Genetic Diversity of Invasive and Native Cichla (Pisces: Perciformes) Populations in Brazil with Evidence of Interspeciﬁc Hybridization

Journal of Fish Biology (2006) 69 (Supplement B), 260–277 doi:10.1111/j.1095-8649.2006.01291.x, available online at http://www.blackwell-synergy.com

Genetic diversity of invasive and native Cichla (Pisces: Perciformes) populations in Brazil with evidence of interspeciﬁc hybridization

A. V. OLIVEIRA*†, A. J. PRIOLI*‡§, S. M. A. P. PRIOLI*‡, T. S. BIGNOTTO*, H. F. JU´LIO JR*‡, H. CARRERk, C. S. AGOSTINHO{ AND L. M. PRIOLI*# *Nućleo de Pesquisas em Limnologia, Ictiologia e Aquïcultura (Nupelia), Universidade Estadual de Maringa´, Av. Colombo 5790, Bloco G-90, 87020-900 Maringa´, PR, Brasil, ‡Departamento de Biologia Celular e Gene´tica, Universidade Estadual de Maringa´,Av. Colombo 5790, Bloco H-67, 87020-900 Maringa´, PR, Brasil, kDepartamento de Cieˆncias Biolo´gicas, Escola Superior de Agricultura Luiz de Queiroz, Universidade de Saõ Paulo, Av. Pa´dua Dias 11, 13418-900 Piracicaba, SP, Brasil, {Universidade Federal do Tocantins, Jardim dos Ipeˆs, 77500-000 Porto Nacional, TO, Brasil and #Departamento de Biologia, Universidade Estadual de Maringa´, Av. Colombo 5790, Bloco H-78, 87020-900 Maringa´, PR, Brasil

(Received 7 July 2005, Accepted 1 August 2006)

Invasive and native populations of the Amazonian fishes ‘peacock bass’ Cichla monoculus and of a not yet described species ‘blue tucunare´’ here referred as Cichla sp. ‘Azul’ were analysed for genetic diversity using the hypervariable domain of the mitochondrial DNA (mtDNA) control region plus steady diagnostic random amplified polymorphic DNA loci. There is no detailed historical record of the introduction of Cichla species into the Upper Parana´River basin, where they became invasive and a potential threat to local ichthyofauna. Genetic diversity among invasive populations confirmed the hypothesis of multiple introductions in this hydrographic basin. Moreover, a large and previously unknown population of natural fertile hybrids between C. cf. monoculus and Cichla sp. ‘Azul’ was identified in the Itaipu hydroelectric reservoir and in the floodplain of the Upper Parana´River. Crossbred morphotypes were similar to C. cf. monoculus, but their morphological identification was not unequivocal. This hybrid population was characterized by high genetic diversity and it was composed of hybrids possessing concurrently nuclear DNA fragments specific for C. cf. monoculus as well as fragments specific for Cichla sp. ‘Azul’. The nuclear DNA markers indicated that reproductive isolation between C. cf. monoculus and Cichla sp. ‘Azul’ has broken down in the new environment, and mtDNA sequences revealed that both species can be the female donor in the interspecific crosses. The data presented herein are potentially useful for future taxonomic, genetic and evolutionary studies in the complex Cichla group, for monitoring of invasive populations, and for further development of ecological guidelines. # 2006 The Authors Journal compilation # 2006 The Fisheries Society of the British Isles

Key words: Cichla; Cichlid; D-loop; interspeciﬁc hybrids; peacock bass; tucunare´.

§Author to whom correspondence should be addressed. Tel. and fax: þ55 44 3263 1424; email: [email protected] †Present address: Centro Universita´rio de Maringa´(Cesumar), Av. Guedner 1610, 87050-390 Maringa´, PR, Brasil. 260 # 2006 The Authors Journal compilation # 2006 The Fisheries Society of the British Isles GENETIC DIVERSITY OF CICHLA POPULATIONS 261

INTRODUCTION Non-native freshwater fishes have been deliberately introduced in Neotropical hydrographic basins even though these habitats are naturally abundant with native fish species. During the last decades, Brazil has received the highest number of non-native fishes in spite of its currently >2100 catalogued fish species, which comprise c. 21% of the world list (Buckup & Menezes, 2003). In- troductions have included fishes from other countries and also transfers among Brazilian hydrographic basins (Agostinho et al., 1994, 2003; Ju´lio & Agostinho, 2003). As extensively reported, non-native introduced fishes may become invasive and have a serious impact on aquatic ecosystems. As discussed by Agostinho et al. (2005), in Brazilian inland waters, fish species introductions have been recognized as one of the principal direct causes of biodiversity loss. Such introductions have been done mainly for aquaculture, fish stocking and recreational fisheries, and generally without considering their potential adverse impact on the environment and on the biodiversity of local aquatic ecosystems. The Upper Parana´River floodplain, a unique ecosystem with >250 reported fish species, has been strongly affected by non-native introduced fishes. It com- prises an environmental protected area, as well as the only remaining running water stretch of the Parana´River in Brazilian territory, which is not restrained by hydroelectric dams. In 1982, when the Itaipu hydroelectric dam was closed, the floodplain received a massive introduction of at least 35 fish species from the Middle Parana´River basin (Agostinho et al., 2003; Ju´lio & Agostinho, 2003). These fishes were introduced because the resulting Itaipu reservoir submerged the Guaı´ra Falls (Seven Falls), which had previously formed the natural geographic barrier between these two ichthyological provinces. As a consequence, c. 150 km of the Parana´River downstream of the falls were merged with the Upper Parana´River. On top of that, during the past three decades populations of both non-native and local fishes have been intentionally introduced in the Upper Parana´River basin. Amazonian piscivores have been the most successful colonizers in this basin where they have spread out of reservoirs and are now affecting areas with high abundance of endemic species, including the floodplain (Agostinho et al., 2004, 2005). Fishes of the genus Cichla Schneider, 1801, are among the species that were deliberately introduced in many hydrographic basins, including in the Upper Parana´(Agostinho et al., 1994, 2003, 2004; Shafland, 1996; Ju´lio & Agostinho, 2003). Most Cichla species are native to the Amazon and Orinoco basins. Morphological traits have been the basis of Cichla taxonomy, but this genus remains problematic. Although 15 different Cichla morphotypes have been reported (Kullander, 1986; Kullander & Nijssen, 1989), presently only five species are described: Cichla temensis Humboldt, 1821 (Orinoco, Negro and Tapajo´s Rivers); Cichla monoculus Spix & Agassiz, 1831 (Amazon basin, including the Tocantins–Araguaia sub-basin); Cichla ocellaris Bloch & Schneider, 1801 (Guyana rivers, from the Marowijne drainage in Suriname and French Guyana to the Essequibo drainage in Guyana); Cichla orinocensis Humboldt, 1821 (Orinoco and Negro rivers); Cichla intermedia Machado-Allison, 1971 (Upper Negro River and Middle Orinoco River).

# 2006 The Authors Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277 262 A. V. OLIVEIRA ET AL.

In 1985, a few specimens identified as C. monoculus species, which is popularly known as ‘tucunare´’, ‘peacock bass’ and ‘pavoń’, were found for the first time in the Itaipu hydroelectric reservoir (Agostinho et al., 1994, 2004). Sometime later, a not yet described Cichla species (S. Kullander, pers. comm.), which is popularly known as ‘tucunareázul’ and ‘blue tucunare´’ and native to the Tocantins– Araguaia sub-basin of the Amazon River basin, was found in the Itaipu reservoir. Initially, both Cichla populations seemed to be present at low density, but they increased rapidly and spread from the reservoir into many rivers and streams. Diverse morphotypes resembling C. monoculus, but of unclear identification as regards their morphological analysis, have also been found in the Itaipu reservoir and in the floodplain (C. S. Pavanelli, pers. comm.). Taxonomy, origin and introduction of Cichla in the Upper Parana´River basin remain unclear. It has been assumed that multiple Cichla introductions might have occurred into this basin, particularly in waters that are regulated by dams. Supposedly, Cichla were introduced by sport fishing associations but incidental escapes from pisci- culture might also have occurred occasionally (Orsi & Agostinho, 1999). More recently, Cichla populations have also been found in other areas of the Upper Parana´basin, mainly in reservoirs, but as far as is known, there is no record of their introductions. Cichla species are voracious predators feeding on a wide range of prey and displaying complex reproductive strategies (Fontanele & Peix- oto, 1979; Novaes et al., 2004). The introduction of Cichla populations in the Upper Parana´basin has developed into a controversial issue because while they became the most important species for sport fishery, they also have become highly invasive and voracious piscivores, a menace to local fishes, including endemic species (Fontenele & Peixoto, 1979; Agostinho et al., 2003, 2004). Knowledge of their genetic diversity and distinctive taxonomy is crucial for monitoring introduced Cichla populations, particularly those that are now invasive and a steady part of the current fauna in many areas of the Upper Parana´River basin. Mitochondrial genome and nuclear DNA fragments have proved useful in taxonomic and genetic studies. The hypervariable domain of the mitochondrial DNA (mtDNA) control region has been the main nucleotide sequence of choice for population and phylogenetic studies among closely related species. Diagnostic nuclear DNA fragments such as steady random amplified polymorphic DNA (RAPD) markers (Williams et al., 1990) have been helpful in taxonomic and genetic research, including studies of hybridization events. In native and non-native fish populations, these nuclear and mitochondrial molecular markers have been informative (Bardakci & Skibinski, 1994; Callejas & Ochando, 2001; Weiss et al., 2001; Oliveira et al., 2002; Prioli et al., 2002; Rubidge & Taylor, 2004). Genetic studies have not previously been reported on Cichla non-native populations and little is known about their native populations. Evidence of hybridization between C. monoculus and C. temensis (‘speckled pavon’) species has been reported for natural populations native to Amazonian regions (Andrade et al., 2001; Brinn et al., 2004; Teixeira & Oliveira, 2005). These studies suggest the possibility of interspecific crosses in regions where more than one Cichla species have been introduced. Genetic studies of native and invasive Cichla populations will help to improve current knowledge of taxonomy and evolution within the cichlid group (Farias et al., 1999).

# 2006 The Authors Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277 GENETIC DIVERSITY OF CICHLA POPULATIONS 263

The objective of this work was to analyse the genetic diversity of native and invasive populations, which have been identiﬁed as C. monoculus and Cichla sp. species, by using the hypervariable domain of the mtDNA control region plus diagnostic nuclear RAPD loci. With the taxonomic and genetic characteriza- tion possible with these tools the aim was to improve the understanding of Cichla introduction in the Upper Parana´basin, and to test the hypothesis of hybridization between introduced species.

MATERIALS AND METHODS

FISH SAMPLING AND DNA EXTRACTION Cichla populations were sampled in four locations of the Upper Parana´River basin and in three locations of the Amazon River basin (Fig. 1). On the basis of morphological traits, the specimens (voucher specimens: NUP1908; NUP3180; NUP1746; NUP3379; NUP3884) were initially identified as C. monoculus and C. temensis (Kullander, 1986), and a third species not yet described, which is popularly known as ‘blue tucunare´’and‘tucunareázul’ (S. Kullander, pers. comm.). Given the unclear status of the taxonomy of Cichla species, the species included in this study are referred to as Cichla cf. monoculus, Cichla sp.‘Azul’andCichla cf. temensis. Cichla specimens were captured with gillnets, and muscle tissues were immediately fixed in ethanol and stored at 20° C. Samples of total DNA were extracted from muscle tissues macerated in the presence of liquid nitrogen, according to Monesi et al. (1998) with few modifications. After phenol/chloroform extraction, DNA was precipitated with ethanol and resuspended in diluted TE buffer (Tris 1 mM, EDTA 01mMpH80) containing RNAase (20 mgml1). DNA aliquots were used for quantification by comparison with known quantities of l phage DNA in 1% agarose gel.

AMPLIFICATION AND ANALYSIS OF RAPD LOCI The eight RAPD primers OPW-04, OPW-09, OPW-17, OPW-19, OPA-06, OPE-09, OPX-05 and OPX-18 (Operon Technologies Inc., Alameda, CA, U.S.A.) were used for polymerase chain reaction (PCR) amplifications. The PCR reaction mix and DNA amplification were performed according to Williams et al. (1990) with minor modifications (Prioli et al., 2002). A sample without template DNA was included as a negative control in each experiment. In order to test reproducibility of PCR amplification products, reactions were performed at least twice and one to two samples of previously amplified and analysed PCR products, with the same primer, were included in each agarose gel. Electrophoresis profiles were visualized under UV radiation and pho- tographed with Kodak EDAS-290. Sizes of DNA fragments were estimated by comparison with standard 100 base pair (bp) ladder (Invitrogen Life TechnologiesÔ, Carlsbad, CA, U.S.A.). RAPD electrophoresis profiles were analysed for polymorphism based on the presence and absence of accurate steady DNA bands on agarose gel. Specimens were compared within and among populations. Indexes of molecular diversity were estimated based on the average gene diversity over all haplotype loci using Arlequin v. 3.0 (Excoffier et al., 2005). Distance matrix between specimens, taken two by two, was obtained by the arithmetic complement of Nei & Li (1979) similarity index, using RAPDPLOT (Black, 1997). Because the genetic distance of Nei & Li (1979) is not met- rical, the Lingoes correction (Legendre & Anderson, 1999) was applied using the DistPCoA software (Legendre & Anderson, 1998).

# 2006 The Authors Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277 264 A. V. OLIVEIRA ET AL.

FIG. 1. Map of South America displaying the seven sampling locations in which Cichla populations were surveyed. Locations 1 to 4 are situated in the Upper Parana´River basin ( ) where Cichla monoculus and Cichla sp. ‘Azul’ were introduced and became invasive. Locations 5 to 7 are situated in the Amazon hydrographic basin ( ) including its Tocantins–Araguaia sub-basin ( ). Native species C. monoculus is found in both and areas, C. temensis in and Cichla sp. ‘Azul’ in . Sampling locations: 1, Upper Parana´River floodplain (22°479 S; 53°199 W) near Porto Rico township: Cichla sp. ‘Azul’, C. monoculus and interspecific hybrids; 2, Itaipu hydroelectric reservoir (between 24°059; 25°339 S and 54°009;54°379 W) in the Parana´River, downstream the floodplain: Cichla sp. ‘Azul’ and interspecific hybrids; 3, Capivara hydroelectric reservoir (27°399 S; 51°219 W) in the Para- napanema River: C. monoculus; 4, Promissaõ hydroelectric reservoir (21°189 S; 17°479 W) in the Tieteˆ River, near Promissaõ township: Cichla sp. ‘Azul’; 5, Tocantins River (09°459 S; 48°229 W), Lajeado reservoir, in the Amazon Tocantins–Araguaia sub-basin, near Porto Nacional city: Cichla sp. ‘Azul’ and C. monoculus; 6, Amazon River (03°079 S; 59°559 W) near the Solimo˜es River and Manaus city: C. monoculus; 7, Fish farm near the Teles Pires River, Lucas do Rio Verde City, Mato Grosso State (13°039 S; 55°549 W): C. temensis.

# 2006 The Authors Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277 GENETIC DIVERSITY OF CICHLA POPULATIONS 265

SEQUENCING AND ANALYSIS OF MITOCHONDRIAL DNA A mtDNA fragment of c. 460 bp was PCR amplified from DNA samples of four to six specimens of each population. The primers D-loop L 59-AGAGCGTCGGTCTTG- TAAACC-39 (Cronin et al., 1993) and H16498 59-CCTGAAGTAGGAACCAGATG-39 (Meyer et al., 1990) were used for PCR amplifications. The reaction mix consisted of Tris-KCl (20 mM Tris-HCl pH 84 and 50 mM KCl), 15 mM MgCl2,25 mM of each primer, 01 mM of each dNTP, 25UTaq DNA polymerase, 15 ng DNA and water to a total volume of 25 ml. PCR amplification started with one cycle of 94° C for 4 min, 50° C for 30 s and 72° C for 2 min, followed by 40 cycles of 94° C for 15 s, 56° C for 30 s, 72° C for 2 min and a final extension step at 72° C for 10 min. The mtDNA segment from each specimen was amplified in two independent PCR reactions, as replicates, and then bi-directionally sequenced. PCR products were directly used as templates for sequencing in an automated sequencer ABI-3100 (Perkin Elmer, Norwalk, CT, U.S.A.). Approximately 50 ng of template DNA and 20 pmol of either primer H16498 or D-Loop L were added to each sequencing reaction. The reaction mix was heated at 94° C for 4 min, and amplifications were performed in 35 cycles of 30 s at 94° C, 30 s at 55° C and 1 min 30 s at 60° C, followed by 5 min at 60° C and then kept at 4° C. Sequence data were submitted to quality check, assembly and alignment on the Vector NTI Suite 6.0 (Informax, Inc., Invitrogen Life TechnologiesÔ). DNA sequences were aligned using the CLUSTALW and genetic analyses were conducted using MEGA 3.1 (Kumar et al., 2004). Matrix of distances among specimens and among haplotypes was obtained from estimates of genetic distances of Tamura & Nei (1993). Clustering was performed by the neighbour- joining method (Saitou & Nei, 1987). Bootstrap analyses were based on 1000 replications.

RESULTS Each of the selected RAPD primers amplified from eight to 11 intense DNA fragments, which ranged from c. 350 bp to 24 kb. Eighty-three most intense, defined and repeatable DNA fragments were chosen for analyses. Of those 83 RAPD loci, 53 (6386%) were polymorphic and 30 (3614%) were monomorphic. Electrophoresis profiles for the OPW-09 primer are illustrated in Fig. 2. All primers, except OPA-06, produced steady monomorphic DNA fragments, which were exclusive either to C. cf. monoculus or to Cichla sp. ‘Azul’. Mono- morphic and exclusive DNA bands were identified in numbers suitable to dis- tinguish these species and their studied populations, and they were used as diagnostic nuclear markers. Specimens from the native C. cf. monoculus populations, two individuals from the Tocantins River (Fig. 1, location 5) and three individuals from the Amazon River (Fig. 1, location 6), were clearly distinguished from each other by exclusive monomorphic DNA fragments. In the native specimens from the Tocantins River, 10 monomorphic DNA fragments were found to be exclusive to Cichla sp. ‘Azul’ and 12 were exclusive to C. cf. monoculus. Cichla sp. ‘Azul’ from the Tocantins River contained 12 exclusive monomorphic DNA fragments when compared to C. cf. monoculus from the Amazon River, while the latter contained 14 exclusive monomorphic DNA fragments when compared to Cichla sp. ‘Azul’ from the Tocantins River. All of the exclusive diagnostic DNA fragments were confirmed in the native and invasive populations. The invasive Cichla sp. ‘Azul’ populations sampled in the floodplain and in the Itaipu and Promissaõ reservoirs shared characteristic exclusive monomorphic nuclear markers with the native population from Tocantins River. The population

# 2006 The Authors Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277 266 A. V. OLIVEIRA ET AL.

FIG. 2. Electrophoresis profiles, obtained by using the RAPD primer OPW-09, of specimens from native and invasive Cichla populations. Lanes 1–3, Cichla temensis native to the Amazon River basin. Lanes 4–6, Cichla sp. ‘Azul’ native to the Tocantins River. Lanes 7–8, Cichla monoculus native to the Tocantins River. Lanes 9–11, C. monoculus invasive to the Capivara reservoir. Lanes 12–15, hybrids (C. monoculus Cichla sp. ‘Azul’) sampled in the Upper Parana´River floodplain. Lanes 16–18, hybrids (C. monoculus Cichla sp. ‘Azul’) sampled in the Itaipu reservoir. Note the presence of DNA fragments exclusive to C. monoculus (lanes 7–11) and Cichla sp. ‘Azul’ (lanes 4–6). Arrows in lane 15 indicate DNA fragments exclusive to either C. monoculus (arrow at right) or Cichla sp. ‘Azul’ (arrow at left), which were inherited by this crossbred. L, Molecular mass markers (Ladder 100). invasive to Promissaõ reservoir, however, contained two monomorphic DNA fragments that were absent in the Tocantins, floodplain and Itaipu populations. On the other hand, these latter populations shared three monomorphic DNA fragments that were absent in the Promissaõ population. The non-native C. cf. monoculus population from Capivara reservoir (Fig. 1, location 3) shared two monomorphic DNA fragments with the population native to the Amazon River (Fig. 1, location 6), which were absent in the Tocantins population (Fig. 1, location 5). The analysed C. cf. temensis specimens were characterized by five exclusive monomorphic RAPD fragments. Of the 68 Cichla specimens captured in the Upper Parana´River floodplain and in the Itaipu reservoir (Fig. 1, locations 1 and 2), a total of 52 specimens contained simultaneously nuclear monomorphic DNA fragments exclusive to C. cf. monoculus and fragments exclusive to Cichla sp. ‘Azul’. They resembled C. cf. monoculus species based on morphological traits. Two of the C. cf. monoculus exclusive monomorphic fragments were specific to the population native to the Tocantins River and absent in the Amazon River population. Genetic variability within these 52 specimens was high, as indicated by 4217% of RAPD polymorphic loci. In contrast, the percentage of polymorphic loci was low in the C. cf. monoculus and in the Cichla sp. ‘Azul’ populations, varying from 12to1446%. The haplotype molecular diversity index, as based on the average gene diversity over all haplotype loci, was estimated as 0143 for all populations analysed as a group. The haplotype molecular diversity index for those 52 specimens sampled the floodplain and Itaipu reservoir was estimated as 0085. This genetic diversity estimate was high when compared to the haplotype molecular diversity indexes varying from 0012 to 0040 within all other populations studied.

# 2006 The Authors Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277 GENETIC DIVERSITY OF CICHLA POPULATIONS 267

The genetic differentiation pattern on the basis of Nei & Li (1979) similarity index is represented by principal co-ordinates (Fig. 3), where the three distinct species C. cf. monoculus, Cichla sp. ‘Azul’ and C. cf. temensis were distinguished from each other. Cichla cf. temensis was positioned closer to Cichla sp. ‘Azul’ than to C. cf. monoculus. The 52 specimens from the Upper Parana´River floodplain and Itaipu reservoir, which shared C. cf. monoculus and Cichla sp. ‘Azul’ nuclear DNA fragments, were arranged as a population in an intermediate position between these two species. These results are evidence of crossbreeding between C. cf. monoculus and Cichla sp. ‘Azul’. The specific nuclear diagnostic DNA fragments were not equally distributed in the 52 specimens from the invasive populations established in the floodplain and Itaipu reservoir, which indicate that they could represent C. cf. monoculus v. Cichla sp. ‘Azul’ advanced progenies. The mtDNA fragments (c. 460 bp) consisted of a partial sequence of the tRNAThr gene, immediately followed by the complete sequence of the tRNAPro gene, and then by c. 360 bp corresponding to the hypervariable domain of the control region (GenBank accession numbers AY836716 to AY836750). Nucleotide polymorphism was low among the tRNA sequences, therefore they were not informative and were excluded from the analysis. The CLUSTALW alignment of the mtDNA control region sequence (c. 360 bp) from 35 Cichla specimens revealed a total of 97 polymorphic nucleotide sites, which were

FIG. 3. The first two axes in the principal co-ordinates analysis (PCO) of Cichla populations: Invasive to the Upper Parana´River basin: ( ) Upper Parana´River floodplain composed of Cichla sp. ‘Azul’ (left) and ( ) interspecific hybrids (middle); ( ) Itaipu reservoir composed of Cichla sp. ‘Azul’ (left) and ( ) interspecific hybrids (middle); ( ) Promissaõ Reservoir consisted of Cichla sp. ‘Azul’; ( ) Capivara reservoir composed of C. monoculus. Native to the Amazon River basin: ( ) Tocantins River comprising C. monoculus and Cichla sp. ‘Azul’ ( ) Amazon River near Manaus composed of C. monoculus;( ) fish farm near the Teles Pires River, in Mato Grosso State, comprising C. temensis. Analyses were corrected by the Lingoes method from the matrix of arithmetic complements of Nei and Li’s (1979) similarity coefficients obtained from RAPD markers.

# 2006 The Authors Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277 268 A. V. OLIVEIRA ET AL. distributed in 10 haplotypes (Table I). Almost all changes were single nucleotide substitutions, and transitions were the most frequent (average ti:tv ¼ 212) as is typical for the mtDNA control region. Genetic distances of Tamura & Nei (1993), as based on the mtDNA control region sequences, are shown in Table II. Genetic distances were low among haplotypes found within the same species, varying from 0006 to 0057. As to native populations, the C. cf. monoculus haplotypes (Hapl-Cmn-VI and Hapl-Cmn-II) were discriminated from Cichla sp. ‘Azul’ (Hapl-Csp-I) by 175–186% nucleotide divergence (63–67 sites), and from C. cf. temensis (Hapl-CtmI) by c.185% divergence. As expected, the genetic distance estimates were proportional to the nucleotide diversity when C. cf. monoculus was compared to Cichla sp. ‘Azul’ or to C. cf. temensis, varying from 0177 to 0195. On the other side, the estimates indicated that Cichla sp. ‘Azul’ is more closely related to C. cf. temensis (0125) than to the C. cf. monoculus (0178–0195) populations. In addition, the analysed mtDNA control region sequence was suitable to discriminate the populations of C. cf. monoculus native either to the Tocantins River (Hapl-Cmn-II) or to the Amazon River (Hapl- Cmn-VI). They were differentiated by 19 nucleotide site polymorphisms (53%), with a genetic distance estimate of 0054. The mtDNA control region sequences indicated the possible native populations that were involved in the Cichla introductions to the locations studied in Upper Parana´River basin. Interestingly, the same C. cf. monoculus haplotype (Hapl-Cmn-VI) from the Amazon River native population (Fig. 1, location 6) was identified in the population introduced in the Capivara reservoir (Fig. 1, location 3). In addition, a second C. cf. monoculus haplotype (Hapl-Cmn-VII) was identified in the Capivara reservoir. As compared to the native C. cf. monoculus, the haplotype Hapl-Cmn-VII was more closely related to the Hapl-Cmn-VI from the Amazon River specimens (39% divergence) than to the Hapl-Cmn-II from Tocantins specimens (78% divergence). The haplotypes of Cichla sp. ‘Azul’ invasive to the floodplain and Itaipu reservoir were identical to those of Cichla sp. ‘Azul’ native to the Tocantins River. The neighbour- joining dendrogram based on Tamura & Nei (1993) genetic distance matrix among Cichla specimens is represented in Fig. 4. Three major haplotype groups, corresponding to C. cf. monoculus, Cichla sp. ‘Azul’ and C. cf. temensis, were separated and supported by a 100% bootstrap rate. The species Cichla sp. ‘Azul’ was more closely related to C. cf. temensis than to C. cf. monoculus (Table II and Fig. 4). As shown in Table I, the specimens identified as interspecific hybrids contained the mitochondrial genome from either C. cf. monoculus or Cichla sp. ‘Azul’. Nine of the 11 interspecific hybrids analysed contained C. cf. monoculus haplotypes, which were divergent by only one to three nucleotide sites from the Hapl-Cmn2 haplotype from the population native to the Tocantins River. The C. cf. monoculus haplotypes of populations invasive to the floodplain and Itaipu reservoir diverged by c. 19 nucleotide changes (53%) when compared to the population native to the Amazon River. As expected, these nine specimens were clustered with specimens native to the Tocantins River in the neighbour-joining dendrogram based on Tamura & Nei (1993) genetic distances (Fig. 4). The remaining two interspecific hybrids carried a haplotype identical

# 2006 The Authors Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277 ora compilation Journal # ABLE

06TeAuthors The 2006 T I. Nucleotide polymorphisms in the hypervariable sequence (c. 360 bp) of the mtDNA control region (D-loop) from Cichla invasive and native populations. Sampling locations are indicated by the first number in each specimen identification: 1, Upper Parana´River floodplain; 2, Itaipu reservoir; 3, Capivara reservoir; 5, Tocantins River; 6, Amazonas River; 7, fish farm near Teles Pires River (see Fig. 1). Haplotypes: Hapl-Cmn, C. monoculus; Hapl-Csp, Cichla sp. ‘Azul’; Hapl-Ctm, C. temensis. Entire sequences at Genbank: AY836716 to AY836750

# 0112222233335566677777888889999111111111111111111111111111111111111111111222222222222222222333333

06TeFseisSceyo h rts Isles, British the of Society Fisheries The 2006 7451345856783506824789067890246111112222222333344455666667777788888899999000123333445577788223455 EEI IEST OF DIVERSITY GENETIC Specimen Haplotypes Identiﬁcation 123450125679037917809245792345803578902458127070278265905814060316

2-TUC83 Hapl-Cmn-I Hybrid CCCATACAATTAATTTGGTCGTTTATGAACTTTAAC—GATTACCTGATTCATAT-TGTTAACTTAACAATTT-GCA-CCTCAATACGTCTTACGT

2-TUC85 Hapl-Cmn-I Hybrid ...... - - - ...... - ...... - ...-......

2-TUC90 Hapl-Cmn-I Hybrid ...... - - - ...... - ...... - ...-......

2-TUC62 Hapl-Cmn-I Hybrid ...... - - - ...... - ...... - ...-......

1-TUC18 Hapl-Cmn-I Hybrid ...... - - - ...... - ...... - ...-......

1-TUC26 Hapl-Cmn-I Hybrid ...... - - - ...... - ...... - ...-......

5-TUC103 Hapl-Cmn-II C. monoculus* ...... C....- - -...... -.A...... -...-......

5-TUC104 Hapl-Cmn-II C. monoculus* ...... C....- - -...... -.A...... -...-......

5-TUC105 Hapl-Cmn-II C. monoculus* ...... C....- - -...... -.A...... -...-...... CICHLA

ora fFs Biology Fish of Journal 1-TUC16 Hapl-Cmn-III Hybrid ...... C....- - -...... -.A...... -...-.....G......

1-TUC15 Hapl-Cmn-IV Hybrid . . . . C ...... C . . . . - - - ...... - . A ...... - ...-.....G......

1-TUC21 Hapl-Cmn-V Hybrid ...G..G...... C....- - -...... -.A...... -...-..... G...... POPULATIONS

6-TUC114 Hapl-Cmn-VI C. monoculus*.T...G...... A...T....C...- - -...... CA.C...A..C.A.C.....G.TT.C..-...-...... TC....C

6-TUC115 Hapl-Cmn-VI C. monoculus*.T...G...... A...T....C...- - -...... CA.C...A..C.A.C.....G.TT.C..-...-...... TC....C

6-TUC116 Hapl-Cmn-VI C. monoculus*.T...G...... A...T....C...- - -...... CA.C...A..C.A.C.....G.TT.C..-...-...... TC....C

2006, 6-TUC120 Hapl-Cmn-VI C. monoculus*.T...G...... A...T....C...- - -...... CA.C...A..C.A.C.....G.TT.C..-...-...... TC....C

3-TUC42 Hapl-Cmn-VI C. monoculus .T...G...... A...T....C...- - -...... CA.C...A..C.A.C.....G.TT.C..-...-...... TC....C 69 3-TUC55 Hapl-Cmn-VI C. monoculus .T...G...... A...T....C...- - -...... CA.C...A..C.A.C.....G.TT.C..-...-...... TC....C Splmn ) 260–277 B), (Supplement 3-TUC77 Hapl-Cmn-VI C. monoculus .T...G...... A...T....C...- - -...... CA.C...A..C.A.C.....G.TT.C..-...-...... TC....C

3-TUC80 Hapl-Cmn-VI C. monoculus .T...G...... A...T....C...- - -...... CA.C...A..C.A.C.....G.TT.C..-...-...... TC....C

3-TUC57 Hapl-Cmn-VII C. monoculus T....G...... C.C...A...C..AT...... - - -...... A.C.-.A..C.AC....C.G.TT.C..-...-...... T ......

3-TUC78 Hapl-Cmn-VII C. monoculus T....G...... C.C...A...C..AT...... - - -...... A.C.-.A..C.AC....C.G.TT.C..-...-...... T......

3-TUC79 Hapl-Cmn-VII C. monoculus T....G...... C.C...A...C..AT...... - - -...... A.C.-.A..C.AC....C.G.TT.C..-...-...... T...... 269 270 ora compilation Journal # 06TeFseisSceyo h rts Isles, British the of Society Fisheries The 2006

TABLE I. Continued

0112222233335566677777888889999111111111111111111111111111111111111111111222222222222222222333333

7451345856783506824789067890246111112222222333344455666667777788888899999000123333445577788223455

Specimen Haplotypes Identiﬁcation 123450125679037917809245792345803578902458127070278265905814060316 .V OLIVEIRA V. A.

1-TUC5 Hapl-Csp-I Hybrid .....G.GC...T.-...ATAC..TAATTAC..T.ACATACC..ATCAT.A.TAC.TAA.C-T..ATT.CTCCAAAATCTTATTG..AACT.ATGAC

1-TUC19 Hapl-Csp-I Hybrid .....G.GC...T.-...ATAC..TAATTAC..T.ACATACC..ATCAT.A.TAC.TAA.C-T..ATT.CTCCAAAATCTTATTG..AACT.ATGAC

1-TUC68 Hapl-Csp-I Cichla sp...... G.GC...T.-...ATAC..TAATTAC..T.ACATACC..ATCAT.A.TAC.TAA.C-T..ATT.CTCCAAAATCTTATTG..AACT.ATGAC

1-TUC69 Hapl-Csp-I Cichla sp...... G.GC...T.-...ATAC..TAATTAC..T.ACATACC..ATCAT.A.TAC.TAA.C-T..ATT.CTCCAAAATCTTATTG..AACT.ATGAC

1-TUC70 Hapl-Csp-I Cichla sp...... G.GC...T.-...ATAC..TAATTAC..T.ACATACC..ATCAT.A.TAC.TAA.C-T..ATT.CTCCAAAATCTTATTG..AACT.ATGAC

2-TUC63 Hapl-Csp-I Cichla sp...... G.GC...T.-...ATAC..TAATTAC..T.ACATACC..ATCAT.A.TAC.TAA.C-T..ATT.CTCCAAAATCTTATTG..AACT.ATGAC ora fFs Biology Fish of Journal

5-TUC98 Hapl-Csp-I Cichla sp.* .....G.GC...T.-...ATAC..TAATTAC..T.ACATACC..ATCAT.A.TAC.TAA.C-T..ATT.CTCCAAAATCTTATTG..AACT.ATGAC AL. ET

5-TUC96 Hapl-Csp-I Cichla sp.* .....G.GC...T.-...ATAC..TAATTAC..T.ACATACC..ATCAT.A.TAC.TAA.C-T..ATT.CTCCAAAATCTTATTG..AACT.ATGAC

5-TUC95 Hapl-Csp-II Cichla sp.* .....G.GT...T.-...ATAC..TAATTAC..T.ACATACC..ATAAT.A.TAC.TAA.C-T..ATT.CTCCAAAATCTTATTG..AACT.ATGAC

7-TUC73 Hapl-Ctm-I C. temensis* ..T..G.GTAATT.-.AAAT.CC...AT..C..CGTTATAC.CCATCACCC.TATCA.A..-.-.ATT.C.CCGAATGCTTA..GCCAACTC.T...

7-TUC74 Hapl-Ctm-I C. temensis* ..T..G.GTAATT.-.AAAT.CC...AT..C..CGTTATAC.CCATCACCC.TATCA.A..-.-.ATT.C.CCGAATGCTTA..GCCAACTC.T...

7-TUC75 Hapl-Ctm-I C. temensis* ..T..G.GTAATT.-.AAAT.CC...AT..C..CGTTATAC.CCATCACCC.TATCA.A..-.-.ATT.C.CCGAATGCTTA..GCCAACTC.T... 2006,

69 *Specimens from native populations. Splmn ) 260–277 B), (Supplement # 06TeAuthors The 2006 ora compilation Journal # 06TeAuthors The 2006 #

06TeFseisSceyo h rts Isles, British the of Society Fisheries The 2006 TABLE II. Genetic distances of Tamura & Nei (1993) among Cichla haplotypes from invasive and native populations, based on the

hypervariable sequence of the mtDNA control region. Haplotypes: Hapl-Cmn, C. monoculus; Hapl-Csp, Cichla sp. ‘Azul’; Hapl-Ctm, C. OF DIVERSITY GENETIC temensis. Sampling locations: 1, Upper Parana´River ﬂoodplain; 2, Itaipu reservoir; 3, Capivara reservoir; 5, Tocantins River; 6, Amazonas River; 7, ﬁsh farming near Teles Pires River (see Fig. 1)

Hapl-Cmn-II Hapl-Cmn-VI Hapl-Cmn-VII Hapl-Cmn-I Hapl-Csp-I Hapl-Csp-I C. monoculus C. monoculus C. monoculus Hybrid Cichla sp.* Hybrid Haplotypes, locations 5* 6* and 3 3 1 and 2 5*, 1 and 2 1

Hapl-Cmn-VI, C. monoculus 0054 6* and 3 Hapl-Cmn-VII, C. monoculus 0057 0042 3 CICHLA ora fFs Biology Fish of Journal Hapl-Cmn-I, Hybrid 0006 0054 0057 1 and 2

Hapl-Csp-I, Cichla sp.* 0192 0178 0195 0192 POPULATIONS 5*, 1 and 2 Hapl-Csp-I, Hybrid 0192 0178 0195 0192 0000 1 2006, Hapl-Ctm-I C. temensis 0192 0177 0187 0191 0125 0125

69 7 Splmn ) 260–277 B), (Supplement *Specimens from native populations. 271 272 A. V. OLIVEIRA ET AL.

FIG. 4. Neighbour-joining dendrogram obtained from the hypervariable domain of the mtDNA control region (D-loop) sequences of Cichla haplotypes from populations invasive to the Upper Parana´ River basin and populations native to the Amazon hydrographic basin: ( ) Upper Parana´River ﬂoodplain; ( ) Itaipu reservoir; ( ) Capivara reservoir; ( ) Tocantins River; ( ) Amazon River near Manaus; ( ) ﬁsh farm near the Teles Pires River, in Mato Grosso State. Genetic distances were estimated by the Tamura & Nei (1993) method. Numbers in the dendrogram indicate bootstrap probability as based on 1000 replicates. *, Specimens from native populations. to native Cichla sp. ‘Azul’, and they were grouped with this species population native to the Tocantins River. Therefore, the specimens positioned in the intermediate area of the graph of PCO factors I and II (Fig. 3) had maternal ances- tors from the C. cf. monoculus and Cichla sp. ‘Azul’ species.

DISCUSSION The molecular genetic data described in this work conﬁrm that the species C. cf. monoculus and the Cichla sp. ‘Azul’ (blue tucunare´), a not yet described species, were introduced into the southern part of the Upper Parana´River

# 2006 The Authors Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277 GENETIC DIVERSITY OF CICHLA POPULATIONS 273 basin. Moreover, the data indicate that introduced populations of C. cf. monoculus and Cichla sp. ‘Azul’ interbred in the Itaipu reservoir and in the floodplain of the Upper Parana´River. Hybrids between C. cf. monoculus and Cichla sp. ‘Azul’ have not been described in the Tocantins–Araguaia sub-basin where both species are native and sympatric. Polymorphisms in the mtDNA sequences and in nuclear DNA fragments confirm the hypothesis of multiple Cichla introductions in the Upper Parana´ River basin. Data revealed two subpopulations of C. cf. monoculus in the Capivara reservoir and indicated that they were derived from populations native to the Amazon River basin, which are diverse of the Tocantins– Araguaia sub-basin. In the Upper Parana´floodplain and Itaipu reservoir, however, invasive populations might have been introduced at first from C. cf. monoculus and Cichla sp. ‘Azul’ native to the Tocantins–Araguaia sub- basin. Data also indicated that a diverse subpopulation of Cichla sp. ‘Azul’ was introduced in the Promissaõ reservoir. Therefore, multiple intentional introductions of Cichla species from the Tocantins–Araguaia sub-basin and from the Amazon River are likely to have occurred into the Upper Parana´River basin, and they obviously involved diverse native subpopulations at the different events. In addition, Orsi & Agostinho (1999) reported recent Cichla introductions into the Capivara reservoir probably were the result of fish escapes from fish farming operations. The genetic differentiation pattern demonstrated 52 specimens genetically intermediate between C. cf. monoculus and Cichla sp. ‘Azul’ (Fig. 3). The data presented here provide strong indication for the breakdown of reproductive isolation between Cichla species in a new environment, resulting in hybridization. The low frequencies of Cichla parental species in the Itaipu reservoir and in the floodplain of the Upper Parana´basin reinforce the assumption of local hybridization. Because hybrids were prevalent (765%) in the established invasive populations plus the evidence that currently they would represent advanced progenies, it could be hypothesized that the C. cf. monoculus v. Cichla sp. ‘Azul’ hybrids are fertile. The number and repeatability of the exclusive diagnostic nuclear DNA bands were sufficient for an unambiguous discrimina- tion of the three Cichla species and their populations. Diagnostic nuclear DNA fragments exclusive to the same studied Cichla species and populations have also been confirmed using the inter-simple sequence repeat (ISSR) technique. In addition, the ISSR diagnostic markers corroborate the results reported in this work both for the native and invasive Cichla populations and for the exis- tence of C. cf. monoculus Cichla sp. ‘Azul’ hybrids (G. C. A. Almeida, pers. comm.). RAPD diagnostic loci have been used effectively for preliminary assessments of genetic variability and for unequivocal detection of natural interspecific hybrids in other fishes (Bardakci & Skibinski, 1994; Callejas & Ochando, 2001; Weiss et al., 2001; Oliveira et al., 2002; Khrisanfova et al., 2004). The Cichla hybrids identified in the Upper Parana´River basin inherited mtDNA either from C. cf. monoculus or from Cichla sp. ‘Azul’, hence demon- strating that both parental species can act as the female donor in the interspecific crosses. Hybrid haplotypes were clustered with their corresponding native species, which must have been the mother in the interspecific crosses, and

# 2006 The Authors Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277 274 A. V. OLIVEIRA ET AL. the clustering did not discriminate native and introduced Cichla specimens. As based on the mtDNA nucleotide similarity (Fig. 4 and Table I), a C. cf. monoculus population from the Tocantins-Araguaia hydrographic basin rather than the Amazon River must have been involved in the interspecific crosses. Introgressive hybridization is a common feature between divergent lineages of fishes, particularly when allopatric taxa are introduced into new habitats (Hubbs, 1955; Arthington, 1991; Pierce & Van Den Avyle, 1997; Avise et al., 2002; Rubidge & Taylor, 2004). In the Upper Parana´River floodplain, for instance, diagnostic RAPD markers revealed crossbreeding between the endemic Steindachnerina insculpta (Eigenmann & Eigenmann, 1889) and Steindachnerina brevipinna (Fernańdez-Ye´pez, 1948), which was introduced from the Middle Parana´River (Oliveira et al., 2002). Cichla species have a highly similar karyotype (2n ¼ 48) macrostructure (Alves, 1998; Nishiyama, 1998), and the possibility of occasional natural hybridization between C. cf. monoculus and C. cf. temensis has been previously reported in their native regions, as inferred from karyological and esterase analyses (Andrade et al., 2001; Brinn et al., 2004; Teixeira & Oliveira, 2005). The three species studied were sharply separated in the neighbour-joining dendrogram (Fig. 4). The mtDNA sequences indicated that C. cf. temensis population is more closely related to Cichla sp. ‘Azul’ than to C. cf. monoculus, but there are no reports of natural coexistence and hybridization between them. Crossbreeding between C. cf. monoculus and Cichla sp. ‘Azul’ in their native region has not been reported. Hybridization between closely related fish species has been described in regions where the introduced species is genetically com- patible to either local or other introduced species (Hubbs, 1955; Arthington, 1991; Pierce & Van Den Avyle, 1997; Oliveira et al., 2002). Displacement of species outside their native region may disrupt isolation mechanisms (Scribner et al., 2001). Cichla species are known to have complex reproductive and behaviour strategies such as nest building and parental care (Agostinho et al., 2003). It appears that the C. cf. monoculus and Cichla sp. ‘Azul’ populations have not encountered major restrictions in the new habitat, since already shortly after their introduction they were widespread in the lentic environments of the Upper Parana´River basin. Moreover, the high frequency of interspecific hybrids in the Upper Parana´River suggests that the new environment was favourable for hybridization between Cichla sp. ‘Azul’ and C. cf. monoculus. As discussed by Smith et al. (2003), hybridization among cichlids may be more significant as an evolutionary impact than previously assumed. Moreover, interspecific hybridization can lead to local species extinction and can represent a threat to the integrity of unique gene pools (Scribner et al., 2001; Perry et al., 2002). When hybridization between species results in fertile hybrids, well- adapted and vigorous strains may be created, which are potentially more competitive than the most aggressive variants of the parental species (Arthington, 1991). Since the number of hybrid specimens in the Upper Parana´basin was relatively large, they may have some competitive advantage over the parental species. Continued surveillance of these populations, including studies on population density and differentiation migration patterns, might be useful in deter- mining causes for hybridization and thus that will be of genetic and ecological interest.

# 2006 The Authors Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277 GENETIC DIVERSITY OF CICHLA POPULATIONS 275

The data presented herein are potentially useful for the monitoring of the invasive Cichla populations and for future taxonomic, genetic and evolutionary studies within this genus. The detection of a large interspeciﬁc hybrid population calls attention to the imminent possibility of natural hybridization with unpredictable consequences when two or more Cichla species are concurrently introduced. Therefore, the data are also of interest for the development of future ecological guidelines.

The authors gratefully acknowledge A. A. Agostinho and M. Petrere Jr for valuable discussions and suggestions, C. S. Pavanelli and W. J. Gracxa for assisting with species identiﬁcation, E. K. Okada for helping with ﬁsh sampling, C. T. Harms for revising the manuscript, and Nupelia-UEM for logistic support. Part of this research was supported by grants from CNPq and CAPES.

References Agostinho, A. A., Ju´lio, H. F. Jr & Petrere, M. Jr (1994). Itaipu Reservoir (Brazil): impacts of the impoundment on the fish fauna and fisheries. In Rehabilitation of Freshwater Fisheries (Cowx, I. G., ed.), pp. 171–184. Hull: Hull International Fisheries Institute, University of Hull. Agostinho, A. A., Ju´lio, H. F. Jr & Gomes, L. C. (2003). Allochthonous species in the Upper Parana basin: status and patterns. In 2003 Joint Meeting of Ichthyologists and Herpetologists, Abstracts (Vogt, R. C. & Chao, N. L., eds), p. 5. Manaus, AM: American Society of Ichthyologists and Herpetologists (ASIH). Agostinho, A. A., Bini, L. M.; Gomes, L. C., Ju´lio, H. F. Jr, Pavanelli, C. S. & Agostinho, C. A. (2004). Fish Assemblage. In The Upper Parana´ River and its Floodplain: Physical Aspects, Ecology and Conservation (Thomaz, S. M., Agostinho, A. A. & Hahn, N. S., eds), pp. 223–246. Leiden: Backhuys Publishers. Agostinho, A. A., Thomaz, S. M. & Gomes, L. C. (2005). Conservation of the biodiversity of Brazil’s island waters. Conservation Biology 19, 646–652. Alves, M. N. (1998). Ana´lise Citogene´tica da Famı´lia Cichlidae: Geˆnero Cichla (Schneider, 1801) Perciformes, Labroidei. MS Thesis Dissertation, Instituto Nacional de Pesquisas da Amazoˆnia, AM, Brazil. Andrade, F., Schneider, H., Farias, I., Feldberg, E. & Sampaio, I. (2001). Ana´lise filogene´tica de duas espećies simpa´tricas de tucunare´(Cichla, Perciformes), com registro de hibridacxaõ em diferentes pontos da bacia amazoˆnica. Revista Virtual de Iniciacxaõ Acadeˆmica da UFPA 1, 1–11. Arthington, A. H. (1991). Ecological and genetic impacts of introduced and translocated freshwater fishes in Australia. Canadian Journal of Fisheries and Aquatic Sciences 48, 33–43. Avise, J. C., Jones, A. G., Walker, D. & Dewoody, J. A. (2002). Genetic mating systems and reproductive natural histories of fishes: lessons for ecology and evolution. Annual Review of Genetics 36, 19–45. Bardakci, F. & Skibinski, D. O. F. (1994). Application of the RAPD technique in tilapia fish: species and subspecies identification. Heredity 73, 117–123. Black, B. (1997). RAPDPLOT 3.0. Fort Collins, CO: Colorado State University. Brinn, M. N., Porto J. I. & Feldberg, E. (2004). Karyological evidence for interspecific hybridization between Cichla monoculus and C. temensis (Perciformes, Cichlidae) in the Amazon. Hereditas 141, 252–257. Callejas, C. & Ochando, M. D. (2001). Molecular identification (RAPD) of the eight species of the genus Barbus (Cyprinidae) in the Iberian Peninsula. Journal of Fish Biology 59, 1589–1599. Cronin, M. A., Spearman, W. J., Wilmot, R. L., Patton, J. C. & Bickham J. W. (1993). Mitochondrial DNA variation in chinook (Oncorhynchus tshawytscha) and chum salmon (O. keta) detected by restriction enzyme analysis of polymerase chain

# 2006 The Authors Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277 276 A. V. OLIVEIRA ET AL.

reaction (PCR) products. Canadian Journal of Fisheries and Aquatic Sciences 50, 708–715. Excoffier, L., Laval, G. & Schneider, S. (2005). Arlequin ver. 3.0: an integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online 1, 47–50. Farias, I. P., Orti, G., Sampaio, I., Schneider, H. & Meyer, A. (1999). Mitochondrial DNA phylogeny of the family Cichlidae: monophyly and fast molecular evolution of the neotropical assemblage. Journal of Molecular Evolution 48, 703–711. Fontenele, O. & Peixoto, J. T. (1979). Apreciacxaõ sobre os resultados da introducxaõdo tucunarećomum, Cichla ocellaris (Bloch & Schneider, 1801), nos acxudes do nordeste brasileiro, atrave´s da pesca comercial. Boletim Tećnico do DNOCS 37, 109–134. Hubbs, C. L. (1955). Hybridization between fish species in nature. Systematic Zoology 4, 1–20. Ju´lio, H. F. Jr & Agostinho, A. A. (2003). Introduced species into the Upper Parana´ River floodplain by elimination of a geographical barrier and stocking programs. In 2003 Joint Meeting of Ichthyologists and Herpetologists, Abstracts (Vogt, R. C. & Chao, N. L., eds), pp. 244–245. Manaus, AM: American Society of Ichthyologists and Herpetologists (ASIH). Khrisanfova, G. G., Ludannyi, R. I., Slyn’ko, Iu. V., Iakovlev, V. N. & Cemenova, S. K. (2004). RAPD fingerprinting of common bream Abramis brama L., roach Rutilus rutilus L., and their F1 hybrids. Genetika 40, 1432–1436. Kullander, S. O. (1986). Cichlid Fishes of the Amazon River Drainage of Peru. Stockholm: Swedish Museum of Natural History. Kullander, S. O. & Nijssen, H. (1989). The Cichlids of Surinam. Leiden: E.J. Brill. Kumar, S., Tamura, K. & Nei, M. (2004). MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Briefings in Bioinformatics 5, 150–163. Legendre, P. & Anderson, M. J. (1998). Program DistPCoA. Montreal: De´partement de sciences biologiques, Universite´de Montreál. Legendre, P. & Anderson, M. J. (1999). Distance-based redundancy analysis: testing multispecies responses in multifactorial ecological experiments. Ecological Mono- graphs 69, 1–24. Meyer, A., Kocher, T. D., Basasibwaki, P. & Wilson, A. C. (1990). Monophyletic origin of Victoria cichlid fish suggested by mitochondrial DNA sequences. Nature 347, 550–553. Monesi, N., Jacobs-Lorena, M. & Pacxo-Larson, M. L. (1998). The DNA puff gene BhC4- 1ofBradysia hygida is specifically transcribed early prepupal salivary glands of Drosophila melanogaster. Chromosoma 107, 559–569. Nei, M. & Li, W. H. (1979). Mathematical model for studying genetic variation in terms of restriction endonucleases. Proceedings of the National Academy of Sciences of the United States of America 76, 5269–5273. Nishiyama, P. B. (1998). Ana´lise citogene´tica de tucunare´s (Cichla: Pisces, Cichlidae) da represa de Volta Grande, municı´pio de Conceicxaõ das Alagoas, Minas Gerais. MS Thesis Dissertation, Instituto de Biocieˆncias – UNESP, SP, Brazil. Novaes, J. L. C., Caramaschi, E. P. & Winemiller, K. O. (2004). Feeding of Cichla monoculus Spix, 1829 (Teleostei: Cichlidae) during and after reservoir formation in the Tocantins River, Central Brazil. Acta Limnologica Brasileira 16, 41–49. Oliveira, A. V., Prioli, A. J., Prioli, S. M. A. P., Pavanelli, C. S., Ju´lio, H. F. Jr & Panarari, R. S. (2002). Diversity and genetic distance in populations of Steindachnerina in the upper Parana´river floodplain of Brazil. Genetica 115, 259–267. Orsi, M. L. & Agostinho, A. A. (1999). Introducxaõ de espećies de peixes por escapes acidentais de tanques de cultivo em rios da bacia do rio Parana´, Brasil. Revista brasileira de Zoologia 16, 557–560. Perry, W. L., Lodge, D. M. & Feder, J. L. (2002). Importance of hybridization between indigenous and nonindigenous freshwater species: an overlooked threat to North American biodiversity. Systematic Biology 51, 255–275.

# 2006 The Authors Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277 GENETIC DIVERSITY OF CICHLA POPULATIONS 277

Pierce, P. C. & Van Den Avyle, M. J. (1997). Hybridization between introduced spotted bass and smallmouth bass in reservoirs. Transactions of the American Fisheries Society 126, 939–947. Prioli, S. M. A. P., Prioli, A. J., Ju´lio, H. F. Jr, Pavanelli, C. S., Oliveira, A. V., Carrer, H., Carraro, D. M. & Prioli, L. (2002). Identification of Astyanax altiparanae (Teleostei, Characidae) in the Iguacxu river, Brazil, based on mitochondrial DNA and RAPD markers. Genetics and Molecular Biology 25, 421–430. Rubidge, E. M. & Taylor, E. B. (2004). Hybridization zone structure and the potential role of selection in hybridizing populations of native westlope cutthroat trout (Oncorhynchus clarki lewisi) and introduced rainbow trout (O. mykiss). Molecular Ecology 13, 3735–3749. Saitou, N. & Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4, 406–425. Scribner, K. T., Page, K. S. & Bartron, M. L. (2001). Hybridization in freshwater fishes: a review of case studies and cytonuclear methods of biological inference. Reviews in Fish Biology and Fisheries 10, 293–323. Shafland, P. L. (1996). An overview of Florida’s introduced butterfly peacock bass (Cichla ocellaris) sportfishery. Natura Caracas 96, 26–29. Smith, P. S., Konings, A. D. & Kornfield, I. (2003). Hybrid origin of a cichlid population in lake Malawi: implications for genetic variation and species diversity. Molecular Ecology 12, 2497–2504. Tamura, K. & Nei, M. (1993). Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular Biology and Evolution 10, 512–526. Teixeira, A. S. & Oliveira, S. S. (2005). Evidence for a natural hybrid of peacock bass (Cichla monoculus vs. Cichla temensis) based on esterase electrophoretic patterns. Genetics and Molecular Research 4, 74–83. Weiss, S., Schlo¨tterer, C., Waidbacher, H. & Jungwirth, M. (2001). Haplotype (mtDNA) diversity of brown trout Salmo trutta in tributaries of the Austrian Danube: massive introgression of Atlantic basin fish – by man or nature? Molecular Ecology 10, 1241–1246. Williams, J. G. K., Kubelik, A. R., Livak, J., Rafalski, J. A. & Tingey, S. V. (1990). DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Research 18, 6531–6535.

Electronic Reference Buckup, P. A. & Menezes, A. (2003). Cata´logo dos peixes marinhos e de a´gua doce do Brasil. Available from http://www.mnrj.ufrj.br/catalogo

# 2006 The Authors Journal compilation # 2006 The Fisheries Society of the British Isles, Journal of Fish Biology 2006, 69 (Supplement B), 260–277