US 20170 107160A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2017/0107160 A1 NEWMAN et al. (43) Pub. Date: Apr. 20, 2017
(54) HOPANOIDS PRODUCING BACTERIA AND Publication Classification RELATED BIOFERTILIZERS, (51) Int. Cl. COMPOSITIONS, METHODS AND SYSTEMS C05F II/08 (2006.01) (71) Applicant: CALIFORNLA INSTITUTE OF CI2N L/20 (2006.01) TECHNOLOGY, Pasadena, CA (US) GOIN 33/92 (2006.01) (52) U.S. Cl. (72) Inventors: Dianne K. NEWMAN, PASADENA, CPC ...... C05F II/08 (2013.01); G0IN 33/92 CA (US); Gargi KULKARNI, (2013.01); C12N 1/20 (2013.01); G0IN PASADENA, CA (US); Brittany Jo 2405/00 (2013.01) BELIN, PASADENA, CA (US) (57) ABSTRACT (21) Appl. No.: 15/298,172 Hopanoids, hopanoids-producing nitrogen-fixing bacteria, and related formulations, systems and methods are described (22) Filed: Oct. 19, 2016 herein. In particular, hopanoids alone or in combination with hopanoid-producing nitrogen-fixing bacteria can be used as Related U.S. Application Data biofertilizer to stimulate plant growth and yield with (60) Provisional application No. 62/243,418, filed on Oct. enhanced tolerance to diverse stresses found in plant-mi 19, 2015. crobe Symbiotic microenvironments. Patent Application Publication Apr. 20, 2017. Sheet 1 of 14 US 2017/O107160 A1
A) f d C.
top-2-ene top-22.9}-ere apart-2-ene (W) Bopan-22-ol Tetraymanov W. Dokopee) W, biplopteros)
--- R, ii, a GH oh s, ri o
e-P-508 vil Afinobacteriohopatrio a Bacteriahopaetetra (b. Adenosylhopane (d)
R, s - orch,
B)
sit: A lioid Fitiparoi
F.G. Patent Application Publication Apr. 20, 2017. Sheet 2 of 14 US 2017/O107160 A1
A. oH ch o: X------3s 28 ^-NY23 s R. t 2 oH R, g2
hiopanoid Tetrahyrnatiot R, x - or c-, R. so- or x-, B) s &S& C &yss& S & 9 & & & S. 8 O C-:)) I} { {KXCIC3) {:KI IX} 38s
------~~~~scale?e : Stic f f a. diploptee C5r ci, th& QC, 2-methyidipogteineC Hipnh 8, adenosylhopane rSC 5 O
100.
5 0.
oil. Tr: ------18 8 20 22 24 28 28 33 33 34 36 38 40 Time (min)
FG. 2 Patent Application Publication Apr. 20, 2017. Sheet 3 of 14 US 2017/O107160 A1
Root Nodule Nodule cross-section Pant Ces Symbiosome
Noctule Cotics Ces facedone Pas Nicles Bacteris Pat Ce:Wai Batteroic at Cea Peribacteroid Parterbare
F.G. 3 Patent Application Publication Apr. 20, 2017. Sheet 4 of 14 US 2017/O107160 A1
Penta-acylated hexa-acylated Lipid A 100- 2622.84. W
epta-acylated tipid A 335,22 SO. # topanoid + Hopanoid ------races of 2-hopanoid
O. 36365? s 2000 236 2720 3O8O o 3800 hexa-acylated lipid A OO 287.58 AhpnP
50 Hepta-acylated Lipid A Penta-acylated 329 lipid A + Hopanoid # opanoid -es- -- Traces of i 228.98 2 hopanoid
1 O 3838. 2000 2360 2720 3800 Hexa-acylated Lipid A OO 289.3 Ahpnh
50 Penta-acylated 21yeLipid A trace O
2000 2360 2720 3O80 3440 3800 Mass (mfz)
F.G. 4 Patent Application Publication Apr. 20, 2017. Sheet 5 of 14 US 2017/O107160 A1
0, 4. :: 25C 40: 38. 36. 34. 32. 0.3 : Patent Application Publication Apr. 20, 2017. Sheet 6 of 14 US 2017/O107160 A1
F.G. 6 Patent Application Publication Apr. 20, 2017. Sheet 7 of 14 US 2017/O107160 A1
A) Aerobic - 30°C B) Aerobic - 37°C s
s 38 s 0.
Time (h (WT: Ahpn?& Ahpnh
Cotri
NCR335 Iwi Aliprap 8Ahpnh
FIG. 7 Patent Application Publication Apr. 20, 2017. Sheet 8 of 14 US 2017/O107160 A1
- a. - s 8 & 3. - g s 2 s -gs E al
F.G. 8 Patent Application Publication Apr. 20, 2017. Sheet 9 of 14 US 2017/0107160 A1
0. 2 -
). 8
F.G. 9 Patent Application Publication Apr. 20, 2017. Sheet 10 of 14 US 2017/0107160 A1
O 2
21 d.p.i.
FG, 10 Patent Application Publication Apr. 20, 2017. Sheet 11 of 14 US 2017/O107160 A1
hpnP shc hpni
ey.
FIG.
Patent Application Publication Apr. 20, 2017. Sheet 12 of 14 US 2017/0107160 A1
2. Š- C.
3 wildtype 20 dpi : 8 -hpah & 3 : " : S :
: 3 R.; 1. C.. ... :
b. c. s. s S. s s S. s c 2 WT Alphi Patent Application Publication Apr. 20, 2017. Sheet 13 of 14 US 2017/0107160 A1
Exp: 38c
an as:
F.G. 13 Patent Application Publication Apr. 20, 2017. Sheet 14 of 14 US 2017/O107160 A1
3.
8 S. 8 33 8
-ip:
F.G. 4 US 2017/01 07160 A1 Apr. 20, 2017
HOPANOIDS PRODUCING BACTERIA AND fixing rhizobia strains. The method further comprises detect RELATED BIOFERTILIZERS, ing among the one or more candidate nitrogen fixing rhizo COMPOSITIONS, METHODS AND SYSTEMS bia Strains, at least one rhizobia Strain capable of producing Cs hopanoids. The method further comprises providing the CROSS REFERENCE TO RELATED at least one rhizobia Strain capable of producing Cs APPLICATIONS hopanoids in a form Suitable for administration to a legu 0001. The present application claims priority to U.S. minous plant or seed or soil Surrounding a leguminous plant Provisional Application No. 62/243,418, entitled “Using or seed, thus providing a biofertilizer for the leguminous Hopanoids to Improve Stress Resistance in Biological Nitro plant. In some embodiments, the method further comprises gen Fixation filed on Oct. 19, 2015, with docket number providing the at least one rhizobia Strain capable of produc CIT-7327-P which is incorporated herein by reference in its ing Cs hopanoids in combination with carrier allowing entirety. increased stability, viability and/or effectiveness of the nitro gen-fixing bacteria gas exchance of the one or more nitro STATEMENT OF GOVERNMENT GRANT gen-fixing rhizobia. 0009. According to a third aspect, a method to provide a 0002 This invention was made with government support biofertilizer for a leguminous plant, is described. The from NASA (NNX12AD93G), the National Science Foun method comprises genetically engineering a nitrogen fixing dation (1224158) and the Howard Hughes Medical Institute rhizobia Strain incapable of producing Cls hopanoids to (HHMI). The government has certain rights in the invention. introduce Cs synthesis genes thus providing a genetically engineered nitrogen fixing rhizobia strains capable of pro FIELD ducing Cls hopanoids. The method further comprises pro 0003. The present disclosure relates to hopanoids, viding the genetically engineered nitrogen fixing rhizobia hopanoids producing bacteria and related biofertilizers, strains in a form suitable for administration to a leguminous microorganisms, compositions, methods and systems com plant or seed, and/or a soil Surrounding leguminous plant or prising hopanoid-producing microorganisms and related for seed thus providing the biofertilizer for the leguminous mulations, and uses as biofertilizer in agriculture industry. plant. 0010. According to a fourth aspect, a biofertilizer com BACKGROUND position for a leguminous plant is described. The biofertil 0004. The exploitation of beneficial microbes as a biofer izer composition comprises one or more biofertilizers essen tilizer has become of paramount importance in agriculture tially consisting of one or more nitrogen-fixing rhizobia sector for their potential role in food safety and sustainable capable of producing Cls hopanoids and an acceptable crop production. vehicle. In some embodiments, the biofertilizer composition 0005. There remains however a challenge for developing can further comprise one or more Cs hopanoids. In the eco-friendly and economically feasible alternatives to biofertilizer composition the one or more biofertilizers and chemical fertilizers, which can improve soil fertility, health the vehicle are formulated for administration to a legumi of the environment, and agricultural productivity particu nous plant and/or for administration to a leguminous seed. In Some embodiments the vehicle comprises at least one carrier larly under different soil conditions. allowing increased stability, viability and/or effectiveness of the nitrogen-fixing bacteria gas exchance of the one or more SUMMARY nitrogen-fixing rhizobia. 0006 Provided herein are hopanoid-producing bacteria, 0011. According to a fifth aspect, a biofertilizer compo and related biofertilizers, microorganisms, formulations, and sition is described. The biofertilizer composition comprises methods which can comprise one or more particular types of one or more nitrogen-fixing rhizobia capable of producing hopanoids and/or one or more hopanoid-producing nitrogen Cs hopanoids and one or more Cs hopanoids. In some fixing bacteria. In several embodiments, the microorgan embodiments the composition can be formulated for admin isms, and related biofertilizers, compositions methods and istration to a leguminous plant, a leguminous seed and/or systems described herein can improve stress-resistance dur soil Surrounding the leguminous plant or leguminous seed. ing the progression of plant-microbe Symbiosis and in In some embodiments, the biofertilizer composition further particular of a legume-microbe Symbiosis. comprises one or more carriers allowing increased stability, 0007 According to a first aspect, a biofertilizer for a viability and/or effectiveness of the nitrogen-fixing bacteria leguminous plant is described. The biofertilizer essentially gas exchance of the one or more nitrogen-fixing rhizobia. consists of one or more nitrogen-fixing rhizobia capable of producing Cs hopanoids. In the biofertilizer, the one or 0012. According to a sixth aspect, a genetically modified more nitrogen-fixing rhizobia capable of producing Cs nitrogen-fixing rhizobium is described. The genetically hopanoids are in a form suitable for administration to one or modified nitrogen-fixing rhizobium is a rhizobium naturally more leguminous plant or seed, and/or for administration to incapable of producing Cs hopanoids and genetically engi a Soil Surrounding the one or more leguminous plant or seed. neered to produce Cls hopanoids. In some embodiments, the biofertilizer is in combination 0013. According to a seventh aspect, described herein is with carrier allowing increased stability, viability and/or a leguminous seed coated and/or inoculated with a biofer effectiveness of the nitrogen-fixing bacteria gas exchance of tilizer, and/or biofertilizer composition herein described, the one or more nitrogen-fixing rhizobia. optionally in combination with one or more Cs hopanoids. 0008 According to a second aspect, a method to provide In the leguminous coated and/or inoculated seed, the nitro a biofertilizer for a leguminous plant, is described. The gen-fixing rhizobia in the biofertilizer and/or biofertilizer method comprises providing one or more candidate nitrogen composition can be rhizobia naturally capable of producing US 2017/01 07160 A1 Apr. 20, 2017
Cs hopanoids and/or rhizobia naturally incapable of pro viability of the rhizobia used in fertilization of leguminous ducing Cs hopanoids and genetically modified to produce plants, and/or improvement of the related survive under soil Cs hopanoids. conditions, such as high temperature and low pH, to effec 0014. According to an eighth aspect, a method of fertil tively enhance plant growth and soil life and to improve soil izing leguminous plants is described. The method comprises nitrogen content when leguminous plants are used for crop applying one or more biofertilizer and/or biofertilizer com rotation. positions herein described to a leguminous plant or soil 0022. The biofertilizer, biofertilizer compositions, nitro Surrounding a leguminous plant for a time and under con gen-fixing rhizobia, seeds and related methods and systems ditions to allow symbiosis of the nitrogen-fixing rhizobia herein described can be used in connection with agronomy, with the leguminous plant. In some embodiments the biofer ecology and other applications wherein increased stress tilizer and/or biofertilizer compositions can be applied in tolerance of rhizobia is desired. Additional exemplary appli combination with one or more Cs hopanoids. In those cations would be identifiable by a skilled person upon embodiments, applying the biofertilizer and/or biofertilizer reading of the present disclosure. compositions and applying one or more Cs hopanoids are 0023 The details of one or more embodiments of the performed for a time and under conditions allowing inter disclosure are set forth in the accompanying drawings and action of the one or more Cs hopanoids with the nitrogen the description below. Other features, objects, and advan fixing rhizobia in the administered biofertilizer and/or tages will be apparent from the description and drawings, biofertilizer compositions. and from the claims. 0015. According to a ninth aspect, a method offertilizing leguminous plants is described. The method comprises coat BRIEF DESCRIPTION OF DRAWINGS ing and/or inoculating one or more seeds of the leguminous 0024. The accompanying drawings, which are incorpo plant with one or more biofertilizer and/or biofertilizer rated into and constitute a part of this specification, illustrate compositions herein described. In some embodiments the one or more embodiments of the present disclosure and, method further comprises coating and/or inoculating the one together with the detailed description and the examples, or more seeds of the leguminous plant with one or more Cs serve to explain the principles and implementations of the hopanoids before the coating and/or inoculating the one or disclosure. more seeds of the leguminous plant with one or more 0025 FIG. 1 shows, in panel A, exemplary chemical biofertilizer and/or biofertilizer composition. structures of hopanoids and related molecules and in panel 0016. According to a tenth aspect, a system to fertilize B, the cell envelope of a Gram-negative bacterium consist leguminous plants is described. The system comprises one ing of an inner (IM) and an outer membrane (OM). or more biofertilizer and/or biofertilizer compositions herein Hopanoids are found within both membranes. They are described and one or more Cs hopanoids for simultaneous either “free” or, in the case of Cs hopanoids, covalently sequential or combined use in fertilizing a leguminous plant bound to lipid A (Hol. A), which is present in the outer leaflet herein described. of the OM. As seen in the expanded view of the OM, B. 0017. According to an eleventh aspect, a system to fer diazoefficiens makes short (Co) hopanoids like diploptene tilize a leguminous plant is described. The system comprises and extended (Cs) hopanoids like bacteriohopanetetrol one or more leguminous seed coated with one or more (BHT) and aminotriol. Penta- and hexa-acylated Lipid A biofertilizer and/or biofertilizer composition herein contain 5 and 6 fatty acyl chains, respectively. Hepta described and one or more Cs hopanoids for simultaneous acylated Lipid A contains the Cs hopanoid, 34-carboxyl sequential or combined use in fertilizing a leguminous plant bacteriohopane-32.33-diol, covalently attached to hexa-acy herein described. lated Lipid A. B. diazoefficiens makes another triterpenoid 0018. According to a twelfth aspect, a method of storing with a gammacerane skeleton called tetrahymanol. With the a biofertilizer is described herein. The method comprises exception of Ho A, hopanoid positioning in the inner VS providing a biofertilizer herein describe, the biofertilizer outer leaflet has not been established and example structures comprising nitrogen-fixing bacteria that are naturally pro are placed randomly. Dark gray and light gray colors rep ducing Cls hopanoids and/or have been genetically modified resent hydrophilic and hydrophobic regions, respectively. to produce Cs hopanoids, and storing the biofertilizer 0026 FIG. 2 shows, in panel A, exemplary structures of formulation at a temperature between 22° C. and 37° C. a Cls hopanoid and tetrahymanol. B. diazoefficiens makes 0019. According to a thirteenth aspect, a biofertilizer for Co hopanoids like diploptene (C-22=C-30) and diplopterol a soil is described. The biofertilizer essentially consist of one (OH at C-22); Cs hopanoids like bacteriohopanetetrol or more nitrogen-fixing rhizobia capable of producing Cs (BHT, R=OH) and amino-bacteriohopanetriol (aminotriol, hopanoids and capable to fixing nitrogen outside a plant in R=NH); and tetrahymanol. All these compounds can be a form suitable for administration to the soil. Such biofer methylated at C-2 (2Me, R=CH). Panel B shows the tilizer can be applied to oxygen-poor soils to enrich the soil hopanoid biosynthetic gene cluster of B. diazoefficiens. In nitrogen content. this study, we focused on the genes colored in gray: she 0020. The biofertilizer, biofertilizer compositions, nitro (squalene hopene cyclase) catalyzes squalene cyclization to gen-fixing rhizobia, seeds and related methods and systems hopene, the first reaction in the hopanoid biosynthetic path herein described allow in several embodiments the nitrogen way; hpnH catalyzes addition of adenosine to hopene, the fixing rhizobia with enhanced tolerance to numerous first reaction in the synthesis of Cls hopanoids; and hpnP stresses, including acidic pH, high temperature, high osmo catalyzes C-2 methylation. Panel C shows GC-MS and larity, oxidative stress, detergents and antibiotics. LC-MS (inset) total ion chromatograms of total lipid 0021. The biofertilizer, biofertilizer compositions, nitro extracts from aerobically grown B. diazoefficiens Strains. gen-fixing rhizobia, seeds and related methods and systems GC-MS: Main hopanoid peaks are numbered and the meth herein described allow in several embodiments improved ylated counterparts elute 0.2-0.5 min earlier: I, pregnane US 2017/01 07160 A1 Apr. 20, 2017
acetate (standard); II, (2Me) hop-17(21)-ene: III, (2Me) H, K) and AhpnP (Panels F, I, L). (D, E, F) Whole roots, hop-X-ene: IV. (2Me) hop-22(29)-ene (diploptene); V. (2Me) scale=4 mm, (Panels G, H, I) Cross-section of live nodules, hop-21-ene, VI, (2Me) hopan-22-ol (diplopterol); VII, (2Me scale=1 mm. (Panels J, K, L) Nodule thin sections viewed by and 20Me) tetrahymanol; and VIII, BHP-508. LC-MS: a, brightfield microscopy, scale=1 mm. Panels M-R: Observa aminotriol; b. BHT; c. 2Me-aminotriol; d, adenosylhopane: tion of nodules elicited by WT (Panels M, P), AhpnH (Panels and e, 2Me-BHT. Lipid analysis for each strain was per N, Q) and AhpnP (Panels O, R) strains by confocal micros formed in triplicates. For chemical structures of hopanoids, copy using Syto9 (green, healthy bacteroids), calcofluor refer to FIG. 1, panel A. (blue, plant cell wall) and propidium iodide (red, infected 0027 FIG. 3 shows in some embodiments the endosym plant nuclei and bacteroids with compromised membranes). biotic context of B. diazoefficiens within root nodules of A. Scale=300 um (M, N, O) 50 um (Panels P, Q, R). Panels afraspera. B. diazoefficiens exists as a bacteroid, a termi S-X: Transmission electron micrographs of nodules elicited nally differentiated enlarged, elongated and polyploid state, by WT (Panels S, V), AhpnH (Panels T. W) and AhpnP within infected plant cortical cells. In addition to its own (Panels U, X). Scale=1 um (Panels S, T, U), 0.2 um (Panels membrane, each bacteroid is surrounded by a peribacteroid V, W, X). plant-derived membrane. The double-layered bacteroid is 0033 FIG. 9 illustrates in some embodiments that a B. called a symbiosome. The infected plant cell niche is char diazoefficiens AhpnH mutant is impaired in Symbiosis with acterized by low O., low pH, hyperosmosis and oxidative A. afraspera at 21 d.p.i. Panel A) Comparison of growth of stress 1, 2. plants, non-inoculated (NI) or inoculated with WT, AhpnH 0028 FIG. 4 shows in some embodiments the MALDI and AhpnP. Panel B) Quantification of acetylene reduction MS analysis of lipid A from B. diazoefficiens strains. Lipid activity (ARA) in plants inoculated with WT, AhpnH and A from WT and AhpnP is composed of a mixture of AhpnP. Error bars represent standard error (n=10). **p<0.01 penta-acylated and hexa-acylated species, whereas AhpnH by Tukey's HSD test. Panel C) Number of nodules per plant lipid A is mainly hexa-acylated. ACs hopanediolic acid is elicited by WT. AhpnH and AhpnP. Panels D-M) Aspect of ester-linked to hexa-acylated and hepta-acylated lipid A in the nodules elicited by WT (Panels D, G, J), AhpnP (Panels WT and AhpnP. AhpnH does not contain any lipid A-bound E. H. K) and AhpnH (Panels F, I, L, M). (D, E, F) Whole hopanoids. roots, scale=1 mm, (Panels G, H, I) Cross-section of live 0029 FIG. 5 plots whole cell membrane fluidity mea nodules, scale=500 um. (Panels J, K, L) Nodule thin sections Surements by fluorescence polarization, which show that viewed by brightfield microscopy, scale=500 um. Panel M) rigidity decreases for all strains as temperature increases and The black arrow shows plant defense reactions (necrotic that the AhpnH membrane is less rigid than that of WT or plant cells), scale=500 um. Panel N) Aspect of the nodules AhpnP (**p<0.01 by Student’s 2-Tailed t-test). Error bars elicited by AhpnH as observed by confocal microscopy represent the standard deviation from three biological rep using the live-dead kit, scale=200 um. White arrows show licates (~22 technical replicates). plant defense reactions. Panel 0) Aspect of the nodules 0030 FIG. 6 shows in some embodiments the CRYO elicited by AhpnH stained with lugol. Scale=500 um. White transmission electron microscopy (TEM) micrographs arrows show starch granules in dark. Panels P-U) Confocal which show intact outer and inner membranes in all B. microscopy observations of nodules elicited by WT (Panels diazoefficiens strains. Scale=200 nm. P. Q) AhpnH (Panels R. S) and AhpnP (Panels T. U) strains 0031 FIG. 7 shows in some embodiments the growth of and stained using Syto9 (green, healthy bacteroids), calco B. diazoefficiens Strains under various stress conditions. fluor (blue, plant cell wall) and propidium iodide (red, Growth of WT (circle), AhpnP (square) and AhpnH (tri infected plant nuclei and bacteroids with compromised angle) was monitored at ODoo in Panel A) PSY at 30° C. membranes). Scale=200 um (P. R. T), 20 um (Q, S, U). Panel B) PSY at 37° C., Panel C) microaerobic PSY with Panels V-Z') TEM of nodules elicited by WT (Panels V, W, 0.5% O, at 30° C., Panel D) PSY at pH=6 and 30° C. Each X) and AhpnH (Panels Y, Z, Z). Panels V, Y) Black arrows curve represents the average of at least three biological show symbiososmes. Panel Z) Cell envelope of some replicates, except the microaerobic growth curves for which AhpnH bacteroids is not well delineated (bold black arrow) a representative data set out of four trials is shown. Growth and some deposits of cellular material can be observed in the of B. diazoefficiens Strains under stress as measured in Panel peribacteroid space (black arrow). Panel Z') The bold black E) stressor gradient plates with 50 mM. NaCl, 500 mM arrow shows bacteroid wall breakdown. The black arrow inositol, 0.4% bile salts or 1 mM EDTA or by Panel F) disc shows cellular material of unknown origin. Scale 2 um (V, diffusion assays with 10% SDS, 5.5 MHO, and 2 M HC1. Y), 0.5 um (W, Z), 0.2 M (X,Z). Error bars represent standard error (n=9). p-0.05 and 0034 FIG. 10 shows in some embodiments kinetics of **p<0.01 by Tukey's HSD test. Panel G) NCR335 sensi nodulation and nitrogen fixation of A. afraspera plants tivity of B. diazoefficiens strains. inoculated with B. diazoefficiens. Panel A. Number of nod 0032 FIG. 8 shows in some embodiments that B. diazo ules elicited by WT. AhpnH and AhpnP on plants at 9, 14 and efficiens AhpnH mutant is impaired in Symbiosis with Soy 21 days post inoculation (d.p. i.). Panel B: The acetylene bean at 21d.p.i. Panel A: Comparison of growth of plants, reducing activity (ARA) in plants inoculated with WT, non-inoculated (NI) or inoculated with WT, AhpnH and AhpnH and AhpnPat 9, 14 and 21 d.p.i. Error bars represent AhpnP. Panel B: Quantification of acetylene reduction activ standard error (n=10). Asterisk above the error bars indicate ity (ARA) in plants inoculated with WT, AhpnH and AhpnP. significant differences at *p-0.05 and **p<0.01 (Tukey's Panel C. Nodulation efficiency of WT. AhpnH and AhpnPon HSD test). plants. Error bars in B, C represent standard error (n=10). 0035 FIG. 11 show, in panel (a), an exemplary structure Based on Tukey's HSD test differences between strains were of the Cs hopanoid 2Me-bacteriohopanetetrol (BHT). The found to be insignificant, pc-0.05. Panels D-L: Aspects of gene shc generates the pentacyclic core from squalene; the nodules elicited by WT (Panels D, G, J), AhpnH (Panels E, addition of a methyl group at the C position is performed by US 2017/01 07160 A1 Apr. 20, 2017 hpnP; and the addition of a ribose-derived hydrocarbon the enzyme squalene-hopene cyclase, that can be linked via chain at the Co position to form a Cs hopanoid is per a C-C bond to a Cs sugar moiety derived from ribose. In formed by hpnH. Panel (b) plots acetylene reduction rates some hopanoids, the polar moieties of BHP can attach for A. afraspera plants at 24 days post-inoculation (dpi) with Sugars, amino acids or other functionalized units, which can wild-type (WT), AhpnP or AhpnH B. diazoefficiens. Panel be used for their preservation in the geological record. The (c) shows manual cross-sections of root nodules harvested at apolar ring system of hopanoids in the sense of the disclo 24 dpi for wild type and AhpnH mutants stained with Sure can comprise an extra methyl group at either position 2 Calcofluor white, propidium iodide (PI) or SYTO9. Panel (2Me-hopanoids) or position 3 (3Me-hopanoids) located in (d) shows normalization of acetylene reduction rates by the A-ring, or by unsaturation and/or attachment to a ribose nodule dry weight for wild type and AhpnH mutants. All derived side chain (Cs-hopanoids) (see Examples 3 and 4) values shown are average values from 10 plants per condi 3. Distribution of hopanoids with different chemical struc tion. Error bars represent standard deviation. ture among bacteria does not appear to follow a systematic 0036 FIG. 12 shows in some embodiments acetylene pattern. For example, BHPs methylated at C-2 are known to reduction rates per plant taken every four days after inocu be produced in abundance by cyanobacteria, but not by other lation for WT- and AhpnH-inoculated plants (panel a), bacteria. number of nodules per plant, nodule dry weight per plant 0042. Hopanoids producing bacteria, in the sense of the and plant shoot heights for WT and AhpnH-inoculated disclosure are bacteria having a gene set allowing produc plants (panel b) and images of 10 WT- and AhpnH-inocu tion of one or more hopanoids in the sense of the disclosure lated plants at 20 dpi and 40 dpi (panel c). All values shown and in particular a set of genes encoding molecules that are average values per condition and are pooled from two catalyze the production of hopanoids using squalene as the replicates of four plants each. Error bars represent standard beginning molecular substrate, including but not limited to deviation. the following genes: hpnP hpnF (also known as she), hpnG, 0037 FIG. 13 shows in some embodiments sample track hpnH, and hpnO.” ing of multiple nodules on a single WT plant (with nodule 0043 Hopanoid-producing bacteria comprise both free radii) using digital microscopy (panel a); sample nodule living bacteria and symbiotic bacteria. Examples of free growth time series for WT and AhpnH plants (panel b), and living bacteria producing hopanoids include Rho same nodule growth plot for a WT nodule (panels c-f). In dopseudomonas palustris, Bacillus spp., Synechococcus particular, panel c shows the raw data; panel d shows the raw spp., and Azotobacter spp. Examples of symbiotic bacteria data fit to quadratic, exponential or sigmoidal curves; panel producing hopanoids include Bradyrhizobia spp., Frankia e shows additional parameter fits for the sigmoidal fit; and spp., Anabaena spp., and Nostoc spp. For example, panel f shows a schematic overview of nodule growth hopanoids comprise BHPs localized in the cytoplasmic and parameters. outer membranes of various bacteria Such as Alicyclobacil 0038 FIG. 14 illustrates a schematic overview of deter lus acidocaldarius, Zymomonas mobilis, Frankia sp., and minate root nodule development in panel a. Parameters Streptomyces coelicolor. In particular, hopanoids have been describing this process include: to the time of bacterial found in nitrogen-fixing bacteria that form root or stem internalization, and Vo, the volume of the first infected cell; nodules in Symbiosis with various types of plants, where the t, the time at which a nodule is visible by eye, and V ris capacity for hopanoid biosynthesis is statistically enriched in the smallest nodule volume visible by eye; t the time at the (meta)genomes of bacteria associated with plants 4. which nodule growth has leveled off, and V, the volume For example, hopanoids have been found in membranes of of the nodule when nodule growth stops; dV/dt, the rate of plant symbionts of nitrogen-fixing Bradyrhizobia (40% of increase in nodule Volume between to and t. Panel b total lipid extract (TLE)) and Frankia (87%) genera 5, 6. shows sample wild-type nodule growth time course. Nodule Studies have shown that elimination of hopanoid biosynthe radii are measured directly and the nodule volume is deter sis in photosynthetic Bradyrhizobium BTAi1 impairs its mined by approximation of nodules as spheres. Panel c plots symbiosis with the legume Aeschynomene evenia (7. the distribution of newly-emerged nodules over time (in dpi) Hopanoids have not been found in other plant-associated for wild-type and AhpnH nodules from 40 plants each. bacteria, including ~50% of the symbiotic Rhizobiales fam Panels d, e, and f plot the distributions of dV/dt, predicted ily. Exemplary hopanoids producing bacteria that are natu to, and V for wild-type (N-75) and AhpnH nodules rally capable of producing hopanoids include strains from (N-50). Acetobacter, Acidiphilium, Azotobacter vinelandii, Bacillus amyloliquefaciens, Bacillus anthracis, Bacillus cereus, Bur DETAILED DESCRIPTION Kholderia cenocepacia, Bradyrhizobium, Burkholderia, 0039 Provided herein are hopanoids, hopanoid-produc Frankia, Geobacter, Methylobacterium, Pelobacter, ing bacteria and related biofertilizers, compositions, meth Nitrosococcus, Rhodopseudomonas, Rhodospirillum, Syn ods and systems that in several embodiment stimulate plant echocystis, Streptomyces, Zymomonas mobilis and others growth with enhanced tolerance to stresses encountered identifiable by a person of ordinary skill in the art of during the progression of plant-microbe Symbioses. microbiology. 0040. The term “hopanoids' as used herein indicate bac 0044. In hopanoids producing bacteria in the sense of the teriohopanepolyols (BHPs), which is a class of pentacyclic disclosure, hopanoids can promote membrane rigidity 8 triterpenoids that are found in a variety of bacteria including and confer protection against numerous stresses, including Gram-positive and Gram-negative bacteria as cell mem acidic or alkaline pH, high temperature, high osmolarity, brane components. oxidative stress, detergents and antibiotics 7, 9-11. The 0041 Hopanoids in the sense of the disclosure include in structural variation of hopanoids, including modification by particular amphiphilic BHP comprising a Cso pentacyclic methylation or the addition of diverse polar head groups, triterpene hydrocarbon skeleton, derived from squalene via Suggests there may be specificity in their structures with US 2017/01 07160 A1 Apr. 20, 2017
regard to localization and/or function. Evidence also Sug wherein a wavy line on the ring carbon indicates a R or S gests that diverse hopanoid types have non-overlapping chirality of the ring carbon, roles. For example, in Rhodopseudomonas palustris (12 m and m are independently 0 or 1; and Burkholderia cenocepacia / 10, Cs hopanoids are criti R. R. R. R. and Rs are selected from OH, NH2, cal for OM stability, and resistance to low pH, detergent hydroxymethyl, or aminomethyl groups wherein R. R. (sodium dodecyl sulfate, SDS) and polymyxin B, respec R. R. and Rs contain at least one NH2 or aminimethyl tively. In R. palustris, the biosynthesis of 2Me-hopanoids is groups and one of R and Rs is hydroxymethyl, or amin transcriptionally induced under stress 9, Suggesting that omethyl groups. 2Me-hopanoids may contribute to stress resistance under certain conditions and organisms. In Methylococcus capsu 0047. In some embodiments. Formula (II) can be For latus, 3Me-hopanoids contribute to late stationary phase mula (IIa) or Formula (IIb): survival 13. In vitro, 2Me-hopanoids rigidify membranes of varied compositions 8). However, no study has explored Formula (IIa) whether different hopanoids impact fitness in a natural ecological context. It is unclear whether there are functional distinctions under specific environmental conditions for diverse hopanoid types. 0045. In embodiments herein described, biofertilizer to be used to fertilize plants or soil are hopanoids producing bacteria capable of producing Cs hopanoids. The term "Cs hopanoids' in the sense of the disclosure include in particu lar amphiphilic BHP comprising a Copentacyclic triterpene Formula (IIb) hydrocarbon skeleton, derived from squalene via the enzyme squalene-hopene cyclase, and are linked via a C-C bond to a Cs. Sugar moiety derived from ribose 0046) In particular, in embodiments herein described, Cs hopanoids are compounds of Formula (I):
(I) 0048. In some embodiments, R. R. and Rs are OH. In Some embodiments, R is NH2. In some particular embodi ments, the Cs hopanoids are bacteriohopanetetrol (BHT) and aminobacteriohopanetrial shown in FIG. 1A. 0049. In some embodiments, the Chopanoids comprise aminobacteriohopanetriol, bacteriohopanetriol, 2-methyl bacteriohopanetriol, aminobacteriohopanetriol, bacterio hopanetetrol, 2Me-aminobacteriohopanetriol, adenosyl hopane, 2Me-bacteriohopanetetrol. 0050 Cs hopanoids are produced in bacteria by a set of genes comprising at least shc, hpnH and hpnG. The set can C22, C31, C33 and C34 have independently R or Schirality: also comprise hpnO, hpnP, and also hpnC, hpnD and hpnE. R. R. R. and R are independently selected from H. D. depending on the specific C35 produced as will be under methyl, or ethyl groups; stood by a skilled person. For example, hnpH is required to generate adenosyl hopane, which is a C35 hopanoid, how R. R. R. and Rs are selected from H. D. methyl, ever, hpnG and hpnO are needed to make aminobacterio hydroxymethyl, aminomethyl, hydroxyl, or amino groups, hopanetetrol and bacteriohopanetetrol (Welander 2012 wherein at least three of the R. R. R. and Rs groups each 12). Shc, hpnH and hpnG, hpnO, hpnP hpnC, hpnD and contains hydroxymethyl, aminomethyl, hydroxyl, or amino hpnE are conserved among various Cls producing bacteria groups: and encodes enzymes forming a hopanoid biosynethtic R is selected from OH, NH, hydroxymethyl, aminomethyl, pathway Such as squalene-hopene cyclase (Sch), B12 bind formula (II) ing radical SAM (hpnH), nucleosidase (hpnG), ornithine oxo-acid-transaminase (hpnO), B12 binding radical SAM (hpnP), squalene synthase (hpnC), squalene synthase Formula (II) (hpnD), and squalene dependent FAD-dependent desaturase (hpnE) as will be understood by a skilled person. In par ticular among different C35 producing bacteria strains, each of the proteins encoded by she, hpnHandhpnG, hpnO, hpnP. hpnC, hpnD or hpnE genes shows a same enzymatic activity in the different strains even if the sequences can differ from strain to strain at a polynucleotide and/or at a protein level. In particular, proteins encoded by each of Shc, hpnH and hpnG, hpnO, hpnP, and also hpnC, hpnD and hpnE can have an amino acid sequence identity >55% at a protein level US 2017/01 07160 A1 Apr. 20, 2017 while maintaining the respective enzymatic activity indi accurate statistical estimates, ensuring protein sequences cated above (see e.g. h.pnP as indicated by Ricci et al. 14) that share significant similarity also have similar structures. 0051. The term “gene' as used herein indicates a poly 0056. In embodiments herein described, hopanoids pro nucleotide encoding for a protein that in some instances can ducing bacteria capable of producing Cs hopanoids, and take the form of a unit of genomic DNA within a bacteria, particularly Cs hopanoids of Formula (I), are nitrogen plant or other organisms. fixing bacteria and, in particular, symbiotic nitrogen fixing 0052. The term “polynucleotide' as used herein indicates bacteria, which can be used to fertilize a plant and/or a soil, an organic polymer composed of two or more monomers as will be understood by a skilled person upon reading of the including nucleotides, nucleosides or analogs thereof. The present disclosure. term “nucleotide' refers to any of several compounds that 0057 The term “nitrogen-fixing bacteria” refers to consist of a ribose or deoxyribose Sugar joined to a purine or microorganisms capable of transforming atmospheric nitro pyrimidine base and to a phosphate group and that are the gen to fixed nitrogen in inorganic compounds usable by basic structural units of nucleic acids. The term “nucleoside' plants. Nitrogen-fixing bacteria are also called diazotrophs; refers to a compound (as guanosine or adenosine) that Some diazotrophs are capable of performing nitrogen fixa consists of a purine or pyrimidine base combined with tion naturally in a free-living state, while others can only fix deoxyribose or ribose and is found especially in nucleic nitrogen within plant hosts. Examples of diazotrophs include acids. The term “nucleotide analog or “nucleoside analog non-Symbiotic bacteria, Such as the plant-associated Soil refers respectively to a nucleotide or nucleoside in which bacterium Azotobacter, as well as Symbiotic bacteria includ one or more individual atoms have been replaced with a ing rhizobia (in particular Bradyrhizobia spp., Rhizobia different atom or a with a different functional group. Accord caea, Phyllobacteria, Sinorhizobia (Ensifer), Mesorhizobia ingly, the term polynucleotide includes nucleic acids of any and Azorhizobia), cyanobacteria (Anabaena spp., Nostoc length, and in particular DNA RNA analogs and fragments spp.), Frankia spp., and others identifiable by a person of thereof. ordinary skill in the art. 0053. The term “protein’ as used herein indicates a 0058. The wording “symbiotic bacteria' as used herein polypeptide with a particular secondary and tertiary struc indicates bacteria that provide fixed nitrogen to plants via ture that can interact with another molecule and in particular, direct plant-microbe association in exchange for nutrients with other biomolecules including other proteins, DNA, (generally carbon Sources) and include the model bacteria RNA, lipids, metabolites, hormones, chemokines, and/or Sinorhizobium meliloti, Rhizobium leguminosarum, and small molecules. The term “polypeptide' as used herein Bradyrhizobium diazoefficiens. During symbiotic nitrogen indicates an organic linear, circular, or branched polymer fixation, nitrogen-fixing bacteria establish a symbiotic rela composed of two or more amino acid monomers and/or tionship with plants in which the plant provides the nitrogen analogs thereof. The term “polypeptide' includes amino fixing bacteria with carbohydrates as an energy source and acid polymers of any length including full-length proteins the nitrogen-fixing bacteria provides the plant with nitrogen and peptides, as well as analogs and fragments thereof. A in the form of ammonium. Examples of plant-microbe polypeptide of three or more amino acids is also called a symbioses include rhizobia associated with leguminous protein oligomer, peptide, or oligopeptide. In particular, the plants and trees of the Acacia and Parasponia families, terms “peptide' and "oligopeptide' usually indicate a poly Frankia associated with certain dicotyledonous species (ac peptide with less than 100 amino acid monomers. A protein tinorhizal plants), certain Azospirillum species, associated “sequence' indicates the order of the amino acids that form with cereal grasses, Nostoc or Anabaena associated with the primary structure ferns, palms, lichens and hornwort, and many other plant 0054 As used herein the term “amino acid”, “amino acid microbe symbiotic systems identifiable by a person of monomer', or "amino acid residue' refers to organic com ordinary skill in the art. pounds composed of amine and carboxylic acid functional 0059. In particular, in embodiments herein described groups, along with a side-chain specific to each amino acid. hopanoids producing nitrogen-fixing bacteria capable of In particular, alpha- or O-amino acid refers to organic producing Cls hopanoids are rhizobia that can be used alone compounds composed of amine (-NH2) and carboxylic or in combination with Cs hopanoids to stimulate growth of acid (-COOH), and a side-chain specific to each amino leguminous plants and/or fertilize a soil. acid connected to an alpha carbon. Different amino acids 0060 1 The term “leguminous plants' or “legumes’ have different side chains and have distinctive characteris indicates plants in the family of Fabaceae (or Leguminosae) tics, such as charge, polarity, aromaticity, reduction poten with taxa Such as kudzu, clovers, soybeans, alfalfa, lupines, tial, hydrophobicity, and pKa. Amino acids can be cova peanuts and rooibos. Examples of leguminous plants include lently linked to form a polymer through peptide bonds by including Vicia faba, Arachis hypogaea, Cicer arientum, reactions between the amine group of a first amino acid and Dolichos lablab, Lupinus albus, Pisum arvense, Glycine the carboxylic acid group of a second amino acid. Amino max, Cajanus Cajan, Lens esculenta, Vigna radiate, Cyam acid in the sense of the disclosure refers to any of the twenty opsis tetragonoloba, Vigna aconitifolius, Vicia hirsute, naturally occurring amino acids, non-natural amino acids, Trigonella foenum-graecum, Onobrychis sativa, Coronilla and includes both Dan L optical isomers. cretica, Ornithopus sativus, Desmodium intortum, Indigo 0055. The term "percent identity refers to a quantitative fera hirsute, Medicago sativa, Trifolium incarnatum, Lotus measurement of the similarity between sequences of a pedunculatus, Trifolium agrarium and Lotonois bainesi and polypeptide or a polynucleotide and in particular indicates others identifiable to a person of ordinary skill in the relevant the amount of characters which match exactly between two art. Plants in the legume family can form symbioses with different sequences. Widely used similarity searching pro nitrogen-fixing soil bacteria to provide a Sustainable nitro grams, like BLAST, PSI-BLAST 15, SSEARCH 1617, gen Source to improve fertility in agricultural settings. Most FASTA 18 and the HMMER3 19 programs produce legumes interact optimally with nitrogen-fixing bacteria of a US 2017/01 07160 A1 Apr. 20, 2017 single genus, although the specificities of legumes for bac Mesorhizobium, Ensifer, Bradyrhizobium, Burkholderia, terial partners are largely uncharacterized. The nitrogen Phyllobacterium, Microvirga, Ochrobactrum, Methylobac fixing rhizobia that form symbioses with a given legume are terium, Cupriavidus, DevOsia, and Shinella. Detailed taxo referred to as legume symbionts. Examples of legume sym nomic information about rhizobia are identifiable by a bionts include Bradyrhizobia, Rhizobiacaea, Phyllobacte person of ordinary skill in the Azorhizobium, art. ria, Sinorhizobia (Ensifer), Mesorhizobia and Azorhizobia. 0062. In particular, in embodiments here described rhizo 0061. The term "rhizobia as used herein indicates a bia used in biofertilizers, and related seeds compositions, family of Gram-negative soil bacteria that fix nitrogen in methods and systems are naturally capable of producing Cs association with plants. Rhizobia form an endosymbiotic hopanoids. Exemplary legume symbionts naturally capable nitrogen fixing association with roots of legumes and some of producing Cls hopanoids include Bradyrhizobium BTAil, trees including Acacia and Parasponia. In particular, rhizo Bradyrhizobium japonicum, Bradyrhizobium diazoefficiens, bia colonize plant cells within root nodules where they Bradyrhizobium ORS278 and Methylobacterium nodulans. convert atmospheric nitrogen into ammonia and then pro Exemplary legume symbionts naturally incapable of pro vide organic nitrogenous compounds such as glutamine or ducing Cls hopanoids but capable of being engineered to ureides to the plant. The plant in turn provides the bacteria produce Cs hopanoids include Rhizobium etli, Rhizobium with organic compounds made by photosynthesis. Most of leguminosarum, Mesorhizobium loti, Sinorhizobium meli the rhizobia species are in the Rhizobiacae family in the loti, Azorhizobium caulinodans, and Ochrobactrum alpha-proteobacteria and are in Rhizobium, Mesorhizobium, anthropi. The symbiotic relationship between these and Ensifer, or Bradyrhizobium genera. There are also some other exemplary legume symbionts and their host plants, is other rhizobial species, presumably arisen through lateral shown in Table 1. Table 1 also includes an indication gene transfer of symbiotic genes. In general, rhizobia con whether the rhizobia strain contains the hpnH gene that is sists of about 98 species in 13 genera, including Rhizobium, required for the Cs biosynthesis. TABLE 1. Symbiotic relationship between exemplary legume symbionts and their host plants and whether the hpnH gene is present in the rhizobia strain hpnH Rhizobia Native host(s) present (Para)Burkholderia Mimosa spp. YES caribensis (Para)Burkholderia Mimosa spp. YES minosariin (Para)Burkholderia nodosa Mimosa spp. NO (Para)Burkholderia Aspalathus carnosa YES phymatum Azorhizobium cauinodans Sesbonia pp., e.g. Sesbania rostrata NO Azorhizobium doebereinerae Sesbania virgata NO Bradyrhizobium BTAi1 Aeschynomene indica, Aeschynomene evenia YES Bradyrhizobium canariense Lupinus spp. UNKNOWN Bradyrhizobium cytisi Cytist is viliosits UNKNOWN Bradyrhizobium Aeschynomene indica UNKNOWN denitrificans Bradyrhizobium elkani Glycine Soia YES Bradyrhizobium iriomotense Entada koshtinensis YES Bradyrhizobium japonicum Glycine Max YES Bradyrhizobium jicamae Pachyrhizus erosus YES Bradyrhizobium Glycine spp. YES iiaoningense Bradyrhizobium manausense Vignatinguiculata UNKNOWN Bradyrhizobium Centrolobium paraense UNKNOWN neotropicale Bradyrhizobium sp. ORS278 Aeschynomene evenia, Aeschynomene indica YES Bradyrhizobium sp. ORS285 Aeschynomene afiaspera YES Bradyrhizobium pachyrhizi Pachyrhizus erosus YES Bradyrhizobium paxillaeri Phaseolus itinatius L. UNKNOWN Bradyrhizobium retamae Retama spp. UNKNOWN Bradyrhizobium Arachis hypogea L. UNKNOWN subterraneum Bradyrhizobium Lespedeza spp. YES vitanningense Bradyrhizovbium Glycine max YES diazoefficiens Burkholderia cepacia Mimosa spp. YES Burkhoideria Sabiae Mimosa spp. UNKNOWN Burkhoideria tuberum Aspalathus carnosa UNKNOWN Cipriavidiis taiwanensis Mimosa spp. YES Devosia neptuniae Neptunia naians UNKNOWN Mesorhizobium abyssinicae Acacia abyssinica UNKNOWN Mesorhizobium albiziae Albizia kaikora UNKNOWN Mesorhizobium aihagi Alhagi sparsifolia NO Mesorhizobium amorphae Amorpha fitticosa NO US 2017/01 07160 A1 Apr. 20, 2017
TABLE 1-continued Symbiotic relationship between exemplary legume symbionts and their host plants and Whether the hpnH gene is present in the rhizobia Strain hpnH Rhizobia Native host(s) resent Mesorhizobium australicum Biserratia pelecinus L. Mesorhizobium caneithorni Alhagi sparsifolia KNOWN Mesorhizobium caraganae Caragana spp. KNOWN Mesorhizobium chacoense Prosopis alba KNOWN Mesorhizobium Ciceri Cicer arrieintin L. Mesorhizobium eraimani Lotus spp. Mesorhizobium gobiense Glycyrrhiza tiraiensis, Lotus corniculatus, Oxytropis glabra KNOWN and Robinia pseudoacacia Mesorhizobium hawassense Acacia spp. KNOWN Mesorhizobium huakui Thermopsis lupinoides Mesorhizobium jarvisii Lotus spp. KNOWN Mesorhizobium ioti Lottis spp., e.g. Lotus japonicals Mesorhizobium Cicer arrieintin L. KNOWN mediterraneum Mesorhizobium Anthyllis vulneraria NO metailidurans Mesorhizobium milieiense Cicer arrieintin L. KNOWN Mesorhizobium Biserratia pelecinus L. NS opportunistin Mesorhizobium plurifarium Acacia spp. Mesorhizobium qingshengii Astragalus Sinicus KNOWN Mesorhizobium robiniae Robinia pseudoacacia KNOWN Mesorhizobium sangai Astragalus spp. KNOWN Mesorhizobium Astragalus adsurgens KNOWN Septentionale Mesorhizobium Shangriiense Caragana spp. KNOWN Mesorhizobium shonense Acacia spp. KNOWN Mesorhizobium Caragana spp. KNOWN Silamurtinense Mesorhizobium Anagyris laiifolia and Lotus berihelotii KNOWN tamadavense Mesorhizobium tarinense Glycyrrhiza tiraiensis, Lotus corniculatus, Oxytropis glabra KNOWN and Robinia pseudoacacia Mesorhizobium temperatum Astragalus adsurgens KNOWN Mesorhizobium Vicia spp., Trifolium spp. KNOWN tianshanense Methyliobacterium nodulans Crotaiaria spp. Microvinga lotononidis Listia angolensis Microvinga lupini Lupinus textensis Microvinga zambiensis Listia angolensis KNOWN Ochrobactrum anthropi Cicer arrieintin Ochrobactrum Ciceri Cicer arrieintin KNOWN Ochrobactrum cytisi Cytistis scoparitis KNOWN Ochrobactrum lupini Lupinus albus KNOWN Phyliobacterium ifiiqiyense Astragalus algeriantis, Lathyrus intimidicus KNOWN Phyliobacterium leguminum Argyrolobium unifiorum, Astragalus algeriants KNOWN Phyliobacterium trifolii Trifolium spp. and Lupinus spp. KNOWN Rhizobium alianii Medicago ruthenica Rhizobium aikaisoii Caragana intermedia KNOWN Rhizobium azibense Phaseolus vulgaris KNOWN Rhizobium caliandrae Calliandra grandiflora KNOWN Rhizobium cattense Kinnerowia Stipulacea KNOWN Rhizobium cellulosilyticum Medicago Saiiva KNOWN Rhizobium daejeonense Medicago Saiiva KNOWN Rhizobium endophyticum Phaseolus vulgaris KNOWN Rhizobium eti Phaseolus vulgaris L. Rhizobium fabae Vicia faba KNOWN Rhizobium freirei Phaseolus vulgaris NO Rhizobium galegae Galega orientalis UN KNOWN Rhizobium gallicum Phaseolus vulgaris Rhizobium giardinii Phaseolus vulgaris Rhizobium grahamii Dalea leporina, Leucaena leucocephala and Citoria S iepilated Rhizobium hainanense Hainan province legumes UNKNOWN Rhizobium halophytocola Rosa rugosa UNKNOWN Rhizobium herbae Various wild legumes in China UNKNOWN Rhizobium huanitiense Sesbania herbacea UNKNOWN Rhizobium indigoferae Indigofera spp. UNKNOWN Rhizobium iagliaris Calliandra grandiflora UNKNOWN Rhizobium laguerreae Vicia faba UNKNOWN Rhizobium leguminosarum Phaseolus vulgaris, Trifolium spp. Pisum sativum NO US 2017/01 07160 A1 Apr. 20, 2017
TABLE 1-continued Symbiotic relationship between exemplary legume symbionts and their host plants and Whether the hpnH gene is present in the rhizobia Strain hpnH Rhizobia Native host(s) resent Rhizobium leucaenae Leucaena leticocephala, Leucaena escienta, common beans NO (Phaseolus vulgaris) and Giricidia sepium Rhizobium ioessense Astragalus and Lespedeza KNOWN Rhizobium iusitanum Phaseolus vulgaris Rhizobium mayense Calliandra grandiflora KNOWN Rhizobium mesoamericantin Phaseolus vulgaris, siratro, cowpea and Mimosa pudica Rhizobium mesosinicum Albizia, Kummerowia and Dalbergia KNOWN Rhizobium militionense Lespedeza Rhizobium mongolense Medicago ruthenica Rhizobium multihospitium Robinia pseudoacacia Rhizobium oryzae Phaseolus vulgaris and Glycine max KNOWN Rhizobium paranaense Phaseolus vulgaris L. KNOWN Rhizobium petrolearium Medicago Saiiva KNOWN Rhizobium phaseoli Phaseolus vulgaris Rhizobium pisi Pistin Saivitin KNOWN Rhizobium sophorae Sophora fiavescens KNOWN Rhizobium sophoriradicis Sophora fiavescens KNOWN Rhizobium sphaerophysae Sphaerophysa Salistia KNOWN Rhizobium suiae Hedysarum coronarium L. Rhizobium taibaishanense Kinnerowia Striata KNOWN Rhizobium tibeticum Trigonella archiducis-nicolai, Medicago inputina, Medicago KNOWN Saiva, Melilotus officinalis, Phaseolus vulgaris and Trigonella foenum-graecum Rhizobium tropici Phaseolus vulgaris L. beans and Leticaena sp. trees NO Rhizobium tubonense Oxytropis glabra UNKNOWN Rhizobium indicola Neptunia naians NO Rhizobium vais Phaseolus vulgaris, Mimosa pidica and Indigofera spicaia UNKNOWN Rhizobium vignae Vigna radiata NO Rhizobium yangingense Phaseolus vulgaris UNKNOWN Shinelia kunnerowiae Kinnerowia Stipulacea UNKNOWN Sinorhizobium/Ensifer abri Abris precatorius UNKNOWN Sinorhizobium/Ensifer Lotus arabict is UNKNOWN adhaerens Sinorhizobium/Ensifer Acacia spp. NO americantin Sinorhizobium/Ensifer Acacia Senegal and Prosopis chiiensis NO arboris Sinorhizobium/Ensifer fiedi Glycine Max NO Sinorhizobium/Ensifer Argyrolobium unifiorum, Medicago Saiiva UNKNOWN garamanticits Sinorhizobium/Ensifer Sesbania rostrata UNKNOWN indiaense Sinorhizobium/Ensifer Acacia Senegal and Prosopis chiiensis UNKNOWN kOstiensis Sinorhizobium/Ensifer Kinnerowia Stipulacea UNKNOWN kunnerowiae Sinorhizobium/Ensifer Medicago spp. NO medicae Sinorhizobium/Ensifer Medicago spp., e.g. Madicago truncatula NO meioti Sinorhizobium/Ensifer Acacia anguistissina UNKNOWN mexicantis Sinorhizobium/Ensifer Leucaena leticocephala UNKNOWN moreiense Sinorhizobium/Ensifer Argyrolobium unifiorum, Lotus creticus UNKNOWN intimidicus Sinorhizobium/Ensifer Saheli Sesbania cannabina NO Sinorhizobium/Ensifer Sesbania spp. UNKNOWN Sesbaniae Sinorhizobium/Ensifer soiae Glycine max NO Sinorhizobium/Ensifer Acacia laeta NO terangae
0063. In some embodiments, the nitrogen-fixing rhizobia species. Many members of this genus have the ability to fix naturally capable of producing C35 hopanoids can comprise atmospheric nitrogen by forming either specific or general Bradyrhizobia. Bradyrhizobia are Gram-negative bacilli symbioses. This means that one species of Bradyrhizobium (rod shaped) with a single Subpolar or polarflagellum. Bra can only be able to nodulate one legume species, whereas dyrhizobia are a common Soil dwelling microorganism that other Bradyrhizobium species can be able to nodulate sev can form symbiotic relationships with leguminous plant eral legume species. US 2017/01 07160 A1 Apr. 20, 2017
0064 Exemplary Bradyrhizobia naturally capable of pro plant-derived “peribacteroid membrane (FIG. 3); and (iii) ducing Cls hopanoids and that are suitable to be used in initiation of nitrogen fixation by bacteroids, during which biofertilizer, compositions, seeds, methods and systems there is a high rate of nutrient exchange across the symbio herein described include Bradyrhizobium diazoefficiens, Some membranes between plant-Supplied carbon Sources Bradyrhizobium elkanii, Bradyrhizobium embrapense, Bra and fixed atmospheric nitrogen produced by bacterial nitro dyrhizobium icense, Bradyrhizobium japonicum, Bra genase 2, 22. dyrhizobium jicamae, Bradyrhizobium lablabi, Bradyrhizo 0068. In some embodiments, nitrogen fixing Cs produc bium liaoningense, Bradyrhizobium manausense, ing rhizobia to be used in biofertilizer, compositions, seeds Bradyrhizobium neotropicale, Bradyrhizobium Oligotrophi methods and systems herein described are rhizobia naturally cum, Bradyrhizobium pachyrhizi, Bradyrhizobium paxillaeri, incapable of producing Cls hopanoids (herein also Cas Bradyrhizobium retamae, Bradyrhizobium stylosanthis, hopanoid-deficient rhizobia), and genetically engineered to Bradyrhizobium tropiciagri, Bradyrhizobium valentinum, include genes for production of Cs hopanoids thus provid Bradyrhizobium viridifiuturi, Bradyrhizobium yuanmin ing genetically engineered rhizobia capable of producing gense, Bradyrhizobium sp., Bradyrhizobium sp. Aila-2, Bra Cs hopanoids herein also indicated as genetically engi dyrhizobium sp. ARR65, Bradyrhizobium sp. AT1, Bra neered C35 rhizobia. dyrhizobium sp. BR 10245, Bradyrhizobium sp. BR 10303, 0069. In some embodiments, the rhizobia naturally inca Bradyrhizobium sp. BTAi1, Bradyrhizobium sp. CCBAU pable of producing Cs is a bacteria closely genetically 15544, Bradyrhizobium sp. CCBAU 15635, Bradyrhizo related to (i.e. within a same taxonomic order of) hopanoids bium sp. CCBAU 43298, Bradyrhizobium sp. CCGE producing legume symbionts capable of producing Cs LA001, Bradyrhizobium sp. CCH5-F6, Bradyrhizobium sp. hopanoids that can be used in biofertilizers, compositions, Cp5.3, Bradyrhizobium sp. DFCI-1, Bradyrhizobium sp. methods and systems herein described. For example, a DOA1, Bradyrhizobium sp. DOA9, Bradyrhizobium sp. rhizobium naturally incapable of producing Cls hopanoids Ec3.3, Bradyrhizobium sp. err11, Bradyrhizobium sp. G22, that can be genetically modified in the sense of the disclo Bradyrhizobium sp. Leaf396, Bradyrhizobium sp. LMTR 3, sure comprise Sinorhizobium meliloti, a symbiont of alfalfa Bradyrhizobium sp. LTSP849, Bradyrhizobium sp. (Medicago spp.), which is closely genetically related to LTSP857, Bradyrhizobium sp. LTSP885, Bradyrhizobium Bradyrhizobia and to all other members of the Rhizobiales sp. LTSPM299, Bradyrhizobium sp. ORS 278, Bradyrhizo order of the alpha proteobacteria having nitrogen-fixing bium sp. ORS 285, Bradyrhizobium sp. ORS 375, Bra capability in Symbioses with plants. dyrhizobium sp. S23321, Bradyrhizobium sp. STM 3809, 0070. In embodiments herein described, nitrogen-fixing Bradyrhizobium sp. STM 3843, Bradyrhizobium sp. th.b2, rhizobia capable of producing Cls either naturally or fol Bradyrhizobium sp. TV2a-2, Bradyrhizobium sp. lowing genetic modification, can be used as biofertilizer for URHAO002, Bradyrhizobium sp. URHAO013, Bradyrhizo legumes and/or soil. The term “biofertilizer” as used herein bium sp. URHD0069, Bradyrhizobium sp. WSM1253, Bra refers to a Substance containing living microorganisms, dyrhizobium sp. WSM1417, Bradyrhizobium sp. WSM1743, which, when applied to seeds, plant Surfaces, or soil, colo Bradyrhizobium sp. WSM2254, Bradyrhizobium sp. nizes the rhizosphere or the interior of the plant and/or WSM2793, Bradyrhizobium sp. WSM3983, Bradyrhizo promotes growth by increasing the Supply or availability of bium sp. WSM4349, Bradyrhizobium sp. WSM471, and primary nutrients to the host plant. Biofertilizers in the sense Bradyrhizobium sp. YR681. of the disclosure adds nutrients through the natural processes 0065. In particular, in some embodiments Bradyrhizobia of nitrogen fixation, solubilizing phosphorus, and stimulat that are naturally capable of producing Cs hopanoids that ing plant growth through the synthesis of growth-promoting can be used in biofertilizer and related seeds compositions, Substances. methods and systems can include Bradyrhizobium BTAi1, 0071 Biofertilizers herein described comprise and in Bradyrhizobium diazoefficiens USDA 110, Bradyrhizobium particular essentially consist of nitrogen fixing rhizobia japonicum USDA 6, Bradyrhizobium sp. ORS 278, and capable of producing Cs hopanoids. In particular, in biofer Bradyrhizobium diazoefficiens. tilizers essentially consisting of nitrogen fixing rhizobia 0066. In some of those embodiments, the nitrogen-fixing capable of producing Cs hopanoids herein described, at Bradyrhizobium naturally capable of producing hopanoids least 70%, preferably at least 80%, more preferably at least that can be used in biofertilizer and related seeds composi 85%, even more preferably at least 90%, and more prefer tions, methods and systems is Bradyrhizobium diaZoeffi ably at least 95%, of the nutrient adding activity of the ciens. The Bradyrhizobium diazoefficiens is a member of the biofertilizer is performed by nitrogen fixing rhizobia capable Bradyrhizobium genus, having the ability to form root of producing Chopanoids. The nutrient adding activity of nodules on leguminous plants. a bacteria and/or the biofertilizer can be quantitatively 0067. In particular, in embodiments herein described B. detected by detecting with techniques identifiable by a diazoefficiens can exhibit two different life-styles, free skilled person the nitrogen fixed by the plant or soil, the living in Soil or symbiotic within legume root nodule cells nitrogen solubilized in the plant or soil and/or a difference in 2, 20. In addition to its native soybean host, B. diazoeffi plant growth, following addition of the biofertilizer and/or ciens can engage in nitrogen-fixing symbioses with the of each rhizobia Strains. In general, nitrogen detection can be stems and roots of the tropical legume Aeschynomene performed by quantitatively detecting the percentage of the afraspera 21. In both of the these hosts, development of nitrogen dry weight by spectrometry on a dry sample of soil the symbiosis progresses through a series of defined stages: and/or the plants. Additional techniques comprise use of (i) colonization and invasion of host root tissue; (ii) inter biosensors that use a fluorescent label or other label that can nalization of bacteria by plant cells to form an organelle-like be incubated with a dried sample to report on the amount of structure called the symbiosome, comprising endosymbiotic glutamine (the main form of fixed N) or other forms of bacterial cells termed “bacteroids' that are surrounded by a fixed N as will be understood by a skilled person US 2017/01 07160 A1 Apr. 20, 2017
0072. The terms “detect' or “detection as used herein purified form wherein the bacteria are provided without a indicates the determination of the existence, presence or fact detectable presence of other microorganism. A bacterial of a compound, bacteria and/or related activity in a limited strain in isolated form can be obtained by obtaining a clonal portion of space, including but not limited to a sample, a bacterial preparation of the bacteria, for example by inocu reaction mixture, and a substrate. The “detect' or “detec lating a bacterial sample into a culture plate, and picking a tion” as used herein can comprise determination of chemical single bacterial colony grown on the plate as will be under and/or biological properties of a bacteria, plant, Soil and or stood by a skilled person. A purified bacterial strain can be related compositions, including but not limited to ability to obtained for example by separating bacteria from a growth fixing nitrogen, Solubilize nitrogen promote growth and medium, with methods identifiable by a skilled person such additional properties identifiable by a skilled person upon as inoculating a bacterial culture broth with an isolated reading of the present disclosure. The detection can be bacterial colony, growing the culture, and Subsequently quantitative or qualitative. A detection is "quantitative' separating the bacteria from the medium (e.g. by centrifu when it refers, relates to, or involves the measurement of gation and discarding the Supernatant medium, while retain quantity or amount of the compound, bacteria and/or related ing the pelleted bacteria). Additional techniques to isolate or activity (also referred as quantitation), which includes but is purify bacteria are identifiable by a skilled person upon not limited to any analysis designed to determine the reading of the present disclosure. amounts or proportions of the compound, bacteria and/or 0077. In some embodiments, a biofertilizer for legumi related activity. A detection is “qualitative' when it refers, nous plant can be provided from one or more candidate relates to, or involves identification of a quality or kind of nitrogen fixing rhizobia Strains, by a method comprising: the target or S compound, bacteria and/or related activity detecting among the one or more candidate nitrogen fixing signal in terms of relative abundance to another compound, rhizobia Strains, at least one rhizobia Strain capable of bacteria and/or related activity, which is not quantified. producing Cls hopanoids. The method further comprises 0073. The terms “label and “labeled molecule' as used providing the at least one rhizobia Strain capable of produc herein refer to a molecule capable of detection, including but ing Cs hopanoids in a form suitable for administration to a not limited to radioactive isotopes, fluorophores, chemilu leguminous plant or seed or soil Surrounding a leguminous minescent dyes, chromophores, enzymes, enzymes Sub plant or seed. strates, enzyme cofactors, enzyme inhibitors, dyes, metal ions, nanoparticles, metal Sols, ligands (such as biotin, 0078. In some embodiments, detecting rhizobia strains avidin, streptavidin or haptens) and the like. The term capable of producing Cs hopanoids in natural samples can “fluorophore” refers to a substance or a portion thereof be performed by culture-independent techniques, such as which is capable of exhibiting fluorescence in a detectable 16S rDNA sequencing. Positive identification in this manner image. As a consequence, the wording “labeling signal” or can then be used to target particular samples for enrichment signal as used herein indicates the signal emitted from the of Rhizobia strains, followed by isolation using methods label that allows detection of the label, including but not described below. limited to radioactivity, fluorescence, chemiluminescence, 0079. In particular, detecting among the one or more production of a compound in outcome of an enzymatic candidate nitrogen fixing rhizobia Strains, at least one rhizo reaction and the like. bia Strain capable of producing Cs hopanoids can be per 0.074. In embodiments herein described a biofertilizer for formed by detecting Cls hopanoids production by the one or a leguminous plant can be produced by providing a nitrogen more candidate compounds For example, Cs hopanoids fixing rhizobium in a form suitable for administration to a analysis can be performed by routine extraction and analysis leguminous plant or seed or soil Surrounding a leguminous using either high temperature GC-MS or ultra-performance plant or seed. In particular, the nitrogen-fixing rhizobium LC-MS as well as other approaches identifiable to a skilled can be provided in a biofertilizer in a culture in a viable form person in the art. Detailed protocol of hopanoid analysis can and preferably in a culture with a percentage of live cells in be found for example in related publications such as a whole population that can be at least 5%, preferably at least Welander et al., 2009 11 or Neubauer et al., 201526 as 25% and more preferably at least 50% well as in Example 6 of the present disclosure. 0075. A skilled person will be able to identify different 0080. In some embodiments detecting among the one or type of rhizobia and related application including specific more candidate nitrogen fixing rhizobia strains, detecting at condition for related viability. For example B. diazoefficiens least one rhizobia strain capable of producing Cls hopanoids differs phylogenetically from Bradyrhizobium BTAi1 as for can be performed by detecting genes for the synthesis of Cs example, Shc from these two strains falls in distinct phylo hopanoids in the one or more candidate one rhizobia Strain. genetic clades 7. Unlike Bradyrhizobium BTAi1, B. diazo I0081. In some embodiments, detecting genes for synthe efficiens is unable to photosynthesize 23, 24. Moreover, B. sis of Cs hopanoids in the one or more candidate rhizobia diazoefficiens infects plants via a Nod-factor dependent strains can be performed by detecting sequences of one or pathway, whereas Bradyrhizobium BTAi1 uses alternate more of the shc, hpnH and hpnG, hpnO, as well as hpnP, and symbiotic strategies 25. The inability to delete shc in B. also hpnC, hpnD and hpnE, in the genome, transcriptome, or diazoefficiens suggests that hopanoids are essential in this proteome of the one or more candidate Strains. Exemplary species, in contrast to Bradyrhizobium BTAi1 where shc techniques that can be used to detecting sequences of one mutants are viable. Such difference between these two more genes (e.g. where the genome is known), comprises species likely reflects differences in the niches the two computer-based tools for comparing gene sequences, tran bacteria inhabit as a consequence of their metabolic differ Script sequences, or protein sequences, such as those using ences, and what is required for Survival therein. the Basic Local Alignment Search Tool (BLAST) or any 0076. In some embodiments, the nitrogen fixing rhizobia other similar methods known to those of ordinary skill in the can be provided in the biofertilizer in an isolated and/or art. US 2017/01 07160 A1 Apr. 20, 2017
0082 In some embodiments, detecting genes for synthe least 50%. In some embodiment providing the at least one sis of Cs hopanoids in the one or more candidate rhizobia rhizobia Strain capable of producing Cls hopanoids in a form strains can be performed by detecting the genes and/or Suitable for administration to a leguminous plant or seed or related transcript in the one or more candidate rhizobia. soil Surrounding a leguminous plant or seed, in an isolated Exemplary techniques comprise wet bench approaches Such or purified form wherein the bacteria are provided without a as DNA sequencing, PCR, Southern blotting, DNA microar detectable presence of other microorganism. rays, or other methods of hybridization of DNA or RNA I0089. In some embodiments a biofertilizer for a legumi probes to DNA, wherein probes are attached to a label nous plant can be provided from a rhizobium naturally capable of emitting a signal Such as radiolabeling, fluores incapable of producing Cls hopanoids, by a method com cence, luminescence, mass spectroscopy or colorimetric prising: genetically engineering a nitrogen fixing rhizobia methods. Exemplary probes that can be used comprise strain incapable of producing Cls hopanoids to introduce primers from known Shc, hpnH and hpnG, hpnO, as well as Cs synthesis genes to provide a genetically engineered hpnP hpnC, hpnD and/or hpnE, and/or related transcript as nitrogen fixing rhizobia Strains capable of producing Cs will be understood by a skilled person. hopanoids, and providing the genetically engineered nitro 0083. In some embodiments, detecting genes for synthe gen fixing rhizobia Strains in a form suitable for adminis sis of Cs hopanoids in the one or more candidate rhizobia tration to a leguminous plant or seed, and/or a soil Surround strains can be performed by detecting transcripts of Shc, ing leguminous plant or seed. hpnH and hpnG, hpnO, as well as hpnP, and/or also hpnC, 0090. In some of those embodiments, genetically engi hpnD and/or hpnE. Exemplary techniques comprise RNA neering a nitrogen fixing rhizobia Strain incapable of pro sequencing, PCR, quantitative PCR, Northern blotting, in ducing Cs hopanoids to introduce Cs synthesis genes can situ hybridization, RNA microarrays, or other methods of be performed by providing at least one gene selected from hybridization of DNA or RNA probes to RNA. shc, hpnH and hpnG, hpnO, as well as hpnP hpnC, hpnD 0084. In some embodiments, detecting genes for synthe and hpnE and introducing the at least one gene in the sis of Cs hopanoids in the one or more candidate rhizobia rhizobium incapable of producing Cls hopanoids for a time strains can be performed by detecting proteins encoded by and under conditions to allow expression of the at least one shc, hpnH and hpnG, hpnO, as well as hpnP, and/or also hpnC, hpnD and/or hpnE detecting the proteins. Exemplary gene. 0091. In some of those embodiments, genetically engi techniques comprise proteomics, antibody-based methods neering a nitrogen fixing rhizobia Strain incapable of pro including immunohistochemistry, immunofluorescence, ducing Cs hopanoids to introduce Cs synthesis genes can western blotting, or any other method of protein detection. be performed by obtaining Cs hopanoid synthesis genes 0085. In embodiments, herein described, the conditions from rhizobium that naturally produces Cls hopanoid using and parameters to use probes/primers to detect shc, hpnH polymerase chain reaction-based amplification and isolation and hpnG, hpnO, as well as hpnP hpnC, hpnD and/or hpnE, of a region of genomic DNA encoding hopanoid synthesis can be varied to permit lower or higher threshold or strin genes and/or genomic regulatory elements, or cDNA encod gency of detection, to ensure hybridization within the least inghopanoid synthesis genes (see Examples 22-27). In some 55% sequence identity at gene level in view of the specific embodiments, the introduction of Cs hopanoid synthesis primers/probes selected. For example, use of oligonucle genes into Cs hopanoid-deficient rhizobia to produce otides comprising one or more degenerated nucleotide bases genetically engineered C35 rhizobia can be performed by or or using an antibody that binds to more highly conserved transduction using a recombinant viral vector containing a protein regions, can require modification of the detection Cs hopanoid synthesis gene expression construct. conditions as will be understood by a skilled person. I0086. In some embodiments, detecting genes for synthe 0092 Additional techniques and related vectors, methods sis of Cs hopanoids in the one or more candidate rhizobia and systems to modify a nitrogen fixing rhizobia incapable strains can be performed by detecting C35 hopanoids in lipid of producing C35 are identifiable by a skilled person. fractions or other cellular fractions isolated from cells using 0093. In some embodiments, providing the genetically methods mass spectrometry. engineered nitrogen fixing rhizobia Strains in a form Suitable 0087. In an exemplary embodiment, the detection can be for administration to a leguminous plant or seed, and/or a done, for example, by isolating genomic DNA from a soil Surrounding leguminous plant or seed can be performed candidate and performing PCR using primer sequences by providing the at least one genetically engineered rhizobia designed to amplify hpnH genes from known Cs hopanoid strain in a culture in a viable form and preferably in a culture producing rhizobia, including the primers listed in Table 4. a percentage of live cells in a whole population can be at Alternatively, RNA samples can be isolated from the can least 5%, preferably at least 25% and more preferably at didate(s) and these transcripts can be sequenced, and expres least 50%. In some embodiment providing the at least one sion of the hpnH gene can be detected by identification of genetically engineered rhizobia Strain capable of producing this gene using homology-based computational identifica Cs hopanoids in a form Suitable for administration to a tion (e.g. BLAST). leguminous plant or seed or soil Surrounding a leguminous 0088. In some embodiments, providing the at least one plant or seed, in an isolated or purified form wherein the rhizobia strain capable of producing Chopanoids in a form bacteria are provided without a detectable presence of other Suitable for administration to a leguminous plant or seed or microorganism. soil Surrounding a leguminous plant or seed, can be per 0094. In several embodiments, one or more biofertilizers formed by providing the at least one rhizobia Strain in a of the present disclosure are comprised in a biofertilizer culture in a viable form and preferably in a culture contain composition together with one or more Suitable vehicles, ing a percentage of live cells in a whole population that is at wherein the term “vehicle' as used herein indicates any of least 5%, preferably at least 25% and more preferably at various media acting usually as solvents, carriers, binders or US 2017/01 07160 A1 Apr. 20, 2017
diluents for the biofertilizer that are comprised in the com of producing Cls hopanoids and one or more Cs hopanoids. position as an active ingredient. In some embodiments the composition can be formulated for 0095. In some embodiments, a biofertilizer composition administration to a leguminous plant, a leguminous seed for a leguminous plant comprises one or more biofertilizers and/or soil Surrounding the leguminous plant or leguminous essentially consisting of one or more nitrogen-fixing rhizo seed. bia capable of producing Cls hopanoids and an acceptable 0101. In some embodiments, a biofertilizer composition vehicle. In some embodiments, the biofertilizer composition can be formulated as an inoculant, wherein the term "inocu can further comprise one or more Cs hopanoids. In the lant’ as used herein indicates a biofertilizer composition biofertilizer composition the one or more biofertilizers and containing a bacterial culture capable of providing fixed the vehicle are formulated for administration to a legumi nitrogen to plants, either via direct association (symbiosis) nous plant and/or for administration to a leguminous seed. In or via enrichment of the soil or medium in which the plant some embodiments the biofertilizer composition is formu is grown. lated for administration to a soil as will be understood by a skilled person. 0102. In particular, in some embodiments, the biofertil 0096. In particular, in some embodiments in the biofer izers formulation described herein can be prepared as car tilizer compositions the vehicle comprises one or more rier-based inoculants containing Cls hopanoids, living Cs carriers. Incorporation of carrier materials in the biofertilizer hopanoids-producing nitrogen-fixing bacteria and a carrier, composition herein described can enable easy-handling, Such as a Cs-bacteria-carrier mixture, according to common long-term storage and high effectiveness of the nitrogen procedures as would be recognized by a person skilled in the fixing capability of the nitrogen-fixing bacteria comprised in art of agriculture and fertilizer applications. the biofertilizer composition. In particular, the suitable car 0103) In particular, in some embodiments, a biofertilizer rier material can allow gas exchance, also have high organic composition formulated as an inoculant can be prepared by matter content and high water holding capacity, as well as first harvesting log-phase cultures of diazotrophs in their provide a stable medium for the storage of the biofertilizer appropriate free-living cultivation medium as described in while retaining high viability of the nitrogen-fixing bacteria literatures. For a given plant host, a concentrated Solution of comprised therein as will be understood by a skilled person. inoculation medium is prepared according to common pro 0097. In particular, suitable carrier materials can enhance cedures described in literatures, which typically contains the the survival of the nitrogen-fixing rhizobia on the seed necessary elements for the nitrogenase reaction, such as Surface against drying conditions until placed into Soil, the molybdenum/vanadium, iron, sulfur-containing compounds. Survival of the bacteria during the storage period, as well as A concentrated Cs hopanoid solution can be obtained by the survival of the bacteria in soil. After being introduced total lipid extraction of a rhizobia culture using Bligh-Dyer into the soil, the carrier material provides nutrient and/or method 27 modified for large-scale extraction, followed by habitable micro-pore to the inoculant bacteria for them to purification using silica gel and HPLC as would be under compete with native soil microorganisms. stood by a skilled person in the art. Detailed description of 0098 Various types of carrier materials can be used for methods for obtaining purified hopanoids from hopanoid seed or soil inoculation. For preparation of seed inoculant, producing rhizobia can be found in related publications such the carrier material can be milled to fine powder with as C-H Wu et. al. 28 herein incorporated by reference in its particle size of 10-40 um. The properties of a suitable carrier entirety. material for seed inoculation are (1) non-toxic to inoculant 0104. In some embodiments, biofertilizer compositions bacterial strain, (2) good moisture absorption capacity, (3) herein described can optionally comprise also Cls hopanoids easy to process and free of lump-forming materials, (4) easy and in particular Cs hopanoids of Formula I. In particular, to sterilize by autoclaving or gamma-irradiation, (5) avail in embodiments herein described, Cs hopanoids, and in able in adequate amounts, (6) inexpensive, (7) good adhe particular Cs hopanoids of Formula I, can be comprised in sion to seeds, and (8) good pH buffering capacity and (9) biofertilizer compositions together with Cs-hopanoids-pro non-toxic to plant. Further information about carrier mate ducing nitrogen-fixing rhizobia naturally capable of produc rials can be found in “Handbook for Rhizobia’ (Somasega ing hopanoids or with nitrogen fixing rhizobia naturally ran and Hoben, Springer, 1994). incapable of producing hopanoids and genetically engi 0099. The carrier can be a material, such as peat, ver neered to produce Cs hopanoids of Formula I can be miculite, lignite powder, clay, talc, rice bran, seed, rock combined at a weight ratio identifiable to a person of phosphate pellet, charcoal, Soil, paddy Straw compost, wheat ordinary skill in the art of agriculture, in particular, in the art bran or a mixture of Such materials. In common practice, for of fertilization. better shelf-life of biofertilizer formulation, a carrier or a 0105. In some embodiments, the biofertilizer or biofer mixture of such carrier materials are selected based on the tilizer composition herein described can be used to stimulate viability of the microorganisms mixed with them. In some plant growth with enhanced tolerance to the diverse stresses particular cases, to achieve a tight coating of inoculant on encountered during the progression of plant-microbe Sym seed Surface, adhesive material. Such as gum Arabic, methy bioses, including high temperature, oxic and hypoxic con lethylcellulose. Sucrose solutions and vegetable oils, can be dition, acidic, detergent, and oxidative stresses. used as carrier. In some cases, Supplementary nutrients and cell protectants such as Sucrose, maltose, trehalose, molas 0106. In particular, herein provided are methods offer ses, glucose and glycerol can be used together with the tilizing leguminous plants and/or soil with biofertilizer and/ carrier material to ensure improved cell viability and or related biofertilizer compositions herein described. extended shelf-life. 0107. In some embodiments, the method comprises 0100. In some embodiments, the biofertilizer composi applying one or more biofertilizer and/or biofertilizer com tion comprises one or more nitrogen-fixing rhizobia capable positions herein described to a leguminous plant or soil US 2017/01 07160 A1 Apr. 20, 2017
Surround a leguminous plant for a time and under conditions biofertilizer formulation can be directly applied to soil to allow symbiosis of the nitrogen-fixing rhizobia with the where the seed is planted or to be planted. leguminous plant. 0114. In embodiments herein described, methods offer 0108. In some embodiments, the biofertilizer and/or tilizing leguminous plants are described. The methods com biofertilizer compositions can be administered in combina prise administering the Cs hopanoids, and rhizobia herein tion with one or more Cs hopanoids. In those embodiments, described and related biofertilizer composition to legumi administering the biofertilizer and/or biofertilizer composi nous plants through seedling dipping, and/or direct-soil tions and administering one or more Cs hopanoids are application, and/or seed treatment (also called seed inocu further performed for a time and under conditions allowing lation), or other fertilizer application approaches identifiable interaction of the one or more Cs hopanoids with the by the skilled person. nitrogen-fixing rhizobia in the administered biofertilizer 0.115. In some embodiments, the methods of fertilizing and/or biofertilizer compositions. leguminous plants comprise preparing a Suspension contain 0109. In some embodiments, applying the biofertilizer or ing one or more biofertilizer herein described and dipping biofertilizer composition alone or in combination with C35 the seedlings of the leguminous plants in the Suspension for hopanoids can be performed on the roots or to the soil in a certain time under a certain condition to allow the sym which the roots are present. In particular, the applying can be biotic interaction between the rhizobia, Cs hopanoids and performed at any time in plant growth as will be understood the leguminous plants. by a skilled person. 0116. In particular, a biofertilizer/inoculant suspension comprising Cls hopanoids and Cs-hopanoids-producing 0110. In some embodiments, application on legumes of nitrogen-fixing bacteria is prepared in water. The roots of Cs hopanoids, and Cls hopanoids-producing rhizobia seedlings are then dipped in the Suspension and kept herein described and related biofertilizer composition, can immersed for a certain period of time, typically several be performed under conditions allowing extensive host minutes, before being transplanted. Here, seedling refers to control of bacteroid physiology and establishment of a a young plant sporophyte developing out of a plant embryo specific host microenvironment, defined by low oxygen, low from a seed. Seedling development starts with germination pH, hyperosmosis and oxidative stress 1. For example, in of the seed. A typical young seedling consists of three main A. afraspera application of Cs hopanoids, and rhizobia parts: the radicle (embryonic root), the hypocotyl (embry herein described and related biofertilizer composition can be onic shoot), and the cotyledons (seed leaves). For example, performed in connection with the plants ability to produce for soybean, each seedling can be treated with 1 ml of an nodule-specific, cysteine-rich antimicrobial peptides ODoo-1.0 (~10 cells) suspension of bacteria in a nodula (NCRs) that induce differentiation of the bacteroid into an tion medium that includes trace elements required by the enlarged, elongated and polyploid state. nitrogenase cofactors to support nitrogen fixation. 0111. In some embodiments, application on legumes of 0117. In some embodiments, about ~1 billion cells can be biofertilizers, biofertilizer composition alone or in combi Suspended in a nodulation medium that contains Cs nation with Cs hopanoids, can be performed for microaero hopanoids at a concentration below its critical micelle bic growth and tolerance to diverse stresses of the rhizobia concentration (CMC). the symbiotic microenvironment, Such as oxic and hypoxic 0118. The term “critical micelle concentration (CMC)” is condition, acidic (pHs6), detergent, oxidative stresses (such used herein to characterize the aqueous solubility of a lipid as due to hydrogen peroxide), ambient (between 22°C. and compound such as Cs hopanoids. CMC indicates the con 32° C.) and particularly higher temperatures (i.e. 37 centration above which amphiphilic molecules aggregate to C. a skilled person in the art. These constant values can also be selected based on the viability of the microorganisms mixed found in textbooks such as Kreshech 1975 29. It is also with them. The carriers used in the biofertilizer for seed possible to measure the CMC of a molecule with devices inoculation are typically non-toxic to inoculant bacterial Such as a contact angle system, a tensiometer, a Langmuir strains and plant, with certain moisture absorption and pH trough, or with other equipment identifiable by a skilled buffering capacity, easy to process and sterilize by autoclav person. ing or gamma-irradiation and cost-effective. In some par 0120 In some embodiment, methods of fertilizing legu ticular cases, to achieve a tight coating of inoculant on seed minous plants herein described comprise applying one or Surface, adhesive material. Such as gum Arabic, methyleth more biofertilizer and/or related biofertilizer composition ylcellulose. Sucrose solutions and vegetable oils, can be used herein described alone or in combination with the Cs hopanoids directly to the soil where the leguminous plants as carrier. In some cases, Supplementary nutrients and cell are grown. In particular, the biofertilizer composition com protectants such as Sucrose, maltose, trehalose, molasses, prising a biofertilizer herein described, optionally in com glucose and glycerol can be used together with the carrier bination Cs hopanoids and can be directly applied to the soil material to ensure improved cell viability and extended before or at the time of plantation or Sowing. shelf-life. 0121 For example, in some embodiments, the biofertil 0128. In some embodiments, coated seeds comprising izer or biofertilizer composition can be firstly mixed with leguminous plant seeds coated with the biofertilizer formu finely powdered farm yard manure (FYM), compost, or soil lation or inoculant are described. The coated seeds are at a specific ratio and then directly applied to the soil. The prepared by coating or inoculating the seeds with the biofer formed mixture can be broad-cast at the time of plowing. tilizer/inoculant according to the methods above described. 0122. In some embodiments, methods of fertilizing legu The coated seeds can be prepared by manufactures and then minous plants comprise applying the Css hopanoids, Cas distributed to farmers. Alternatively, the seeds can be coated hopanoid-producing rhizobia and related biofertilizer com or inoculated by farmers prior to planting. In particular, the position herein described via Soil inoculation by placing the seeds are leguminous seeds, including Vicia faba, Arachis biofertilizer and related composition into the furrow under Hypogaea, Cicer arientum, Dolichos lablab, Lupinus albus, or alongside the seeds. Pisum arvense, Glycine max, Cajanus Cajan, Lens esculenta, 0123. In particular, the biofertilizer and related compo Vigna radiate, Cyanopsis tetragonoloba, Vigna aconitifo sitions can further comprise a carrier material in granular lius, Vicia hirsute, Trigonella foenum-graecum, Onobrychis form of a size about 0.5-1.5 mm. Suitable carrier material sativa, Coronilla Cretica, Ornithopus sativus, Desmodium includes granular forms of peat, perlite, talcum powder, or intortum, Indigofera hirsute, Medicago sativa, Trifolium materials that can offer nutrient and/or habitable micro-pore incarnatum, Lotus pedunculatus, Trifolium agrarium and to the inoculants bacteria including carriers with micro Lotonois bainesii. The biofertilizers formulation are carrier porous structure Such as charcoal or soil aggregates. based inoculants containing Cls hopanoids, Cis-hopanoids 0.124. In some embodiments, the methods of fertilizing producing nitrogen-fixing bacteria and a carrier as described leguminous plants comprise coating/inoculating the legumi above. nous seeds with the Cs hopanoids, Cs hopanoid-producing I0129. In some embodiments, Cs hopanoids have been rhizobia and related biofertilizer composition herein shown to promote protection against numerous stresses, in described, also referred to as seed treatment methods. particular, higher temperatures and acidic soil conditions. 0.125. In particular, to prepare for inoculation, the biofer Consequently, the biofertilizer formulation comprising Cs tilizer can be firstly mixed with water to form a slurry hopanoids and Cs-hopanoids-producing bacteria as mixture. The seeds desired to be treated are then immersed described herein and the seeds inoculated with such biofer in the mixture for a certain period of time under certain tilizer can achieve improved viability of the microorganism conditions to form seeds coated or inoculated with the used in such formulations prior to its release into the field as inoculum. well as to Survive under certain soil conditions (Examples 0126 Leguminous plant seeds can be treated with the 16-18). biofertilizer compositions comprising a carrier, Cs hopanoids and Cs-hopanoids-producing nitrogen-fixing 0.130. In some embodiments, the biofertilizer and/or bacteria inoculant at a certain weight ratio identifiable to a inoculated or coated seeds can be stored at ambient or higher skilled person in the art of agriculture and inoculation. In temperatures between 22° C. and 37° C. More preferably, particular, the skilled person will recognize the relationship the storage condition includes a temperature of about 30° C. between seed size, number of Cs-hopanoids-producing to about 35° C. In particular, in some embodiments, the nitrogen-fixing bacteria, the amount of Cs hopanoids and biofertilizer and/or inoculated or coated seeds herein weight of the inoculant. Similar to the seedling dipping described can be stored at a temperature higher than 25°C., method described above, about ~1 billion cells can be while still retaining a high viability rate, compared to other Suspended in a nodulation medium that contains Cs biofertilizer or inoculated/coated seeds comprising rhizobia hopanoids at a concentration below its CMC. incapable of producing Cs hopanoids. In embodiments 0127. In some embodiments, the vechicle used in the herein described, the biofertilizer and/or inoculated or biofertilizer for seed treatment is in the form of fine powder coated seeds can be stored for long-term purpose in glycerol with particle size of 10-40 Lum. The carrier can be a material, at -20°C. or below, after flash-freezing, or desiccation with Such as peat, Vermiculite, lignite powder, clay, talc, rice improved bacterial Survival rate and elongated storage time. bran, seed, rock phosphate pellet, charcoal, soil, paddy Straw 0.131. In some embodiments, the biofertilizer herein compost, wheat bran or a mixture of Such materials. In described and the seed coated with such biofertilizer can be common practice, for better shelf-life of biofertilizer formu planted under stress Soil conditions such as high tempera lation, a carrier or a mixture of Such carrier materials are tures and low pH to effectively enhance plant growth and US 2017/01 07160 A1 Apr. 20, 2017 soil life. The stress soil condition includes a temperature of genetic modification can include modification of the bacteria about 25°C. to about 37° C. and a pH value of about 6 to by transfer of the genes using a recombinant plasmid, a 8 recombinant non-viral vector, or a recombinant viral vector, 0132. In some embodiments, the biofertilizer herein encoding Such gene expression constructs and additional described comprises nitrogen-fixing rhizobia that can fix methods identifiable by a skilled person. nitrogen outside plants, such as photosynthetic rhizobia I0138. In some embodiments, Cs hopanoid synthesis including Bradyrhizobium BTAi1, Cyanobacteria and Azo genes can be obtained from “donorrhizobium that naturally tobacter species. Rhizobia that can fix nitrogen outside produces Cls hopanoids, by using polymerase chain reaction plants comprise nif genes that are a set of genes encoding (PCR)-based amplification and isolation of a region of enzymes involved in the fixation of atmospheric nitrogen genomic DNA encoding hopanoid synthesis genes and/or into a form of nitrogen available to living organisms. Such genomic regulatory elements, or cDNA encoding hopanoid biofertilizer can be applied to oxygen-poor soils to enrich synthesis genes (see Example 22). 'Donor genetic material the Soil nitrogen content. Exemplary rhizobia species that used as a template for obtaining these genes and/or regula can be comprised in these biofertilizer include Bradyrhizo tory elements can be in the form of isolated genomic DNA, bium BTAi1, Bradyrhizobium ORS285, Bradyrhizobium cDNA, or genetic material contained in previously-cloned ORS278 and other rhizobia that can fix nitrogen in free plasmids. Sequences of donor material can be obtained from living conditions. available gene databases and/or by sequencing the material 0133. In some embodiments, the nitrogen-fixing rhizobia using standard techniques. Using the DNA sequences in the herein described are wild type bacteria that can naturally donor material as a guide, design of appropriate primers, produce Cls hopanoids. In other embodiments, the nitrogen fixing bacteria herein described are nitrogen-fixing rhizobia PCR reagents and methods can be achieved by a person of that are naturally incapable of producing Cls hopanoids ordinary skill in the art. (herein also Cs hopanoid-deficient rhizobia) that are geneti I0139. In some embodiments, after the Cs hopanoid syn cally modified to produce Cls hopanoids (herein also geneti thesis genes and/or other regulatory elements are obtained, cally engineered C35 rhizobia). Cs hopanoid-deficient incorporation of the genes and/or other regulatory elements rhizobia include rhizobia lacking of one or more Cs into a plasmid vector or other vector can be achieved using hopanoids synthesis genes and capable of being mutated to standard molecular cloning techniques. For example, the Cs include one or more Cs hopanoids synthesis genes. Differ hopanoid synthesis genes can be excised from Surrounding ent from their wild type counterparts that cannot naturally genetic material by restriction endonuclease digestion to produce Cls hopanoids, genetically engineered C35 rhizobia provide a Cs hopanoid synthesis gene "insert”. In parallel, are capable of producing Cls hopanoids. The genetically restriction endonuclease digestion can be performed on a engineered C35 rhizobia are expected to be more stress plasmid vector or other vector into which the Cs hopanoid tolerant compared to their wild type counterparts. genes are inserted. DNA ligation can then be performed to 0134. Thus herein described are also one or more nitro result in a plasmid containing the Cs hopanoid synthesis gen-fixing genetically engineered Cls rhizobia can be com genes and/or regulatory sequences. prised in the biofertilizer described herein alone or in 0140. In some embodiments, the vector containing the combination with Cs hopanoids. Cs hopanoid synthesis genes can contain appropriate regu 0135) In some embodiments, the genetically engineered latory elements to express the Cs hopanoid synthesis genes, Cs rhizobia comprise one or more bacteria closely geneti including but not limited to promoters, enhancers, 5' and 3' cally related to (within the same taxonomic order of) Bra untranslated regions, exons, introns, enzyme recognition dyrhizobia, Such as Sinorhizobium meliloti that are geneti sites for appropriate processing of transcripts, and post cally modified to produce Cls hopanoids. Additional transcriptional and post-translational genetic elements. exemplary legume Cs bacteria mutants include mutants of Exemplary regulatory elements that can be comprised in the Rhizobium leguminosarum, Mesorhizobium loti, Sinorhizo vector can comprise elements that are naturally associated bium meliloti, Azorhizobium caulinodans, and Ochrobac with the Cs hopanoid synthesis genes in genomic DNA of trum anthropi. the 'donor genetic material, and/or elements comprised of 0.136 General methods of preparing genetically engi "heterologous' elements that are not normally associated neered C. rhizobia are identifiable to a person of ordinary with the natural Cs hopanoid synthesis genes, such as skill in the art upon reading of the present disclosure. In promoters normally associated with other genes. particular, preparing Cls bacteria mutant can be achieved by introducing Css hopanoids Synthesis genes (e.g. Cas 0.141. In some embodiments, vectors used to introduce hopanoid gene cluster shown in FIG. 2, panel B) required for Cs hopanoids synthesis genes can include in addition to Cs hopanoid synthesis into a rhizobia incapable of produc elements for regulating expression of Cs hopanoid synthe ing Cls hopanoids, including the genes hpnP, she, and hpnH. sis genes, other genetic material comprising other regulatory at physiologically relevant levels to result in a beneficial sequences, including origin of replication, genes for express effect on plants affiliated with the bacteria, including ing antibiotic resistance, and restriction endonuclease sites. legumes such as A. afraspera or soybeans or others. 0142. In some embodiments, vectors used to introduce 0.137 This genetic modification can be achieved using Cs hopanoids synthesis genes comprise a plasmid vector various techniques identifiable by a skilled person including containing an expression cassette for a single hopanoid using gene expression constructs that direct expression of synthesis gene. In other embodiments, vectors used to genes required for Cs hopanoid synthesis, including Suit introduce Cls hopanoids synthesis genes comprise a plasmid able promoter, enhancer, and other elements required for vector containing expression cassettes for more than one expression in bacteria that would be recognized to perform hopanoid synthesis gene. In some embodiments, a recipient this function by those of ordinary skill in the art. Methods for rhizobium can be genetically modified with one or more US 2017/01 07160 A1 Apr. 20, 2017 plasmid vectors containing one or more hopanoid synthesis stress-resistant rhizobia comprising providing the one or gene expression cassettes, as required to provide a full set of more candidate rhizobia strains; and detecting in the one or hopanoid synthesis genes. more candidate rhizobia strains, production of a Cs 0143. In some embodiments, vectors containing hopanoid and/or Cs hopanoids synthesis genes to identify hopanoid synthesis genes can be introduced into bacteria, stress-resistant rhizobia. including rhizobia, by a process of transformation, whereby I0153 Detection of Cs hopanoid can be performed by the bacterial cell wall is transiently opened allowing entry of directly detecting the Cs hopanoid and/or molecules the plasmid DNA into the bacterium. Several methods of involved in the related biosynthetic pathway including transformation can be used, including electroporation, ther squalene, diploptene, adenosyl hopane, ribosyl hopane, mal shock, freeze-thaw techniques (see Examples 25-27). formyl hopane, other hopanoid intermediates and Cs pre 0144. In some embodiments, transfer of vectors and in cursors as shown in Welander 2009 and Welander 2012 and particular plasmid vectors containing Cs hopanoid synthe identifiable to a skilled person in the art. sis genes into rhizobia can be performed by a process of 0154) In particular, in some embodiments, a method of conjugation, in which plasmid DNA is transferred from an screening stress-resistant rhizobia strains can comprise pro E. coli bacterial cell into a rhizobium by direct contact (see viding a plurality of rhizobia strains, culturing the cells of Example 23). each rhizobia Strain, analyzing lipids extracted for presence 0145. In some embodiments, gene expression cassettes of Css hopanoids, and selecting the rhizobia Strain producing required for genetically modifying a rhizobium to produce Cs hopanoids as stress-resistant rhizobia. Cs hopanoids are maintained on an plasmid, rather than 0155 For example, screening rhizobia for the ability to integrating into bacterial host DNA. In other embodiments, produce Cs hopanoids can be performed by analysis of gene expression cassettes required for genetically modifying lipids extracted from samples of rhizobia obtained from soil, a rhizobium to produce Cs hopanoids are integrated into legume nodules, or other sources. In particular, the analysis host rhizobial DNA. In some embodiments, integration into can be performed by culturing the rhizobia, extracting the rhizobial DNA is at a symbiotically-silent locus in the lipid content from the cultured cells, and purifying the lipid genome. A person of ordinary skill in the art will be able to extract and performing analytical chemistry techniques to identify appropriate plasmid vectors available that contain detect the Cs hopanoids (including gas chromatography ing elements to either maintain a C-shopanoid gene expres mass spectrometry and liquid chromatography-mass spec sion cassette in a plasmid, or that contain elements that trometry) (see Example 29). enable integration into a host bacterial genome, including 0156. In some embodiments, detection of Cs hopanoid containing DNA sequences that enable homologous recom can be performed in addition or in the alternative by detect bination into host bacteria DNA, or non-homologous end ing one or more Cs hopanoids synthesis genes. Detection of joining of gene expression cassette DNA into host bacteria Cs hopanoids synthesis genes can be performed by DNA DNA sequencing, PCR probes and/or other nucleotide amplifica 0146 In some embodiments, introduction of Cs tion techniques as will be understood by a skilled person. hopanoid synthesis genes into Cls hopanoid-deficient rhizo 0157 For example, in some embodiments, a method of bia to produce Cs rhizobia mutants can be performed by screening stress-resistant rhizobia strains as biofertilizer can transduction using a recombinant viral vector containing a comprise genetically screening rhizobia strains capable of Cs hopanoid synthesis gene expression construct producing C35 hopanoids. In those embodiments, the 0147 In some embodiments, vectors containing method can comprise providing a plurality of rhizobia hopanoid synthesis genes can be introduced into bacteria, strains, for each rhizobia Strain detecting Cls hopanoid including rhizobia, by a process of transformation, whereby synthesis genes (e.g. by conducting a diagnostic polymerase the bacterial cell wall is transiently opened allowing entry of chain reaction or DNA sequencing methods) in the rhizobia the plasmid DNA into the bacterium. Several methods of strain, and selecting the rhizobia strain with detected Cs transformation can be used, including electroporation, ther hopanoid synthesis genes. mal shock, freeze-thaw techniques (see Examples 25-27). 0158. In method for genetic screening of rhizobia, 0148. In some embodiments, transfer of vectors and in detected presence of Cs hopanoid synthesis genes can be particular plasmide vectors containing Cs hopanoid synthe used as a marker for the ability of particular rhizobia to sis genes into rhizobia can be performed by a process of produce Cls hopanoids (see Example 30). In some embodi conjugation, in which plasmid DNA is transferred from an ments, detecting Diagnostic PCR or DNA sequencing on E. coli bacterial cell into a rhizobium by direct contact (see genomic DNA isolated from rhizobia obtained from soil, Example 23). legume nodules, or other sources can be performed to 0149. In some embodiments, introduction of Cs determine whether Cs hopanoid synthesis genes are present hopanoid synthesis genes into Cs hopanoid-deficient rhizo in a particular sample rhizobial genome. Using available bia to produce genetically engineered C35 rhizobia can be gene sequence information, PCR primers can be designed to performed by transduction using a recombinant viral vector amplify genes in the hopanoid synthesis gene cluster, containing a Cls hopanoid synthesis gene expression con whereby amplification of genes necessary for Cs hopanoid Struct synthesis indicates a rhizobial species genetically capable of 0150. Additional techniques and related vectors methods producing Cls hopanoids. Similarly, DNA sequencing may and systems to modify a nitrogen fixing rhizobia incapable be used to determine whether Cs hopanoid synthesis genes of producing Cs are identifiable by a skilled person. are present in the genome of a sample rhizobium, and 0151. Nitrogen fixing rhizobia capable of producing Cs therefore whether the rhizobium is genetically equipped to naturally or after genetic modifications as herein described synthesize Cls hopanoids. can be identified by Screening methods performed on one or 0159. Additional techniques for detecting Cs hopanoids more candidate rhizobia strains for their ability to produce of and/or Cs hopanoids synthesis genes are identifiable by a Cs hopanoids. skilled person. 0152. In some embodiments, one or more candidate (0160. In some embodiments, biofertilizers, biofertilizer rhizobia Strains can be screened by a method of screening compositions, seed and methods herein described can com US 2017/01 07160 A1 Apr. 20, 2017 prise at least one nitrogen fixing bacteria other than a bacteria forming symbiosis with exemplary leguminous rhizobia (e.g. ar rhizobiales) which is symbiotic with plants and related methods and systems. In particular, in the legumes, is incapable of producing Cls hopanoids (Cs examples described herein, B. diazoefficiens is used as a deficient), and is closely genetically related to (i.e. within a model Strain to study the roles of two hopanoid classes, same taxonomic order of) hopanoids-producing legume 2Me-hopanoids and Cls hopanoids, in Symbiosis with legu rhizobia symbiont capable of producing Cls hopanoids. In minous plants such as Aeschynomene afraspera and Soy those embodiments the at least one nitrogen fixing bacteria bean. other than a rhizobia can be genetically engineered to 0166 A person skilled in the art will appreciate the include shc, hpnH and hpnG, hpnO, as well as hpnP hpnC, applicability and the necessary modifications to adapt the hpnD and/or hpnE and provide a genetically engineered C35 features described in detail in the present section, to addi bacteria that can be used in fertilizers, biofertilizer compo tional hopanoids-producing nitrogen-fixing bacteria, Such as sitions, seed and methods herein described. other related Bradyrhizobium bacteria as described in the 0161 The biofertilizer, biofertilizer composition, seeds, above disclosure capable of forming symbiosis with legu genetically engineered Cls rhizobia and Cls hopanoids minous plants, and related methods and systems according herein described can be provided as a part of systems to to embodiments of the present disclosure. fertilize leguminous plants or soil with suitable methods, including any of the methods described herein. The systems Example 1: Hopanoids from B. diazoefficiens can be provided in the form of kits of parts. In a kit of parts, 0.167 FIG. 1, panel A shows exemplary chemical struc the biofertilizer, biofertilizer composition, seeds and Cs tures of isolated hopanoids from B. diazoefficiens. While hopanoids and other reagents to perform fertilization of the most hopanoids are thought to occur free within membranes, leguminous plant or soil can be comprised in the kit inde the Cs hopanoid, (2-Me) 34-carboxyl-bacteriohopane-32, pendently. The biofertilizer, biofertilizer composition, seeds 33-diol, was found to be covalently attached to LPS lipid A and C35 hopanoids can be included in one or more com in the outer leaflet of the outer membrane (OM), a well positions, and nitrogen fixing rhizobia capable of producing established player in a broad range of host-microbe inter Cs hopanoids can be in a composition together with a actions, to form a compound called Hopanoid-Lipid A suitable vehicle. (HoA) 7, 30 (FIG. 1, panel B). As seen in the expanded 0162. In particular, the components of the kit can be view of the OM, B. diazoefficiens makes short (C) provided, with Suitable instructions and other necessary hopanoids like diploptene and extended (Cs) hopanoids reagents, in order to perform the methods here described. like bacteriohopanetetrol (BHT) and aminotriol. Penta- and The kit will normally contain the compositions in separate hexa-acylated Lipid A contain 5 and 6 fatty acyl chains, containers. Instructions, for example written or audio respectively. Hepta-acylated Lipid A contains the Cs instructions, on paper or electronic Support Such as tapes or hopanoid, 34-carboxyl-bacteriohopane-32,33-diol, cova CD-ROMs, for carrying out the assay, will usually be lently attached to hexa-acylated Lipid A. In addition to Co included in the kit. The kit can also contain, depending on and Cls hopanoids 57, B. diazoefficiens makes tetrahyma the particular method used, other packaged reagents and nol, a triterpenoid with a gammacerane skeleton 31 (FIGS. materials such as buffers and the like. 1 and 2, panel A). 0163. Further details concerning biofertilizers, and Example 2: Synthesis of Hopanoids from B. related seeds compositions methods and system, cells and formulation of the present disclosure will become more diazoefficiens apparent hereinafter from the following detailed disclosure 0168 Cs hopanoids are biosynthesized by a hopanoid of examples by way of illustration only with reference to an biosynthetic gene cluster in some bacteria. For example, in experimental section. B. diazoefficiens, Cs hopanoids can be synthesized by a hopanoid biosynthetic gene cluster shown in FIG. 2, Panel Examples C. In particular, she (squalene hopene cyclase) catalyzes squalene cyclization to hopene, the first reaction in the 0164. The hopanoids, hopanoids-producing nitrogen-fix hopanoid biosynthetic pathway; hpnH catalyzes addition of ing bacteria, and related formulation and methods herein adenosine to hopene, the first reaction in the synthesis of Cs described are further illustrated in the following examples, hopanoids; and hpnP catalyzes C-2 methylation. Detailed which are provided by way of illustration and are not description of the biosynthetic pathway and involved genes intended to be limiting. can be found in Welander 2012 12. 0.165. In particular, the following examples illustrate 0169 Table 2 lists the Cs hopanoid biosynthesis genes exemplary hopanoids, hopanoids-producing nitrogen-fixing and their sequences from R. palustris. TABLE 2 DNA sequences of R. palustris hopanoid biosynthesis genes SEQ Gene ID Name DNA sequence NO hpnC ATGACGTCTGCGAGCGAGCTTCGATCGGGCAAGACCCACCGGGACGAGAATTTC 25 CCGGTCGCGTCGTGGATCATCCATCCGCGGCATCGCGACCTGATTCTGGCGTTCT ACAATTTCGTCCGGACCGCGGACGACATCGCCGATCACGAGATGCTCGATGGCG ACACCAAGCTCGAATATCTCGATCTGCTCGAAGCCGAGCTGCTCGGCCGCGGCG AGACCCAGCCCGAGGCGGTGCATCTGCGTCGGGCGCTGGCCGAACGCGGCATGC CGCCGCGCCATGCGCTCGATCTGCTGACCGCGTTTCGGATGGACGTCACCAAGCT GCGCTACGAGGATTGGGACGAGGTCATTCACTACTGCCGCTACTCGGCGATGCCG GTTGGCCGCTTCATGCTCGACGTCCACGGCGAAAGCACCACGACCTGGCAGGCCT US 2017/01 07160 A1 Apr. 20, 2017 22 incubated at 30° C. with shaking at 250 rpm for aerobic growth in non-selective medium and segregants were cultures and 60 rpm for microaerobic cultures, unless indi obtained by 5% sucrose selection. Potential mutants were cated otherwise. Antibiotics were used for selection at these screened by PCR and verified by sequencing. Deletion of concentrations (ug/ml): spectinomycin, 100; kanamycin shc (hpnF) and the hpnCDEFG (FIG. 2B) operon using (Kim), 100; tetracycline (Tc), 50. pK18mobsacB- and pSUP202pol4-based plasmids (Table 3) were attempted. For the latter, a 1.2 Kb Km resistance Example 4: Sequence Analysis cassette from pl3SL86 was sub-cloned between ~1 Kb 0171 The Integrated Microbial Genome (IMG) system upstream and downstream regions of the genes in (https://img.jgi.doe.gov/cgi-bin/w/main.cgi) was used to pSUP202pol4. Following selection of deletion plasmids access DNA and protein sequences, identify orthologs and with Kim resistance, potential Kim resistant and Tc sensitive assess genomic context of genes 33. mutants were screened by PCR. It was unable to isolate an shc mutant with either methods in PSY at 30° C. or room Example 5: Mutant Construction temperature (23-25° C.) with and without 100 uM choles 0172 Fusion PCR products of ~1 Kb upstream and terol or diplopterol as Supplements. Counterselection of Shc downstream regions of genes of interest were cloned into deletion plasmid segregants at lower Sucrose concentrations pK18mobsacB to obtain deletion plasmids that were mobi (1-4%) were also carried out, but the mutant was still not lized into WT and selected using Kim resistance (Table 3). obtained. Tables 3 and 4 list the strains, plasmids and Subsequently, the plasmid integrants were resolved by primers used in constructing the mutants. TABLE 3 Strains and plasmids Source Strain or plasmid Genotype, description and construction or US Strains E. Coi DH10B F endA1 recA1 galE15 galK16 nupG rpsL AlacX74 d80laczAM15 (34) arad139 A(ara, leu)7697 mcra A(mirr-hsdRMS-mcrBC) : DKN89 E. Coi S17-1 thi pro hdsRhdsM" recA; chromosomal insertion of RP4-2 (Tc::Mu 35 Km::Tn7); DKN1 DKN1391 B. japonicum 110spc4, Sp, WT 36 DKN1386 B. japonicum 110spc4 AhpnP; deletion of blr2995 in DKN1391 This study using pCK247 DKN1529 B. japonicum 110spc4 AhpnH; deletion of blr3006 in DKN1391 This study using pCK255 Plasmids pK18mobsacB Kim mobilizable plJC18 derivative, mob, sacB (DKN1387) 37) pSUP202pol4 TcpSUP202 part of the polylinker subcloned into pBluescript II 38 KS (+) using EcoRI and PstI sites (DKN1390) BSL86 Ap, Km (DKN1388) 39 GK259 shc deletion vector; HindIIIPstI-digested blr3004 (shc) upstream This study and downstream fusion PCR product amplified using primers shcupfor, sheuprevfusion-new, shednforfusion-new and Shcclnrev was ligated to HindIIIPst-digested pK18mobsacB (DKN1492) GK248 NotIXbal-digested she upstream PCR product amplified using This study primers pSUPshcupfor and pSUPshcuprev was ligated to NotI/Xbal-digested pSUP202.pol.4 (DKN1421) GK262 Xbal/PstI-digested she downstream PCR product amplified using This study primers pSUPshcdnfor-new and pSUPshcdnirev was ligated to Xbal/PstI-digested pCK248 GK263 shc deletion vector; 1.2 Kb Km cassette from Xbal-digested This study pBSL86 sub-cloned into Xbal-digested pCK262 (DKN1430) GK268 hpnCDEFG deletion vector; blr3001 (hpnC) upstream and blr3005 This study (hpnG) downstream PCR products amplified using primers hpnCupforw?pK18fusion, hpnCuorevw?hpnGfusion and hpnGdnforw/hpnCfusion, hpnGdnrevw?pK18fusion were Gibson cloned into Xbal/PstI-cut pK18mobsacB (DKN1604) pGK269 NotIXbal-digested hpnC upstream PCR product amplified using This study primers hpnCupfor and hpnCuprev was ligated to NotIXbal digested pSUP202.pol.4 (DKN1605) pGK270 Xbal/PstI-digested hpnG downstream PCR product amplified using This study primers hpnGdnfor and hpnGdnirev was ligated to Xbal/PstI digested pCK269 (DKN1606) pGK276 hpnCDEFG deletion vector; 1.2 Kb Km cassette from Xbal- This study digested pBSL86 sub-cloned into Xbal-digested pGK270 (DKN1609) pGK247 hpnP deletion vector; BamHIPstI-digested hpnP upstream and This study downstream fusion PCR product amplified using primers hpnPupfor, hpnPuprevfusion, hpnPdnforfusion and hpnPdnirev was igated to BamHIVPstI-digested pK18mobsacB (DKN1395) US 2017/01 07160 A1 Apr. 20, 2017 23 TABLE 3-continued Strains and plasmids Source Strain or plasmid Genotype, description and construction or US pGK255 hpnH deletion vector; HindIIIPst-digested hpnH upstream and This study downstream fusion PCR product amplified using primers hpnHupfor, hpnHuprevifusion, hpnHanforfusion and hpnHanrev was ligated to HindIIIPstI-digested pK18mobsacB (DKN1482) Km, Kanamycin; Sp, Spectinomycin underlined sequence 1. Casadaban, M. J., and Cohen, S. N. 1980. Analysis of gene control signals by DNA fusion and cloning in Escherichia coi, J Mol Biol 138; 179-207. 2. Simon, R., Priefer, U., and Puhler, A. 1983. A broad host range mobilization system for in vivo genetic engineering - transposon mutagenesis in Gram negative bacteria. Bio-Technol 1: 784-791. 3. Regensburger, B., and Hennecke, H. 1983. RNA polymerase from Rhizobium japonicum, Arch Microbiol 135: 103-109. 4. Schafer, A., Tauch, A., Jager, W., Kalinowski, J., Thierbach, G., and Puhler, A. 1994. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19; selection of defined deletions in the chromosome of Corynebacterium glutamicum, Gene 145: 69-73. 5. Fischer, H. M., Babst, M., Kaspar, T., Acuna, G., Arigoni, F., and Hennecke, H. 1993. One member of a groESL-like chaperonin multigene family in Bradyrhizobium japonicum is co-regulated with symbiotic nitrogen fixation genes, The EMBO journal 12: 2901-2912. 6. Lindemann, A., Koch, M., Pessi, G., Muller, A. J., Balsiger, S., Hennecke, H., and Fischer, H. M. 2010. Host-specific symbiotic requirement of BdeAB, a RegR-controlled RND-type efflux system in Bradyrhizobium japonicum, FEMS microbiology letters 312: 184-191. TABLE 4 Primers SEQ ID Primers Sequences Source NO Shcupfor TATCTAGAAAGCTTGCAGTTTCCCTTCGTCGATA HindIII 1. shcuprevifusion ACCATGATACCGTAGATAGAATACACGGGGCATCTGGCT eW CGATTACTCCGATAGTTAATT shconforfusion AATTAACTATCGGAGTAATCGAGCCAGATGCCCCGTGTAT eW TCTATCTACGGTATCATGGT Shcc.nrew TATCTAGACTGCAGAGCAGGTCCAGAAGAAGCTC PSt. pSUPshcupfor TATATATAGCGGCCGCGCAGTTTCCCTTCGTCGATA Not pSUPshcuprev TATATATATCTAGACATCTGGCTCGATTACTCCGATAGTT Xoal AATT pSUPshcdnfor TATATATATCTAGACCCCGTGTATTCTATCTACGGTATCAT Xoal eW GG pSUPshcdnrev TATATATACTGCAGAGCAGGTCCAGAAGAAGCTC PSt. hpnCup forw/pK18 TTCGAGCTCGGTACCCGGGGATCCTCTAGAGTGGAACCGT fusion CGGACAGC hpnCuprevw/hpnG TTGTCAGATCGAGACGCTCACTGGTTTACAATCGTTTGGA fusion CAGGAAGAGC hpngdnforw/hpnC GCTCTTCCTGTCCAAACGATTGTAAACCAGTGAGCGTCTC fusion GATCTGACAA hpngdnrevw/pK18 ACGGCCAGTGCCAAGCTTGCATGCCTGCAGGCTGATCCAC fusion AAGGAGATCG hpnCup for TATATATAGCGGCCGCGTGGAACCGTCGGACAGC Not hpnCuprev TATATATATCTAGACTGGTTTACAATCGTTTGGACAGGAA Xoal GAGC hpngdnfor TATATATATCTAGATGAGCGTCTCGATCTGACAA Xoal hpngdnrev TATATATACTGCAGGCTGATCCACAAGGAGATCG PSt. US 2017/01 07160 A1 Apr. 20, 2017 TABLE 4 - continued Primers SEQ ID Primers Sequences Source NO hpnPupfor TATCTAGACTGCAGAACACCATCGGGCTGAAG PSt. 17 hpnPuprevifusion GGAAGCCTCGCGCAGCCGGATCGAATAGTTCATAGCGTA 18 ATGCTGTCGCCGGAATTTCTC hpnPdnforfusion GAGAAATTCCGGCGACAGCATTACGCTATGAACTATTCGA 19 TCCGGCTGCGCGAGGCTTCC hpnPdnrev TATCTAGAGGATCCTTTTCGAGCATGCCTTATCC BamHI 2O hpnHupfor TATCTAGAAAGCTTAACTTTGAAGCGGATTGGTG HindIII 21 hpnHuprevifusion TTTTTGTTCGTGGTGCTGTTTCTCGCCTTACATTACACGTT 22 TCTTTCTGGGCTTGAAATT hpnHanforfusion AATTTCAAGCCCAGAAAGAAACGTGTAATGTAAGGCGAG 23 AAACAGCACCACGAACAAAAA hpnHanrev TATCTAGACTGCAGCCTGATTGCAACACAGAACG PSt. 24 Example 6: Hopanoid Analysis TABLE 5 0173 Triplicate cultures of B. diazoefficiens strains were Compounds identified by high temperature GC-MS grown till saturation in aerobic (100 ml PSY in 500 ml Rt flasks) and microaerobic (25 ml PSY in 500 ml Wheaton Compound (min) Diagnostic ions (m/z) bottles) growth media. They were centrifuged at 5000xg for Pregnane-acetate (I) 15.93 358, 298, 283, 255, 145, 105, 79 20 min at 4° C. and frozen at -80° C. until extraction. Cell 2-Methylhop-17(21)-ene 17.37 424, 381,245, 205, 161, 135 pellets were suspended in 2 ml water and transferred to Hop-17(21)-ene (II) 17.51 410, 367, 231, 191, 161, 135 Teflon centrifuge tubes (VWR. Bridgeport, N.J.), followed 2-Methylhop-X-ene 19.30 424, 409, 281, 205, 189,95 Hop-X-ene (III) 19.49 410, 395, 243, 203, 191, 189,95 by addition of 5 ml methanol (MeOH) and 2.5 ml dichlo 2-Methylhop-22(29)-ene 20.27 424, 313, 205, 189,95 romethane (DCM) and sonicated for 15 min at room tem Hop-22(29)-ene 20.47 410, 299, 191, 189,95 perature (VWR B2500A-DTH: 42-kHz radio frequency (Diploptene, IV) power, 85 W). Samples were centrifuged at 7000xg for 10 2-Methylhop-21-ene 20.33 424, 381, 355, 245, 205, 189, 121 min at 22°C. and the supernatants transferred to new tubes. Hop-21-ene (V) 20.52 410, 367, 341, 231, 191, 189, 121 2-Methylhopan-22-ol 23.84 442, 409, 205, 189, 149, 95 Cell pellets obtained from aerobically-grown cultures were Hopan-22-ol (Diplopterol, 24.05 428, 395, 191, 189, 149, 95 Sonicated again, centrifuged, and the Supernatants combined VI) with the first extraction. The samples were separated into 2-Methyltetrahymanol 24.84 484, 424, 249, 205, 189,83 two phases by adding 7.5-13 ml DCM and centrifuged at 20-Methyltetrahymanol 24.84 424, 409, 249, 6000xg for 10 min at 22° C. The organic phase was Tetrahymanol (VII) 25.09 470, 410, 249, 91, 189, 69 BHP-508 (VIII) 34.78 508, 493, 369,287, 213, 191, 111 transferred to a new vial and evaporated in a chemical hood 2-Methylbacteriohopanetetrol 38.11 728, 669, 493,383, 205, 95 overnight. The total lipid extract (TLE) was resuspended in Bacteriohopanetetrol 38.44 714, 655, 493, 369, 191, 95 DCM at a concentration of 1 mg/ml. 100 ul of this extract was combined with 1 ul of an internal standard (500 ng/ul pregnane-acetate 40) and evaporated at 60° C. The TLE TABLE 6 was derivatized to acetate esters by incubation in 100 ul 1:1 acetic anhydride/pyridine for 30 min at 60° C. and then Compounds identified by ultra performance LC-MS analyzed by gas chromatography/mass spectrometry (GC Compound Rt (min) miz Ion MS). Peak areas of hopanoid species were integrated and Aminobacteriohopanetriol 4.34 546.487 M + H' compared to those from pregnane-acetate standards to obtain (aminotriol, a) the yields from TLE 41. 2- 4.76 560.504 M + H" Methylaminobacteriohopanetriol 0.174 For liquid chromatography/mass spectrometry (c) (LC-MS), 100 ul 1 mg/ml TLE was evaporated under Bacteriohopanetetrol (BHT) S.66 529.462 (M - HO + H" nitrogen, dissolved in isopropanol-acetonitrile-water (2:1:1) Bacteriohopanetetrol (b) S.66 569.454 M - Nal Adenosylhopane (d) 5.94 662.501 M + H" or DCM-MeOH (9:1) and then analyzed 26. Hopanoid 2-Methylbacteriohopanetetrol 6.22 543.478 M - HO + H" peaks were identified by comparison of retention times and 2-Methylbacteriohopanetetrol (e) 6.2O 583.470 IM - Na)" mass spectra to those of Rhodopseudomonas palustris TIE-1 (Tables 5 and 6) 26, 41. US 2017/01 07160 A1 Apr. 20, 2017 Example 7: Lipid a Analysis diazoefficiens strains were washed once with 4-(2-hydroxy ethyl)-1-piperazineethanesulfonic acid (HEPES) buffer (50 0175 Bacterial cells were extracted using the phenol/ mM HEPES, 50 mM sodium chloride (NaCl), pH 7.0) and water method 42 and after extensive dialyses, the extracted then resuspended in the same to an ODou0.2 with 7.36 uM phases were subjected to enzymatic digestion with DNases, of the fluorophore diphenyl hexatriene (DPH). Prior to RNases and proteases in order to remove nucleic acids and protein contaminants and recovered by ultracentrifugation measurement of fluorescence polarization, samples were (100 000xg, 4° C., 24 h). Water phases were analysed incubated in a 25°C. or 40°C. water bath in dark for 30 min. through 13.5% SDS-PAGE: the lipopolysaccharide (LPS) Three biological replicates were measured, each containing fraction was exclusively found in water phase as Suggested 8 technical replicates. by the presence of the typical ladder in its migration pattern Example 9: CRYO-TEM (Transmission Electron in the gel. The LPS material was further purified by a second Microscopy extraction with phenol/chloroform (CHCl)/petroleum methods to get rid of glucan contaminants, and LPS frac 0180 PSY-grown aerobic cultures at an ODoo of 1 were tions were further purified by size filtration chromatography concentrated 5 times and frozen in a Vitrobot MkIV (FEI, (Sephacryl S-400 HR in 50 mM ammonium carbonate Hillsboro, Oreg.) as described previously 47, 48. In brief, (NHCO) from GE Healthcare). 2 ul of a 10 nm colloidal gold (Sigma Aldrich, St. Louis, (0176 LPS sugar content was determined by GLC-MS Mo.) in 5% Bovine serum albumin (BSA) was added to 8 ul analysis of acetylated O-methyl derivatives. Methanolic of culture. 3 ul of this suspension was placed onto a glow hydrochloric acid (HCl) was added to dried LPS and incu discharged carbon-coated R 2/2 Quantifoil copper-finder bated at 85° C. for 16 h, the sample was subsequently grid in the Vitrobot maintained at 22.5° C. with 95% acetylated with pyridine and AcO, 85° C. 20 min and humidity. This was followed by a 3 s blot with a pressure of analysed by GLC-MS 43. Linkage analysis was carried out 6 atm, a drain time of 1 sec, and plunge freezing in a mixture by methylation analysis. The sample was hydrolyzed with 4 of liquid ethane (63%) and propane (37%). The frozen grids M trifluoroacetic acid (100° C., 4 h), carbonyl-reduced with were then stored in liquid nitrogen until further use. Grids sodium borodeuteride (NaBD), carboxy-methylated, car were imaged in Tecnai TEM 120 KeV (FEI, Hillsboro, boxyl-reduced, acetylated and analysed by GLC-MS 44. Oreg.) at -178°C. using a Gatan 626 cryoholder and Gatan Total fatty acid content was obtained by acid hydrolysis. 2x2K CCD. Images were acquired with Digital Micrograph LPS was first treated with 4M HCl (4 h, 100° C.) and then at 15,000x magnification 49, 50. with 5M sodium hydroxide (NaOH, 30 min, 100° C.). Fatty acids were then extracted in CHCl, methylated with diaz Example 10: Growth Curves and Stress Assays omethane and analysed by GLC-MS. The ester bound fatty acids were selectively released by base-catalysed hydrolysis 0181. To monitor growth in different media, triplicate with 0.5M NaOH/MeOH (1:1 v/v, 85° C., 2 h), then the cultures were inoculated at 10° dilution using aerobic product was acidified, extracted in CHCl, methylated with PSY-grown log-phase (ODoo-0.5-0.7) WT or mutant diazomethane and analysed by GLC-MS 45. strains. Growth was measured at ODoo using a Spectronic (0177. In order to obtain lipid A. LPS was dissolved in 20D+(Thermo Scientific) or a Beckman Coulter spectropho acetate buffer (pH 4.4), and was hydrolyzed for 5 h at 100° tometer for microaerobic medium. Unless otherwise indi C. Then, adequate amounts of CHCl and MeOH were cated, the incubation temperature was 30° C. Growth curves added to the hydrolysate to obtain CHCl/MeOH/hydroly were performed in triplicates at least twice independently. sate 2:2:1.8 (V/v/v), and the mixture was vigorously shaken, 0182 Sensitivity to high temperature (37°C.) and low or then centrifuged 46. The lipid A-containing CHCl phases high pH was measured by monitoring growth in PSY at were collected and washed twice with the water phase from ODoo using Spectronic 20D+. Acidic (pH-6) and alkaline a freshly prepared two-phase Bligh-Dyer mixture (CHCl/ (pH-8) media were prepared by buffering PSY with 100 MeOH/water, 2:2:1.8 (v/v/v). mM MES (4-Morpholineethanesulfonic acid) and 100 mM (0178 For MALDITOF MS, a 4800 Proteomic Analyzer bicine (N,N-Bis(2-hydroxyethyl)glycine) or BIS-TRIS Pro (ABSciex), MALDI TOF/TOF instrument equipped with a pane, respectively. It was unable to collect a growth curve at Nd:YAG laser at a wavelength of 355 nm with <500-ps pulse pH-8 because this was outside the WT growth range. and 200-Hz firing rate was employed. External calibration Growth curves were performed in triplicates at least twice was performed using an ABSciex calibration mixture. All independently. measurements were performed in positive polarity. Approxi 0183 Growth in the presence of osmotic and membrane mately, 1500 laser shots were accumulated for each spec stresses was measured using gradient plates. To prepare trum in the MS experiments. Samples were dissolved in these, 25 ml of 50 mM 3-(N-morpholino)propanesulfonic CHCl/MeOH (50:50, v/v) at a concentration of 1 mg/ml. acid (MOPS)-buffered PSYagar (pH=7) with 50 mM. NaCl, Matrix solution was prepared by dissolving trihydroxyac 500 mM inositol, 0.4% bile salts (BS, Himedia, Mumbai, etophenone (THAP) in MeOH/0.1% trifluoroacetic acid/ India) or 1 mMethylenediaminetetraacetic acid (EDTA) was acetonitrile (7:2:1, by volume) at a concentration of 75 poured in a slightly tilted square grid plate (Fisher, Pa.). The mg/ml. 1 ul of the sample/matrix Solution (1:1, V/v) was solidified plate was topped with 25 ml PSY-MOPS agar. deposited onto the well plate and allowed to dry at room Control plates contained 50 ml PSY-MOPS agar. 5 ul of temperature. aerobic PSY-grown log-phase cultures at 10" dilution were spotted on the plates. To assess stationary-phase stress, Example 8: Membrane Rigidity saturated instead of log-phase cultures were used for plating. The plates were incubated at 30° C. for 5-7 days. Spotting 0179 For whole cell membrane rigidity measurements, assays were performed in duplicates at least two indepen as described in 8. PSY-grown aerobic cultures of B. dent times. US 2017/01 07160 A1 Apr. 20, 2017 26 0184 Disk diffusion assays were used to quantify growth scopic observations were performed for each of the 3 plant under oxidative, acidic and detergent stresses. For this, 4 experiments, except for the TEM observations which were day-old cultures of B. diazoefficiens Strains grown in yeast only done once. Semi thin nodule sections (30-40 um) were extract-mannitol (YM) medium were washed and adjusted prepared using a vibratome (VT1000S. Leica, Nanterre, to an ODoo of 1.2 ml bacterial Suspensions were then France). Immediately after slicing, the sections were incu mixed with 100 ml of 42° C. pre-warmed YM soft agar bated for 20 min in live/dead staining solution (5uMSYTO (0.8% agar) and 5 ml portions of this mixture were poured 9 and 30 uM propidium iodide (PI) in 50 mM Tris pH 7.0 on solid Y.M. Filter disks were placed at the center of the buffer; Live/Dead BacLight, Invitrogen). Sections were then plates, and 5ul of 5.5 MHO, 2 M HCl or SDS (10% w/v), removed and incubated an additional 15 min in 10 mM were deposited on the disks. The diameters of growth phosphate saline buffer (PBS) containing calcofluor white inhibition areas were measured after incubation at 30° C. for M2R (Sigma, Munich) to a final concentration of 0.01% 5 days. (w/v) to stain the plant cell wall 53. After washing with PBS, the sections were mounted on microscope slides in Example 11: MIC Determination PBS containing glycerol at a final concentration of 50% 0185. The MIC of polymyxin B was determined by the (v/v). Analyses were carried out using a confocal laser E-test method using disk diffusion assay as described above. scanning microscope (Carl Zeiss LSM 700; Jena, Germany). Strips containing a gradient of polymyxin B ranging from Calcofluor was excited at 405 nm with emission signal 0.064-1024 ug/mL (Biomérieux, Marcy-l'étoile, France) collection at 405 to 470 nm. For SYTO 9 and PI, an were placed in the center of plates, which were incubated at excitation wavelength of 488 nm and 555 nm was used with 30° C. for 7 days before recording the results. The experi emission signal collection at 490 to 522 nm and 555 to 700 ment was done in triplicates. nm, respectively. Images were obtained using the ZEN 2008 0186. The effect of the NCR335 peptide on cell viability software (Zeiss). was determined by spot assays. YM-grown exponential (0191) For TEM of the nodules, the samples were fixed in phase cultures were washed three times in 10 mM potassium a 4% glutaraldehyde, 0.1 M cacodylate buffer (pH 7.2). phosphate buffer pH 7.0, diluted to an ODoo of 0.01, and postfixed in 1% osmium tetroXyde, dehydrated using a series treated with 6 uM NCR335 for 24 h at 30° C. Samples were of acetone washes, and embedded in TAAB 812 epon resin. serially diluted in YM medium, and 5 ul aliquots of each Ultrathin sections (60 nm) were mounted on collodion dilution were spotted in duplicate on YMagar. CFU/ml were carbon-coated copper grids, contrasted using uranyl acetate determined after 7 days at 30° C. The experiment was and lead citrate, and examined at 80 kV with a TEM (Jeol performed in triplicates. 100CX II). Example 12: Plant Cultivation and Symbiotic Example 14: Elimination of Shc in B. diazoefficiens Analysis 0.192 To eliminate hopanoid production in B. diazoeffi 0187 A. afraspera seeds were surface sterilized by ciens, and to test whether a requirement for hopanoids in immersion in Sulfuric acid for 45 minutes with shaking, efficient symbiosis is conserved between B. diazoefficiens followed by thorough washing in sterile distilled water and and Bradyrhizobium BTAi1, deletion of the gene encoding incubation in the same overnight. The seeds were germi the enzyme catalyzing the first step in hopanoid biosynthe nated by transferring to 0.8% agar plates for 2 days at 37° sis, squalene hopene cyclase (Shc) (FIG. 2B) was carried C. in dark. Subsequently, plantlets were rooted in buffered out. A Ashc mutant was isolated using either the nodulation medium (BNM)-filled test tubes, which were pK18mobsacB-based markerless gene deletion method covered with aluminum foil for hydroponic culturing 51. (~400 colonies screened) or the gene replacement strategy Plants were grown in a 28°C. growth chamber with a 16 h with pSUP202pol4 (1200 colonies screened) 54). No we light and 8 h dark cycle and 70% humidity. Seven days after were NOT able to isolate this mutant. We don't have anshc transfer, each seedling was inoculated with a 1 ml cell deletion for B. diazoefficiens. Suspension from a 5 day-old bacterial culture washed in 0193 This suggests that Shc may be essential either BNM and adjusted to reach an ODoo of 1. because hopanoids are required for growth and Survival of B. 0188 Soybean (Glycine max Williams 82) seeds were diazoefficiens or because squalene, the Substrate of Shc 11. cleaned with 100% ethanol for 30 seconds and sterilized accumulates to toxic levels within Ashc. To rule out the latter with 1% bleach for 5 min. After several washes with sterile possibility, deletion of the entire operon encoding squalene distilled water, seeds were germinated on tap-water agar synthesizing enzymes (hpnCDE), she (hpnF) and hpnG plates at 28°C. for 3 days. Seedlings were then transferred (catalyzes second step in the synthesis of Cs hopanoids) to magenta boxes filled with BNM, inoculated and grown 12 was carried out. The AhpnCDEFG mutant (~150 colo hydroponically as described above for Aeschynomene nies screened) (FIG. 2B) was unable to obtain. These results plants. Plants were watered with BNM medium. Suggest that hopanoid synthesis is essential for the Survival 0189 Infection assays were carried out three independent of B. diazoefficiens under the conditions used to select the times with 7 and 10 plants for soybean and A. afraspera, mutantS. respectively. At 21 d.p. i., plants were analyzed for the number of nodules and nitrogenase activity as previously Example 15. B. diazoefficiens AhpnP and AhpnH described 52. Mutants 0194 To eliminate synthesis of 2Me- or Cs hopanoids Example 13: Cytological Analyses and Microscopy specifically, genes predicted to encode the C-2 methylase, 0190. Cytological analyses were done on 5-10 nodules hpnP55 or the first enzyme catalyzing the extension of Cso originating from 3 different plants for each condition; micro hopanoids, hpnH 12 (FIG. 2B) were deleted. US 2017/01 07160 A1 Apr. 20, 2017 27 0.195 As illustrated in FIG. 2C, no methylated hopanoids tain membrane rigidity at 37°C., but are dispensable at 30° were detected in AhpnPTLE using gas chromatography C. It is important to note that the phenotypic defect of mass spectrometry (GC-MS) and liquid chromatography AhpnH could be either due to the absence of Cs hopanoids mass spectrometry (LC-MS) (Tables S1 and S2) 26, 41. or the lack of downstream products, such as HoDA, and even AhpnH does not make any detectable Cs hopanoids, includ accumulation of the HpnH Substrate diploptene, or a com ing aminotriol (a,c), BHP-508 (VIII, degradation product of bination of these factors. aminotriol), bacteriohopanetetrol (b, e) and adenosylhopane (d). In addition, AhpnH accumulates a 6-fold excess of the Example 18: Stress Tolerance Tests of B. HpnH substrate 12, diploptene (IV, WT 18+2 g/mg diazoefficiens AhpnP and AhpnH Mutants TLE, AhpnP 29+6 g/mg TLE, AhpnH-111+3 g/mg 0201 Hopanoids have been shown to contribute to stress TLE). tolerance in diverse organisms 7, 9-11. It is speculated that 0196. The presence of HoDA in the mutants using Such protection would also be seen in B. diazoefficiens. To MALDI-MS (FIG. 4) was also analyzed. WT and AhpnP test this hypothesis, AhpnP and AhpnH were challenged with lipid A are composed of a mixture of penta- to hepta a variety of stressors that are relevant during the initiation acylated species, whereas AhpnH lipidA is mainly hexa and progression of symbiosis, such as hypoxia, acidic pH, acylated (FIG. 1B). In WT and AhpnP hepta-acylated spe high osmolarity, reactive oxygen species and peptide anti cies, a C-shopanediolic acid is ester-linked to hexa-acylated biotics 1, 56. lipid A, and traces of a second hopanoid Substitution are also 0202 Under hypoxic conditions with 0.5% oxygen, detected; conversely, AhpnH is missing any lipid A-bound AhpnP is unable to attain growth yields as high as WT and hopanoids. Not only do the results confirm the proposed AhpnH fails to grow (FIG. 7C). This indicates that in the roles of HpnP and Hpnh, they also show that synthesis of free-living state 2Me-hopanoids contribute to microaerobic Cs hopanoids is required for Ho A production. growth and Cs hopanoids are essential. 0203 Using GC-MS, the abundance of these hopanoid Example 16: Hopanoids Contribute to Outer types in the WT (Table 7) was determined. The amount of Membrane Rigidity 2Me-hopanoids dramatically increased from 33+2% TLE 0.197 A fluorescence polarization method was employed under oxic conditions to 77+2% TLE under hypoxic condi by incubating the dye diphenyl hexatriene (DPH) with tions. This is consistent with hopanoid methylation being whole cells to determine whether 2Me- and Cs hopanoids important to sustain WT-levels of microaerobic growth. The affect the rigidity of B. diazoefficiens membranes at 25°C. only C hopanoid detectable by GC-MS, BHP-508, and 40°C. (FIG. 5). Because previous studies of whole cells increased in abundance from 3+1% TLE for cells grown of different R. palustris hopanoid mutants indicated that the aerobically to 21+1% TLE when grown microaerobically, in majority of DPH gets incorporated in the OM, whole cell agreement with a microaerobic growth defect for AhpnH. polarization values was interpreted to reflect the rigidity of the OM 8, 26. TABLE 7 0198 Membranes of all strains were less rigid at higher Hopanoid and tetrahymanol quantification by GC-MS using pregnane temperature. The AhpnP membrane was as rigid as the WT acetate as standard membrane at both temperatures, whereas the AhpnH mem brane was less rigid. Thus, Cs hopanoids are important for Growth % Total hopanoids maintaining membrane rigidity in B. diazoefficiens in vivo, condition Strain C3o Tetrahymanol C35 %2Me in contrast to R. palustris, where the AhpnH membrane showed similar rigidity to the WT, despite the capacity of Aerobic WT 69 - 1 28 - 1 3 - 1 33 2 (PSY) AhpnP 72 6 23 4 5 - 2 O Cs hopanoids to enhance rigidity in vitro 8. This indicates AhpnH 94 - O 6 - O O 11 - 0.2 that the fraction of Cs hopanoids or Hol A in the OM may Microaerobic WT 34 - 2 46 - 4 21 1 77 - 2 be greater in B. diazoefficiens than R. palustris. Despite the AhpnP 61 - 1 34 O.3 6 - 1 O lack of Cs hopanoids, the AhpnH membrane is morpho AhpnH NG NG NG NG logically indistinguishable from the WT membrane, as seen Total hopanoids = methylated and unmethylated versions of C30 hopanoids (compounds in whole cell cryo-transmission electron microscopy (TEM) II, III, IV, V, VI) + tetrahymanol (VII) and C35 hopanoids (VIII) (refer to table 5 for compound names), micrographs (FIG. 6). %2Me = ratio of methylated to total hopanoids NG, no growth Example 17: Aerobic Growth of B. diazoefficiens WT, AhpnP and AhpnH Mutants 0204 Under acidic conditions (pH-6), AhpnH is unable to grow (FIG. 7D). AhpnH is also more prone to stationary 0199 To address the question whether a less rigid mem phase stress, osmotic stressors (NaCl and inositol) and brane affect the fitness of AhpnH at different temperatures, membrane destabilizers (bile salts and ethylenediaminetet aerobic growth of AhpnH at 30° C. and 37° C. were raacetic acid, EDTA (12) than WT, as evidenced by a compared with WT and AhpnP (FIGS. 7A and B). AhpnP reduction in AhpnH growth on stressor gradient plates (FIG. grows like WT at both temperatures, whereas AhpnH grows 7E). slower at 30° C. and is unable to grow at 37° C. 0205 Additionally, disc diffusion assays showed that 0200. These results suggest that Cs hopanoids are impor AhpnH is more sensitive to oxidative (hydrogen peroxide tant for growth at ambient temperature (30°C.) and essential (HO)), detergent (SDS) and acidic (hydrochloric acid for growth at higher temperature (37° C.). As shown in our (HCl)) stresses than WT (FIG. 7F). whole cell membrane fluidity measurements, the higher the 0206 Because B. diazoefficiens is exposed to NCRs in A. temperature, the less rigid the membrane. This might be the afraspera, the sensitivity of AhpnH to two antimicrobial reason why Cls hopanoids are absolutely required to main peptides, polymyxin B 57 and NCR335 from the legume US 2017/01 07160 A1 Apr. 20, 2017 28 Medicago truncatula 158 was also tested. AhpnH displayed were rarely observed in WT and AhpnP nodules (FIG. 90). a 10-fold lower MIC (48 ug/ml) for polymyxin B than WT Starch accumulation is indicative of an imbalance between (512 ug/ml). In addition, AhpnH was found to be 100-fold the photosynthates furnished by the plant and the ability of more susceptible than WT to NCR335 (FIG. 7G). AhpnP the bacteria to metabolize them, a typical feature of non withstood all of the aforementioned stressors as well as the fixing or underperforming strains I60, 61. WT, with the exception of acidic stress, where it grew slower 0211 To determine whether AhpnH symbiotic defects than WT. stem from a problem in the bacterial differentiation process or are due to a damaged membrane, nodule sections were Example 19: Css Hopanoids are Required to examined by confocal microscopy using live-dead staining Establish an Efficient Symbiosis with A. Afraspera 62 and TEM to analyze the ultrastructure of bacteroids. and with Soybean Confocal microscopy revealed that all strains, including 0207 Because hopanoids are required for microaerobic AhpnH, differentiated properly into elongated bacteroids, growth and stress tolerance in the free-living state, it is which were, for the majority, viable, as indicated by the hypothesized that they would aid survival within the plant green Syto9 staining (FIG. 9, panels P-U). However, TEM microenvironment. To test this, the symbiotic phenotypes of analysis showed that the cell envelope of some AhpnH AhpnP and AhpnH on two host plants, soybean and A. bacteroids was not well delineated and in a few cases, even afraspera were analyzed. broken (FIG.9, panels Y-Z). Similar damage was seen in the peribacteroid membrane that surrounds bacteroids. Deposits 0208 FIG. 8 shows the symbiotic phenotypes of AhpnP of cellular material, possibly resulting from the release of and AhpnH on Soybean. On soybean, at 21 days post plant or bacterial cytoplasm, were also observed in the inoculation (d.p. i.), both mutants induced fewer nodules and peribacteroid space, suggesting a beginning of senescence or displayed reduced nitrogenase activity as estimated by the perhaps necrosis of symbiotic bacterial cells (FIG. 9, panels acetylene reduction assay (ARA) relative to WT (FIG. 8, Z, Z). Such defects were not observed in the WT (FIG. 9, panels A-C). The ARA data shown in FIG. 8, panel B has a panels V-X) or AhpnP nodules. unit of umol. h". g' per plant as a result of normalization 0212 Taken together, the data indicate that under these per gram. As further described with respect to FIG. 11, conditions Cs hopanoids, but not 2Me-hopanoids, play an panels (b) and (d), the N-fixation deficit of AhpnH is due to important role in facilitating the fitness of B. diazoefficiens the reduction in nodule mass and the normalization of ARA in Symbiosis with A. afraspera and Soybean. rates by nodule dry weight eliminates the N-fixation rate 0213 Two reasons the plant host mounts an immune difference between wild type and AhpnH (see FIG. 11, panel response against AhpnH may be that the altered mutant d, upper graph V.S. FIG. 11, panel b, lower-right graph). Surface layer, as seen in TEM images, is unable to suppress Therefore, one would expect that if the ARA data of FIG. 8, this response 63 and/or the host induces nodule senescence panel B is not normalized per gram, the differences between pre-maturely on detecting an under-productive symbiont the WT and AhpnH mutant would be expected to be more statistically significant. Thus, under the conditions of these 64. Consistent with this, nitrogenase activity is reduced in assays, hpnH mutation appears to have a symbiotic effect on AhpnH relative to WT, a likely consequence of poor cell the host plants when B. diazoefficiens infects soybean. viability. Similarly, the build-up of plant carbon as starch in 0209 FIG. 9 shows the symbiotic phenotypes of AhpnP AhpnH nodules might indicate slow metabolism and/or and AhpnH on A. afraspera. Plants inoculated with AhpnH perturbation of membrane transport processes that facilitate displayed typical nitrogen starvation symptoms, including bacteroid carbon acquisition. foliage chlorosis, reduced plant growth and half the ARA Example 20: Assessment of Effects of AhpnH in B. activity of WT- and AhpnP-infected plants (FIG.9, panels A, diazoefficiens on A. afraspera Nodules B). Reduced nitrogen fixation was not due to a decrease in the number of nodules, which was comparable in WT- and 0214) To assess survival rates of WT B. diazoefficiens and AhpnH-infected plants at 9, 14 and 21 d.p.i., Suggesting that AhpnH mutants of B. diazoefficiens within A. afraspera root the hpnH mutation does not affect nodule organogenesis nodules, live cross-sections of WT and AhpnH within A. (FIG. 9, panels C and 10). However, cytological analyses afraspera root nodules were stained with SYTO9 (a live revealed that AhpnH nodules displayed several disorders in cell-permeable DNA dye) and propidium iodide (a live comparison to WT and AhpnP nodules (FIG. 9, panels D-Z). cell-impermeable DNA dye that reports on the fraction of 0210. At the cellular level, AhpnH nodules were smaller dead cells). Imaging these sections with confocal micros (FIG. 9, panels D-F) and had pink or, in 30% of cases, even copy revealed that the density and proportion of live bac white central tissue in contrast to WT and AhpnP nodules, terial cells is indistinguishable between WT and AhpnH which were dark pink due to the accumulation of the nodules as shown in FIG. 11, panel c. Instead, the main O-carrier, leghemoglobin (FIG. 9, panels G-I). The central difference observed was a reduction in size in AhpnH symbiotic tissue of AhpnH nodules was often disorganized nodules, reducing the number of infected plant cells. and partially infected (FIG. 9, panels L., M. R), as opposed 0215. To confirm the observed reduction in size, nodules to the fully occupied tissue of WT and AhpnP nodules (FIG. were harvested from WT- and AhpnH-inoculated plants at 24 9, panels J. K. P. T). In some AhpnH nodules, the presence dpi and their dry weight determined. In particular, to calcu of necrotic regions—characterized by the accumulation of late nodule dry weight, all nodules from each plant were autofluorescent brown compounds—could be seen (FIG. 9. harvested by hand, transferred into a pre-weighted Eppen panels M, N). These are likely polyphenol compounds dorf tube and dried for 48 hours in a drying oven at 50° C. whose production is associated with plant defense responses before weighting. 59. Within AhpnH nodules, iodine staining also revealed 0216. As shown in FIG. 11, panel (d), lower graph, accumulation of starch granules in the non-infected cells consistent with the microscopy data, the nodule dry mass per Surrounding the symbiotic tissue, whereas such granules plant was ~50% less for AhpnH-inoculated plants. Since the US 2017/01 07160 A1 Apr. 20, 2017 29 normalization of acetylene reduction rates by nodule dry nodule Volume is determined by approximation of nodules weight eliminates the N-fixation rate difference between as spheres. Panel c plots the distribution of newly-emerged wild type and AhpnH (see FIG. 11, paneld, upper graph), the nodules over time (in dpi) for wild-type and hpnH nodules results suggest that the N-fixation deficit of AhpnH is due from 40 plants each. to the reduction in nodule mass. The N-fixation rate per 0223 For each nodule, a sigmoidal curve, such as the bacterium is likely similar between the two strains. Thus, the sigmoidal curve shown in FIG. 13, panel f, was generated, primary symbiotic defect in the AhpnH mutant observed at from which dV/dt, to and V were extracted. FIG. 14 24 dpi appears to be an inhibition of proper root nodule Panels die.fplot the distributions of dV/dt, predicted to, and development. V for about 75 wild-type nodules and about 50 hpnH 0217. To further test how a nodule volume reduction at 24 nodules. dpiarises, Acetylene reduction assays were performed every 0224. The results shown in FIG. 14, panels d-f suggest 4 days between 8 dpi and 40 dpi. As shown in FIG. 12, panel that both reduced nodule growth rates and more variable a, a total of 36 plants were inoculated for each strain. At each nodule initiation times occur for AhpnH nodules, and pre time point, 4 inoculated plants for each strain (and 1 liminary computational simulations suggest they contribute un-inoculated control plant) were chosen randomly for ARA equally to nodule size defects. measurements. The experiment was repeated once. 0218. The results shown in FIG. 12, panel b indicate that Example 22: Polymerase Chain Reaction-Based by 40 dpi, the per-nodule N-fixation rates, number of Cloning of Hopanoid Synthesis Genes nodules per plant, and nodule dry weight per plant are 0225. In the following paragraphs, an exemplary proce indistinguishable between the strains. These data demon dure is provided that is expected to provide effective genetic strate that a developmental arrest in AhpnH nodules is not modification of rhizobia incapable of producing Cs sufficient to explain their low N-fixation rates. hopanoids (Cs hopanoid-deficient rhizobia) is described. 0226. In some cases, genetic modification of Cs Example 21: Computational Modeling of Root hopanoid-deficient rhizobia can be performed by poly Nodule Development in B. diazoefficiens WT and merase chain reaction-based cloning of Cs hopanoid syn hpnH Mutant thesis genes, based on Some common approaches described 0219 Plants were inoculated as previously described. in related literatures such as the method in Welander et al. After 5-7 dpi. 5 plants each for WT and hpnH were removed (2012) 12 which is incorporated herein by reference in its from their plant culture tubes and transferred to a plastic entirety. imaging dish containing pre-warmed, sterile plant medium. 0227 Briefly, Cs hopanoid synthesis genes including Images of plant roots were taken using a Keyence digital one or more of shc, hpnH, hpnG, hpnO, hpnP hpnC, hpnD microscope and manually aligned. After imaging each plant and hpnE shown in FIG. 2, panel B are cloned into a was returned to its original culture tube and returned to the rhizobium expression plasmid vector. A Suitable plasmid plant cultivation chamber. Plant roots were imaged every vector such as those described in Welander et al (2009) 11, 2-4 days for 40 days; only nodules that were visible within Ledermann etal (2015) Mol. Plant Microbe Interact. 28:959, 14 dpi were tracked, due to the increasing likelihood of or Vincze and Bowra (2006) 65 are used. For example, a cross-contamination over time. plasmid with broad host range such as pPZP211 was engi 0220. For each nodule, the radius was measured and the neered containing a spectinomycin resistance gene, an origin nodule Volumes were estimated by approximating nodules of replication recognized by the recipient rhizobium and E. as spheres. FIG. 13, panel a plots raw nodule volumes over coli, and compatible cloning sites comprising unique restric time (dpi). Multiple models were tested to identify the tion endonuclease recognition sites. The cloning site where function that best fit the nodule growth curves. FIG. 13, a Cls hopanoid synthesis gene is inserted is downstream of panel dplots nodule Volumes fit to quadratic, exponential or a promoter recognized by the recipient rhizobium, to ensure sigmoidal curves and panel e shows additional parameter expression of the Cs hopanoid synthesis gene in the recipi fitting for the sigmoidal fit. ent rhizobium. Primers used to amplify a Cls hopanoid 0221) The following parameters were extracted from synthesis gene comprise forward and reverse sequences each fitted sigmoidal curve: dV/dt, maximum nodule growth complementary with 5' and 3' ends of a Cls hopanoid rates: V, the time at which a nodule was visible to the synthesis gene sequence, flanked by sequences for compat naked eye; V, maximum nodule Volumes; and to the time ible unique restriction endonuclease recognition sites that of bacterial internalization (an approximation of the nodule are present in the insertion site in the plasmid. initiation time, e.g. when volumes surpassed 0.1 mm). 0228. The Cs hopanoid producing rhizobium Bra 0222 FIG. 14 shows the results from computational dyrhizobium diazoefficiens can be used as donor species, modeling of root nodule development in both B. diazoeffi from which the hopanoid biosynthesis genes are obtained. ciens WT and the hpnH mutant. In particular, panel a Genomic DNA from Bradyrhizobium diazoefficiens is iso illustrates a schematic overview of determinate root nodule lated using a DNeasy Blood and Tissue Kit (Qiagen). development. Parameters describing this process include: to Primers are designed based on the DNA sequences for genes the time of bacterial internalization, and Vo, the volume of in the hopanoid synthesis gene cluster required to amplify the first infected cell; t the time at which a nodule is genes required for Cs hopanoid biosynthesis, for example visible by eye, and V, the smallest nodule volume visible hpnH (Genbank locus tag AAV28 RS 11540) as shown in by eye; t, the time at which nodule growth has leveled off. Table 2, with the addition of appropriate restriction endo and V, the Volume of the nodule when nodule growth nuclease recognition sites at the 5' and 3' ends flanking the stops; dV/dt, the rate of increase in nodule volume between gene t,fia and t.F' Panelb shows sample wild-type nodule growth 0229 Hopanoid for example, the C35 hopanoid synthesis time course. Nodule radii are measured directly and the gene hpnH is amplified using PCR and the resulting ampli US 2017/01 07160 A1 Apr. 20, 2017 30 con is analyzed by agarose gel electrophoresis. An amplicon 0232 Colonies and grown for 48 h in the presence of band of the expected size is excised from the gel and purified appropriate selection antibiotic. Plasmid DNA is isolated using the Wizard SV Gel and PCR Clean-Up System (Pro from the recipient rhizobium transformants using a Qiagen mega). The purified hpnH amplicon is then cloned into the plasmid preparation kit, following the manufacturer's direc expression plasmid vector, for example pPZP211 containing tions. Plasmids are analyzed using restriction endonuclease an antibiotic resistance gene, for example spectinomycin to digestions and gel electrophoresis and DNA sequencing. permit selection of positive clones, as follows. The plasmid and hpnH amplicon insert are digested with restriction Example 24: Preparation of enzymes to create compatible DNA ends for the inserting the Transformation-Competent S. meliloti Cells hpnH amplicon into the pPZP211 cloning site. For ligation of the insert into the plasmid, the plasmid is mixed with the 0233. As an alternative to conjugation method in hpnH insert, ligation buffer and T4 DNA ligase, and incu Example 23, transfer of plasmids containing hopanoid syn bated at room temperature for 30 minutes. One aliquot of E. thesis genes into recipient S. meliloti cells is expected to be coli S17-1 competent cells is transformed by electroporation performable using transformation methods. Prior to trans with the ligation mixture, and streaked onto Luria-Bertani formation, S. meliloti cells is expected to be treated to (LB) agar plates containing antibiotic, for example spec become transformation-competent, based on the protocol of tinomycin. 12-16 hours later, colonies are picked and used Vincze and Bowra (2006) 65 as follows. PSY medium is to inoculate LB broth cultures containing spectinomycin. inoculated with S. meliloti and grown at 28°C. with vigor After cultures are grown, 1 mL of bacterial culture is used ous shaking until it reaches the stationary growth phase. for preparing glycerol stocks, which is stored at -80° C. and 0234. Two milliliters from the stationary-phase cultures used for starting Subsequent cultures. The remainder of the is used to inoculate 50 ml of PSY medium and incubated transformed E. coli S17-1 culture is used for plasmid puri with shaking for 6 h at 28° C. Cells are harvested by fication using a QIAprep Spin Miniprep Kit (Qiagen). Integ centrifugation at 12,000 g for 10 min at 4°C., and the pellet rity of cloned plasmids is assessed using analytical restric is resuspended in 2 ml of ice-cold 20 mM CaCl, solution. tion endonuclease digestion and gel electrophoresis. The resulting cell Suspension is placed into ice-cold 1.5-ml Following identification of positive clones by analytical microcentrifuge tubes in aliquots of 100 ul before being restriction digest analysis, clones are also analyzed by DNA Snap-frozen in liquid N. The prepared competent cells are sequencing, using primers designed to bind to sequences Stored at -80° C. flanking the inserted amplicon in the plasmid. Example 25. Transformation of Competent Example 23: Transfer of a Plasmid Vector Recipient S. meliloti Cells with Plasmid Vectors Comprising a hpnH Expression Plasmid into a Comprising Hopanoid Synthesis Genes Using an Recipient Rhizobium that Naturally Expresses all Electroporation Method Genes Required for C35 Hopanoid Synthesis Except hpnH, by Conjugation with E. coli S17-1 0235. In one example, S. meliloti are expected to be Derivatives transformable with plasmid vectors containing hopanoid synthesis genes using an electroporation method, based on 0230. In one example, transfer of a plasmid vector the method of Garget al (1999) 66. expressing hpnH into a recipient rhizobium expressing all 0236. In particular, recipient S. meliloti cells can be genes required for C35 hopanoid synthesis except hpnH, is grown for 72 h at 30° C. with vigorous shaking to mid expected to be performed by conjugation with E. coli S-17 logarithmic phase (absorbance at 600 nm of 0.4 to 0.6). Cells cells that are transformed with a plasmid vector containing are prepared for electroporation by a modification of the the hopanoid synthesis genes, as follows. procedure of Dower et al (1988) 67. Cells can be chilled 0231. Late log cultures of E. coli S17-1 (DKN1) strain for 15 to 30 min on ice and then harvested by centrifugation (5-10 ml) and a rhizobium recipient strain (10-20 ml) are at 9,000 rpm for 10 min at 4°C. The cell pellet is washed harvested by centrifugation (10 min, 5000 rpm). The super four times with cold sterile deionized water and finally natant is discarded and cells are washed with 10-20 ml washed with 10% glycerol. The cells can be resuspended in sterile 0.9% NaCl. The ODoo of this solution is measured 10% glycerol to have an approximate concentration of 10' and cells are again centrifuged. Cells are resuspended in a to 10' colony-forming units/ml (CFU/ml) and kept on ice. volume to yield an ODoo of approximately 4. 250 ul of E. The cell suspension can be distributed in aliquots of 90 ul coli donor cells are mixed with 750 ul of a rhizobium and mixed thoroughly with plasmid vector containing recipient strain. The cell mixture is centrifuged (1 min, hopanoid synthesis genes (2 Lig) by Vortexing at high speed 13000 rpm, RT) and the supernatant reduced to ~50 ul in for 10 s and then kept on ice for 30 min. The cell-DNA which the cells are resuspended. The resuspended cells are mixture can be loaded in a chilled electroporation cuvette transferred as a drop onto a plate containing Suitable growth with a 0.1-cm gap (BTX Inc., San Diego, Calif.) and is medium, which is dried for approx. 15 min under a laminar Subjected to a single pulse of high Voltage. For pulse flow bench. The plate is incubated for at least two days at generation, an electrocell manipulator, model 600 (BTX 30°C. The cells paste is collected from the plate with a loop, Inc.), may be used that is capable of generating a field resuspended in 2 ml 0.9% NaCl and appropriate aliquots strength of up to 25 kV/cm with a 0.1-cm-gap cuvette. After (e.g. 50, 100, 200 ul) are streaked on selective agar plates the pulse is delivered, the cuvettes are kept on ice for 10 min. containing Suitable growth medium and appropriate selec The electroporated cells are suspended in PSY broth and tion antibiotic. E. coli S 17-1 donor cells are counter incubated for 24 h at 30° C. The cell suspension is diluted selected with 20 ug/ml chloramphenicol which does not and plated on selective medium containing the appropriate interfere with growth of the recipient rhizobial cells. antibiotic. US 2017/01 07160 A1 Apr. 20, 2017 0237 Colonies from the electrotransformed S. meliloti genes dissolved in 0.15 M NaCl (pH 7). The mixture is can be selected and grown for 48 h in the presence of chilled rapidly at 0°C. After 15 min at 0°C., it is transferred appropriate selection antibiotic. Plasmid DNA is isolated for 5 min at 37° C. then at 0°C. After 40 min, the mixture from the S. meliloti transformants using a Qiagen plasmid is incubated for 30 min in a 30°C. water bath. Then, to allow preparation kit, following the manufacturer's directions. phenotypic expression of the drug markers, the cells are Plasmids are analyzed using restriction endonuclease diges diluted in appropriate medium and streaked on selective agar tions and gel electrophoresis and DNA sequencing. plates containing appropriate medium and antibiotic. After 4 days of incubation at 30° C. S. meliloti transformant colo Example 26: Transformation of Competent nies are analyzed for the presence of the plasmid vector. Recipient S. meliloti Cells with Plasmid Vectors 0243 Colonies from the different electrotransformed S. Comprising Hopanoid Synthesis Genes Using a meliloti can be selected and grown for 48 h in the presence Freeze-Thaw Method of appropriate selection antibiotic. Plasmid DNA is isolated 0238. In one example, transformation of competent S. from the S. meliloti transformants using a Qiagen plasmid meliloti cells with plasmid vectors containing hopanoid preparation kit, following the manufacturer's directions. synthesis genes is expected to be performable following a Plasmids are analyzed using restriction endonuclease diges “freeze-thaw' method based on that of Vincze and Bowra tions and gel electrophoresis and DNA sequencing (2006) 65. Approximately 1 ug of a vector plasmid con taining cloned hopanoid synthesis genes, can be made up to Example 28: Assessment of the Ability of S. a volume of 5ul with sterile distilled water. This can be then meliloti Harboring Plasmid Vectors Containing added to a 100 ul aliquot of competent cells immediately Hopanoid Synthesis Genes to Form Nodules after they are removed from -80° C. Subsequently, the 0244. In one embodiment, assessment of the ability of mixture is kept at 37° C. for 5 min without shaking. For the genetically modified S. meliloti harboring plasmid vectors recovery phase, 1 ml of the appropriate medium is added to containing hopanoid synthesis genes to form nodules is the transformed cells before they are transferred to 10-ml expected to be based on the method of Vincze and Bowra tubes and incubated at 28° C. for 2 h with shaking. To (2016) 65). determine the actual transformation efficiency, the cell Sus 0245. It is expected that the presence of the plasmid pension is diluted and plated on nonselective agar medium vector will not prevent the transformed S. meliloti from to count the cells. Cells without added DNA and the appro forming effective nodules on legumes. To confirm the sta priately diluted transformation mixture are plated on selec bility of the plasmid in the S. meliloti during nodulation, tive medium to calculate the number of spontaneous resis bacteria and bacteroids are isolated from nodules 4 weeks tant colonies and transformation efficiency, respectively. after inoculation and are characterized, as follows. The 0239 Similar to the results of Vincze and Bowra (2006), bacteria are isolated on nonselective medium from the it is expected that a 6-h growth period for competent-cell surface-sterilized nodules. The colonies are tested for anti preparation will be sufficient to produce transformants of biotic resistance on selective plates, and the restriction fast-growing species of Sinorhizobium. The S. meliloti trans endonuclease digest pattern of the purified plasmid was formants are checked for the presence of the introduced analyzed by gel electrophoresis. It is expected that no loss of plasmid comprising cloned hopanoid synthesis genes. Colo antibiotic resistance is observed, and the S. meliloti isolated nies from the transformed S. meliloti are selected and grown from the nodules harbors the plasmid vector containing the for 48 h in the presence of appropriate selection antibiotic. hopanoid sysnthesis genes. Plasmid DNA is isolated from the S. meliloti transformants using a Qiagen plasmid preparation kit, following the manu Example 29: Analysis of Cls Hopanoid Production facturer's directions. Plasmids are analyzed using restriction in Rhizobia endonuclease digestions and gel electrophoresis and DNA sequencing 0246. In some cases, screening of rhizobia for the pro duction of Cs hopanoids is expected to be performed using Example 27: Transformation of Competent analysis of lipids extracted from cultured rhizobia for the Recipient S. meliloti Cells with Plasmid Vectors presence of C35 hopanoids, based on Some common Comprising Hopanoid Synthesis Genes Using a approaches described in related literatures Such as the Thermal Shock Method method in Welander et al. (2012)12, which is incorporated herein by reference in its entirety. 0240. In one embodiment, transformation of S. meliloti 0247 Briefly, rhizobial cells can be grown in YPS with plasmid vectors containing hopanoid synthesis genes is medium under aerobic conditions at 30° C. to stationary expected to be performable by a “thermal shock' method, phase (3 days). Cells are harvested by centrifugation at 4°C. based on a protocol by Courtois et al. (1988) 68, as and lipids are extracted by sonication the cells for 15 follows. minutes at room temperature in 10 ml of 10:5:4 (v:v:v) 0241 The recipient S. meliloti is grown up in the appro methanol (MeOH): dichloromethane (DCM):water. Samples priate medium in a rotary bath shaker (60 revolutions per are centrifuged for 10 minutes at 3000xg and the supernatant min) at 30° C. to a density of 10 CFU/ml, and it maintained is transferred to a new tube. Cell pellets are Sonicated again static at 30° C. After 3 h of incubation, the cells are in 10 ml of MeOH:DCM:water (10:5:4, V/v/v), centrifuged, harvested by centrifugation at 3,000xg for 10 min and and the Supernatant combined with the first extraction. Suspended in the appropriate medium to give a cell density 0248. The samples can be separated into two phases by of 10 CFU/ml. adding 20 ml 1:1 (v/v) DCM: water, centrifuged for 10 0242 A0.2-ml portion of this suspension can be added to minutes at 3000xg, and the organic phase is transferred to a 0.1 ml of vector plasmid containing hopanoid synthesis new vial. To the remaining aqueous phase, 10 ml of DCM: US 2017/01 07160 A1 Apr. 20, 2017 32 water (1:1, V/v) is added again, centrifuged, and the organic compositions, microorganisms, systems and methods of the phase was combined with the previous extract. The organic disclosure, and are not intended to limit the scope of what solvents are evaporated under N2 and the total lipid extract the inventors regard as their disclosure. Those skilled in the (TLE) is redissolved in 2 ml DCM. The TLE is divided into art will recognize how to adapt the features of the exempli two 1 ml aliquots. One aliquot is separated by chromatog fied hopanoids, hopanoids-producing nitrogen-fixing bacte raphy on a silica gel column. Six fractions are eluted: F1: ria, leguminous plants and related formulation and uses to hexane: F2: hexane: DCM (4:1, v/v); F3: DCM; F4: DCM: others according to various embodiments and scope of the ethyl acetate (EtOAC) (4:1, v/v); F5: EtOAc; F6: MeOH. claims. Separation of the TLE facilitated the detection of diplopterol 0254 The examples set forth above are provided to give in fraction 4. Fractions 4, 5, 6 and the remaining TLEs are those of ordinary skill in the art a complete disclosure and incubated in 100 ul of acetic anhydride: pyridine (1:1, V/v) description of how to make and use the embodiments of the for 1 hour at 70° C. to derivatize alcohols into acetate esters. compositions, microorganisms, systems and methods of the The hydrocarbon fractions (F1 and F2), the acetylated disclosure, and are not intended to limit the scope of what fractions (F4, F5, and F6), and the acetylated TLEs are the inventors regard as their disclosure. Those skilled in the analyzed by high temperature gas chromatography-mass art will recognize how to adapt the features of the exempli spectrometry (GC-MS) as previously described (Welander et fied hopanoids, hopanoids-producing nitrogen-fixing bacte al., 2009) 11). ria, leguminous plants and related formulation and uses to 0249. The acetylated TLEs can be also analyzed by liquid others according to various embodiments and scope of the chromatography-mass spectrometry (LC-MS). A Poroshell claims. 120 EC-C18 column (2.1 x 150 mm, 2.7 um; Agilent Tech 0255 All patents and publications mentioned in the nologies), set at 30° C., is eluted isocratically first with specification are indicative of the levels of skill of those MeOH/water (95:5, v:v) for 2 min at a flow rate of 0.15 skilled in the art to which the disclosure pertains. ml/min, then using a linear gradient up to 20% (v) of 0256 The entire disclosure of each document cited (in isopropyl alcohol (IPA) over 18 min at a flow rate of 0.19 cluding patents, patent applications, journal articles, ml/min, and isocratic for 10 min. The linear gradient is then abstracts, laboratory manuals, books, or other disclosures) in set to 30% (v) of IPA at 0.19 ml/min over 10 min, and the Background, Summary, Detailed Description, and maintained for 5 min. The column is subsequently eluted Examples is hereby incorporated herein by reference. All using a linear gradient up to 80% IPA (v) over 1 minata flow references cited in this disclosure are incorporated by ref rate of 0.15 ml/min and isocratic for 14 min. Finally the erence to the same extent as if each reference had been column was eluted with MeOH/water (95:5, v:v) at 0.15 incorporated by reference in its entirety individually. How ml/min for 5 min. The APCI parameters were as follows: gas ever, if any inconsistency arises between a cited reference temperature 325°C., vaporizer temperature 350° C., drying and the present disclosure, the present disclosure takes gas (N2) flow 6 l/min, nebulizer (N2) flow 301/min, capil precedence. lary voltage 1200 V. corona needle 4 LA, fragmentor 150 V. 0257 The terms and expressions which have been Data are recorded by scanning from m/z. 100 to 1600. employed herein are used as terms of description and not of Identification of the hopanoids is done using their exact limitation, and there is no intention in the use of Such terms mass and by comparison of the retention time and the mass and expressions of excluding any equivalents of the features spectra with published data (Talbot et al., 2007; Talbot et al., shown and described or portions thereof, but it is recognized 2003b) 69, 70. that various modifications are possible within the scope of the disclosure claimed. Thus, it should be understood that Example 30: Genetic Screen of Stress-Resistant although the disclosure has been specifically disclosed by Rhizobia as a Biofertilizer embodiments, exemplary embodiments and optional fea (0250 Screening of rhizobia for the production of Cs tures, modification and variation of the concepts herein hopanoids is expected to be performed by using a method of disclosed can be resorted to by those skilled in the art, and performing a diagnostic screen for the presence of Cs that such modifications and variations are considered to be hopanoid synthesis. Oligonucleotide primers are designed to within the scope of this disclosure as defined by the amplify sequences of genes for Cs hopanoid synthesis, appended claims. based on the DNA sequences of of the genes. 0258. It is also to be understood that the terminology used 0251 Briefly, genomic DNA can be isolated from rhizo herein is for the purpose of describing particular embodi bia and diagnostic PCR is performed using primers to ments only, and is not intended to be limiting. As used in this amplify Cs hopanoid synthesis genes. The resulting ampli specification and the appended claims, the singular forms cons are analyzed by gel electrophoresis to confirm expected “a,” “an,” and “the' include plural referents unless the DNA band molecular weight. In addition, DNA sequencing content clearly dictates otherwise. The term “plurality” is performed on genomic DNA samples to confirm the includes two or more referents unless the content clearly presence of hopanoid synthesis genes. dictates otherwise. Unless defined otherwise, all technical 0252. The diagnostic PCR and DNA sequencing can and scientific terms used herein have the same meaning as determine whether Cs hopanoid synthesis genes are present commonly understood by one of ordinary skill in the art to in the genome of a rhizobium sample, and therefore whether which the disclosure pertains. the rhizobium is capable of synthesizing Cls hopanoids, and 0259 When a Markush group or other grouping is used thus to be used as biofertilizer with enhanced stress-resis herein, all individual members of the group and all combi tance properties. nations and possible Subcombinations of the group are 0253) The examples set forth above are provided to give intended to be individually included in the disclosure. Every those of ordinary skill in the art a complete disclosure and combination of components or materials described or exem description of how to make and use the embodiments of the plified herein can be used to practice the disclosure, unless US 2017/01 07160 A1 Apr. 20, 2017 otherwise stated. One of ordinary skill in the art will of the C-2 hopanoid methylase HpnP in Rhodopseudomo appreciate that methods, device elements, and materials naspalustris TIE-1.J. Bacteriol, 2013. 195(11): p. 2490-8. other than those specifically exemplified may be employed 0271 10. Schmerk, C. L., et al., Elucidation of the in the practice of the disclosure without resort to undue Burkholderia cenocepacia hopanoid biosynthesis path experimentation. All art-known functional equivalents, of way uncovers fitnctions for conserved proteins in any such methods, device elements, and materials are hopanoid-producing bacteria. Environ Microbiol, 2015. intended to be included in this disclosure. Whenever a range 17(3): p. 735-50. is given in the specification, for example, a temperature 0272 11. Welander, P. V., et al., Hopanoids play a role in range, a frequency range, a time range, or a composition membrane integrity and pH homeostasis in Rho range, all intermediate ranges and all Subranges, as well as, dopseudomonas palustris TIE-1. J Bacteriol, 2009. 191 all individual values included in the ranges given are (19): p. 6145-56. intended to be included in the disclosure. Any one or more 0273) 12. Welander, P. V., et al., Identification and char individual members of a range or group disclosed herein acterization of Rhodopseudomonas palustris TIE-1 may be excluded from a claim of this disclosure. The disclosure illustratively described herein suitably may be hopanoid biosynthesis mutants. Geobiology, 2012. 10(2): practiced in the absence of any element or elements, limi p. 163-77. tation or limitations which is not specifically disclosed (0274 13. Welander, P. V. and R. E. Summons, Discovery, herein. taxonomic distribution, and phenotypic characterization 0260 A number of embodiments of the disclosure have of a gene required for 3-methylhopanoid production. Proc been described. The specific embodiments provided herein Natl Acad Sci USA, 2012. 109(32): p. 12905-10. are examples of useful embodiments of the invention and it (0275 14. J. N. RICCI, A.J.M.A.D.K.N., Phylogenetic will be apparent to one skilled in the art that the disclosure analysis of Hpn Preveals the origin of 2-methylhopanoid can be carried out using a large number of variations of the production in Alphaproteobacteria. Geobiology, 2015. devices, device components, methods steps set forth in the 13: p. 11. present description. As will be obvious to one of skill in the (0276) 15. Altschul S F. M. T., Schiffer A A. Zhang J, art, methods and devices useful for the present methods may Zhang Z. Miller W. Lipman D. J., Gapped BLAST and include a large number of optional composition and pro PSI-BLASTa new generation of protein database search cessing elements and steps. programs. Nucleic Acids Res., 1997. 25(17): p. 14. 0261. In particular, it will be understood that various (0277. 16. Smith T F. W. M., Identification of common modifications may be made without departing from the spirit molecular subsequences. J Mol Biol, 1981. 147(1): p. 3. and Scope of the present disclosure. Accordingly, other 0278 17. W. R. P. Searching protein sequence libraries: embodiments are within the scope of the following claims. comparison of the sensitivity and selectivity of the Smith Waterman and FASTA algorithms. Genomics, 1991. 11 (3): REFERENCES p. 16. 0262. 1. Gibson, K. E. H. Kobayashi, and G. C. Walker, (0279. 18. Pearson W R. L. D., Improved tools for bio Molecular determinants of a symbiotic chronic infection. logical sequence comparison. Proc Natl Acad Sci USA, Annu Rev Genet, 2008. 42: p. 413-41. 1988. 85(8): p. 5. 0263. 2. Oldroyd, G. E., et al., The rules of engagement (0280) 19. Johnson L S. E. S. Portugaly E, Hidden in the legume-rhizobial symbiosis. Annu Rev Genet, 2011. Markov model speed heuristic and iterative HMM search 45: p. 119-44. procedure. BMC Bioinformatics, 2010. 11 (431): p. 8. 0264 3. Rohmer, M., The Biosynthesis of Triterpenoids 0281. 20. Masson-Boivin, C., et al., Establishing nitro of the Hopane Series in the Eubacteria—a Mine of New gen-fixing symbiosis with legumes: how many rhizobium Enzyme-Reactions. Pure and Applied Chemistry, 1993. recipes? Trends Microbiol, 2009. 17(10): p. 458-66. 65(6): p. 1293-1298. 0282) 21. Renier, A., et al., Photosynthetic Bradyrhizo 0265. 4. Ricci, J. N., et al., Diverse capacity for 2-meth bium Sp. Strain ORS285 synthesizes 2-O-methylfucosy vlhopanoid production correlates with a specific ecologi lated lipochitooligosaccharides for nod gene-dependent cal niche. ISMEJ, 2014. 8(3): p. 675-84. interaction with Aeschynomene plants. Mol Plant 0266 5. Kannenberg, E. L., M. Perzl, and T. Hartner. The Occurrence of Hopanoid Lipids in Bradyrhizobium Bac Microbe Interact, 2011. 24(12): p. 1440-7. teria. Fems Microbiology Letters, 1995. 127(3): p. 255 (0283. 22. Prell, J. and P. Poole, Metabolic changes of 261. rhizobia in legume nodules. Trends Microbiol. 2006. 0267 6. Nalin, R., et al., High hopanoid/total lipids ratio 14(4): p. 161-8. in Frankia mycelia is not related to the nitrogen status. 0284. 23. Fleischman, D. and D. Kramer, Photosynthetic Microbiology, 2000. 146 (Pt 11): p. 3013-9. rhizobia. Biochimica Et Biophysica Acta-Bioenergetics, 0268 7. Silipo, A., et al., Covalently linked hopanoid 1998. 1364(1): p. 17-36. lipid A improves outer-membrane resistance of a Bra 0285 24. Kaneko, T., et al., Complete genomic sequence dyrhizobium symbiont of legumes. Nat Commun, 2014. 5: of nitrogen-fixing symbiotic bacterium Bradyrhizobium p. 5106. japonicum USDA110. DNA Res, 2002.9(6): p. 189-97. 0269 8. Wu, C. H., M. Bialecka-Fornal, and D. K. 0286 25. Giraud, E., et al., Legumes symbioses: absence Newman, Methylation at the C-2 position of hopanoids of Nod genes in photosynthetic bradyrhizobia. Science, increases rigidity in native bacterial membranes. Elife, 2007. 316(5829): p. 1307-12. 2015. 4. 0287. 26. Neubauer, C., et al., Lipid remodeling in Rho 0270. 9. Kulkarni, G., C. H. Wu, and D. K. Newman, The dopseudomonas palustris TIE-1 upon loss of hopanoids general stress response factor EcfG regulates expression and hopanoid methylation. Geobiology, 2015. US 2017/01 07160 A1 Apr. 20, 2017 34 0288. 27. Bligh E. G. D. W. A rapid method of total lipid Their Acelylated Glycosides Formed from Chiral Alco extraction and purification. Can J Biochem Physiol. hols. Carbohydrate Research, 1978. 62(2): p. 359-362. 1959, 37(8): p. 7. 0305. 44. Hakomori, S.I., Rapid Permethylation of Gly 0289 28. Wu C H., K. L., Bialecka-Fornal M, Park S, colipid-i-Polysaccharide Catalyzed by Methylsulfinyl Car Thompson A L. Kulkarni G. Conway SJ, Newman D. K. banion in Dimethyl Sulfoxide. Journal of Biochemistry, Ouantitative hopanoid analysis enables robust pattern 1964. 55(2): p. 205-&. detection and comparison between laboratories. Geobi 0306 45. Rietschel, E. T., Absolute configuration of ology, 2015. 13(4): p. 17. 3-hydroxy fatty acids present in lipopolysaccharides from 0290 29. Kreshech, G. C., Surfactants in Water A Com various bacterial groups. Eur J Biochem, 1976. 64(2): p. prehensive Treatise. 1975: Plenum, N.Y. 423-8. 0291 30. Komaniecka, I., et al., Occurrence of an 0307 46. Que, N. L. S., et al., Purification and mass unusual hopanoid-containing lipid A among lipopolysac spectrometry of six lipid A species from the bacterial charides from Bradyrhizobium species. J Biol Chem, endosymbiont Rhizobium etli—Demonstration of a con 2014, 289(51): p. 35644-55. served distal unit and a variable proximal portion. Jour 0292) 31. Bravo, J. M., et al., Novel methylated triterpe nal of Biological Chemistry, 2000. 275(36): p. 28006 noids of the gammacerane series from the nitrogen-fixing 28O16. bacterium Bradyrhizobium japonicum USDA 110. Eur J (0308 47. Dobro, M. J., et al., Plunge Freezing for Elec Biochem, 2001. 268(5): p. 1323-31. tron Cryomicroscopy. Methods in Enzymology, Vol 481: 0293 32. Hauser. F., et al., Design and validation of a Cryo-Em, Part a Sample Preparation and Data Collec partial-genome microarray for transcriptional profiling tion, 2010. 481: p. 63-82. of the Bradyrhizobium japonicum symbiotic gene region. 0309 48. Iancu, C. V., et al., Electron cryotomography sample preparation using the Vitrobot. Nat Protoc, 2006. Mol Genet Genomics, 2006. 275(1): p. 55-67. 1(6): p. 2813-9. 0294 33. Markowitz, V. M. and N. C. Kyrpides, Com 0310 49. Chen, S., et al., Electron cryotomography of parative genome analysis in the integrated microbial bacterial cells. J. Vis Exp, 2010(39). genomes (IMG) system. Methods Mol Biol, 2007. 395: p. 0311 50. Jensen, G. J., Cryo-E M, Part A. Sample 35-56. Prepration and Data Collection. Methods Enzymol, 0295 34. Casadaban, M. J. and S. N. Cohen, Analysis of 2010. 481: p. 2-410. Gene-Control Signals by DNA-Fusion and Cloning in 0312 51. Ehrhardt, D. W. E. M. Atkinson, and S. R. Escherichia-Coli. Journal of Molecular Biology, 1980. Long, Depolarization of alfalfa root hair membrane 138(2): p. 179-207. potential by Rhizobium meliloti Nod factors. Science, 0296 35. Simon, R., U. Priefer, and A. Puhler, A Broad 1992. 256(5059): p. 998-1000. Host Range Mobilization System for Invivo Genetic 0313 52. Bonaldi, K., et al., The Nod factor-independent Engineering—Transposon Mutagenesis in Gram-Nega symbiotic signaling pathway: development of Agrobacte tive Bacteria. Bio-Technology, 1983. 1 (9): p. 784-791. rium rhizogenes-mediated transformation for the legume 0297 36. Regensburger, B. and H. Hennecke, Rina-Poly Aeschynomene indica. Mol Plant Microbe Interact, 2010. merase from Rhizobium-Japonicum. Archives of Micro 23(12): p. 1537-44. biology, 1983. 135(2): p. 103-109. 0314. 53. Nagata, T. and I. Takebe, Cell wall regenera 0298 37. Schafer, A., et al., Small mobilizable multi tion and cell division in isolated tobacco mesophyll purpose cloning vectors derived from the Escherichia coli protoplasts. Planta, 1970. 92(4): p. 301-8. plasmids pK18 and pK19. selection of defined deletions in 0315 54. Masloboeva, N., et al., Reactive oxygen spe the chromosome of Corynebacterium glutamicum. Gene, cies-inducible ECF sigma factors of Bradyrhizobium 1994. 145(1): p. 69-73. japonicum. PLoS One, 2012. 7(8): p. e43421. 0299 38. Fischer, H. M., et al., One member of a gro 0316 55. Welander, P. V., et al., Identification of a ESL-like chaperonin multigene family in Bradyrhizobium methylase required for 2-methylhopanoid production and japonicum is co-regulated with symbiotic nitrogen fixa implications for the interpretation of sedimentary tion genes. EMBO J, 1993. 12(7): p. 2901-12. hopanes. Proc Natl Acad Sci USA, 2010. 107(19): p. 0300 39. Lindemann, A., et al., Host-specific symbiotic 8537-42. requirement of BaeAB, a RegR-controlled RND-type efflux 0317 56. Czernic, P., et al., Convergent Evolution of system in Bradyrhizobium japonicum. FEMS Microbiol Endosymbiont Differentiation in Dalbergioid and IRLC Lett, 2010. 312(2): p. 184-91. Legumes Mediated by Nodule-Specific Cysteine-Rich 0301 40. Wu, C. H., et al., Ouantitative hopanoid analy Peptides. Plant Physiol, 2015. sis enables robust pattern detection and comparison 0318 57. Newton, B. A., Properties and Mode of Action between laboratories. Geobiology, 2015. of the Polymyxins. Bacteriological Reviews, 1956. 2001): 0302 41. Sessions, A. L., et al., Identification and quan p. 14-27. tification of polyfiunctionalized hopanoids by high tem 0319 58. Tiricz, H., et al., Antimicrobial nodule-specific perature gas chromatography-mass spectrometry. Org cysteine-rich peptides induce membrane depolarization Geochem, 2013. 56: p. 120-130. associated changes in the transcriptome of Sinorhizobium 0303 42. Westphal, O.a.J., J. K. Bacterial lipopolysac meliloti. Appl Environ Microbiol, 2013. 79(21): p. 6737 charide extraction with water-phenol and further appli 46. cations of the procedure. Methods Carbohydr Chem, 0320 59. Vasse, J., F. Debilly, and G. Truchet, Abortion 1965. 43: p. 83-91. of Infection during the Rhizobium-Meliloti-Alfalfa Sym 0304 43. Leontein, K., B. Lindberg, and J. Lonngren, biotic Interaction Is Accompanied by a Hypersensitive Assignment of Absolute-Configuration of Sugars by Gic of Reaction. Plant Journal, 1993. 4(3): p. 555-566. US 2017/01 07160 A1 Apr. 20, 2017 35 0321) 60. Finan, T. M., J. M. Wood, and D. C. Jordan, 0327 66. Garg, B., R. C. Dogra, and P. K. Sharma., Symbiotic Properties of C4-Dicarboxylic Acid Transport High-efficiency transformation of Rhizobium legumi Mutants of Rhizobium-Leguminosarum. Journal of Bac nosarum by electroporation. Appl. Environ. Microbiol. teriology, 1983. 154(3): p. 1403-1413. 1999.65: p. 3. 0322 61. Lodwig, E. M., et al., Amino-acid cycling 0328 67. Dower W. J. M. J., Ragsdale C W., High drives nitrogen fixation in the legume-Rhizobium symbio efficiency transformation of E. coli by high voltage elec sis. Nature, 2003. 422(6933): p. 722-6. troporation. Nucleic Acids Res., 1988. 16: p. 19. 0323 62. Haag, A. F., et al., Protection of Sinorhizobium 0329. 68. Courtois J. C. B.a.G. J., High frequency trans against host cysteine-rich antimicrobial peptides is criti formation of Rhizobium meliloti. J. Bacteriol., 1988. 170 cal for symbiosis. PLoS Biol, 2011. 9(10): p. e1001169. (12): p. 3. 0324 63. Kannenberg, E. L. and R. W. Carlson, Lipid A 0330 69. Talbot H M. R. M., Farrimond P. Structural and O-chain modifications cause Rhizobium lipopolysac characterisation of unsaturated bacterial hopanoids by charides to become hydrophobic during bacteroid devel atmospheric pressure chemical ionisation liquid chroma opment. Mol Microbiol, 2001. 39(2): p. 379-91. tography/ion trap mass spectrometry. Rapid Communi 0325 64. West, S. A., et al., Sanctions and mutualism cations in Mass Spectrometry., 2007. 21: p. 10. stability: why do rhizobia fix nitrogen? Proc Biol Sci, 0331 70. Talbot H M. S. R., Jahnke L. Farrimond P. 2002. 2.69(1492): p. 685-94. Characteristic fragmentation of bacteriohopanepolyols 0326 65. Vincze E, B. S., Transformation of Rhizobia during atmospheric pressure chemical ionisation liquid with broad host range plasmids using Freeze-thaw chromatography/ion trap mass spectrometry. Rapid Com method. Appl Environ Microbiol., 2006. 72: p. 4. munications in Mass Spectrometry, 2003. 17: p. 9. SEQUENCE LISTING <16 Os NUMBER OF SEO ID NOS: 32 <21 Oc SEO ID NO 1 <211 LENGTH: 34 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <22 Os FEATURE; OTHER INFORMATION: Synthetic polynucleotide <4 OOs SEQUENCE: 1 tat citagaaa gottgcagtt tocct tcgt.c gata 34 SEO ID NO 2 LENGTH: 60 TYPE: DNA ORGANISM: Artificial Sequence FEATURE; OTHER INFORMATION: Synthetic polynucleotide <4 OOs SEQUENCE: 2 accatgatac cqtagataga at acacgggg catctggctic gattact cog at agittaatt 60 SEO ID NO 3 LENGTH: 60 TYPE: DNA ORGANISM: Artificial Sequence FEATURE; OTHER INFORMATION: Synthetic polynucleotide <4 OOs SEQUENCE: 3 aattalactat cqgagtaatc gagccagatg ccc.cgtgitat totatic tacg gtat catggit 60 SEO ID NO 4 LENGTH: 34 TYPE: DNA ORGANISM: Artificial Sequence FEATURE; OTHER INFORMATION: Synthetic polynucleotide <4 OOs SEQUENCE: 4 tat ct agact gcagagcagg to Cagaagaa gCtc 34 US 2017/01 07160 A1 Apr. 20, 2017 36 - Continued <210s, SEQ ID NO 5 &211s LENGTH: 36 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide <4 OOs, SEQUENCE: 5 tatatatago gg.ccgc.gcag titt coctitcg togata 36 <210s, SEQ ID NO 6 &211s LENGTH: 44 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide <4 OOs, SEQUENCE: 6 tatatatat c taga catctg gct cqattac toccatagitt aatt 44 <210s, SEQ ID NO 7 &211s LENGTH: 43 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide <4 OO > SEQUENCE: 7 tatatatat c tag accc.cgt g tatt citat c tacggitatica togg 43 <210s, SEQ ID NO 8 &211s LENGTH: 34 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide <4 OOs, SEQUENCE: 8 tatatatact gcagagcagg to Cagaagaa got c 34 <210s, SEQ ID NO 9 &211s LENGTH: 48 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide <4 OOs, SEQUENCE: 9 titcgagct cq gtaccc.gggg atcct ctaga gtggalaccgt. C9gacagc 48 <210s, SEQ ID NO 10 &211s LENGTH: 50 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide <4 OOs, SEQUENCE: 10 ttgtcagatc gagacgctica Ctggtttaca atcgtttgga Caggaagagc SO <210s, SEQ ID NO 11 &211s LENGTH: 50 &212s. TYPE: DNA US 2017/01 07160 A1 Apr. 20, 2017 37 - Continued <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide <4 OOs, SEQUENCE: 11 gctic titcc tig to caaacgat td taalaccag tdagcgt.ctic gatctgacaa SO <210s, SEQ ID NO 12 &211s LENGTH: 50 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide <4 OOs, SEQUENCE: 12 acggc.cagtg C caagcttgc atgcctgcag gctgatccac aaggagat.cg SO <210s, SEQ ID NO 13 &211s LENGTH: 34 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide <4 OOs, SEQUENCE: 13 tatatatagc ggcc.gc.gtgg aaccgt.cgga cagc 34 <210 SEQ ID NO 14 &211s LENGTH: 44 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide <4 OOs, SEQUENCE: 14 tatatatat c tag actggitt tacaatcgtt tacaggaia gagc 44 <210s, SEQ ID NO 15 &211s LENGTH: 34 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide <4 OOs, SEQUENCE: 15 tatatatat c tagatgagcg tot cqatctg acaa 34 <210s, SEQ ID NO 16 &211s LENGTH: 34 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide <4 OOs, SEQUENCE: 16 tatatatact gcaggctgat C cacaaggag atcg 34 <210s, SEQ ID NO 17 &211s LENGTH: 32 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide US 2017/01 07160 A1 Apr. 20, 2017 38 - Continued <4 OOs, SEQUENCE: 17 tatictagact gcagaacacic atcgggctga ag 32 <210s, SEQ ID NO 18 &211s LENGTH: 60 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide <4 OOs, SEQUENCE: 18 ggaa.gc.ctic cqcago.cgga t caatagitt Catagcgtaa tictgtc.gcc gga atttctic 6 O <210s, SEQ ID NO 19 &211s LENGTH: 60 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide <4 OOs, SEQUENCE: 19 gagalaatticc ggcgacagca ttacgctatgaactatt.cga t ccggctg.cg cgaggct tcc 6 O <210s, SEQ ID NO 2 O &211s LENGTH: 34 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence & 22 O FEATURE; <223> OTHER INFORMATION: Synthetic polynucleotide <4 OOs, SEQUENCE: 2O tatic tagagg atccttitt cq agcatgcctt atcc 34 <210s, SEQ ID NO 21 &211s LENGTH: 34 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide <4 OOs, SEQUENCE: 21 tatictagaaa gcttalactitt gaagcggatt ggtg 34 <210s, SEQ ID NO 22 &211s LENGTH: 60 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide <4 OOs, SEQUENCE: 22 ttitttgttcg toggtgctgtt tot cqcctta cattacacgt ttctittctgg gcttgaaatt 6 O <210s, SEQ ID NO 23 &211s LENGTH: 60 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic polynucleotide <4 OOs, SEQUENCE: 23 aatttcaa.gc ccagaaagaa acgtgtaatg taaggcgaga aac agcacca Caacaaaaa 6 O US 2017/01 07160 A1 Apr. 20, 2017 6. The biofertilizer of claim 1, wherein the one or more 13. The biofertilizer composition of claim 11, wherein the nitrogen-fixing rhizobia are nitrogen-fixing rhizobia natu one or more nitrogen-fixing bacteria comprise at least one rally incapable of producing Cls hopanoids and genetically Bradyrhizobium. engineered to include a set of genes enabling production of 14. The biofertilizer composition of claim 11, wherein the Cs hopanoids by the one or more nitrogen-fixing rhizobia. one or more nitrogen-fixing bacteria comprise Rhizobium 7. The biofertilizer of claim 5, wherein the one or more etli, Rhizobium leguminosarum, Mesorhizobium loti, nitrogen-fixing rhizobia comprise Rhizobium etli, Rhizo Sinorhizobium meliloti, Azorhizobium caulinodans, and bium leguminosarum, Mesorhizobium loti, Sinorhizobium Ochrobactrum anthropi. meliloti, Azorhizobium caulinodans, and Ochrobactrum 15. The biofertilizer composition of claim 9, wherein the anthropi. vehicle is a carrier selected from the group consisting of 8. A method to provide the biofertilizer for a leguminous peat, Vermiculite, lignite powder, clay, talc, rice bran, seed, plant of claim 1, the method comprising rock phosphate pellet, charcoal, soil, paddy Straw compost, providing one or more candidate nitrogen-fixing rhizobia wheat bran, gum Arabic, methylethylcellulose. Sucrose solu strains: tions, vegetable oils and a mixture thereof. detecting among the one or more candidate nitrogen 16. The biofertilizer composition of claim 11, further fixing rhizobia strains, at least one rhizobia Strain comprising one or more Cs hopanoids. capable of producing Cls hopanoids; and 17. The biofertilizer composition of claim 16, wherein the providing the at least one rhizobia Strain capable of one or more Cs hopanoids comprise the one or more Cs producing Cls hopanoids in a form Suitable for admin hopanoids having a formula of (I) (I) istration to a leguminous plant or seed or soil Surround wherein ing a leguminous plant or seed. C22, C31, C33 and C34 have independently R or S 9. The method of claim 8, further comprising providing chirality; the at least one rhizobia strain in combination with one or R. R. R. and R are independently selected from H. D. more carrier allowing increased stability, viability and/or methyl, or ethyl groups; effectiveness of the nitrogen-fixing bacteria gas exchange of R. R. R. and Rs are selected from H. D. methyl, the one or more nitrogen-fixing rhizobia. hydroxymethyl, aminomethyl, hydroxyl, or amino 10. A method to provide biofertilizer for a leguminous groups, wherein at least three of the R. R. R. and Rs plant of claim 1, the method comprising groups each contains hydroxymethyl, aminomethyl, genetically engineering a nitrogen-fixing rhizobia Strain hydroxyl, or amino groups; incapable of producing Cls hopanoids to introduce Cs R is selected from OH, NH, hydroxymethyl, aminom synthesis genes thus providing a genetically engineered ethyl, formula (II) nitrogen-fixing rhizobia Strains capable of producing Cs hopanoids; and providing the genetically engineered nitrogen-fixing Formula (II) rhizobia strains in a form suitable for administration to a leguminous plant or seed, and/or a soil Surrounding leguminous plant or seed thus providing the biofertil izer for the leguminous plant. 11. A biofertilizer composition for a leguminous plant, the biofertilizer composition comprising one or more biofertilizers essentially consisting of one or more nitrogen-fixing rhizobia capable of producing Cs hopanoids of claim 1 together with an acceptable vehicle. in which in a wavy line on the ring carbon indicates a R 12. The biofertilizer of claim 11, wherein the acceptable or S chirality of the ring carbon, vehicle is a carrier allowing increased stability, viability m and m are independently 0 or 1: and/or effectiveness of the nitrogen-fixing bacteria gas R. R. R. R. and Rs are selected from OH, NH, exchange of the one or more nitrogen-fixing rhizobia. hydroxymethyl, or aminomethyl groups wherein R, US 2017/01 07160 A1 Apr. 20, 2017 46 R22, R2, R24 and R2s contain at least one NH2 or for a time and under conditions allowing interaction of the aminimethyl groups and one of R and Rs is one or more Cs hopanoids with the nitrogen-fixing rhizobia hydroxymethyl, or aminomethyl groups. in the administered biofertilizer and/or biofertilizer compo 18. The biofertilizer composition of claim 16, wherein the sitions. one or more Cs hopanoids comprise at least one Cs 23. A method of fertilizing a leguminous plant, the hopanoid selected from the group consisting of bacterio method comprising hopanetetrol (BHT) and aminobacteriohopanetriol, coating and/or inoculating one or more seeds of the 2-methyl bacteriohopanetriol, aminobacteriohopanetriol, leguminous plant with one or more biofertilizer essen bacteriohopanetetrol, 2Me-aminobacteriohopanetriol, tially consisting of one or more nitrogen-fixing rhizobia adenosylhopane, and 2Me-bacteriohopanetetrol. capable of producing Cls hopanoids, in a form Suitable 19. A seed of a leguminous plant coated and/or inoculated for administration to the one or more seeds of the with the biofertilizer of claim 1. leguminous plant. 20. The coated seed of claim 19, wherein the leguminous 24. The method of claim 23, the method further compris plant is soybean (Glycine max). ing 21. A method of fertilizing a leguminous plant, the coating and/or inoculating one or more Cs hopanoids method comprises before the coating and/or inoculating the one or more applying one or more biofertilizer to a leguminous plant seeds of the leguminous plant with the one or more or soil Surrounding a leguminous plant for a time and biofertilizer. under conditions to allow Symbiosis of the nitrogen 25. A system to fertilize leguminous plants, the system fixing rhizobia with the leguminous plant, comprising one or more biofertilizer and/or biofertilizer wherein the one or more biofertilizer essentially con compositions herein described and one or more Cs sisting of one or more nitrogen-fixing rhizobia hopanoids for simultaneous, sequential or combined use in capable of producing Cs hopanoids, in a form Suit fertilizing a leguminous plant. able for administration to the leguminous plant, 26. A system to fertilize a leguminous plant, the system and/or for administration to a soil Surrounding the comprising one or more leguminous seed coated with one or leguminous plant. more biofertilizer and/or biofertilizer composition herein 22. The method of claim 21, wherein applying the one or described and one or more Cs hopanoids for simultaneous, more biofertilizer is performed in combination with one or sequential or combined use in fertilizing a leguminous plant. more Chopanoids, and wherein the applying is performed