ORAC

44 uses an automated microplate fluorescence reader, making the method accessible as well as

increasing sample throughput efficiency by tenfold. ORAC also has the capability of

employing different free radical generators or oxidants (Karadeg et al. 2009). The measured

antioxidant capacity of a compound depends on which free radical or oxidant source used in

the assay.

This assay also has its pitfalls. Close temperature control through the microplate reader is essential because the ORAC reaction is temperature sensitive. Failure to do so will result in a discrepancy in reproducing the assay (Lussignoli et al. 1999). To avoid this from occurring, incubation of the reaction buffer at 37 °C prior to the addition of AAPH decreases intra-assay variability (Prior et al. 2003). In the past, another detriment in using this assay is the long analysis time (≥ 1 hour). The issue of time, however, has been somewhat resolved by the development of “high-throughput” assays using thermostated plate readers (Huang etal.

2002).

Total Phenols

The Folin-Ciocalteu assay focuses on the transfer of electrons in alkaline medium from phenolic compounds to molybdenum and follows the basic mechanism of an oxidation/reduction reaction (Karadag et al. 2009). Phenolic compounds can only react with

Folin-Ciocalteu reagent under basic conditions (MacDonald-Wicks et al. 2008). This reaction converts compounds into blue complexes that can be measured spectrophotometrically at 750 nm (Magalhaes et al. 2008). Phenols are responsible for the majority of oxygen capacity in most plant derived products, such as wine (Singleton et al. 1999), but there are exceptions, for example carotenes. Some antioxidants, such as monophenols, have the ability to prevent

45 oxidative rancidity by donating a hydrogen or increase lipid solubility in fats due to decreased availability in an aqueous environment (Singleton et al. 1999). Therefore, it is important that total phenol assays incorporate monophenols as well as easily oxidized polyphenols. The Folin-

Ciocalteu Reagent was initially used for the analysis of proteins. It was not until years later that

Singleton and co-workers applied this assay to the analysis of total phenols in wine (Singleton and Rossi, 1965; Singleton et al. 1999). The number of hydroxyl groups or potentially oxidizable groups controls the amount of color formed (Amerine and Ough 1980).

The Folin-Ciocalteu method is simple yet sensitive and can be useful for the characterization and standardization of botanical samples provided that some limitations and variations are properly controlled. However, the assay results can lead to a wide range of difference in detected phenols, which is contingent on assay conditions (Prior et al. 2003). For example, total phenolics in blueberries range from 22-4180 mg/100 g (Lee 2000). The Folin-

Ciocalteu method also suffers from interfering substances particularly sugars, which can give inaccurate results (Prior et al. 2003). Additional nonphenolic organic substances can react with the Folin-Ciocalteu reagent such as ascorbic acid and EDTA. The same goes for some inorganic substances such as sodium sulfite, manganese sulfate, etc., which can cause elevated phenolic concentrations (Box 1983; Peterson 1979).

Oxidative Stress

Reactive oxygen and nitrogen species (ROS and RNS) are constantly generated in the

human body. These highly reactive compounds react non-enzymatically, which can cause

alterations to the structure and function of cellular or extracellular components including the

cell membranes, lipoproteins, RNA and DNA (Blomhoff 2005; Mittler 2002; Bukte and

46 Sandstrom 1994). Antioxidants are compounds that are able to donate an electron and/or hydrogen atom and prevent or delay oxidation of an oxidizable substrate. Antioxidants can act as scavengers, help prevent cell and tissue damage, be part of the redox antioxidant network, and/or regulate gene expression. Oxidants and antioxidants must be kept in balance to minimize molecular and cellular tissue damage due to oxidative stress. Blomhoff (2005) defines oxidative stress as an “accumulation of non-enzymatic oxidative damage to molecules thus destroying the function of properly working cell organisms”. This stress occurs as a result of an unfavorable balance between the generation of free radicals, other

ROS or RNS and antioxidant defenses (Sies 1997). Oxidative stress can also arise from body metabolism, aging and exposure to environmental stressors such as ultraviolet irradiation and cigarette smoke. Oxidative damage to lipids, proteins and DNA does, however, accumulate during aging. Therefore, tissues from aged individuals are more susceptible to diseases.

Compelling evidence has shown that oxidative stress may significantly contribute to all inflammatory diseases as well as be directly involved in the pathophysiology of many unrelated types of disease such as arthritis, cancer and many others (Blomhoff 2006; Apel et al. 2004; Sies 1997). In addition, mild oxidation not only affects cell signaling pathways but can also hinder gene expression.

Redox-based antioxidants interact with one another through an “antioxidant network” comprised of non-enzymatic reactions. Within this network, antioxidants are recycled or regenerated by biological reductants (Blomhoff 2005; Cadenas et al. 2000). This network can be weakened by oxidative stress. It has been hypothesized that polyphenols found in ruits and vegetables can decrease oxidative stress (Biesalski, 2007; Han et al. 2007; Blomhoff,

47 2006). The proposed mechanism is their ability to react directly with reactive oxygen species

(ROS), thus, forming products with much lower activity. Polyphenols exhibit significant functions, such as protection against oxidative stress and degenerative diseases (Kim et al.

2004). These biological actions can be attributed to their intrinsic antioxidant capabilities

(Han et al. 2007). When there is an excess of free radicals due to oxidative stress, humans use endogenous and exogenous mechanisms in order to maintain redox homeostasis. Among these, studies have shown that polyphenols have the antioxidant capacity and properties to restore cell regulation. In order to decrease the effects of ROS, various antioxidant strategies have been derived by either increasing the endogenous antioxidant enzyme defenses or enhancing the non-enzymatic defenses through a dietary or pharmacological means (Du et al.

2007, Appiah-Opong et al. 2007). Studies have shown that polyphenols possess potent antioxidant activity by endogenous and exogenous mechanisms (Han et al. 2007; Escarpa et al. 2001; Aura et al. 2002; Du et al. 2007). The polyphenolic compounds curcumin and quercetin have been reported to increase several antioxidant enzyme activities such as glutathione peroxidase, catalase or glutathione reductase (Han et al.

2007).

Following a plant-based diet helps to increase the capacity of antioxidant defense and modulate the cellular redox state. Initially, supplements of antioxidants such as β-carotene and ascorbic acid were thought to neutralize ROS or RNS thereby preventing oxidative damage (Blomhoff, 2005; Baynes 1999). In vivo studies generated positive results showing that antioxidants have the ability to inhibit oxidative damage (Williams et al. 2004;

Soobrattee et al. 2005; Blomhoff, 2005; Chandra et al 2000). However, data from

48 epidemiological studies for cancer research is less convincing. For colorectal cancer, data has

been reported inconsistently (Burke et al 1997; McPhillips et al. 1994). The reason behind

this may be in part due to the exposure of polyphenolics, which could be chronic at

lowconcentrations to human subjects (Arts and Hollman, 2005). Therefore, the

bioavailability of polyphenolics is limited. Absorption of polyphenols is also important as

polyphenols are subject to phase II metabolism, yielding methoxylated, glucuronidated, and

sulfated compounds (Arts and Hollman, 2005).

Inflammation

Inflammation occurs as a result of increased blood flow to affected tissue.

Inflammation can be a beneficial response to infection or tissue injury in that it results in the restoration of homeostasis and repair (Ghosh, 2007). Unresolved inflammation is a problemas it is the underlying cause of a variety of diseases such as arthritis, asthma, cancer, diabetes, amongst others (Libby et al. 2002). Inflation of cell wall stress promotes the production of certain leukocyte adhesion molecules by arterial smooth muscle cells (SMCs) of proteoglycans, which can bind and retain low-density lipoprotein particles (Libby et al.2002).

Leukocytes also release inflammatory mediators, which develop and maintain the inflammatory response (Ghosh, 2007; Tak and Firestein, 2001). Once leukocytes adhere to the surface of the endolthelium, they are able to penetrate the innermost lining of the lesion

(Libby et al. 2002; Lee et al. 2001). After adhesion, leukocytes initiate a local inflammatory response. Macrophages express scavenger receptors for modified lipoproteins, thus allowing these receptors to ingest and become foam cells (Ghosh, 2007; Greaves and Schall, 2000).

The T-cells are also affected as they encounter signals that cause them to elaborate

49 inflammatory cytokines, such as tumor necrosis factor (TNF-β) (Libby et al. 2002). In turn, macrophages as well as vascular endothelial cells and SMCs are stimulated (Libby et al.

2002; Tak and Firestein, 2001). SMCs help facilitate oxidative modification thus promoting an inflammatory response at sites of lesion formation (Libby et al. 2002).

Eicosanoids

Eicosanoids are a family of biological signaling molecules that acts on cells near the

point of hormone synthesis instead of being transported in the blood to act on cells in other

tissues or organs (Nelson and Cox, 2004). As fatty acid derivatives, they are known to be

involved in reproductive function, inflammation, fever, amongst other processes by causing

dramatic effects on vertebrate tissues (Nelson and Cox, 2004). Eicosanoids are formed from

20-carbon polyunsaturated fatty acids. An example of an eicosanoid precursor is arachidonic

acid. Arachidonic acid is a polyunsaturated omega-6 fatty acid that is present in cell

membranes (Matsuyama and Yoshimura, 2008). Free arachidonic acid is present in most

membrane cells and is released by phospholipase A2 which releases arachidonic acid

(Davies et al. 1984). As a result, arachidonic acid is converted into prostaglandins (PGs),

beginning with the formation of prostaglandin H2 (PGH2). PGH2 is the immediate precursor

of many other prostaglandins and of thrombanes (Figure 6). PGH2 can be formed by two

stages via metabolism of the cyclooxygenase (COX) pathway. The first step of the reaction,

COX activity introduces molecular oxygen to convert arachidonate to PGG2, an unstable

endoperoxide intermediate. The second step is catalyzed by the peroxidase activity of COX,

which converts PGG2 to PGH2. The PGH2 further breaks down nonenzymatically to

produce prostaglandins E2 and D2 (PGE2 and PGD2).

50

Figure 6: Eicosanoid biosynthetic enzyme pathways. Arachidonic acid, a common precursor of eicosanoids, is released from membrane phospholipids by phospholipase A2 activity. The COX pathway leads to the formation of PGs. The LO pathway, responsible for the synthesis of leukotrienes, involves a catalytic complex consisting of 5-LO (Lousse et al. 2009).

Cyclooxygenase

Cyclyooxygenase (COX) helps to catalyze the first step in the arachidonic acid pathway by converting arachidonic acid into an unstable intermediate called PGG2 (Vane et al. 1998). COX rapidly converts PGG2 to PGH2. As a result, a series of biologically active prostaglandins (PGD2, PGE2α, PGF2 and PGI2) and thromboxane A2 (TXA2) are formed by

PGH2 by various isomerases (Vane et al. 1998). Two isoforms that have been identified are

COX-1 and COX-2 (Portanova et al. 1996). They are similar in structure and possess a

51 molecular weight of 71K and 63% amino acid identical sequence. Although COX-1 and 2 are both associated enzymes, they are expressed in different parts of the body (Vane et al.

1998). COX-1 is always expressed in nearly all cell types at a constant level. COX-2 is expressed in the central nervous system (CNS) but its activity is normally absent from cells.

However, when COX-2 is induced, protein levels reach their peak then quickly decrease in a matter of hours after a single stimulus (Needleman et al. 1986). Importantly, stimuli known to induce COX-2 are those associated with inflammation such as bacterial lipopolysaccharide (LPS), tumor necrosis factor (TNF)-α and cytokines (interluekin (IL)-1 and IL-2). Anti- inflammatory cytokines such as IL-4, IL-10 and IL-13 have been shown to decreaseinduction of COX-2 (Vane et al. 1998). The effects of non-steroidal anti- inflammatory drugs (NSAIDs) such as aspirin are non-selective and inhibit both COX-1 and

COX-2 whereas COX-2 inhibitors (Celecoxib, Vioxx, etc.) preferentially inhibit COX-2 over COX-1 (Yang and Chen, 2008). As a result, inhibition of prostaglandin biosynthesis at inflammatory sites and constitutive biosynthesis occurs (Vane et al. 1998).

Prostaglandin E2

The major sign of an inflammatory stimulus is pain. This response results from the interaction of multiple mediators such as histamine and nitric oxide that are released at sites of tissue injury (Portanova et al. 1996). The role of prostaglandins (PG’s) with regards to pain following mechanical or chemical injury has been established (Currie and Needleman,

1984; Bonney and Humes, 1984; Goodwin and Ceuppens, 1983). In addition to the inflammatory mediators, PG’s have been detected in inflammatory cell matter such as white blood cells (Needleman, 1986). The contribution of prostaglandins to the development of pain in multiple immunoinflammatory diseases has been illustrated by the therapeutic effect

52 of nonsteroidal anti-inflammatory drugs (NSAIDS) (Needleman, 1986). NSAIDS anti- inflammatory activity has been reported to inhibit PG synthesis by inhibiting cyclooxygenase-2 (COX-2) (Needleman, 1986). COX-2 is a key enzyme in the metabolic pathway in which numerous biologically active PG’s such as PGD2, PGE2, PGF2, PGH2,

PGI2 and thromboxane are synthesized from arachidonic acid (Raz et al. 1989; O’Sullivan et al. 1992; Masferrer et al. 1994). PGE2 is present in high concentrations in inflamed tissues (Masferrer et al. 1994).

PGE2 can enhance pain in tissue exposed to inflammatory mediators when administered exogenously (Williams and Morley, 1973; Williams and Peck, 1977).

PGE2does not exist preformed in the cell. When cells are activated or free arachidonate is supplied, PGE2 is synthesized de novo and released into the extraceullar space

(Hamberg and Samuelsson, 1971; Granström et al. 1980). As a result, PGE2 is converted into an inactive metabolite by the PG 15-dehydrogense pathway (Hamberg and

Samuelsson, 1971; Granström et al. 1980). The determination of in vivo PGE2 biosynthesis is often best accomplished by the measurement of PGE2 metabolites because of the rapid metabolism of PGE2 (Hamberg and Samuelsson 1971).

Nuclear Factor κB and Nitric Oxide

The nuclear factor ~κB (NF~κB)/ Re1is a transcription family consisting of proteins that can control the transcription of DNA when active in the nucleus (Ghosh, 2007;

Makarov 2001). NF~κB plays a vital role in the regulation of immune response to infections.

As described by Makarov (2001), incorrect regulation of NF~κB has been linked to cancer, autoimmune and inflammatory diseases. In order for NF~κB to function, it must move to the

53 nucleus. Retention of NF~κB in the cytoplasm is provided by its interaction with inhibitory proteins known as IκB. Activation of NF~κB occurs upon proteolysic degradation of IκB, therefore, allowing NF~κB to enter the nucleus initiating transcription (Ghosh, 2007;

Makarov, 2001). Activation can also occur by appropriate cellular stimulation, such as stress.

Initiation of transcription is regulated by interactions with several transcriptional co- activators and basal transcriptional machinery (Makarov, 2001). Pathways that control

NF~κB nuclear translocation and its transcription function are independently regulated, but act as a unit in the activation of NF~κB dependent gene expression (Makarov, 2001). The synthesis of certain cytokines, such as TNF-α, IL-1β, IL-6 and IL-8 as well as the expression of COX-2 is mediated by NF~κB (Ghosh, 2007). Hence, NF~κB has the ability to induce transcription of these pro-inflammatory genes (Ghosh, 2007).

Polyphenolics and Anti-inflammatory properties

Inflammation caused by oxidative stress is arbitrated by the activation of NF-kB and

AP-1 (Tak and Firestein, 2001). This domino effect alters a variety of cellular signaling processes eventually leading to generation of inflammatory mediators (Wahyudi and

Sargowo, 2007). As a result, pro-inflammatory genes such as inducible nitric oxide synthase links, interleukin-1 beta (IL-1B) and IL-8 are affected (Wahyudi and Sargowo, 2007; Tak and Firestein, 2001). Antioxidant and anti-inflammatory effects of polyphenols have been shown to control undesired effects of oxidative stress. The stillbene compound, resveratrol, has been reported to have the ability to interfere and prevent cardiovascular disorders from occurring. Schaffer et al. (2007) reported that the resveratrol inhibits of NF-kB

54 transactivation. Procyanidins have been shown to inhibit transcription and secretion of IL-1B in peripheral blood mononuclear cells in vitro (Mao et al. 2000).

Flavonoids such as quercetin and luteolin that possess a carbon 2, 3 double bond and

5, 7-dihydroxyl groups in the A-ring were shown to inhibit NO production. Kim et al. (1999) suggested that the 8-methoxyl groups found on the A-ring as well as the 4’- or 3’, 4’-vicinal substitutions in the B-ring may have NO inhibitory activity. This is due to the planar ring in the flavonoid molecule, which may cause NO production to be inhibited (Kim et al. 1999).

They investigated the effects of naturally occurring flavonoids on nitric acid production in vitro. This study determined that certain flavonoids inhibited NO production. The basis for inhibition was due to chemical structure of the flavonoids. Djoko et al. (2007) observed anti- inflammatory activities of peanut stilbenoids: resveratrol, arachidonic 1 and piceatannol, differentiating in the number of hydroxyl groups present, in vitro. Contributors of inflammation, PGE2 and NO, were inhibited by all the test stilbenoids in a dose-dependent manner while gene and protein expressions of COX-2 and iNOS were not inhibited. The researchers reported that inhibitory effects on LPS-induced PGE2 and NO production was partly through the direct scavenging activity of intracellular NO and direct suppression of PG synthesis by inhibiting enzyme activity of COX-1 and 2 in a dose-dependent manner as seen in the phenolic compound resveratrol (Djoko et al. 2007; Jang et al. 1997).

Anti-atherosclerosis and Cardioprotection

Studies have shown that there are a limited number of polyphenols which exert anti- atherosclerosis and cardioprotection capabilities (Arts and Hollman, 2005, Halliwell and

Gutteridge, 1999). Quercetin was reported to decrease lipid peroxidation, upregulate the

55 expression of serum high-density lipoprotein (HDL) associated paraoxonase 1 (PON-1) in the HUH7 human hepatoma cell line (Ahmad, 2001; Han et al. 2007). Flavonoid consumption has been associated with reduced risks of chronic diseases and strongly inhibits low-density lipoprotein (LDL) oxidation both in vivo and in vitro (Cao et al. 1997;

Soobrattee et al. 2005). Mechanisms of action are attributed to flavonoids capacity for antioxidation, anti-inflammation, anti-proliferation and modulation of signal transduction pathways (Halliwell and Whitman, 2004). These mechanisms help to reduce platelet aggregation, hence, reducing cardiovascular heart disease (CHD) mortality (Cao et al. 1997;

Ashida et al. 2005).

Effect of the Regulation of Cell Cycle Progression by Polyphenols

Historially the cell cycle can compartmentally contain four phases: G1 phase, S phase

(synthesis), G2 phase and M phase (mitosis) (Cooper et al. 2004). Activation of each phase is dependent on the proper progression and completion of the previous one (Morgan, 2007).

Modifications of the cell cycle components can lead to tumor formation (Watson, 2004).

Two families of genes: the cip/kip family and the INK4a/ARF (Inhibitor of Kinase

4/Alternative Reading Frame) prevent the progression of the cell cycle (Watson, 2004).

These genes, known as tumor suppressors, are instrumental in prevention of tumor formation.

The cip/kip family includes the genes p21, p27 and p57 (Morgan, 2007; Watson, 2004). They can stop the cell cycle in the G1 phase, by binding to, and inactivating, cyclin-CDK complexes (Morgan, 2007; Watson, 2004). Studies have shown that certain polyphenols can regulate cell cycle progression by up-regulating p21 expression, G1 phase arrest and down regulate cyclin D1/D2-Cdkle in vitro (Ahmad et al. 2001; Kuo et al. 2002; Mamunur Rahman

56 et al. 2010; Wolter et al. 2001).

Cell Based Assays MTT

Cell-based assays are powerful tools that are incredibly versatile. They can be designed to measure many cellular or biochemical functions, which cannot be obtained from animal models or humans (Ward 2008). Cell-based assays have the ability to measure a variety of different markers: measure the number of dead cells (cytotoxicity assay), live cells

(viability assay, 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)), and the total number of cells or a molecular mechanism (Riss et al. 2003). The MTT assay is a colorimetric assay that measures the ability of cellular enzymes to reduce the tetrazolium dye, MTT, to its insoluble formazan crystal, thus, creating a purple color that is detected colormetrically (Mossman 1983; Gerlier and Thomasset 1986). This assay measures cellular metabolic activity via NAD(P)H-dependent cellular oxidoreductase enzymes and could reflect the number of viable cells (Riss et al. 2003; Mossman 1983).

Trypan Blue

Trypan Blue is a technique widely used for cell cultures in vitro and tumor cell preparation tested in vivo to color dead tissues or cells selectively for direct comparison between variability. Trypan blue values have been shown to be 85% of cultivability values under optimal conditions of handling (Tennant 1964). The mechanism of trypan blue, a negatively charged diazo dye, is based on the interaction of cells with undamaged intact membranes (Mascotti 2000). Therefore, all the cells that have an intact plasma membrane

(viable cells) exclude the dye. By contrast, cells that have damaged membranes (nonviable)

57 are stained with blue color and can be observed under a microscope. Thus, trypan blue dye is escribed as being a vital stain allowing discrimination between viable cells and cells with damaged membranes that are usually considered to be dead cells. The staining of nonviable cells can be difficult to interpret due to the problem that viability is being determined indirectly from the cell membrane’s integrity (Mascotti 2000; Prescott, 1976). Thus, the capability to be measured by growth or function is affected, even though its membrane integrity is maintained (Macotti 2000; Prescott, 1976). Dye uptake can be another potential problem as uptake is assessed subjectively. Therefore, small amounts of dye uptake indicative of cell injury may go unnoticed. A solution for this potential problem is performing a dye exclusion procedure with fluorescent dye and a fluorescent microscope

(Macotti 2000). The use of this technique results in an increase in the viability of nonviable cells than tests performed with trypan blue using a transmission microscope (Macotti 2000).

Western Blotting

Western blotting is a technique used to detect specific proteins in a given sample of tissue extract or homogenate (Burnette, 1981). This analytical technique uses gel electrophoresis to separate denatured proteins via the length of the polypeptide or by the 3D structure of the protein. Proteins are then transferred to a nitrocellulose or PVDF membrane, where the protein is detected using antibodies specific to the protein of interest. Other sources of protein can also come from bacteria, viruses or environmental samples. Western blotting is not restricted to cellular studies. Chassaigne et al. (2009) used this method to locate and identify two different isoforms of the allergen Arachis hypogaea (Ara) Ara h1 and

Ara h2 in peanuts. The sample that contains the protein of interest may be taken from whole

58 tissue or from a cell culture. If this is the case, solid tissues are first broken downmechanically either by sonication, a homogenizer or a blender. Salt buffers and assorted detergents are used to encourage lyses of cells and for the solubility of proteins. Protease and phosphatase inhibitors are incorporated to prevent digestion of the sample by its own enzymes. To avoid protein denaturing, tissue preparation may be done at cold temperatures.

ELISA

Enzyme-linked immunosorbent assay, also called ELISA, is a technique used to detect the presence of an antibody or antigen in a sample (Voller et al. 1978). This technique consists of a series of additions of reagents separated by washing steps (Lequin, 2005; Voller et al. 1978). Addition of reagents is accomplished using any commercially available dispensers that are accurate (Voller et al. 1978). ELISA can also be used for determining serum antibody concentration such as HIV testing. This assay has also found applications in the food industry detecting potential food allergens such as milk, peanuts, eggs and walnuts.

Loizou et al. (1985) used ELISA for measuring IgG and IgM anticardiolipin antibodies

(ACA) in patients with systemic lupus erythemetsus or seropositive rheumatoid arthritis. The use of ELISA made quantitative determination of ACA levels more reliable for clinical and experimental monitoring. Li et al. (2009) reported the ELISA method could be used to accurately determine total aflatoxins in peanuts. Kubota et al. (2009) reported that ELISA could be used to investigate the role of resveratrol in the suppression of leukocyte adhesion to retinal vessels of endotoxin-induced uveitis (EIU) mice. By using this method it was concluded that resveratrol prevented inflammatory responses via inhibiting oxidative damage. In ELISA, an unknown amount of antigen binds to a surface and then a specific

59 antibody is washed over the surface so that it can bind to the antigen (Lequin, 2005; Voller et al. 1978). Addition of substrate produces a detectable signal. The use of substrates is to give a colored product following enzymic degradation (Lequin, 2005; Voller et al. 1978).

Performing an ELISA involves at least one antibody specific to a particular antigen.

The unknown antigen of interest is immobilized on a solid support usually a polystyrene microtiter plate either non-specifically or specifically (Lequin, 2005; Voller et al. 1978).

Addition of the antibody is added to the plate allowing for detection, thus forming a complex with the antigen. The detection of antibody can be covalently linked to an enzyme or can be detected by a secondary antibody through bioconjugation (Lequin, 2005; Voller et al. 1978).

During each step of ELISA, the plate is washed with a mild detergent solution to remove any proteins or antibodies that are not specifically bound (Lequin, 2005; Voller et al. 1978). The final wash step produces a visible signal by adding an enzymatic substrate to the plate. The signal that is emitted indicates the quantity of antigen in the sample. Visual readings of

ELISA can be made quantitative by testing a series of dilutions of the test sample (Lequin,

2005; Voller et al. 1978). A dilution that does produce a discernible substrate color can establish the end-point.

Competitive ELISA

ELISA test can be competitive for the assay of antigen. Hefle et al. (1995) were able to determine the highest amount of Ara allergen in six commercial peanut skin extracts using this method. For competitive ELISA, enzyme labeled antigen is mixed with test sample containing antigen, which competes for a limited amount of antibody (Voller et al. 1978).

The bound antigen is then separated from the free material and its enzyme activity is

60 estimated by the addition of substrate. The signal that is emitted can be weakened by an increasing original antigen concentration. The major advantage of competitive ELISA is the ability to use crude or impure samples while still selectively binding to any antigen that may be present (Voller et al. 1978).

Conclusion and Summary

Many in vitro, ex vivo, and animal studies have provided ample evidence that polyphenolic compounds like those found in peanuts, particularly catechins and flavonoids, may reduce the incidence of a number of chronic diseases via their antioxidant properties, or by modulating various cellular signaling pathways (Higgs, 2003; Nakamura et al. 2001;

Morton et al. 2000; Howard and Kritchersky, 1999; Cao et al. 1997; Adlercreutz and Mazur,

1997). However, the evidence gathered from these studies has yet to extrapolate to peanut skins. The bioavailability of polyphenolic compounds in peanut skins, its metabolites, and their ability to elicit health effects at physiologically relevant levels is not yet understood.

The experimental concentrations of peanut skins may be higher than physiologically tolerable levels, which, if given to humans on a regular basis, could cause toxic effects over time. Additionally, cell culture conditions are drastically different from human physiological conditions, making it difficult to determine if the observed effects in culture will also occur in humans.

Peanut skins are normally restricted to animal feed; therefore, there is a lack of reporting for peanut skin consumption studies. This makes it extremely difficult to assess actual skin extract intake and the possible effects on health. Thus, a better understanding of the properties of peanut skins, their polyphenolic compounds, and the specific mechanisms

61 by which they exert their health effects in humans as well as in vivo needs to be established before recommendations for peanut skin extract consumption can be implemented.

62 References

Adlercreutz, H.; Mazur W.; Phyto-oestrogens and western diseases. Ann. Med. 1997, 29, 95– 120.

Ahmad, N.; Adhami, V. M.; Afaq, F.; Feyes, D. K.; Mukhtar, H. Resveratrol causes WAF- 1/p21-mediated G (1)-phase arrest of cell cycle and induction of apoptosis in human epidermoid carcinoma A431 cells. Clin. Cancer Res. 2001, 7, 1466-1473.

Alper, C. M.; Mattes, R. D. Peanut consumption improves indices of cardiovascular disease risk in healthy adults. J. Am. Coll. Nutr. 2003, 22(2), 133-141.

American Peanut Council. Peanut Information, 2006. http://www.peanutsusa.org.uk/Europe/index.cfm?fuseaction=home.page&pid=55. Accessed November, 2009.

Amerine, M. A.; Ough C. S. In Methods for analysis of musts and wines. Hoboken, New Jersey: John Wiley & Sons 1980.

Apel, K.; Hirt, H. Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu. Rev. Plant Biol. 2004, 55, 373-399.

Appiah-Opong, R.; Commandeur, J.N.; van Vugt-Lussenburg, B.; Vermeulen, N.P. Inhibition of human recombinant cytochrome P450s by curcumin and curcumin decomposition products. Toxicol. 2007, 235, 83-91.

Arora, M. K.; Strange, R. N. Phytoalexin accumulation in groundnuts in response to wounding. Plant Sci. 1991, 78, 157-163.

Arts, I. C. W.; Hollman, P. C. Polyphenols and disease risk in epidemiologic studies. Amer. J. Clinical. Nutr. 2005, 81 (1), 317S-325S.

Ashida, H.; Fukuda, I.; Yamashita, T.; Kanazawa, K. Flavones and flavonols at dietary levels inhibit a transformation of arylhydrocarbon receptor induced by dioxin. FEBS Lett. 2000, 476, 213-217.

Aura, A. M.; O’Leary, K. A.; Williamson, G.; et al. Quercetin derivatives are deconjugated and converted to hydroxyphenylacetic acids but not methylated by human fecal flora in vitro. J. Agric. Food Chem. 2002, 50, 1725–30.

Bagchi, D.; Garg, A.; Krohn, R. L.; Bagchi, M.; Bagchi, D. J.; Balmoori, J. Protective effects of grape seed proanthocyanidins and selected antioxidants against TPA- induced hepatic and brain lipid peroxidation and DNA fragmentation, and peritoneal macrophage activation in mice. Gen. Pharm. 1998, 30(5), 771-776.

63 Ballard, T.; Mallikarjunan, P.; Zhou, K.; O'Keefe, S. Optimizing the extraction of phenolic antioxidants from peanut skins using response surface methodology. J. Agri. Food Chem. 2009, 57(8), 3064-3072.

Bankole, S. A.; Eseigbe, D. A. Aflatoxins in Nigerian dry-roasted groundnuts. J. Nutr. Food Sci. 2004, 34(6) 268-271.

Basha, S. M.; Musingo, M. N.; Mohanty, B.; Dorner, J. W.; Cole, R. J. Factors affecting phytoalexin production in peanut seed. Plant Physiol. 1990, 136, 143-148.

Baynes, J. W. Thorpe, S. R. Role of oxidative stress in diabetic complications: a new perspective on an old paradigm. Diabetes. 1999, 48(1), 1-9.

Biesalski, H. K. Polyphenols and inflammation: Basic interactions. Curr. Opin. Clin. Nutr. Met. Care. 2007, 10, 724-728.

Blomhoff, R.; Carlsen M. H.; Andersen, L. F,; Jacobs D. R. Health benefits of nuts: potential role of antioxidants. Br. J. Nutr. 2006, 96, S52-S60.

Blomhoff, R. Dietary antioxidants and cardiovascular disease. Curr. Opin. Lipidol. 2005, 16, 47-54.

Bolling, B. W.; McKay, D. L.; Blumberg, J. B. The phytochemical composition and antioxidant actions of tree nuts. Asia Pac. J. Clin. Nutr. 2010, 19 (1), 117-123.

Bonney, R. J.; Humes, J. L. Physiological and pharmacological regulation of prostaglandin and leukotriene production by macrophages. J. Leukocyte. Biol. 1984, 35, 1-10.

Box, J. D. Investigation of the Folin−Ciocalteu phenol reagent for the determination of polyphenolic substances in natural waters. Water Res. 1983, 17, 511−525.

Burda, S.; Oleszek, W. Antioxidant and antiradical activities of flavonoids. J. Agric. Food Chem. 2001, 49, 2774-2779.

Burke, V.; Milligan, R. A.; Beilin, L.J. et al. Clustering of health-related behaviors among 18-year-old Australians. Prev. Med. 1997, 26, 724–33.

Burnette, W. N. “Western Blotting”: Electrophoretic transfer of proteins from sodium dodecyl sulfate-polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A. Anal. Biochem. 1981, 117 (2), 195-203.

Butke, T. M.; Sandstrom, P. A. Oxidative stress as a mediator of apoptosis. Immun. Today. 1994, 15(1), 7-10.

64 Cadenas, E.; Davies, K. J. Mitochondrial free radical generation, oxidative stress, and aging. Free Rad. Biol. Med. 2000, 29(3-4), 222-230.

Cao G.; Sofic, E.; Prior, R. L. Antioxidant and prooxidant behavior of flavonoids: structure-activity relationships. Free Radic. Biol. Med. 1997, 22, 749-760.

Chassaigne, H.; Trégoat, V.; Nørgaard, J. V.; Maleki, S. J.; van Hengel, A. J. Resolution and identification of major peanut allergens using a combination of fluorescence two- dimensional differential gel electrophoresis, western blotting and Q-TOF mass spectrometry. J. Proteomic. 2009, 72 (3), 511-526.

Chandra, J.; Samali, A; Orrenius, S. Triggering and modulation of apoptosis by oxidative stress. Free Rad. Biol. Med. 2000. 29 (3-4), 323-333.

Chen, C.; Blumberg, J. B. Phytochemical composition of nuts. Asia Pac. J. Clin. Nutr. 2008, 17 (S1), 329-332.

Chen, R. S.; Wu, P. L.; Chiou, R. Y-Y. Peanut roots as a source of resveratrol. J. Agri. Food Chem. 2002, 50 (6), 1665-1667.

Chukwumah, Y.; Walker, L. T.; Verghese, M.; Ogutu, S.; Bokanga, M. Extraction of selected phytochemicals from peanuts (Arachis hypogae L.) using high-frequency ultrasonication method. Ultrason. SoniChem. 2009, 16, 293-299.

Constanza, K. E.; White, B. L.; Davis, J. P.; Sanders, T. H.; Dean, L. L. Value-added processing of peanut skins: antioxidant capacity, total phenolics, and procyanidin content of spray-dried extracts. J. Agric. Food Chem. 2012, 60 (43), 10776-10783.

Copper, G. M.; Hausman, R. E. The cell: a molecular approach, 3rd ed. ASM Press, Washington, DC. 2004, pg 591.

Crozier, A.; Jensen, E.; Lean, M. E. J.; McDonald, M. S. Quantitative analysis of flavonoids by reversed-phase high performance liquid chromatography. J. Chromatogr. A 1997, 761, 315-321.

Currie, M. G.; Needleman, P. Renal arachidonic acid metabolism. Ann. Rev. Physiol. 1984, 46, 327-341.

Dai, J.; Mumper, R. J. Plant phenolics: extraction, analysis and their anticancer properties. Molec. 2010, 15, 7313-7352.

Davies, P.; Bailey, P. J.; Goldenberg, M. M. The role of arachidonic acid oxygenation products in pain and inflammation. Ann. Rev. Immunol. 1984, 2, 335-357.

65 De Beer, D.; Joubert, E.; Gelderblom,W. C. A.; Manley, M. Antioxidant activity of South African red and white cultivar wines: Free radical scavenging. J. Agri. Food Chem. 2003, 51 (4), 902-909.

Didzbalis, J.; Ritter, K. A.; Trail, A. C.; Plog, F. J. Identification of fruity/fermented odorants in high-temperature-cured roasted peanuts. J. Agric. Food Chem. 2004, 52, 4828– 4833.

Djoko, B.; Chiou, R. Y-Y.; Shee, J.; Liu, Y. Characterization of immunological activites of peanut stilbenoids, arachidin-1, piceatannol, and resveratrol on lipopolysaccharide-induced inflammation of RAW 264.7 macrophages. J. Agric. Food Chem 2007, 55, 2376-2383.

Dong, M. W. In Modern HPLC for practicing scientists. Hoboken, New Jersey: John Wiley & Sons, 2006.

Dorner, J. W.; Cole, R. J.; Sanders, T. H.; Blankenship, P. D. Interrelationship of kernel water activity, soil temperature, maturity, and phytoalexin production in preharvest aflatoxin contamination of drought-stressed peanuts. Mycopath. 1989, 105, 117-128.

Du, Y.; Guo, H.; Lou, H. Grape seed polyphenols protect cardiac cells from apoptosis via induction of endogenous antioxidant enzymes. J. Agric. Food Chem. 2007, 55, 1695- 1701.

Duke, J. A. In Handbook of phytochemical constituents of GRAS herbs and other economic plants. 1992. CRC Press. Boca Raton, Fl.

Ellsworth, J. L.; Kushi, L. H.; Folsom, A. R. Frequent nut intake and risk of death from coronary heart disease and all causes in postmenopausal women: the Iowa Women’s Health Study. Nutr. Metab. Cardiovasc. Dis. 2001, 11, 372–377.

Escarpa, A.; Gonzales, M. C. An overview of analytical chemistry of phenolic compounds in foods. Crit. Rev. Anal. Chem. 2001, 31, 57-139.

Fajardo, J. E; Waniska, R. D.; Cuero, R. G.; Peiti, R. E. Phenolic compounds in peanut seeds: enhanced elicitation by chitosan and effects on growth and aflatoxin B1 production by Aspergilus flavus. Food Biotec. 1995, 9 (1-2), 59-78.

Fox, J. E.; Starcevic, M.; Kow, K. Y.; Burow, M. E.; McLachlan, J. A. Endocrine disrupters and flavonoid signaling. Nature. 2001, 413, 128–129.

Francisco, M. L. D. L.; Resurreccion, A. V. A. Development of a reversed-phase high performance liquid chromatography (RP-HPLC) procedure for the simultaneous determination of phenolic compounds in peanut skin extracts. Food Chem. 2009, 117, 356-363.

66 Francisco, M. L. D. L.; Resurreccion, A. V. A. Functional components in peanuts. Crit. Rev. Food Sci. Nutr. 2008, 48 (8), 715-746.

Fuleki, T.; Ricardo da Silva, J.M. Catechin and procyanidin composition of seeds from grape cultivars grown in Ontario. J. Agric. Food Chem. 1997, 45, 1156–1160.

Gerlier, D.; Thomasset, N. Use of MTT colorimetric assay to measure cell activation. J. Immunol. Meth. 1986, 94, 57-63.

Ghosh, S. In Handbook of transcription factor NF-kappaB. CRC Press. Boca Raton. 2007.

Goodwin, J. S.; Ceuppens, J. Regulation of the immune response by prostaglandins. J. Clin. Immunol. 1983, 3, 295–315.

Granström, E.; Hamberg, M.; Hansson, G.; Kindahl, H. C. Chemical instability of 15-keto- 13, 14-dihydro-PGE2: The reason for low assay reliability. Prostag. 1980, 19, 933-945.

Greaves, D. and Schall, T. Chemokines and myeloid cell recruitment. Microbes Infect. 2000, 2, 331-336.

Gu, L.; Kelm, M.; Hammerstone, J. F.; Beecher, G.; Holden, J.; Haytowitz, D.; Gebhardt, S.; Prior, R. L. Screening of foods containing proanthocyandins and their structural characterization using LC-MS/MS and thiolytic degradation. J. Agri. Food Chem. 2003, 51, 7513-21.

Gu, L.; Kelm, M.; Hammerstone, J. F.; Beecher, G.; Cunningham, D.; Vannozzi, S.; Prior, R. L. Fractionation of polymeric procyanidins from lowbush blueberry and quantification of procyanidins in selected foods with an optimized normal- phase HPLC-MS fluorescent detection method. J. Agri. Food Chem. 2002, 50(17), 4852- 4860.

Halliwell B.; Gutteridge, J. M. C.; eds. In Free Radicals in Biology and Medicine, 3rd ed. New York: Oxford University Press, 1999.

Halliwell, B.; Whitman, M. Measuring reactive species and oxidative damage and in cell culture: how should you do it and what do the results mean? Br. J. Pharmacol. 2004, 142 (2), 231-255.

Hamberg, M; Samuelsson, B. On the metabolism of prostaglandins E1 and E2 in man. J. Biol. Chem. 1971, 246, 6713-6721.

Hammerstone, J. F.; Lazarus, S. A.; Schmitz, H. H. Procyanidin content and variation in some commonly consumed food. J. Nutr. 2000, 130, 2068S-2098S.

67 Han, X.; Shen, T.; Lou, H.; Dietary polyphenols and their biological significance. Int. J.Mol. Sci. 2007, 8, 950-988.

Hart, J. H. Role of phytostilbenes in decay and disease resistance. Ann. Rev. Phytopathol. 1981, 19, 437-458.

Hefle, S. L.; Helm, R. M.; Burks, A. W.; Bush, R. K. Comparison of commercial peanut skin test extracts. J. Aller. Clin. Immu., 1995, 95 (4), 837-842.

Heim, K. E.; Tangliaferro, A. R.; Bobilya, D. J. Flavonoid antioxidants: chemistry, metabolism and structure-activityrelationships. J. Nutr. Biochem. 2002, 10, 572-584.

Herrmann, K. M.; Weaver, L. M. The shikimate pathway. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1999, 50, 473-503.

Herrmann, K. M. Flavonols and flavones in food plants: a review. J. Food Technol. 1976, 11, 433-448.

Hertog, M. G. L.; Hollman, P. C. H.; Venema, D. P. Optimization of a quantitative HPLC determination of potentially anticarcinogenic flavonoids in vegetables and fruits. J. Agric. Food Chem. 1992, 40, 1591-1598

Higgs, J. The beneficial role of peanuts in the diet – Part 2. Nutr. Food Sci. 2003, 33, (2), 56 – 64.

Ho, C-T. Phenolic Compounds in food: an overview. In Phenolic compounds in food and their effects on health I. 1997, 1-12.

Hollman, P. C. H; Arts, I. C. W. Flavonols, flavones and flavanols-nature, occurrence and dietary burden. J. Sci. Food Agric. 2000, 80, 1081-1093.

Hongxiang, L.; Huiqing, Y.; Bin, M.; Dungmei, R.; Mei, J.; Oka, S. Polyphenols from peanut skins and their free radical scavenging effect. Phytochem. 2004, 65, 2391– 2399.

Howard, B. V.; Kritchevsky, D. Phytochemicals and cardiovascular disease.Circulation, 1997, 95, 2591–2593.

Hsieh, C. C.; Yen, M. H.; Yen, C. H.; Lau, Y. T. Oxidized low density lipoprotein induces apoptosis via generation of reactive oxygen species in vascular smooth muscle cells. Cardiovasc. Res. 2001, 49 (1), 135–145.

Huang, D. ; Ou, B. ; Prior, R. L. The chemistry behind antioxidant capacity assays. J. Agric. Food Chem. 2005, 53(6), 1841-1856.

68 Huang, S. C.; Yen, G. C.; Chang, L. W.; Yen, W. J.; Duh, P. D. Identification of an antioxidant, ethyl protocatechuate, in peanut seed testa. J. Agri. Food Chem. 2003, 51(8), 2380-2383.

Huang, D.; Ou, B.; Hampsch-Woodill, M.; Flanagan, J.; Deemer, E. Development and validation of oxygen radical absorbance capacity assay for lipophilic antioxidants using randomly methylated β-cyclodextrin as the solubility enhancer. J. Agric. Food Chem. 2002, 50, 1815-1821.

Hwang, J. Y.; Shue, J. S.; Chang, H. M. Antioxidative activity of roasted and defatted peanut kernels. Food Res. Inter. 2001, 34(7), 639-647.

Ingham, J. L. 3,5,4-trihydroxystilbene as a phytoalexin from groundnut (Arachis hypogaea). Phytochem. 1976, 15, 1791-1793.

Isanga, J.; Zhang, G. N. Biologically active components and nutraceuticals in peanuts and related products: Review. Food Rev. Int. 2007, 23 (2), 123-140.

Jackson, R. L.; Taunton, O. D.; Morrisett, J. D.; Gotto, A. M. The role of dietary polyunsaturated fat in lowering blood cholesterol in man. Circul Res. 1978, 42, 447- 453.

Jang, M.; Cai, L.; Udeani, G. O.; Slowing, K. V.; Thomas, C. F.; Beecher, C. W. W. et al. Cancer chemopreventive activity of resveratrol, a natural product derived from grapes. Science. 1997, 275 (5297), 218-220.

Jenkins, D. J. A.; Hu, F. B.; Tapsell, L. C.; Josse, A. R.; Kendall, C. W. C. Possible benefit of nuts in type 2 diabetes. J. Nutr. 2008, 138, 1752S-1756S.

Jiang, R.; Jacobs, D. R.; Jr, Mayer-Davis, E.; Szklo, M.; Herrington, D.; Jenny, N. S.; Kronmal, R.; Barr, R. G. Nut and seed consumption and inflammatory markers in the multi-ethnic study of atherosclerosis. Am. J. Epidemiol. 2006, 163, 222- 231.

Jiang, R.; Manson, J. E.; Stampfer, M. J.; Liu, S.; Willett, W.C.; Hu, F.B. Nut and peanut butter consumption and risk of type 2 diabetes in women. JAMA. 2002, 288, 2554– 2560.

Jianmei, Y.; Ahmedna, M.; Goktepe, I. Effects of processing methods and extraction solvents on concentration and antioxidant activity of peanut skin phenolics. Food Chem. 2005, 90, 199–206.

Karadag, A.; Ozcelik, B.; Saner, S. Review of methods to determine antioxidant capacities. Food Anal. Meth. 2009, 2 (1), 41-60.

69 Karchesy, J. J.; Hemingway, W. W. Condensed tannins: (4 beta to 8-2 beta to O to 7)-linked procyanidins in Arachis hypogaea L. J. Agri. Food Chem. 1986, 34 (6), 966-970.

Kim, H. P.; Son, K. H.; Chang, H.; Kang, S. S. Anti-inflammatory plant flavonoids and cellular action mechanisms. J. Pharmacol. Sci. 2004, 96, 229-245.

Kim, H. P.; Kim, H. K.; Cheon, B. S.; Kim Y. H.; Kim, S. Y. Effects of naturally occurring flavonoids on nitric oxide production in the macrophage cell line RAW 264.7 and their structure-activity relationships. Biochem. Pharmacol. 1999, 32, 1141- 1148.

Kratz, M., P. Cullen, F. Kannenberg, A. Kassner, M. Fobker, P. M. Abuja, G. Assmann and U. Wahrburg. Effects of dietary fatty acids on the composition and oxidizability of low density lipoprotein. Eur. J. Clin. Nutr. 2002, 56: 72-81.

Kris-Etherton P. M.; Hu, F. B.; Ros, E.; Sabaté, J. The role of tree nuts and peanuts in the prevention of coronary heart disease: multiple potential mechanisms. J. Nutr. 2008, 138:1746S-1751S.

Kris-Etherton, P.; Hecker.; Bonanome, A.; Coval, S.; Binkoski, A.; Hilpert, A. Bioactive compounds in foods: their role in the prevention of cardiovascular disease and cancer. Am. J. Med. 2002, 113, 71S-78S.

Kubota, S.; Kurihara, T.; Mochimaru, H.; Satofuka, S.; Noda, K.; Ozawa, Y.; Oike, Y.; Ishida, S.; Tsubota, K. Resveratrol prevents ocular inflammation in endotoxin- induced uveitis via inhibiting oxidative damage and nuclear factor-{kappa} B activation. Inves. Ophthalmol. Vis. Sci. 2009, 50 (7), 3512-3519.

Kuo, P.L.; Chiang, L.C.; Lin, C.C. Resveratrol-induced apoptosis is mediated by p53- dependent pathway in HepG2 cells. Life Sci. 2002, 72, 23-34.

Lampe, J. W. Health effects of vegetables and fruit: assessing mechanisms of action in human experimental studies. Am. J. Clin. Nutr. 1999, 70 (3), 475S-490S.

Lang, C. A.; Mills, B. J.; Mastropaolo, W.; Liu, M. C. Blood glutathione decreases in chronic diseases. J. Lab. Clin. Med. 2000, (135) 402-5.

Lazarus, S. A.; Adamson, G. E.; Hammerstone, J. F.; Schmitz, H. H. High-performance liquid chromatography/mass spectrometry analysis of proanthocyanidins in foods and beverages. J. Agri. Food Chem. 1999, 47 (9), 3693-3701.

Lee, H. S. In HPLC analysis of phenolic compounds. In L. M. L. Nollet (Ed.), Food analysis by HPLC, 2nd ed. New York: Marcel Dekker Inc. 2000.

70 Lee, R. T.; Yamamoto, C.; Feng, Y., et al. Mechanical strain induces specific changes in the synthesis and organization of proteoglycans by vascular smooth muscle cells. J. Biol. Chem. 2001, 276, 13847-13851.

Lee, S. C..; Seok, M. J.; So, Y. K.; Hae, R. P.; Nam, K. C.; Ahn, D. U. Effect of far- infrared radiation and heat treatment on the antioxidant activity of water extracts from peanut hulls. Food Chem. 2006, 94, 489–493.

Lequin, R. Enzyme immunoassay (EIA)/enzyme-linked immunosorbent assay (ELISA). Clin. Chem. 2005, 51(12), 2415–2418.

Li, P.; Zhang, Q.; Zhang, W.; Zhang, J.; Chen, X.; Jiang, J.; Xie, L; Zhang, D. Development of a class-specific monoclonal antibody-based ELISA for aflatoxins in peanut. Food Chem. 2009, 115 (1), 313-317.

Libby, P.; Ridker, P. M.; Maseri, A. Inflammation and atherosclerosis. Circulation. 2002, 105, 135-1143.

Loizou, S.; McCrea, J. D.; Rudge, A. C.; Reynolds, R.; Boyle, C. C.; Harris, E. N. Measurement of anti-cardiolipin antibodies by an enzyme-linked immunosorbent assay (ELISA): Standardization and quantitation of results. Clinic. Exp. Immunol. 1985, 62 (3), 738-745.

Lou, H.; Yuan, H.; Maa, B.; Rena, D.; Jia, M.; Oka, S. Polyphenols from peanut skins and their free radical-scavenging effects. Phytochem. 2004, 65(16), 2391-2399.

Lou, H.; Yamazaki, Y.; Sasaki, T.; Uchida, M.; Tanaka, H.; Oka, S. A-type proanthocyanidins from peanut skins. Phytochem. 1999, 51(2), 297-308.

Lousse, J-C.; Defrère, S.; Colette, S.; Van Langendonckt, A.; Donnez, J. Expression of eicosanoid biosynthetic and catabolic enzymes in peritoneal endometriosis. Hum. Repro. 2009, 25(3), 734-741.

Lussignoli, S.; Fraccaroli, M.; Andrioli, G.; Brocco, G.; Bellavite, P. A microplate- based colorimetric assay of the total peroxyl radical trapping capability of human plasma Anal. Biochem. 1999, 269, 38-44.

MacDonald-Wicks, L. K.; Wood, L. G.; Garg, M. L. Methodology for the determination of biological antioxidant capacity in vitro: a review. J. Sci. Food Chem. 2006, 86(13), 2046-2056.

Magalhaes, L. M.; Segundo, M. A.; Reis, S.; Lima, J. L. F. C. Methodological aspects about in vitro evaluation of antioxidant properties. Anal. Chim. Acta. 2008, 613(1), 1-19.

71 Maiti, R.; Wesche-Ebeling, P. In The Peanut (arachis hypogaea L.) Crop. Enfield, NH : Science Publishers. 2002.

Makarov, S. S. NF-kappaB in rheumatoid arthritis: a pivotal regulator of inflammation, hyperplasia, and tissue destruction. Arthrit. Res. 2001, 3 (4), 200-206.

Mamunur Rahman, M.; Bak, I.; Das, K. D. Effectiveness of Resveratrol against cardiovascular disease. Mini-Rev. Organ. Chem. 2010, 7, 256-261.

Mandal, S. M. M; Chakraborty, D.; Dey, S. Phenolic acids act as signaling molecules in plant-microbe symbioses. Plant Signal Behav. 2010, 5(4), 359–368.

Mao, T.K.; Powell, J.; Van de Water, J.; Keen, C.L.; Schmitz, H.H.; Hammerstone, J.F.; Gershwin, M. The effect of cocoa procyanidins on the transcription and secretion of interleukin lβ in peripheral blood mononuclear cells. Life Sci. 2000, 66, 1377-1386.

Mascotti, K. HPC viability measurement: Trypan blue versus acridine orange and propidium iodide. Transfus. 2000, 40 (6), 693-696.

Masferrer, J. L.; Zweifel, B. S.; Manning, P.; Hauser, S.; Leahy, K.; Smith, W.; Isakson, P.; Seibert, K. Selective inhibition of inducible cyclooxygenase 2 in-vivo is anti- inflammatory and nonulcerogenic. Proc. Natl. Acad. Sci. USA. 1994, 91, 3228- 3232.

Matsuyama, M and Yoshimura, R. The target of arachidonic acid pathway is a new anticancer strategy for human prostate cancer. Biolog. 2008, 2 (4), 725–732.

Mazur, W. Phytoestrogen contents in foods. In Bailliere’s Clinical Endocrinology and Metabolism. 1998. 12, 729-742.

Mazur, E. M.; Dukem, J. A.; Wahala, K.; Rasku, S.; and Adlecreutz. Isoflavonoids and lignans in legumes: Nutritional and health aspects in humans. Nutr. Biochem. 1998, 9,193-200.

Mazza, G.; Minati, E. In Anthocyanins in Fruits, Vegetables, and Grains. CRC Press, Boca Raton. 1993.

McCrae, R. ed. HPLC in Food Analysis. Academic Press, London, 1988.

McPhillips, J. B.; Eaton, C. B.; Gans, K. M.; et al. Dietary differences in smokers and non- smokers from two southern New England communities. J. Am. Diet Assoc. 1994, 94, 287–92.

72 Merken, H. M.; Beecher, G. R. Liquid chromatographic method for the separation and quantification of prominent flavonoids aglycones. J. Chromatogr. A. 2000, 897, 177- 184.

Morton, L. W.; Caccetta, A.; Puddey, I. B.; Croft, K. D. Chemistry and biological effects of dietary phenolic compounds: Relevance to cardiovascular disease. Clin Exp Pharmacol Physiol. 2000;27:152 159.

Moore , J.; Yin, J.; Yu, L. Novel flourometric assay for hydroxyl radical scavenging capacity (HOSC) estimation. J. Agric. Food Chem. 2006, 54, 617-626.

Mittler, R. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 2002, 7(2), 406-410.

Mohanty, B.; Basha, S. M.; Gorbert, D. W.; Cole, R. J.; Dorner, J. W. Variation in phytoalexin production by peanut seed from several genotypes. Peanut Sci. 1991, 18, 19-22.

Monagas, M.; Garrido, I.; Lebron-Aguilar, R.; Gomez-Cordoves, M. C.; Rybarczyk, A.; Amarowicz, R.; Bartolome, B. Comparative flavan-3-ol profile and antioxidant capacity of roasted peanut, hazelnut, and almond skins. J. Agric. Food. Chem. 2009, 57, 10590-10599.

Morgan, D. O. In The Cell Cycle: Principles of Control. London: Published by New Science Press in association with Oxford University Press. 2007.

Moskaug, J. O.; Carlsen, H.; Myhrstad, M. C. W.; Blomhoff, R. Polyphenols and glutathione synthesis regulation. Am. J. Clin. Nutr. 2005, 81 (1), 277S-283S.

Mossmann, T. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J. Immu. Meth. 1983, 65 (1-2), 55-63.

Naczk, M., & Shahidi, F. Extraction and analysis of phenolics in food. J. Chromatogr. A. 2004, 1054 (1–2), 95–111.

Nakamura, Y.; Tsuji, S; Tonogai, Y. Method for analysis of tannic acid and its metabolites in biological samples: application totannic acid metabolism in the rat. J. Agric. Food Chem. 2003, 51, 331-339.

Nakamura, Y.; Torikai, K.; Ohigashi, H. Toxic dose of a simple phenolic antioxidant, protocatechuic acid, attenuates the glutathione level in ICR mouse liver and kidney. J. Agric. Food Chem. 2001, 49, 5674–5678.

73 Natella, F. Grape seed proanthocyanidins prevent plasma postprandial oxidative stress in humans. J. Agri. Food Chem. 2002, 50 (26), 7720-7725.

Needleman, P. Arachidonic acid metabolism. Ann. Rev. Biochem. 1986, 55 (1), 69-102.

Nelson, D. L.; Cox, M. M. In Lehninger: Principles of Biochemistry. Worth Publishers; New York, New York. 2004.

Nepote, V. Grosso, N.; Guzman, C. Optimization of extraction of phenolic antioxidants from peanut skins. J. Sci. Food Agri. 2005, 85 (1), 33-38.

Nepote, V.; Grosso, N.; Guzman, C. Extraction of antioxidant components from peanut skins. Grasas Aceit. 2002, 53, 391– 395.

Nollet, L. ed. Food Analysis by HPLC, 2nd ed. Marcel Dekker, New York, 2000.

O'Sullivan, G. M.; Chilton, F. H.; Huggins, E. M.; McCall, C. E. Lipopolysaccharide printing of alveolar macrophages for enhanced synthesis of eicosanoids involves induction of a novel prostaglandin H synthase. J. Biol. Chem. 1992, 267, 14544- 14550.

Ou, B.; Huang, D.; Hampsch-Woodill, M.; Flanagan, J. A.; Deemer, E. K. Analysis of antioxidant activities of common vegetables employing oxygen radical absorbance capacity (ORAC) and ferric reducing antioxidant power (FRAP) assays: a comparative study. J. Agric. Food Chem. 2002, 50(11), 3122-3128.

Ou, B.; Hampsch-Woodill, M.; Prior, R. L. Development and validation of an improved oxygen radical absorbance capacity assay using fluorescein as the fluorescent probe. J. Agri. Food Chem. 2001, 49 (10), 4619-4626.

Ozgen, M.; Reese, R. N.; Tulio, A. Z.; Scheerens, J. C.; Miller, R. Modified ABTS method to measure antioxidant capacity of selected small fruits and comparison to ferric reducing antioxidant power (FRAP) and DPPH methods. J. Agric. Food Chem. 2006, 54, 1151-1157.

Peanut Plant. http://www.americasbestnutco.com/generalinfo.html. Accessed November 26, 2012.

Peterson, G. L. Review of the Folin phenol protein quantitation method of Lowery et al. Anal. Biochem. 1979, 18, 201−220.

Pinelo, M.; Laurie, V. F.; Waterhouse, A. L. A simple method to separate red wine nonpolymeric and polymeric phenols by solid-phase extraction. J. Agri. Food Chem. 2006, 54, 2839-2844.

74 Portanova, J. P.; Zhang, Y.; Anderson, G. D.; Hauser, S. D.; Masferrer, J. L.; Seibert, K.; Gregory, S. A.; Isakson, P. C. Selective neutralization of prostaglandin E2 blocks inflammation, hyperalgesia, and interleukin 6 production in vivo. J. Exp. Med. 1996, 184 (3), 883-891.

Prakash, D.; Kumar, N. Cost effective natural antioxidants. In Nutrition and Health, Part 4. 2011, 163-187.

Prescott, D.M., Editor. In Methods in Cell Biology.Vol. XIV, Academic Press, New York. 1976, 341–354.

Prior, R. L.; Wu, X.; Schaich, K. Standardized methods for the determination of antioxidant capacity and phenolics in foods and dietary supplements. J. Agric.Food Chem. 2005, 53, 4290-4302.

Prior, R. L.; Hoang, H.; Gu, L.; Wu, X.; Bacchiocca, M.; Howard, L.; Hampsch-Woodill, M.; Huang, D.; Ou, B.; Jacob, R. Assays for hydrophilic and lipophilic antioxidant capacity (oxygen radical absorbance capacity (ORACFL)) of plasma and other biological and food samples. J. Agric. Food Chem. 2003, 51, 3273-3279.

Prior, R. L.; and Gu, L. Occurenece and biological significance of proanthocyanidins in the American diet. Phytochemistry. 2005, 66 (18), 2264-2280.

Proteggente, A. R.; Pannala, A. S.; Paganga, G.; van Buren, L.; Wagner, E.; Wiseman, S.; van de Put, F.; Dacombe, C.; Rice-Evans C. A. The antioxidant activity of regularly consumed fruit and vegetables reflects their phenolic and vitamin C composition. Free Rad. Res. 2002, 36, 217-233.

Rasmussen, S. E.; Frederiksen, H.; Krogholm, K. S.; Poulsen, L. Dietary proanthocyanidins: Occurrence, dietary intake, bioavailability, and protection against cardiovascular disease. Mol. Nutr. Food Res. 2005, 49, 159-174.

Raz, A.; Wyche, A.; Needleman, P. Regulation of fibroblast cyclooxygenase synthesis by interleukin-1. J. Biol. Chem. 1989, 263, 3022-3028.

Renaud, S.; de Lorgeril, M. Wine, alcohol, platelets, and the french paradox for coronary heart disease. Lancet. 1992, 339 (8808), 1523-1526.

Rice-Evans, C. A.; Miller, N. J.; Bolwell, G. P.; Bramley, P. M.; Pridham, J. B. The relative antioxidant activities of plant-derived polyphenolic flavonoids. Free Rad. Res. 1995, 22 (4), 375-383.

Rice-Evans, C. A.; Miller, N. J.; Pagana, G. Structure-antioxidant activity relationships of flavonoids and phenolic acids. Free Radic. Biol. Med. 1996, 20, 933-956.

75 Rice-Evans, C. A.; Packer, L.; eds. In Flavonoids in Health and Disease, 2nd ed. Marcel Dekker, Inc: New York, 2003.

Riss, T.; O’Brien, M.; Moravec, R. Choosing the right cell-based assay for your research. Cell Notes. 2003, 6, 6-12.

Sakakibara, H.; Honda Y.; Nakagawa, S.; Ashida H.; Kanazawa, K. Simultaneous determination of all polyphenols in vegetables, fruits, and teas. J. Agric. Food Chem. 2003, 51, 571-581.

Sanders, T. H.; McMichael, R. W.; Hendrix, K. W. Occurrence of resveratrol in edible peanuts. J. Agric. Food Chem. 2000, 48, 1243–1246.

Scalbert, A.; Williamson, G. Dietary intake and bioavailability of polyphenols. J. Nutr. 2000. 30, 2073S-2085S.

Schaffer, S.; Podstawa, M.; Visioli, F.; Bogani, P.; Müller, W.E.; Eckert, G.P. Hydroxytyrosolrich olive mill wastewater extract protects brain cells in vitro and ex vivo. J. Agric. Food Chem. 2007, 55, 5043-5049.

Sekher Pannala, A.; Chas, T. S.; O’Brien, P. J.; Rice-Evans, C. A. Flavnoid B-ring chemistry and antioxidant activity: fast reaction kinetics. Biochem Biophys Res Commun. 2001, 282, 1161-1168.

Sies, H. Oxidative stress: oxidants and antioxidants. Exp. Phys. 1997, 82 (2), 291-295.

Singleton, V. L.; Orthofer R.; Lamuela-Ravent, R. M. Analysis of total phenols and other oxidation substrates and antioxidants by means of Folin-Ciocalteu reagent. Methods Enzymol. 1999, 299, 152-178.

Singleton, V. L.; Rossi, J. A. Colorimetry of total phenolics with phosphomolybdic- phosphotungstic acid reagents. Amer. J. Enol. Vitvol. 1965, 16 (3), 144-158.

Snyder, L. R.; Kirkland, J. J.; Glajch, J. L. Practical HPLC method development, 2nd ed. Wiley-Interscience, New York, 1997.

Snyder, L. R.; Kirkland, J. J. Introduction to modern liquid chromatography, 2nd ed. John Wiley and Sons, New York, 1979.

Sobolev, V. S.; Neff, S. A.; Gloer, J. B. New stilbenoids from peanut (Arachis hypogaea) seeds challenged by an Aspergillus caelatus strain. J. Agric. Food Chem. 2009, 57 (1), 62-68.

76 Sobolev, V. S.; Horn, B. W.; Potter, T. L.; Deyrup, S. T.; Gloer, J. B. Production of stilbenoids and phenolic acids by the peanut plant at early stages of growth. J. Agric. Food Chem. 2006, 54, 3505-3511.

Sobolev, V.S. and Cole, R. J. Note on utilization of peanut seed testa. J. Sci. Food Agri. 2003, 84, 105–111.

Sobolev, V. S. and Cole, R. J. trans-Resveratrol content in commercial peanuts and peanut products. J. Agric. Food Chem. 1999, 57, 1435-1439.

Soobrattee, M. A.; Neergheen, V. S.; Luximon-Ramma, A.; Aruoma, O. I.; Bahorun, T. Phenolics as potential antioxidant therapeutic agents: Mechanism and actions. Mut. Res. 2005, 579, 200-213.

Strack, D. Phenolic Metabolism. In Plant Biochemistry. 1997. Academic Press. Oxford, GBR. 387-417.

Talcott, S. T.; Passeretti, S.; Duncan, C. E.; Gorbet, D. W. Polyphenolic content and sensory properties of normal and high oleic acid peanuts. Food Chem. 2005, 3, 379-388.

Tak, P. P. and Firestein, G. S. N. NF-κB: a key role in inflammatory diseases. J. Clin. Invest. 2001, 107(1), 7–11.

Tanaka, T.; Makita, H.; Ohnishi, M.; Hirose, Y.; Wang, A.; Mori, H.; Satoh, K.; Hara, A.; Ogawa, H. Chemoprevention of 4-nitroquinoline 1-oxide-induced oral carcinogenesis by dietary curcumin and hesperidin: comparison with the protective effect of β-carotene. Cancer Res. 1994, 54, 4653–4659.

Tanaka, T.; Kojima, T.; Kawamori, T.; Wang, A.; Suzui, M.; Okamoto, K.; Mori, H. Inhibition of 4-nitroquinoline-1-oxideinduced rat tongue carcinogenesis by the naturally occurring plant phenolics caffeine, ellagic, chlorogenic and ferulic acids. Carcinogen. 1993, 14, 1321-1325.

Tatsuno, T.; Jinno, M.; Kawabata, T.; Hasegawa, T.; Yahagi, N.; Takano, F.; Ohta, T. Anti- inflammatory and Anti-melanogenic Proanthocyanidin Oligomers from Peanut Skin. Biol. Pharm. Bull. 2010, 35(6), 909-916.

Tennant, J. R. Evaluation of the trypan blue technique for determination of cell viability. Transplant. 1964, 2, 685-694.

Tiwari, A. K. Imbalance in antioxidant defense and human diseases: Multiple approach of natural antioxidants therapy. Curr. Sci. 2001, 81, 1179-1187.

77 USDA National Nutrient Database for Standard Reference. Nutrient Data Laboratory, Agricultural Research Service, United States Department of Agriculture. 2011. http://ndb.nal.usda.gov/ndb/foods/show/605. Retrieved August 3 2011.

Valkonen, M. Kuusi, T. Spectrophotometric assay for total peroxyl radical trapping antioxidant potential in human serum. J. Lipid Res. 1997, 38, 823-833.

Van Ha, H.; Pokorny, J.; Sakurai, H. Peanut skin antioxidants. J. Food Lipids, 2007, 14 (3), 298-314.

Vane, J. R.; Bakhle, Y. S; Botting, R. M. Cyclooxygenases 1 and 2. Ann. Rev. Pharmacol. Toxicol. 1998, 38 (1), 97-120.

Voller, A.; Bartlett, A.; Bidwell, D. E. Enzyme immunoassays with special reference to ELISA techniques. J. Clin. Path. 1978, 31 (6), 507-520.

Wahyudi, S.; Sargowo, D. Green Tea Polyphenols Inhibit Oxidized LDL-induced NF-KB Activation in Human Umbilical Vein Endothelial Cells. Acta. Med. Indones- Indones. J. Intern. Med. 2007, 39(2), 66-70.

Wang, J.; Yuan, X.; Jin, Z.; Tian, Y.; Song, H. Free radical and reactive oxygen species scavenging activities of peanut skins extract. Food Chem. 2007, 104(1), 242-250.

Ward, S. Cell-based assays and their role in the future of toxicity texting: part 1. 2008. http://alttox.org/spotlight/013/. Accessed November 1, 2012.

Watson, J. D.; Baker, T. A.; Bell, S. P.; Gann, A.; Levine, M.; Losick, R. "Chapter 7". Molecular Biology of the Gene, 5th ed. San Francisco: Pearson/Benjamin Cummings. 2004.

Williams, R. J.; Spencer J. P. E.; Rice-Evans, C. A. Flavonoids: Antioxidants or signaling molecules? Free Radic Biol. 2004, 36, 838-849.

Williams, T. J.; Peck, M. J. Role of prostaglandin-mediated vasodilation in inflammation. Nature. 1977, 270, 530-532.

Williams, T. J.; Morley, J. Prostaglandins as potentiators of increased vascular permeability in inflammation. Nature. 1973, 246, 2-15.

Wollenweber, E.; Dietz, V. H. Occurrence and distribution of free flavonoid aglycones in plants. Phytochem. 1981, 20, 869-932.

78 Wolter, F.; Akoglu, B.; Clausnitzer, A.; Stein, J. Downregulation of the cyclin D1/Cdk4 complex occurs during resveratrol-induced cell cycle arrest in colon cancer cell lines. J. Nutr. 2001, 131, 2197-2203.

Woodroof, J. G. Salted peanuts. In Peanuts: production, processing, products, 3rd ed. AVI Publishing Co., Inc., Connecticut. 1983, 232

World Health Organization. WHO and Cardiovascular Disease. 2009. http://www.who.int/mediacentre/factsheets/fs317/en/index.html. Accessed November, 2010.

Yang, J.; Halim, L.; Liu, R. H.; Antioxidant and antiproliferative activities of common nuts. LWT- Food Sci. Tech. 2009. 42(1), 1-8.

Yang, H.; Chen, C. Cyclooxygenase-2 in synaptic signaling. Curr. Pharm. Des. 2008, 14 (14), 1443-1451.

Yen, W. J.; Chang, L. W.; Duh, P. D. Antioxidant activity of peanut seed testa and its antioxidant component, ethyl protocatechuate. Wiss. U.-Technol. 2005, 38, 193- 200.

Yen, G. C.; Duh, P. D. Scavenging effect of methanolic extracts of peanut hulls on free- radical and active-oxygen species. J. Agric. Food Chem. 1994, 42 (3), 629-632.

Yu, J.; Ahmedna, M.; Goktepe, I.; Dai, J. Peanut skin procyanidins: Composition and antioxidant activities as affected by processing. J. Food Comp. Anal. 2006, 19 (4), 364-371.

Yu, J.; Ahmedna, M.; Goktepe, I. Effects of processing methods and extraction solvents on concentration and antioxidant activity of peanut skin phenolics. Food Chem.2005, 90 (1-2), 199-206.

Zawoznik MS, Garrido LM, del Pero Martinez MA, Tomaro ML. Effect of vanillin on growth and symbiotic ability of Bradyrhizobium sp. (Arachis) strain. In Proc. Int. Plant Growth-promoting Rhizobacteria. 2000. http:/www.ag.auburn.edu/argentina.

79

CHAPTER 3:

Anti-inflammatory Effects of Peanut Skin Extracts

on COX-2 in RAW 264.7 Cells

80 Abstract:

Peanut skins have been traditionally regarded as a low economic waste by-product of the peanut industry but they contain high levels of bioactive compounds including catechins and procyanidins, which could benefit human health. The antioxidant activity of peanut skin extracts (PSE) has been reported in vitro; however, the anti-inflammatory properties have yet to be explored in vivo. This is the first report to investigate the anti-inflammatory effects of

PSE on the pro-infalmmatory enzyme Cyclooxygenase-2 (COX-2) and its downstream product prostaglandin E2 (PGE2). Defatted peanut skins were extracted using aqueous solvent mixtures (acetone/water or ethanol/water) and dried to powders. PSE antioxidant activity was determined by Hydrophilic Oxygen Radical Absorbance Capacity (H-ORAC) and Total Phenol assays. PSE extracted with acetone/water had higher H-ORAC and total phenolic values (3060 µmol Trolox/100 g and 290 mg GAE/g) than PSE extracted with ethanol/water (2622 µmol Trolox/100 g and 250 mg GAE/g, respectively). RAW 264.7 cells were treated with 1.0, 2.5 and 5.0% (v/v) of PSE and induced with the inflammatory marker, lipopolysaccharide (LPS) for 12 hours. Protein expression levels of COX-2 were significantly inhibited by PSE in a concentration-dependent manner using Western blotting analysis. Prostaglandin E2 (PGE2) was measured by ELISA. Increasing concentrations of

PSE induced with LPS demonstrated a decrease in PGE2 concentration suggesting that PSE has anti-inflammatory properties.

Keywords: Peanut skins, antioxidants, anti-inflammatory, Cyclooxygenase (COX-2), Prostaglandin E2 (PGE2)

81 Practical Application:

Peanut skins are known for their astringent taste; however, research has shown that peanut skins contain high levels of bioactive compounds including catechins and procyanidins, which could benefit human health. This study shows that bioactive compounds in peanut skins may have anti-inflammatory effects in vitro by reducing Cyclooxygenase 2 production and prostaglandin E2 (an inflammatory marker). These results highlight the potential health benefits of this antioxidant enriched waste material that could be useful to food and nutraceutical industries.

82 Introduction

Peanuts (Arachis hypogaea L.) are one of the most widely used legumes in the world.

Bioactive compounds such as catechins, flavonoids and proanthocyanidins, found in peanuts have been isolated, identified and evaluated for its potential health benefits (Sanders et al.

2000; Yu et al. 2005; Bolling et al. 2010). By-products of the peanut industry such as peanut leaves, roots, hulls, shells and even skins have also been identified as possible sources of bioactive compounds but currently have little economic value (Francisco and Resurreccion

2008). Peanut skins are most commonly used as low cost fillers in animal feed and are known for their astringent taste. Research has shown that peanut consumption provides potential health benefits by containing high levels of bioactive compounds, such as catechins and procyanidins (Francisco and Resurreccion 2008). These same bioactive compounds are also found in fruits, such as grapes, and vegetables and have been extensively studied for their health promoting abilities including cancer inhibition and anti-inflammatory activities

(Yilmaz and Toledo 2006). This would suggest that the bioactivity found in fruits and vegetables could possibly be present in peanut skins. The antioxidant activity of peanut skins has been reported (Nepote et al. 2002, 2005; Van Ha et al. 2007; Ballard et al. 2009) but, there are no reports in the scientific literature regarding the relationship between antioxidant and anti-inflammatory properties of peanut skins.

Prostaglandins are key mediators in inflammation and inflammatory associated cancers. Prostaglandins (PGs) are messengers that contain a 20-carbon polyunsaturated fatty acid (Needleman 1986). They are found in a wide range of tissue types and serve as autocrine or paracrine lipid mediators that act upon platelets, endothelium, uterine and mast cells

83 (Portanova et al. 1996). In humans, PGs act on an array of cells thus having a wide variety of effects including blood clotting, ovulation, initiation of labor, wound healing, immune response, nerve growth and development (Hamberg and Samuelsson 1971). The key regulatory enzyme of PG biosynthesis, in particular PGE2, is cyclooxygenase (COX).

Cyclooxygenase is a bifunctional enzyme that is required for the production of prostaglandins (Vane et al. 1998).

Two isoforms, COX-1 and COX-2, have been identified (Portanova et al. 1996; Vane et al. 1998). Although COX-1 and 2 are both structurally homologous having similar kinetic properties, they are expressed in different parts of the body (Vane et al. 1998). COX-1 is always expressed in nearly all cell types at a constant level. Its PG products help to mediate housekeeping functions such as gastric epithelial cytoprotection and homeostasis. COX-2 is expressed in the central nervous system (CNS) but its activity is normally absent from cells.

However, when COX-2 is induced, protein levels reach their peak then quickly decrease in a matter of hours after a single stimulus (Needleman et al. 1986). Importantly, stimuli known to induce COX-2 are those associated with inflammation such as bacterial lipopolysaccharide

(LPS), tumor necrosis factor (TNF)-α and cytokines (interluekin (IL)-1 and IL-2) (Vane et al.

1998). These observations suggest that COX-2 generates prostaglandins that regulate an inflammatory response. Anti-inflammatory cytokines such as IL-4, IL-10 and IL-13 have been shown to decrease induction of COX-2 (Vane et al. 1998).

Prostaglandin E2 (PGE2) is the major PG synthesized by macrophages. COX-2 expression occurs in response to intrinsic factors, such as cytokines, or extrinsic factor, such as lipopolysaccharide (LPS), therefore, leading to the production of PGE2 (Huang and Wu

84 2002). Several studies have shown that some phenolics in foods may enhance or inhibit PG formation and potentially affect the inflammatory response (Escarpa and Gonzales 2001;

Halliwell and Whitman 2004; Han et al. 2007). For example, antioxidant phytochemical and other components in food may alter COX-2 expression and PG formation. Therefore, it may be useful to investigate the effect of foods on COX-2 expression and PG formation in terms of pathophysiological conditions associated with inflammation.

The aim of this study was to investigate the antioxidant activity of peanut skin extracts (PSE) in relation to their potential use as anti-inflammatory agents. PSE was prepared by freeze drying. The antioxidant activity was investigated using Hydrophilic

Oxygen Radical Absorbance Capacity (H-ORAC) and Total Phenol assays. The anti- inflammatory effect PSE was evaluated upon induction with an inflammatory marker (LPS), and the anti-inflammatory effect of PSE against PGE2 and COX-2 expression was accessed based on in vitro experimentation.

85 Materials and Methods

Chemicals and Sample collection

Peanut skins were supplied by a commercial peanut processor (Jimbo’s Jumbo,

Edenton, NC). RAW 264.7 cells, a murine monocyte/macrophage cell line, were obtained from American Type Culture Collection. Dulbecco's modified Eagle's medium (DMEM),

Fetal Bovine Serum (FBS) and antibiotics (100x Penicillin Streptomycin Glutamine) were purchased from Invitrogen (Carlsbad, CA). Lipopolysaccharide (LPS) from Escherichia coli

Serotype 0111:B4 was purchased from Sigma Aldrich (St. Louis, MO). The β-actin from rabbit monoclonal antibody (mAB) was obtained from Cell Signaling (Danvers, MA). COX-

2 polycolonal antibody was purchased from Caymen Chemical (Ann Arbor, MI).

Preparation of peanut skins extracts

Peanut skins were defatted by stirring covered in 600 mL of hexane (Fisher

Scientific; Pittsburgh, PA) at room temperature overnight. Hexane was removed by vacuum filtration. Skins were redissolved in 200 mL of hexane and then stirred for 3 hours. The supernatant was poured off and defatted skins were air dried overnight, then milled to a fine powder using a Wiley Mill Model 4 (Arthur H. Thomas Company; Philadelphia, PA).

Polyphenolic compounds were extracted by adding ten grams of milled peanut skins to

100 ml of solvent mixture (10 mL solvent/g skins) (ethanol/water 90/10, v/v or acetone/water

50/50, v/v) at room temperature. The mixture was stirred for 120 min. After the extraction, samples were filtered with Whatman No. 1 filter paper (GE Healthcare Life Sciences;

Piscataway, NJ) and the supernatant collected was washed with 2 × 25 ml of solvent

(ethanol/water 90/10, v/v or acetone/water 50/50, v/v). Solvent from the supernatant was

86 dried using a vacuum rotary evaporator (BUCHI Labortechnik AG; Flawil, Switzerland) at

50°C. Once all of the solvent was removed, crude extracts, which consisted of only water, were freeze-dried using VirTis Freeze Dryer (VirTis, Gardiner, NY) and stored in 4°C without light. Freeze-dried samples were stored in -20°C until further analysis. There were three replications of each treatment.

Analysis of total phenolics

The total phenolic concentration in peanut skin extracts was determined using the

Folin–Ciocalteau colorimetric method (Singleton and Rossi, 1965). Briefly, 100 μl of extract was mixed with 0.5 mL of Folin–Ciocalteau reagent, previously diluted 1:10 in deionized water. A sodium bicarbonate solution (60 g/L) of 1.5 mL was added immediately to the extract mixture. This mixture was then incubated for 120 min at 22°C with absorbance readings taken at 725 nm. Total phenolic content data was calculated using a standard curve prepared with gallic acid. Results were expressed as mg of gallic acid equivalents (GAE) per gram of Peanut Skin Extracts (PSE).

Antioxidant activity

Hydrophilic Oxygen Radical Absorbance Capacity (H-ORAC) Assay

The protocol of Prior et al. (2003) was used to measure H-ORAC activity. Costar polystyrene flat-bottom black 96 microwell plates (Corning; Acton, Massachusetts) were used to perform these assays in 75 mM phosphate buffer, pH 7.4. Either Trolox standard or test sample was added to reach a final reaction volume of 250 μl. Trolox (Aldrich;

Milwaukee, WI) standard solutions were prepared in phosphate buffer at the following concentrations: 3.12, 6.25, 12.5, 30 and 50 μM. The Trolox standards (130 μl), PSE samples

87 (130 μl) and blanks (130 μl) were delivered to appropriate wells. Sixty microliters of a 70 nM Fluorescein solution (Reidel-deHaen; Seelze, Germany), dissolved in 75 mM phosphate buffer, were added to each well and the plate was covered and incubated for 15 min in a

SAFIRE2 microplate reader (Tecan USA; Raleigh NC) preheated to 37 °C. A stock solution of 2, 2′-azobis (2-amidino-propane) dihydrochloride (AAPH) was made to a final concentration of 153 mM in phosphate buffer (Wako; Richmond, VA) (60 μl), and 60 μl was added to wells to generate the peroxyl radicals. Prior to recording the first measurement, the black-bottom plate was shaken for five seconds using a medium orbital intensity.

Fluorescence readings of the plate were acquired over a period of 90 minutes, 1 reading/minute kinetic cycle with a five second medium orbital intensity shake between each cycle. Measurements were taken using the microplate reader equipped with Magellan (v.

6.1) reader software (Tecan USA; Raleigh NC). Excitation and emission filter wavelengths were set at a range of 483 ± 8 and 525 ± 12 nm, respectively. Samples and standard data were measured in triplicate and calculated using Microsoft Excel (Microsoft; Roselle, IL).

Cell culture

RAW 264.7 cells (American Type Culture Collection (ATCC); Manassas, VA) were cultured with Dulbecco's modified Eagle's medium (DMEM) containing 10% (FBS) and 1% antibiotics (40 U/ml penicillin and 40 µg/ml streptomycin), under 5% CO2 at 37 °C. Cell viability was assessed using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide

(MTT) assay (Mosmann 1983).

88

Effects of peanut skin extracts on cell viability

To study the cytotoxicity of peanut skin extracts, cells were plated in 96-well plates

(3 x 105 cells/well) using fresh media and measured using the MTT (3-(4,5-dimethylthiazol-

2-yl)-2,5-diphenyltetrazolium bromide)) assay. The MTT assay is a colorimetric assay for measuring the activity of cellular enzymes that reduce the tetrazolium dye, MTT, to its insoluble formazan, creating a purple color (Mosman 1983). This assay measures cellular metabolic activity via NAD(P)H-dependent cellular oxidoreductase enzymes and may, under defined conditions, reflect the number of viable cells (Mosman 1983). After overnight growth, cells were pretreated with a series of concentrations (1 or 5%) of peanut skin extracts for two hours. Extracts were dissolved in 50 mL of ethanol/water solutions [5 mL ethanol:

45 mL water] or [25 mL of ethanol: 25 mL water] on the day of experiment. At the end of treatment, MTT solution (7.8 mg/mL) was added to each well and incubated for four hours.

For testing cell viability, the MTT assay was performed in the presence or absence of LPS (1

µg/mL) and/or testing compounds based on the method previously described. Formazan crystals were dissolved by addition of acidified isopropanol (200 μL) creating a purple color, which was measured at 620 nm using a SAFIRE2.

Anti-inflammatory activity

Prostaglandin E2 (PGE2) Enzyme Immunoassay

Prostaglandin E2 (PGE2) is a primary product of arachidonic acid metabolism in many cells, including macrophages (Granström et al. 1980). It does not exist preformed in any cellular reservoir but is synthesized de novo and released into extracellular space when cells are activated (Hamberg and Samuelsson 1971). The determination of in vivo PGE2

89 biosynthesis is often best accomplished by the measurement of PGE2 metabolites because of the rapid metabolism of PGE2 (Hamberg and Samuelsson 1971). Cayman

Chemical’s PGE2 EIA kit was used to measure PGE2 activity because all major metabolites are converted into a single stable derivative which is easily measurable. RAW 264.7 cells were cultured in the presence or absence of LPS (1 µg/mL) and/or PSE for a total of 16 hours. Levels of PGE2 in the media were measured by the PGE2-monoclonal enzyme immunoassay (EIA) (Cayman Chemical Company; Ann Arbor, Michigan) according to the manufacturer's instructions. Standards ranging from 7.8 to 1000 pg/ml were used.

Absorbance was measured at 420 nm on SAFIRE2 microplate reader. The limit of detection for this assay is 50 pg/ml.

Western Blotting of COX-2

RAW 264.7 cells were cultured in the presence or absence of LPS (1 µg/mL) and/or

PSE for 12 hr then washed, harvested, homogenized and stored in -80 °C until further used for western blot analysis. Using Tris-glycine gels (12%), electrophoresis was carried out with a Novex Minicell XCell SureLock apparatus (Life Technologies; Grand Island, NY). Bands were blotted to a PVDF membrane (Life Technologies; Grand Island, NY). COX-2 (murine) antibody (160106, Cayman Chemical Company; Ann Arbor, Michigan) was incubated using a 1:300 dilution, and COX-2 bands were visualized after treatment of incubation with a HRP- labeled secondary antibody (Cell Signal; Danvers, MA).

Statistical Analysis

Data were analyzed using the Statistical Analysis System software (SAS, Cary, NC).

For total phenol, ORAC, and MTT analyses analysis of variance was conducted with

90 ProcGLM using Duncan's multiple comparison test to detect differences among means

(α=0.05). A multi-factor analysis of variance based on Proc Mixed with Tukey’s test was used for PGE2 analysis.

Results

Antioxidant Activity

The total phenolic concentration of peanut skin extracts was reported as 292 mg

GAE/g [1:1 acetone:water] 250 mg GAE/g PSE [90:10 ethanol:water] shown in Table 1.

The ORAC values that were observed for this study were acetone PSE, 3060 µmol

Trolox/100 g and ethanol, 2622 µmol Trolox/100g. There were no significant differences

between the two solvent system mixtures used in determining the total phenolic and ORAC

activity.

Cell viability

To understand the effects of PSE bioactive compounds, RAW 264.7 cells were

treated with various concentrations of PSE (0.5g) and dissolved in either [1:9 ethanol: water]

or [1:1 ethanol:water] with a final concentration of ethanol: water to 10% (v/v). Cell

viability was then tested using MTT assay as seen in Figure 2 (Mossman, 1983). The [1:1

ethanol:water] system was used for this study because cell viability was not affected at higher

concentrations of PSE. Therefore, the [1:1 ethanol:water] system was used for all cell assays.

Inhibition of LPS-induced COX-2 and PGE2 expression by Peanut Skin Extracts

As depicted in Figure 3a and b, co-incubation of PSE with 1 μg/mL of LPS

inhibited LPS-mediated induction of PGE2 in a concentration dependent manner (p<0.05).

This observation may suggest that the bioactive compounds in the extracts may suppress

91 PGE2 formation. Skins extracted with acetone appeared to exhibit have a greater suppression on PGE2 activity than ethanol extracts. To further understand the anti-inflammatory effects of both peanut skin extracts, COX-2 expression was analyzed using western blotting. Skins extracted with acetone showed greater suppression on LPS-induced COX-2 protein expression than ethanol extracts (Figure 4).

Discussion

Antioxidant Activity of Peanut Skin Extracts

Peanut skins contain bioactive compounds including catechins, A-type and B-type procyanidin dimers, trimers and tetramers (Yu et al. 2006; Karchesy and Hemingway, 1986).

Extraction of these compounds has been studied using various extraction solvents. Using the

Folin-Ciocalteu reagent, Ballard et al. (2010) reported total phenolic content (TPC) of peanut skins extracted with ethanol as 118 mg/g. Similarly, Nepote et al. (2005) observed a maximum TPC of 118 mg/g from peanut skins under optimal extraction conditions [10 min/room temperature/70% EtOH, mass ratio of 20 ml/g] in the Folin-Ciocalteu method. Yu et al. (2005) measured a total phenolic content of 90-125 mg/g of dry skins using a solvent: mass ratio of 80 ml/g leading to the greatest recovery of total phenols. In this study, peanut skins were extracted using [50:50 acetone/water] or [90:10 ethanol/water] at room temperature with a one hour extraction time and a solvent: mass ratio of 100 ml/g (Table 1).

However, acetone treated peanut skins appear to exhibit a higher total phenolic value due to the interaction of the solvent polarity with the polyphenolic compounds. In all cases, the maximum predicted TPC observed in this work was higher than that reported in previous studies mentioned above. Although ethanol has been reported as an effective solvent for a

92 recovering maximum total phenolic content, our work shows that both acetone and ethanol had similar total phenolic content. Lou et al. (1999) used acetone to extract procyanidins as well as other flavonol moieties. Possibly, similar compounds may be responsible for the higher phenolic activity associated with the acetone fractions used in this study.

ORAC assays were used to measure the peroxyl radical-scavenging ability of PSE based on Trolox antioxidant standards. The peroxyl radical is the most common free-radical in human biology although the hydroxyl radical, singlet oxygen, superoxide radical and reactive nitrogen species are also all present in biological systems (Wu et al. 2004). ORAC assays provide a controllable source of peroxyl radicals that model the reaction of antioxidants with lipids in both food and physiological systems (Prior et al. 2005). In this study, ORAC values were expressed as micromoles of Trolox equivalents (TE) per gram of dry peanut skins. Ballad et al. (2009) reported ORAC values of 2049 µmol TE/g using 30% ethanol and 2789 µmol using [40% methanol, 52.9 °C/30 minute]. Under these optimized conditions, ORAC values that were measured incorporated a combination of shorter extraction time, high temperature and less solvent. ORAC values for a variety of commonly consumed fruits, vegetables, nuts and spices. Yilmaz and Toledo (2006) observed ORAC values of 638 and 345 µmol TE/g for Chardonnay and Merlot grape seeds. Wu et al. (2004) investigated the ORAC activity of blueberries and cranberries, and measured ORAC values of 92.1 and 92.6 μmol TE/g in blueberries and cranberries respectively. Ground cinnamon was reported to have the highest ORAC value (2641 μmol TE/g) of all spices evaluated (Wu et al. 2004). ORAC values were found not be significant.

93 Cytotoxicity Effects of Peanut Skin Extracts

For this study, the viability of RAW 264.7 macrophages treated with peanut skin extracts (1 and 5%) were tested using the MTT assay. The 1.0 and 5.0% levels of PSE were added to determine the maximum amout of PSE that could be added to RAW 264.7 macrophages. Two solvent systems were employed to examine cytotoxicity effects with respect to the cells: [1:9 ethanol:water] or [1:1 ethanol:water] with a final concentration of ethanol: water adjusted to 10% (v/v) (Figure 1). The latter solvent was used for the remainder of the study. This observation suggested that the polarity of the solvent mixture may have some affect on the amount bioactive compound removed from the peanut skin.

However, differences in peanut skin extracts (acetone or ethanol) were shown to be not significantly different. Macrophage viability to the solvent water combinations was also tested. Control wells received the same amount of ethanol: water [5 mL ethanol: 45 mL water] or [25 mL ethanol: 25 mL water]. At both concentrations of ethanol/water, no significant change was seen in cytotoxicity.

Western Blotting Analysis of COX-2 protein expression

Western blotting was performed to determine whether the inhibitory effects of PSE on the pro-inflammatory mediator PGE2 are modulated by the expression of COX-2. In unstimulated RAW 264.7 cells, COX-2 proteins were undetectable. However, in response to

LPS, the expression levels of COX-2 were unregulated, and PSE significantly inhibited

COX-2 expressions in a concentration-dependent manner (Figure 2). However, PSE did not affect the expression of the housekeeping gene β-actin. In general, these results indicate that the reduced expressions of COX-2 by PSE were responsible for the inhibition of PGE2

94 production. However, the various treatment regimens were found to be not significantly different.

Anti-inflammatory Activity of Peanut Skin Extracts on PGE2 production

Macrophage activation is vital for the progression of multiple inflammatory diseases via the release of inflammatory mediators such as cytokines, nitric oxide and prostagalandins

(Liang et al. 1999). As shown in Figure 3a and b, the effects of peanut skin extracts (1.0, 2.5 and 5.0 %, respectively) on PGE2 activity, with and without LPS (1 μg/mL), was investigated. In Figures 3a and b, peanut skins treated with acetone or ethanol without LPS had a minimal effect on PGE2 activity. However, when LPS was added with the peanut skin extract the concentration of PGE2 decreased as the skin extract percentage increased. This suggests that PGE2 formation is being suppressed by the antioxidant content in peanut skin extract. There was a concentration effect only in the presence of LPS thus causing a decrease in inflammatory response with increasing concentration. This effect was seen using either solvent (acetone and ethanol). However, these results did not show any solvent effects per se.

Suppression of PGE2 formation may be affected by the high levels of bioactive compounds, such as catechins and procyanidins, in peanut skins. Although classes of bioactive compounds in peanut skins have not been measured individually in regards to having anti- inflammatory properties, they have been measured in various fruits and vegetables. As far as we know, the effect of polyphenolic compounds in PSE on COX-2 production has not been studied before in this cell model although an inhibition of PGE2 activity has been measured by peanut skin subjected to acid hydrolysis (Cheung et al. 2009).

95 In the current study, PSE exhibited antioxidant activity and demonstrated anti- inflammatory properties based on PGE2 monitoring expression and COX-2 inhibition. Based on the results of the present study, it is conceivable that PGE2 released in high amounts by macrophages in inflamed tissues where inhibited by the bioactive compounds present in PSE.

As a result, these compounds exerted an effect on the expression of PGE2‘s synthesizing enzyme, COX-2. These compounds, which consist of flavonoids, have been measured for their anti-inflammatory activity in vitro and in vivo in other fruits and vegetables (Chi et al

2001; Murakami et al. 2000; Soliman and Mazzio 1998). It has been observed that the structure of these compounds plays a vital role to their anti-inflammatory activity (Williams et al. 2004). Flavonoids, for example epicallogatechin gallate and epigallocatechin-3-gallate, which possess a C-2, 3-double bond and patterns of hydroxylation/methoxylation on the A and B- ring appear to inhibit COX-2 and PGE2 induction (Kim et al. 2004). These compounds are also found in peanut skins (Francisco and Resurreccion 2008). The dose- dependent inhibition of these pro-inflammatory markers demonstrates that peanut skins have anti-inflammatory properties. Several cellular action mechanisms are proposed to explain their anti-inflammatory activity, however, the mechanism of action for PSE has yet to be established. The mode of action of PSE is not yet fully understood but their dose dependent inhibitory effect on PGE2 and COX-2 activity has been established.

3.5 Conclusion

This work shows that the extraction of natural antioxidants from peanut skin extracts have anti-inflammatory activity. In future studies, we plan to further investigate the bioactivity of these phenolics in peanut skins by determining its effect on an inflammatory

96 pathway. This research shows that peanut skins are an inexpensive source of natural antioxidants that could be useful to the food and nutraceutical industries as a potential anti• inflammatory agent.

97 References

Ballard, T, Mallikarjunan, P, Zhou, K, O'Keefe, S. 2010. Microwave-assisted extraction of phenolic antioxidant compounds from peanut skins. Food Chem 120 (4):1185- 1192.

Ballard, T, Mallikarjunan, P, Zhou, K, O'Keefe, S. 2009. Optimizing the extraction of phenolic antioxidants from peanut skins using response surface methodology. J Agri Food Chem 57(8):3064-3072.

Bolling, BW, McKay, DL, Blumberg, JB. 2010. The phytochemical composition and antioxidant actions of tree nuts. Asia Pac J Clin Nutr 19 (1):117-123.

Castilla, R, Gonzàlez, R, Fouad, D, Fraga, E, Muntané, J. 2004. Dual effect of ethanol on cell death in primary culture of human and rat hepatocytes. Alcoh Alcohol 39(4): 290–296.

Chi, YS, Cheon, BS, Kim, HP. 2001. Effect of wogonin, a plant flavone from Scutellaria radix, on the suppression of cyclooxygenase and the induction of inducible nitric oxide synthase in lipopolysaccharide-treated RAW 264.7 cells. Biochem Pharmacol 61:1195-1203.

Cheng, J-C, Kan, L-S, Chen, J-T, Chen, L-G et al. 2009. Detection of cyanidin in different-colored peanut testae and identification of peanut cyanidin 3-sambubioside. J Agric Food Chem 57 (19):8805–8811.

Escarpa, A, Gonzales, MC. 2001. An overview of analytical chemistry of phenolic compounds in foods. Crit Rev Anal Chem 31:57-139.

Francisco, MLDL, Resurreccion, AVA. 2008. Functional components in peanuts. Crit Rev Food Sci Nutr 48 (8):715-746.

Granström, E., Hamberg, M., Hansson, G., et al. 1980. Chemical instability of 15-keto-

13,14-dihydro-PGE2: The reason for low assay reliability. Prostaglan 19:933-945.

Halliwell, B, Whitman, M. 2004. Measuring reactive species and oxidative damage and in cell culture: how should you do it and what do the results mean? Br J Pharmacol 142 (2):231-255.

Hamberg, M, Samuelsson, B. 1971. On the metabolism of prostaglandins E1 and E2 in man. J Biol Chem 246: 6713-6721.

Han, X, Shen, T, Lou, H. 2007. Dietary polyphenols and their biological significance. Int J Mol Sci 8:950-988.

98 Huang, CJ and Wu, MC. 2002. Differential effects of food traditionally regarded as ‘heating’and ‘cooling’ on prostaglandin E2 production by a macrophage cell line. J Biomed Sci 9:595-606.

Karchesy, JJ and Hemingway, WW. 1986. Condensed tannins: (4 beta to 8-2 beta to O to 7)-linked procyanidins in arachis hypogaea L. J Agri Food Chem 34 (6):966-970.

Kim, HP, Son, KH, Chang, H, Kang, SS. 2004. Anti-inflammatory plant flavonoids and cellular action mechanisms. J Pharmacol Sci 96:229-245.

Liang, Y, Huang, Y, Tsai, S, Lin-Shiau, S, Chen, C, Lin, L. 1999. Supression of inducible cyclooxygenase and inducible nitric oxide synthase by apigenin and related flavonoids in mouse macrophagues. Carcinog 20:1945−1952.

Lou, H, Ymazaki, Y, Sasaki, T, Uchida, M, Tanaka, H, Oka, S. 1999. A-type proanthocyanidins from peanut skins. Phytochem 51(2), 297-308.

Murakami, A, Nakamura, Y, Torikai, T, Koshiba, T, Koshimizu, K, et al. 2000. Inhibitory effect of citrus nobiletin on phormol ester-induced skin inflammation, oxidative stress, and tumor promotion in mice. Cancer Res 60:5059-5066.

Mosmann, T. 1983. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J Immu Meth 65 (1-2):55-63.

Needleman, P. 1986. Arachidonic Acid Metabolism. Ann Rev Biochem 55:69-102.

Nepote, V, Grosso, N, Guzman, C. 2005. Optimization of extraction of phenolic antioxidants from peanut skins. J Sci Food Agri 85 (1):33-38.

Nepote, V, Grosso, N, Guzman, C. 2002. Extraction of antioxidant components from peanut skins. Grasas Aceit 53:391– 395.

Portanova, JP, Zhang, Y, Anderson, GD, Hauser, SD, Masferrer, JL, Seibert, K, Gregory, SA, Isakson, PC. 1996. Selective neutralization of prostaglandin E2 blocks inflammation, hyperalgesia, and interleukin 6 production in vivo. J Exp Med 184 (3):883-891.

Prior, RL, Wu, X, Schaich, K. 2005. Standardized methods for the determination of antioxidant capacity and phenolics in foods and dietary supplements. J Agri Food Chem 53 (10):4290–4302.

99 Prior, RL, Hoang, H, Gu, L,Wu, X, Bacchiocca, M, Howard, L, Hampsch-Woodill, M, Huang, D, Ou, B, Jacob, R. 2003. Assays for hydrophilic and lipophilic antioxidant capacity (oxygen radical absorbance capacity (ORACFL)) of plasma and other biological and food samples. J Agric Food Chem 51: 3273-3279.

Sanders, TH, McMichael, RW, Hendrix, KW. 2000. Occurrence of resveratrol in edible peanuts. J Agric Food Chem 48:1243–1246.

Schetter, A J, Heegaard, NHH, Harris, CC. 2010. Inflammation and cancer: interweaving microRNA, free radical, cytokine and p53 pathways. Carcino 31:37-49.

Singleton, VL and Rossi, JA. 1965. Colorimetry of total phenolics with phosphomolybdic-phosphotungstic acid reagents. Am J Enol Vitic 16 (3):144-158.

Soliman, KFA and Mazzio, EA. 1998. In vitro attenuation of nitric oxide production in C6 astrocyte cell culture by various dietary compounds. Proc Soc Exp Biol Med 218:390-397.

Tapani E, Taavitsainen M, Lindros K, Vehmas T, Lehtonen E. 1996. Toxicity of ethanol in low concentrations. Experimental evaluation in cell culture. Acta Radiol 37(6):923-926.

Van Ha, H, Pokorny, J, Sakurai, H. 2007. Peanut skin antioxidants. J Food Lipids 14 (3):298-314.

Vane, JR, Bakhle, YS, Botting, RM. 1998. Cyclooxygenases 1 and 2. Ann Rev Pharmacol Toxicol 38:97-120.

Williams, RJ, Spencer, JPE, Rice-Evans, CA. 2004. Flavonoids: Antioxidants or signaling molecules? Free Radic Biol 36:838-849.

Wu, X., Wu, GR, Beecher, JM, Holden, DB, Haytowitz, SE, Gebhardt and Prior, RL. 2004. Lipophilic and hydrophilic antioxidant capacities of common foods in the United States. J Agri Food Chem 52:4026–4037.

Yilmaz, Y and Toledo, RT. 2006. Oxygen radical absorbance capacities of grape/wine industry byproducts and effect of solvent type on extraction of grape seed polyphenols. J Food Comp Analysis 19 (1):41–48.

Yu, J, Ahmedna, M, Goktepe, I, Dai, J. 2006. Peanut skin procyanidins: Composition and antioxidant activities as affected by processing. J Food Comp Anal 19 (4), 364- 371.

100 Yu, J, Ahmedna, M, Goktepe, I. 2005. Effects of processing methods and extraction solvents on concentration and antioxidant activity of peanut skin phenolics. Food Chern 90 (1-2): 199- 206.

101 Table 1: The total phenolic content and ORAC activity of peanut skin extracts (Acetone or Ethanol) was 1 investigated. There was no significant differences between total phenolic content and ORAC activity. S.E. = standard error. 2 Within a column, means followed by the same letter were not significantly different (p<0.05).

Total Phenols ( mg GAE/g) ± 1 Extracts ORAC (µmol Trolox/100g) ± S.E. S.E

. 2 Acetone 3060 ± 16702 a 292 ± 51 a

Ethanol 2622 ± 31031 a 250 ± 61 a

102

120

100 ab

)

l ab ab o r b

ont 80

C

e e

v i

t

ga 60

Ne

% of %

(

40 T

T

M 20

0 1% EPS (w/v) 5% EPS (w/v) 1% APS (w/v) 5% APS (w/v) in 10% EtOH in 10% EtOH in 10% EtOH in 10% EtOH Treatments

Figure 1: RAW 264.7 cells were treated with 1.0 or 5.0% (v/v) peanut skin extracts (acetone peanut skin (APS) or ethanol peanut skin (EPS)) for 2 h to detect cytotoxicity. The cell viability of peanut skin extract was measured using the MTT assay. Relative to the negative control, cell lysates treated with peanut skin extracts were not significantly different. 1Means followed by the same letter were not significantly different (p<0.05).

103

Figure 2a and b: COX-2 Western Blot. Various amounts of peanut skin extracts (1, 2.5 or 5% (v/v)) inhibited 1μg/mL LPS induced COX-2 expression after 12 h of treatment with RAW 264.7 cells. This inhibition may be based on an expression effect and may inhibit activity on a protein level. The detection of β-actin was used as a loading control. E-PSE = ethanol peanut skin and Acet. = acetone.

104

LPS - + + + + + + + E-PSE - - 1% 2.5% 5% - - - A-PSE - - - - - 1% 2.5% 5%

COX-2 – (72 kDA)

1 2 3 4 5 6 7 8

Β-actin

1 2 3 4 5 6 7 8

105

500

b 400 b bc

L) 300 m

/

pg (

200 e GE2

P e

100

0 negative positive 1% PS 2.5% PS 5% PS control control (w/v) in (w/v) in (w/v) in (LPS) Acet + Acet + Acet + LPS LPS LPS

a 500

400 b

L) 300 m

/ cd

pg (

200 e GE2

P e

100

0 negative positive 1% PS 2.5% PS 5% PS control control (w/v) in (w/v) in (w/v) in (LPS) EtOH + EtOH + EtOH + LPS LPS LPS

Figure 3a and b: LPS induced PGE2 activity in RAW 264.7 cells with Acetone or Ethanol extracted peanut skins. Relative to the negative control, cell lysates treated with peanut skin extracts were not significantly different. Various amounts of peanut skin extract (1.0, 2.5 or 5.0%) were added to RAW 264.7 cells for 2 hours then treated with 1 μg/mL of LPS for 12 h. After 12 h of treatment with RAW 264.7 cells, PGE2 activity was inhibited. This may suggest that COX-2 expression may also be inhibited. 1Means followed by the same letter were not significantly different (p<0.05).

106

CHAPTER 4:

Enhanced Anti-inflammatory Effects of Peanut Skin

Extracts on NF-kB expression in treated RAW 264.7

Macrophages

107 Abstract:

Nuclear factor B is a transcription factor that plays a central role in the onset of inflammation. Therefore, this study sought to determine the anti-inflammatory effects of PSE on iNOS and NF-κB in vitro. We also wanted to investigate if iNOS and NF-κB could be further inhibited at a longer incubation time. RAW 264.7 macrophages were treated with three concentrations (1.0, 2.5 and 5.0% (v/v)) of acetone and ethanol extracted peanut skin extacts (APSE and EPSE) and induced with an inflammatory marker, lipopolysaccharide

(LPS) for 12 and 18 hours. The Greiss assay was used to determine nitrite levels in culture media. There was an increase in NO production between 12 and 18 hours when RAW 264.7 macrophages were stimulated with the positive control LPS, however, PSE reduced NO production in a dose-dependent manner suggesting that inhibition had occurred. Isolation of nuclear fractions was performed for the NF-κB transcription factor assay. PSE significantly decreased NF-κB activity between 12 and 18 hours. PCR analysis of PSE showed nucleotide changes compared to the published iNOS sequence, suggesting that a single nucleotide polymorphism (SNP) was present. Therefore, a suggested molecular mechanism of action for

PSE would be the inhibition of NF-κB activity.

Keywords: Arachis hypogaea L., peanut skins, antioxidants, anti-inflammatory, NF-κB

108 Introduction

Inflammation is part of a complex biological response of tissues against foreign challenge or tissue injury (Choi et al. 2011). Macrophage cells are vital to the regulation of immune responses and the development of inflammation (Choi et al. 2011). Previous studies of inflammation have used RAW 264.7 murine macrophage cells because of their ability to enhance inflammation by secreting pro-inflammatory factors, such as tumor necrosis factor

(TNF) and interleukin 1β (IL-1β) (Pallarès et al. 2011; Permana et al. 2006). These cellular responses require rapid and accurate transmission of signals from cell-surface receptors to signals. Signaling pathways that rely on protein phosphorylation ultimately lead to the activation of specific transcription factors which induce the expression of appropriate target genes in turn promoting chronic inflammation (Pallarès et al. 2011.)

Activated macrophages transcriptionally express inducible nitric oxide synthase

(iNOS), which catalyzes the oxidative deamination of L-arginine to produce nitric oxide

(NO), thus making it responsible for prolonged production of NO (Hu 2011; Bhaskaran et al.

2010). High output of NO by iNOS induces deleterious effects such as inflammation

(Bhaskaran et al. 2010). Cell wall components of bacteria and fungi trigger the innate immune signaling cascade, leading to expression of iNOS (Jang et al. 2004). Recent studies have reported that the expression of inducible nitric oxide synthase (iNOS) is regulated by transcription factor nuclear factor kappa B (NF-κB) (Li and Verma 2002).

Lipopolysaccharide (LPS), a component of gram-negative bacteria cell walls, binds to LPS-

Binding Protein (LBP), which delivers LPS to CD14, a high-affinity LPS receptor (Jang et al.

2004). Toll-like receptor 4 (TRL4) in conjunction with the small extracellular protein, MD2,

109 interacts with the CD14-LPS complex, and then activates an intracellular signaling cascade via adaptors that include Interleukin-1 Receptor-Associated Kinase (IRAK) (Davis et al.

2005). LPS activation of TLR4 also leads to phosphorylation of IKK (Inhibitor of Kappa B

Kinase), which phosphorylates ikappaB causing a release of NF-κB (Hu 2011).

The transcription nuclear factor-kappa B (NF-κB) consists of a family of transcription factors that includes RelA (p65), NF-κB1 (p50 and p105), NF-κB2 (p52 and p100), c-Rel and

RelB (Medzhitov and Horng 2009). In its inactive state, the family of transcription factors that make up NF-kB are retained in the cytoplasm by IkB thus preventing NF-kB activation and inhibiting nuclear accumulation (Muriel 2009; Marienfield et al. 2003). However, when

NF-κB is in its active site, it turns on the expression of genes that help cells to proliferate as well as protect the cell from conditions that would otherwise cause it to die via apoptosis

(Paur et al. 2011). The NF-kB pathway has been linked to pro-inflammatory effects thus serving as a critical regulator in the production of inflammatory mediators in LPS-evoked macrophage inflammation (Medzhitov and Horng 2009). NF-κB controls many genes involved in inflammation, which links NF-κB activity to many inflammatory diseases such as arthritis and asthma, amongst others (Muriel 2009). It has been reported that inhibition of

NF-κB activation could decrease the over expression of iNOS, cycclooxygenase 2 (COX-2) and other inflammatory mediators (D’Acquisto et al. 2002; Lee et al. 2009). Therefore, it has been suggested that regulation of NF-κB should be one of the major target for the treatment of inflammatory diseases (Yamamoto and Gaynor 2001; Yan and Geer 2008).

Many natural products including antioxidants that have been promoted as having anti-inflammatory activity have also been shown to inhibit NF-κB (Rahman et al. 2006;

110 2004; Paur et al. 2011). Polyphenols have been shown to exert their anti-inflammatory activity by modulating NF-κB activation and acting at multiple steps of the activation process

(Rahman et al. 2006; 2004). Paur et al. (2011) reported that extracts from various herbs and dietary plants such as oregano, walnuts and thyme are efficient inhibitors of NF-κB activation in vivo. Polyphenolics in green tea such as (-)-epigallocatechin-3-gallate (EGCG) has been reported to inhibit TPA induced DNA binding of NF-κB in vivo (Khan and Mukhtar

2008). It has also been reported that peanut stilbenoids are efficient inhibitors of NF-κB dependent transcription when activated by LPS (Sobolev et al. 2011). The assumed mechanism of action was inhibition of IL-1β-mediated IL-1β-receptor-associated kinase

(IRAK) degradation and the signaling events downstream from IRAK degradation such as

IKK activation, IκBα degradation, and NF-κB activation (Yang et al. 2001). The IKK appears to be a key control point for NF-κB activation and may be considered a suitable target for modulating NF-κB-mediated cellular responses (Yang et al. 2001). In activated

RAW 264.7 macrophages, the expression of iNOS mRNA and protein was strongly inhibited by a mixture of polyphenols obtained from grape seeds, likely through the reduction of nuclear NF-κB (p65) and of IκBα mRNA production (Terra 2007). Similarly, in activated human mast cell lines, quercetin decreased the expression of pro-inflammatory cytokines

TNFα, IL-1β, IL-6 and IL-8, by inhibiting the degradation of IκBα and the nuclear translocation of p65, thus blocking NF-κB activation (Min et al. 2007).

In a previous study, we reported that peanut skins had anti-inflammatory effects in

RAW 264.7 macrophage cells by reducing COX-2 expression, suggesting that peanut skins may have potential use as an anti-inflammatory agent. However, the molecular basis of

111 action of these bioactive compounds in regards to their anti-inflammatory effects has yet to be explored. Therefore, the aim of this study was to investigate the molecular mechanism of action of peanut skin extracts added to RAW 264.7 macrophage cells that was stimulated by lipopolysaccharide (LPS) by (i) evaluating nitric oxide production and (ii) its effect on NF-

κB transcription factor pathway.

Materials and Methods

Chemicals and sample collection

Peanut skins (mixture of Runners and Virginia) were obtained by blanching from a commercial peanut processor (Jimbo’s Jumbo, Edenton, NC). RAW 264.7 cells, a murine monocyte/macrophage cell line, were obtained from American Type Culture Collection.

Dulbecco's modified Eagle's medium (DMEM), Fetal Bovine Serum (FBS) and antibiotics

(100x Penicillin Streptomycin Glutamine) were purchased from Invitrogen (Carlsbad, CA).

Lipopolysaccharide (LPS) from Escherichia coli Serotype 0111:B4 was obtained from Sigma

Aldrich (St. Louis, MO). Polymerase Chain Reaction (PCR) primers were purchased from

Eurofins MWG Operon (Huntersville, AL).

Preparation of peanut skins extracts

Peanut skins were defatted by stirring covered in 600 mL of hexane (Fisher

Scientific; Pittsburgh, PA) at room temperature overnight. Hexane was removed by vacuum filtration. Skins were dispersed to antoher in 200 mL of hexane and then stirred for 3 hours.

The supernatant was poured off and defatted skins were air dried overnight, then milled to a fine powder using a Wiley Mill Model 4 (Arthur H. Thomas Company; Philadelphia, PA).

Polyphenolic compounds were extracted by adding ten grams of milled peanut skins to

112 100 ml of solvent mixture (10 mL solvent/g skins) (ethanol/water 90/10, v/v or acetone/water

50/50, v/v) at room temperature. The mixture was stirred for 120 min. After the extraction, samples were filtered with Whatman No. 1 filter paper (GE Healthcare Life Sciences;

Piscataway, NJ) and the supernatant collected was washed with 2 × 25 ml of solvent

(ethanol/water 90/10, v/v or acetone/water 50/50, v/v). Solvent from the supernatant was dried using a vacuum rotary evaporator (BUCHI Labortechnik AG; Flawil, Switzerland) at

50 °C. Once all of the solvent was removed, crude extracts, which contained only water, were freeze-dried using VirTis Freeze Dryer (VirTis, Gardiner, NY) and stored in 4 °C without light. Freeze-dried samples were stored in -20°C until analysis. There were three replications of each treatment.

Cell culture and sample treatment

RAW 264.7 cells (American Type Culture Collection (ATCC); Manassas, VA) were cultured with Dulbecco's modified Eagle's medium (DMEM) containing 10% (FBS) and 1% antibiotics (40 U/ml penicillin and 40 µg/ml streptomycin), under 5% CO2 at 37 °C. Cell viability was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide

(MTT) assay (Mosmann 1983). Freeze dried samples (0.5 g skins) were redissolved in 50 mL of a 1:1 ratio of ethanol:water (0.01 mL solvent/g skins) for cell analyses. Cells were incubated with acetone peanut skin extracts (APSE) or ethanol peanut skin extracts (EPSE) at concentrations of 1, 2.5 and 5% (v/v) and then stimulated with LPS (1 µg/mL) for 12 and 18 hours.

113 MTT assay for cell viability

RAW 264.7 cells were plated at a density of 105 cells/well in 12-well plates (Fisher

Scientific, Pittsburgh, Pa). A dose-response curve consisting of various concentrations of

APSE and EPSE with or without LPS at timepoints 0, 6, 12, 18, 20 or 24 hours were added to

RAW 264.7 cells in order to determine the appropriate time-point not toxic to cells. Cell viability declined after 18 hours, therefore, for this study, studies were performed at 12 and

18 hours. Viabilities were determined using colorimetric MTT assays, as described previously by Mossman (1983).

Nitrite Determination

Nitric oxide (NO) is a molecular mediator in many biological systems including vasodilation, inflammation, immunity and neurotransmission (Harold et al. 1994). Due to its involvement in a variety of systems, there is interest in measuring NO in biological tissues and fluids remains strong. In order to measure nitric oxide formation, one must measure

- nitrite (NO2 ), which is one of two primary, stable and nonvolatile breakdown products of

NO. A number of methods have been reported to measure nitrite (Tracey et al. 1990; Stuehr et al. 1989; Ignarro et al. 1987). One of these methods utilizes the Griess diazotization reaction to spectrophotometrically detect nitrite formed by the spontaneous oxidation of NO under physiological conditions. The Greiss assay consists of a diazotization reaction that was originally described by Greiss in 1879 (Greiss 1879). However, many modifications to the original reaction have been made since then (Chaea et al. 2004; Campos-Neto et al. 1998).

RAW 264.7 cells were plated at 4 x 105 cells/well in 12-well plates and then incubated with or without LPS (1 μg/mL) in the absence or presence of various

114 concentrations (1, 2.5 or 5%) of APSE and EPSE for 12 and 18 hours. Nitrite levels in culture media were measured by the Griess assay (Promega; Madison, WI) according to the manufacturer's instructions. Briefly, 50 μl of cell culture was mixed with 50 μl of Griess reagent [equal volumes of 1% (w/v) sulfanilamide in 5% (v/v) phosphoric acid and 0.1%

(w/v) N-1-naphtylethylenediamine-HCl], and incubated at room temperature for 10 minutes.

Absorbance was measured at 520 nm using a SAFIRE2 microplate reader. Fresh culture media were used as blanks in all experiments. Nitrite levels in samples were quantified using a standard sodium nitrite curve (100, 50, 25, 12.5, 6.25, 3.13 and 1.56μM). Nitrite sensitivity depends on the matrix that is being analyzed. The limit of detection was 2.5 µM (125 pmol) nitrite (in ultrapure, deionized distilled water).

Preparation of Nuclear Extracts

Isolation of nuclear fractions was used for the NF-κB transcription factor assay kit according to the manufacturer's instructions. Cytoplasmic and nuclear extracts were prepared using Cayman’s Nuclear Extraction Kit (Cayman Chemical Company; Ann Arbor, MI).

RAW 264.7 cells were plated at 4 x 105 cells/well in 12-well plates and then incubated with or without LPS (1 μg/mL) in the absence or presence of various concentrations (1, 2.5 or 5%) of APSE and EPSE for 12 and 18 hours. Nuclear extracts were stored in -80°C until analysis.

The assay was performed in triplicate.

NF-κB (p65) Transcription Factor Activity

Specific transcription factor DNA binding activity in nuclear extracts was detected using the NF-κB (p65) Transcription Factor Assay (Cayman Chemical Company; Ann Arbor,

MI) according to the manufacturer's instructions. The response element of NF-κB was

115 detected at an absorbance measured at 450 nm on SAFIRE2 microplate reader. The assay was performed in triplicate.

DNA preparation and PCR (Polymerase Chain Reaction)

Total DNA was isolated from cells by using Purelink Genomic DNA Extraction Kit

(Life Technologies, Grand Island, NY) as described by the manufacturer. This kit, which is commonly used, isolates mitochondria DNA from purified mammalian mitochondria (Guo et al. 2009; Muñoz-Cadavid et al. 2008). DNA extracts were suspended in nuclease-free water and frozen at -20 °C until PCR analyses were performed. PCR master mix containing 1U Taq polymerase (New England Biolabs; Ipswich, MA), 10 µM forward and reverse primers

(Eurofins MWG Operon; Huntsville, AL), 1x standard buffer with MgCl2 (New England

Biolabs; Ipswich, MA), and 5 µl of 5 ng/µl of DNA sample was added to peanut extract PCR samples for a total volume of 25 l. The PCR primers for mouse iNOS gene (Genebank, accession no: AF427516.1) are as follows: 5’-TTCTGTTTCCTGTGGAGCCTGGAT-3’

(forward) and 5’- TGGCCCCTTGAACTCACCATCCTCTT-3’ (reverse) (Eurofins MWG

Operon; Huntsville, AL). The PCR was carried out in an Eppendorf Mastercycler pro

(Hamburg, Germany) under the following conditions: initial denaturation at 95 °C for 5 min;

95 °C for 30 sec; 57 °C for 30 sec; 30 cycles of 72 °C for 2 min, and 72 °C for a 4 min final denaturing step. The amplified PCR products were separated by 1% agarose (SeaKem LE agarose; Cambrex BioScience Rockland, Inc.; Rockland, ME)) gel electrophoresis in 1x Tris-

Acetate-EDTA (TAE) buffer. After separation, amplified products were visualized after soaking in GelStar Nucleic Acid Gel Stain (Lonzo; Rockland, ME). A 528 bp products was amplified. A 1 kb γ ladder (New England Biolabs; Ipswich, MA) was used to assure the

116 product was the correct size. Gene sequencing was conducted by Eton Bioscience, Inc (San

Diego, CA).

Statistical Analysis

Results are expressed as the means ± S. D. of triplicate experiments (Fig. 1, 3-8;

Table 1) (SAS 2012). A statistical model was created in order to test for significance amongst treatment: Yijk = μ + αi + τj (ατ)ij + ε ijk with i = sample treatments, j = incubation times (0, 6,

12, etc) and k = triplicate experiments. Statistically significant values were compared using

ANOVA and proc glmix. P-values of less than 0.001 were considered statistically significant.

Results

Effects of APSE or EPSE on LPS-induced NO production and cell viability

The cell viability of APSE and EPSE was assessed in macrophages at various incubation times of 0, 6, 12, 18, 20 and 24 hours, respectively (Figure 1). Macrophages were treated with APSE or EPSE at doses of 1, 2.5 and 5% (v/v) with or without the addition of

LPS (1μg/mL) for the incubation times described above. These incubation periods determined which incubation time would be used for this study to evaluate the anti- inflammatory activity of APSE and EPSE as well as determine when the macrophages would reach apoptosis (below 80% viability). A statistical model was conducted to evaluate the following factors: time, extract and addition on LPS, respectively. Treatments were arranged according to a 2x2x3x6 complete crossed factorial design of the four factors extract, lps, concentration and time, with an additional positive control. The sums of squares for the main and interaction effects from the complete portion of the arrangement of treatments were recovered by nesting these factors within an additional indicator factor called “control". The

117 sums of squares are given in Table 1. The nature of the time-by-concentration (control) interaction was that the decline in viability over time appeared to be more pronounced as concentration increases (Figure 1 and 2). This further suggested that the study should not be conducted past a 20 hour incubation period as cell viability (less than 80% viability) was affected and should be conducted between 12 and 18 hours (Fig. 2, 3 and 4). However, the 12 hour incubation did show significant difference amongst treatments which may suggest there was an effect on cell viability between treatments of 2.5 and 5% EPSE or APSE, respectively

(p<0.001).

To evaluate the anti-inflammatory activity of APSE or EPSE, we investigated the effect of these extracts on NO production in RAW 264.7 cells stimulated by LPS using the

Greiss assay. Unstimulated macrophages after 12 or 18 hours of incubation in culture produced background levels of nitrite. After treatment with LPS (1 μg/mL) for 12 hour, nitrite concentration was increased about fourfold (4 uM, 12 hours) (p<0.001) (Fig. 5). At a longer incubation time of 18 hours, nitrite concentration increased after treatment with LPS

(~7 uM, 18 hours). When macrophages were incubated with various concentrations of each extract (1, 25, 5 % (v/v)) together with 1 μg/mL of LPS for either 12 or 18 hours, significant concentration dependent inhibition of nitrite production was found in the presence of APSE and EPSE (Fig. 2 and 3). However, APSE and EPSE showed NO inhibition in the presence of LPS as nitrite synthesis decreased to basal levels. This may suggest that APSE and EPSE may have pro and anti-inflammatory activity for NO production (Fig. 5).

118 Effects of NF-κB production

In the present study, NF-κB activation was increased when RAW 264.7 cells were stimulated with LPS. Macrophages were challenged for 12 and 18 hours to compare and contrast which incubation time produced more inhibition of the p65 subunit of NF-κB. APSE and EPSE at doses of 1, 2.5 and 5% (v/v) inhibited the binding activity of p65 in a dose- dependent manner (Fig. 6 and 7). Following incubation with LPS, the binding of NF-κB was increased in the nuclear fraction of macrophages compared to unstimulated fractions. The

NF-κB binding activity was significantly inhibited at both incubation times of 12 and 18 hours (p<0.001). However, at the 18 hour incubation time point, there was a severe decrease in NF-κB binding activity.

Effects of APSE or EPSE on LPS-induced iNOS DNA expression

In order to conduct gene sequencing of APSE and EPSE treatments, PCR was performed. The sequences were then compared to the published iNOS gene (Genebank, accession no: AF427516.1) (Fig. 8). APSE and EPSE showed nucleotide changes within the first 90 nucleotides when compared to the iNOS gene. Samples 2.5% APSE with LPS and

5% EPSE had differing polypeptide sequences compared to the iNOS gene. This may imply a single nucleotide polymorphism (SNPs) had occurred.

Discussion

In a previous study (Chapter 3), we reported that polyphenolic compounds in peanut skin extracts (PSE) were found to possess anti-inflammatory and immunomodulatory activities in vitro. The cellular action mechanism of these compounds for their pharmacological activities have been reported in our previous study partly as involving

119 inhibition of cyclooxygenase/prostaglandin E2 (PGE2) and their antioxidative nature. In this investigation, our study clearly showed that PSE inhibited NO production from LPS- activated RAW 264.7 cells. In our model, 2-hr pre-treatment of RAW 264.7 macrophages with non-toxic amounts of PSE, followed by stimulation with LPS for both 12 and 18 hr caused a dose-dependent decrease in NO released (p<0.001). However, at the 12 hr incubation time NO levels were inhibited to basal levels. Several studies have implicated that production of NO may take place between 18-24 hr (Kim et al. 1999; Gentile et al. 2012;

Chiou et al. 2000; Xie et al. 1994); which would explain why very little NO was produced for our study. We chose the 12 hr incubation due to our previous study which reported inhibition of PGE2 by PSE at 12 hr. However, different pathways control the expression of iNOS or PGE2; whereas the main regulatory step for iNOS is the activation of the transcription factor NF-κB (Aktan 2004). A longer incubation may have caused a higher level of NO to be produced, however, due to the cytotoxicity of PSE past a 20 hour incubation period a longer incubation period could not be used for this study.

Various interconnected signal transduction pathways are conncected to macrophage activation, with NF-κB playing a central role in orchestrating an inflammatory response to a wide range of insults, including LPS (Baeurle and Henkel 1994; Gentile et al. 2012). In resting cells, NF-κB exists in the cytoplasm as a p65/p50 heterodimer with the p65 subunit containing the transcriptional activation domain bound to an inhibitory protein from the IκB family. Activation of NF-κB in macrophages is achieved via phosphorylation and subsequent degradation of IκB followed by nuclear translocation of the p65/p50 dimer and its binding to specific response element in DNA (Victor et al. 2004). In our study, an increase in the

120 nuclear p65 subunit consequent to LPS stimulation was dose dependently inhibited by PSE pre-treatment of RAW 264.7 macrophages (p<0.001). Considering that NF-κB in synergy with other transcriptional activators, coordinates the gene expression for pro-inflammatory enzymes and cytokines, including iNOS and COX-2 (Barnes and Karin 1997), these findings suggest that anti-inflammatory activity of PSE is at least in part mediated by inhibition of the

NF-κB activation pathway. Sobolev et al. (2011) also reported an inhibition of NF-κB when

SW1353 cells were treated with peanut stilbenoids.

There is a correlation between iNOS gene expression and protein production; therefore, detection of DNA is an alternative method of demonstrating iNOS induction (Li et al 2006; Geller et al. 1993). One way of measuring gene expression is using a method called polymerase chain reaction (PCR). One application of PCR includes DNA sequencing, which determines unknown PCR-amplified sequences. The amplification primers may be used in

Sanger sequencing, a method is based on amplification of the DNA fragment to be sequenced by DNA polymerase and incorporation of modified nucleotides (Sanger and Coulson 1975).

Quantitative PCR methods allow the estimation of the amount of a given sequence present in a sample, which can be applied to quantitatively determine levels of gene expression. In this study, we used PCR to conduct gene sequencing of APSE and EPSE treatments. As reported above, APSE and EPSE (2.5% APSE with LPS and 5% EPSE) treatments had differing polypeptide sequences compared to the iNOS gene. This would imply that a single nucleotide polymorphism had occurred. A single nucleotide polymorphism (SNP) is identified as a

DNA sequence variation occurring when a single nucleotide: A, T, C, or G in the genome differs between members of a biological species or paired chromosomes in an individual

121 (Thomas 2008; Vos et al 1995; Botstein et al 1980). If a different polypeptide sequence is produced, the polymorphism is a replacement polymorphism. A replacement polymorphism change may be either missense, which results in a different amino acid being produced; or nonsense, which results in a promoter stop codon, a nucleotide triplet within messenger RNA

(mRNA) that signals a termination of translation. If a SNP produces the same polypeptide sequence, a synonymous polymorphism or silent mutation is present. Samples 2.5% APSE with LPS and 5% EPSE had differing polypeptide sequences compared to the iNOS gene.

The remaining treatments that were investigated in this study had the same genetic sequence as the iNOS gene, which may suggest that a synonymous polymorphism may have occurred

(Fig. 8).

Difference in genetics between individuals is of extreme importance in medicine. In many low frequency diseases such as Huntington’s disease and Paget disease of bone, genetic differences can determine with certainty whether or not diseases will develop

(Antonarakis et al. 2000; McKusick and Amberger 1993; Sommer and Ketterling 1996). For most relatively widely spread ‘common’ diseases, genetic differences can also influence the relative probability of developing a disease (Boerwinkle 1996; Copper and Clayton 1988;

Lander 1996; Roses 1997). SNPs are of particular interest due to their potential as genetic markers that can be correlated with genetic markers in a wide variety of human diseases and other traits (Thomas, 2008). Nitric oxide (NO) is a molecular mediator in many biological systems including vasodilation, inflammation, immunity and neurotransmission (Harold et al.

1994). It is a heme-containing monooxygenase with a reductase and an oxygenase domain

(Harold et al. 1994). Resting cells cannot synthesize NO because they lack the inducible NO

122 synthase (iNOS), the enzyme that synthesizes nitric oxide (Lowenstein and Padalko 2004).

However, a variety of extracellular stimuli, for example LPS, can activate certain signaling pathways that converge to initiate expression of iNOS (Xie et al. 1994). iNOS is regulated at the gene expression level; once expressed, it produces NO at a high rate (Hampl et al. 2000).

Previous studies have shown that iNOS gene expression and subsequent NO production may be controlled by various agonists, such as TNF-α, IL-8, IL-1β and LPS, especially in combination with IFN-γ, in both mice and human (Bruch-Gerharz et al. 1996; Summersgill

1995; Saura 1999; Zhang et al. 2011). SNPs have been used to report various polymorphisms of the iNOS gene in different etiologies in diseases. Zhang et al. (2011) reported that they genotyped three polymorphisms of the iNOS gene using PCR methods to explain the etiology of vitiligo in the Chinese population. Out of the three SNPs that were reported, one of the SNPs had an association with vitilgo, suggesting that persons who had this polymorphism were associated to having a higher risk of vitilgo. On the other hand, enhanced levels of NO has also been reported to provide a lower risk of malaria due to the

SNPs in the promoter of iNOS gene termed NOS2Lambaréné (G-954C) mutation (Kun et al.

2001).

In the above scenario, the mutations in the coding region of the gene of interest are the dominant issue. However, a mutant protein may lead to alteration of how the expression of genetic information is regulated. Similarly, small molecules produced by concerted enzyme action in the various pathways of the cell can feed back to regulate the activity of the protein and gene expression via hormonally-sensitive receptors (Barnes 2008). For example, endogenously produced eicosanoids (pro-inflammatory and anti-inflammatory) interact with

123 a variety of receptors that can alter the expression of a large number of relevant genes when activated (Barnes 2008). Therefore, activation of a receptor is not restricted to endogenous compounds; as some ligands are derived directly from the diet (Martin et al. 1978). Thus the diet becomes an important regulator of gene expression with the potential to offset the effects of the generation of SNPs that an individual may have (Myzack et al. 2004).

Bioactive compounds naturally found in foods may contribute to protect cells against the deleterious effects of inflammation (Maldonado-Rojas et al. 2012). These anti- inflammatory properties have been linked to the modulation of transcription factors that control expression of inflammation related genes, such as iNOS, rather than directly inhibiting these proteins (Maldonado-Rojas et al. 2012; Pan et al. 2009). In addition to their antioxidant capacity it has been reported that compounds of plant origin may regulate different signaling pathways in some diseases (Lansky et al. 2008; Balick et al. 2005). This list of molecules includes proanthocyanidins, terpenoids, omega-3, polyunsatured fatty acids, among others. Some of these molecules from this list have been reported in peanut skins. Yu et al. (2005) reported three classes of phenolics found in peanut skin extracts including phenolic acids (gallic acid and caffeic acid), flavonoids (catechin, epicatechin gallate) and stilbene (resveratrol). All of these classes of phenolics have been reported to have an inhibitory effect on iNOS and Nf-κB expression (Pan et al. 2009; Ahn et al. 2008; Kundu et al. 2007; Lee et al. 2006; Wheeler et al. 2004). Epigallocatechin gallate (EGCG), a component in green and black tea as well as peanut skins, has been reported to inhibit LPS- induced iNOS gene expression and iNOS activity in cultured macrophages (Hou et al. 2007).

Lin et al. (1997) proposed EGCG inhibits iNOS activation by preventing binding of the

124 essential transcription factor NF-κB to the iNOS promoter, which results in decreased transcription of the iNOS gene. They also reported inhibition of iNOS protein in activated macrophages by gallic acid and epicatechin. Another reported mechanism of action has also been reported in other flavanoids found in the peanut; however it is yet to be investigated in peanut skins. Maldonado-Rojas et al (2012) reported cyanidin-3-sambubioside, found in peanut but not peanut skins, could inhibit expression of iNOS because of its high binding affinity for the protein. Cyanidin-3-sambubioside could directly bind with iNOS catalytic site, which is important for its enzymatic activity.

Although a SNP has been identified in our data, the extent to which genotype it influences in the inflammatory process whether directly or indirectly remains to be investigated.

Conclusion

The aim of this study was to investigate a molecular mechanism of action to explain peanut skin extracts anti-inflammatory activity in RAW 264.7 macrophage cells. We evaluated nitric oxide production and NF-κB transcription factor pathway at two different time points, 12 and 18 hours. There was an increase in NO production between 12 and 18 hours when RAW 264.7 macrophages were stimulated with the positive control LPS, however, PSE reduced NO production in a dose-dependent manner suggesting that inhibition had occurred. In this study, we report that NF-κB activity significantly decreased from 12 and 18 hours. Gene sequencing of PSE was compared to the published iNOS gene.

Compared to the iNOS gene, PSE showed nucleotide changes within its sequence, suggesting that a SNP had occurred. The transcription factor NF-κB controls many genes in inflammation and has reported that inhibition of this transcription factory results in a

125 decrease of expression of iNOS. Therefore, we conclude that a suggested molecular mechanism of action for PSE may be the reduction of NF-KB activity. However, other inflammatory mediators such as IFN-y that have been reported to activate NF-KB will need to be further investigated.

126 References

Ahn HY, Xu Y, Davidge ST. 2008. Epigallocatechin-3-O-gallate inhibits TNFR-induced monocyte chemotactic protein-1 production from vascular endothelial cells. Life Sci. 82 (17-18):964–968.

Aktan F. 2004. iNOS-mediated nitric oxide production and its regulation. Life Sci. 75:639-635.

Antonarakis SE, Krawezak M, Cooper DN. 2000. Disease-causing mutations in the human genome. Eur J Ped. 159 (suppl 3):S173-S178.

Balick, M, Lee, R. Inflammation and ethnomedicine: looking to our past.2005. Explore (N.Y.) 1 (5):389–392.

Barnes PJ, Karin M. 1997. Nuclear factor-κB: a pivotal transcription factor in chronic inflammatory diseases. N Engl J Med. 336:1066-1071.

Baeuerle PA, Henkel T. 1994. Function and activation of NF-κB in the immune system. Annu Rev Immunol. 12:141-179.

Barnes S. 2008. Nutritional genomics, polyphenols, diets and their impact on dietetics. J Am Diet Assoc. 108(11):1888–1895.

Bhaskaran M, Shukla S, Srivastava JK, Gupta S. 2010. Chamomile: An anti- inflammatory agent inhibits inducible nitric oxide synthase expression by blocking RelA/p65 activity. Int J Mol Med. 26(6): 935-940.

Boerwinkle E. 1996. A contemporary research paradigm for the genetic analysis of a common chronic disease. Annals of Med. 28:451-457.

Botstein D, White RL, Skolnick M, Davis RW. 1980. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet. 32: 314–331.

Bruch-Gerharz D, Fehsel K, Suschek C, Michel G, Ruzicka T, Kolb-Bachofen, V. 1996. A proinflammatory activity of interleukin 8 in human skin: expression of the inducible nitric oxide synthase in psoriatic lesions and cultured keratinocytes. J Exp Med. 184(5): 2007–2012.

127 Campos-Neto A, Ovendale P, Bement T, Koppi TA, Fanslow WC, Rossi MA, Alderson MR. 1998. CD40 ligand is not essential for the development of cellmediated immunity and resistance to Mycobacterium tuberculosis. J Immunol. 160 (5): 2037– 41.

Chaea SY, Lee M, Kim SW, Bae YH. 2004. Protection of insulin secreting cells from nitric oxide induced cellular damage by crosslinked hemoglobin. Biomaterials. 25 (5): 843–850.

Chiou WF, Chen CF, Liu JJ. 2000. Mechanisms of suppression of inducible nitric oxide synthase (iNOS) expression in RAW 264.7 cells by andrographolide. Bri J Pharm. 129:1553-1560.

Choi YH, Yin GY, Li GZ and Yan GH. 2011. Cornuside suppresses lipopolysaccharide- induced inflammatory mediators by inhibiting nuclear factor-kappa b activation in RAW 264.7 macrophages. Biol Pharm Bull. 34 (7): 959-966.

Cooper DN, Claytton JF. 1988. DNA polymorphism and the study of disease associations. Hum Genet. 78:299-312.

D’Acquisto F, May MJ, Ghosh S. 2002. Inhibition of nuclear factor kappa B (NF-κB): an emerging theme in anti-inflmmatory therapies. Mol Interv. 2:22-35.

Davis RL, Sanchez AC, Lindley DJ, Williams SC, Syapin PJ. 2005. Effects of mechanistically distinct NF-kappaB inhibitors on glial inducible nitric-oxide synthase expression. Nitric Oxide. 12(4): 200-209.

Geller DA, Lowenstein CJ, Shapiro RA, Nussler AK, Di Silvio M, et al. 1993. Molecular cloning and expression of inducible nitric oxide synthase from human hepatocytes. Proc Natl Acad Sci. 90:3491-3495.

Gentile C, Allegra M, Angileri F, Pintaudi AM, Livrea MA, Tesoriere L. 2012. Polymeric proanthocyanidins from Sicilian pistachio (Pistacia vera L.) nut extract inhibit lipopolysaccharide-induced inflammatory response in RAW 264.7 cells. Eur J Nutr. 51:353-363.

Griess P. 1879. Bemerkungen zu der abhandlung der H.H. Weselsky und Benedikt “Ueber einige azoverbindungen.” Chem Ber. 12, 426–8

Guo W, Jiang L, Bhasin S, Khan SM, Swerdlow RH 2009. DNA extraction procedures meaningfully influence qPCR-based mtDNA copy number determination. Mitochondrion. 9(4):261-265.

128 Hampl, V, Herget, J. 2000. Role of nitric oxide in the pathogenesis of chronic pulmonary. Hypertension Physiol Rev. 80:1337-72.

Harald HH, Schmidt W, Walter U. 1994. NO at work. Cell. 78: 919-925.

Hou DX, Masuzaki S, Hashimoto F, Uto T, Tanigawa S, Fujii M, Sakata Y. 2007. Green tea proanthocyanidins inhibit cyclooxygenase-2 expression in LPS-activated mouse macrophages: molecular mechanisms and structure-activity relationship. Arch. Biochem. Biophys. 460 (1): 67–74.

Hu ML. 2011. Dietary polyphenols as antioxidants and anticancer agents: more questions than answers. Chang Guang Med J. 34:449-461.

Ignarro LJ, Buga GM, Wood KS, Byrns RE, Chaudhur G. 1987. Endothelium-derived relaxing factor produced and released from artery and vein is nitric oxide. Proc Natl Acad Sci USA. 84: 9265-9269.

Jang BC, Paik JH, Kim SP, Bae JH, Mun KC, et al. 2004. Catalase induces the expression of inducible nitric oxide synthase through activation of NF-kappaB and PI3K signaling pathway in RAW 264.7 cells. Biochem Pharmacol. 68(11): 2167- 2176.

Khan N and Mukhtar H. 2008. Multitargeted therapy of cancer by green tea polyphenols. Cancer Lett. 269(2): 269-280.

Kim HK, Cheon BS, Kim YH, Kim SY, Kim HP. 1999. Effects of naturally occurring flavonoids on nitric oxide production in the macrophage cell line RAW 264.7 and their structure-activity relationships. Biochem Pharm. 58:759-765.

Kun JF, Mordmüller B, Perkins DJ, May J, Mercereau-Puijalon O, Alpers M, Weinberg JB, Kremsner PG. 2001. Nitric oxide synthase 2Lambaréné (G-954C), increased nitric oxide production, and protection against malaria. J Infect Dis. 184:330–336.

Kundu JK, Surh YJ. 2007. Epigallocatechin gallate inhibits phorbol ester-induced activation of NF-κ B and CREB in mouse skin: role of p38 MAPK. Ann. N.Y. Acad. Sci. 1095:504–512.

Lander, ES. 1996. The new genomics:global views of biology. Science. 274:536-539. Lansky EP, Paavilainen HM, Pawlus AD, Newman RA. 2008. Ficus spp. (fig): ethnobotany and potential as anticancer and antiinflammatory agents. J Ethnopharmacol. 119 (2):195–213.

129 Lee TK, Denny EM, Sanghvi JC, et al. 2009. A noisy paracrine signal determines the cellular NF-kappaB response to lipopolysaccharide. Sci Signal. 2 (93):65.

Lee KW, Kundu J K, Kim SO, Chun KS, Lee HJ, Surh YJ. 2006. Cocoa polyphenols inhibit phorbol ester-induced superoxide anion formation in cultured HL-60 cells and expression of cyclooxygenase-2 and activation of NF-κB and MAPKs in mouse skin in vivo. J Nutr. 136 (5):1150–1155.

Li H, Igarashi J, Jamal J, Yang W, Poulos TL. 2006. Structural studies of constitutive nitric oxide synthases with diatomic ligands bound. J Biol Inorg Chem. 11:753-768.

Li Q and Verma IM. 2002. NF-kappa B regulation in the immune system. Nat Rev Immunol. 2: 725–734.

Lin YL and Lin JK. 1997. (−)-Epigallocatechin-3-gallate blocks the induction of nitric oxide synthase by down-regulating lipopolysaccharide-induced activity of transcription factor nuclear factor-κB. Molec. Pharmacol. 52(3):465-472.

Lowenstein CJ and Padalko E. 2004. iNOS (NOS2) at a glance. J Cell Sci. 117:2865- 2867.

Maldonado-Rojas W and Olievero-Verbel, J. 2012. Food-related compounds that modulate expression of inducible nitric oxide synthase may act as its inhibitors. Molec. 17(7):8118-8135.

Marienfeld R, May MJ, Berberich I, Serling E, Ghosh S, Newmann M. 2003. RelB forms transcriptionally inactive complexes with RelA/p65. J Biol Chem. 278: 19852–19860.

Martin PM, Horwitz KB, Ryan DS, McGuire WL. 1978. Phytoestrogen interaction with estrogen receptors in human breast cancer cells. Endocrinology. 103:1860–1867.

McKusick VA, Amberger JS. 1993. The morbid anatomy of the human genome: chromosomal location of mutations causing disease. J Medical Genet. 30:1-26.

Medzhitov R, Horng T. 2009. Transcriptional control of the inflammatory response. Nat Rev Immunol. 9: 692-703.

Min YD, Choi CH, Bark H, Son HY, Park HH, Lee S, Park JW, Park EK, Shin HI, Kim SH. 2007. Quercetin inhibits expression of inflammatory cytokines through attenuation of NFkappaB and p38 MaPK in HMc-1 human mast cell line. Inflamm Res. 56:210-215.

Mosmann, T. 1983. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J Immu Meth. 65 (1-2):55-63.

130 Muñoz-Cadavid C, Rudd S, Zaki SR, Patel M, Moser SA, Brandt ME, Gómez BL.2010. Improving molecular detection of fungal DNA in formalin-fixed paraffin-embedded tissues: comparison of five tissue DNA extraction methods using panfungal PCR. J Clin Microbiol. 48(6): 2147–2153.

Muriel P. 2009. NF-kB in liver diseases: a target for drug therapy. J Appl Toxic. 29: 91- 100.

Myzak MC, Karplus PA, Chung FL, Dashwood RH. 2004. A novel mechanism of chemoprotection by sulforaphane: inhibition of histone deacetylase. Cancer Res. 64:5767–5774.

Pallerès V, Calay D, Cedό L, Castell-Auvi A, Raes M, Montserrat P, Ardévol A, Arola L, Blay M. 2011. Enhanced anti-inflammatory effect of resveratrol and EPA in treated endotoxin-activated RAW 264.7 macrophages. Br J Nutr. First view article: 1-12.

Pan MH, Lai CS, Dushenkov S, Ho CT. 2007. Modulation of inflammatory genes by natural dietary bioactive compounds. J Agric Food Chem. 57(11):4467-4477.

Paur I, Carlsen H, Blomhoff R. 2011. In vivo imaging of antioxidant effects on nf-κb activity in reporter mice. Oxidative Stress Applied Basic Research in Clinical Practice in Studies on Experiment Models Part 2:157-184.

Permana, PA, Menge, C, Reaven, PD. 2006. Macrophage-secreted factors induce adipocyte inflammation and insulin resistance. Biochem Biophys Res Commun. 341: 507–514.

Rahman I, Biswas SK, Kirkham Pa. 2006. Regulation of inflammation and redox signaling by dietary polyphenols. Biochem Pharmacol.72:1439-1452.

Rahman I, Marwick J, Kirkham P. 2004. Redox modulation of chromatin remodeling: impact on histone acetylation and deacetylation, NF-kappaB and pro-inflammatory gene expression. Biochem Pharmacol. 68:1255-1267.

Roses AD. 1997. A model for susceptibility polymorphisms for complex diseases: apolipoprotein E and Alzhemimer disease. Neurogenetics. 1:3-11.

Sanger F, Coulson AR. 1975. A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase. J Mol Bio. 94(3):441-448.

SAS Institute Inc. SAS Campus Drive. Cary, NC 27513-2414

131 Saura M, Zaragoza C, Bao C, McMillan A, Lowenstein CJ. 1999. Interaction of interferon regulatory factor-1 and nuclear factor κB during activation of inducible nitric oxide synthase transcription. J Mol Biol. 289:459–471.

Sobolev V, Khan SI, Tabanca N, Wedge DE, Manly SP, Cutler SJ, Coy MR, Becnel JJ, Neff SA, Gloer JB. 2011. Biological activity of peanut (Arachis hypogaea) phytoalexins and selected natural and synthetic stilbenoids. J Agri Food Chem. 59:1673-1682.

Sommer SS, Ketterling RP. 1996. The factor 1X gene as a model for analysis of human germline mutations: an update. Human Molec Genetics. 5 (Spec No):1505-1514.

Stuehr DJ, Kwon KS, Gross SS, Thiel BA, Levi R, Nathan CF. 1980. Synthesis of nitrogen oxides from L-arginine by macrophage cytosol: Requirement for inducible and constitutive components. Biochem Biophys Res Commun. 161: 420-426.

Summersgill JT, Sahney NN, Gaydos CA, Quinn TC, Ramirez JA. 1995. Inhibition of Chlamydia pneumoniae growth in HEp-2 cells pretreated with interferon and tumor necrosis factor. Infect Immun. 63:2801–2803.

Terra X, Valls J, Vitrac X, Merrillon JM, Arola L, Ardevola, Blade C, Fernandez-Larrea J, Pujadas G, Salvado J, Blay M. 2007. Grape-seed procyanidins act as antiinflammatory agents in endotoxin-stimulated RAW 264.7 macrophages by inhibiting NFkB signaling pathway. J Agric Food Chem. 55:4357-4365.

Thomas PD. 2008. Single nucleotide polymorphisms in human disease and evolution:phylogenies and genealogies. Encyl Life Sci. 1-11.

Tracey WR, Linden J, Peach MJ, Johns RA. 1990. Comparison of spectrophotometric and biological assays for nitric oxide (NO) and endothelium-derived relaxing factor (EDRF): nonspecificity of the diazotization reaction for NO and failure to detect EDRF. J Pharmacol Exp Ther. 252(3): 922-928.

Victor VM, Rocha M, De la Fuente M. 2004. Immune cells: free radicals and antioxidants in sepsis. Inter Immunopharm. 4:327-247.

Vos P, Hogers R, Bleeker M, Reijans M, Van de Lee T, et al. 1995. AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 23: 4407–4414.

Wheeler DS, Catravas JD, Odoms K, Denenberg A, Malhotra V, Wong HR. 2004. Epigallocatechin-3-gallate, a green tea-derived polyphenol, inhibits IL-1 β-dependent proinflammatory signal transduction in cultured respiratory epithelial cells. J Nutr. 134 (5):1039–1044.

132 Xie QW, Kashiwabara Y, Nathan C. 1994. Role of transcription factor NF-κB/Rel in induction of nitric oxide synthase. J Bio Chem. 269(7):4705-4708.

Yamamoto Y, Gaynor RB. 2001. Therapeutic potential of inhibition of the NF-kappa B pathway in the treatment of inflammation and cancer. J Clin Invest. 107: 135-142.

Yan J, Geer JM. 2008 NF-kappa B, a potential therapeutic target for the treatment of multiple sclerosis. CNS Neurol Disord Drug Targets. 7:536-537.

Yang F, O HS, Barve S, de Villiers WJ, Mcclain CJ, Varilek GW. 2001. The green tea polyphenol (-)-epigallocatechin-3-gallate blocks nuclear factor-kappa B activation by inhibiting I kappa B kinase activity in the intestinal epithelial cell line IEC-6. Mol Pharmacol. 60:528-533.

Zhang Y, Li C, Li D, Liu L, Jian Z, Gao T. 2011. Analysis of inducible nitric oxide synthase gene polymorphisms in vitiligo in han Chinese people. PLOSOne. 6(12):e27077.

Yu J, Ahmedna M, Goktepe I. 2005. Effects of processing methods and extraction solvents on concentration and antioxidant activity of peanut skin phenolics. Food Chem. 90(1-2):199-206.

133

160 # hours

# 0

140

) 6 l #

o # r t 12 120 Con # 18

# # ive t #

# 20 ga

e # N

24 80 # #

age r

e #

Av

% 40

(

T T

M 0

Control LPS 1% 2.5% 5% 1% 2.5% 5% 1% 2.5% 5% 1% 2.5% 5% EPSE EPSE EPSE EPSE- EPSE- EPSE- APSE APSE APSE APSE- APSE- APSE- LPS LPS LPS LPS LPS LPS

Figure 1: The effects of APSE and EPSE on cell viability in RAW 264.7 cells. Cells were treated with different concentration of APSE or EPSE (1.0, 2.5 or 5.0% (v/v)) for 2 h then induced with LPS for 0, 6, 12, 18, 20 or 24 hours. Control values were obtained in the absence of LPS (positive control), APSE and EPSE. A viability of less than 80% was not used for the study. Values are means of ± S. D. of three independent experiments. *p<0.001 significances between treated groups were determined using ANOVA. Significant differences amongst treatments are shown as #.

134 Table 1: Sum of Squares Table for Dose-Response Curve. A 2x2x3x6 complete crossed factorial design of the four factors extract, lps, concentration and time, with an additional positive control were analyzed using proc glmix. The main and interaction effects from the arrangement of treatments, were recovered by nesting these factors within an additional indicator factor called ``control".

Source DF Sum of Squares Mean Square F Value Pr > F Model 77 17.80466289 0.23122939 2.49 <.0001 Error 156 14.47458072 0.09278577 Corrected Total 233 32.27924361

R-Square Coeff Var Root MSE lviable Mean 0.551582 6.801085 0.304608 4.478808

Source DF Type I SS Mean Square F Value Pr > F PosCont 1 0.11924175 0.11924175 1.29 0.2587 extract(PosCont) 1 0.00039328 0.00039328 0.00 0.9482 conc(PosCont) 2 2.74247077 1.37123538 14.78 <.0001 addL(PosCont) 1 0.53965740 0.53965740 5.82 0.0170 extrac*conc(PosCont) 2 0.08448913 0.04224456 0.46 0.6351 addL*extrac(PosCont) 1 0.00116654 0.00116654 0.01 0.9109 addL*conc(PosCont) 2 0.05473505 0.02736753 0.29 0.7450 addL*extr*conc(PosC) 2 0.09584935 0.04792467 0.52 0.5976 Timec 5 7.88389653 1.57677931 16.99 <.0001 timec*PosCont 5 0.71402617 0.14280523 1.54 0.1807 timec*extrac(PosCon) 5 0.04971826 0.00994365 0.11 0.9906 timec*conc(PosCont) 10 3.39075396 0.33907540 3.65 0.0002 timec*addL(PosCont) 5 0.28438859 0.05687772 0.61 0.6901 time*extr*conc(PosC) 10 0.50174095 0.05017410 0.54 0.8591 time*addL*extr(PosC) 5 0.27753913 0.05550783 0.60 0.7013 time*addL*conc(PosC) 10 0.60882826 0.06088283 0.66 0.7634 tim*add*ext*con(Pos) 10 0.45576774 0.04557677 0.49 0.8939

135

Figure 2: A decline in viability over time appeared to be more pronounced as concentration increases as shown here in the LSMEANS plot.

136

A with LPS

without LPS

) l #

o 120

r t

n # o

C

ive 80

t # #

ga

e N

40 rage

e Av

% ( 0 TT M 1% Control 2.5% 5% APSE APSE APSE

B # without LPS 200

with LPS 160 #

ol) r

t n o 120

C #

# ive

t ga

e 80 N

rage e

40

Av

% (

TT 0 M Control 1% 2.5% 5% EPSE EPSE EPSE

Figure 3a and b: The effects of cell viability by APSE (A) and EPSE (B) in RAW 264.7 cells were measured using MTT assay. Cells were treated with different concentration of APSE or EPSE (1, 2.5 or 5% (v/v)) for 2 h then induced with LPS for 12 hours. Control with the addition of LPS was used as a positive control (A and B). Values are means of ± S. D. of three independent experiments. *p<0.001 significances between treated groups were determined using ANOVA. Significant differences amongst treatments are shown as #.

137 A

160 # without LPS

140 with LPS

120 ol)

r #

t n

o # C

100 # ive t #

ga #

e N

80

rage

e 60

Av

% (

40 TT

M 20

0

Control 1% 2.5% 5% APSE APSE APSE

B

without LPS

# with LPS

200

ol)

r

t n

o 160 C

# ive

t # # ga 120

e # # N

rage

e 80 Av

% (

40 T

T

M 0

Control 1%EPSE 2.5%EPSE 5%EPSE

Figure 4a and b: The effects of cell viability by APSE (A) and EPSE (B) in RAW 264.7 cells were measured using MTT assay. Cells were treated with different concentration of APSE or EPSE (1, 2.5 or 5% (v/v)) for 2 h then induced with LPS for 18hours. Control with the addition of LPS was used as a positive control (A and B). Values are means of ± S. D. of three independent experiments. *p<0.001 significances between treated groups were determined using ANOVA. Significant differences amongst treatments are shown as #.

138 A without LPS

# with LPS

4

) 3

M

u (

on i

t 2

ra

t

n e

c n

o 1

C

e

t ri

t Ni 0

-1

-2 Control 1% 2.5% 5% 1% 2.5% 5% APSE APSE APSE EPSE EPSE EPSE

B without LPS

9 with LPS 8

7 )

M

u ( 6

on ti

ra 5 nt

e #

c n

o 4

C #

e

t # ri

t 3

Ni # 2 # # # 1

0

-1 Control 1% 2.5% 5% 1%EPSE 2.5% 5% APSE -2 APSE APSE EPSE EPSE

Figure 5a and b: The effect of LPS induces NO by APSE (A) and EPSE (B) in RAW 264.7 cells. Cells were treated with different concentration of APSE or EPSE (1, 2.5 or 5% (v/v)) for 2 h then induced with LPS for 12 (A) and 18 hrs (B). Control values were obtained in the absence of LPS (positive control), APSE and EPSE at a concentration of 10 μM (A). Values are means of ± S. D. of three independent experiments. *p<0.001 significances between treated groups were determined using ANOVA. Significant differences amongst treatments are shown as #.

139

A

3 without LPS

with LPS

) # # #

nm 2.5

# #

# 50

4

D 2 O

(

n o

1.5 ati

v acti

1 κB -

NF 0.5

0 Control 1% 2.5% 5% EPSE EPSE EPSE

B without LPS

with LPS

3

)

m 2.5

n

450

OD 2

( n n

o

ti a

v 1.5

i

t

c a

κB 1

- F

N # # 0.5 #

0 Control 1 % 2.5% 5 % EPSE EPSE EPSE

Figure 6a and b: The inhibitory effects of EPSE on LPS-induced NF-κB production in RAW 264.7 cells. Nuclear extracts were prepared from control, or pretreated with different concentrations (1, 2.5, 5% (v/v)) of EPSE for 2 hr, then with LPS (1 μg/ml) for either 12 hr (A) or 18 hr (B) and analyzed for NF-κB binding. The data shown are representative of three independent experiments. The values shown are means ±S.D. of three independent experiments. Significant differences amongst treatments are shown as #.

140

A without LPS

with LPS

3

) # m 2.5

# #

n

0

D45 2

O (

n o

ti 1.5

a

v i

t

c a

1

κB -

F N 0.5

0

Control 1% 2.5% 5% APSE APSE APSE

without LPS B

with LPS

3

2.5

) m

n

0 2

D45

O (

n n 1.5

o ti

a

v

i t

c 1 a

κB - # F 0.5

# # # N

0 Control 1% 2.5% 5% APSE APSE APSE

Figure 7a and b: The inhibitory effects of APSE on LPS-induced NF-κB production in RAW 264.7 cells. Nuclear extracts were prepared from control, or pretreated with different concentrations (1, 2.5, 5% (v/v)) of APSE for 2 hr, then with LPS (1 μg/ml) for either 12 hr (A) or 18 hr (B) and analyzed for NF -κB binding. The data shown are representative of three independent experiments. The values shown are means ±S.D. of three independent experiments. Significant differences amongst treatments are shown as #.

141

Figure 8: The effects of APSE and EPSE on LPS-induced iNOS protein (A) and their DNA expression (B) in RAW 264.7 cells. Genomic total DNA was prepared for PCR of iNOS gene expression from RAW 264.7 macrophages stimulated with LPS (1 μg/ml) with/without APSE or EPSE (1, 2.5, 5% (v/v)) for 18 hr. The experiment was repeated three times and similar results were obtained. Gene sequencing differences in LPS-induced iNOS expression was obtained. The *and space characters demonstrates where nucleotides differ from iNOS gene.

142 A

NegCon - LPS - - - LPS LPS LPS - - - LPS LPS LPS APSE - - 1 2.5 5 1 2.5 5 ------EPSE ------1 2.5 5 1 2.5 5

iNOS →

B iNOS ACGGGGATTTAACAAATGTTTGCCCCATGTGTGCCATGCATTAGCTATGGGTTCATACAA 60 Control ACGGGGATTTAACAAATGTTTGCCCCATGTGTGCCATGCATTAGCTATGGGTTCATACAA 60 1%EPSE ACGGGGATTTAACAAATGTTTGCCCCATGTGTGCCATGCATTAGCTATGGGTTCATACAA 60 5%EPSE ACGGGGATTTAACAAATGTTTGCCCCATGTGTGCCATGCATTAGCTATGGGTTCATACAA 60 1%APSE ACGGGGATTTAACAAATGTTTGCCCCATGTGTGCCATGCATTAGCTATGGGTTCATACAA 60 2.5%APSE ACGGGGATTTAACAAATGTTTGCCCCATGTGTGCCATGCATTAGCTATGGGTTCATACAA 60 5%APSE ACGGGGATTTAACAAATGTTTGCCCCATGTGTGCCATGCATTAGCTATGGGTTCATACAA 60 1%APSE-LPS ACGGGGATTTAACAAATGTTTGCCCCATGTGTGCCATGCATTAGCTATGGGTTCATACAA 60 2.5%APSELPS ACGGGGATTTAACAAATGTTTGCACCATGTGTGCCATGCATAAGCTATGGGTTCATACAA 60 *********************** ***************** ****************** iNOS TGTCCTCCAGGACTGGGACACTCTCTGGAAGATTAATTTTGTGCTCACTGGAGTAAAGGG 120 Control TGTCCTCCAGGACTGGGACACTCTCTGGAAGATTAATTTTGTGCTCACTGGAGTAAAGGG 120 1%EPSE TGTCCTCCAGGACTGGGACACTCTCTGGAAGATTAATTTTGTGCTCACTGGAGTAAAGGG 120 5%EPSE TGTCCTCCAGGACTGGGACACTCTCTGGAAGATTAATTTTGTGCTCACTGGAGTAAAGGG 120 1%APSE TGTCCTCCAGGACTGGGACACTCTCTGGAAGATTAATTTTGTGCTCACTGGAGTAAAGGG 120 2.5%APSE TGTCCTCCAGGACTGGGACACTCTCTGGAAGATTAATTTTGTGCTCACTGGAGTAAAGGG 120 5%APSE TGTCCTCCAGGACTGGGACACTCTCTGGAAGATTAATTTTGTGCTCACTGGAGTAAAGGG 120 1%APSE-LPS TGTCCTCCAGGACTGGGACACTCTCTGGAAGATTAATTTTGTGCTCACTGGAGTAAAGGG 120 2.5%APSE-LPS TGTCCTTCAGGACTGGGACACTCTCTGGAAGATTAATTTTGTGCTCACTGGAGTAAAGGG 120 ****** ***************************************************** iNOS TGGTGAGCTAACACAAAGAAGGAAGAGCCCCACCCCCAGCCCCTGGGGCAGGCCCAGGCA 180 Control TGGTGAGCTAACACAAAGAAGGAAGAGCCCCACCCCCAGCCCCTGGGGCAGGCCCAGGCA 180 1%EPSE TGGTGAGCTAACACAAAGAAGGAAGAGCCCCACCCCCAGCCCCTGGGGCAGGCCCAGGCA 180 5%EPSE TGGTGAGCTAACACAAAGAAGGAAGAGCCCCACCCCCAGCCCCTGGGGCAGGCCCAGGCA 180 1%APSE TGGTGAGCTAACACAAAGAAGGAAGAGCCCCACCCCCAGCCCCTGGGGCAGGCCCAGGCA 180 2.5%APSE TGGTGAGCTAACACAAAGAAGGAAGAGCCCCACCCCCAGCCCCTGGGGCAGGCCCAGGCA 180 5%APSE TGGTGAGCTAACACAAAGAAGGAAGAGCCCCACCCCCAGCCCCTGGGGCAGGCCCAGGCA 180 1%APSE-LPS TGGTGAGCTAACACAAAGAAGGAAGAGCCCCACCCCCAGCCCCTGGGGCAGGCCCAGGCA 180 2.5%APSE-LPS TGGTGAGCTAACACAAAGAAGGAAGAGCCCCACCCCCAGCCCCTGGGGCAGGCCCAGGCA 180 ************************************************************ iNOS GGAAGGACCACCCCTGGTTCATACATCCTAACCCCCAGGGACTCCCACCGCCAACCCTGA 240 Control GGAAGGACCACCCCTGGTTCATACATCCTAGCCCCCAGGGACTCCCACAGCCAACCCTGA 240 1%EPSE GGAAGGACCACCCCTGGTTCATACATCCTAACCCCCAGGGACTCCCACCGCCAACCCTGA 240 5%EPSE GGAAGGACCACCCCTGGTTCATACATCCTAACCCCCAGGGACTCCCAAAGCCAACCCTGA 240 1%APSE GGAAGGACCACCCCTGGTTCATACATCCTAACCCCCAGGGACTCCCACCGCCAACCCTGA 240 2.5%APSE GGAAGGACCACCCCTGGTTCATACATCCTAACCCCCAGGGACTCCCACCGCCAACCCTGA 240 5%APSE GGAAGGACCACCCCTGGTTCATACATCCTAACCCCCAGGGACTCCCACCGCCAACCCTGA 240 1%APSE-LPS GGAAGGACCACCCCTGGTTCATACATCCTAACCCCCAGGGACTCCCACCGCCAACCCTGA 240 2.5%APSE-LPS GGAAGGACCACCCCTGGTTCATACATCCTAACCCCCAGGGACTCCCACCGCCAACCCTGA 240 ****************************** **************** *********** iNOS CTCAAGCAGGATGCAGATGTGTCCCAGCAAATGCACAGAGACATAGTCACCCCCTGATGA 300 Control CTCAAGCAGGATGCAGATGTGTCCCAGCAAATGCACAGAGACATAGTCACCCCCTGATGA 300 1%EPSE CTCAAGCAGGATGCAGATGTGTCCCAGCAAATGCACAGAGACATAGTCACCCCCTGATGA 300 5%EPSE CTCAAGCAGGATGCAGATGTGTCCCAGCAAATGCACAGAGACATAGTCACCCCCTGATGA 300 1%APSE CTCAAGCAGGATGCAGATGTGTCCCAGCAAATGCACAGAGACATAGTCACCCCCTGATGA 300 2.5%APSE CTCAAGCAGGATGCAGATGTGTCCCAGCAAATGCACAGAGACATAGTCACCCCCTGATGA 300 5%APSE CTCAAGCAGGATGCAGATGTGTCCCAGCAAATGCACAGAGACATAGTCACCCCCTGATGA 300

143

1%APSE-LPS CTCAAGCAGGATGCAGATGTGTCCCAGCAAATGCACAGAGACATAGTCACCCCCTGATGA 300 2.5%APSE-LPS CTCAAGCAGGATTCAGATGTGTCGCAGCAAATGCACAGAGACATAGTCACCCCCTGATGA 300 ************ ********** ************************************ iNOS TGTCCCT 307 Control TGTCCCT 307 1%EPSE TGTCCCT 307 5%EPSE TGTCCCT 307 1%APSE TGTCCCT 307 2.5%APSE TGTCCCT 307 5%APSE TGTCCCT 307 1%APSE-LPS TGTCCCT 307 2.5%APSE-LPS TGTCCCT 307 *******

144 Chapter 5:

Conclusion and Future Work

145 The primary goal of this study was to investigate the relationship between the antioxidant and anti-inflammatory properties of bioactive compounds in peanut skin extracts

(PSE). To achieve this goal, the study was divided into three parts. The objective of the first part of the study was to optimize an extraction system for bioactive compounds using polar solvents including aqueous ethanol and acetone. Defatted peanut skins were extracted using aqueous solvent mixtures (acetone/water or ethanol/water) and dried to powders. The effect of the two solvents, ethanol and acetone, and alcohol concentration (90% ethanol vs. 50% acetone) on total phenolic content (TPC) and oxygen radical absorbance capacity (ORAC) were investigated. PSE extracted with acetone/water had higher H-ORAC and total phenolic values (3060 mmol Trolox/100 g and 292 mg GAE/g) than PSE extracted with ethanol/water

(2622 mmol Trolox/100 g and 250 mg GAE/g, respectively). However, both solvents were not statistically different (p<0.05). The data suggest that both solvents may be effective for the extraction of phenols from peanut skins. This part of the study clearly shows that peanut skins contain relatively high levels of phenolic compounds that have excellent peroxyl radical scavenging ability as indicated by the ORAC value. This would suggest that peanut skins could serve as a functional ingredient much like grape seed extract, which has been reported as an effective antioxidant supplement.

The second part of the study focused on an in vitro approach to studying the anti- inflammatory response of peanut skins. Specifically, we evaluated the anti-inflammatory activity of bioactive compounds from peanut skin by using a murine macrophage cell line,

RAW 264.7, induced by lipopolysaccharide (LPS) to initiate inflammation. In part two, the protective effects of PSE on LPS-induced RAW 264.7 cells were investigated. RAW cells

146 were treated with PSE at 1, 2.5 and 5% (v/v) for 2 h prior to treatment with LPS. The cell viability of RAW cells not treated with PSE prior to treatment with LPS had significantly

(p<0.05) higher cell death than cells supplemented with PSE before LPS treatment. Peanut skins effectiveness as anti-inflammatory agent in order to inhibit Cyclooxygenase-2 (COX-2) and Prostaglandin E2 expression was also evaluated. RAW 264.7 cells were treated with 1,

2.5 and 5% (w/v) of PSE and induced with the inflammatory marker, lipopolysaccharide

(LPS) for 14 hr. Prostaglandin E2 (PGE2) activity was measured by ELISA. Increasing concentrations of PSE induced with LPS demonstrated a decrease in PGE2 concentration.

PSE extracted with acetone or ethanol treatments of 5% showed significantly decreased concentrations of PGE2 activity compared to the negative control (p<0.05). The compounds that would exert this effect on the expression of PGE2‘s synthesizing enzyme, COX-2, are flavonoids, which have been measured for their anti-inflammatory activity in vitro and in vivo in other fruits and vegetables (Chi et al 2001; Murakami et al. 2000; Soliman and

Mazzio 1998). It has been observed that the structure of these compounds plays a vital role to their anti-inflammatory activity (Williams et al. 2004). For example, epicallogatechin gallate and epigallocatechin-3-gallate, which possess a C-2, 3-double bond and patterns of hydroxylation/methoxylation on the A and B- ring appear to inhibit COX-2 and PGE2 induction (Kim et al. 2004). These compounds are also found in peanut skins (Francisco and

Resurreccion 2008). The dose-dependent inhibition of these pro-inflammatory markers demonstrates that peanut skins have anti-inflammatory properties.

Part three of the study sought to determine the molecular mechanism of action that would explain the anti-inflammatory effects of PSE by investigating its effects on inducible

147 Nitric Oxide Synthase (iNOS) and nuclear factor kappa B (NF-κB) in vitro. In our model, 2- hr pre-treatment of RAW 264.7 macrophages with non-toxic amounts of PSE, followed by stimulation with LPS for both 12 and 18 hr caused a dose-dependent decrease in NO released

(p<0.001). However, at the 12 hr incubation time NO levels were inhibited to basal levels.

Several studies have implicated that production of NO may take place between 18-24 hr

(Kim et al. 1999; Gentile et al. 2012; Chiou et al. 2000; Xie et al. 1994); which would explain why very little NO was produced for our study. We chose the 12 hr incubation due to our previous study which reported inhibition of PGE2 by PSE at 12 hr (after pre-treatment with PSE). However, different pathways control the expression of iNOS or PGE2; whereas the main regulatory step for iNOS is the activation of the transcription factor NF-κB (Aktan

2004). A longer incubation may have caused a higher level of NO to be produced, however, due to the cytotoxicity of PSE past a 20 hour incubation period a longer incubation could not be used for this study.

In resting cells, NF-κB exists in the cytoplasm as a p65/p50 heterodimer with the p65 subunit containing the transcriptional activation domain bound to an inhibitory protein from the IκB family. Activation of NF-κB in macrophages is achieved via phosphorylation and subsequent degradation of IκB followed by nuclear translocation of the p65/p50 dimer and its binding to specific response element in DNA (Victor et al. 2004). In the third part of our study, an increase in the nuclear p65 subunit consequent to LPS stimulation was inhibited dose dependently by PSE pre-treatment of RAW 264.7 macrophages (p<0.001). PSE significantly decreased NF-κB activity between 12 and 18 hr. Considering that NF-κB in synergy with other transcriptional activators, coordinates the gene expression for pro-

148 inflammatory enzymes and cytokines, including iNOS and COX-2 (Barnes and Karin 1997), these findings suggest that anti-inflammatory activity of PSE is at least in part mediated by inhibition of the NF-κB activation pathway. As reported above, APSE and EPSE (2.5%

APSE with LPS and 5% EPSE) treatments had differing polypeptide sequences compared to the published iNOS gene, suggesting that a single nucleotide polymorphism (SNP) had occurred. Although a SNP has been identified in our data, the extent to which genotype it influences in the inflammatory process whether directly or indirectly remains to be investigated. Therefore, a suggested molecular mechanism of action for PSE would be the inhibition of NF-κB activity.

FUTURE WORK

Future work would suggest that PSE should be fractionated in order to determine which classes of compounds are primarily responsible for the antioxidant and anti- inflammatory activity of PSE. This would be particularly useful for the in vitro analysis as it may reveal if phenolic compounds present in PSE work synergistically to inhibit COX-2 and

NF-κB or if a single class of compounds inhibits these inflammatory pathways. It is likely that polyphenols act in synergy with other antioxidants (Li et al. 2010). Additive and synergistic effects of polyphenolics in fruits and vegetables are responsible for their bioactive properties. Therefore, the benefit of a diet rich in fruits and vegetables is attributed to the complex mixture of polyphenolics present in whole foods (Liu 2003). The synergistic effects of some polyphenols has been measured but not in peanuts especially peanut skins.

Suganuma et al. (1999) observed epigallocatechin gallate (EGCG) and epicatechin gallate

(ECG) having a synergistic effect with epicatechin (EC) but not with epigallocatechin (EGC)

149 in preventing the release of tumor necrosis factor-α (TNF-α), an inflammatory biomarker, in cultured human cancer cells. Mertens-Talcott et al. (2005) reported anti-carcinogenic effects attributed by polyphenols were due to synergistic effects. They measured these effects using quercetin and ellagic acid in the induction of apoptosis in the human leukemia cell line,

MOLT-4. They concluded that when these two compounds were combined, there was an additive effect on apoptosis. Li et al. (2010) also reported that some polyphenolics help to protect other phenolics due to synergy. These compounds that have been examined are also found in peanut skins (Francisco and Resurreccion 2008). Therefore, it would be of importance to analyze synergistic effects of the polyphenolics that are present in skins.

For the cell culture work, it is suggested that PSE effects on other inflammatory pathways be investigated. In addition, other pro-inflammatory biomarkers, such as interferon gamma (IFN-γ) and TFN-α, should be explored in order to determine greater protective effects that PSE may have. For example, TFN-α directly activates the NF-κB pathway, which results in an amplification loop, increasing the duration of the inflammatory response (Jung et al. 2009). To further investigate the SNP that was reported in our study, microarray and mRNA analysis should be explored. These analyses will determine if PSE has an effect on cell cycle regulation, apoptosis and specific inflammatory receptors. This goal can be accomplished by using cDNA microarray analyses. DNA microarrays provide a simple and natural vehicle for exploring the genome in both a systematic and comprehensive way by measuring the transcripts for every gene at once (DeRisi et al 1997; Shalon et al. 1996).

Microarray analysis also determines what biochemical and regulatory systems are operative by the set of genes expressed in a cell (Brown and Botstein 1999). Narayanan et al. (2004)

150 observed the inhibitory effects induced by resveratrol in human prostate cancer cells and their impact on tumor initiation, promotion and progression by using cDNA microarray analysis. This analysis helped to report the overall cell growth inhibition by resveratrol as well as the differential expression of genes involved in the cellular metabolism of prostate cancer cells altered by resveratrol.

Lastly, more identification work is needed in order to obtain a more complete profile of the exact phenolic composition of PSE. Catechins, A-type and B-type procyanidin dimers, trimers and tetramers in peanut skin extracts have been identified (Yu et al. 2006; Lazarus et al. 1999). In this study, the peanut skins that we received were of a mixed variety. We attempted to identify the polyphenolic composition of this batch; however, a further in-depth investigation would need to take place. Identification and quantification of these compounds would be needed to further verify the importance of peanut skin’s potential as functional ingredients in food and non-food applications.

151 References

Aktan F. 2004. iNOS-mediated nitric oxide production and its regulation. Life Sci. 75:639-635.

Barnes PJ, Karin M. 1997. Nuclear factor-κB: a pivotal transcription factor in chronic inflammatory diseases. N Engl J Med. 336:1066-1071.

Brown, PO, Botstein, D. 1999. Exploring the new world of the genome with DNA microarrays. Nature Genet. 21:33-37.

Chi YS, Cheon BS, Kim HP. 2001. Effect of wogonin, a plant flavone from Scutellaria radix, on the suppression of cyclooxygenase and the induction of inducible nitric oxide synthase in lipopolysaccharide-treated RAW 264.7 cells. Biochem Pharmacol. 61:1195-1203.

Chiou WF, Chen CF, Liu JJ. 2000. Mechanisms of suppression of inducible nitric oxide synthase (iNOS) expression in RAW 264.7 cells by andrographolide. Bri J Pharm. 129:1553-1560.

DeRisi JL, Iyer V, Brown PO. 1997. Exploring the metabolic and genetic control of gene expression on a genomic scale. Science. 278:680-686.

Francisco MLDL, Resurreccion, AVA. 2008. Functional components in peanuts. Crit Rev Food Sci Nutr. 48 (8):715-746.

Gentile C, Allegra M, Angileri F, Pintaudi AM, Livrea MA, Tesoriere L. 2012. Polymeric proanthocyanidins from Sicilian pistachio (Pistacia vera L.) nut extract inhibit lipopolysaccharide-induced inflammatory response in RAW 264.7 cells. Eur J Nutr. 51:353-363.

Jung M, Triebel S, Anke, T, Richling E, Erkel, G. 2009. Influence of apple polyphenols on inflammatory gene expression. Mol Nutr Food Res. 53:1263-1280.

Kim HP, Son KH, Chang H, Kang SS. 2004. Anti-inflammatory plant flavonoids and cellular action mechanisms. J Pharmacol Sci. 96:229-245.

Kim HK, Cheon BS, Kim YH, Kim SY, Kim HP. 1999. Effects of naturally occurring flavonoids on nitric oxide production in the macrophage cell line RAW 264.7 and their structure-activity relationships. Biochem Pharm. 58:759-765.

Lazarus SA, Adamson GE, Hammerstone JF, Schmitz HH. 1999. High-performance chromatography/mass spectrometry analysis of proanthocyanidins in foods and beverages. J Agric Food Chem. 47:3693-3701.

152 Li W, Wu J-X, Tu Y-Y. 2010. Synergistic effects of tea polyphenols and ascorbic acid on human lung adenocarcinoma SPC-A-1 cells. J Zhei Univ Sci B. 11(6):458-464.

Liu RH. 2003. Health benefits of fruit and vegetables are from additive and synergistic combinations of phytochemicals. Amer J Clin Nutr. 78(3):517S-520S.

Mertens-Talcott SU, Bomser JA, Romero C, Talcott ST, Percival SS. 2005. Ellagic acid waf1/cip1 potentiates the effect of quercetin on p21 , p53, and MAP-kinases without affecting intracellular generation of reactive oxygen species in vitro. J Nutr. 135:609- 614.

Murakami, A, Nakamura, Y, Torikai, T, Koshiba, T, Koshimizu, K, et al. 2000. Inhibitory effect of citrus nobiletin on phormol ester-induced skin inflammation, oxidative stress, and tumor promotion in mice. Cancer Res. 60:5059-5066.

Narayanan NK, Narayanan BA, Nixon DW. 2004. Resveratrol-induced cell growth inhibition and apoptosis is associated with modulation of phosphoglycerate mutase B in human prostate cancer cells: two-dimensional sodium dodecyl sulfate- polyacrylamide gel electrophoresis and mass spectrometry evaluation. Cancer Det Prev. 28:443-452.

Suganuma M, Okabe S, Kai Y, Sueoka N, Sueoka E, Fujiki H 1999. Synergistic effects of (-)-epigallocatechin gallate with (-)-epicatechin, sulindac, or tamoxifen on cancer- preventive activity in the human lung cancer cell line PC-9. Cancer Res. 59:44-47.

Shalon D, Smith SJ, Brown PO. 1996. A DNA micro-array system for analyzing complex DNA samples using two-color flurorescent probe hybridization. Genome Res. 6:639- 645.

Soliman, KFA and Mazzio, EA. 1998. In vitro attenuation of nitric oxide production in C6 astrocyte cell culture by various dietary compounds. Proc Soc Exp Bio Med. 218:390-397.

Williams RJ, Spencer JPE, Rice-Evans CA. 2004. Flavonoids: Antioxidants or signaling molecules? Free Radic Biol. 36:838-849.

Victor VM, Rocha M, De la Fuente M. 2004. Immune cells: free radicals and antioxidants in sepsis. Inter Immunopharm. 4:327-247.

Yu, J, Ahmedna, M, Goktepe, I, Dai, J. 2006. Peanut skin procyanidins: Composition and antioxidant activities as affected by processing. J Food Comp Anal. 19(4), 364- 371.

153 Xie QW, Kashiwabara Y, Nathan C. 1994. Role of transcription factor NF-KB/Rel in induction of nitric oxide synthase. J Bio Chem. 269(7):4705-4708.

154

APPENDICES

155 APPENDIX A:

Least Squares Means

Standard Effect trt Estimate Error DF t Value Pr > |t| trt (+) control 5.5601 0.3044 26 18.27 <.0001 trt (-) control 4.5329 0.3044 26 14.89 <.0001 trt 1% Acet 4.7332 0.3044 26 15.55 <.0001 trt 1% Acet/LPS 5.4678 0.3044 26 17.96 <.0001 trt 1% EtOH 4.6996 0.3044 26 15.44 <.0001 trt 1% EtOH/LPS 5.8500 0.3044 26 19.22 <.0001 trt 2.5% Acet 4.7805 0.3044 26 15.71 <.0001 trt 2.5% Acet/LPS 5.4409 0.3044 26 17.87 <.0001 trt 2.5% EtOH 4.7801 0.3044 26 15.70 <.0001 trt 2.5% EtOH/LPS 5.1357 0.3044 26 16.87 <.0001 trt 5% Acet 4.9525 0.3044 26 16.27 <.0001 trt 5% Acet/LPS 4.6723 0.3044 26 15.35 <.0001 trt 5% EtOH 4.7971 0.3044 26 15.76 <.0001 trt 5% EtOH/LPS 4.7692 0.3044 26 15.67 <.0001

Figure 1: ANOVA of peanut skin extract treatments for PGE2 activity

156

Re s i d u a l 0 . 6

0 . 5

0 . 4

0 . 3

0 . 2

0 . 1

0 . 0

- 0 . 1

- 0 . 2

- 0 . 3

- 0 . 4

- 0 . 5

- 0 . 6

4 5 6 7

P r e d i c t e d

t r t ( + ) c o n t r o l ( - ) c o n t r o l 1 % A c e t 1 % A c e t / L P S 1 % E t OH 1 % E t OH/ L P S 2 . 5 % A c e t 2 . 5 % A c e t / L P S 2 . 5 % E t OH 2 . 5 % E t OH/ L P S 5 % A c e t 5 % A c e t / L P S 5 % E t OH 5 % E t OH/ L P S

Figure 2: Muti-factor analysis of effects of peanut skin extracts to PGE2 activity

157 APPENDIX B:

Kannapolis Eicosanoid Study

Introduction

Arachidonic acid, a basic constituent of cells, is the main eicosanoid precursor.

Arachidonic acid is an essential fatty acid that can be derived from linoleic acid by the action of desaturase enzymes or ingested directly in red meat; the latter source for humans (Higgins

1985). Arachidonic acid does not exist freely within cells but is bound as an integral part of phospholipids molecules, triglycerides, and cholesterol esters, with phospholipids being the most important source (Calder 2006). Phospholipase A2 releases arachidonic acid following an inflammatory stimulus. Free arachidonic acid (arachidonate) is either re-esterified or metabolized by one of two possible enzyme pathways: cyclooxygenase (COX) enzyme or lipooxygenase (Higgins et al. 1983). The COX enzyme pathway converts arachidonate to a cyclic endoperoxide-prostaglandin G2 (PGG2). PGG2 reacts with another enzyme to yield

PGH2, a cyclic hydroxyl endoperoxide which gives rise to the primary PGs: PGD2, PGE2 and

PGF2 as well as prostacyclin (PGI2) and thromboxanes A2 and TXB2, collectively called eicosanoids (Williams and Higgs 1988). These eicosanoids have been reported to be involved in every phase of inflammation (Samuelsson et al. 1978). Eicosanoids are involved in modulating the intensity and duration of inflammatory responses. They have cell and stimulus specific sources and frequently have opposing effects. Thus, the overall physiologic outcome will depend on cells that are present, the nature of the stimulus, the timing and concentrations of different eicosanoids that are generated as well as the sensitivity of the target cells and tissues to the eicosanoids that are produced (Greene et al. 2011). Another

158 group of eicosanoids that are synthesized from arachidonic acid are the leukotrienes via the lipoxygenase pathway (Lewis et al. 1990). Leukotrienes also have a role in inflammation but their formation is not prevented by non-steroidal anti-inflammatory drugs (NSAIDS) when used to block the cyclooxygenase pathway (Serhan et al. 2011; Vane et al. 1998). As a result, more arachidonic acid is made available for lipooxygenase activity which may intensify leukotriene-mediated responses (Higgs et al. 1980).

Prostaglandins are potent mediators of both inflammation and thrombosis (Serhan

2011). Prostaglandin formation occurs from arachidonic acid being catalyzed by the enzyme

PGG/H synthase, often known as cyclooxygenase (McAdam et al. 2000). Prostaglandin synthesis always accompanies an inflammatory response as a result of living tissue injury or irritation. Willis (1969) proposed the role of prostaglandins in inflammation when he reported prostaglandin activity in carrageenin-induced inflammatory exudates in rats.

Subsequently, prostaglandins, mostly PGE2 and mainly of the E series have been detected in clinical as well as experimental inflammation (Williams and Higgs 1988). Studies have shown that PGE2 induces COX-2 in fibroblasts cells thus causing an up-regulation of its own production (Calder 2006; Williams and Higgs 1988). In our previous report we investigated the anti-inflammatory properties of peanut skin extracts in vitro. We concluded that the extracts could have the ability to inhibit PGE2 activity in a dose-dependent manner. This may suggest that the bioactive compounds in peanut skin extracts could inhibit the production of other eicosanoids, thus, reducing the effect of pro-inflammatory markers. Therefore, the aim of this study will be to evaluate the inhibitory effects of peanut skin extracts on eicosanoid production at different time points.

159 Materials and Methods

Eicosanoid standards (PGE2, PGF2α, LTB4, LTC4, and LTD4) and internal standards

(PGF2α-D4 and LTB4-D4) were purchased from Caymen Chemical Company (Ann Arbor,

MI). Methanol and 2-propanol were purchased from Mallinckrodt Baker Inc. (St. Louis,

MO). Acetonitrile and formic acid were purchased from Thermo Fisher Scientific (FairLawn,

NJ). Ultrapure water (18.2 MΩ∙cm @ 30°C) was produced by a Mill-Q Reference system equipped with a LC-MS Pak filter (Millipore, Billerica, MA). Sodium formate solution (0.05

M NaOH + 0.5% formic acid in 90:10 2-propanol: water, Waters Corp., Milford, MA) was used for instrument tuning and calibration.

Ultra Performance Liquid Chromatography-Mass Spectrometry/Mass Spectrometry (UPLC-

MS/MS)

Deems et al. (2007) protocol was used for extraction and analysis of eicosanoids from media and cells produced in vitro. RAW 264.7 cells were plated at a density of 105 cells/well in 12-well plates (Fisher Scientific, Pittsburgh, Pa). A dose-response curve consisting of various concentrations of acetone peanut skin extracts (APSE) with or without LPS at timepoints 0, 6, 12, 18, 20 or 24 hours were added to RAW 264.7 cells in order to evaluate the appropriate time-point not toxic to cells. Cell viability declined after 18 hours, therefore, for this study, studies were performed at 12 and 18 hours. Viabilities were determined using colorimetric MTT assays, as described previously by Mossman (1983). Study samples were stored at -80°C and given to the David H. Murdock Research Institute (DHRMI; Kannapolis,

NC) for sample preparation and analysis. Another batch of test samples was used for validation of methods and optimization for instrument conditions. A UPLC-MS/MS system

160 (ACQUITY UPLC-Quattro Premier XE MS, Waters Corp., Milford, MA) was used. The system was operated in electrospray ionization (ESI) negative mode. The optimized instrument settings are briefly described in Table 1a-b. Mobile phase B was 57:43:0.1 (v/v/v)

[water:acetonitrile:formic acid] and mobile phase A was 50:50:0.1 (v/v/v) [2- propanol:acetonitrile:formic acid].

Sample preparation and Solid Phase Extraction

The study samples were subjected to solid phase extraction (SPE). SPE cartridges

(Strata-X 33 µm polymeric reversed phase) were purchased from Phenomenex (Torrance,

CA). SPE cartridges were prepared for use by washing with 2 mL of methanol followed by 2 mL of water. Each 1 mL of sample was loaded onto the cartridge and washed with 1 mL of

10% methanol solution. The eicosanoids were eluted off the cartridge with 1 mL of methanol and dried under nitrogen evaporation. The sample was reconstituted in 100 µL of

[water:acetonitrile:formic acid] (57:43:0.1, v/v/v) and analyzed on a UPLC-MS/MS system

(Waters Corp., Milford, MA).

Curve preparation for eicosanoid quantitation The eicosanoid standards were prepared as follows:

Prostaglandin E2: 1 mg/mL Prostaglandin F2α: 1 mg/mL Leukotriene B4: 0.1 mg/mL Leukotriene C4: 0.1 mg/mL Leukotriene D4: 0.1 mg/mL

The internal standard (IS) solutions were prepared as a mixture: Each 15 µL of LTB4-D4 stock (100 ng/µL) and 75 µL of PGF2α-D4 stock (100 ng/µL) were combined and diluted to

1200 µL with methanol. The final concentrations of LTB4-D4 and PGF2α-D4 were 0.125 and

161 0.625 ng/µL, respectively. The stock standard solutions were diluted with methanol and 20

µL of IS solution to the following concentrations for analysis:

PGE2 PGF2α LTB4/LTC4/LTD4 0.45 0.68 0.14 0.23 0.34 0.068 0.11 0.19 0.034 0.056 0.084 0.017 0.028 0.042 0.0084 0.014 0.021 0.0042 0.0070 0.011 0.0021

The curve standards were prepared for testing at the same time as the samples. The calibration/linearity equation and corresponding regression coefficients (R2) were calculated using the QuanLynx Application Manager (Waters Corp., Milford, MA) and the limit of quantitation was defined as the lowest concentration in the calibration curve.

Table 1a. UPLC-MS/MS instrument settings

UPLC

ACQUITY UPLC BEH C18 1.7 µM VanGuard pre-column (2.1×5 mm) and ACQUITY UPLC BEH C18 1.7 µM analytical Column column (2.1 × 100 mm) Column Temp (°C) 25 ± 0.5 Sample Manager Temp (°C) 4 ± 0.5 0 min (1% A), 0-2.2 min (1-20% A), 2.2-2.7 min (20-55% A), 2.7-4.5 min (55% A), 4.5-5.5 min (55-100% A), 5.5-6.5 min Gradient Conditions (100% A), 6.5-6.6 min (100-1% A), 6.6-7.6 min (1% A). Flow Rate (mL/min) 0.40 Quattro XE Premier MS Capillary (kV) 4.0 Sampling Cone (V) See Table 1b for details Collision Energy See Table 1b for details Extraction Cone (V) 4.0 Source Temp (°C) 120

162 Table 1a. Continued

Desolvation Temp (°C) 350 Desolvation Gas Flow (L/Hr) 700 Cone Gas (L/Hr) 50

Table 1b. MS/MS parameters for eicosanoid detection

Comp. u Formula Multiple reaction Cone Collision Dwell monitoring (MRM) voltage energy (sec) transition

PGE2 C20H32O5 351 > 271 35 15 0.10

PGF2α C20H34O5 353 > 193 40 25 0.10

LTB4 C20H32O4 335 > 195 35 20 0.10

LTC4 C30H47N3O9 624 > 272 45 25 0.10 S LTD4 C25H40N2O6 495 > 177 25 25 0.10 S

The literature method referenced for method transfer used for LC/MS/MS analysis was established on an analytical liquid chromatography system coupled to an Applied

Biosystems 4000 Qtrap (Deems et al 2007). The transferred method was validated on the

DHMRI UPLC-MS/MS system (Waters Corp.) The method conditions optimized at the

DHMRI significantly decreased the analytical time from 15 min to 7 min without loss of separation efficiency. The instrument settings i.e., cone voltage and collision energy (Table

1b) was optimized for each metabolite. A spiked study was conducted to test the viability of

163 the SPE method for eicosanoid analysis under these conditions and to validate the established method. The study followed the same sample preparation as described in Section 1.1 except for the addition of 10 µL of a standard solution mixture to a sample to test for the recovery of the eicosanoids from the SPE cartridge. The spiking study successfully detected all five of the above standards plus the two internal standards through SPE without a significant signal loss when compared to the mixed standards alone. This confirmed that the established method was viable for this analysis.

Results

LC/MS/MS Analysis Results

Using UPLC-MS/MS with MRM transitions, the five target compounds were quantitated in a low concentration range (LOQ < 0.01 ng/µL) with good linearity. The analytical variations of the standard QC injections analyzed during the sample sequence are less than 20%, which suggests that the instrument was stable during the sample analysis.

PGE2 was detected in three samples (positive controls, LPS) at time points 6 and 18 hours

(Figure 1).

Discussion

As shown in Figure 1, PGE2 was detected at 2.2 min. The limit of quantitation (LOQ, defined as a signal/noise ratio of 10:1) was considered to be the same as the LOD for the

2 quantitation study as 0.00703 ng/uL for PGE2 and 0.0110 ng/uL for PGF2α. The r values for

PGE2 were 0.994 and 0.989 for PGF2α, respectively. For the amount on the column, 5 uL of sample was injected to give an amount of 35 pg for PGE2 and 55 pg for PGF2α. This value is lower than what has been reported by Schmidt et al. (2005) using LC-MS/MS with a

164 different chromatography system. Schmidt also loaded a larger amount of sample, 10 uL, onto their column, thus, increasing the possibility for detection. We detected PGE2 in PSE using an ELISA kit (Caymen Chemical; Ann Arbor, MI) in Chapter 2; however, PGE2 was not detected in PSE samples in this study. Immunoassays have been most widely used as immunological techniques, but a major limitation of these assays is the lack of ability to determine more than one analyte at a time (Lundström et al. 2009). In addition, the antibodies used, often do not provide sufficient specificity due to crossreactivity, which may explain why these PG metabolites were not detected in LC/MS/MS.

Detection and quantification of eicosanoids has mainly been measured using HPLC or gas chromatography coupled to mass spectrometry (GC/MS) as well as radioimmunoassay techniques, which are more sensitive (Kumlin 1996; Powell and Funk 1987). HPLC and

GC/MS are less sensitive than RIA and EIA but offers increased selectivity for detection of multiple eicosanoids simultaneously (Tsukamoto et al. 2002; Tsikas 1998). One limitation of using a combined LC/MS method was the interface between HPLC and MS. With the development of MS ionization techniques such as electrospray ionization (ESI) and atmospheric pressure chemical ionization (APCI), eicosanoids can now be analyzed directly from aqueous samples (Murphy et al. 2005). One advantage to using this approach is the simplification of sample preparation. As a result, one of the most powerful techniques was developed, liquid chromatography tandem mass spectrometry (LC/MS/MS or LC/MSn). This approach can quantify large numbers of eicosanoids in a variety of biological matrices.

Medium that is used for cell culture contains inorganic salts, vitamins, amino acids, antibiotics, and 10% calf serum, thus, a sample pretreatment is necessary prior to

165 chromatographic analysis in order prevent colum clogging of signal. Additionally, the reported PG binding to proteins may also hinder an accurate determination of the PGs (Unger

1997). Most of the methods described in the literature use SPE sample preparation or other techniques prior to chromatographic analysis. Several sample pretreatment methods described in the literature, including protein precipitation, liquid – liquid extraction, SPE, and ultrafiltration were preliminarily investigated (Rinne et al. 20007). However, for all methods, either coprecipitation, loss of PGs, and/or signal suppression was observed, indicating that the sample preparation was not satisfactory (Holm et al. 2005).

Conclusion

PGE2 was only observed above the detection limit in the stimulated cells, indicating that LPS produces PGE2 upon stimulation. However, it cannot be ruled out that PGE2 and other PGs in nonstimulated cells are present, but below the LOD of this method.

166 References

Calder PC. 2006. n-3 Polyunsaturated fatty acids, inflammation, and inflammatory diseases. Am J Clin Nutr. 83:1505S-1519S.

Deems, R, Buczynski, MW, Bowers-Gentry, R, Harkewicz, R, Dennis, EA. 2007. Detection and quantitation of eicosanoids via high performance liquid chromatography-electrospray ionization-mass spectrometry. Meth Enzymol. 432:59- 82.

Greene ER, Huang S, Serhan CN, Panigrahy, D. 2011. Regulation of inflammation in cancer by eicosanoids. Prostaglandins Other Lipid Mediat. 96 (1-4):27-36.

Higgs GA, Moncada, S, Vane, JR. 1980. The mode of action of anti-inflammatory drugs which prevent the peroxidation of arachidonic acid. Clin Rheum Dis. 6:675-693.

Higgins, AJ. 1985. The biology, pathophysiology and control of eicosanoids in inflammation. J Vet Pharmacol Therap. 8:1-18.

Holm, A., Storbråten, E, Mihailova, A, Bartosz, K, Lundanes, E, Greibrokk, T. 2005. Combined solid-phase extraction and 2D LC–MS for characterization of the neuropeptides in rat-brain tissue. Anal Bioanal Chem. 382: 751 – 759.

Kumlin, M. 1996. Analytical methods for the measurement of leukotrienes and other eicosanoids in biological samples from asthmatic subjects. J Chromatogr A. 725:29– 40.

Lewis RA, Austen KF, Soberman RJ. 1990. Leukotrienes and other products of the 5- lipooxygenase pathway: biochemistry and relation to pathobiology in human diseases. Engl J Med. 323: 645-655.

Lundström, SL, D’Alexandri, FL, Nithipatikom, K, Haeggström, JZ, Wheelock, ÅM, Wheelock, CE. 2009. HPLC/MS/MS-based approaches for detection and quantification of eicosanoids. Lipidomics, Meth Molec Bio. 579 pt 2:161-187.

McAdam, BF, Mardini, IA, Habib, A, Burke, A, Lawson, JA, Kapoor, S, FitzGerald, GA. 2000. Effect of regulated expression of human cyclooygenase isoforms on eicosanoid and isoeicosanoid production in inflammation. J Clin Inves. 105: 1473-1483

Mosmann, T. 1983. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J Immu Meth. 65(1-2):55-63.

167 Murphy, RC, Barkley, RM, Berry Zemski, Hankin, K, Harrison, C, Johnson, J et al. 2005. Electrospray ionization and tandem mass spectrometry of eicosanoids. Anal Biochem. 346:1-42.

Powell, WS, Funk, CD. 1987. Metabolism of arachidonic acid and other polyunsaturated fatty acids by blood vessels. Prog Lipid Res. 26:183–210.

Rinne, S, Ramstad Kleiveland, C, Kasseem, M, Lea, T, Lundanes, E, Greibrokk, T. 2007. Fast and simple online sample preparation coupled with capillary LC-MS/MS for determination of prostaglandins in cell culture supernatants. J Sep Sci. 30(12):1860- 1869.

Samuelsson, B, Goldyne, M, Granstrom, E, Hamberg, M, Hammarstrom, S, Malmsten, C. 1978. Prostaglandins and thrombanes. Ann Rev Biochem. 47:997-1029.

Schmidt, R, Coste, O, Geisslinger, G. 2005. LC-MS/MS analysis of prostaglandin E2 and D2 in microdialysis samples of rats. J Chromatogr B. 826:188-197.

Serhan CN, Hamberg M, Samuelsson B. 2011. The resolution of inflammation: the devil in the flask and in the details. FASEB J. 25:1441–1448.

Serhan CN, Krishnamoorthy S, Recchiuti, A., Chiang, N. 2011. Novel anti- inflammatory-pro-resolving mediators and their receptors. Curr Top Med Chem. 11: 629–647.

Tsikas, D, Schwedhelm, E, Gutzki, FM, Frèolich, JC. 1998. Gas chromatographic-mass spectrometric discrimination between 8-iso-prostaglandin E2 and prostaglandin E2 through derivatization by O-(2,3,4,5,6-pentafluorobenzyl)hydroxyl amine. Anal Biochem. 261:230-232.

Tsukamoto H, Hishinuma T, Mikkaichi T, et al. 2002. Simultaneous quantification of prostaglandins, isoprostane and thromboxane in cell-cultured medium using gas chromatography-mass spectrometry. J Chromatogr B Analyt Technol Biomed Life Sci. 774:205–214.

Unger, WG. 1972. Binding of prostaglandin to human serum albumin. J Pharma Pharmcol. 24:470-474.

Williams, KI, Higgs GA. 1988. Eicosanoids and inflammation. J Path. 156:101-110.

Willis AL. 1969. Release of histamine, kinin and prostaglandins during carrageenin- induced inflammation of the rat. Prostglanidins, Peptides and Amines. Eds. Mantegazza P and Horton EW. 31-38. Academic Press London.

168 Vane, JR, Bakhle, YS, Botting, RM. 1998.Cyclooxygenases 1 and 2. Ann Rev Phannacol Toxicol. 38(1):97-120.

169

Figure 1: These first three chromatograms are for sample 1 (LPS, positive control) at Oh, 6h, and 18h time points. The second set of three chromatograms is for sample 9 (LPS, positive control) at Oh, 6h, and 18h time points. The peaks @ RT 1.6 and 3.5 min. correspond to the internal standards PGF2.-D4 and LTB4 -D4, respectively. The retention time for PGE2 is 2.2 min.

170 Standard injection: Cells + LPS 0h

UPLC-Quattro Premier XE MS Sept21_0h_1 MRM of 9 Channels ES- 5.77 BPI

141 % 7.27

3.34

5.42 3.94 4.55 0.36 2.18 1.73 1.09 6.33 0.87 1.25 1.60 3.50 4.31 6.68 2.33 2.59 5.68 4.72 2.91 3.16 6.97 7.46 3.58 6.14 1.36 2.00 5.14 0.58 6.60 3.83 4.21 4.45 5.23 5.58 1.89 7.16 7.62 3.74 2.73 6.00

38 Time 0.50 1.00 1.50 2.00 2.50 3.00 3.50 4.00 4.50 5.00 5.50 6.00 6.50 7.00 7.50 8.00

Standard injection: Cells + LPS 6h UPLC-Quattro Premier XE MS Sept21_6h_1 MRM of 9 Channels ES- 3.56 TIC 5.47e3

LTB4-D4

1.67

PGF2α-D4 %

PGE2

2.32

2.21

8 Time 0.50 1.00 1.50 2.00 2.50 3.00 3.50 4.00 4.50 5.00 5.50 6.00 6.50 7.00 7.50

171

Standard injection: Cells + LPS 18h

UPLC-Quattro Sept21_18 Premier XE MS MRM of 9 h_1 3.5 Channels ES- B 4 2.73PI e3

1.6 3

%

2.2 9

1.9 2

2 Tim 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0 5.5 6.0 6.5 7.0 7.5 8.0e 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Standard injection: Cells + LPS 0h

UPLC-Quattro Premier XE MS Sept21_0h_9 MRM of 9 Channels ES- 3.54 BPI 5.26e3

1.60 %

4.37

1 Time 0.50 1.00 1.50 2.00 2.50 3.00 3.50 4.00 4.50 5.00 5.50 6.00 6.50 7.00 7.50 8.00

172

Standard injection: Cells + LPS 6h

UPLC-Quattro Premier XE MS Sept21_6h_9 MRM of 9 Channels ES- 3.56 BPI 6.54e3

1.62 %

2.35

1 Time 0.50 1.00 1.50 2.00 2.50 3.00 3.50 4.00 4.50 5.00 5.50 6.00 6.50 7.00 7.50 8.00

Standard injection: Cells + LPS 18h

UPLC-Quattro Premier XE MS Sept21_18h_9 MRM of 9 Channels ES- 3.54 BPI 5.80e3 PGF2α-D4

1.65 LTB4-D4

% 2.33

PGE

2.14 1.97

1 Time 0.50 1.00 1.50 2.00 2.50 3.00 3.50 4.00 4.50 5.00 5.50 6.00 6.50 7.00 7.50 8.00

173

Standard injection: Cells + LPS; Conc = 1.2 ng/µL

1.2 UPLC-Quattro Premier XE MS AS1_21Sept12_1 MRM of 9 Channels ES- 3.61 TIC 1.43e5 1.70

2.21

LT %

3.45 3.24

0 Time 0.50 1.00 1.50 2.00 2.50 3.00 3.50 4.00 4.50 5.00 5.50 6.00 6.50 7.00 7.50

174