DOCSLIB.ORG

Phylogenetic Relationships and Morphology of the Pristimantis Leptolophus Species Group

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Phylogenetic Relationships and Morphology of the Pristimantis Leptolophus Species Group Zootaxa 4243 (1): 042–074 ISSN 1175-5326 (print edition) http://www.mapress.com/j/zt/ Article ZOOTAXA Copyright © 2017 Magnolia Press ISSN 1175-5334 (online edition) https://doi.org/10.11646/zootaxa.4243.1.2 http://zoobank.org/urn:lsid:zoobank.org:pub:B4D35FB5-BC82-426C-BFCF-4EEF4D6EAFE6 Phylogenetic relationships and morphology of the Pristimantis leptolophus species group (Amphibia: Anura: Brachycephaloidea), with the recognition of a new species group in Pristimantis Jiménez de la Espada, 1870 GUSTAVO A. GONZÁLEZ-DURÁN1, MARIANE TARGINO2, MARCO RADA2 & TARAN GRANT2,3 1Instituto de Ciencias Naturales, Laboratorio de Anfibios, Universidad Nacional de Colombia, Bogotá, Colombia, 111321 2Instituto de Biociências, Universidade de São Paulo, São Paulo, SP, Brazil, 05508-090 3Corresponding author. E-mail: [email protected] Abstract We evaluate the monophyly and phylogenetic relationships of the Pristimantis leptolophus species group and describe its external morphology, osteology, and some myological characteristics. We also compare the P. leptolophus species group to other related species groups. The P. leptolophus group is not monophyletic due to the inclusion of P. acatallelus, for- merly believed to be part of the P. devillei group. The revised P. leptolophus group is composed of nine named species and six unnamed species. Based on our results, we recognize a new species group, the P. boulengeri species group, com- posed of eight species, many of which were previously assigned to the P. lacrimosus species group. Key words: Craugastoridae, myology, osteology, phylogeny, systematics, terrarana Introduction With 494 species of Neotropical, direct-developing frogs (Frost, 2016), Pristimantis Jiménez de La Espada, 1870 is the richest genus of vertebrates. The largest phylogenetic analysis of the genus included only approximately 33% (160 species, Mendoza et al. 2015), meaning that the phylogenetic relationships of most species have never been tested. Padial et al. (2014a, b) recognized 11 species groups, although most species were not assigned to any group. Three species groups have not been included in any phylogenetic analysis: the Pristimantis bellona, P. leptolophus, and P. loustes species groups. The characters used to diagnose these species groups areunderstudied, rendering the taxonomic placement of newly described species tentative and frequently erroneous without genetic data (Padial et al., 2014a). The Pristimantis leptolophus group was proposed by Lynch (1991) as an explicitly phenetic assemblage lacking known synapomorphies. The group currently comprises eight species distributed in the Cordillera Central and northern Cordillera Occidental of Colombia: P. leptolophus (Lynch, 1980), P. peraticus (Lynch, 1980), P. maculosus (Lynch, 1991), P. parectatus (Lynch and Rueda-Almonacid, 1997), P. scoloblepharus (Lynch, 1991), P. uranobates (Lynch, 1991), P. lasalleorum (Lynch, 1995), and P. stictus (González-Durán, 2016). As noted by Lynch (1991), species of the P. leptolophus group resemble the species of the P. myersi group. Hedges et al. (2008) proposed a phenotypic diagnosis for the Pristimantis leptolophus group following those of Lynch (1991) and Lynch and Duellman (1997): 1) small size (female snout–vent length [SVL] < 30 mm); 2) robust bodies, narrow heads, short snouts, moderately long legs; Finger I shorter than Finger II, Toe V much longer than Toe III, extending to distal edge of distal subarticular tubercle on Toe IV; 3) digital discs expanded; 4) tympanic membrane and annulus usually present but weakly defined (tympanic membrane and annulus absent in P. peraticus); 5) cranial crests absent; 6) vocal slits and vomerine teeth present. Nevertheless, these characters do not permit the unequivocal assignment of species to the P. leptolophus group, and variation within the species of the group is not discussed, i.e., some species/individuals lack some or all the character states. 42 Accepted by J. Padial: 19 Jan. 2017; published: 14 Mar. 2017 Herein, we test the monophyly of the Pristimantis leptolophus group, the relationships among its species, and its relationship with other species and species groups of Pristimantis based on evidence from DNA sequences. Additionally, we review the morphological characters purported to diagnose the P. leptolophus group and discuss the evolution of some phenotypic characters. Methods DNA Sequences. We sequenced fragments of different length of the mitochondrial H-strand transcription unit 1 (H1), one comprising partial 12S rRNA, complete tRNAval and partial 16S rRNA (~1500−2400 bp), and other comprising only partial 16S rRNA (~580−1000 bp). For a subset of samples we also sequenced exons of three nuclear genes: recombination activating gene 1 (RAG-1), tyrosinase precursor gene (TYR), and proopiomelanocortin A (POMC). Primers are listed in Table 1 and specimens and GenBank numbers in Appendices 1 and 2. TABLE 1. Primers employed in this study for PCR and DNA sequencing. F = forward, R = reverse. Gene Primer name Primer sequence (5’-3’) Source region 12S MVZ59 (F) ATAGCACTGAAAAYGCTDAGATG Graybeal, 1997 12S F-H (R) CTTGGCTCGTAGTTCCCTGGCG Goebel et al., 1999 12S A-L (F) AAACTGGGATTAGATACCCCACTAT Goebel et al., 1999 MVZ50 (R) TYTCGGTGTAAGYGARAKGCTT Graybeal, 1997 L13 (F) TTAGAAGAGGCAAGTCGTAACATGGTA Feller and Hedges (1998) 16S Titus I (R) GGTGGCTGCTTTTAGGCC? Titus and Larson (1996) L2A (F) CCAAACGAGCCTAGTGATAGCTGGTT Hedges (1994)? H10 (R) TGATTACGCTACCTTTGCACGGT Hedges (1994) AR (F) CGCCTGTTTATCAAAAACAT Palumbi et al. (1991) BR (R) CCGGTCTGAACTCAGATCACGT Palumbi et al. (1991)? POMC POMC 1 (F) GAATGTATYAAAGMMTGCAAGATGGWCCT Wiens et al. (2005) POMC 2 (R) TAYTGRCCCTTYTTGTGGGCRTT Wiens et al. (2005) RAG RAG1FF2 (F) ATGCATCRAAAATTCARCAAT Heinicke et al. (2007) RAG1FR2 (R)CCYCCTTTRTTGATAKGGWCATA Heinicke et al. (2007) TYR TYR1F (F) GTTGTYGTATCTACCTCRCC Heinicke et al. (2007) TYR1R (R) GMAGGGAATGGTGAARTTCTC Heinicke et al. (2007) Whole cellular DNA was extracted from ethanol-preserved tissues, liver or thigh muscle, with the DNeasy (QIAGEN, Valencia, CA) isolation kit. Amplification was carried out in a 25μl reaction using the Thermo Scientific PCR Master Mix (2X) (Thermo Fisher Scientific Inc., USA). For the amplifications, the PCR program included an initial denaturing step of 30s at 96°C, followed by 35 (mitochondrial gene fragments) or 45 (nuclear gene fragments) cycles of amplification (96°C for 30 s; 48–54°C for 30 s; 60°C for 60s), with a final extension step at 60°C for 7 min. For low-yielding samples, the annealing temperature was lowered to 46°C. PCR amplification products were cleaned using the Agencourt AMPure XP DNA Purification and Cleanup kit (Beckman Coulter Genomics, Brea, CA, USA), and sequenced by a third party using fluorescent-dye labelled terminators (ABI Prism Big Dye Terminators v. 1.1 cycle sequencing kits; Applied Biosystems, Foster City, CA, USA) with an ABI 3730XL (Applied Biosystems, Foster City, CA, USA). All samples were sequenced in both directions to check for potential errors. Chromatograms obtained from the automated sequencer were read and contigs made using the sequence editing software Sequencher 5.2.3. (Gene Codes, Ann Arbor, MI, USA). Complete sequences were edited and pairwise distances calculated with Geneious v.6.1.6 (Kearse et al., 2012). In addition to data generated in this study, we included data for those loci and the following additional loci from GenBank (Appendix I): The protein coding mtDNA genes cytochrome b (cytb), cytochrome c oxidase PHYLOGENY OF THE PRISTIMANTIS LEPTOLOPHUS SPECIES GROUP Zootaxa 4243 (1) © 2017 Magnolia Press · 43 subunit I (COI), and NADH dehydrogenase subunit II (ND2) and intervening tRNAcyst, and the nuclear protein- coding genes cellular myelocytomatosis (c-myc; exon two), chemokine receptor 4 (CXCR4), histone H3 (HH3), sodium-calcium exchanger 1 (NCX1), rhodopsin (Rhod), seven-in-absentia (SIA), and solute carrier family 8 member 3 (SLC8A3). In cases in which museum vouchers were not available from either GenBank or the respective publications, we use either the identifiers provided by the original authors or the last name of the first author of the publication. Taxon sampling. We obtained new DNA sequence data from 19 individuals representing seven named species of the Pristimantis leptolophus group and five unnamed species in process of description. Additional sequences representing 114 species of Pristimantis, including different species groups, were obtained from GenBank, mostly provided in studies by Pinto-Sanchéz et al. (2012), García-R. et al. (2012), Mendoza et al. (2015), and Mahecha et al., an unpublished study carried out in the Instituto de Ciencias Naturales (ICN), Universidad Nacional de Colombia, which generated sequences of COI and 16S. These sequences are available on GenBank, but it was not possible to locate the vouchers in the ICN amphibian collection, so the identities were not corroborated. Only specimens with at least one fragment of H1 mitochondrial region sequenced were used here. Based on our quality control assessment we excluded several sequences from GenBank, as follows: From Mahecha et al. we excluded the cytochrome b sequences from Pristimantis lutitus (JDL 26126), P. anolirex (JDL 26115), P. merostictus (JDL 26125), P. eriphus (JJM 210), and P. w-nigrum (DM 1235) because they are almost identical while showing 4–7% distance between the first three specimens, and 18.7% distance in 16S between the two last specimens, as well as the terminals of P. boulengeri (MAV 257) and P. simoterus
Load more

Recommended publications
  • Pontificia Universidad Católica Del Ecuador Facultad De Ciencias Exactas Y Naturales Escuela De Ciencias Biológicas
    PONTIFICIA UNIVERSIDAD CATÓLICA DEL ECUADOR FACULTAD DE CIENCIAS EXACTAS Y NATURALES ESCUELA DE CIENCIAS BIOLÓGICAS Descripción y relaciones filogenéticas de dos nuevas especies de Pristimantis crestadas (Anura: Terrarana: Craugastoridae) de los Andes Norte de Ecuador Tesis previa a la obtención del título de Magister en Biología de la Conservación MARIO H. YÁNEZ-MUÑOZ Quito, 2014 i Certifico que la Tesis de la Maestría en Biología de la Conservación del candidato Mario H. Yánez-Muñoz ha sido concluida de conformidad con las normas establecidas, por lo tanto, puede ser presentada para la calificación correspondiente. Santiago R. Ron Ph. D. Director de Disertación Quito, Diciembre 2014 ii A Mauro, Alejandra y Joaquín mis pequeños grandes motivadores A los inmortales, mi amada Beatriz y mis entrañables amigos Marco y Carlos iii AGRADECIMIENTOS Esta investigación contó con el soporte institucional Pontificia Universidad Católica del Ecuador y de la Secretaria Nacional de Educación Superior, Ciencia y Tecnología del Ecuador (SENESCYT PIC-08-470), a través del proyecto “Inventario y caracterización genética y morfológica de los anfibios, reptiles y aves de los Andes del Ecuador”. Parte de mi programa de Maestría en la PUCE fue financiado por el programa de Becas de la Unidad ABC del Municipio de Quito. Santiago Ron (QCAZ), permitió el acceso a las colecciones que está a su cuidado y con paciencia autorizó la disección de algunos de especímenes para la inspección de crestas craneales y tímpanos. El trabajo de laboratorio contó con el apoyo incondicional de Fernando Ayala V. y Diego Paucar, que prestaron todas las facilidades en la colección Herpetológica del QCAZ.
    [Show full text]
  • Catalogue of the Amphibians of Venezuela: Illustrated and Annotated Species List, Distribution, and Conservation 1,2César L
    Mannophryne vulcano, Male carrying tadpoles. El Ávila (Parque Nacional Guairarepano), Distrito Federal. Photo: Jose Vieira. We want to dedicate this work to some outstanding individuals who encouraged us, directly or indirectly, and are no longer with us. They were colleagues and close friends, and their friendship will remain for years to come. César Molina Rodríguez (1960–2015) Erik Arrieta Márquez (1978–2008) Jose Ayarzagüena Sanz (1952–2011) Saúl Gutiérrez Eljuri (1960–2012) Juan Rivero (1923–2014) Luis Scott (1948–2011) Marco Natera Mumaw (1972–2010) Official journal website: Amphibian & Reptile Conservation amphibian-reptile-conservation.org 13(1) [Special Section]: 1–198 (e180). Catalogue of the amphibians of Venezuela: Illustrated and annotated species list, distribution, and conservation 1,2César L. Barrio-Amorós, 3,4Fernando J. M. Rojas-Runjaic, and 5J. Celsa Señaris 1Fundación AndígenA, Apartado Postal 210, Mérida, VENEZUELA 2Current address: Doc Frog Expeditions, Uvita de Osa, COSTA RICA 3Fundación La Salle de Ciencias Naturales, Museo de Historia Natural La Salle, Apartado Postal 1930, Caracas 1010-A, VENEZUELA 4Current address: Pontifícia Universidade Católica do Río Grande do Sul (PUCRS), Laboratório de Sistemática de Vertebrados, Av. Ipiranga 6681, Porto Alegre, RS 90619–900, BRAZIL 5Instituto Venezolano de Investigaciones Científicas, Altos de Pipe, apartado 20632, Caracas 1020, VENEZUELA Abstract.—Presented is an annotated checklist of the amphibians of Venezuela, current as of December 2018. The last comprehensive list (Barrio-Amorós 2009c) included a total of 333 species, while the current catalogue lists 387 species (370 anurans, 10 caecilians, and seven salamanders), including 28 species not yet described or properly identified. Fifty species and four genera are added to the previous list, 25 species are deleted, and 47 experienced nomenclatural changes.
    [Show full text]
  • Supplemental Material Conservation Status of the Herpetofauna
    Official journal website: Amphibian & Reptile Conservation amphibian-reptile-conservation.org 8(2) [Special Section]: 1–18; S1–S24 (e87). Supplemental Material Conservation status of the herpetofauna, protected areas, and current problems in Valle del Cauca, Colombia 1Alejandro Valencia-Zuleta, Andrés Felipe Jaramillo-Martínez, Andrea Echeverry-Bocanegra, Ron- ald Viáfara-Vega, Oscar Hernández-Córdoba, Victoria E. Cardona-Botero, Jaime Gutiérrez-Zúñiga, and Fernando Castro-Herrera Universidad del Valle, Grupo Laboratorio de Herpetología, Departamento de Biología, Cali, COLOMBIA Citation: Valencia-Zuleta A, Jaramillo-Martínez AF, Echeverry-Bocanegra A, Viáfara-Vega R, Hernández-Córdoba O, Cardona-Botero VE, Gutiérrez- Zúñiga J, Castro-Herrera F. 2014. Conservation status of the herpetofauna, protected areas, and current problems in Valle del Cauca, Colombia. Amphibian & Reptile Conservation 8(2) [Special Section]: 1–18; S1–S24 (e87). Copyright: © 2014 Valencia-Zuleta et al. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCom- mercial-NoDerivatives 4.0 International License, which permits unrestricted use for non-commercial and education purposes only, in any medium, provided the original author and the official and authorized publication sources are recognized and properly credited. The official and authorized publication credit sources, which will be duly enforced, are as follows: official journal title Amphibian & Reptile Conservation; official journal website <amphibian-reptile-conservation.org>. Received: 12 March 2014; Accepted: 24 November 2014; Published: 19 December 2014 Table 1. Taxonomic list of amphibians and reptile of the department of Valle del Cauca (Cardona-B. et al. 2014). Actualization of threat categories based on: IUCN (red list), Red Book of Amphibians (Rueda et al.
    [Show full text]
  • Rediscovery of Andinophryne Olallai Hoogmoed, 1985 (Anura, Bufonidae), an Enigmatic and Endangered Andean Toad
    Copyright: © 2014 Lynch et al. This is an open-access article distributed under the terms of the Creative Commons Attribution–NonCommercial–NoDerivs 3.0 Amphibian & Reptile Conservation 8(1) [Special Sec]: 1–7. Unported License, which permits unrestricted use for non-commercial and educa- tion purposes only provided the original author and source are credited. The of- ficial publication credit source:Amphibian & Reptile Conservation at: amphibian- reptile-conservation.org Rediscovery of Andinophryne olallai Hoogmoed, 1985 (Anura, Bufonidae), an enigmatic and endangered Andean toad 1Ryan L. Lynch, 2 Sebastian Kohn, 3 Fernando Ayala-Varela, 1Paul S. Hamilton, and 3Santiago R. Ron 1The Biodiversity Group, Tucson, Arizona, USA 2Río Manduriacu Cooperative, Quito, ECUADOR 3Museo de Zoología, Escuela de Biología, Pontificia Universidad Católica del Ecuador, Quito, ECUADOR Abstract.—We report the rediscovery of Andinophryne olallai, an endangered species only known from a single specimen, collected in 1970. At the type locality, Tandayapa, Pichincha Province, numerous follow-up surveys after 1970 failed to record the species suggesting that the population is extinct. The rediscovery of A. olallai took place in 2012 at Río Manduriacu, Imbabura Province, Ecuador. Two surveys suggest that a healthy population of A. olallai survives at the site, with observations of froglets, juveniles, and adults across numerous stream systems. However, the extent of known occupancy of the population is small (<1 km2). Further data are presented to update knowledge of the distribution, ontogeny, morphology, and conservation status of the species. The population at Río Manduriacu is surrounded by logging, mining, and hydroelectric developments that could compromise its future survival. There is an urgent need to establish a monitoring program and to protect its remaining population and habitat in the region.
    [Show full text]
  • Species Diversity and Conservation Status of Amphibians in Madre De Dios, Southern Peru
    Herpetological Conservation and Biology 4(1):14-29 Submitted: 18 December 2007; Accepted: 4 August 2008 SPECIES DIVERSITY AND CONSERVATION STATUS OF AMPHIBIANS IN MADRE DE DIOS, SOUTHERN PERU 1,2 3 4,5 RUDOLF VON MAY , KAREN SIU-TING , JENNIFER M. JACOBS , MARGARITA MEDINA- 3 6 3,7 1 MÜLLER , GIUSEPPE GAGLIARDI , LILY O. RODRÍGUEZ , AND MAUREEN A. DONNELLY 1 Department of Biological Sciences, Florida International University, 11200 SW 8th Street, OE-167, Miami, Florida 33199, USA 2 Corresponding author, e-mail: [email protected] 3 Departamento de Herpetología, Museo de Historia Natural de la Universidad Nacional Mayor de San Marcos, Avenida Arenales 1256, Lima 11, Perú 4 Department of Biology, San Francisco State University, 1600 Holloway Avenue, San Francisco, California 94132, USA 5 Department of Entomology, California Academy of Sciences, 55 Music Concourse Drive, San Francisco, California 94118, USA 6 Departamento de Herpetología, Museo de Zoología de la Universidad Nacional de la Amazonía Peruana, Pebas 5ta cuadra, Iquitos, Perú 7 Programa de Desarrollo Rural Sostenible, Cooperación Técnica Alemana – GTZ, Calle Diecisiete 355, Lima 27, Perú ABSTRACT.—This study focuses on amphibian species diversity in the lowland Amazonian rainforest of southern Peru, and on the importance of protected and non-protected areas for maintaining amphibian assemblages in this region. We compared species lists from nine sites in the Madre de Dios region, five of which are in nationally recognized protected areas and four are outside the country’s protected area system. Los Amigos, occurring outside the protected area system, is the most species-rich locality included in our comparison.
    [Show full text]
  • NORTHWEST NAZARENE UNIVERSITY Assisting Frog
    NORTHWEST NAZARENE UNIVERSITY Assisting Frog Identification in Costa Rica Using a Mobile App THESIS Submitted to the Department of Mathematics and Computer Science in partial fulfillment of the requirements for the degree of BACHELOR OF ARTS Justin Tyler Laplante 2021 THESIS Submitted to the Department of Mathematics and Computer Science in partial fulfillment of the requirements for the degree of BACHELOR OF ARTS Justin Tyler Laplante 2021 Assisting Frog Identification in Costa Rica Using a Mobile App Author: ____________________________________________________________ Justin Tyler Laplante Approved: ____________________________________________________________ Dale Hamilton, Ph.D., Professor, Department of Mathematics and Computer Science, Faculty Advisor Approved: ____________________________________________________________ John Cossel Jr., Ph.D., Professor, Chair, Department of Biology Second Reader Approved: ____________________________________________________________ Barry L. Myers, Ph.D., Chair, Department of Mathematics & Computer Science ABSTRACT Assisting Frog Identification in Costa Rica Using a Mobile App. LAPLANTE, JUSTIN (Department of Mathematics and Computer Science). Quickly identifying a single frog species from over a hundred other possible species can be a challenge for research while in the Costa Rican jungle. Though researchers can use field guides to assist, these still mean you may have look through all currently identified frog species to find the frog being viewed. This project was created to help researchers narrow the list of possible frog species quickly based on Geolocation. Using Xamarin.Forms, an app was developed that worked offline, used an ArcGIS API and was cross platform. However, to ensure performs and accuracy certain design choices were made for designing the ArcGIS map that was used within the app. The used geospatial data for the frog species and generalized it into a hexagonal pattern.
    [Show full text]
  • Redalyc.Anuros En Los Complejos Paramunos Los Nevados, Chilí
    Biota Colombiana ISSN: 0124-5376 [email protected] Instituto de Investigación de Recursos Biológicos "Alexander von Humboldt" Colombia Buitrago-González, Wolfgang; Hernán López-Guzmán, Jorge; Vargas-Salinas, Fernando Anuros en los complejos paramunos Los Nevados, Chilí-Barragán y Las Hermosas, Andes centrales de Colombia Biota Colombiana, vol. 17, núm. 2, julio, 2016, pp. 52-76 Instituto de Investigación de Recursos Biológicos "Alexander von Humboldt" Bogotá, Colombia Disponible en: http://www.redalyc.org/articulo.oa?id=49148414005 Cómo citar el artículo Número completo Sistema de Información Científica Más información del artículo Red de Revistas Científicas de América Latina, el Caribe, España y Portugal Página de la revista en redalyc.org Proyecto académico sin fines de lucro, desarrollado bajo la iniciativa de acceso abierto Anuros en los complejos paramunos Los Nevados, Chilí- Barragán y Las Hermosas, Andes centrales de Colombia Anurans of the highland complex Los Nevados, Chilí-Barragán and Las Hermosas, Central Andes of Colombia Wolfgang Buitrago-González, Jorge Hernán López-Guzmán y Fernando Vargas-Salinas Resumen Se presentan los resultados de una caracterización rápida de anuros en ocho localidades de los complejos paramunos de Los Nevados, Chilí-Barragán y Las Hermosas, ubicados en los departamentos de Quindío, Valle del Cauca y Tolima, cordillera Central de Colombia. Se registraron 263 individuos pertenecientes a 11 especies de anuros de las familias Craugastoridae y Bufonidae. La riquez a local fue pobre (3-5 especies) pero la mayoría de especies (8/11) son endémicas para Colombia y al menos dos ( Osornophryne percrassa y Pristimantis simoteriscus ) están catalogadas con algún riesgo de amenaza. La mayoría de especies son de actividad nocturna- arbórea y reproducción terrestre; se amplía el rango de distribución conocido para tres especies ( Pristimantis simoterus, Pristimantis obmutescens, Pristimantis vicarius ).
    [Show full text]
  • Thermal Adaptation of Amphibians in Tropical Mountains
    Thermal adaptation of amphibians in tropical mountains. Consequences of global warming Adaptaciones térmicas de anfibios en montañas tropicales: consecuencias del calentamiento global Adaptacions tèrmiques d'amfibis en muntanyes tropicals: conseqüències de l'escalfament global Pol Pintanel Costa ADVERTIMENT. La consulta d’aquesta tesi queda condicionada a l’acceptació de les següents condicions d'ús: La difusió d’aquesta tesi per mitjà del servei TDX (www.tdx.cat) i a través del Dipòsit Digital de la UB (diposit.ub.edu) ha estat autoritzada pels titulars dels drets de propietat intel·lectual únicament per a usos privats emmarcats en activitats d’investigació i docència. No s’autoritza la seva reproducció amb finalitats de lucre ni la seva difusió i posada a disposició des d’un lloc aliè al servei TDX ni al Dipòsit Digital de la UB. No s’autoritza la presentació del seu contingut en una finestra o marc aliè a TDX o al Dipòsit Digital de la UB (framing). Aquesta reserva de drets afecta tant al resum de presentació de la tesi com als seus continguts. En la utilització o cita de parts de la tesi és obligat indicar el nom de la persona autora. ADVERTENCIA. La consulta de esta tesis queda condicionada a la aceptación de las siguientes condiciones de uso: La difusión de esta tesis por medio del servicio TDR (www.tdx.cat) y a través del Repositorio Digital de la UB (diposit.ub.edu) ha sido autorizada por los titulares de los derechos de propiedad intelectual únicamente para usos privados enmarcados en actividades de investigación y docencia.
    [Show full text]
  • UNIVERSIDAD SAN FRANCISCO DE QUITO USFQ Evaluación
    UNIVERSIDAD SAN FRANCISCO DE QUITO USFQ Colegio de Ciencias Biológicas y Ambientales Evaluación morfológica y genética del complejo de especies Pristimantis verecundus (Anura: Strabomantidae) Proyecto de Investigación . Edgar Antonio Pillajo Sigcho Biología Trabajo de titulación presentado como requisito para la obtención del título de Licenciatura en Biología, concentración en Microbiología Quito, 19 de julio de 2019 2 UNIVERSIDAD SAN FRANCISCO DE QUITO USFQ COLEGIO CIENCIAS BIOLÓGICAS Y AMBIENTALES HOJA DE CALIFICACIÓN DE TRABAJO DE TITULACIÓN Evaluación morfológica y genética del complejo de Pristimantis verecundus (Anura: Strabomantidae) Edgar Antonio Pillajo Sigcho Calificación: Nombre del profesor, Título académico Juan Manuel Guayasamín, Ph.D. Firma del profesor Quito, 19 de julio de 2019 3 Derechos de Autor Por medio del presente documento certifico que he leído todas las Políticas y Manuales de la Universidad San Francisco de Quito USFQ, incluyendo la Política de Propiedad Intelectual USFQ, y estoy de acuerdo con su contenido, por lo que los derechos de propiedad intelectual del presente trabajo quedan sujetos a lo dispuesto en esas Políticas. Asimismo, autorizo a la USFQ para que realice la digitalización y publicación de este trabajo en el repositorio virtual, de conformidad a lo dispuesto en el Art. 144 de la Ley Orgánica de Educación Superior. Firma del estudiante: _______________________________________ Nombres y apellidos: Edgar Antonio Pillajo Sigcho Código: 00123377 Cédula de Identidad: 1719104976 Lugar y fecha: Quito, 19 de julio de 2019 4 RESUMEN La diversidad críptica en los anfibios es inmensa en la mayoría de los ecosistemas neotropicales. Esta diversidad se ve potencialmente amplificada en zonas topográficamente complejas con los Andes.
    [Show full text]
  • Etar a Área De Distribuição Geográfica De Anfíbios Na Amazônia
    Universidade Federal do Amapá Pró-Reitoria de Pesquisa e Pós-Graduação Programa de Pós-Graduação em Biodiversidade Tropical Mestrado e Doutorado UNIFAP / EMBRAPA-AP / IEPA / CI-Brasil YURI BRENO DA SILVA E SILVA COMO A EXPANSÃO DE HIDRELÉTRICAS, PERDA FLORESTAL E MUDANÇAS CLIMÁTICAS AMEAÇAM A ÁREA DE DISTRIBUIÇÃO DE ANFÍBIOS NA AMAZÔNIA BRASILEIRA MACAPÁ, AP 2017 YURI BRENO DA SILVA E SILVA COMO A EXPANSÃO DE HIDRE LÉTRICAS, PERDA FLORESTAL E MUDANÇAS CLIMÁTICAS AMEAÇAM A ÁREA DE DISTRIBUIÇÃO DE ANFÍBIOS NA AMAZÔNIA BRASILEIRA Dissertação apresentada ao Programa de Pós-Graduação em Biodiversidade Tropical (PPGBIO) da Universidade Federal do Amapá, como requisito parcial à obtenção do título de Mestre em Biodiversidade Tropical. Orientador: Dra. Fernanda Michalski Co-Orientador: Dr. Rafael Loyola MACAPÁ, AP 2017 YURI BRENO DA SILVA E SILVA COMO A EXPANSÃO DE HIDRELÉTRICAS, PERDA FLORESTAL E MUDANÇAS CLIMÁTICAS AMEAÇAM A ÁREA DE DISTRIBUIÇÃO DE ANFÍBIOS NA AMAZÔNIA BRASILEIRA _________________________________________ Dra. Fernanda Michalski Universidade Federal do Amapá (UNIFAP) _________________________________________ Dr. Rafael Loyola Universidade Federal de Goiás (UFG) ____________________________________________ Alexandro Cezar Florentino Universidade Federal do Amapá (UNIFAP) ____________________________________________ Admilson Moreira Torres Instituto de Pesquisas Científicas e Tecnológicas do Estado do Amapá (IEPA) Aprovada em de de , Macapá, AP, Brasil À minha família, meus amigos, meu amor e ao meu pequeno Sebastião. AGRADECIMENTOS Agradeço a CAPES pela conceção de uma bolsa durante os dois anos de mestrado, ao Programa de Pós-Graduação em Biodiversidade Tropical (PPGBio) pelo apoio logístico durante a pesquisa realizada. Obrigado aos professores do PPGBio por todo o conhecimento compartilhado. Agradeço aos Doutores, membros da banca avaliadora, pelas críticas e contribuições construtivas ao trabalho.
    [Show full text]
  • PRISTIMANTIS ACHATINUS (Cachabi Robber Frog)
    440 NATURAL HISTORY NOTES Everglades National Park, Homestead, Monroe Co. Florida, USA (5.25060°N, 100.46510°E; WGS 84). We captured the toad and put (25.1588°S, 80.9131°W; WGS 84) was dissected and found to con- in on leaves to photograph. Suddenly the toad produced a smelly tain a juvenile O. septentrionalis (SVL = 2.5 cm). This is the first milky secretion from both parotoid glands and stayed immobi- known documented incidence of N. clarkii consuming O. septen- lized. The secretion was viscous, white in color and smelt like trionalis. pepper. While releasing these secretions, the specimen was in Likelihood of successful establishment of a non-indigenous a normal posture (immobilized) with both of its eyes open. The species such as O. septentrionalis, may be increased when they toad continually released the secretions until we finished pho- possess a novel weapon or defense mechanism (Callaway and tographing it (approx. 2 min). Later the specimen was brought Ridenour 2004. Front. Ecol. Environ. 2:436–443). However, time back to the laboratory for measurements (SVL = 74 mm; 16 g). and exposure may reduce the novelty and thus dampen the ef- The specimen was preserved and deposited at School of Phar- fectiveness of these defense mechanisms. Avian and ophidian macy, Universiti Sains Malaysia (14USM-SS-PH01). This finding taxa are expected to be predators of O. septentrionalis in the non- is the first description of antipredatory secretions by P. hosii. native range because they are the primary predators within the I express my heartfelt gratitude to Universiti Sains Malaysia, native distribution (Henderson and Powell 2009.
    [Show full text]
  • Anura: Craugastoridae: Pristimantis) in the Eastern Andes of Colombia
    Title: Influence of environment on thermal ecology of direct-developing frogs (Anura: Craugastoridae: Pristimantis) in the eastern Andes of Colombia. Edgar A. Bernal Castro 1*, Erika Ximena Cruz Rodríguez 2, José Nicolás Urbina3 Cardona; Andrew J. Crawford 1 1 Department of Biological Sciences, Universidad de los Andes, Bogotá, 111711, Colombia. 2. Department of Biology, Universidad del Tolima, A.A. 546, Ibagué, Colombia. 3. Department of Ecology and Territory, Pontificia Universidad Javeriana, A.A. 56710, Bogotá, Colombia. * Communicating autor Physical address: Colombia, Departamento del Huila, Ciudad Neiva, Calle 6c # 16 – 03, Barrio Calixto. Email: [email protected]; Alternative email: [email protected] Celular: 57 - 3158507780 Keywords: Physiology, Environmental, Amphibians, Altitudinal, Coverage. Abstract Amphibian’s temperature is a critical variable in the biology and ecology of organisms, especially ectotherms whose body temperatures depend on environmental conditions. In this study we compared the thermal biology of 13 species of frogs of the genus Pristimantis across 11 sites across different elevations in the Eastern Andes of Colombia, and sought to correlate ecophysiological variation with environmental variation at two scales. We measured critical thermal maximum (CTMax) and critical thermal minimum (CTMin) temperatures of reach frog, along with air temperature, and microhabitat temperature and structure. As the height of the locality increases, CTMin decreases in greater scale in relation to the CTMax, which is high in relation to the maximum temperature reported for highlands. There are also differences in thermal physiology between the flanks of the mountain range. The variables of herbaceous cover, litter cover and Humidity are related to the thermal limits of the 1 species.
    [Show full text]