Phylogenetic Relationships and Morphology of the Pristimantis Leptolophus Species Group

Zootaxa 4243 (1): 042–074 ISSN 1175-5326 (print edition) http://www.mapress.com/j/zt/ Article ZOOTAXA Copyright © 2017 Magnolia Press ISSN 1175-5334 (online edition) https://doi.org/10.11646/zootaxa.4243.1.2 http://zoobank.org/urn:lsid:zoobank.org:pub:B4D35FB5-BC82-426C-BFCF-4EEF4D6EAFE6 Phylogenetic relationships and morphology of the Pristimantis leptolophus species group (Amphibia: Anura: Brachycephaloidea), with the recognition of a new species group in Pristimantis Jiménez de la Espada, 1870

GUSTAVO A. GONZÁLEZ-DURÁN1, MARIANE TARGINO2, MARCO RADA2 & TARAN GRANT2,3 1Instituto de Ciencias Naturales, Laboratorio de Anfibios, Universidad Nacional de Colombia, Bogotá, Colombia, 111321 2Instituto de Biociências, Universidade de São Paulo, São Paulo, SP, Brazil, 05508-090 3Corresponding author. E-mail: [email protected]

Abstract

We evaluate the monophyly and phylogenetic relationships of the Pristimantis leptolophus species group and describe its external morphology, osteology, and some myological characteristics. We also compare the P. leptolophus species group to other related species groups. The P. leptolophus group is not monophyletic due to the inclusion of P. acatallelus, formerly believed to be part of the P. devillei group. The revised P. leptolophus group is composed of nine named species and six unnamed species. Based on our results, we recognize a new species group, the P. boulengeri species group, composed of eight species, many of which were previously assigned to the P. lacrimosus species group.

Key words: Craugastoridae, myology, osteology, phylogeny, systematics, terrarana

Introduction

With 494 species of Neotropical, direct-developing frogs (Frost, 2016), Pristimantis Jiménez de La Espada, 1870 is the richest genus of vertebrates. The largest phylogenetic analysis of the genus included only approximately 33% (160 species, Mendoza et al. 2015), meaning that the phylogenetic relationships of most species have never been tested. Padial et al. (2014a, b) recognized 11 species groups, although most species were not assigned to any group. Three species groups have not been included in any phylogenetic analysis: the Pristimantis bellona, P. leptolophus, and P. loustes species groups. The characters used to diagnose these species groups areunderstudied, rendering the taxonomic placement of newly described species tentative and frequently erroneous without genetic data (Padial et al., 2014a). The Pristimantis leptolophus group was proposed by Lynch (1991) as an explicitly phenetic assemblage lacking known synapomorphies. The group currently comprises eight species distributed in the Cordillera Central and northern Cordillera Occidental of Colombia: P. leptolophus (Lynch, 1980), P. peraticus (Lynch, 1980), P. maculosus (Lynch, 1991), P. parectatus (Lynch and Rueda-Almonacid, 1997), P. scoloblepharus (Lynch, 1991), P. uranobates (Lynch, 1991), P. lasalleorum (Lynch, 1995), and P. stictus (González-Durán, 2016). As noted by Lynch (1991), species of the P. leptolophus group resemble the species of the P. myersi group. Hedges et al. (2008) proposed a phenotypic diagnosis for the Pristimantis leptolophus group following those of Lynch (1991) and Lynch and Duellman (1997): 1) small size (female snout–vent length [SVL] < 30 mm); 2) robust bodies, narrow heads, short snouts, moderately long legs; Finger I shorter than Finger II, Toe V much longer than Toe III, extending to distal edge of distal subarticular tubercle on Toe IV; 3) digital discs expanded; 4) tympanic membrane and annulus usually present but weakly defined (tympanic membrane and annulus absent in P. peraticus); 5) cranial crests absent; 6) vocal slits and vomerine teeth present. Nevertheless, these characters do not permit the unequivocal assignment of species to the P. leptolophus group, and variation within the species of the group is not discussed, i.e., some species/individuals lack some or all the character states.

42 Accepted by J. Padial: 19 Jan. 2017; published: 14 Mar. 2017 Herein, we test the monophyly of the Pristimantis leptolophus group, the relationships among its species, and its relationship with other species and species groups of Pristimantis based on evidence from DNA sequences. Additionally, we review the morphological characters purported to diagnose the P. leptolophus group and discuss the evolution of some phenotypic characters.

Methods

DNA Sequences. We sequenced fragments of different length of the mitochondrial H-strand transcription unit 1 (H1), one comprising partial 12S rRNA, complete tRNAval and partial 16S rRNA (~1500−2400 bp), and other comprising only partial 16S rRNA (~580−1000 bp). For a subset of samples we also sequenced exons of three nuclear genes: recombination activating gene 1 (RAG-1), tyrosinase precursor gene (TYR), and proopiomelanocortin A (POMC). Primers are listed in Table 1 and specimens and GenBank numbers in Appendices 1 and 2.

TABLE 1. Primers employed in this study for PCR and DNA sequencing. F = forward, R = reverse. Gene Primer name Primer sequence (5’-3’) Source region 12S MVZ59 (F) ATAGCACTGAAAAYGCTDAGATG Graybeal, 1997 12S F-H (R) CTTGGCTCGTAGTTCCCTGGCG Goebel et al., 1999 12S A-L (F) AAACTGGGATTAGATACCCCACTAT Goebel et al., 1999 MVZ50 (R) TYTCGGTGTAAGYGARAKGCTT Graybeal, 1997 L13 (F) TTAGAAGAGGCAAGTCGTAACATGGTA Feller and Hedges (1998) 16S Titus I (R) GGTGGCTGCTTTTAGGCC? Titus and Larson (1996) L2A (F) CCAAACGAGCCTAGTGATAGCTGGTT Hedges (1994)? H10 (R) TGATTACGCTACCTTTGCACGGT Hedges (1994) AR (F) CGCCTGTTTATCAAAAACAT Palumbi et al. (1991) BR (R) CCGGTCTGAACTCAGATCACGT Palumbi et al. (1991)? POMC POMC 1 (F) GAATGTATYAAAGMMTGCAAGATGGWCCT Wiens et al. (2005) POMC 2 (R) TAYTGRCCCTTYTTGTGGGCRTT Wiens et al. (2005) RAG RAG1FF2 (F) ATGCATCRAAAATTCARCAAT Heinicke et al. (2007) RAG1FR2 (R)CCYCCTTTRTTGATAKGGWCATA Heinicke et al. (2007) TYR TYR1F (F) GTTGTYGTATCTACCTCRCC Heinicke et al. (2007) TYR1R (R) GMAGGGAATGGTGAARTTCTC Heinicke et al. (2007)

Whole cellular DNA was extracted from ethanol-preserved tissues, liver or thigh muscle, with the DNeasy (QIAGEN, Valencia, CA) isolation kit. Amplification was carried out in a 25μl reaction using the Thermo Scientific PCR Master Mix (2X) (Thermo Fisher Scientific Inc., USA). For the amplifications, the PCR program included an initial denaturing step of 30s at 96°C, followed by 35 (mitochondrial gene fragments) or 45 (nuclear gene fragments) cycles of amplification (96°C for 30 s; 48–54°C for 30 s; 60°C for 60s), with a final extension step at 60°C for 7 min. For low-yielding samples, the annealing temperature was lowered to 46°C. PCR amplification products were cleaned using the Agencourt AMPure XP DNA Purification and Cleanup kit (Beckman Coulter Genomics, Brea, CA, USA), and sequenced by a third party using fluorescent-dye labelled terminators (ABI Prism Big Dye Terminators v. 1.1 cycle sequencing kits; Applied Biosystems, Foster City, CA, USA) with an ABI 3730XL (Applied Biosystems, Foster City, CA, USA). All samples were sequenced in both directions to check for potential errors. Chromatograms obtained from the automated sequencer were read and contigs made using the sequence editing software Sequencher 5.2.3. (Gene Codes, Ann Arbor, MI, USA). Complete sequences were edited and pairwise distances calculated with Geneious v.6.1.6 (Kearse et al., 2012). In addition to data generated in this study, we included data for those loci and the following additional loci from GenBank (Appendix I): The protein coding mtDNA genes cytochrome b (cytb), cytochrome c oxidase

PHYLOGENY OF THE PRISTIMANTIS LEPTOLOPHUS SPECIES GROUP Zootaxa 4243 (1) © 2017 Magnolia Press · 43 subunit I (COI), and NADH dehydrogenase subunit II (ND2) and intervening tRNAcyst, and the nuclear protein- coding genes cellular myelocytomatosis (c-myc; exon two), chemokine receptor 4 (CXCR4), histone H3 (HH3), sodium-calcium exchanger 1 (NCX1), rhodopsin (Rhod), seven-in-absentia (SIA), and solute carrier family 8 member 3 (SLC8A3). In cases in which museum vouchers were not available from either GenBank or the respective publications, we use either the identifiers provided by the original authors or the last name of the first author of the publication. Taxon sampling. We obtained new DNA sequence data from 19 individuals representing seven named species of the Pristimantis leptolophus group and five unnamed species in process of description. Additional sequences representing 114 species of Pristimantis, including different species groups, were obtained from GenBank, mostly provided in studies by Pinto-Sanchéz et al. (2012), García-R. et al. (2012), Mendoza et al. (2015), and Mahecha et al., an unpublished study carried out in the Instituto de Ciencias Naturales (ICN), Universidad Nacional de Colombia, which generated sequences of COI and 16S. These sequences are available on GenBank, but it was not possible to locate the vouchers in the ICN amphibian collection, so the identities were not corroborated. Only specimens with at least one fragment of H1 mitochondrial region sequenced were used here. Based on our quality control assessment we excluded several sequences from GenBank, as follows: From Mahecha et al. we excluded the cytochrome b sequences from Pristimantis lutitus (JDL 26126), P. anolirex (JDL 26115), P. merostictus (JDL 26125), P. eriphus (JJM 210), and P. w-nigrum (DM 1235) because they are almost identical while showing 4–7% distance between the first three specimens, and 18.7% distance in 16S between the two last specimens, as well as the terminals of P. boulengeri (MAV 257) and P. simoterus (CAP 823) because their 16S and cytochrome b sequences are almost identical (99% sequence identity), which suggests problems with either species identification or sample contamination. From Pinto-Sanchez et al. (2012) we excluded the terminal of P. zophus (Andes 54), because there are two other terminals of the same species, and because its COI is identical to that of two specimens of P. paisa (MHUA 4811 and Andes 466). Both P. paisa specimens were retained but their COIs were excluded. Sequences of 12S and 16S from Pinto-Sanchez et al. (2012) present areas of gaps that are not present in any other sequences available from GenBank or any of the sequences generated by us. Since these areas correspond to variable sites in these markers, they were probably excluded from their analysis and the edited sequences mistakenly uploaded to GenBank. Blocks of homologous portions of these genes were constructed in order to accommodate these incomplete sequences in our analyses. Nine of the 11 recognized species groups were sampled in the analysis; DNA sequences were only unavailable for the Pristimantis bellona and P. loustes species groups. Based on the most recent analysis of Brachycephaloidea and analyses that sampled the group (Padial et al. 2014a and 2014b; Pyron et al. 2014), representatives of all other genera of Craugastoridae except Ceuthomantis and “Eleutherodactylus” bilineatus were sampled as outgroups. Specifically, we included Barycholos pulcher, Bryophryne cophites, Craugastor augusti, Craugastor rhodopis, Euparkerella brasiliensis, Haddadus binotatus, Holoaden bradei, Hypodactylus dolops, Lynchius flavomaculatus, Noblella lochites, Oreobates choristolemma, Oreobates pereger, Phrynopus bracki, Psychrophrynella usurpator, Strabomantis biporcatus, Tachiramantis prolixodiscus, Yunganastes ashkapara, Yunganastes pluvicanorus, with Strabomantis biporcatus used to root the topology. Tissues collected by us were preserved in 95% ethanol following euthanization using 1% benzocaine; specimens were subsequently preserved in 10% formalin and stored in 70% ethanol. Tissues and specimens were deposited in the collection of amphibians from the Instituto de Ciencias Naturales (ICN), Universidad Nacional de Colombia, Bogotá. Additional tissues were obtained by Wilmar Bolivar (WB) and Jhon Jairo Ospina-Sarria (JJS). Phylogenetic Analysis. The choice of optimality criteria is an objective procedure that should rely on strong philosophical and theoretical foundations. We employed phylogenetic parsimony (Kluge, 2001), a non-parametric, non-statistical method of historical inference that selects as optimal the hypotheses of cladistic and patristic relationships that maximize explanatory power by minimizing the number of causal events required to explain the data (Kluge and Grant 2006; Grant and Kluge 2009). Its justification is anchored by the anti-superfluity principle (Barnes 2000; Baker 2003) and Popperian refutationism (Popper 1959; 1983). Following the arguments of Padial et al. (2014a; see also Kluge and Grant, 2006; Grant and Kluge, 2009), we employed tree-alignment (e.g., Sankoff, 1975; Wheeler, 1996; Varón and Wheeler, 2012, 2013) in POY 5.1.1 (Wheeler et al. 2015), which tests hypotheses of nucleotide homology dynamically by optimizing unaligned DNA sequences directly onto alternative topologies (Kluge and Grant, 2006; Wheeler et al. 2006; Grant and Kluge,

44 · Zootaxa 4243 (1) © 2017 Magnolia Press GONZÁLEZ-DURÁN ET AL. 2009). Accordingly, the optimal alignment is selected objectively according to the same optimality criterion used to select the optimal topology (Wheeler 1996; 2003a), i.e., homology provides the explanation for the nucleotide diversity instead of structural or functional similarity (Padial et al. 2014a). All compute-intensive analyses were executed using the Museu de Zoologia da Universidade de São Paulo’s high- performance computing cluster Ace, which consists of 12 quad-socket AMD Opteron 6376 16-core 2.3 GHz CPU, 16MB cache, 6.4 GT/s compute nodes (= 768 cores total), eight with 128Gb RAM DDR3 1600 MHz (16 × 8 Gb), two with 256 Gb (16 × 16 Gb), and two with 512Gb (32 × 16 Gb), and QDR 4X InfiniBand (32 Gb/s) networking. Analyses included several steps. First, using the standard direct optimization algorithm (Wheeler, 1996), we ran 15 searches of 6 h each on 704 CPUs (giving a total of 63360 CPU-hours) using the command “search,” which implements a driven search composed of random addition sequence Wagner builds, Subtree Pruning and Regrafting (SPR) and Tree Bisection and Reconnection (TBR) branch swapping (RAS + swapping; Goloboff, 1996), Parsimony Ratcheting (Nixon, 1999), and Tree Fusing (Goloboff, 1999), storing the shortest trees from each independent run and performing a final round of Tree Fusing on the pooled trees. Next, we performed 1000 rounds of Tree Fusing of the optimal trees from the 15 driven searches, also using the standard direct optimization algorithm. We then used the exact iterative pass algorithm (Wheeler, 2003a) to calculate the cost of the optimal trees identified in the previous analyses and generate the matrix version of the tree-alignment (i.e., the implied alignment; Wheeler, 2003b) of the optimal tree. Finally, we performed 1320 RAS + TBR of the implied alignment, holding up to 5 trees per replicate, to search for additional optimal trees. Once we found the optimal trees, we estimated clade support (Grant and Kluge, 2008a) using the Goodman- Bremer measure (GB; Goodman et al. 1982; Bremer, 1988; Grant and Kluge, 2008b) by determining the difference in length between the optimal tree and all trees visited during a TBR swap of that tree using the corresponding implied alignment. As in any heuristic analysis, the resulting GB values should be interpreted as upper bounds. Although it is possible shorter suboptimal trees would be found by calculating the optimal tree-alignment for each visited topology, the time requirements would be prohibitive unless each search was made extremely superficial. Further, Padial et al. (2014) found that using the implied alignment to estimate support overestimates GB values considerably less than when GB is calculated using a MAFFT (Katoh et al. 2005) similarity-alignment, showing that this heuristic is more rigorous than standard support analyses. Morphology. The terminology for the mandibular depressor muscle was modified from Griffiths (1954), Starret (1968), Savage (1987) and Lynch (1993) regarding the origin of group of fibers: from the annulus tympanicus (AT), otic ramus of the squamosal (SQ), posterior portion of the squamosal inserted in the musculus levator posterior longus (SQp), or dorsal fascia overlying scapula (DF). Osteological characters/character-states were scored from cleared and stained specimens deposited in the amphibian collections of the Instituto de Ciencias Naturales of the Universidad Nacional de Colombia (ICN), Museo de Herpetologia of the Universidad de Antioquia (MHUA), the University of Kansas Natural History Museum and Biodiversity Research Center (KU), and Field Museum of Natural History (FMNH). Additional osteological observations were based on specimens collected by Juan Daza (JMD), Sergio Escobar (SEL) and Belisario Cepeda (BCQ), all of which are in the process of being deposited in permanent institutional collections. Additional specimens were cleared and stained using Alcian Blue and Alizarin Red following Taylor and Van Dyke’s (1985) protocol. Examined specimens are listed in Appendix III. Ossification is usually more extensive in adult females of Pristimantis species than in adult males. As such, to avoid conflating non-equivalent semaphoronts, only adult females were used to score osteological characters. All illustrations were made using a camera lucida coupled to a Wild Heerbrugg stereomicroscope. Osteological terminology is that of Duellman and Trueb (1986), Trueb (1973), Guayasamin (2004), Duellman and Lehr (2009), and González-Durán (2016). Fingers are numbered preaxially to postaxially from I to IV. Although this is not consistent with the hypothesis that digit I of other tetrapods was lost in amphibians, it is consistent with usage in Pristimantis taxonomy. We scored the length of Toe V relative to Toe III following Lynch and Duellman (1997): A) Toe V shorter than III; B) Toe V longer than III, but not reaching the distal subarticular tubercle of Toe IV; C) Toe V much longer than III. Vocal sac terminology follows Boulenger (1896) and Liu (1935). Characterization of the exposure of the frontoparietal fontanelle follows the states/characters suggested by Faivovich (2002). Recently, Heinicke et al. (2015) reported a “posterior frontoparietal fontanelle” (e.g., p. 161) in Tachiramantis. Although the condition of the frontoparietals they refer to entails a valid character-state, it is unrelated to the frontoparietal fontanelle and instead refers to a large, irregularly shaped posterior gap between the frontoparietals.

The concatenated implied alignment has a total of 5866 transformation series. Our driven searches performed 19066 RAS + TBR, 20341 rounds of Tree-Fusing, and 5181 rounds of Ratcheting. Following additional Tree- Fusing, iterative pass optimization, and swapping of the implied alignment, we obtained 108 most parsimonious trees of 24341 steps. The strict consensus between all most parsimonious trees is presented in Figures 1 and 2. A complete TBR swap of one of the optimal tree-alignments visited 711286 trees, which were used to calculate GB values for each node. The differences between the most parsimonious trees involve the relationships of Pristimantis lutitus and P. nervi cus to P. carranguerorum + P. l ynchi , P taeniatus (MC 11208) and P. taeniatus (NRPS 0016) to P. yukpa + P. taeniatus (CJD 069), and three internal nodes in P. leptolophus species group discussed below. The monophyly of Pristimantis is supported in the optimal cladograms (GB = 9), and Yunganastes is corroborated as its sister group (GB = 20). Our analysis supports Craugastor + Haddadus, Phrynopus (Lynchius + Oreobates), Bryophryne (Barycholos + Noblella), relationships that were also supported by Padial et al. (2014a), Pyron (2014a), and Heinicke et al. (2015). We recover Holoaden and Euparkerella as sister taxa, as reported previously by Canedo et al. (2012) and Pyron (2014). All other relationships in our optimal trees differ from those of previous analysis. Tachiramantis is recovered as sister group of Hypodactylus, whereas Heinicke et al. (2015) found support for a sister group relationship with a clade formed by Psychrophrynella, Holoaden, Bryophryne, Noblella, and Barycholops. Within Pristimantis, the P. danae species group was the only group sampled whose monophyly was corroborated (GB = 31). The P. danae group is sister group of a clade composed of Venezuelan species, formerly not referred to any species group, and both clades are the sister group of the P. conspicillatus group. The P. conspicillatus, P. ridens, P. lacrimosus, P. myersi and P. devillei species groups were not monophyletic, and P. galdi and P. chalceus species groups were sampled with one species each in the analysis. Monophyly of the Pristimantis conspicillatus species group is corroborated (GB = 17; Fig. 1), albeit with the exclusion of P. carranguerorum (MC 10866) and P. peruvianus (MC 11718); these sequences were deposited in GenBank by Mahecha et al. and we were unable to examine voucher specimens to confirm their identity (see Materials and Methods). The P. ridens species group is not monophyletic because P. moro (AJC 1753) and P. jorgevelosai (JDL 26123) (vouchers not examined) are not closely related to the group. The remaining species of the P. ridens species group form a clade with GB = 12. The six included species of the P. lacrimosus species group were placed in three different clades: Pristimantis schultei + P. bromeliaceus related to P. gal di ; P. acuminatus sister group of P. supernatis + P. thymelensis, and P. brevifrons, P. boulengeri and P. dorsopictus recovered in other clade together with P. angustilineatus. The sequence of P. acuminatus (MC 1555) sampled here is from Mahecha et al. and its position is highly divergent from the position of the P. acuminatus sampled by Padial et al. (2014a), QCAZ 19664, which in their tree-alignment + parsimony analysis is related to P. cf. mendax and P. bromeliaceus, both of which are members of the P. lacrimosus species group; vouchers of these specimens were not examined. Monophyly of the P. myersi species group was not corroborated because P. hectus and P. thymelensis (QCAZ 16428) fall outside the clade. The other four sampled species of this group (P. festae, P. leoni, P. ocreatus, and P. pyrrhomerus) form a clade (GB = 7). Similarly, monophyly of the P. devillei species group was refuted because of the position of P. acatallelus, recovered inside the P. leptolophus species group. The other 10 species form a clade with GB = 13 (Fig. 2). Within Pristimantis, some species were found to be non-monophyletic, including P. achatinus, P. ockendeni, P. pardalis, P. savagei, P. taeniatus, P. zophus, and P. w-nigrum. Pinto-Sánchez et al. (2012) obtained the same results of non-monophyly for P. zophus (NRPS0071–72) and P. pardalis (KRL0690, AJC0188). Pristimantis taeniatus is tested here with the specimens from Pinto-Sanchéz et al. (2012), who found the species to be monophyletic; however, our analysis does not support the monophyly of this species because one of the specimens is more closely related to P. yukpa, a species not included by Pinto-Sanchéz et al. (2012). Sequences of P. savagei NRPS0085 and JJM111 (from Pinto-Sanchéz et al. [2012] and Mahecha et al., respectively) are not each other’s closest relatives. Pristimantis achatinus is tested here with two specimens from Mendoza et al. (2012; UVC15867 and UVC15953), also not each other’s closest relatives, and one from Pinto-Sanchéz et al. (2012; AJC0573), which clusters with UVC 15953. Mendoza et al. (2012) also found P. achatinus to be non-monophyletic, with P. lymani (not included here) nested within the clade. Pristimantis w-nigrum is tested here using two specimens taken from the studies of Mendoza et al. (2012; UVC15923) and the unpublished work of Mahecha et al., (DM1235), which are paraphyletic with respect to P. thectopternus. Insofar as we have not examined the corresponding voucher specimens, we cannot determine if these results owe to identification errors or problems in species delimitation.

46 · Zootaxa 4243 (1) © 2017 Magnolia Press GONZÁLEZ-DURÁN ET AL. FIGURE 1. First part of the consensus tree showing the phylogenetic relationships of Brachycephaloidea as recovered by the 108 most parsimonious trees obtained with direct optimization (length 24341 steps) under equal weights for all transformations. Institutional collection codes follow Sabaj-Pérez (2014). Values above nodes are Goodman-Bremer support.

PHYLOGENY OF THE PRISTIMANTIS LEPTOLOPHUS SPECIES GROUP Zootaxa 4243 (1) © 2017 Magnolia Press · 47 FIGURE 2. Second part of the consensus tree showing the phylogenetic relationships of Brachycephaloidea (Pristimantis myersi, P. leptolophus, P. boulengeri, P. devillei species group and unassigned species) as recovered by the 108 most parsimonious trees obtained with direct optimization (length 24341 steps) under equal weights for all transformations. Institutional collection codes follow Sabaj-Pérez (2014). Photos by Marco Rada, John Lynch and Giovany Chaves. Values above nodes are Goodman-Bremer support.

As noted previously, the monophyly of the Pristimantis leptolophus group was refuted due to the placement of P. acatallellus inside the clade. Pristimantis acatallelus was formerly placed in the P. devillei group by Lynch and Duellman (1997), which was followed by Hedges et al. (2008) and Padial et al. (2014a). Mendoza et al. (2015) found P. acatallellus to be sister species of P. capitonis, which was not included here because only COI is available for that species. Pristimantis acatallelus is here included in the P. leptolophus species group. The sister clade of the Pristimantis leptolophus species group is composed of P. angustilineatus, P. boulengeri, P. brevifrons, P. dorsopictus, P. myops, and P. quantus (Fig. 1). Pristimantis angustilineatus, P. myops, P. quantus were previously placed in the P. unistrigatus group (Lynch and Duellman, 1997) but were not assigned to any species group by Padial et al. (2014a). In turn, P. dorsopictus, P. boulengeri and P. brevifrons were assigned to P. lacrimosus group (Lynch and Duellman, 1997; Padial et al. 2014a). These clades of the P. leptolophus group and species related to P. boulengeri are sister to a clade containing P. devillei + P. myersi species group, P. verecundus + P. celator and P. jubatus. Based on these topological results, herein we redefine and characterize the Pristimantis leptolophus species group after briefly proposing a new species group for its sister clade, as follows.

Content (Fig. 2). Eight recognized species: Pristimantis angustilineatus (Lynch, 1998), P. baiotis (Lynch, 1998), P. boulengeri (Lynch, 1981), P. brevifrons (Lynch, 1981), P. dorsopictus (Rivero & Serna, 1988), P. myops (Lynch, 1998), P. quantus (Lynch, 1998), and P. urani (Rivera-Correa & Daza, 2016). Distribution. The species are known from the Cordillera Occidental of Colombia (from Munchique National Park to north of the Orquideas National Park, at elevations of 1780–2610 m) and along the Cordillera Central of Colombia (from Cauca Department to Antioquia Department, 2500–3200 m). Morphological diagnosis. Males with vocal slits and external vocal sac. Dorsolateral folds absent (with exception of Pristimantis quantus). Ventral skin coarsely areolate. Parietal peritoneum covered by iridophores (condition unknown in P. quantus and P. myops). Nuptial pads present on Finger I (absent in P. myops). Ulnar tubercles present (with exception of P. brevifrons). Tip of snout with small papilla. Double distal subarticular tubercle on Finger III (polymorphic in P. brevifrons). Double distal subarticular tubercle present on Finger IV (polymorphic in P. brevifrons and P. boulengeri). Heel tubercle present (with exception of P. angustilineatus). Finger I shorter than Finger II. Digital discs expanded and round, except in Finger I and Toe I in P. myops, P. quantus and P. brevifrons. Toe V much longer than Toe III, reaching level of distal subarticular tubercle of Toe IV. Cranial crests absent. SQp portion of m. depressor mandibulae reaching dorsally to level of optic ramus of squamosal. We propose as putative synapomorphies 1) presence of a double distal subarticular tubercle on Finger III, 2) presence of a double distal subarticular tubercle on Finger IV, 3) parietal peritoneum covered by iridophores (unknown in P. myops and P. quantus), 4) extended external vocal sac; and 5) tip of the snout with small papilla. Comments. Pristimantis brevifrons, P. boulengeri and P. dorsopictus were species of the P. lacrimosus group, which is not monophyletic according to our results. Hedges et al. (2008) included three of the 18 species then placed in the P. lacrimosus group, and those three species also form a clade in our results. Hedges et al. (2008) characterized the group as arboreal and commonly inhabiting bromeliads. Pinto-Sánchez et al. (2012) found the species group to be paraphyletic, with P. brevifrons falling outside the clade. Padial et al. (2014a) also failed to corroborate the monophyly of the P. lacrimosus group due to the placement of P. acuminatus, a species of P. unistrigatus species group sensu Hedges et al. (2008), inside the group. They transferred this and several other species to the P. lacrimosus group, due to the presence of an acuminate snout, smooth dorsal skin, and round and ovate finger and toe discs, bringing the total number of species to 25. Mendoza et al. (2015) sampled more specimens of P. brevifrons and also recovered this species outside the P. lacrimosus species group, but also found P. moro to be placed inside the group. Rivera-Prieto et al. (2015) included P. dorsopictus in their analysis and found it to be placed outside the P. lacrimosus species group. Heinicke et al. (2015) sampled P. prolixodiscus, then a member of the P. lacrimosus species group and, finding that species to fall outside Pristimantis, designated it as the type species of their new genus Tachiramantis. Rivera-Correa and Daza (2016) found P. lacrimosus group to be paraphyletic, noting that the species formed two clades (their clades A and B). They also describe a new species, P. urani, as the sister of P. brevifrons according to their phylogenetic hypothesis. DNA sequences are unavailable for Pristimantis lacrimosus and its phylogenetic position has never been tested. Lynch and Schwartz (1971) redescribed P. lacrimosus, and Heyer and Hardy (1991) designated the specimen figured by Lynch and Schwartz (1971) as neotype. Neither the figure nor the redescription show double distal subarticular tubercles on Fingers III or IV, putative synapomorphies of the P. boulengeri group, proposed herein. On that basis, we hypothesize that P. lacrimosus is not part of this clade, which is the reason we propose the P. boulengeri group as a new group. DNA sequences are also unavailable for Pristimantis baiotis and its phylogenetic position also has not been tested, so it is here tentatively allocated based on putative morphological synapomorphies, especially the double subarticular tubercles (Lynch, 1998). The description of P. urani was published (Rivera and Daza, 2016) after analyses for the present study had been completed. As such, we include it in the P. boulengeri group on the basis of Rivera and Daza’s (2016) phylogenetic analysis. The Pristimantis boulengeri and P. leptolophus species groups form a monophyletic group with GB = 21. Pristimantis brevifrons, P. angustilineatus, P. boulengeri, and P. dorsopictus can inhabit bromeliads (Lynch, 1981; Lynch, 1998; Rivero and Serna, 1988).

Content (Fig. 2 and 3). Nine named species, six unnamed species, five in process of description: Pristimantis acatallelus (Lynch and Ruiz-Carranza, 1983), P. leptolophus (Lynch, 1980), P. lasalleorum (Lynch, 1995), P. maculosus (Lynch, 1991), P. parectatus (Lynch and Rueda-Almonacid, 1998), P. peraticus (Lynch, 1980), P. scoloblepharus (Lynch, 1991), P. stictus González-Durán, 2016, P. uranobates (Lynch, 1991), Pristimantis sp. 1, Pristimantis sp. 2, Pristimantis sp. 3, Pristimantis sp. 4, Pristimantis sp. 5 and Pristimantis sp. 6. Distribution. Cordillera Central (Puracé National Park to Parámos de Belmira, 2300–3900 m) and Cordillera Occidental (Munchique National Park to Páramo de Urrao, 2000–3850 m) of Colombia. Morphological diagnosis. The Pristimantis leptolophus group is diagnosed by the following morphological character-states: Males with vocal slits (except Pristimantis sp. 1). Vocal sac internal (except in P. acatalellus P. leptolophus and Pristimantis sp. 3). Dorsolateral folds or scapular ridges present. Ventral skin coarsely areolate. Ulnar tubercles present. Heel tubercle and tubercles on outer edge of tarsus present. Inner tarsal fold short. Eyelid tubercles conical, subconical or small warts. Finger I shorter than Finger II. Digital discs expanded except on Finger I, which is narrow. Toe V much longer than Toe III, almost reaching distal edge of distal subarticular tubercle on Toe IV. Digital discs on toes expanded (narrow on Toe I in P. peraticus). Frontoparietal fenestra almost entirely hidden, visible only between the narrow space between the parallel frontoparietals, frontoparietal crests absent (Fig. 4b, d, e). Anterior margin of optic fenestra ossified (Fig. 4c, e) (cartilaginous in P. acatallelus and Pristimantis sp. 1 as in Fig. 4a, polymorphic in P. maculosus, P. peraticus, P. scoloblepharus, P. uranobates as in Fig. 4e). Dorsal fascia slip (DF) of m. depressor mandibulae absent (present in P. scoloblepharus, Pristimantis sp. 1, and Pristimantis sp. 5). Squamosal flap of m. depressor mandibulae short, overlapping otic ramus of squamosal (SQ). Posterior fibers of squamosal slip of m. depressor mandibulae originating from m. levator posterior longus at level of otic ramus of squamosal (SQp). Only one character-state is proposed as putative synapomorphy: 1) Posterior fibers of squamosal slip of m. depressor mandibulae (SQp) at the level of otic ramus of squamosal (Table 2, Fig. 5d, f). Morphological characterization. External morphology. Species of the Pristimantis leptolophus group are small–medium in size, SVL < 27.8 mm in females and 20.3 mm in males (except P. acatallelus, maximum SVL = 31.7 mm in females, 27.2 mm in males; Lynch and Ruiz-Carranza, 1983). Snout short, subacuminate or round in dorsal view, rounded or protruding in lateral profile. Tip of snout with small papilla in some specimens, mostly males (P. leptolophus, P. stictus, Pristimantis sp. 3, and P. scoloblepharus). Canthus rostralis concave. Adult males with vocal slits (absent in Pristimantis sp. 1), vocal sac internal (external in P. acatalellus, P. leptolophus, Pristimantis sp. 3). Nuptial pads on Finger I present in P. lasalleorum, P. maculosus, P. scoloblepharus, P. uranobates, Pristimantis sp. 1, and Pristimantis sp. 4, absent in P. acatallelus, P. leptolophus, P. parectatus P. peraticus, P. stictus, Pristimantis sp. 2, Pristimantis sp. 3, and Pristimantis sp. 5. Dorsolateral folds complete, thick in P. uranobates, P. scoloblepharus, P. lasalleorum, Pristimantis sp. 4, and Pristimantis sp. 5, thin in P. acatallelus, P. stictus, P. leptolophus; polymorphic in P. parectatus, P. peraticus, Pristimantis sp. 3; incomplete, row of tubercles reaching level of sacrum in P. maculosus and Pristimantis sp. 2 (polymorphic in P. parectatus; only scapular ridges present in Pristimantis sp. 1). Ventral skin coarsely areolate. Ulnar tubercles small, subconical. Tubercles present on heel and outer edge of tarsus. Inner tarsal fold short. Supernumerary plantar tubercles present. Upper eyelid tubercles conical (P. lasalleorum, P. parectatus, P. scoloblepharus and P. uranobates), subconical (P. leptolophus, P. peraticus, Pristimantis sp. 1, Pristimantis sp. 2, Pristimantis sp. 3, Pristimantis sp. 4 and Pristimantis sp. 5), or forming small warts (P. maculosus). Finger I shorter than Finger II, fingers with expanded round digital discs, except Finger I. Relative length of fingers: I < II < IV < III. Lateral fringes on fingers and toes present (less developed in Pristimantis sp. 3, absent in P. parectatus). Length of toes IV > V > III > II > I. Toe V is much longer than toe III, extending near distal edge of distal subarticular tubercle on Toe IV. Digital discs expanded and round (except on toe I in P. peraticus). Cranium (Fig. 4). In dorsal view, the sphenethmoid is concave posteriorly and hidden dorsally by the frontoparietal. Anteriorly, it reaches, but is not overlapped, by the nasals (except in Pristimantis acatallelus and Pristimantis sp. 1, Fig. 4b). In ventral view, the anterior margin of optic fenestra is ossified (cartilaginous in P. acatallelus and Pristimantis sp. 1, Fig. 4a, polymorphic in P. maculosus, P. peraticus, P. scoloblepharus, and P. uranobates, Fig. 4e). Anteroventrally, it is overlapped by the vomers. The nasals are separated medially (Fig. 4d, e) (except in P. acatallelus and Pristimantis sp. 1, in which they are in contact, Fig. 4b). The maxillary process of the

50 · Zootaxa 4243 (1) © 2017 Magnolia Press GONZÁLEZ-DURÁN ET AL. FIGURE 3. Species of P. leptolophus group: A) Pristimantis leptolophus, adult female (ICN7061; photo: J.D. Lynch). B) P. acatallelus, adult female (ICN7224; photo: J.D. Lynch). C) P. stictus, adult female (ICN55702). D) P. maculosus, adult female (ICN55760; photo: H. Arias). E) P. parectatus, adult female (ICN55764). F) P. peraticus, adult female (ICN55767). G) P. scoloblepharus, adult female (ICN55768). H) P. uranobates, adult female (ICN55770).

PHYLOGENY OF THE PRISTIMANTIS LEPTOLOPHUS SPECIES GROUP Zootaxa 4243 (1) © 2017 Magnolia Press · 51 FIGURE 4. Skulls. A, B) Ventral and dorsal view of Pristimantis acatallelus (ICN28978, female; scale bar: 2 mm and 5 mm, respectively). C, D) Ventral and dorsal view of P. leptolophus (ICN7033, female; scale bar: 2 mm and 2.5 mm, respectively). E, F) Ventral and dorsal view of P. uranobates (ICN22738, female; scale bar: 2.5 mm). nasal does not approximate the preorbital process of the maxilla. The frontoparietal crests are absent and the frontoparietal fontanelle is almost hidden (Fig. 4b, d, f). Posterolaterally, the frontoparietal extends to the level of, but do not overlap, the epiotic eminence of the prootic (Fig. 4b, d, f). The frontoparietal and prootic are separate, not fused. The cultriform process of the parasphenoid does not reach the level of the palatines and vomers; it almost reaches the palatines, lying just posterior to them (Fig. 4a, c, e). The otic ramus of the squamosal contacts the cartilaginous crista parotica and does not reach the otoccipital. The stapes (= columella auris) is present

52 · Zootaxa 4243 (1) © 2017 Magnolia Press GONZÁLEZ-DURÁN ET AL. (absent in P. peraticus). The vomers are separated medially. The prechoanal process is triangular, poorly developed, and laterally oriented. The postchoanal process is narrow and pointed (Fig. 4b, d, f). The dentigerous process of the vomer is elongate and narrow, directed posteromedially, extending posteriorly but not reaching the palatine. Pristimantis leptolophus, P. lasalleorum, and P. stictus bear oblique keels on the vomers and lack odontophores and teeth (Fig. 4c) (as defined by González-Durán, 2016), whereas P. uranobates, P. peraticus, P. parectatus, P. maculosus, P. scoloblepharus, Pristimantis sp. 3, and Pristimantis sp. 4 bear a small odontophore with a few teeth (Fig. 4a), and P. acatallelus and Pristimantis sp. 1 have triangular odontophores with a transverse row of teeth (Fig. 4a). The palatine contacts the maxilla and sphenethmoid. The pterygoid is triradiate and the anterior ramus contacts the maxilla, being longer than the posterior and medial rami. Hyobranchial apparatus. The hyoid plate is cartilaginous, bearing posterolateral processes directed posteriorly and ossified posteromedial processes. The anterolateral processes are absent, except in Pristimantis stictus, where it may be absent or present. The hyales are thin and reach the ventral part of the otic capsule. They bear anterior processes, which are as long as the length of the hyoid plate.

FIGURE 5. Musculus depressor mandibulae drawings, scale bars: 2 mm. A) Pristimantis buckleyi (ICN21843, female). B) P. curtipes (ICN22199, female). C) P. devillei (ICN10734, female). D) P. leptolophus (ICN41835, female). E) P. myersi (BCQ827, female). F) P. scoloblepharus (ICN55769, female).

PHYLOGENY OF THE PRISTIMANTIS LEPTOLOPHUS SPECIES GROUP Zootaxa 4243 (1) © 2017 Magnolia Press · 53 Axial skeleton. The vertebral column has eight procoelous, presacral vertebrae. This condition varies intraspecifically in some species in which the eighth vertebra and sacrum are fused in some specimens (e.g., P. uranobates, ICN 29876; P. stictus, ICN 55717; P. leptolophus, ICN 6745, 25925; P. peraticus, ICN 40777). The vertebrae have complete neural arches and low neural processes. The relative lengths of the transverse processes and sacral diapophyses are: III ≈ Sacrum > IV > II ≈ V ≈ VI ≈ VII ≈ VIII. The sacral diapophyses are slightly expanded distally. The urostyle has a well-developed dorsal ridge that extends along half its length. The phalangeal finger formula is 2-2-3-3, and phalangeal toe formula is 2-2-3-4-3. The proximal phalanx of Toe IV is less than or equal to half the length of Metacarpal IV, which causes the distal phalanx of toe V to reach the base of the penultimate phalanx of Toe IV. Depressor mandibulae musculature. (Fig. 5, Table 2). The group of fibers originating from the otic ramus of the squamosal (SQ) has a small flap overlapping the otic ramus (SQ1) (Fig. 5 d, f). The fibers with origin on the posterior region of the squamosal (SQp), originate on the m. levator posterior longus at the level of the otic ramus of the squamosal (SQp1) (Fig. 5d, f)). Additionally, there are no fibers with origin in the dorsal fascia over the scapula (DF2) (except in P. scoloblepharus, Pristimantis sp. 1, and Pristimantis sp. 5, Fig. 5f).

TABLE 2. Character states of the Musculus depressor mandibulae muscle. Fibers originating in otic ramus of squamosal (SQ), 0: fibers insert in the otic ramus of squamosal without flap, 1: fibers form a small dorsal flap overlapping the squamosal, 2: extensive flap over squamosal. Fibers originating in posterior portion of squamosal in m. levator posterior longus (SQP), 0: absence of fibers originating from m. levator posterior longus, 1: fibers originating on m. levator posterior longus to the level of otic ramus of squamosal. 2: fibers originating on m. levator posterior longus to upper level of otic ramus of squamosal. Fibers originating in dorsal fascia overlying scapula (DF), 0: well extended group of fibers with insertion in the dorsal fascia of scapula, 1: discrete and slender group of fibers inserting in the dorsal fascia, 2: absence of fibers originating on dorsal fascia overlying scapula.

Species SQ SQP DF P. leptolophus 112 P. peraticus 112 P. uranobates 112 P. scoloblepharus 111 P. maculosus 112 P. lasalleorum 112 P. parectatus 112 P. stictus 112 Pristimantis sp. 1 1 1 1 Pristimantis sp. 2 1 1 2 Pristimantis sp. 3 1 1 2 Pristimantis sp. 4 1 1 1 P. boulengeri 222 P. brevifrons 221 P. angustilineatus 221 P. dorsopictus 222 P. myops 122 P. quantus 122 P. devillei 022 P. buckleyi 020 P. curtipes 020 P. duellmani 021 P. myersi 002 P. ocreatus 102 P. leoni 102

According to the topology, the related groups of Pristimantis leptolophus group are the P. devillei, P. myersi, and P. boulengeri species groups and the unassigned species P. celator, P. verecundus, and P. jubatus. These species share morphological similarities and are distributed in the northern Andes of Ecuador and Colombia. Therefore, a comparison with the three species groups is here presented. External morphology. A character used in the diagnosis of species groups of Brachycephaloidea is the length of Toe V relative to Toe III, as defined by Lynch and Duellman (1997). In the Pristimantis myersi group, Toe V is shorter than Toe III (Type A of Lynch and Duellman, 1997) in P. myersi, P. ocreatus, P. repens, and P. trepidotus, whereas it is only slightly longer than Toe III (Type B of Lynch and Duellman, 1997) in P. floridus, P. hectus, and P. leoni, in which Toe V slightly surpasses the medial subarticular tubercle of Toe IV (Lynch, 1991; Lynch, 1994; Lynch and Duellman, 1997). In the P. devillei group, Toe V is only slightly longer than Toe III (Type B of Lynch and Duellman, 1997), with the exception of P. thymalopsoides, described by Lynch and Duellman (1997) as possessing Type C, in which Toe V reaches the level of at least the proximal margin of the distal subarticular tubercle of Toe IV. Like P. thymalopsoides, the P. boulengeri and P. leptolophus groups have the Type C condition. Lynch and Duellman (1997) characterized all members of the former P. orcesi and P. unistrigatus species group as having the Type C condition, but these groups are highly polyphyletic (Hedges et al., 2008). All species of the Pristimantis leptolophus group except Pristimantis sp. 1 have vocal slits, but most do not possess an external vocal sac (except in P. acatalellus, P. leptolophus, and Pristimantis sp. 3). In contrast, all species of the P. boulengeri group have both vocal slits and an expanded, external vocal sac. Species of the P. devillei group do not have vocal slits or a vocal sac (vocal slits and external vocal sac present in P. silverstonei) and species of the P. myersi group present vocal slits and an internal vocal sac (vocal slits absent in P. floridus and P. xeniolum). Nuptial pads are present on Finger I of the Pristimantis leptolophus group, except in P. acatallelus, P. leptolophus, P. parectatus, P. peraticus, P. stictus, Pristimantis sp. 2, Pristimantis sp. 3, and Pristimantis sp. 4. Most species possess nuptial pads in the P. boulengeri group, with the exception of P. myops, and the P. devillei group, with exception of P. cacao, P. devillei, P. gentry, P. hamiotae, P. romanorum, P. silvertonei, P. siopelus, P. surdus, and P. susaguae. Species of the P. myersi group do not usually have nuptial pads, the only exception being P. myersi. Dorsolateral folds are present in most species of the Pristimantis leptolophus species group. Only P. quantus presents dorsolateral folds in the P. boulengeri group, whereas the P. devillei group has fleshy dorsolateral folds in all species except P. cacao, P. chrysops, P. xylocobates, and P. xestus. Species of the P. myersi group lack dorsolateral folds. In the Pristimantis leptolophus species group, only scapular ridges occur in Pristimantis sp. 1. In the P. boulengeri group, P. myops has scapular folds. Several species of the P. myersi group have paravertebral, scapular and sagittal folds (P. bicantus, P. hectus, P. leoni, P. gladiator, P. repens, P. festae, P. munozi, and P. ocreatus). In Pristimantis leptolophus group some individuals (mostly males) of P. leptolophus, P. stictus, Pristimantis sp. 3, and P. scoloblepharus can have a protuberance on the tip of the snout. All species of the P. boulengeri group have a pointed tip or papilla on the snout. No species of the P. myersi (except P. bicantus and P. leoni) or P. devillei group present a protuberance on the tip of the snout. The Pristimantis leptolophus group has fingers with expanded, round, digital discs, except Finger I. Species of the P. myersi group can be distinguished by their narrow digital discs. In the P. devillei group the discs on the digits are expanded and round (P. devillei and P. duellmani) or narrow (P. buckleyi and P. curtipes). All species of the P. boulengeri group have expanded digital discs. Osteology. The P. leptolophus species group is characterized by the frontoparietal fontanelle being almost hidden (equivalent to “not exposed” of most authors, e.g., Guayasamin 2004; Padial et al. 2007) because of the median proximity of the frontoparietals, which do not contact each other (Fig. 4b, d, f). As an ontogenetic state of incomplete ossification of the frontoparietals, in juveniles and subadults we also observed a large, irregularly shaped, posterior gap between the frontoparietals, similar to that reported in Tachirimantis prolixodiscus by Heinicke et al. (2015). The frontoparietal fontanelle is almost hidden in different groups of Brachycephaloidea, which some authors (e.g., Guayasamin 2004) have suggested has value in delimiting species and species groups; however, the homology of the character-state has never been tested phylogenetically. This character-state has been

PHYLOGENY OF THE PRISTIMANTIS LEPTOLOPHUS SPECIES GROUP Zootaxa 4243 (1) © 2017 Magnolia Press · 55 reported in species of Yunganastes (Padial et al. 2007) and the P. orcesi species group, as well as P. lynchi, P. vicarius, and P. pseudoacuminatus (Guayasamin, 2004). All species of the Pristimantis devillei species group included in our analysis present cranial crests. We did not include P. cacao, P. chrysops, P. hamiotae, P. romanorum, P. satagius, P. silverstonei, P. siopelus, P. sobetes, P. sulculus, P. susaguae, P. xestus, and P. xylochobates. All species confirmed by any phylogenetic analysis, including the present study, as pertaining to the P. devillei species group, present cranial crests, including P. buckleyi, P. curtipes, P. devillei, P. duellmani, P. gentry, P. quinquagesimus, P. surdus, P. thymalopsoides, P. truebae, and P. vertebralis. Among the untested species of the P. devillei species group, all have cranial crests except P. romanorum, P. silverstonei, and P. susaguae, accordingly to their original descriptions (Lynch and Ruiz-Carranza, 1996; Rueda-Almonacid et al. 2003; Yánez-Muñoz et al. 2010). The P. leptolophus species group lacks cranial crests, and although cranial crests were reported in the description of P. peraticus (Lynch, 1981), they were not observed in any individual of this species in the present study, including specimens collected near the type locality. Cranial crests of frontoparietals are also present in the P. bellona and P. loustes species groups, as well as a few other species (e.g., P. galdi, P. torrenticola, P. tribulosus; Lynch and Duellman, 1997). The shape of the vomer is distinctive in some Pristimantis species groups because the dentigerous processes may be absent or present, more or less developed, and with different numbers of teeth. Some species of the P. leptolophus group have an elongation of the dentigerous process leading to the formation of a keel embedded in the mucosa of the mouth and lack odontophores, including P. stictus, P. leptolophus, and P. lasalleorum (González- Durán, 2016). This keel and absent odontophores were also observed in the P. boulengeri species group (P. myops, P. quantus, P. dorsopictus, and some individuals of P. brevifrons) and the P. myersi species group (P. floridus¸ P. xeniolum and some individuals of P. myersi). The larger species of the P. leptolophus group have large odontophores and large transversal row of teeth (e.g., P. acatallelus and Pristimantis sp. 1). Depressor mandibulae musculature (Table 2, Fig. 5). The Pristimantis boulengeri and P. devillei species groups present the posterior portion of the squamosal slip (SQp) dorsally past the level of the otic ramus of the squamosal (SQp2) (see Table 2, Fig. 5a, b, c), whereas the P. myersi group does not present the SQp portion (SQp0, Fig. 5e), and in species of the P. leptolophus group the SQp slip is at the same level as the otic ramus of squamosal (SQp1, Fig. 5d, f). Among the species of the P. devillei and P. myersi species groups we studied, only P. ocreatus and P. leoni present the flap in the SQ portion (SQ1). In the P. boulengeri group, only P. brevifrons and P. angustilineatus present the DF portion (DF1).

Discussion

Phylogenetic relationship of the Pristimantis leptolophus species group and comments on related groups The Pristimantis leptolophus group was not recovered as strictly monophyletic in our analysis due to the position of P. acatallelus inside the group (Fig. 1). As such, we refer P. acatallelus to the P. leptolophus group based on its phylogenetic position and shared characteristics (i.e., posterior portion of SQ slip at same level as the otic ramus of the squamosal, dorsolateral folds present, “C” condition of Toe V). Lynch and Duellman (1997) included the species in the P. devillei group; however, the results of Mendoza et al. (2015) suggest it is the sister species of P. capitonis. Pristimantis capitonis was not included in the present analysis because only a single gene (COI) was available for it on GenBank. Pristimantis capitonis was referred to the P. unistrigatus group by Lynch (1998), which was followed by Hedges et al. (2008), and was not referred to any species group by Padial et al. (2014a). It possesses dorsolateral folds, lacks the DF portion of the m. depressor mandibulae, the posterior portion of the SQ slip (SQp) is at the same level as the otic ramus of the squamosal, and its odontophores are triangular with a transverse row of teeth, as in P. acatallelus and Pristimantis sp. 1. These characters and the analysis of Mendoza et al. (2015) suggest that P. capitonis might also be part of the P. leptolophus species group, but additional evidence and analyses are necessary to corroborate this hypothesis. In the Pristimantis leptolophus species group, P. lasalleorum, Pristimantis sp. 4, P. peraticus and Pristimantis sp. 5 comprise a monophyletic group distributed exclusively in páramos at elevations > 3200 m. The sister species P. uranobates and P. scoloblepharus both occur in the northern region of the Cordillera Central (Tolima, Caldas, and Antioquia Departments) and are distributed allopatrically, with P. scoloblepharus in Antioquia and P. uranobates in Tolima, Risaralda, and Caldas. Pristimantis sp. 1 is sister to all other species of the P. leptolophus

56 · Zootaxa 4243 (1) © 2017 Magnolia Press GONZÁLEZ-DURÁN ET AL. species group (Fig. 1). This species lacks dorsolateral folds and vocal slits, which are present in all other species of the group. The vocal sac is present in all species of the P. leptolophus, P. boulengeri, and P. myersi species groups, as well as P. verecundus, P. celator, P. hectus, and P. jubatus, so its absence in Pristimantis sp. 1 is autapomorphic. Both Pristimantis sp. 1 and P. acatallelus are larger species with more developed odontophores and a transverse row of teeth; however, P. acatallelus is more closely related to Pristimantis sp. 2 and P. leptolophus, both smaller species with no or few teeth in a round formation. Also, the anterior margin of optic fenestra is cartilaginous in these species. In other species of the P. leptolophus group, the anterior margin of the optic fenestra is ossified, but this is polymorphic in some species (e.g., P. maculosus, P. peraticus, P. scoloblepharus, and P. uranobates). Nuptial pads are absent in many species of the P. leptolophus group. Their presence in the P. boulengeri group (except P. myops) and Pristimantis sp. 1 show that the absence of nuptial pads is a synapomorphic character of P. leptolophus species group minus Pristimantis sp. 1, with three independent internal reappearances. Sequences of the terminals Pristimantis permixtus (CAP 765; identified as P. permixtus by Mahecha et al.) and P. uranobates (MAV 258) were obtained from the unpublished study of Mahecha et al. We were unable to find either voucher specimen, which prevented us from confirming their identities. Pristimantis permixtus currently is not referred to any species group (Padial et al. 2014a). It does not present dorsolateral folds or vocal slits, and it is a large species with an extensive DF slip of the m. depressor mandibulae, well-developed nasal, adjacent frontoparietals, and elongate vomers. According to Lynch (1979) and Lynch et al. (1994), P. permi xtus resembles P. supernatis. Also, comparisons to sequences of P. permixtus from the type locality (data not shown), the topology and genetic distances (see Table 3; Fig. 2) indicate that Pristimantis permixtus CAP 765 actually corresponds to an undescribed species of the P. leptolophus species group, here named Pristimantis sp.6. Pristimantis uranobates (MAV 258) of Mahecha et al. (labeled Pristimantis sp. 5 MAV 258 in our tree) presents 1.2% distance in 16S from Pristimantis sp. 5 (Table 2 and Fig. 2). Based on its position and genetic distance we hypothesize they are conspecific. DNA sequences of the three specimens of Pristimantis sp. 1 are identical and, therefore, collapse into a polytomy. The other two polytomies in the P. leptolophus species group are composed of P. acatallelus, P. leptolophus and Pristimantis sp. 2, and P. lasalleorum, Pristimantis sp. 4, and Pristimantis sp. 6 (CAP 765). Although these species form polytomies, each can be validated as different species by morphology and genetic distances (Table 3). Regarding the outgroup species, we recovered a clade composed of P. verecundus + P. celator as sister clade of the P. devillei species group (GB = 6). In previous studies, these species were the sister clade of the P. myersi species group (Hedges et al. 2008, Padial et al. 2014a, Rivero-Prieto et al. 2014, Mendoza et al. 2015). These two species were previously members of the P. unistrigatus species group (Lynch and Duellman, 1997) but are not referred to any species group presently (Padial et al. 2014a). Further analysis including additional characters and taxa may better define the position of these species. The same may be necessary to stabilize the position of P. jubatus and P. hect us. Pristimantis thymelensis was included in the P. myersi species group (sensu Padial et al. 2014a); however, other studies contradict this result (Hedges et al. 2008; Pinto-Sanchéz et al. 2012; Mendoza et al. 2015). Ortega- Venegas et al. (2014) included the two specimens of P. thymelensis available in Genbank, QCAZ 16428 and WED 53004. QCAZ 16428 is grouped with P. eriphus, P. chloronotus, and P. supernatis, whereas WED 53004 is placed in the P. myersi species group as sister of P. ocreatus (cf. Padial et al. 2014a). WED 53004 has 1% of distance in the H1 fragment from P. ocreatus KU 208508 and 14% to the other P. thymelensis QCZA 16428. There is clearly a problem in the identification of these specimens. Pristimantis celator, P. jubatus, and P. verecundus are not placed in any species-group. Further studies are necessary to better evaluate their phylogenetic position and the composition of P. myersi and P. devillei species groups. Relevant characters. Some osteological character states might be useful to delimit species groups, such as the degree of exposure of the frontoparietal fontanelle, the size of the sphenethmoid, and the overlap of the sphenethmoid and the nasals. Savage (1987) discussed the usefulness of the m. depressor mandibulae to delimit different groups of Brachycephaloidea; however, its utility was rejected for use in systematics by Lynch (1993) due to extensive variation. Nevertheless, and based on our review of four groups of Pristimantis, we conclude that: 1) the m. depressor mandibulae revealed a useful character (i.e. posterior part of SQ, SQ flap, and DF; Fig, 5) that is almost invariable in some clades, with the DF portion and posterior part of SQ being absent in the species of P. myersi group (P. leoni, P. myersi, P. ocreatus) but present in the P. devillei (P. duellmani, P. buckleyi, P. curtipes)

PHYLOGENY OF THE PRISTIMANTIS LEPTOLOPHUS SPECIES GROUP Zootaxa 4243 (1) © 2017 Magnolia Press · 57 and P. boulengeri groups (DF portion present in P. brevifrons and P. angustillineatus). In the P. leptolophus group, some states of the m. depressor mandibulae (absence of DF portion, presence of SQ flap and SQ posterior part) occur almost invariably: the DF portion of m. depressor mandibulae independently appears in P. scoloblepharus, Pristimantis sp. 1, and Pristimantis sp. 5. There is still a need for additional studies of this character system in Brachycephaloidea, which might provide morphological synapomorphies for clades and better understanding of morphological evolution.

TABLE 3. Percent uncorrected pairwise genetic distances for 16S rDNA gene (ca., 580 bp) among the Pristimantis leptolophus species group. 123456789101112131415116 1: P. lasalleorum – ICN55758 2: Pristimantis sp. 2 4.6 – ICN55759 3: P. maculosus 4.2 5.1 – ICN55760 4: P. peraticus 2.2 5.1 4.0 – ICN55765 5: P. peraticus 2.9 6.0 4.8 1.3 – WB1301 6: P. parectatus 4.8 5.0 3.6 3.8 4.4 – ICN55763 7: P. parectatus 4.2 4.9 3.5 3.5 4.0 1.0 – ICN55762 8:P. scoloblepharus 3.85.54.23.74.05.24.8– ICN55768 9: Pristimantis sp. 1 4.2 5.5 4.4 3.5 4.6 5.2 4.8 2.9 – JJS122 10: Pristimantis sp. 4 2.7 5.5 3.5 2.0 2.3 3.8 3.8 2.9 3.5 – ICN55774 11: Pristimantis sp. 3 2.4 4.0 3.1 2.0 2.7 3.6 3.3 2.6 3.5 2.2 – ICN55756 12: Pristimantis sp. 5 3.5 6.2 4.1 1.9 2.7 3.6 3.9 4.3 3.7 2.5 2.5 – ICN55775 13: P. uranobates 3.96.24.53.73.94.44.54.54.53.13.52.7– ICN55770 14: P. uranobates 3.15.73.82.93.34.64.33.53.52.22.62.51.4– ICN55771 15: P. acatallelus 6.06.45.85.86.07.46.66.24.66.75.66.65.95.2– UVC15863 16: Pristimantis sp. 5 4.67.15.23.32.75.14.85.24.83.73.91.24.03.57.1– MAV258 17: Pristimantis sp. 6 4.06.95.03.12.95.65.45.05.03.53.72.55.44.27.32.2 CAP765

Lynch and Duellman (1997: 42) emphasized the relative lengths of Toes III and V as “a character of systematic importance.” Within the clade composed of these four groups (Pristimantis boulengeri, P. devillei, P. leptolophus,

58 · Zootaxa 4243 (1) © 2017 Magnolia Press GONZÁLEZ-DURÁN ET AL. and P. myersi), the length of Toe V is variable. Toe V is shorter in the P. myersi group than other groups (reaching or slightly exceeding the penultimate subarticular tubercle of Toe IV), Toe V is longer in species of the P. devillei group than in the P. myersi group (reaching the middle part between the penultimate and distal subarticular tubercle of Toe IV), and P. leptolophus and P. boulengeri groups have a much longer Toe V than the P. devillei and myersi groups (Toe V reaches the distal or proximal part of distal subarticular tubercle of Toe IV in P. leptolophus and P. boulengeri groups) (Lynch, 1994; Lynch and Duellman, 1997; Hedges et al. 2008). Unknown and cryptic diversity in the Pristimantis leptolophus species group. The Pristimantis leptolophus group is a small clade distributed in the northern Andes of Colombia. However, the diversity of the group is still poorly studied and there are probably more species to be discovered. In this preliminary analysis we found five unnamed species in the north section of Cordillera Central, but south of Cordillera Central and the páramos of the Cordillera Occidental are areas of Colombia that are poorly sampled. Based on our revision of scientific collections we estimate that there are five more undescribed species that have not yet been included in phylogenetic analysis due to the lack of DNA-quality tissue samples. According to genetic distances, by comparing 16S sequences equivalent to the fragment of ~580 bp amplified by the AR–BR primer pair, pairwise distances between species of the Pristimantis leptolophus group vary between 1.9–7.3% (Table 3). The specimen identified as P. leptolophus (JJS 093) does not have the fragment amplified by AR–BR, but presents a distance of 4% from Pristimantis sp. 2 (ICN 55759) in a portion of the 16S gene equivalent to that amplified by primers L2A–H10. All three specimens identified as Pristimantis sp. 1 have the same haplotype, as do the two specimens of P. scoloblepharus. However, this is not the case for P. uranobates, which is a polymorphic, broadly distributed species; the specimens sampled in this study represent to three localities, Pensilvania and El Cedral from Caldas Department and Ucumarí from Risaralda Department, and the genetic distance is 1.4–1.8% between these three specimens. Another noteworthy result derived from the comparisons of genetic distances includes the unexpected variation between the two specimens of P. peraticus and the two specimens of P. parectatus. There is a distance of 1.3% and 1.0%, respectively, between these samples from Herrera, Tolima Department, and Palmira, Valle del Cauca Department, and Aguadas, Caldas Department and Sonsón, Antioquia Department. More studies are necessary to better understand the status of these populations.

Acknowledgments

Humberto Piñeros, Giovanny Chaves, Fernando Castellanos, Jhonathan Vanegas and Jonathan Castellanos provided assistance during fieldwork. Sandy Arroyo, Juan Manuel Daza, Hector Fabio Arias, Jhon Jairo Ospina- Sarria, Wilmar Bolivar, Wolfgang Buitrago, and Marvin Anganoy-Criollo shared specimens and tissue samples. Andrew Crawford and Nelsy Pinto Sánchez provided information on voucher specimens and sequences. Johana Echeverry Garzón, Armando Herrera Caicedo, and Felipe Cardona Toro provided logistical support in PNN Selva de Florencia. For comments, discussions and revision of early versions of the manuscript we are grateful to Sandy Arroyo, John D. Lynch, Teddy Angarita, Pedro G. Dias, and Pedro Henrique dos Santos Dias. Photographs of specimens in life were taken by P.M. Ruiz-Carranza (deceased) and J.D. Lynch. This study was supported by Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq Proc. 305234/2014-5), Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP Procs. 2012/10000-5, 2012/09401-5, 2015/14959-3) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES/PNPD Proc. 2016.1.263.41.6). Collection of amphibians in Colombia was authorized by the Ministerio de Ambiente, Vivienda y Desarrollo Territorial (ANLA Resolutions 255 of 2014 and 701 of 2016) and Parques Nacionales Naturales (Autorización de Recolección en Parques Nacionales Naturales No. 006 of 2015).

References

Baker, A. (2003) Quantitative parsimony and explanatory power. The British Journal for the Philosophy of Science, 54 (2), 245–259. https://doi.org/10.1093/bjps/54.2.245 Barnes, E.C. (2000) Ockham's Razor and the Anti-Superfluity Principle. Erkenntnis, 353–374.

PHYLOGENY OF THE PRISTIMANTIS LEPTOLOPHUS SPECIES GROUP Zootaxa 4243 (1) © 2017 Magnolia Press · 59 https://doi.org/10.1023/A:1026464713182 Bremer, K. (1994) Branch support and tree stability. Cladistics, 10 (3), 295–304. https://doi.org/10.1111/j.1096-0031.1994.tb00179.x Boulenger, G.A. (1897) The tailless batrachians of Europe. printed for the Ray Society, London, 264 pp. https://doi.org/10.5962/bhl.title.52023 Duellman, W.E. & Trueb, L. (1994) Biology of Amphibians. Johns Hopkins University Press, Baltimore, Maryland, 670 pp. Duellman, W.E. & Lehr, E. (2009) Terrestrial-breeding frogs (Strabomantidae) in Peru. Nature und Tier Verlag, Münster, 384 pp. Frost, D.R. (2016) Amphibian Species of the World: an Online Reference. Version 6.0. American Museum of Natural History, New York, USA. Available from: http://research.amnh.org/herpetology/amphibia/index.html (accessed 19 June 2016) García-R, J.C., Crawford, A.J., Mendoza, Á.M., Ospina, O., Cardenas, H. & Castro, F. (2012) Comparative phylogeography of direct-developing frogs (Anura: Craugastoridae: Pristimantis) in the southern Andes of Colombia. PLOS ONE, 7 (9), e46077, 1–9. https://doi.org/10.1371/journal.pone.0046077 Grant, T. & Kluge, A.G. (2008a) Clade support measures and their adequacy. Cladistics, 24 (6), 1051–1064. https://doi.org/10.1111/j.1096-0031.2008.00231.x Grant, T. & Kluge, A.G. (2008b) Credit where credit is due: the Goodman–Bremer support metric. Molecular Phylogenetics and Evolution, 49 (1), 405–406. https://doi.org/10.1016/j.ympev.2008.04.023 Grant, T. & Kluge, A.G. (2009) Perspective: Parsimony, explanatory power, and dynamic homology testing. Systematics and Biodiversity, 7 (4), 357–363. https://doi.org/10.1017/S147720000999017X Goloboff, P.A. (1996) Methods for faster parsimony analysis. Cladistics, 12 (3), 199–220. https://doi.org/10.1111/j.1096-0031.1996.tb00009.x Goloboff, P.A. (1999) Analyzing large data sets in reasonable times: solutions for composite optima. Cladistics, 15 (4), 415– 428. https://doi.org/10.1111/j.1096-0031.1999.tb00278.x González-Durán, G.A. (2016) A new small frog species of the genus Pristimantis (Anura: Craugastoridae) from the northern Paramos of Colombia. Zootaxa, 4066 (4), 421–437. https://doi.org/10.11646/zootaxa.4066.4.4 Goodman, M., Weiss, M.L. & Czelusniak, J. (1982) Molecular evolution above the species level: Branching pattern, rates, and mechanisms. Systematic Zoology, 31 (4), 376–399. https://doi.org/10.2307/2413365 Griffiths, I. (1954) On the “otic element” in Amphibia Salientia. Proceedings of the Zoological Society of London, 124 (1), 35– 50. https://doi.org/10.1111/j.1096-3642.1954.tb01476.x Guayasamin, J.M. (2004) The Eleutherodactylus orcesi species group (Anura: Leptodactylidae): comparative osteology and comments on its monophyly. Herpetological Monographs, 18 (1), 142–174. https://doi.org/10.1655/0733-1347(2004)018[0142:TEOSGA]2.0.CO;2 Hedges, S.B., Duellman, W.E. & Heinicke, M.P. (2008) New World direct-developing frogs (Anura, Terrarana), molecular phylogeny, classification, biogeography, and conservation. Zootaxa, 1737, 1–182. Heinicke, M.P., Duellman, W.E. & Hedges, S.B. (2007) Major Caribbean and Central American frog faunas originated by oceanic dispersal. Proceedings of the National Academy of Sciences, 104 (24), 10092–10097. https://doi.org/10.1073/pnas.0611051104 Heinicke, M.P., Barrio-Amoros, C.L. & Hedges, S.B. (2015) Molecular and morphological data support recognition of a new genus of New World direct-developing frog (Anura: Terrarana) from an under-sampled region of South America. Zootaxa, 3986 (2), 151–172. https://doi.org/10.11646/zootaxa.3986.2.1 Jiménez de la Espada, M. (1871 ‘1870) Fauna neotropicalis species quaedam nondum cognitae. Jornal de Sciências, Mathemáticas, Physicas e Naturaes, 3, 57–65. Katoh, K., Kuma, K.I., Toh, H. & Miyata, T. (2005) MAFFT version 5: improvement in accuracy of multiple sequence alignment. Nucleic acids research, 33 (2), 511–518. https://doi.org/10.1093/nar/gki198 Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Meintjes, P. & Drummond, A. (2012) Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics, 28, 1647–1649. https://doi.org/10.1093/bioinformatics/bts199 Kluge, A.G. (2001) Parsimony with and without scientific justification. Cladistics, 17, 199–210. https://doi.org/10.1006/clad.2001.0164 Kluge, A.G. & Grant, T. (2006) From conviction to antiVsuperfluity: old and new justifications of parsimony in phylogenetic inference. Cladistics, 22 (3), 276–288.

60 · Zootaxa 4243 (1) © 2017 Magnolia Press GONZÁLEZ-DURÁN ET AL. https://doi.org/10.1111/j.1096-0031.2006.00100.x Liu, C. (1935) Types of vocal sac in the Salientia. Proceedings of the Boston Society of Natural History, 41 (3), 19–40. Lynch, J.D. (1979) The identity of Eleutherodactylus vertebralis (Boulenger) with the description of a new species from Colombia and Ecuador (Amphibia: Leptodactylidae). Journal of Herpetology, 13, 411–418. https://doi.org/10.2307/1563475 Lynch, J.D. (1980) New species of Eleutherodactylus of Colombia (Amphibia: Leptodactylidae). I: Five new species from the Paramos of the Cordillera Central. Caldasia, 13 (61), 165–188. Avaliable from: http://www.jstor.org/stable/43406131 (Accessed 13 Mar. 2017) Lynch, J.D. (1981) Two new species of Eleutherodactylus from western Colombia (Amphibia: Anura: Leptodactylidae). Occasional Papers of the Museum of Zoology, University of Michigan, 697, 1–12. Lynch, J.D. (1991) New diminutive Eleutherodactylus from the Cordillera Central of Colombia (Amphibia: Leptodactylidae). Journal of Herpetology, 25 (3), 344–352. https://doi.org/10.2307/1564595 Lynch, J.D. (1993) The value of the m. depressor mandibulae in phylogenetic hypotheses for Eleutherodactylus and its allies (Amphibia: Leptodactylidae). Herpetologica, 49 (1)32–41. Avaliable from: http://www.jstor.org/stable/3892684 (Accessed 13 Mar. 2017) Lynch, J.D. (1994) A new species of high-altitude frog (Eleutherodactylus: Leptodactylidae) from the Cordillera Oriental of Colombia. Revista de la Academia Colombiana de Ciencias Exactas, Fısicas y Naturales, 19, 195–203. Lynch, J.D. (1995) Three new species of Eleutherodactylus (Amphibia: Leptodactylidae) from the Paramos of the Cordillera Occidental of Colombia. Journal of Herpetology, 29 (4), 513–521. https://doi.org/10.2307/1564734 Lynch, J.D. (1998) New species of Eleutherodactylus from the Cordillera Occidental of western Colombia with a synopsis of the distributions of species in western Colombia. Revista de la Academia Colombiana de Ciencias Exactas Físicas y Naturales, 22, 117–148. Lynch, J.D. & Ruiz-Carranza. P.M. (1983) New frogs of the genus Eleutherodactylus from the Andes of southern Colombia. Transactions of the Kansas Academy of Science, 86, 99–112. https://doi.org/10.2307/3628163 Lynch, J.D., Ruiz-Carranza, P.M. & Ardila-Robayo. M.C. (1994) The identities of the Colombian frogs confused with Eleutherodactylus latidiscus (Boulenger) (Amphibia: Anura: Leptodactylidae). Occasional Papers of the Museum of Natural History, University of Kansas, 170, 1–42. Lynch, J.D. & Ruiz-Carranza, P.M. (1996) New sister-species of Eleutherodactylus from the Cordillera Occidental of southwestern Colombia (Amphibia: Salientia: Leptodactylidae). Revista de la Academia Colombiana de Ciencias Exactas, Físicas y Naturales, 20, 347–363. Lynch, J.D. & Duellman, W.E. (1997) Frogs of the genus Eleutherodactylus (Leptodactylidae) in western Ecuador, systematics, ecology, and biogeography. University of Kansas Natural History Museum Special Publications, 23, 1–236. https://doi.org/10.5962/bhl.title.7951 Lynch, J.D. & Rueda-Almonacid, J.V. (1998) New frogs of the genus Eleutherodactylus from the eastern flank of the northern Cordillera Central of Colombia. Revista de la Academia Colombiana de Ciencias Exactas, Físicas y Naturales, 22 (85), 561–570. Mendoza, Á.M., Ospina, O.E., Cárdenas-Henao, H. & García-R, J.C. (2015) A likelihood inference of historical biogeography in the world’s most diverse terrestrial vertebrate genus: Diversification of direct-developing frogs (Craugastoridae: Pristimantis) across the Neotropics. Molecular phylogenetics and evolution, 85, 50–58. https://doi.org/10.1016/j.ympev.2015.02.001 Nixon, K.C. (1999) The parsimony ratchet, a new method for rapid parsimony analysis. Cladistics, 15 (4), 407–414. https://doi.org/10.1111/j.1096-0031.1999.tb00277.x Ortega-Andrade, H.M. & Venegas, P.J. (2014) A new synonym for Pristimantis luscombei (Duellman and Mendelson 1995) and the description of a new species of Pristimantis from the upper Amazon basin (Amphibia: Craugastoridae). Zootaxa, 3895 (1), 031–057. https://doi.org/10.11646/zootaxa.3895.1.2 Padial, J.M., Castroviejo-Fisher, S., Köhler, J., Domic, E. & De la Riva, I. (2007) Systematics of the Eleutherodactylus fraudator species group (Anura: Brachycephalidae). Herpetological Monographs, 21 (1), 213–240. https://doi.org/10.1655/06-007.1 Padial, J.M., Grant, T. & Frost, D.R. (2014a) Molecular systematics of terraranas (Anura: Brachycephaloidea) with an assessment of the effects of alignment and optimality criteria. Zootaxa, 3825 (1), 001–132. https://doi.org/10.11646/zootaxa.3825.1.1 Padial, J.M., Grant, T. & Frost, D.R. (2014b) Corrections to “Padial et al. (2014) Molecular systematics of terraranas (Anura: Brachycephaloidea) with an assessment of the effects of alignment and optimality criteria”. Zootaxa, 3827 (4), 599–600. https://doi.org/10.11646/zootaxa.3827.4.10 Pinto-Sánchez, N.R., Ibáñez, R., Madriñán, S., Sanjur, O.I., Bermingham, E. & Crawford, A.J. (2012) The great American biotic interchange in frogs: Multiple and early colonization of Central America by the South American genus Pristimantis (Anura: Craugastoridae). Molecular Phylogenetics and Evolution, 62 (3), 954–972.

PHYLOGENY OF THE PRISTIMANTIS LEPTOLOPHUS SPECIES GROUP Zootaxa 4243 (1) © 2017 Magnolia Press · 61 https://doi.org/10.1016/j.ympev.2011.11.022 Popper, K.R. (1959) The logic of scientiﬁc discovery. Hutchinson, London, 513 pp. Popper, K.R. (1983) Conjectures and Refutations. The growth of scientific knowledge (essays and lectures). Routledge & Kegan Paul Limited, London, 417 pp. Pyron, R.A. (2014) Biogeographic analysis reveals ancient continental vicariance and recent oceanic dispersal in amphibians. Systematic Biology, 63 (5), 779–797. https://doi.org/10.1093/sysbio/syu042 Rivera-Correa, M. & Daza, J.M. (2016) Molecular phylogenetics of the Pristimantis lacrimosus species group (Anura: Craugastoridae) with the description of a new species from Colombia. Acta Herpetologica, 11 (1), 31–45. https://doi.org/10.13128/Acta_Herpetol-16434 Rivero, J.A. & Serna, M.A. (1988 "1987") Tres nuevas especies de Eleutherodactylus (Amphibia, Leptodactylidae) de Antioquia, Colombia. Caribbean Journal of Science, 23, 386–399. Rivera-Prieto, D.A., Rivera-Correa, M. & Daza-R. J.M. (2014) A new colorful species of Pristimantis (Anura: Craugastoridae) from the eastern flank of the Cordillera Central in Colombia. Zootaxa, 3900 (2), 223–242. https://doi.org/10.11646/zootaxa.3900.2.3 Rueda-Almonacid, J.V., Lynch, J.D. & Galvis, P.A. (2003) Una nueva especie de anfibio (Anura: Leptodactylidae) de los Alrededores de la Sabana de Bogotá, Colombia. Revista de la Academia colombiana de ciencias exactas, físicas y naturales, 27 (104), 461. Sabaj-Pérez, M.H. (2014) Standard symbolic codes for institutional resource collections in herpetology and ichthyology: an Online Reference. Version, 5, 22. Available from: http://asih.org/sites/default/files/documents/resources/ symbolic_codes_for_collections_v5.0_sabajperez_2014.pdf (accessed 13 February 2017) Sankoff, D. (1975) Minimal mutation trees of sequences. SIAM Journal on Applied Mathematics, 28 (1), 35–42. https://doi.org/10.1137/0128004 Savage, J.M. (1987) Systematics and distribution of the Mexican and Central American rainfrogs of the Eleutherodactylus gollmeri group (Amphibia: Leptodactylidae). Fieldiana, 33, 1–57. Starrett, P.A. (1968) The Phylogenetic Significance of the Jaw Musculature in Anuran Amphibians. Ph. D. Dissertation, University of Michigan, Ann Arbor, Michigan. Taylor, W.R. & Van Dyke, G.C. (1985) Revised procedures for staining and clearing small fishes and other vertebrates for bone and cartilage study. Cybium, 9 (2), 107–119. Trueb, L. (1973) Patterns of cranial diversity among the Lissamphibia. In: Hanken, J. & Hall, B.K. (Eds.), The skull. Vol. 2. Patterns of structural and systematic diversity. The University of Chicago Press, Chicago, pp. 255–343. Varón, A. & Wheeler, W.C. (2012) The tree alignment problem. BMC bioinformatics, 13 (1), 293. https://doi.org/10.1186/1471-2105-13-293 Varón, A. & Wheeler, W.C. (2013) Local search for the generalized tree alignment problem. BMC bioinformatics, 14 (1), 1. https://doi.org/10.1186/1471-2105-14-66 Wheeler, W.C., Arango, C.P., Grant, T., Janies, D., Varón, A., Aagesen, L., Faivovich, J., D'Haese, C., Smith, W.L. & Giribet, G. (2006) Dynamic Homology and Phylogenetic Systematics, A Unified Approach Using POY. American Museum of Natural History, New York, 365 pp. Wheeler, W.C., Lucaroni, N., Hong, L., Crowley, L.M. & Varón, A. (2015) POY version 5: phylogenetic analysis using dynamic homologies under multiple optimality criteria. Cladistics, 31 (2), 189–196. https://doi.org/10.1111/cla.12083.x Wheeler, W.C. (1996) Optimization alignment: the end of multiple sequence alignment in phylogenetics?. Cladistics, 12 (1), 1– 9. https://doi.org/10.1111/j.1096-0031.1996.tb00189.x Wheeler, W.C. (2003a) Iterative pass optimization of sequence data. Cladistics, 19 (3), 254–260. https://doi.org/10.1111/j.1096-0031.2003.tb00368.x Wheeler, W.C. (2003b) Implied alignment: a synapomorphyVbased multipleVsequence alignment method and its use in cladogram search. Cladistics, 19 (3), 261–268. https://doi.org/10.1111/j.1096-0031.2003.tb00369.x Yánez-Muñoz, M.H., Meza-Ramos, P., Cisneros-Heredia, D.F. & Reyes-Puig, J.P. (2011 "2010") Descripción de tres nuevas especies de ranas del género Pristimantis (Anura: Terrarana: Strabomantidae) de los bosques nublados del Distrito Metropolitano de Quito, Ecuador. Avances en Ciencias e Ingeníerias, Sección B, Quito 2 (3), B16–B27.

62 · Zootaxa 4243 (1) © 2017 Magnolia Press GONZÁLEZ-DURÁN ET AL. ...... continued on the next page next the on ...... continued '21/3*+.45/011/ '()*++) '21/311 69//1)+-69//1,169//1/* 69//001 69//0*. 65.,0+1 69//303 69//3* 69//1/3-69//1,/ 69//00) 65.,0+ 69//30) 69//1))-69//1,069//1/.-69//1,+ 69//301 69//1)*-69//1,3 69//003 65.,0+. 69//30, 69//1,, 65.,0*/ 69//30 45/011) 693+.3,69//1)0-69//1,.69.1*+* 69//00,693+.33 65.,0*) 69//31/ 693+/ 693+, 693+,, 62).//3+-2613)). 62)./)/* 62).//+ '21/3+./2613)).+-2613)+/* '21/30.+ 62)./)/) 5310,)-'21/31, 62)./// 5310,*3 531031 53103.3 '()***+'()**//62).//,62).//,* '()*+**'21/3+1 '()*+++'()**/ 62)./)) '()*+108$,/+3)0 62)./))0 '()*+0* 62).//.. 62).//.0 '()*++0 8$,/+3)/ 5310,)3 8$,/+3)+ 5310,*0 45,)33+67,/),+*-67,/)3*'21/33* 67,/),3+'21/33+)-'21/33**'21/33/1 '()*++/ 45,),/*) 67,/))0 '21/311/ '21/31)3 67,/)30+ '21/311 5310,+)-'21/33/+ 67,/)3+ 5310,0/ 53103./ 45,),).) 45,)3/*. 53103.1 '21/303+45,)3,+ '21/30.) 45,),/*3 '21/31,3 45,),+)* 45,)3/30 '()*+,+-'()*+./ '()*+*0 '()*+11 !"# $"%! &# " Pristimantis altamazonicus altamazonicus Pristimantis altamazonicus Pristimantis Pristimantis altae Pristimantis altae Pristimantis affinis affinis Pristimantis Pristimantis aff taeniatus 2 2 taeniatus aff Pristimantis 3 taeniatus aff Pristimantis Pristimantis aff taeniatus 1 1 taeniatus aff Pristimantis Pristimantis aff cruentus cruentus aff Pristimantis Pristimantis aff altamazonicus aff Pristimantis Pristimantis achatinus achatinus Pristimantis achatinus Pristimantis achatinus Pristimantis acuminatus Pristimantis Pristimantis acatallelus acatallelus Pristimantis Oreobates pereger pereger Oreobates bracki Phrynopus usurpator Psychrophrynella biporcatus Strabomantis prolixodiscus Tachiramantis ashkapara Yunganastes pluvicanorus Yunganastes Lynchius flavomaculatus flavomaculatus Lynchius Noblella lochites choristolemma Oreobates Euparkerella brasiliensis binotatus Haddadus Holoaden bradei dolops Hypodactylus Craugastor augusti augusti Craugastor rhodopis Craugastor pulcher Barycholos cophites Bryophryne

PHYLOGENY OF THE PRISTIMANTIS LEPTOLOPHUS SPECIES GROUP Zootaxa 4243 (1) © 2017 Magnolia Press · 63 ...... continued on the next page next the on ...... continued 8$.),)*1-8$.),)+1 3,*..3 '()***) 69//0.)-69//11169//0.*-69//11, '21/303 '21/3*)) '21/31/+ '21/3130 69//3+ 45/0100 '21/30,/ '21/31// '21/313+ 6700,)+ '21/3301 '21/30., '21/311. '21/3+.. 3,*..+ '21/3*+0 45/010345/010169//0..-69//130'()**)* 69//0*,'21/3*)0 69//13+ 65.,0+*'21/30,. 69//0*1 69//3*1 65.,0++ 69//3** '21/330.69.1*0)'21/30,3 69.1**+ 45/010.69//1/+-69//13,69//1/)-69//133 693+./0+ 693+./*) 6700,/+'21/330 69//3*, 693+.1 693+.0, !"# $"%! &# " 693+.31 693+,3 :! ; Pristimantis duellmani Pristimantis duellmani Pristimantis devillei Pristimantis devillei diadematus Pristimantis dorsopictus Pristimantis Pristimantis cruentus Pristimantis curtipes Pristimantis Pristimantis cruentus cruentus Pristimantis Pristimantis croceoinguinis croceoinguinis Pristimantis Pristimantis conspicillatus conspicillatus Pristimantis Pristimantis conservatio conservatio Pristimantis Pristimantis colomai Pristimantis colomai Pristimantis citriogaster Pristimantis citriogaster Pristimantis chloronotus Pristimantis chloronotus Pristimantis carvalhoi Pristimantis carvalhoi caryophyllaceus Pristimantis caryophyllaceus Pristimantis celator Pristimantis cerasinus Pristimantis ceuthospilus Pristimantis Pristimantis chalceus Pristimantis buckleyi Pristimantis buckleyi calcaratus Pristimantis calcarulatus Pristimantis Pristimantis carranguerorum Pristimantis bogotensis bogotensis Pristimantis brevifrons Pristimantis brevifrons Pristimantis brevifrons Pristimantis briceni Pristimantis bromeliaceus Pristimantis angustilineatus Pristimantis anolirex Pristimantis

64 · Zootaxa 4243 (1) © 2017 Magnolia Press GONZÁLEZ-DURÁN ET AL. ...... continued on the next page next the on ...... continued 69//0,,-69//10* 69//0++ 65.,0/1 69//3)* 69//0/-69//10369.1*), 69//0+1 65.,0/, 69//3)3 693+3, 45/01*0'()**0+45/01**69//0)-69//10, 69//0+3 69//3), 45/01*369//0+ 69//0+, 65.,0)/ 69//3) 45/01*1 8$1/1. 8$1//* '21/3*)169//00-69//10 69//0+ '21/31/0 65.,0)) '21/3133 69//3+/ 6700,/1 69.1** 69.1*+. 69.1*)693+./)1693+.//) 693+.*+ 693+.) '21/3*+*693+.3)8$.),)*.-8$.),)*045/01* 693+3. '()**+.'21/30 '()*+*+ '()*+1* 69//01-69//10. 65.,0)0 69//0-69//11+ 69//3+* 45/010/ '21/3+.3'21/300 69//0.-69//11* 69//3+3 45/010)'()**+ !"# $"%! &# " :! ; Pristimantis myops Pristimantis myops nervicus Pristimantis Pristimantis minutulus Pristimantis minutulus Pristimantis miyatai Pristimantis miyatai Pristimantis moro Pristimantis martiae martiae Pristimantis Pristimantis merostictus Pristimantis lynchi Pristimantis lynchi Pristimantis lutitus Pristimantis lutitus Pristimantis lutitus Pristimantis librarius librarius Pristimantis Pristimantis leoni Pristimantis leoni Pristimantis lancinii Pristimantis lancinii Pristimantis jubatus jubatus Pristimantis jubatus Pristimantis kelephas Pristimantis Pristimantis hectus hectus Pristimantis jaguensis Pristimantis Pristimantis jorgevelosai Pristimantis juanchoi Pristimantis gentryi gentryi Pristimantis glandulosus Pristimantis Pristimantis galdi Pristimantis galdi Pristimantis gaigei Pristimantis gaigei Pristimantis frater frater Pristimantis Pristimantis gaigei Pristimantis festae Pristimantis festae Pristimantis fenestratus Pristimantis fenestratus Pristimantis erythropleura erythropleura Pristimantis Pristimantis eriphus Pristimantis eriphus

PHYLOGENY OF THE PRISTIMANTIS LEPTOLOPHUS SPECIES GROUP Zootaxa 4243 (1) © 2017 Magnolia Press · 65 ...... continued on the next page page next the on ...... continued 69//03*-69//1*+'21/3*) 69//0)+'()***0 3,*..0 65.,0,.0 69//1. 45/01+. '21/331)'21/3+.0'()**/3 '21/30. '21/313/ '21/3+.+69//030-69//1** 69//0)* '21/31/) 65.,0,.1 '21/313* 69//1.. '21/3*/. 69//03 69//0), 65.,0,.. 69//3/* 6700,+)69//03.'21/3*)369.1*)1 69//0) 69//3/0 693+3* 69//0,)-69//1*,69//0,/ 69//0). 65.,0// 69//3/3 69//3/1 45/01*)'21/331/ 69//1* 69//3/, 69//0,+-26+)133*45/01*+ 65.,0/) 26+**).1 69//0,* 69//0+/ 65.,0/+ 69//3/ 693+.,* 693+3 '21/3*+/'21/33))69//0,1-69//10/ 69//0+) 69//3)/ '21/30,*'21/3*), '21/31)+ '21/31,0 '21/30/69//0,3-69//10+ '21/31/* '21/3131 65.,0/0 69//3)+ !"# $"%! &# " :! ; ockendeni ockendeni ockendeni ockendeni Pristimantis schultei Pristimantis schultei Pristimantis simonsii supernatis Pristimantis Pristimantis savagei Pristimantis savagei Pristimantis sagittulus sagittulus Pristimantis Pristimantis saltissimus Pristimantis savagei Pristimantis ridens ridens Pristimantis Pristimantis riveti Pristimantis reichlei Pristimantis reichlei Pristimantis quinquagesimus Pristimantis Pristimantis ptochus ptochus Pristimantis pyrrhomerus Pristimantis Pristimantis quantus quaquaversus Pristimantis Pristimantis platydactylus platydactylus Pristimantis pleurostriatus Pristimantis Pristimantis phoxocephalus phoxocephalus Pristimantis pirrensis Pristimantis Pristimantis peruvianus peruvianus Pristimantis Pristimantis permixtus Pristimantis permixtus peruvianus Pristimantis Pristimantis pardalis pardalis Pristimantis Pristimantis palmeri palmeri Pristimantis pardalis Pristimantis Pristimantis orestes Pristimantis paisa Pristimantis orcesi Pristimantis orcesi nyctophylax Pristimantis Pristimantis Pristimantis ocreatus Pristimantis

66 · Zootaxa 4243 (1) © 2017 Magnolia Press GONZÁLEZ-DURÁN ET AL...... continued on the next page next the on ...... continued 45/01++69.1*)*673.*.,.69//1). 69//01)-69//1+) 69//0/+ 65.,0,1 69//13 69//10 '21/3*)*'21/3*)/69//01*-69//1+*69//010-69//1+0 69//0/0'21/30) 69//0/1 65.,0,, '21/31/. 69//1 '21/31,) 69//1. 45/01+* '21/3303'21/30,45/01+0'21/33)+ '21/30.0 '21/3111 '21/30* '21/30.3 '21/311, !"# $"%! &# " '21/3*)+69//01-69//1+,69//01,-69//1+3 69//0/.45/01+1 69//0/69//013-69//1+1 65.,0,.*69.1*)0 69//0/, 65.,0,.+'21/301 69//1.* 69//1.+ 69//1.) ralis :! ; verecundus Pristimantis wnigrum Pristimantis wnigrum Pristimantis yukpa zophus Pristimantis zophus Pristimantis Pristimantis verteb viejas Pristimantis viejas Pristimantis Pristimantis walkeri Pristimantis wnigrum Pristimantis unistrigatus Pristimantis unistrigatus Pristimantis unistrigatus uranobates Pristimantis Pristimantis Pristimantis truebae truebae Pristimantis Pristimantis toftae Pristimantis toftae Pristimantis surdus Pristimantis taeniatus Pristimantis taeniatus Pristimantis taeniatus Pristimantis taeniatus Pristimantis thectopternus thymalopsoides Pristimantis Pristimantis thymelensis

PHYLOGENY OF THE PRISTIMANTIS LEPTOLOPHUS SPECIES GROUP Zootaxa 4243 (1) © 2017 Magnolia Press · 67 ……continued on the next page page next on the ……continued 3 45,)1,/45,)13+ ! , 9!7 !7! 1 &<)3 94, 67,/)1., 5310/) 53101+ 5310,3 5310)3 53103,/ 5310,+ 5310,., 53100. 5310,31 5310)* 531033, 5310,.0 5310,.1 53100, 5310,3* 5310)) 5310331 '(113)0

:! ; pulcher Barycholos cophites Bryophryne Craugastor augusti augusti Craugastor Craugastor rhodopis rhodopis Craugastor Euparkerella brasiliensis Haddadus binotatus binotatus Haddadus Holoaden bradei Hypodactylus dolops dolops Hypodactylus flavomaculatus Lynchius Noblella lochites Oreobates choristolemma choristolemma Oreobates Oreobates pereger pereger Oreobates Phrynopus bracki bracki Phrynopus usurpator Psychrophrynella Strabomantis biporcatus biporcatus Strabomantis Yunganastes ashkapara ashkapara Yunganastes pluvicanorus Yunganastes acatallelus Pristimantis achatinus Pristimantis achatinus Pristimantis achatinus Pristimantis Tachiramantis prolixodiscus prolixodiscus Tachiramantis Pristimantis acuminatus acuminatus Pristimantis altamazonicus aff Pristimantis cruentus aff Pristimantis 1 taeniatus aff Pristimantis 2 taeniatus aff Pristimantis 3 taeniatus aff Pristimantis affinis Pristimantis Pristimantis altae altamazonicus Pristimantis

68 · Zootaxa 4243 (1) © 2017 Magnolia Press GONZÁLEZ-DURÁN ET AL. ……continued on the next page next on the ……continued 3 ! , 9!7 !7! 1 &<)3 94, 45/01) :! ; altamazonicus Pristimantis angustilineatus Pristimantis Pristimantis anolirex anolirex Pristimantis bogotensis Pristimantis brevifrons Pristimantis Pristimantis brevifrons brevifrons Pristimantis Pristimantis brevifrons brevifrons Pristimantis Pristimantis briceni briceni Pristimantis Pristimantis bromeliaceus bromeliaceus Pristimantis Pristimantis buckleyi calcaratus Pristimantis calcarulatus Pristimantis Pristimantis carranguerorum Pristimantis carranguerorum Pristimantis carvalhoi Pristimantis caryophyllaceus caryophyllaceus Pristimantis caryophyllaceus Pristimantis celator Pristimantis Pristimantis ceuthospilus ceuthospilus Pristimantis Pristimantis cerasinus cerasinus Pristimantis Pristimantis chalceus Pristimantis chalceus Pristimantis chloronotus Pristimantis citriogaster Pristimantis colomai conservatio Pristimantis conspicillatus Pristimantis croceoinguinis Pristimantis cruentus Pristimantis cruentus Pristimantis Pristimantis curtipes curtipes Pristimantis Pristimantis devillei diadematus Pristimantis

PHYLOGENY OF THE PRISTIMANTIS LEPTOLOPHUS SPECIES GROUP Zootaxa 4243 (1) © 2017 Magnolia Press · 69 ……continued on the next page next on the ……continued 3 ! , 9!7 45/01)0 !7! 1 &<)3 94, 45/01)* 45/01/. :! ; dorsopictus Pristimantis Pristimantis duellmani Pristimantis eriphus Pristimantis eriphus Pristimantis eriphus erythropleura Pristimantis Pristimantis fenestratus Pristimantis festae frater Pristimantis Pristimantis gaigei Pristimantis gaigei Pristimantis galdi gentryi Pristimantis Pristimantis glandulosus glandulosus Pristimantis hectus Pristimantis Pristimantis jaguensis jaguensis Pristimantis Pristimantis jorgevelosai Pristimantis juanchoi jubatus Pristimantis jubatus Pristimantis kelephas Pristimantis Pristimantis lancinii Pristimantis leoni librarius Pristimantis Pristimantis lutitus Pristimantis lutitus Pristimantis lynchi martiae Pristimantis Pristimantis merostictus Pristimantis minutulus Pristimantis miyatai Pristimantis miyatai Pristimantis miyatai

70 · Zootaxa 4243 (1) © 2017 Magnolia Press GONZÁLEZ-DURÁN ET AL. ……continued on the next page page next on the ……continued 3 ! , 9!7 !7! 1 &<)3 94, 45/01/, '(113/. '(113)/ :! ; ockendeni ockendeni ockendeni Pristimantis moro Pristimantis myops Pristimantis nervicus nervicus Pristimantis nyctophylax Pristimantis Pristimantis Pristimantis ocreatus Pristimantis Pristimantis orcesi Pristimantis orestes Pristimantis paisa palmeri Pristimantis pardalis Pristimantis pardalis Pristimantis Pristimantis permixtus Pristimantis peruvianus peruvianus Pristimantis peruvianus Pristimantis phoxocephalus Pristimantis Pristimantis pirrensis pirrensis Pristimantis platydactylus Pristimantis pleurostriatus Pristimantis ptochus Pristimantis pyrrhomerus Pristimantis Pristimantis quantus Pristimantis quantus quaquaversus Pristimantis quinquagesimus Pristimantis Pristimantis reichlei ridens Pristimantis Pristimantis riveti sagittulus Pristimantis Pristimantis saltissimus Pristimantis saltissimus Pristimantis savagei Pristimantis savagei

PHYLOGENY OF THE PRISTIMANTIS LEPTOLOPHUS SPECIES GROUP Zootaxa 4243 (1) © 2017 Magnolia Press · 71 3 ! , 9!7 !7! 1 &<)3 94, 45/01// ralis :! ; verecundus Pristimantis schultei Pristimantis simonsii supernatis Pristimantis Pristimantis surdus Pristimantis taeniatus Pristimantis taeniatus Pristimantis taeniatus Pristimantis taeniatus Pristimantis taeniatus Pristimantis taeniatus Pristimantis taeniatus Pristimantis taeniatus Pristimantis thectopternus Pristimantis thectopternus thymalopsoides Pristimantis Pristimantis thymelensis Pristimantis toftae truebae Pristimantis Pristimantis unistrigatus Pristimantis unistrigatus Pristimantis unistrigatus Pristimantis uranobates uranobates Pristimantis Pristimantis Pristimantis verteb Pristimantis viejas viejas Pristimantis Pristimantis viejas viejas Pristimantis Pristimantis walkeri Pristimantis walkeri Pristimantis wnigrum Pristimantis wnigrum Pristimantis yukpa Pristimantis zophus zophus Pristimantis Pristimantis zophus zophus Pristimantis

Pristimantis boulengeri ICN55788 KY494232 KY494217 KY494205 KY494195 Villamaría municipality, Caldas Department

Pristimantis lasalleorum ICN55758 KY494221 Urrao municipality, Antioquia Department

Pristimantis leptolophus JJS093 KY494226 KY494216 KY494201 Inzá municipality, Cauca Department

Pristimantis maculosus ICN55760 KY494240 KY494210 KY494204 Manizales municipality, Caldas Department

Pristimantis parectatus ICN55762 KY494233 KY494220 KY494207 KY494200 Sonsón municipality, Antioquia Department

Pristimantis parectatus ICN55763 KY494222 Aguadas municipality, Caldas Department

Pristimantis peraticus ICN55765 KY494228 KY494208 KY494199 Rio Blanco municipality, Tolima Department

Palmira municipality, Valle del Cauca Pristimantis peraticus WB1301 KY494224 Department

Pristimantis scoloblepharus ICN55768 KY494236 KY494218 KY494212 KY494197 Sonsón municipality, Antioquia Department

Pristimantis scoloblepharus ICN55744 KY494229 KY494219 KY494213 KY494198 Sonsón municipality, Antioquia Departament

Pristimantis sp. 1 ICN55772 KY494235 KY494209 KY494203 Manizales municipality, Caldas Department

Pristimantis sp. 1 JJS123 KY494237 KY494215 KY494202 Manizales municipality, Caldas Department

Pristimantis sp. 1 JJS122 KY494239 Manizales municipality, Caldas Departament

Pristimantis sp. 2 ICN55759 KY494238 Río Blanco municipality, Tolima Department

Pristimantis sp. 3 ICN55756 KY494230 KY494211 Sonsón municipality, Antioquia Department

Pristimantis sp. 4 ICN55774 KY494234 KY494206 KY494196 Sonsón municipality, Antioquia Department

Pristimantis sp. 5 ICN55775 KY494223 San Felix municipality, Caldas Department

Pristimantis uranobates ICN55771 KY494227 Villamaría municipality, Caldas Department

Pristimantis uranobates ICN55787 KY494231 Ucumarí municipality, Risaralda Department

Pristimantis uranobates ICN55770 KY494225 KY494214 Pensilvania municipality, Caldas Department

PHYLOGENY OF THE PRISTIMANTIS LEPTOLOPHUS SPECIES GROUP Zootaxa 4243 (1) © 2017 Magnolia Press · 73 APPENDIX III. Specimens examined and sequenced. Abbreviations: Holotype (H); Paratype (P); Male (M); Female (F).

Pristimantis acatallelus: COLOMBIA: CAUCA: Munchique: ICN 7814 (H, F), UVC15863. VALLE DEL CAUCA: El Cairo: 28978 (F). Pristimantis angustilineatus: COLOMBIA: VALLE DEL CAUCA: El Cairo: ICN29252 (F). Pristimantis baiotis: COLOMBIA: ANTIOQUIA: Frontino: ICN16831 (F); Urrao: ICN19181 (M). Pristimantis boulengeri: COLOMBIA: CALDAS: Villamaría: ICN55788 (M); HUILA: Isnos: ICN7992 (F). Pristimantis brevifrons: COLOMBIA: CAUCA: Munchique: ICN25868 (M); VALLE DEL CAUCA: Cali: ICN5212–5229 (P). Pristimantis buckleyi: COLOMBIA: NARIÑO: Pasto: ICN21843 (F). Pristimantis curtipes: ECUADOR: CARCHI: El Carmelo: ICN22199 (F). Pristimantis devillei: ECUADOR: NAPO: Papallacta: ICN10734 (F). Pristimantis dorsopictus: COLOMBIA: ANTIOQUIA: Sonson: ICN9249 (F). Pristimantis duellmani: COLOMBIA: CAUCA: Munchique: ICN25872 (F). Pristimantis lasalleorum: COLOMBIA: ANTIOQUIA: Frontino: FMNH69719–20 (P, F), Urrao: ICN55758. JMD2453(F). Pristimantis leoni: COLOMBIA: PUTUMAYO: Colon: ICN49713. Pristimantis leptolophus: COLOMBIA: CAUCA: Belalcazar: ICN41857–58 (F), 41865 (F), 41898 (F); Coconuco: ICN07799 (F); Inza: ICN11487 (F), 41831 (F), 41834–35 (F), 41838–40 (F); Paez: ICN06745 (F), 06750–51 (F), 06753 (F), 06762 (F), 06765 (F), 07033 (F), 7058 (F), 07304–05 (F), JJS093; Purace: ICN25925 (F), KU169041 (H, F). Pristimantis maculosus: COLOMBIA: ANTIOQUIA: Belmira, ICN8591 (H, F), ICN8592–93 (P–M); Sonson: ICN8594(P, F), 8596 (P, M); CALDAS: Manizales: ICN55578 (F), 55760–61 (F). QUINDIO: Salento: ICN29828 (F). Pristimantis myersi: COLOMBIA: NARIÑO: Cumbal: ICN24337 (F); Pasto: BCQ827 (F). Pristimantis myops: COLOMBIA: VALLE DEL CAUCA: El Cairo: ICN29337 (F). Pristimantis ocreatus: ECUADOR: CARCHI: Chiles: ICN12368. Pristimantis parectatus: COLOMBIA: ANTIOQUIA: Bello: ICN9247 (P, F); Sonson: ICN9248 (H, F), ICN55743 (F), ICN55762 (F), ICN55764 (F), JMD2596, 2640 (F); CALDAS: Aguadas: ICN–55740 (F), ICN55763 (F); Pensilvania: ICN41687–90 (P, F), ICN41691–95 (P, M). Pristimantis peraticus: COLOMBIA: VALLE DEL CAUCA: Palmira: WB1301; Tenerife: KU168915 (H, F); Tulua: ICN40772–73(F), ICN40777 (F); TOLIMA: Herrera: ICN55742 (F), ICN55765 (F), ICN55766 (F), ICN55767 (F). Pristimantis quantus: COLOMBIA: VALLE DEL CAUCA: El Cairo: ICN29297 (F). Pristimantis scoloblepharus: COLOMBIA: ANTIOQUIA: Belmira: ICN8583 (H, F), ICN8584–85 (M, P); Sonson: ICN18770–71 (M, P), ICN18774 (M, P), ICN55744 (F), ICN55768–69 (F). Pristimantis stictus: COLOMBIA: CALDAS: Manizales: ICN55591 (F), ICN55592 (F); Marulanda: ICN55689 (H, F), ICN55697 (F, P); Salamina: ICN55717 (F). Pristimantis uranobates: COLOMBIA: CALDAS: Manizales: ICN55580–81 (F), 55587–88 (F); Villamaria: ICN14424 (H–F), ICN14425 (P, M), 14426–27 (P, F) 14428–31, ICN55771 (F); Pensilvania: ICN55770 (F); QUINDIO: Salento: ICN– 24974–24977 (F), 24980 (F), 24983–84 (F), 29836–38 (F), 29843–46 (F), 29873 (F), 29875–76 (F), 29881 (F); RISARALDA: Pereira: ICN55787 (M). TOLIMA: Cajamarca: ICN22738 (F). Pristimantis sp. 1: COLOMBIA: CALDAS: Manizales: ICN55772 (M), JJS122–123; Villamaria: ICN55773 (F). Pristimantis sp. 2: COLOMBIA: TOLIMA: Herrera: ICN55759 (F). Pristimantis sp. 3: COLOMBIA: ANTIOQUIA: Sonson: ICN55756 (F). Pristimantis sp. 4: COLOMBIA: ANTIOQUIA: Sonson: ICN55774 (F). Pristimantis sp. 5: COLOMBIA: CALDAS: San Felix: ICN55775 (M).