MICROBIOLOGY ECOLOGY MICROBIOLOGY Membranaceus and Astragalus Mongolicus (Also Called Especially at the Species Level (E.G
Total Page：16
File Type：pdf, Size：1020Kb
RESEARCH ARTICLE Horizontal gene transferand recombination shape mesorhizobial populations in the gene centerof the host plantsAstragalusluteolus and Astragalus ernestii in Sichuan, China Qiongfang Li1,2, Xiaoping Zhang1, Ling Zou1, Qiang Chen1, David P. Fewer 3 & Kristina Lindstrom¨ 3 1Department of Resources and Environment, Sichuan Agricultural University, Ya’an Sichuan, China; 2College of Life Science and Engineering, Southwest University of Science and Technology, Mianyang, Sichuan, China; and 3Department of Applied Chemistry and Microbiology, University of Helsinki, Helsinki, Finland Downloaded from https://academic.oup.com/femsec/article/70/2/227/532724 by guest on 23 September 2021 Correspondence: Xiaoping Zhang, Abstract Department of Resources and Environment, Sichuan Agricultural University, Ya’an Sichuan Thirty-three rhizobial strains isolated from the root nodules of Astragalus luteolus 625014, China. Tel.: 1 86 835 2882710; and Astragalus ernestii growing on the west plateau at two different altitudes in fax: 186 835 2883166; e-mail: Sichuan province, China, were characterized by amplified rDNA restriction [email protected] analysis (ARDRA), amplified fragment length polymorphism (AFLP), and by sequencing of rrs, glnA, glnII and nifH. The ARDRA analysis revealed considerable Received 10 November 2008; revised 27 August genomic diversity. In AFLP analysis, 20 of 33 Astragalus rhizobia formed three 2009; accepted 27 August 2009. distinct clades, with others dispersed into different groups with the reference Final version published online strains. Phylogenetic analysis of the rrs gene of six representative strains showed 30 September 2009. that the isolates were members of the genus Mesorhizobium. Three of the isolates DOI:10.1111/j.1574-6941.2009.00776.x formed a sister clade to Mesorhizobium loti and Mesorhizobium ciceri, whereas the other three formed a sister clade to a clade harboring the species Mesorhizobium Editor: Philippe Lemanceau huakuii, Mesorhizobium plurifarum, Mesorhizobium septentrionale and Mesorhizo- bium amorphae, indicating the existence of two new species. Phylogenetic analysis Keywords of glnA and glnII confirmed the rrs phylogenies for four strains, but the trees were rhizobia; Astragalus; phylogeny; gene transfer. incongruent. The nifH sequences of the strains formed a monophyletic clade and were typical of those of mesorhizobia forming symbioses with inverted repeat lacking clade legume species. The incongruent phylogenies of the genes studied suggest that horizontal gene transfer and recombination shape mesorhizobial populations in the gene center of the host plants. Introduction rapidly being destroyed, characterization and biogeographi- The genus Astragalus consists of up to 3000 species, which cal studies of rhizobial strains isolated from Astragalus are distributed mainly in cool to warm arid and semiarid species are urgently required. Astragalus luteolus and Astra- regions of the northern hemisphere, South America and galus ernestii are wild plants that grow at altitudes above tropical East Africa. It is especially diverse in the south- 3000 m. Astragalus luteolus are indigenous endemic plants of western and the Sino-Himalayan regions of Asia, with the western Sichuan province. Astragalus ernestii grows only approximately 1500–2000 recorded species (Sanderson & in western Sichuan, northwest of Yunnan and in eastern Wojciechowski, 2000; Osaloo et al., 2005). Astragalus species Tibet. Astragalus ernestii is also used in Chinese medicine. can form nodules and fix nitrogen in symbiosis with The classification of rhizobia into taxa is strongly based rhizobia and some representatives of this perennial legume on phylogenies of rrs genes (encoding 16S rRNA gene or family are used in China. Astragalus adsurgens is used for SSU), but phylogenies of several protein encoding house- forage and Astragalus sinicus as green manure. Astragalus keeping genes have recently been used for resolving taxa MICROBIOLOGY ECOLOGY MICROBIOLOGY membranaceus and Astragalus mongolicus (also called especially at the species level (e.g. Gao et al., 2001; Vinuesa A. membranaceus ssp. mongolicus) are used in Chinese et al., 2005a; Martens et al., 2007, 2008; Nandasena et al., traditional medicine. Astragalus species are also important 2007; Chen et al., 2008). Multilocus sequence analysis is a bee plants. Because environments for Astragalus plants are more reliable classification method than methodology based FEMS Microbiol Ecol 70 (2009) 227–235 c 2009 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved 228 Q. Li et al. on solely ribosomal sequences for a number of reasons. Table 1. Strains used in this study and results from ARDRA and rrs Firstly, several unlinked genes dispersed in the core genome sequence analysis better represent the true genealogy of the organism than just rrs sequence one single sequence or sequences from a locus that might Strain code rrs type type (species) show within strain variation (Young & Haukka, 1996). Astragalus luteolus (3650 m) Secondly, especially in rhizobia, ribosomal sequences show SCAU1 A ND mosaicism as a consequence of homologous recombination, SCAU2 A M. huakuii clade which interferes with phylogenetic tree construction (Ter- SCAU3 A ND efework et al., 1998; Van Berkum et al., 2003; Eardly et al., SCAU4 B ND SCAU5 CND 2005). Thirdly, rrs genes of rhizobia often display low SCAU6 D ND polymorphism in comparison with other taxonomic mar- SCAU7 E M. loti/ciceri clade Downloaded from https://academic.oup.com/femsec/article/70/2/227/532724 by guest on 23 September 2021 kers. They are thus often unreliable for species delineation. SCAU12 G ND This last feature is especially true for the genus Mesorhizo- SCAU13 E M. huakuii clade bium, a prevalent symbiont of Astragalus plant species. SCAU14 H ND Sampling of Chinese rhizobia has mainly been carried SCAU15 B ND out from the provinces Xinjiang, Gansu, Shanxi, Hubei, SCAU17 A ND SCAU18 A ND Hainan, Qinhai and Tibet, and some novel species have been SCAU20 H ND reported to date (Tan et al., 1997; Wei et al., 2003; Kan et al., SCAU21 I ND 2007; Han et al., 2008a, b; Tian et al., 2008). In this study, we SCAU22 C ND wished to obtain information about hitherto unexplored SCAU23 E ND ecosystems at high elevations on the southeast fringe of the SCAU24 D ND Qinghai-Tibet Plateau and obtain more information about SCAU26 F ND rhizobial diversity. We obtained root nodules from SCAU30 E ND SCAU31 E ND A. luteolus and A. ernestii, growing in the Aba district on SCAU32 B ND the northwest plateau of the Sichuan province in south- SCAU33 A ND western China, which is an important catchment area for Astragalus ernestii (4240 m) the Yellow River and Yangtze River. The area has a long and SCAU8 A ND cold winter and a cool and moist summer. The mean annual SCAU9 A M. huakuii clade temperature is 7.8 1C, the rainfall level is low (average SCAU10 A ND 613.9 mm per year) and the soil is barren. The plants SCAU11 F M. loti/ciceri clade SCAU16 B ND sampled grew at elevations of 3650 m (A. luteolus) and SCAU19 H ND 4250 m (A. ernestii), respectively. Thirty-three nodule iso- SCAU25 I ND lates were studied by molecular systematic methods, includ- SCAU27 A M. loti/ciceri clade ing amplified rDNA restriction analysis (ARDRA), SCAU28 A ND amplified fragment length polymorphism (AFLP) and se- SCAU29 D ND quencing of PCR products corresponding to rrs, glnA, glnII Strains used in the phylogenetic studies are in bold. and nifH genes, in order to observe diversity, phylogenetic M., Mesorhizobium; ND, not determined. patterns and speciation in these populations. N-free plant nutrient solution (Vincent, 1970) and main- Materials and methods tained in a growth chamber at 28 1C with a photoperiod of 15 h. Nodulation was observed after 1 month. Bacterial strains and culture conditions The bacterial strains used in this work are listed in Table 1. DNA isolation Bacterial strains were isolated using the methods described Total genomic DNAs of all isolates were obtained after by Weir et al. (2004). Strains were grown on yeast extract- lysozyme–sodium dodecyl sulfate lysis, followed by phe- mannitol medium (Sy et al., 2001) at 28 1C, and culture nol–chloroform extraction and ethanol precipitation as purity was checked by repeated streaking. Strains were described (Laguerre et al., 1992). stored at À 70 1C in 20% (v/v) glycerol for long-term preservation. In order to check the capacity of the isolates ARDRA to nodulate their original hosts, surface-sterilized seeds of A. luteolus and A. ernestii were inoculated and plants were Complete 16S rRNA genes were amplified with the universal grown in pots filled with vermiculite moistened with a forward primer P1 and the universal reverse primer P6 c 2009 Federation of European Microbiological Societies FEMS Microbiol Ecol 70 (2009) 227–235 Published by Blackwell Publishing Ltd. All rights reserved Horizontal gene transfer and recombination 229 Table 2. Oligonucleotides used as PCR primers and for sequencing Target gene Primer sequenceà Positionw Size of amplified fragment Reference rrs AGAGTTTGATCCTGGCTCAG AACGAACCCT 8–37 c.1400bp Tanet al. (1997) TACGGCTACCTTGTTACGACTTCACCCC 1479–1506 glnA AAGGGCGGCTAYTTCCCGGT 532–551 c. 530 bp Turner & Young (2000) GTCGAGACCGGCCATCAGCA 1143–1124 glnII AACGCAGACAAGGAATTCG 69–88 c.600bp ATGCCCGAGCCGTTCCAGTC 686–667 nifH TACGGNAARGGSGGNATCGGCAA 25–50 c. 840 bp Laguerre et al. (2001) AGCATGTCYTCSAGYTCNTCCA 787–808 à Y = C or T; H = A, C or T; R