THE POLYCHAETA OF CANADA: EXPLORING DIVERSITY AND
DISTRIBUTION PATTERNS USING DNA BARCODES
A Thesis
Presented to
The Faculty of Graduate Studies
of
The University of Guelph
by
CHRISTINA M. CARR
In partial fulfilment of requirements
for the degree of
Master of Science
April, 2010
© Christina M. Carr, 2010 Library and Archives Bibliotheque et 1*1 Canada Archives Canada Published Heritage Direction du Branch Patrimoine de I'edition
395 Wellington Street 395, rue Wellington Ottawa ON K1A 0N4 Ottawa ON K1A 0N4 Canada Canada
Your Tile Votre reference ISBN: 978-0-494-64615-1 Our file Notre reference ISBN: 978-0-494-64615-1
NOTICE: AVIS:
The author has granted a non L'auteur a accorde une licence non exclusive exclusive license allowing Library and permettant a la Bibliotheque et Archives Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par I'lnternet, preter, telecommunication or on the Internet, distribuer et vendre des theses partout dans le loan, distribute and sell theses monde, a des fins commerciales ou autres, sur worldwide, for commercial or non support microforme, papier, electronique et/ou commercial purposes, in microform, autres formats. paper, electronic and/or any other formats.
The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in this et des droits moraux qui protege cette these. Ni thesis. Neither the thesis nor la these ni des extraits substantiels de celle-ci substantial extracts from it may be ne doivent etre imprimes ou autrement printed or otherwise reproduced reproduits sans son autorisation. without the author's permission.
In compliance with the Canadian Conformement a la loi canadienne sur la Privacy Act some supporting forms protection de la vie privee, quelques may have been removed from this formulaires secondaires ont ete enleves de thesis. cette these.
While these forms may be included Bien que ces formulaires aient inclus dans in the document page count, their la pagination, il n'y aura aucun contenu removal does not represent any loss manquant. of content from the thesis.
1+1 Canada ABSTRACT
THE POLYCHAETA OF CANADA: EXPLORING DIVERSITY AND DISTRIBUTION PATTERNS USING DNA BARCODES
Christina M. Carr Advisor: University of Guelph, 2010 Dr. P.D.N. Hebert
This thesis investigates the diversity and distribution of polychaetes from
Canadian marine waters employing both morphological (literature reports) and molecular
(mtDNA) approaches. Collation of species reports from the literature indicated that nearly 15% of the 1,023 Canadian polychaete species occur in all three of Canada's oceans. In contrast, DNA barcode analysis of these widespread species indicated that most were species complexes. Barcode analysis of 333 provisional polychaete species revealed 40 times more sequence divergence between than within species, and extensive cryptic diversity in 36 morphospecies. Further examination of genetic discontinuities between Pacific and Atlantic-Arctic sister taxa indicated that periodic ice retreats during the Pleistocene enabled multiple migrations of polychaete species across the Bering
Strait, ultimately increasing polychaete diversity in Canada. This thesis demonstrates the utility of DNA barcoding as a tool for species identification in polychaetes and for illuminating evolutionary and biogeographic patterns among species. ACKNOWLEDGEMENTS
/ have grown so much during the two and a half years of this Masters degree and
owe several people thanks. First and foremost I thank my advisor, Paul Hebert, for
allowing me to choose my own path. He never told me no and was genuinely excited
about everything I pursued. There was never-ending infrastructure andfieldwork
support, allowing me to sequence every polychaete (and amphipod) I could collect, and
to travel to various coasts of Canada and Russia. I learned the value of each specimen,
and how to smuggle them across borders.
I thank the 1999-2001 collectors who traveled to and dove in Resolute and Igloolik, NU.
Your collections inspired me to pursue research in polychaete worms, a group in which I
took an immediate and lasting personal interest. The acquisition of over 2000 specimens
was a team effort. I thank my co-workers and friends for help in the field: Brandon
Laforest, Erin Corstorphine, Jayme Sones, Jeremy deWaard, Lauren Wallace, Martin
Brummell, Nick Jeffery, Paola Pierossi, Sandra McCubbin, and the Saunders lab. The
"zodiak of adventure " and running tactfully from polar bears will never be forgotten. I
thank the researchers and staff at the Churchill Northern Studies Centre for providing
great accommodations and delicious meals.
I thank my advisory committee, Alex Smith and Jonathan Witt, for fruitful discussions and
guidance. I thank my lab mates for teaching me everything I know about being a graduate student. I am forever grateful that Erin chose to work on echinoderms, and not moths, so we could travel together. Beth Clare was always there to train me in the lab, to
edit my drafts, and to bounce ideas off Kevin Kerr, John Wilson, and Vazrick Nazari
i were great lab mates, willing to listen and take time out of their day to give advice. My
office mates, Taika von Konigslow and Chandni Kher, provided many laughs and
distractions along the way; thanks!
Thank you to several BIO people for helping me with numerous tasks along the way, including sequencing bone tissue from a potential Lake Okanogan Ogopogo. I thank Alex
Borisenko, Jay Cossey, Justin Schonfeld, Liuqiong Lu, Maria Kuzmina, Megan Milton,
Natalia Ivanova, Rick Turner, Rob Dooh, and Sujeevan Ratnasingham for help and
support with programming, imaging, lab protocols, software, and specimen curation.
Thanks to Susan Mannhardt for keeping our lives in order, and to Sarah Adamowiczfor
providing thoughtful feedback and inspiration along the way.
Several organizations and grants supported this research. Funding to Paul Hebert supporting DNA barcode analysis include a NSERCIPYgrant, NSERC Discovery grant,
NSERC Strategic Network grant to the Canadian Healthy Oceans Network, and grants through Genome Canada. The Churchill Northern Studies Centre, the Census of Marine
Life, the Northern Scientific Training Program, and the Ontario Graduate Scholarship
Program provided additional support for my research. I owe great thanks to those who
helped with identification of specimens: Tara Macdonald, Ruth Barnich, Dieter Fiege,
Torkild Bakken, and Myriam Schuller. Thanks also to Sarah Mincks Hardy and Tanya
Brown for providing valuable specimens.
Finally, I thank my family for support, encouragement, and always believing in me more
than I did myself. Especially I thank Mark, without whom I would not have made it
through this thesis in one piece. I will never forget his guidance, help, and endless
patience.
ii TABLE OF CONTENTS
LIST OF TABLES vii
LIST OF FIGURES viii
LIST OF APPENDICES ix
GENERAL INTRODUCTION 1
CHAPTER 1: Polychaete diversity and distribution patterns in Canadian marine waters 5
Abstract 6
Introduction 7
Methods 10
Geographic regions 10
Data collection 11
Similarity indices 12
Faunal distributions 12
Results 13
Sampling effort and taxonomy 13
Species diversity 13
Faunal distributions 14
Discussion 14
A checklist for Canadian polychaetes 14
Species diversity in Canadian waters 15
iii Geographic distributions of Canadian polychaete species 17
Boreal distributions 17
Boreal-arctic distributions 17
Amphiboreal and amphiboreal-arctic distributions 18
Conclusions 19
CHAPTER 2: DNA barcoding in Canadian polychaetes 28
Abstract 29
Introduction 30
Methods 33
Specimen collection and taxonomy 33
DNA isolation, extraction, and amplification 34
Species delineation 35
Diversity and regional similarity indices 36
Nucleotide and amino acid composition 37
Statistical analyses 37
Results 38
Amplification and sequence success 38
Species diversity and genetic distances 39
Diversity and regional similarity indices 40
Nucleotide and amino acid composition 41
Discussion 41
A DNA barcode reference library for Canadian polychaetes 42
Species diversity and divergence 42
iv BINs as biological species 44
Comparison of morphological and molecular diversity 47
Geographic distributions 48
Conclusions 50
CHAPTER 3: High divergence rates and staggered Pleistocene migrations in trans-
Arctic polychaetes 68
Abstract 69
Introduction 70
Methods 72
Specimens 72
Sequence divergence 73
Saturation 74
Molecular clock tests 74
Results 75
Sequence divergence 75
Saturation 75
Molecular clock tests 76
Divergence rates and divergence times of sister taxa 76
Discussion 77
Conclusions 84
SUMMARY AND CONCLUSIONS 89
Chapter summary 89
v Future directions 90
LITERATURE CITED 92
APPENDIX 1.1 123
APPENDIX 3.1 229
APPENDIX 3.2 236
VI LIST OF TABLES
CHAPTER 1
Table 1 Biogeographic distributions of Canadian polychaetes 21
CHAPTER 2
Table 1 List of primers 51
Table 2 Faunal composition of polychaete species with DNA barcodes 52
Table 3 Thirty-six polychaete morphospecies split into multiple provisional species
by DNA barcodes 54
vii LIST OF FIGURES
CHAPTER 1
Figure 1 Map of collection sites from the reference literature 22
Figure 2 Sampling effort vs. number of species in five ocean regions 23
Figure 3 Reports of polychaete species from Canadian waters 24
Figure 4 Dates of first descriptions for polychaete species in Canada 25
Figure 5 Faunal composition of polychaetes in five ocean regions of Canada 26
Figure 6 Similarity plot of species among five ocean regions 27
CHAPTER 2
Figure 1 Map of eight collection sites with associated number of specimens 56
Figure 2 Neighbour-joining tree of 333 provisional barcode species 57
Figure 3 Genetic distances (% K2P) within species, genera, and families 61
Figure 4 Number of 28S nucleotide differences vs. COI % K2P divergence 62
Figure 5 Instraspecific divergence vs. number of individuals per BIN 63
Figure 6 Maximum intraspecific vs. nearest neighbour distances 64
Figure 7 Rarefaction curves of BINs and morphospecies 65
Figure 8 Similarity plot of provisional species among seven regions 66
Figure 9 Consensus secondary structure plot of the barcode region 67
CHAPTER 3
Figure 1 Neighbour-joining tree of 18 trans-Arctic polychaete species 86
Figure 2 Saturation plot of transitions and transversions for the barcode region.... 87
Figure 3 Sequence divergence and dates of divergence between sister taxa 88
viii LIST OF APPENDICES
Appendix 1.1 Species checklist of polychaetes from Canadian marine waters .... 123
Appendix 3.1 List of trans-Arctic polychaete species 229
Appendix 3.2 Results of relative rate tests for three polychaete datasets: between sister taxa, between trans-Arctic species, and within families 236
ix GENERAL INTRODUCTION
The diversity of life in the ocean is largely unknown (Knowlton 1993; Bouchet
2006). Throughout the past 250 years of systematic research, approximately 250,000 marine species have been formally described (Bouchet 2006). Estimates extrapolated from the well-studied European fauna suggest that 1.4 - 1.6 million species exist worldwide (Bouchet 2006), while estimates from the deep-sea predict over 10 million
(Grassle and Maciolek 1992). Highlighting this gap between recognized and unknown marine biodiversity, a recent review reported that one third of specimens analyzed in marine studies are not identified to species (Schander and Willassen 2005). However, our knowledge of marine biodiversity has increased substantially in the past decade, reflecting advances in sampling technology and the ease of acquiring DNA sequences.
For example, the Census of Marine Life has discovered more than 5,600 potential new species over this time interval (http://www.coml.org). Moreover, molecular approaches are beginning to shed light on long standing questions in biogeography and evolutionary history of marine fauna.
Polychaetes are one of the dominant macroinvertebrate groups in marine systems, in terms of both species number and abundance (Quijon and Snelgrove 2005). Despite being a conspicuous component of benthic communities, most species are undescribed.
Many are overlooked because of presumed widespread geographic and ecological distributions (Hutchings 1998), but it is now apparent that such widespread distributions are usually a consequence of inadequate taxonomic assessment (Maltagliati et al. 2000;
Bhaud and Petti 2001; Bleidorn et al 2006). Recently, several studies have employed molecular techniques to discriminate species of polychaetes, and most reveal cryptic
1 diversity (e.g., Rice et al. 2008; Olson et al. 2009; Pleijel et al. 2009). However, previous
work has been taxon-focused and no broad genetic investigation (geographic or taxonomic) has been undertaken.
Polychaetes have generally been excluded from broad-scale distributional studies because of their supposed lack of geographic structure (Pocklington and Tremblay 1987).
However, the recent discovery that many widespread species are actually species assemblages with similar morphology has led to an increased interest in employing genetic data to study taxon distributions (e.g., Breton et al. 2003; Jolly et al. 2005; 2006).
Distribution and diversity patterns might be particularly interesting among Canadian polychaetes, where the fauna has been strongly impacted by repeated cycles of glaciation.
The North Pacific and Atlantic faunas were isolated for much of the Cenozoic until approximately 3.5 million years ago (Ma), when the Bering Strait flooded and numerous
Pacific species invaded the Arctic and North Atlantic Oceans (Vermeij 1991;
Cunningham and Collins 1998). Climatic and hydrographic effects of Pleistocene glaciations dramatically altered the distribution of marine invertebrates in the northern hemisphere (Wares and Cunningham 2001). Examining patterns of molecular divergence in polychaete species from widespread Canadian marine regions will provide valuable insights into geographic dispersal barriers and degrees of gene flow between extant populations.
The DNA barcode initiative (Hebert et al 2003a) began in 2003 and now provides a major effort to document global biodiversity through a DNA-based identification system. It is now apparent that sequence variation in a short fragment of the mitochondrial cytochrome c oxidase I (COI) gene provides a powerful tool for
2 differentiating animal species (Hebert et al. 20036). As of March 2010, the Barcode of
Life Data System (Ratnasingham and Hebert 2007) holds more than 800,000 records representing 67,000 described species, and more than 30,000 additional provisional species. Through sequences linked to voucher specimens, DNA barcoding offers a standardized and reproducible approach to species identification and discovery in biological studies. This has been particularly useful in marine systems where variable reproductive forms and life stages, morphological stasis, and damage to specimens during collection hinder identification of even well known taxa (Knowlton 1993).
The present study investigates species diversity and distributions of polychaete worms in Canadian marine waters. Since there is no comprehensive account of species from these regions, existing literature records are synthesized to create a taxonomic framework and diversity benchmark (Chapter 1). These data are then used to examine the diversity and biogeographic distributions of species in different ocean basins. This study establishes the extent of cosmopolitanism in Canadian waters, and provides a foundation for finer-scale examination of diversity using modern techniques.
Chapter 2 examines diversity and distribution patterns of polychaetes using DNA barcoding, while establishing a reference sequence library for a substantial fraction of the polychaete fauna of Canada. The efficacy of the COI barcode to discriminate polychaete species collected from Atlantic, Pacific, and Arctic Oceans of Canada is assessed. Using
DNA barcode clusters as proxies for species, morphological and molecular diversity estimates are compared. Finally, faunal similarity between regions and the prevalence of cosmopolitanism are examined and contrasted with previously determined trends
3 (Chapter 1). The patterns in mitochondrial DNA sequence divergence provide insights into mechanisms of speciation and the factors that drive diversification in polychaetes.
In Chapter 2, several species with distributions spanning Pacific, Arctic, and
Atlantic waters (i.e., amphiboreal-arctic) were determined to have large genetic breaks between Pacific and Atlantic-Arctic lineages. Chapter 3 examines this pattern in more detail, in reference to vicariance caused by northern hemisphere glaciations. The first major trans-Arctic interchange 3.5 million years ago (Vermeij 1991) provides the time context needed for examining patterns of molecular divergence in 18 trans-Arctic polychaete species, and for calibrating a molecular clock for the barcode region in polychaetes.
Finally, the main conclusions of this thesis and future research directions are briefly discussed.
4 - CHAPTER 1 -
Polychaete diversity and distribution patterns in Canadian marine waters Abstract
Polychaetes are an abundant and conspicuous component of benthic communities in Canadian marine waters. Although regional information on species diversity and distribution is available, less is known about broader-scale patterns. This study compiles diversity and distributional data for polychaete species collected from Canadian marine waters over the last 150 years. Records indicate the presence of 1,023 species belonging to 66 families with the greatest species diversity in the Pacific. While faunal similarity is highest between the Eastern and Western Arctic, endemism is lowest, reflecting the recent ice-free status of this basin. The high similarity of Atlantic and Arctic faunas suggests that the Atlantic played a major role in recolonization of the Arctic following glaciation. Nearly 15% of the species (144) have amphiboreal-arctic distributions, but many of these taxa may represent species complexes. This study provides a first comprehensive census of Canadian polychaetes, and a taxonomic framework for future diversity studies.
6 Introduction
With 8,000 - 9,000 described species (Hutchings and Fauchald 2000; Rouse and
Pleijel 2001) in more than 80 families (Fauchald and Rouse 1997), and an estimated
25,000 species worldwide (Snelgrove 1997), polychaetes are a key component of marine ecosystems. Because of their abundance and diversity, they are often used as indicators of environmental quality (Pocklington and Wells 1992) and as surrogates for total biodiversity (Olsgard et al. 2003). Such use is most effective when knowledge of species diversity is comprehensive (e.g., for Arabian Seas, Wehe and Fiege 2002; Brazil, Lana et al. 2006; Australia, Glasby et al. 2000). However, this information is lacking for many regions including Canada. Instead, species records exist in scattered, difficult-to-obtain taxonomic publications, or as one component of multi-taxon benthic surveys. The present study collates these reports to provide a taxonomic framework for future studies on polychaete biodiversity in Canadian waters.
The organization of species records also provides an opportunity to probe the distributional patterns and origins of the fauna (Dunton 1992). The distributions of
Canadian polychaetes have been little studied, in part due to the high frequency of presumed cosmopolitanism in the group (Westheide and Schmidt 2003). However, recent reports of hidden species endemism (usually based on DNA sequence analysis) have spurred new interest in examining taxon distributions (e.g., Breton et al. 2003; Jolly et al.
2005; 2006). The extent of cosmopolitanism versus endemism can be evaluated by combining all previous species reports from disparate geographic regions. Moreover, insights into colonization patterns and the degree of gene flow between populations are gained by evaluating faunal similarity between regions. These patterns may be
7 particularly interesting in Canada, where the fauna has been strongly impacted by repeated cycles of glaciation.
Species diversity and distribution among the three oceans surrounding Canada
(Northeast Pacific, Arctic, and Northwest Atlantic) are influenced by water mass characteristics and bathymetry (see Dunbar and Moore 1980; Bluhm et al. 2005), as well as by historical and ecological factors (Briggs 1974; Vermeij 1991; Dunton 1992). The
Pacific Ocean contains the most diverse fauna, reflecting the fact that it was least impacted by Pleistocene glaciations (Vermeij 1991). Often referred to as the 'centre of evolution and dispersal' for marine life (Briggs 1974), the North Pacific is the oldest and most heterogeneous basin supporting both cold-water and warm-temperate species
(Hobson and Banse 1981).
In the Canadian Arctic, Pleistocene glaciations forced species to the southern extent of their range, or to extinction. As a result, the Arctic has a young, less diverse fauna with few endemics (Dunton 1992). The relative contribution of Atlantic and Pacific species in post-glacial colonization is controversial (e.g., Holthe 1978; Wilce 1990;
Kupriyanova and Badyaev 1998), and may be taxon-specific. Greater basin connectivity enabled deep sublittoral species to colonize the Arctic from the North Atlantic (Knox and
Lowry 1977). By contrast, faunal exchange with the Pacific is limited to shallow water species by the Bering Strait (depth 70 m; Coachman and Barnes 1961). Despite this limited connectivity, numerous Pacific species occur in the Arctic today (Durham and
MacNeil 1967), reflecting strong eastward currents, a rich Pacific biota, and empty niches
(Vermeij 1991). Today, harsh climatic conditions, lower salinity, and perennial sea ice are dominant features of the Arctic ecosystem, limiting its colonization by many boreal
8 species. In contrast to the situation on land, the Arctic Ocean gains biological diversity as one moves from the west to the east (Cusson et al. 2007). There is one exception; Hudson
Bay is thought to have a less diverse biota because of its shallow waters (average depth
100 m), young age (10,000 yrs), and low salinity (Beals 1968).
The Northwest Atlantic was also greatly impoverished by the last glaciation
(Briggs 1970; Vermeij 1991). A large portion of its fauna was extirpated, and modern communities include many Pacific and European invaders (Vermeij 1991; Wares and
Cunningham 2001; Vainola 2003), resulting in a mixed fauna of old endemics and recent immigrants. The Pacific component reflects multiple invasions via the Arctic Ocean. The most successful migration occurred during the Pliocene (3.5 Ma; Vermeij 1991), when warmer conditions allowed the exchange of numerous temperate species. By contrast, more recent invasions have involved cold-water species, which expanded their range through the Arctic during interglacial periods (e.g., Dodson et al. 2007). While the
Canadian Atlantic is dominated by cold-temperate species with broad distributions
(Briggs 1970), boreal and warm-temperate forms are also found (Pocklington and
Tremblay 1987).
The present study provides a checklist of polychaete species for five major
Canadian marine regions: Atlantic, Pacific, and Arctic (divided into Eastern, Western, and Hudson Bay) waters. This information is used as a basis to examine regional biodiversity and biogeographic distributions of species. Further, by summarizing trans oceanic occurrences, the extent of cosmopolitanism in Canadian waters is addressed.
Collating records into a baseline inventory provides a taxonomic framework for future
9 identifications, a baseline diversity measure, and a means of determining whether a species is common, rare, or new to Canada.
Methods
Geographic regions
Each reported occurrence of a polychaete species was assigned to one of five regions: Atlantic (AT), Eastern Arctic (EAO), Western Arctic (WAO), Hudson Bay
(HB), and Pacific (PC) (Fig. 1). These regions are defined geographically and do not delineate faunal zones. Instead, boundaries were chosen to best integrate differences in basin characteristics as well as sites with data on species composition. Records from waters adjacent to Canada including Arctic and Pacific Alaska, Puget Sound
(Washington), Western Greenland, and the northern coast of Maine (> 44° N) were incorporated in these regional classifications.
The Atlantic region includes sites from 44° N bordering the southern coast of
Nova Scotia to 60° N extending from the northern tip of Labrador seaward to the southern tip of Greenland. This region spans 20 degrees of longitude (45 - 65° W). Major sites of collecting activity include Cobscook Bay (Maine), Bay of Fundy, St. Lawrence Estuary,
Minas Basin, Bras d'Or Lake (Nova Scotia), Bonne Bay (Newfoundland), and the
Labrador Sea (Fig. 1).
The EAO extends from the Atlantic boundary (60° N, 65° W - 60° N, 45° W) to the 97° W meridian and ranges from north of Hudson Bay to the northern tip of Ellesmere
Island (83° N). Important collection sites include Baffin Bay, Lancaster Sound, Western
Greenland, Davis Strait, Cumberland Sound, Frobisher Bay, Hudson Strait, Ungava Bay,
10 and Foxe Basin. The WAO ranges from the EAO boundary (97° W) to the Bering Strait
with collections deriving from the Canada Basin, Beaufort Sea shelf, Point Barrow
(Alaska), Amundsen Gulf, and Dease Strait. Hudson Bay spans 95 - 77° W and
approximately 12 degrees of latitude (51 - 63° N), with collection sites dispersed
throughout the Bay.
The Pacific region extends from the Bering Strait south to Puget Sound,
Washington (48° N, 122° W) with principal collection sites in the Bering Sea, the Gulf of
Alaska, Queen Charlotte Sound, and Puget Sound.
Data collection
The present list includes species records from 62 ecological and taxonomic
surveys including publications, technical reports, and keys. Multiple references were
examined for each region, but it was not possible to extract records from all past
investigations. The references span from 1852 to 2008 and include both benthic and pelagic surveys. The combined use of citations will occasionally result in redundancy where species records are cross-referenced between studies.
The record for each species includes its original author and type locality,
synonymies, and details on its distribution in Canadian waters. Uncertain species names, usually indicated by a question mark in the reference literature, were excluded. Only records identified to the species level were included; generic-level identifications were retained only when a genus had not previously been recorded from a region. The two main sources of type localities were Hartman (1959) and the World Register of Marine
Species (WoRMS; Fauchald 2009). Family assignments follow WoRMS (Fauchald
2009).
11 Valid species names and their synonymies are listed. This includes the original
designation and synonyms or alternate representations used in the reference literature,
and is not an exhaustive list. Sources of synonymy include Hartman's world polychaete
catalogue (Hartman 1959), WoRMS (Fauchald 2009), taxonomic revisions (Hartman
1938; Pettibone 1956; 19636; 1971; 1993; Banse 1973; Jumars 1974; Fauchald 1982; ten
Hove and Jansen-Jacobs 1984; Maciolek 1985; 1990; Paxton 1986; Mackie 1987; Wilson
1988; Fitzhugh 1990; Pleijel 1990; 1991; 1998; Blake 1991; 1996a; b; Light 1991;
Warren et al. 1994; Lovell 1997; Knight-Jones 1998; Petersen 1999; Jirkov 2001;
Boggemann 2002; Hutchings and Peart 2002; Kato and Pleijel 2002; Nygren 2004;
Sikorski and Bick 2004; Tovar-Hernandez 2007; Barnich and Fiege 2009), and personal communication with taxonomic specialists on particular families.
Similarity indices
Between-region species similarity measures were calculated using S0rensen's
similarity index QS=2C/(S1 + S2) where SI is the number of species in region 1, S2 is the number of species in region 2, and C is the number of species common to both regions (Sorensen 1948). The coefficient of similarity (QS) compares the proportion of species shared by two regions and ranges from 0 (no overlap) to 1 (complete overlap).
Similarity indices were calculated using Estimates v.8.2.0 (Colwell 2006).
Faunal distributions
Based on distribution patterns, each Canadian polychaete species was assigned to one of 7 biogeographic categories: i) Atlantic-boreal; ii) Pacific-boreal; iii) Arctic; iv)
Atlantic-Arctic; v) Pacific-Arctic; vi) amphiboreal; and vii) amphiboreal-arctic.
Categories are defined as follows: Atlantic-boreal or Pacific-boreal (occurring only in
12 boreal regions of one basin), Atlantic-Arctic or Pacific-Arctic (occurring in the Arctic
and either the Atlantic or Pacific), Arctic (occurring only in the Arctic), amphiboreal
(occurring in both Atlantic and Pacific waters, but not the Arctic), and amphiboreal-arctic
(occurring in Atlantic, Pacific, and Arctic waters).
Results
Sampling effort and taxonomy
Overall, 4,553 records of Canadian polychaete species were compiled. Sampling
effort was highest in the Pacific, followed by the Atlantic, Eastern Arctic, Western
Arctic, and Hudson Bay (Fig. 2). The number of specimens sampled in each region was highly correlated with species richness (Fig. 2). Sampling efforts were highest in the
1950's and 1980's (Fig. 3). A timeline of original descriptions for species recorded from
Canada shows that few new taxa have been recognized in the past two decades (Fig. 4).
Peaks in species descriptions occurred in the mid 1860's, 1880's, early 1900's, and mid
1950's. Major contributions for species recorded in Canada are Berkeley and Berkeley
(1828 - 1956), Sars (1829 - 1867), Malmgren (1865 - 1867), Verrill (1873 - 1885),
Moore (1902 - 1923), and Hartman (1936 - 1969).
Species diversity
In total, 1,023 polychaete species in 66 families are known from Canadian waters
(Appendix 1.1). The Polynoidae is the most diverse family with 74 species, followed by
Syllidae (69 species), and Spionidae (64 species). Of the 66 families recorded from
Canada, 25 account for more than 80% of the total diversity and family richness differs markedly between the five regions (Fig. 5). Diversity is highest in the Pacific with 645
13 species, followed by the Atlantic (455), the Eastern Arctic (287), the Western Arctic
(232), and Hudson Bay (102).
Faunal distributions
The EAO and WAO regions show the highest similarity (QS = 0.62), followed closely by the AT and EAO (QS = 0.60). The lowest species overlap occurs between PC and HB (QS = 0.21) (Fig. 6). Both Atlantic and Pacific faunas include many species with
Atlantic-boreal (41%) or Pacific-boreal (67%) distributions, whereas the Arctic has the lowest proportion (22%) of endemics (Table 1). Few species have Pacific-Arctic distributions, and more than 65% of these taxa are restricted to the Western Arctic. More species have distributions spanning Atlantic-Arctic Canada (Table 1). In addition, there are 45 amphiboreal species, and 144 amphiboreal-arctic species. The ten most common amphiboreal-arctic species are: Chaetozone setosa, Gattyana cirrhosa, Harmothoe imbricata, Lumbrineris fragilis, Nephtys ciliata, Nereis pelagica, Pectinaria granulata,
Pholoe minuta, Phyllodoce (Anaitides) groenlandica, and Terebellides stroemi.
Discussion
A checklist for Canadian polychaetes
The present study, which is the first to synthesize polychaete reports encompassing more than one ocean basin, indicates that at least 1,023 polychaete species in 66 families occur in Canadian waters (Appendix 1.1). The coastal areas of British
Columbia and New Brunswick have been well sampled, but efforts decline with increasing latitude. Notable gaps occur throughout the Canadian Arctic Archipelago and the North Atlantic between Newfoundland-Labrador and Davis Strait (Fig. 1).
14 Species diversity in Canadian waters
Taking into account uncertainty in the number of described polychaete species
(Hutchings and Fauchald 2000; Rouse and Pleijel 2001), approximately 12 - 13% of the
global fauna occurs in Canada. Hence, polychaete diversity in Canadian waters is
comparable to that reported for Australia (1,140 species; Glasby et al. 2000), the French
Atlantic (934 species; Dauvin et al. 2006), and the Southern Ocean (800 species; Schuller
and Ebbe 2007). The Canadian Pacific (645 species) is more diverse than the seas of
Eastern Russia (420 species; Ushakov 1965), while Atlantic Canada (455 species) is less
diverse than other boreal-arctic regions of similar or smaller area, such as the English
Channel (495 species; Dauvin et al. 2003). The 360 polychaete species reported from the
Canadian Arctic represent approximately half the species known from the Arctic Ocean
(Jirkov 2001). Based on its extensive coastline, Canada (with the exception of the
Pacific) is either low in polychaete diversity or contains a large portion of undescribed
diversity.
The most speciose families in Canadian marine waters (Polynoidae, Syllidae, and
Spionidae) are also dominant in Europe (Wehe and Fiege 2002; Dauvin et al. 2003; 2006)
and the Arctic Ocean (Jirkov 2001). The Polynoidae is dominant in terms of both abundance and species richness, with many endemics as well as widespread species.
Syllids and spionids, on the other hand, showed more restricted distributions suggesting high local speciation. Figure 5 indicates that, while there are differences in family composition among regions, the same eight families dominate the species assemblages for all regions of Canada. Species in these families are often unique in the Pacific.
15 Conversely, many taxa have distributions spanning the Arctic and Atlantic, reflecting the high connectivity of these regions (Fig. 6).
The higher diversity of North Pacific in comparison to North Atlantic polychaetes reflects a pattern noted in other animal phyla (Briggs 1970). Pacific diversity is three times higher than Atlantic diversity in fishes and various marine invertebrates (Powell and Bousfield 1969; Briggs 1970), and 1.5 - 2.7 times higher than Atlantic-Arctic diversity in molluscs (Vermeij 1991). The present study suggests that polychaete diversity in the northeast Pacific is 1.4 times higher than the northwest Atlantic. The apparent higher diversity in the Pacific was expected due to its older age, larger size, higher taxonomic diversity, and higher endemism, compared to the recently decimated fauna of the northwest Atlantic (Briggs 1970; Wares and Cunningham 2001).
Lower diversity and endemism in Arctic polychaetes is consistent with other taxa that experience latitudinal declines in richness (Weider and Hobaek 2000). Contributing factors include recent colonization, widespread distributions, and harsh climatic conditions. The high gene flow among Arctic regions likely reflects environmental similarity, high dispersal via currents, and a lack of physical barriers. The particularly low species diversity and endemism in Hudson Bay polychaetes has been previously noted in molluscs (Dyke et al. 1996) and various marine invertebrates (Cusson et al.
2007). However, Hudson Bay is the least sampled region in Canada and the nearly equal number of samples versus species (Fig. 2) suggests that many more taxa await discovery.
As in Cusson et al. (2007), more polychaete species are reported from the shallow, more productive Canadian Eastern Arctic than Western Arctic. However, the western region contains the largest subbasin of the Arctic Ocean, the Canada Basin (average depth 3,810
16 m; Dietz and Shumway 1961), and since many polychaetes are abyssal (> 3,500 m;
Paterson et al. 2009), additional species will certainly be revealed with further sampling efforts (e.g., MacDonald et al. 2009).
Geographic distributions of Canadian polychaete species
Boreal distributions
Many Canadian polychaete species are strictly boreal, reaching their northern range limit in Atlantic or Pacific Canada. As in other faunal groups (Briggs 1970), many polychaetes of the northwestern Atlantic have broad latitudinal distributions, extending north and south of the boreal zone. In contrast, restricted boreal forms are more prevalent in the Pacific where they constitute 67% of the fauna. Shifts in family composition were apparent when approaching the Arctic boundary. Many small-bodied families from boreal Canada have not yet been recorded in the Arctic (e.g., Alciopidae, Dinophilidae,
Magelonidae, Nerillidae, and Saccocirridae). Temperature limitation or weak dispersal capability may explain their absence, but it is also possible that many have been overlooked (Rouse and Pleijel 2001). While the families Ampharetidae, Polynoidae,
Maldanidae, and Terebellidae are dominant in the Arctic (Fig. 5; Wlodarska-Kowalczuk et al. 2007), most polychaete families are better represented in the temperate or tropic zones including Onuphidae (Paxton 1986), Sabellidae (Giangrande and Licciano 2004),
Serpulidae (Kupriyanova and Badyaev 1998), and pelagic families such as Tomopteridae and Alciopidae (Maurer and Reish 1984).
Boreal-arctic distributions
The number of species with Atlantic-Arctic distributions (96) was more than twice as high as those with Pacific-Arctic distributions (43), indicating that the Atlantic
17 has played a major role in recolonizing the Arctic. High migration between Atlantic and
Arctic regions of Canada may reflect the 2 - 5 times higher volume of northward flowing water compared to water entering from the Pacific (Dunton 1992), or the fact that the
Atlantic fauna has more cold-water species with larger latitudinal distributions than its
Pacific counterparts.
The low similarity between Pacific and Arctic regions (Fig. 6) might initially suggest that the Pacific has played a minor role in recolonizing the Arctic fauna. In reality, there is a similar number (110) of polychaete species with Pacific-Arctic distributions, but most of these taxa occur in the seas of Eastern Russia and do not extend to the Pacific coast of North America (Ushakov 1965). This faunal disconnect between the northeast (Canada and Alaska) and northwest (Eastern Russia and Japan) Pacific has been linked to historical processes. The warming of waters in coastal Pacific North
America following the Quaternary glaciations caused previously widespread cold-water species to either go extinct, or to seek refuge in the northwestern Pacific (Ushakov 1965).
The constant below zero temperature of the Bering Sea permitted survival of cold-water species, which subsequently became a major component of the modern Arctic fauna
(Ushakov 1965). The documented Pacific component (Ushakov 1965), coupled with evidence of a strong Atlantic influence from this study, indicates that both regions have played an important role in the recolonization of Arctic polychaete fauna.
Amphiboreal and amphiboreal-arctic distributions
This study revealed 45 polychaete species that occur in both Atlantic and Pacific
Canada, but are absent from the Arctic. This number is congruent with the 46 amphiboreal polychaete species reported in the northwestern Pacific (Ushakov 1965).
18 Amphiboreal distributions could arise from insufficient sampling in the Arctic, but most cases appear to reflect the interruption of a previously continuous distribution (Holthe
1986). Many temperate species recorded on the east and west coast of Canada migrated across an ice-free Arctic over 3 million years ago, and have been isolated ever since (e.g.,
Clymenella torquata; Kenny 1969). Despite their morphological similarities (Holthe
1978; Vermeij 1991), lineages that have been separated for this length of time are likely reproductively isolated, suggesting that species with truly amphiboreal distributions are probably rare (Briggs 1970). If correct, the 45 amphiboreal polychaete taxa in Canada may actually represent 90 species.
A substantial proportion of Canadian polychaete species have amphiboreal-arctic distributions, and many of these species are reported worldwide (i.e., are cosmopolitan).
In this study, 14% of species were found in all three oceans, a value similar to that
(12.2%) reported by Grainger (1954) for Canadian Arctic polychaetes, and the 12% cosmopolitan component in the South African polychaete fauna (Day 1967). However, several of the amphiboreal-arctic species from Canadian waters are now known to represent a species assemblage, indicating again that polychaete diversity in Canada is presently underestimated (e.g., Maldane sarsi Malmgren (Light 1991), Myriochele heeri
Malmgren (Parapar 2006), Owenia fusiformis delle Chiaje (Koh et al. 2003; Ford and
Hutchings 2005), Polydora cornuta Bosc (Rice et al. 2008), Scoloplos armiger Mtiller
(Bleidorn et al. 2006), and Syllis gracilis Grube (Maltagliati et al. 2000)).
Conclusions
Biogeographic inferences rely on the validity of taxonomic systems and since the literature is cited uncritically, it is possible that a number of species recorded in this study
19 are misidentifications. Further, many species currently regarded as widely distributed or
cosmopolitan may actually be complexes of sibling species. In addition to an overly
conservative taxonomy (Bleidorn et al. 2006), multiple and incomplete original
descriptions of taxa have led to a confusing list of synonymies within species in many
genera reported from Canadian waters. Additionally, an 'author effect' (Giangrande and
Licciano 2004) could bias the reported diversity and distributions of Canadian
polychaetes as the majority of taxonomic specialists work in temperate Atlantic and
Pacific regions.
The apparently large number of cosmopolitan and amphiboreal species is likely
an overestimate that reflects the weakness in polychaete taxonomy. If this conclusion is
correct, diversity in Canada may be seriously underestimated. To better understand the
true diversity of polychaetes, the application of modern analytical methods, such as DNA
sequencing, is critical. However, past studies provide an important foundation for finer-
scale examinations of biodiversity. Future research efforts should aim to increase
sampling in the Canadian Arctic and to examine the status of presumed amphiboreal and
cosmopolitan species. Because polychaetes are dominant macroinvertebrates in benthic
environments, compiling their known diversity is imperative for monitoring changes in
faunal composition. This may be particularly important if climate warming results in the anticipated mass migration of boreal Pacific species into the Arctic and North Atlantic
(Vermeij and Roopnarine 2008).
20 Table 1. Biogeographic distributions of Canadian polychaetes and the associated proportion of total Canadian species.
Distribution Total no. species % of total Canadian species
Atlantic-boreal 187 18 Pacific-boreal 429 42 Arctic 79 8 Atlantic-Arctic 96 10 Pacific-Arctic 43 4 Amphiboreal 45 4 Amphiboreal-arctic 144 14
21 to to
Figure 1. Map of five oceanic regions with black circles marking major collection sites in the reference literature. The pie diagram
compares relative polychaete species diversity across the five regions. 1800
1600
1400
1200 • Specimens recorded re
£ 1000 • Species o
E 800 3 to z 600
400
200
AT EAO HB PC WAO Region
Figure 2. Sampling effort vs. number of species reported in each of five regions across Canada: Atlantic (AT), Eastern Arctic Ocean
(EAO), Hudson Bay (HB), Pacific (PC), and Western Arctic Ocean (WAO). Cumulative Records o O O o o o o O O o o o o o o o o o CD in ^ CO CM T-
o
•a u s o .G2O 'o (L) 9v< t/3
o
OH o GO •c
spjooey o
24 go Cumulative Descriptions
C/3
S8
u £ o
o
'•o2
ol-l C/J
ts
O GO 25 10 Hudson Bay(n=102) 8 6 4 -\ 2 10 Western Arctic (n=232) 8 6 4 2 n n T1 T1 n'. ' R' , ' T1 10 Eastern Arctic (n=287) 8 6 4 - 2 - n n ^nnm[1 a_ 10 m Atlantic (n=455) 8 6 4 H 2 RnFlnnrin Figure 5. Proportion of total species from each of five marine regions belonging to the 25 most speciose families ranked in order from most (Polynoidae) to least (Goniadidae) diverse. 26 to complete over.ap) are represented by ,i„e width between two region, -CHAPTER 2- DNA barcoding in Canadian polychaetes Abstract Fast, reliable methods for assessing biodiversity are essential to support large- scale monitoring programs of marine benthos. Polychaetes comprise a large component of the diversity in these settings, but poorly defined species boundaries make identification difficult. Consequently, a DNA-based identification system linking voucher specimens to DNA sequences would be invaluable. This study explores the efficacy of cytochrome c oxidase subunit I (COI) to delineate and identify polychaete species from eight locations in Canadian marine waters. Analysis of 1,876 specimens indicated the presence of 333 provisional species, with 40 times more sequence divergence between than within species (16.5% versus 0.38%). The number of provisional species was twice as high as the number of identified morphospecies, suggesting that species diversity is significantly higher than presently recognized. While many polychaete species were thought to have amphiboreal-arctic distributions, few species with these broad distributions showed low divergence. Instead, large genetic breaks occur between Pacific and Arctic-Atlantic lineages. Results of this study demonstrate that COI sequences are an effective tool for species identification in polychaetes, and suggest that DNA barcoding will aid the recognition of polychaete species overlooked by the current taxonomic system. 29 Introduction Polychaetes are a diverse group of segmented worms found in oceanic habitats ranging from shallow estuarine waters to the deep sea. Although 8,000 - 9,000 polychaetes have been described (Hutchings and Fauchald 2000; Rouse and Pleijel 2001), it is thought that there are at least 25,000 species (Snelgrove 1997). Polychaetes are consistently one of the most abundant and species-rich groups in benthic surveys, numerically comprising between 48% (Mackie et al. 1997) and 79% (Laudien et al. 2007) of macroinvertebrates. As a consequence, they are often used as surrogates for overall biodiversity (Olsgard et al. 2003). Despite their abundance, polychaetes are poorly studied compared to other taxa of similar ecological importance (Fauchald 1984; Quijon and Snelgrove 2005). To obtain accurate estimates of benthic biodiversity, it is essential to improve the understanding of species diversity in this group. It now seems apparent that many polychaete species have been overlooked due to presumed cosmopolitanism (Hutchings 1998). Although most genera and families are cosmopolitan (Fauchald 1984), there is growing evidence that "widespread" species are more a reflection of inadequate taxonomy rather than true cosmopolitanism (Maltagliati et al. 2000; Bhaud and Petti 2001; Bhaud et al. 2006; Bleidora et al 2006; Martin et al. 2006). About 14% of the 1,025 polychaete species from Canadian marine waters are thought to occur in all three surrounding oceans (Ch. 1), but the extent of gene flow among their populations has never been tested. Moreover, the discovery of numerous undescribed sibling species of polychaetes in other boreal-arctic regions (e.g., Europe; Bastrop et al. 1998; Jolly et al. 2005) suggests that many species may be overlooked. 30 Species identification is difficult in many polychaete families (e.g., Syllidae; Aguado et al. 2007) due to a high proportion of morphologically cryptic species and a lack of taxonomic knowledge, especially for small-bodied families. Variable reproductive forms (e.g., epitokes) and larval types are difficult or impossible to identify, and damage during collection and preservation often leads to the loss of diagnostic characters. Further, many families combine morphological stasis with frequent homoplasy of the few varying traits (e.g., Oweniidae; Eklof et al. 2007), making it difficult to establish diagnostic characters. Benthic monitoring programs would particularly benefit from a standardized approach to species identification that can be employed by non-experts to aid rapid and accurate assessments of biodiversity. Traditional taxonomic approaches often overlook biologically distinct polychaete sibling taxa (e.g., Maltagliati et al. 2000; Mendez et al. 2000; Rice et al. 2008; Iannotta et al. 2009), and the incorporation of molecular data is increasingly recognized as necessary for delineating species boundaries and cataloguing biodiversity (Westheide and Schmidt 2003). In the past decade, several studies have utilized variation in mitochondrial DNA sequences to discriminate polychaete species (e.g., Westheide and Hass-Cordes 2001; Glover et al. 2005; Bastrop and Blank 2006; Bleidorn et al. 2006). Studies that incorporate DNA as a taxonomic character have consistently split presumed cosmopolitan species into complexes of often very divergent sibling species (e.g., Syllis gracilis, Maltagliati et al. 2000; Capitella capitata, Mendez et al. 2000). Further, there are no apparent cases where molecular data have been used to synonymize polychaete taxa. Hence, a large-scale genetic survey could provide new insights into polychaete biodiversity and systematics. 31 The DNA barcode initiative is a global effort to catalogue the diversity of life by linking sequence data to voucher specimens (Hebert et al. 2003a; Ratnasingham and Hebert 2007). The DNA barcode region for the animal kingdom is a short fragment (650 bp) of the mitochondrial cytochrome c oxidase subunit I (COI) gene. Barcoding has been shown to discriminate species effectively in well-studied groups such as birds (Kerr et al. 2007; 2009), bats (Clare et al. 2006), and fishes (Ward et al. 2005). Barcoding has also been used to recognize provisional species in groups with incomplete taxonomy (Floyd et al. 2002; Smith et al. 2005) including annelids (Chang et al. 2009; Novo et al. 2009). Despite concerns about its utility in understudied groups (Meyer and Paulay 2005), DNA barcoding has proven effective at linking larval stages to adults (Pegg et al. 2006), facilitating taxonomic descriptions and flagging errors (Janzen et al. 2009), revealing cryptic (Witt et al. 2006) and introduced (deWaard et al. 2009) species, and establishing diversity correlates for conservation and management (Smith et al. 2005; 2009). Previous studies have regularly demonstrated morphological, ecological, and behavioural differences between provisional species initially recognized through barcode analysis (Hebert et al. 2004a; Smith et al. 2006). Accordingly, barcode divergence thresholds are commonly applied to detect provisional species, including 'hard' thresholds set at 2 - 3% (Floyd et al. 2002; Smith et al. 2005), standard screening thresholds set at 10 times the average intraspecific COI divergence among known species (Hebert et al. 20046), and 98% or higher bootstrap support in a neighbour-joining tree (Kerr et al. 2009). While several studies have suggested the efficacy of COI to discriminate polychaete species (e.g., Rice et al. 2008; Olson et al. 2009; Pleijel et al. 2009), no large- scale survey has been undertaken. This study seeks firstly to establish a DNA barcode 32 reference library for the polychaete species of Canada. Second, the utility of a COI barcode for discriminating species across a diverse class is tested by examining discontinuities in genetic divergence within and between lineages (i.e., a 'barcode gap' between intra- versus interspecific divergences; Meyer and Paulay 2005). The third goal is to examine the congruence between morphological and molecular diversity estimates. Finally, this study aims to assess the biogeography and prevalence of cosmopolitanism in Canadian polychaetes. Methods Specimen collection and taxonomy A total of 2,324 polychaetes were collected (see project information in "Polychaeta of North America (PONA)" on the Barcode of Life Data System (BOLD); www.barcodinglife.org) between 1999 and 2008 from eight locations in Canada and Alaska (Fig. 1). These sites included Bamfield (British Columbia), Bering Sea, Chukchi Sea (Alaska), Churchill (Manitoba), Resolute, Igloolik (Nunavut), Torngat Mountains National Park (Labrador), and St. Andrews (New Brunswick). Samples were primarily collected in the intertidal zone and nearshore coastal waters from dives, subtidal dredges, and plankton tows. Whenever possible, multiple specimens of each morphospecies were collected for analysis. Specimens were fixed and preserved in 95% ethanol which was replaced a minimum of three times to prevent dilution of the fixative. Specimens were initially assigned to a family or genus using morphological criteria. Following DNA sequence analysis, specimens from each barcode cluster were morphologically identified using taxonomic keys for each region and, where possible, 33 species identifications were verified by taxonomic specialists. Taxonomic assignments follow the World Register of Marine Species (WoRMS; Fauchald 2009). In cases where a single morphospecies split into two or more distinct clusters, the Linnaean species name was retained and appended with interim identifiers (e.g., Glycera capitata CMC01). Where the most precise identification was to a genus, similar interim names were applied (e.g., Polycirrus sp. CMC01). Morphological work is ongoing and taxonomic assignments will be updated as experts examine specimens. Collection data, photographs, specimen information, sequences, and electropherograms are available from the PONA project console on BOLD. DNA isolation, extraction, and amplification A small piece of muscle or gill tissue was lysed in 45 ul cetyltrimethylammonium bromide (CTAB) lysis buffer solution (Ivanova et al. 2008) plus 5 ul proteinase K. Samples were incubated at 56 °C for 12 - 18 hours. DNA was extracted following the manual protocol of Ivanova et al. (2008) with a 3 um glass fibre plate and re-suspended in 40 - 50 ul of ddH20. The target COI region was amplified using the polymerase chain reaction (PCR) with standard primers (Table 1). To further validate species recognized through barcode analysis, a 700 bp sequence of the more slowly evolving nuclear 28S ribosomal D9-10 expansion region was sequenced for a subset of COI barcode clusters. PCR for both COI and 28S were carried out in a 12.5 \i\ reaction volume containing 6.25 ul 10% trehalose, 2 \x\ ddH20,1.25 \x\ 10X PCR buffer, 0.625 ul MgCl2 (50 mM), 0.125 ul of each primer (10 uM), 0.0625 ul dNTPs (10 mM), 0.06 ul Platinum Taq polymerase, and 2 ul of DNA template (10-50 ng). The thermocycling profile for all primers (except the cocktail) consisted of one cycle of 1 min at 94 °C, five cycles of 34 40 s at 94 °C, 40 s at 45 °C, and 1 min at 72 °C, followed by 35 cycles of 40 s at 94 °C, 40 s at 51 °C, and 1 min at 72 °C, with final extension for 5 min at 72 °C. For the primer cocktail, thermocycling conditions were slightly modified (see Ivanova et al. 2007). PCR products were run on the E-Gel® 96-well system (Invitrogen) and PCR products for both COI and 28S were bidirectionally sequenced using BigDye v3.1 on an ABI 3730x1 DNA Analyzer (Applied Biosystems). Sequences were manually edited using Sequencher v4.5 (Gene Codes Corporation, Ann Arbor, MI) and aligned by ClustalW in MEGA 4.0 (Tamura et al. 2007). Sequences were quality-checked with the sequence scanner software SeqCleanR (von Konigslow 2009) which flags and ranks the likelihood of sequence validity based on quality, length, and fit to the dataset. Reported anomalous sequences that were not obvious pseudogenes (i.e., no frameshifts, full-length) or contaminants (following BLAST-type searches) were re-analyzed with alternate primers to test for multiple copies of COI. Species delineation Species assignments were based on the distance-based Barcode Index Number (BIN) algorithm (Ratnasingham and Hebert, in prep.), which creates maximum spanning networks by connecting sequences that are within 2% similarity and assigns a unique identifier to each sequence cluster. Unlike approaches that employ a hard threshold, species networks created by the BIN algorithm are flexible, allowing for total within-BIN divergence to vary. If two closely related barcode clusters form distinct BINs, they become candidates for separate species (hereafter referred to as provisional species). The operational BIN concept allows practical recognition of species and provides a 35 foundation for explicit examination of species status. To test for congruence between the generated BIN results and other species-sorting algorithms, the data set was also run through TCS (Clement et al. 2000). This is a character-based program that constructs haplotype networks by inferring the most parsimonious branch connections at a 95% confidence level. Throughout the results and discussion, all 'provisional species' refer to BIN designations unless otherwise indicated, and 'morphospecies' refers to all specimens identified to a particular Linnaean name. Neighbour-joining (NJ) analysis using the Kimura two-parameter (K2P) model (Kimura, 1980) was conducted in MEGA 4.0 to provide a graphical representation of the species tree, using one representative per barcode cluster (BIN). For all subsequent data analyses, BINs were used as proxies for species. Genetic distances (K2P) were calculated using the BOLD "Distance Summary" and "Nearest Neighbour Summary" tools (Ratnasingham and Hebert 2007). Diversity and regional similarity indices To examine differences in molecular and morphological diversity, BIN groups were compared to morphospecies in the cases where morphological designations were available (approximately 3/4 of specimens). Individual-based rarefaction curves were generated for morphospecies (n=l,343) and BINs (n=l,876) with 50 randomizations and sampling without replacement. To evaluate similarity in species composition between collection sites, Serensen's similarity index was calculated (S0rensen 1948) QS=2C/(S1 + S2) where SI is the number of species in region 1, S2 is the number of species in region 2, and C is the number of species common to both regions. Both diversity and similarity indices were calculated using Estimates v.8.2.0 (Colwell 2006). 36 Nucleotide and amino acid composition Nucleotide composition for the barcode region of COI was obtained using the "Sequence Composition" tool in BOLD. To locate the position of insertions and deletions (indels) in the aligned data set (1,876 sequences), a secondary structure map of the barcode region was constructed. A majority consensus sequence was obtained using Geneious Pro (Drummond et al. 2009) and placed into MEMSAT3 (Jones 2007) to estimate the secondary structure topology. Statistical analyses To determine whether the number of individuals analyzed affected the amount of intraspecific variation (average and maximum), a linear regression was performed between these variables. To test the assumptions of homoscedastic variance, a Spearman rank correlation was run on the absolute value of the residuals and K2P distance. A Shapiro-Wilk test was run to test the assumption of normally distributed residuals. In all cases, the data fit these assumptions. To compare the two molecular markers, a Pearson product moment correlation was performed between the number of substitutions in 28S nearest-neighbour pairs and the corresponding COI K2P distance. Because 28S data were non-normal, a Spearman rank correlation was also determined, but results were qualitatively similar (Spearman's p= 0.773,/? < 0.0001). Sequences of some species examined in this study possessed amino acid indels that might represent nuclear copies of mitochondrial DNA (NUMTs). To assess whether these species differed from the rest of the dataset in patterns of nucleotide substitution, transition:transversion (Ti:Tv) ratios were calculated in MEGA 4.0 and a two-sample, two-tailed t-test was performed on GC and GT dinucleotide ratios, calculated in DAMBE 37 (v.5.1.1; Xia and Xie 2001). According to Bensasson et al. (2001), Ti:Tv ratios are higher in mtDNA, and GC -> GT mutations are more common in nuclear DNA. Levene's test, and the Shapiro-Wilk test were used to check the assumptions of equal variance and normality of the two distributions, respectively, and the data conformed to these assumptions. All statistical tests were conducted in JMP v.6 (SAS). Results Amplification and sequence success Three primer sets successfully amplified COI from 1,876 of 2,324 specimens (81% success). Failures mostly involved members of species where it was possible to recover a barcode record from other conspecifics, but approximately 25 morphospecies failed to yield sequences. Most of these taxa belonged to the families Serpulidae, Spionidae, and Spirorbidae. Initial PCR with LCO1490J1/HCO2198J1 (Folmer et al. 1994) amplified 50% of specimens, while a new primer set (polyLCO/polyHCO) amplified an additional 20%. Most species of Spionidae, Sabellidae, and Cirratulidae were amplified with the primer cocktail (Ivanova et al. 2007), while members of the genus Nephtys were more easily amplified with polyLCO/PolyshortCOIR. Species of Serpulidae and Spirorbidae were amplified with polyLCO/polyHCO using PCR products as template for a second PCR. SeqCleanR flagged approximately 30 sequences with comparatively low likelihood scores. These sequences were either truncated (removed from BOLD and analyses if < 500 bp), low quality (removed if > 1% N's), or contained amino acid indels (see below). 38 Species diversity and genetic distances Overall, 1,876 sequences were recovered from 333 species, representing 110 genera and 36 families (Fig. 2; Table 2). Richness estimates from the BIN algorithm and TCS were similar (TCS: 336 species networks), and therefore only BIN results are presented. In total, 194 (58%) BINs were identified to a described species, 97 to a genus level, and the remaining 42 to a family level. COI sequence divergence between species was 40-fold higher than within species (mean congeneric and conspecific K2P distances 16.5% (SE = 0.05%) and 0.38% (SE = 0.01%) respectively), while divergences within each family averaged 25.18%) (SE = 0.03%) (Fig. 3). COI divergences differed among families: the scale worms Polynoidae and Pholoidae showed the lowest nearest-neighbour distances (mean 9.6%), while species of Hesionidae, Serpulidae, and Spionidae had the highest nearest-neighbour distances (mean 32.4%). Approximately 35% of the 215 species with 28S sequences shared a genotype. The remaining 28S sequences had an average congeneric divergence of 3.43% (SE = 0.37%o). The number of 28S substitutions and COI %K2P distance showed a strong positive correlation (Fig. 4); congeners with no 28S variation have low COI divergence. The average number of individuals analyzed per species was 5.7 (range = 1 - 69), but many species (119) were represented by single sequences, reflecting the high taxon diversity. There was no significant relationship between the number of individuals analyzed per species and average intraspecific variation, which was always under 2% (Fig. 5a). There was, however, a significant relationship between the number of individuals analyzed per species and maximum intraspecific variation, though 95% of maximum divergences were under 3% (Fig. 5b). 39 Several morphospecies had average intraspecific divergences between 15% and 25% and these taxa always included two or more distinct clusters, which the BIN algorithm partitioned (Fig. 6a,b). BINs formed clusters with minimum nearest-neighbour distances of 2% and maximum intraspecific variation from 0 - 3.8% (Fig. 6b). Within morphospecies, the average of the maximum K2P distances was 5.9% compared to 0.9% within BINs. Of the BINs with species-level identifications (194), 106 had unique species assignments, while the remaining 88 were derived from 36 morphospecies. Average intraspecific divergence within these 36 assemblages was 12.5% (Table 3). The scale worms Arctonoe fragilis and Arctonoe vittata were the only two species to share a barcode. Although maximum intraspecific divergence in the cluster was high (2.81%), the 16 specimens formed a connected network with no consistent geographic or taxonomic division (indicated by an asterisk in Fig. 2). Diversity and regional similarity indices The rarefaction curve generated with BINs showed a higher slope than the morphospecies curve, with significant divergence (non-overlapping 95% confidence intervals) apparent after sampling of 200 specimens (Fig. 7). Faunal similarity was highest between Arctic sites (Nunavut, Churchill, and Labrador) and lowest between Bamfield and all other sites (Fig. 8). There were no BINs with amphiboreal distributions, and only one, Harmothoe imbricata CMC01, with a continuous amphiboreal-arctic distribution across Canada. 40 Nucleotide and amino acid composition Nucleotide composition showed a moderate AT bias (mean A 25%, T 34.5%, C 22.5%, G 18%). GC content averaged 40.6% (SE = 0.075), ranging from a low of 28% (Sphaerodoridae) to a high of 54% (Travisia spp.J. Most indels occurred in external loop 2 and inner loop 2 (Fig. 9). Twelve species had multiple indels in their amino acid profile (Serpulidae: n=5, Spirorbidae: n=4, Travisia: n=2, and Spio setosa), but in all cases the reading frame was preserved suggesting the amplified COI fragments are functional copies. Moreover, they showed no signs of PCR ghost bands (Bensasson et al. 2001), retained 13 of 16 residues that are thought to be of functional importance (Fig. 9; Ward and Holmes 2007), and demonstrated characteristics typical of mtDNA. For example, the Ti:Tv ratio (0.7) was comparable to the rest of the dataset (0.9) and there was no evidence for a shift in GC -» GT dinucleotide frequency. In fact, anomalous sequences had significantly more GC dinucleotides than the rest of the data set (t-stat=8.00,/><0.001) indicating that methylation of GC sites is not occurring as would be expected if the DNA was nuclear (Bensasson et al. 2001). Discussion The present study demonstrates the effectiveness of DNA barcoding as a general tool for species identification in polychaetes. The clustering pattern of COI barcodes helped to flag misidentifications, guided taxonomic decisions, and facilitated the detection of diversity overlooked by the current taxonomic system. Of the 142 morphospecies identified in this study, 36 contained multiple BINs representing nearly 90 provisional species. This suggests that the use of molecular techniques will make it 41 possible to rapidly bridge the large gap between the number of described (8,000 - 9,000; Hutchings and Fauchald 2000; Rouse and Pleijel 2001) and predicted (25,000; Snelgrove 1997) polychaete species. A DNA barcode reference library for Canadian polychaetes This study has led to the analysis of nearly 2,000 specimens and 333 provisional polychaete species. Based on the 1:2 ratio of morphospecies to provisional species found in this study (Fig. 7), this diversity represents 16% of the reported Canadian total (1,023; Ch. 1). The Arctic was the most heavily sampled region with 140 species (20% of known fauna), followed by the Pacific (120 species, 9% of known fauna), and Atlantic (86 species, 10% of known fauna). Within the reference library, sequences can be matched to 106 supported species (e.g., Arenicola marina), 36 morphospecies representing 88 provisional barcode-supported species (e.g., Pectinaria granulata CMC01), and 97 genus-level provisional species (e.g., Nephtys sp. CMC01). Although many provisional species recognized in this study lack Linnaean binomials, barcode results alone provide useful information about species' geographic distribution, ecology, and morphology (Zhou et al. 2009). Many of the species identified in this study are common and widespread throughout the Arctic and North Atlantic, suggesting the immediate utility of the reference library for the identification of specimens collected throughout these regions. Sequence diversity and divergence In comparison to many other groups, polychaetes show elevated variation in both nucleotide and amino acid profiles for COL For example, while the average congeneric divergence (16.5%) may decrease with further sampling of closely related taxa, it is the 42 highest value in a survey of 11 animal phyla (Hebert et al. 20036), and is currently exceeded only by other annelids (Huang et al. 2007; Chang et al. 2009). The broad range of GC content variation in the mitochondrial region of polychaetes encompasses the full range recorded for this region across all animals (22 - 53%; Clare et al. 2008). Reports of indels in the barcode region of COI are rare, but among polychaetes they were observed in species of seven families. Additionally, there was evidence for accelerated evolution in recently separated trans-Arctic sister taxa with sequence divergences about twice as high (15.5%) as expected (7%) under the standard 2% per My mtDNA clock (Brown et al. 1979; Knowlton et al. 1993). This high level of variation could reflect unique properties of mitochondrial evolution in polychaetes. In this study, barcodes differentiated morphologically identified polychaete species in all but one case (98% discrimination success). All interspecific distances were above 2%, while most intraspecific divergences fell well below 2%, leaving only a small amount of overlap (Fig. 3). Although the BIN algorithm allows for species networks to be infinitely large (provided each sequence connection is within 2%), the highest observed within-BIN divergence was 3.8%, indicating that barcodes naturally form tight clusters with low variation. The 40-fold higher average sequence divergence between species than within species and the infrequency of intermediate divergences indicates that COI barcodes have high discriminatory power for polychaetes. This is especially useful in recently glaciated Arctic and North Atlantic regions where many species are young. An increase in maximum intraspecific divergence was noted with the accumulation of more individuals, supporting the use of a soft (rather than hard) threshold approach to species delimitation. It seems intuitive that as sampling becomes 43 more comprehensive across a species' geographic range, maximum divergence will increase; but if the network forms a cohesive cluster, it is important that it remains one species rather than being arbitrarily split into two. The BIN algorithm (Ratnasinghham and Hebert, in prep.) is flexible in assigning provisional species boundaries, allowing those with naturally higher intraspecific variation to form one network. A soft threshold approach is therefore particularly important for species with large geographic ranges. BINs as biological species The low intra- and high interspecific divergence values noted in this study are consistent with other studies that used COI to investigate relationships between polychaete taxa (Chevaldonne et al. 2002; Hurtado et al. 2004; Glover et al. 2005; Jolly et al. 2005; Bastrop and Blank 2006; Drake et al. 2007; Osborn et al. 2007; Rice et al. 2008). For example, interspecific divergence found in this study averaged 16.5% vs. 16% between cryptic populations of Pectinaria koreni (Jolly et al. 2005), 10% between sister species of siboglinid polychaetes (Chevaldonne et al. 2002), and 8.3% between morphologically indistinguishable species of polynoid polychaetes (Glover et al. 2005). Similarly, Drake et al. (2007) found low intraspecific (0.2 - 2%) and high interspecific (19 - 23%) distances among species of reef-building Phragmatopoma. There are several examples in recent polychaete studies where members of genetically differentiated cryptic complexes (sibling taxa) show variation in other traits. For example, genetically distinct populations of both the Poly dor a cornuta complex (Rice et al. 2008) and the Capitella capitata complex (Mendez et al. 2000) are reproductively isolated. Members of the Hediste japonica complex show differences in life history (Sato and Masuda 1997), while sympatric sibling species of the Polydora AA ciliata complex show differences in their ecology (Manchenko and Radashevsky 1993). Likewise, in Syllis gracilis, morphologically identical populations are genetically separated by marine and brackish water habitats (Maltagliati et al. 2000). These results support the hypothesis that genetically distinct cryptic species are truly reproductively isolated entities with significant divergence in biological attributes. Similarly, there are indications that the natural clusters formed by the BIN system in this study represent distinct species. Consistent with Hebert et al. (20036), high intraspecific divergences were often associated with distinct geographic isolates, suggesting independent evolution (Fig. 2; Table 3). Ecological specialization was another apparent driving factor for undocumented diversity. For example, two species of Eteone were previously recorded from Hudson Bay, but barcoding revealed eight distinct BINs at Churchill alone (Fig. 2). These provisional species were generally associated with different habitats (e.g., estuary, mud, sand, subtidal kelp, dense clay). Evidence for local adaptation and genetic isolation in geographically and ecologically widespread species that share a similar morphology suggests that future studies on natural populations will reveal substantial cryptic diversity. Some BINs may represent an intermediate between divergent populations and distinct species. In three cases, maximum intraspecific K2P distance in a lineage exceeded minimum congeneric distance: Harmothoe imbricata CMC04 (3.1% and 2.6%), Pectinaria granulata CMC03 (3.8% and 2.2%), and Pholoe sp. CMC03 (2.8% and 2.1%). These patterns in variation might reflect the impacts of repeated glacial cycles in North Atlantic and Arctic regions, known to harbour species with complex genetic patterning (e.g., Macoma balthica; Nikula et al. 2007). Within each complex, sister taxa were 45 separated less than a million years ago (based on a divergence rate of 4.4% per My for polychaetes; Ch. 3). Insufficient time for lineage sorting could explain the small distances between taxa, but it is also possible that populations are not reproductively isolated. Recent origins coupled with complex historical distributions make such young species particularly difficult to diagnose (Knowlton 2000; Hebert et al. 20046). In most cases, interpreting species boundaries in this study was straightforward. Formally named species formed genetic clusters that were easily identifiable and highly divergent from other such clusters. However, this study also revealed many sibling, or provisional species, which required further consideration. BINs presumably represent reproductively isolated biological species since, in the absence of gene flow, populations acquire fixed genetic differences. While reproductive isolation is difficult to test among allopatric taxa (Knowlton 2000), it can be inferred by the presence of molecular divergence between sympatric sibling taxa (Wayne 1992), or by the maintenance of distinction between vicariant lineages after secondary contact (Coyne and Orr 2004). There were cases in this study where divergent intraspecific clusters were evident in the absence of geographic barriers (e.g., British Columbia Naineris dendritica), and many cases of vicariant speciation where fragmented populations evolved in allopatry during Pleistocene glaciations. In at least one case, the Harmothoe imbricata complex, refugial lineages coexist in the central Canadian Arctic, yet remain distinct despite the potential for gene flow. Whether these relatively young provisional species will continue on separate evolutionary trajectories, hybridize to form new types, or eventually merge cannot be predicted; speciation is not a static process, but is dynamic, continuous, and reversible. Although further examination is required for confirmation of species status, 46 such apparent divergence in sympatry is strongly suggestive of reproductive isolation (Coyne and Orr 2004). Comparison of morphological and molecular diversity In this study, rarefaction curves were employed to assess differences in diversity estimates based on molecular versus morphological data. This approach is preferred to comparing total richness as it takes into account relative abundances (Colwell et al. 2004). As expected, barcode-based diversity curves were considerably steeper than curves generated with morphologically identified species (Fig. 7). After analysis of 300 specimens, genetic species diversity was 1.5 times higher than morphospecies diversity and after analysis of 1,000 specimens, diversity estimates doubled. Treating provisional species as functional units of biodiversity, these trends indicate that species richness in polychaetes is greatly underestimated. The effectiveness of DNA barcoding was originally established through work on groups where a strong taxonomic framework enabled tests of the validity of barcodes. The opportunity to examine whether COI-delineated species reflect morphological species in polychaetes was possible in two families, Nereididae and Polynoidae, which were identified by taxonomic experts. In differentiating species, most disagreements between diagnostic methods reflected a conservative morphology. In the Nereididae, all identified specimens were correctly assigned to species, no morphospecies shared a barcode, and divergences between species far exceeded those within. Barcodes further partitioned members of two species into geographically distinct lineages: Nereis pelagica, which showed no morphological variation (T. Bakken, pers comm.), and Allita virens, one of many amphiboreal species collected in this study (Table 3). Further study 47 revealed morphological differences in the provisional Pacific species, Alitta sp. CMC01, which is currently under taxonomic investigation. Barcodes also flagged possible cryptic diversity in three morphospecies of Polynoidae: Harmothoe imbricata, Harmothoe rarispina, and Lepidonotus squamatus, all of which exhibited deep genetic divergences between Pacific and Atlantic lineages (Fig. 2; Table 3). Confirmation of the ability of barcodes to discern morphospecies in expertly identified groups supports its utility in polychaete families lacking taxonomic expertise. All other identified Polynoidae species formed distinct barcode clusters, except for two genetically indistinguishable (both by COI and 28S) species in the genus Arctonoe. Barcode sharing may arise in varied ways (Kerr et al. 2007), but hybridization is a likely explanation since gametes of these species are highly compatible in reciprocal cross studies, suggesting their potential for gene exchange (Pernet 1999). These species occur sympatrically (Pernet 1999), and are distinguishable morphologically (R. Barnich, pers comm.), however, morphological intermediates are common (Davenport 1950; Pernet 1999). While intermediate phenotypes are a general feature of hybrids (Mallet 2007), an alternative hypothesis may be that this is actually one phenotypically plastic species. Further examination with various nuclear genes should aid clarification of species boundaries in this genus. Geographic distributions Most amphiboreal-arctic species examined in this study contained multiple provisional species (Fig. 2; Table 3). Genetic discontinuities were consistently detected between lineages from British Columbia and the Arctic or Atlantic (Fig. 8), suggesting long-term separation (e.g., Lepidonotus squamatus; 14.81% divergence). However, many 48 North Pacific (Bering Sea) and Arctic-Atlantic taxa were genetically similar (e.g., Pholoe baltica; 1.55% divergence), suggesting recent or continuous gene flow among northern populations over the Bering Strait. Consistent with previously determined distribution patterns (Ch. 1), the highest endemism was apparent in the Pacific, while the Arctic fauna showed little regional divergence (Fig. 8). The observed geographic distributions support three general conclusions: i) there is no evidence for current amphiboreal gene flow as all amphiboreal sister taxa were genetically distinct; ii) the fauna of British Columbia and the Bering Sea are markedly different; and iii) Arctic polychaetes are genetically similar to both North Pacific (Bering Sea) and Atlantic taxa, but distinct from the fauna of coastal British Columbia (Fig. 8). Many species thought to occur in the Atlantic and Pacific Oceans are likely distinct, reflecting their separation for about 3.5 million years (Briggs 1970). In the present study, eighteen species occurred in Pacific and North Atlantic or Eastern Arctic regions and twelve of these eighteen showed enough genetic divergence to designate them provisional species (Table 3). Although many of these taxa likely originated from Pacific ancestors and migrated into the North Atlantic via the Arctic Ocean (Vermeij 1991; Vainola 2003), most were originally described from the Atlantic (Table 3), suggesting new names for Pacific lineages may be required. The discovery of several cases where one morphospecies split into multiple provisional species was anticipated given the high number of cryptic species reported in recent literature (Bastrop et al. 1998; Westheide and Schmidt 2003; Bleidorn et al. 2006), and supports the assertion of large genetic breaks coupled with little morphological variation among trans-Arctic species in general (Holthe 1978; Palumbi and Kessing 1991; Vermeij 1991). 49 Conclusions DNA barcoding and BIN grouping provides a way to recognize species without defining them (Witt et al. 2006) and without requiring their a priori assignment to a Linnaean binomial (Smith et al. 2008). Given the public nature of barcode records, provisional species hypotheses generated with COI data are open to interpretation. This study provides further support that barcoding can accelerate the detection of overlooked species and help distinguish between truly cryptic species and morphological variants or 'pseudo-cryptic' species (Knowlton 1993; Saez et al. 2003). Integrating conventional taxonomy with a DNA-based identification system for polychaetes of Canada has the potential to provide a fast and efficient approach to biodiversity assessment that cannot be achieved by morphology alone (Smith et al. 2005). With the incorporation of molecular characters, estimates of species diversity are rising; the polychaetes represent a model case for unregistered biodiversity and will undoubtedly benefit from a global effort to expand the DNA barcode reference library. 50 Table 1. List of primer pairs with the 5' Ml 3 tail shaded. Primer Sequence (5'-3') Reference LCO1490J1 (F) TGTAAAACGACGGCCAGTGGTCAACAAATCATAAAGATATTGG Folmeretal. 1994 HC02198J1 (R) CAGGAAACAGCTATGACTAAACTTCAGGGTGACCAAAAAATCA Folmeretal. 1994 polyLCO (F) GAYTATWTTCAACAAATCATAAAGATATTGG This study polyHCO (R) TAMACTTCWGGGTGACCAAARAATCA This study PolyshortCOIR (R) CCNCCTCCNGCWGGRTCRAARAA This study C_VFlLFtl (F) Ratio Ivanova et al. 2007 LepFltl 1 TGTAAAACGACGGCCAGTATTCAACCAATCATAAAGATATTGG VF1J1 1 TGTAAAACGACGGCCAGTTCTCAACCAACCACAAAGACATTGG VFldJl 1 TGTAAAACGAGGGCCAGTTCTCAACCAACCACAARGAYATYGG VFliJl 3 TGTAAAACGACGGCCAGTTCTCAACCAACCAIAAIGAIATIGG C_VRlLRtl (R) Ivanova et al. 2007 LepRIJl 1 CAGGAAACAGCTATGACTAAACTTCTGGATGTCCAAAAAATCA VRldJl 1 CAGGAMCAGCTATGACTAGACTTCTGGGTGGCCRAARAAYCA VR1J1 1 CAGGAAACAGCTATGACTAGACTTCTGGGTGGCCAAAGAATCA VRliJl 3 CAGGAAACAGCTATGACTAGACTTCTGGGTGICCIAAIAAICA 28S D9-10 Fl (F) AAGGTAGCCAAATGCCTCATC Brown etal. 1999 28S D9-10 Rl (R) GTGAATTCTGCTTCATCAATGTAGGAAGAGCC Brown etal. 1999 M13F (F) TGTAAAACGACGGCCAGT Messing 1983 M\3R(R) CAGGAAACAGCTATGAC Messing 1983 Table 2. Faunal composition by region (east to west): St. Andrews (ST); Torngat Mountains (TOR); Churchill (CHU); Igloolik (IGL); Resolute (RES); Chukchi Sea (CHK); Bering Sea (BS); and Bamfield (BAM). Families are listed in order of species richness (BINs). Within each family, the abundance (N) and number of morphospecies containing multiple BINs (split morphospecies) are indicated. Number of Species Split Family BINs N morpho ST TOR CHU IGL RES CHK BS BAM species Polynoidae 38 294 6 5 7 3 10 9 11 11 5 Phyllodocidae 30 164 5 1 13 3 5 1 2 5 4 Syllidae 28 86 2 - 6 2 3 - 2 15 2 Terebellidae 28 95 3 6 5 3 6 - 1 10 1 Spionidae 18 106 4 1 8 - 4 - 1 3 1 Orbiniidae 16 68 4 - 4 - - - 4 5 2 Sabellidae 15 60 3 1 3 - 1 - 2 7 2 Nereididae 14 150 2 - 1 2 1 - 1 10 2 Maldanidae 13 46 4 2 3 - 1 - 2 3 2 Nephtyidae 13 96 5 2 3 2 2 - - 3 2 Flabelligeridae 12 30 1 2 1 1 6 - - 1 2 Ampharetidae 11 38 1 - 8 - 1 - 2 1 Cirratulidae 11 76 1 - 6 2 3 - 1 3 1 Pholoidae 8 111 3 - 4 - 2 - 3 2 Capitellidae 7 24 1 - 4 - 1 - 2 - 2 Glyceridae 7 31 2 1 1 - 1 - 1 4 1 Opheliidae 7 90 1 2 4 - - - - 1 2 Goniadidae 6 19 1 1 - - - - 1 3 Lumbrineridae 6 54 2 1 1 - - - 1 2 1 Trichobranchidae 6 13 1 3 2 - 3 - - - 1 Serpulidae 5 6 ------5 52 Number of Species Split Family BINs N morpho- ST TOR CHU IGL RES CHK BS BAM species Dorvilleidae 4 15 - 4 Hesionidae 4 54 - 1 2 2 Pectinariidae 4 52 2 2 2 Spirorbidae 4 9 2 1 Scalibregmidae 3 15 - 2 Aphroditidae 2 7 1 Onuphidae 2 9 - Oweniidae 2 16 - Sternaspidae 2 7 - Arenicolidae 14 - Chaetopteridae 6 - Chrysopetalidae 1 - Magelonidae 8 - Paraonidae 3 - Saccocirridae 2 - Sphaerodoridae 1 - Total 333 1876 57 32 93 21 55 10 39 108 36 53 Table 3. Thirty-six polychaete morphospecies split by barcodes into multiple lineages with associated divergence between populations (%K2P) and previously determined distribution across Canada (Ch.l). Type locality and regional occurrence for lineages of each taxon (Atlantic Ocean (AT), Arctic Ocean (AO), Pacific Ocean (PC), and cosmopolitan (COS)) are shown. No. of Mean Species Populations Distribution Type locality lineages % div. Alitta virens (M. Sars, 1835) 2 15.56 PC/AT Amphiboreal-subarctic Atlantic Ocean, Norway Barantolla americana Hartman, 1963 2 22.86 PC Pacific-arctic Pacific Ocean, California Brada villosa (Rathke, 1843) 2 20.10 PC/AO Amphiboreal-arctic Atlantic Ocean, Norway Capitella capitata (Fabricius, 1780) 2 21.78 AO Amphiboreal-arctic Atlantic Ocean, Greenland Chone magna (Moore, 1923) 2 18.92 PC Pacific-boreal Pacific Ocean, California Cirratulus cirratus (O.F. Muller, 1776) 3 18.20 PC/AO Amphiboreal-arctic Atlantic Ocean, Europe Eteone longa (Fabricius, 1780) 3 14.03 AO Amphiboreal-arctic Arctic Ocean, Spitsbergen Euclymene zonalis (Verrill, 1874) 2 16.88 AT Amphiboreal Atlantic Ocean, Maine Eumida minuta (Ditlevsen, 1917) 2 4.10 AO Arctic Arctic Ocean, Davis Strait Eunoe nodosa (M. Sars, 1861) 2 2.64 AO Amphiboreal-arctic Atlantic Ocean, Norway Eunoe oerstedi Malmgren, 1866 2 5.47 AO/AT Amphiboreal-arctic Atlantic Ocean, Sweden Flabelligera affinis M. Sars, 1829 2 16.49 AO Amphiboreal-arctic Atlantic Ocean, Norway Glycera capitata 0rsted, 1842 2 8.68 PC/AO Amphiboreal-arctic Atlantic Ocean, Greenland Harmothoe imbricata (Linnaeus, 1767) 6 11.63 COS/PC/AO/AO+AT Amphiboreal-arctic Atlantic Ocean, North Sea Harmothoe rarispina (M. Sars, 1861) 3 10.21 AO/PC/AO+AT Amphiboreal-arctic Atlantic Ocean, Norway Laonice cirrata (M. Sars, 1851) 2 19.38 PC Amphiboreal-arctic Atlantic Ocean, Norway No. of Mean Species Populations Distribution Type locality lineages % div. Leitoscoloplos pugettensis (Pettibone, 1957) 5 15.88 PC Pacific-arctic Pacific Ocean, Washington Lepidonotus squamatus (Linnaeus, 1758) 2 14.81 PC/AT Amphiboreal Atlantic Ocean, Europe Lumbrineris fragilis (O.F. Miiller, 1776) 2 3.00 AO/AT Amphiboreal-arctic Atlantic Ocean, Denmark Micronephthys neotena (Noyes, 1980) 2 5.18 AT/AO+AT Atlantic-arctic Atlantic Ocean, Maine Myxicola infundibulum (Renier, 1804) 2 15.76 PC/AT Amphiboreal-arctic Atlantic Ocean, Med. Sea Naineris dendritica (Kinberg, 1867) 4 5.79 PC Pacific-boreal Pacific Ocean, British Columbia Neoamphitrite robusta (Johnson, 1901) 2 11.60 PC Pacific-boreal Pacific Ocean, Washington Nephtys punctata Hartman, 1938 3 8.48 PC/AO Pacific-arctic Pacific Ocean, Alaska Nereiphylla castanea (Marenzeller, 1879) 2 22.66 PC/AO Pacific-boreal Pacific Ocean, Japan Nereis pelagica Linnaeus, 1758 3 3.73 PC/PC+AO/AT Amphiboreal-arctic Atlantic Ocean, Europe Nothria conchylega (M. Sars, 1835) 2 6.64 PC/AO Amphiboreal-arctic Atlantic Ocean, Norway Ophelia limacina (Rathke, 1843) 2 8.68 AO Amphiboreal-arctic Atlantic Ocean, Norway Ophelina acuminata 0rsted, 1843 2 3.82 AO/AT Amphiboreal-arctic Atlantic Ocean, Denmark Pectinaria granulata (Linnaeus, 1767) 3 8.47 PC/AT/AO+AT Amphiboreal-arctic Atlantic Ocean, Europe Phyllodoce groenlandica 0rsted, 1843 2 12.99 AO Amphiboreal-arctic Atlantic Ocean, Greenland Praxillella praetermissa (Malmgren, 1865) 2 3.45 PC+AO Amphiboreal-arctic Atlantic Ocean, Norway Scalibregma inflatum Rathke, 1843 2 5.48 PC/AO+AT Amphiboreal-arctic Atlantic Ocean, Norway Syllis alternata Moore, 1908 5 29.69 PC Pacific-boreal Pacific Ocean, Alaska Syllis elongata (Johnson, 1901) 2 4.18 PC Pacific-boreal Pacific Ocean, Washington TerebellidesstroemiM. Sars, 1835 4 20.27 AT/AO Amphiboreal-arctic Atlantic Ocean, Norway ,.™ •••\-jpm» 5 66N 'Ifef11 1L ! ££26]^\ Arctic Ocean ResoluteBay, Bay, X^ J \ Parrymy Chi Channel ^ 'L V < V n=167\i 30 W- X/V~X^""W-VJ2a Ccv? $?rc^& ••. ^v>^ XAA Torngat Mountains \ National Park, Labrador Sea 4Wk Atlantic Ocean ON X1 . >KN ^•y St. Andrews, 1/ BayofFundy n=409I \ 6f;^vyf . Figure 1. Map of eight collection sites across Canada and Alaska and the number of specimens collected at each location. • Polynoidac (n~t) -0 Polynoidac (n~3) Bam field — ^fGattyantt cirrhosa (it^ll) St. Andrews ® ® Euttoe depressa (n=4) Churchill 0 Harmothoe rarispina CMCOl (n~l) Resolute — © Harmothoe rarispina CMC02 (n=l) Igloolik — ^0 Harmothoe rarispina CMC03 (n-lH) Chukchi Sea ® • Polynoidac (n—2) Bering Sea • Eitipo torelti Oi=Jj Torngat Mountains • Polynoidac (n-t) a ^ pdttttoe nodosa CMC02 (n~lO) I "I ® Eunoe nodosa CMCOl fwl) \ Polynoidae t&Gattyuna eiliata (n~2) -• —• © Euttoe oerstedi CMC02 (n~2) I ® Euaoe oerstedi CMCOl © Lepidasthenia berkeleyae (n~l) t — 0 Arctonoe fragith / A. vittata (n=!6) - @ArctonoepidchraOr*I'7) 0 f'holoe sp. CMCOl (n=l) ® Photoe sp. CMC02 (n=3) IP Photoe mhwta (n~30) # Photoe baltica (n*=4) Pholoidae _ ® Photoe sp. CMC05 (n«*t) -* Photoe sp. CMC03 (tr-=40j % Photoe sp. CMC04 (n=2S) - 0 tlalosydna hrevisetosa (n~13) © Lepidotiotus squamutns CMCOl (n~5) ! % Lepidonotus st/uamatus CMC02 (n~21) j 0 Pttofoides aspents (n~l) © Dorvitlea sp. CMCOl (a*>I) - ® Dorvitlea sp. CMC02 (n=l) Dorvilleidae % Protodorvlltea gracilis (n~2) • © Schis/omeringos tongicorttis (n—tl) - ® Latmice cirrata CMCOl (iv7) | ® Loot/ice ctrrafa CMC02 C/i-l) S •- 0 OphcO'ntt ammiiutttt CMCOl (tr-2) I Opheliidae (part) 13 Ophvlhut (u-umhiiiHi CM CO 2 (n*>4) \ 0 Spio sp. CMC02 0r-l2J —%Spiosp. CMC03 (n=U) „ 9 Sptmmliti- (n-l) - • Scolclcpis sp. CMC03 (n=9) 0 SpkmidiH! (n-l) -~0 Spioriidac (n-l) Spionidae (part) — # Scolelephi sp. CMCOl (n-6) •••-•- 9 Sadetepis sp. CMC02 <«=/> 0 Scoleiepis stpntmata (ir~2) QScoletepis sp. CMC04 (rr^l) QSpittsp. CMCOl (n^llf „ 0 Praxitletla praatermisKa CMCOl (n~~$) I ~l Q/Pruxillettupraetennissa CMC02 (n~8) \ - OEuciymene zonatis CMCOl (»=.*) | OEuciymene zanalts CMCOl 57 m .-- (J ^:-lt.:ili ;:-y,::^r.-- - ft, "!?, u '-1 : ~~ OSciililiri'gmii iiiffiitiim CMCIIJ 58 # —-QLumbrinerisfragilis CMCOI (n=ll) I — %Lambrmcrisfragitis CMC02 (n=l) \ Bamlield • # Lttmhrineris sp. CMCOI In—2) St. Andrevvs ® tumbrmcris «•*.* <»-/) Lumbrineridae Churchill • %Lumbrweris japonica (n™2) Resolute • —&?Vinoc nigripex ($t<=A7) Igloolik j %Si-i>hphs uniu'&r fit-13} & '- %Sctiloph>s sp. C 'MC02 Or-If Chukchi Sea • • Leito\foU>plo\ptwiu HL j QXaincris ilvmfrilh'a CMCtll ar-2) "1 + Wiim'iis th-iulriticu CMCU4 Or-7} s — — __ fcCapkeSiiihic (»~~ QBtiranmllii nntericiinii CMCOI tn~2) »Hamntt>lln mmriciiiut CMCII2 (11=11 Capitellidae (part) ; •0(»i(eiiid:H- ln---s*) "!__ £ < 'apiii-llid,,,. (a=6) - 9 ExvgoHC timli's/a tp—2) - • ExogoiK sp. CMCOI lip-1) r- ./W —0E\fif;imfsp. CMCII2 (n-2) L.. y"0 ;l, 9E\0£0IH' Sp. CMCOJ Ol'l) - • Syllis eliun-alii CMCOI Oi-J) — • Syllis rliiiigulu CMCtll (n-4) 0 SylliiJac (n=2) •Syllidm- lii"l) — • Syllis tillmwtii CMCOI (tr--2) Htytlis alumina CS1C02 (n=2) 0'lyposyllispi^iiK'ntatti (n~4) •.Sj'tfjv nltermnti CMCIU lir-'l) -tOpislluisytlissp. CMCIU (n-16) ~9SyiMm(n=l) - -OSrltis- ultcrntlhl CMCIU In'/) I Typosyllts sp. CMCIU (ir=4) — - • Oirysopctalidae (n-l) Chrysopetalidae • .YamrW/rm sp, CMCOI tn- 2} •• %Mkrt»iti'rcis nuiuiimoa'Cts (n~2t Saccocirriclac - # Etnlhtylia vuncouveri (n=8) rc: -m%Ahc\\\&MOr---i) • Megatommasptemtuhi fn~I) • Schizobranchia insignis (tt=*6) % Potumilla cf. neglecta (a-1) 0Pseu ; ^ Chtme inftuulibulifornm Or-1) ""L -••• • Chone sp. CMC02 (u<*/) O Chone mollis (n=2) • Saljcllklac 01=2) OXtnrh pelagica CMCIU • tlitm v. f Ml -III (w=2) -@. Uiltn vireits (11^-4111 -mi'lmynen/issp. CMCIU (u=-2l) O (ioniiula miu-tikilit tn~4) — OCi'iniiiiJii hiumi,:u It} l) OCiifiiailit tintuiiin.i tir-l) Cioiiiadidae — 00phi/t%lyi<:r.l '4i^litiH) ® Cilyci'tu dihrtincltiutit In=l3) |J (;lyl:„a capital,, CMCOI (n=I2) - •Glyccru capilala CMCtll ln=2) OCityceru robusta III—I) Glyceridae • Clyieru sp. CMC02 (n-l) »Gl.nerasp. CMCOI (n=l) X •C/j'i'.To sp. CMCI/.t (n-l) 59 X -@Odontosyitispliosphorea (n- 2) Bamfield 5 Pionosytlts sp, I (n**2) St. Andrews ©m 9 Syf/is alternate 4 (n-2) | Churchill 0 Syllidae (n=4) ® — — ® Auudytits emertoni (n-2) Resolute # © Autafyuts sp. I (n=l) Igloolik ® - ® Epi^amia ttlexandri (n-2) Chukchi Sea 0 1 — toAutotytus sp. 2 (it~f) Bering Sea &Aut('/ytu.Ksp. 3 (n—l) 0 -QAufa/ytm.sp. 4 (n=I3j Torngat Mountains O -0Atuotyttis sp. 5 (n~2) 9 Oph unit a QAmpharete sp. I (n=I) #Ampharelidae (n=l) —%Ampharetesp. 2 (n=2) - • Ampharete acutifrons (n—I) -(jAmpharetidae (n=2) Ampharetidae J C • Amphatclidac (n--5) - % Ampharete tabrops (n=S) tAmpliaretiduc (n=l) - HAntphisamytha sp. I (n~3) -%Asabeltides sp. I (tr=14) 0 Ampharetidae (n=5) QCapitellit cupiuttti I {>r:~4}\ QCap'tteiht cHtpihitu 2 (n"-4) I -•S|>ftM*icl«>rid.c Sphaerodoridae QGahtiftowtmia ocuhttu (n~l4) iQwcniu fuslfortitis (tt--2) Oweniidae -© Mureni cUeriu viridis (n™ 10} — m.Mh-mrtoiht. i ty&untida mi/tutu i (n~t) 1 QJutmidu miittiiii 2 (n-l) -® KereiphyUu east uu at i (n*:!}\\ © Enow fotiga I (n-2) ® Eicniw fai^u 2 (rt~6) toEtemu- fanga 3 (tv^lH) i Eteone sp. I (tr^l) ~-%E/0»u-sp. 2 (n~-7) © Ek'otu: sp. i (n^i) QEJeotie iongti 4 (n~fy) %E(t,,mcsp. •tOv-H) —%Eteottesp. S (tt-*4) 0£Mme Spm fj (,y.:.l) Phyllodocidae &En>twesp. 7 0t^5f -®Eh:Mtesp. 8(n-l) % Hargafroemia nigrimm:utata fit—I) Q^i-raphylla aisSanen 2 (tr=2)\\ toPhyilodoci' medipttpWuta i (n-H) fyfuimitlit fuhifonnis (n-2) ®£ut Figure 2. Neighbour-joining tree (K2P distances) for 333 provisional species (BINs) with collection locations indicated by pie graphs. One specimen per BIN and associated abundance are shown. Vertical bars indicate morphospecies with multiple BINs. 60 80 -\ BBI Species (mean = 0.38) I I Genus (mean = 16.50) f^H Family (mean = 25.18) 60 >» o c 0 g-40 20 A n n n n a it III i i i i i—II 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 >20 Sequence Divergence (% K2P) Figure 3. K2P distances for the COI barcode region within species, within genera, and within families. Conspecific distances are based on BIN assignments, congeneric values are between BINs, and family comparisons are between genera. 61 0 5 10 15 20 25 30 35 40 45 50 55 # of 28S Nucleotide Differences Figure 4. Correlation between the number of nucleotide substitutions in 28S nearest- neighbours vs. COI divergence (% K2P). 62 A. Average intraspecific OL CM CD CJ c sCD> CD £> 2 b o o CD Q. (0 CD FT = 0.007 p = 0.295 10 20 30 40 50 60 70 Number of Individuals per BIN (L B. Maximum ir ltraspecific oj 4 - * • •"•8 CD ~ • • o 3 - • c • • OCD) _ A > 2 - • • • o •-• • .•• ••• • ••• • • pecifi i • (0 wms-^* • • • ro •S* •• • • •) •*-» • FT = 0.211 inr :• •• • p < 0.0001 —i 1— 1— i i 0 - i 10 20 30 40 50 60 70 Number of Individuals per BIN Figure 5. Linear regression of the number of individuals analyzed in each BIN versus (A) mean intraspecific distance and (B) maximum intraspecific distance. 63 1 < ^ 40 - I 11 A. Morphospecies Q_ 2 ^ • • ~ 30 -• .. ; ;• L- 3 • O » • • % • • • JQ - * • sz * •! • \ . •? 20 "y * • £ :M " • • • • —• •* • ^ (A • a> *••« ' • ; • to 10- •• _ :• • • •• * • Z • t 0 - fill , I i 1 r »v , , , , , 5 10 15 20 25 30 35 40 45 50 Maximum Intraspecific Divergence (% K2P) 40 II B. BINS 30 o3 .o JC ^v O) CD 20 Z :SF 10 fc$ CO CD z HI _LY_ 0 10 15 20 25 30 35 40 45 50 Maximum Intraspecific Divergence (% K2P) Figure 6. Maximum intraspecific compared to nearest neighbour distance (K2P) for (A) morphospecies (n=90) and (B) BIN-delineated species (n=147). BINs species-sorting algorithm restricts nearest neighbour distance to a minimum of 2% (y-axis) while levels of intraspecific variation vary from 0 to 3.8% (x-axis). The x-axis divider represents the lOx average intraspecific distance threshold (Hebert et al. 2004Z>) for polychaetes of this study and also corresponds to the maximum observed within-BIN divergence in the dataset. Plotting these axes creates 4 species categories where intraspecific distance and nearest neighbour distance are: I) <3.8%, >2%: typical species; II) >3.8%, >2%: probable species complex; III) <3.8%, <2%: hybridization, young species, synonymy; IV) >3.8%, <2%: probable specimen misidentification. 64 350 BINS Morphospecies 1 , j j ! , ! ! ! ! , , .?> ,P i>> .£> /^ rQ> AO ,£> C> C5 O C> C> C> .Q> O .Q> C> C3 r^ r*>. rv r*^ I"*** p** T^ l*-**, r*s, N Individuals Sampled Figure 7. A comparison of BINs and morphospecies rarefaction curves (taxonomic diversity) with 95% confidence intervals plotted. ON ON >0.20 10.15-0.19 ! 0.10-0.14 i 0.05 - 0.09 0.01 - 0.04 ( tfOW Figure 8. Similarity plot of provisional species (BINs) among seven regions. Igloolik and Resolute are combined into one Nunavut site. Similarity values (range 0-1, with 1 indicating complete overlap) are represented by line width between two regions. COI-5' COI-3' OS ^1 AjpOl Orbiniidac * T Exogone spp. Figure 9. Consensus secondary structure plot of the DNA barcode region for 333 provisional polychaete species depicting insertions (+), deletions (X). Functionally important residues are indicated by their three letter abbreviations. - CHAPTER 3 - High divergence rates and staggered Pleistocene migrations in trans-Arctic polychaetes 68 Abstract Repeated cycles of glaciation have greatly influenced the diversity and distribution of marine invertebrates in the northern hemisphere. The recurrent opening and closing of the Bering Strait was particularly influential, providing intermittent opportunities for range expansion of Pacific species into the Arctic Ocean. The most conspicuous of these marine transgressions occurred 3.5 Ma, leading to successful invasion of the North Atlantic by numerous Pacific species. The present study examines patterns of molecular divergence in eighteen trans-Arctic polychaete species that have contemporary populations in both the Pacific and Atlantic or Arctic. Results indicate that the divergence of vicariant lineages was not simultaneous. Instead, migrations occurred once during the Pliocene, and multiple times throughout the Pleistocene and Holocene. Assuming that the first wave of dispersal through the Bering Strait occurred 3.5 Ma, COI divergences between sister taxa suggest an evolutionary rate of 4.4% per My. These results emphasize the importance of a multi-taxon approach when using a known vicariance event to calibrate a molecular clock. Moreover, this study demonstrates the utility of sequence data in providing insights into the biogeographic history of a group which lacks a fossil record. 69 Introduction Pleistocene glaciations have strongly impacted the evolution and contemporary distribution of arctic taxa. Glacial advances promoted diversification by fragmenting populations into coastal refugia where they evolved in allopatry. Recent molecular studies have provided valuable insight into the genetic consequences of Pleistocene glaciations and biogeographic histories of arctic taxa. For example, extraordinary levels of genetic diversity have been found in arctic water fleas (Hobaek and Weider 1999), clams (Vainola 2003; Nikula et al. 2007), and fishes (Dodson et al. 2007). For marine species, phylogeographic studies have revealed large genetic breaks between Pacific and Atlantic-Arctic lineages (Ch. 2; Darling et al. 2007, Dodson et al. 2007), congruent with interglacial range expansion and subsequent separation. Faunal interchanges through the Bering Strait are among the best-known events to shape biotic distributions in northern marine waters (Vermeij 1991; Wares and Cunningham 2001; Dodson et al. 2007). Pacific-Atlantic biotic exchanges are relatively recent, well studied, and accurately dated with fossil evidence from various taxa (Durham and MacNeil 1967; Vermeij 1991; Marincovich and Gladenkov 1999). Populations in the North Atlantic and Pacific were isolated from the early Cenozoic (65 Ma) until the opening of the Bering Strait permitted exchange between the two faunas via the Arctic Ocean (Cunningham and Collins 1998; Vainola 2003). Populations of some cold-water species maintain gene flow between these two basins (e.g., Palumbi and Kessing 1991; Olsen et al. 2004; Addison and Hart 2005). Other species invaded once and subsequently differentiated from source populations (e.g., Collins et al. 1996), many of which were boreal taxa that crossed the Arctic during the mid-Pliocene when water temperatures were 4°C warmer than today (Cunningham and Collins 1998; Harris 2005). 70 The timing of the initial opening of the Bering Strait is controversial (Marincovich and Gladenkov 1999; 2001). It has been suggested that the seaway flooded 10-12 Ma (Durham and MacNeil 1967; but see Herman and Hopkins 1980) and again during the late Miocene and mid-Pliocene (7.3 - 5.2 Ma and 3-4 Ma, respectively; Marincovich and Gladenkov 2001). Based on fossil evidence, the earliest Bering seaway migration involved the Atlantic bivalve Astarte, which moved from the Arctic into the Pacific 4.8 - 5.5 Ma (Mavincovich and Gladenkov 2001). It was not until 3.5 Ma that a major seaway migration occurred in the opposite direction, involving numerous Pacific mollusc and echinoderm species invading the North Atlantic via the Arctic Ocean (Durham and MacNeil 1967; Briggs 1970; Vermeij 1991; Dodson et al. 2007). These migrations were largely unidirectional, with over 85% of the taxa moving from the Pacific to the Atlantic (Durham and MacNeil 1967; Vermeij 1991). Initial invasions were followed by drops in sea level with the formation of glaciers (beginning 3-3.5 Ma; Harris 2005) causing the Bering seaway to close episodically throughout the late Pleistocene, and leading to vicariant isolation of dispersed species. The recent vicariance of sibling species in Atlantic and Pacific basins provides a powerful opportunity for the calibration of a molecular clock (Collins et al. 1996; Knowlton and Weigt 1998; Wares 2001). Mitochondrial DNA (mtDNA) has frequently been used to estimate molecular divergence rates between vicariant sister species (Knowlton et al. 1993; Collins et al. 1996; Knowlton and Weigt 1998; Wares 2001; Wares and Cunningham 2001), and this work suggests that rates vary considerably across taxa. A 2% per million years (My) mtDNA clock derived from mammals is commonly used to calibrate separation dates (Brown et al. 1979; Klicka and Zink 1997; Avise et al. 1998). More recent estimates from diverse lineages of marine invertebrates (divergence 71 per My) range from 1.4 - 2.6% (Alpheus; Knowlton et al. 1993; Knowlton and Weigt 1998), 3.5% (Metaphire; Chang and Chen 2005), 3.1 - 5.3% (various echinoderm species; Hart et al. 1997; Lessios et al. 1999; Wares 2001), and 3.7 - 6.6% (Macoma balthica; Nikula et al. 2007). The contemporary trans-Arctic distribution of several polychaete species (Ch. 1) provides the opportunity to examine the frequency and timing of migrations, to test for shared vicariance, and to estimate rates of molecular evolution in relation to Pacific- Arctic interchanges. Past studies have provided divergence data for trans-Arctic sibling taxa using 3.5 Ma as a vicariance date (Wares 2001; Wares and Cunningham 2001; Nikula et al. 2007), but there are no data for soft-bodied groups such as polychaetes. Moreover, studies employing a multi-taxon approach to examine the tempo of arctic marine transgressions are lacking. Given that there were several opportunities for dispersal into the Arctic (Harris 2005), the comparison of multiple co-distributed sister taxa could provide new insight into the invasion history of trans-Arctic species. This study addresses these gaps by examining mitochondrial COI sequence divergence in 18 polychaete species that occur in: (1) the Pacific and (2) the Atlantic or Eastern Arctic. A maximum separation time of 3.5 Ma is used to estimate a mitochondrial COI clock for polychaetes, as this represents the approximate timing of the first major trans-Arctic interchange (Vermeij 1991). Methods Specimens Polychaete specimens were collected from two Pacific regions: Bamfield (British Columbia), and the Bering Sea, and from five Atlantic or Eastern Arctic regions: St. 72 Andrews (New Brunswick), Torngat Mountains National Park (Labrador), Churchill (Manitoba), Resolute and Igloolik (Nunavut). Since migrating taxa moved through the Bering Strait, Atlantic and Eastern Arctic areas are treated as a unit and are compared to lineages in the Pacific. Specimens were identified either by the collector, regional taxonomist, or family specialist (see specimen information in "Polychaetes of North America (PONA)" on Barcode of Life Data Systems (BOLD); www.barcodinglife.org). Mitochondrial COI sequences of 650 bp were acquired for all specimens (see Ch. 2 for DNA extraction, amplification, and sequence protocol) and used in this analysis. Species were chosen for comparison provided they had representatives in both the Pacific basin and the Atlantic or Eastern Arctic basin (hereafter referred to as sister taxa). All sister taxa examined in this study were reciprocally monophyletic on a neighbour-joining tree of all available polychaete COI sequences. These criteria identified 20 comparisons, representing 18 species, for subsequent analysis (see Appendix 3.1). Species were provisionally defined previously (Ch. 2) based on COI barcode divergence. Sister lineages in 12 of the 20 Atlantic - Pacific pairs formed genetically divergent clusters and were assigned provisional species status. The remaining 8 pairs had low divergences and are considered populations of one species. All trans-Arctic pairs were morphologically similar and, in all but one case, retain the same Linnaean species name. Sequence divergence A neighbour-joining (NJ) tree was constructed using the Kimura two-parameter (K2P) model (Kimura, 1980) in MEGA 4.0 (Tamura et al. 2007). For each sister pair, the divergence rate (r) was estimated as r = D / T, where D is the net K2P distance, and T is the time of divergence (since divergence rate, not mutation rate, is being calculated the equation is not divided by two; Graur and Li 2000). Pairwise distances were calculated 73 using the net distance method: dAB (net) = dAB - Vi (dA + dB) where dAB is the mean between-species distance and dA and dB are mean within-lineage distances (Nei and Li 1979; Avise 2000). This approach reduces overestimation of variation between two lineages by assuming that variation within extant lineages is representative of ancestral polymorphisms (Avise et al. 1998; Avise 2000; Dodson et al. 2007). Saturation To test when the relationship between accumulation of genetic divergence and the number of substitutions deviated from linearity (i.e., sequences began to saturate), K2P distance was plotted against the number of transitions and transversions for all nucleotide positions using DAMBE (v.5.1.1; Xia and Xie 2001). To obtain a representative estimate of substitution saturation for the barcode region of polychaetes, one individual from each species in the PONA project (333 provisional species) was included in this analysis. Molecular clock tests Although application of a global molecular clock has been controversial, local clocks are well accepted among closely related taxa (Graur and Li 2000; Yoder and Yang 2000). Consequently, tests for rate constancy were performed at both global and local scales. To test for a global molecular clock, the likelihood ratio test (Felsenstein 1981) was performed using all sister taxa (n=132 haplotypes). Because a global clock was easily rejected for all sister taxa, a likelihood score was obtained for a subset of the data, excluding apparently rate accelerated lineages. Likelihood scores were calculated in PAUP* 4.0b (Swofford 2002) using the K2P distance model with and without the molecular clock constraint. To test for local clocks, comparisons were performed between: i) each sister lineage of a species; ii) genera of five families; and iii) trans-Arctic species (Appendix 74 3.2). For comparisons between sister lineages, outgroups were chosen from the same genus (where possible) and obtained from the PONA project. At the family level, pairwise rate tests were run between all genera for which barcode sequences were available (obtained from the PONA project), grouped according to phylogenetic relatedness (Bakken and Wilson 2005; Rousset et al. 2007). Trans-Arctic species were used to calibrate a molecular clock, and lineages that deviated from clock-like evolution were removed. All three local rate constancy tests were calculated using the relative rate two-cluster test (Takezaki et al. 1995) in PHYLTEST (Kumar 1996) with the K2P distance metric. This method is based on the assumption that the observed number of substitutions from a common ancestor of two lineages is equal under the constancy of the molecular clock. Results Sequence divergence Monophyly of each species pair was supported by NJ bootstrap percentages of 100% (Fig. 1). Net divergence between Atlantic and Pacific sister taxa ranged from 0.12 - 15.97%, but there was congruent division of reciprocally monophyletic lineages into two clusters. Five sister taxa formed a cohesive group with similar divergences (14.48 - 15.97%; Fig. 3), while the remaining 15 sister taxa showed lower and much more variable genetic divergences (0.12 - 8.4%; Fig. 3). Saturation Transversional substitutions remained linear with increased K2P distance, but evidence for saturation of transitional substitutions began at approximately 16 - 18% K2P sequence divergence (Fig. 2). However, the deviation from linearity was slight and 75 full saturation was never apparent. This suggests that COI sequences of the five species with highly divergence Pacific - Atlantic sister taxa (mean 15.26%) had negligible saturation. Molecular clock tests A global molecular clock was rejected by the likelihood ratio test (x2=196, df=\30, rejection value at a=0.05:158,/?<0.001). Although a global clock was still rejected following removal of two rate-accelerated lineages (Cirratulus cirratus CMCOJ and CMC02), the test statistic was quantitatively close to the critical value for acceptance of a molecular clock (x2=158, df=\26,p=Q.03). When lineages of each sister taxa were tested for deviations from clock-like evolution, all comparisons conformed to the molecular clock assumption (relative rate test,;? > 0.08; Appendix 3.2). Similarly, when genera of five families were tested for deviations from uniform rates, there was strong support for a constant rate of evolution within each family (relative rate test, p > 0.26 for all comparisons; Appendix 3.2). In contrast, rates between the five species with highly divergent Pacific and Atlantic lineages were not all uniform. A molecular clock was rejected for all comparisons involving Cirratulus cirratus, which displayed branch lengths twice as great as the compared lineages (Appendix 3.2). Therefore this species was removed from the molecular clock calculation. Divergence rates and divergence times of sister taxa Assuming simultaneous isolation of all trans-Arctic species at 3.5 Ma would imply extreme variation in rates of evolution, which conflicts with evidence for approximately constant substitution rates among closely related species and within families (Appendix 3.2). A more parsimonious explanation is that polychaete species migrated through the Bering Strait on separate occasions. Assuming the initial invasion 76 coincides with the first major trans-Arctic interchange 3.5 Ma, an average sequence divergence of 15.41 ± 0.37% (after removal of C. cirratus) indicates a COI divergence rate of 4.4% ± 0.1%/My. Based on this rate estimate, subsequent entries occurred at approximately 1.9, 1.6 - 1.3, 0.8 - 0.7, 0.4 Ma, and 7 within the last 120,000 years (Fig. 3). Discussion For groups lacking a fossil record, biogeographic events are valuable in providing the time context required to examine patterns of molecular divergence. However, when estimates of rates of molecular evolution are based on such vicariance events, simultaneous isolation of dispersed taxa is often assumed. In contrast, divergence values in trans-Arctic polychaetes indicate an 'entry - isolation - entry' scenario. Two periods of Bering Strait migrations were separated by a 1.5 My gap between the Pliocene and Pleistocene. The initial invasions were synchronized, whereas staggered migrations occurred throughout the Pleistocene and well into the Holocene. These divergence patterns emphasize the impact of Pleistocene glaciations on North American populations of marine invertebrates, causing diversification and ultimately speciation through repeated but distinct migrations (Grant and Stahl 1988; Weider and Hoba^k 2000). Isolation of Atlantic and Pacific populations from approximately 3.3-1.9 Ma suggests the presence of a barrier to dispersal. Cold-events in the Northern Hemisphere began 3.5 Ma and were quickly followed by substantial drops in sea level (Herman and Hopkins 1980; Harris 2005), physically blocking access to the Arctic via the Bering Strait shortly after it opened. The formation of a land barrier coupled with harsh climatic conditions led to effective isolation of taxa that dispersed through the Bering Strait during 77 the brief period it was opened. The most extensive glaciations in North America occurred between 3.0 and 2.2 Ma (Webb and Bartlein 1992; Cunningham and Collins 1998; Harris 2005), which supports this gap in trans-Arctic polychaete migrations. Each subsequent glacial maximum provoked a global drop in sea level, periodically exposing the Bering land bridge and blocking marine migrations. Each ice advance was followed by ice retreat and rising sea levels, enabling marine transgressions (Harris 2005). These episodic cycles of glacial retreat and advance, lasting about 0.1 My (Hewitt 2004), provided repeated opportunity for the dispersal and subsequent vicariance of marine taxa and continued until today's interglacial period, beginning approximately 14,000 years ago (Dunton 1992). The evidence for staggered migrations of polychaetes during the Pleistocene is consistent with 13+ cycles of glaciation (Harris 2005). Recurrent Pacific - Atlantic interchanges during this time are not unique to polychaetes. They have been reported in fishes (Dodson et al. 2007), red algae (van Oppen et al. 1995), and sea urchins (Addison and Hart 2005). The case of the Pacific mollusc Macoma balthica is particularly interesting. The first fossil appearance of this species in the North Atlantic occurred 1.7 - 1.95 Ma (Vainola 2003; Nikula et al. 2007). Modern populations of Macoma balthica in the North Atlantic include four genetically distinct lineages reflecting a series of colonization events, suggesting that glacial vicariance both creates and maintains diversity (Nikula et al. 2007). The timing of the second round of polychaete invasions revealed by this study coincides with the approximate arrival of Pacific capelin in the Atlantic (1.6 Ma; Dodson et al. 2007), with the divergence of Pacific and Atlantic harbor seals (1.7 - 2.2 Ma; Stanley et al. 1996), and with the first arrival of Macoma balthica (Vainola 2003). Similarly, the evidence for recent trans-Arctic gene flow between 78 lineages of eight polychaete species in Pacific and Atlantic basins has been documented in several other species (e.g., Strongylocentrotus droebachiensis, Palumbi and Kessing 1991; Phycodrys rubens, van Oppen et al. 1995; Zostera marina, Olsen et al. 2004; Macoma balthica, Nikula et al. 2007). Interspersed migrations between glacial maxima illustrate the opportunistic nature and high dispersal capability of many polychaete species. Variation in life history, habitat preference, and thermal tolerance could explain the differing migration times of polychaete species. While differences in dispersal potential could influence the ability to cross the Bering land bridge, there are no obvious differences in reproductive mode among species pairs of separate invasions, which is consistent with other trans-Arctic studies (e.g., Vermeij 1991; Cunningham and Collins 1998). Most of the species involved have free-swimming planktonic larvae, and those that do not (e.g., Alitta virens, Nothria conchylega, and Cirratulus cirratus; Wilson 1991; Pleijel and Rouse 2006), migrated at different times. Many recent colonizers of the North Atlantic are rocky shore species (e.g., molluscs, barnacles, hermit crabs, sea urchins; Vermeij 1991), capitalizing on the recently impoverished rocky shores of the northwestern Atlantic ('ecological opportunity' hypothesis; Vermiej 1991; Cunningham and Collins 1998). However, there were no consistent habitat preferences between the different invasion clusters of polychaetes. Differences in migration time could, however, be driven by thermal tolerance. For example, the only two temperate species in this study that do not occur in Arctic Canada {Alitta virens and Lepidonotus squamatus; Ch. 1) took part in the first invasion, while all members of the second invasion are cold-water species, usually widespread throughout the Arctic (Ch. 1; Pettibone 1963a). This pattern is consistent with the fact that Arctic waters were warmer than 4 °C 3.5 Ma allowing 79 temperate species to invade (Vermeij 1991; Dodson et al. 2007), but 2° - 4 °C colder during the Pleistocene (Harris 2005) restricting migrations to cold-water species. Given the recency of these events, the Bering Strait interchanges might represent one of the few cases in polychaetes where historical factors better predict biogeographic patterns than ecology or life history (see Fauchald 1984; Glasby 2005). Evidence of multiple within-species Bering Strait migrations was only apparent in two species. Assuming a Pacific ancestor, two distinct haplotypes ofHarmothoe imbricata in the North Atlantic suggests multiple invasions, whereas the two distinct haplotypes of Glycera capitata in the Pacific suggest an initial migration to the Atlantic, and recent back-migration to the Pacific. This latter pattern has been observed in the sea urchin Strongylocentrotus droebachiensis and attributed to high trans-Arctic gene flow (Addison and Hart 2005). Several factors could account for the failure to detect multiple lineages (from multiple independent invasions) of other species examined in this study. First, individuals were collected from few sites in the northwest Atlantic. As in Macoma balthica (Nikula et al. 2007), separate lineages of a Pacific source population might be detected with further sampling in the northeastern Atlantic. Second, local extinction may have removed lineages that invaded the Arctic via the Bering Strait. Species that migrated recently could have previously expanded into the Arctic when opportunity presented itself (i.e., during each interglacial period), but retreated to the Pacific, or went extinct, when glaciers advanced. Finally, homogenization of mtDNA variation might reflect recurrent selective sweeps if successive waves of migrants were reproductively compatible (Bazin et al. 2006). This could happen in two directions. First, successive invaders might gain the genetic signature of the original established population over time. Alternatively, the successive invading population could replace antecedent lineages if 80 favoured by natural selection. Each of the above mechanisms would limit the number and variation of extant lineages, so that one modern population is apparent despite multiple past invasions. An alternative timescale for the initial divergence in this study is possible. At least four studies suggest that migrations across the Bering seaway occurred earlier in Astarte (4.8 - 5.5 Ma; Marincovich and Gladenkov 1999; 2001), cod (4.8 - 8.9 Ma; Grant and Stahl 1988), the mollusc Nucella (7-8 Ma; Collins et al. 1996), and Cancer crabs (6 - 12 Ma; Harrison and Crespi 1999). However, two of these migrations occurred in an Atlantic to Pacific direction, reflecting the southward current patterns at the time, which reversed to a northward flow sometime after 4.6 Ma (Marincovich and Gladenkov 1999). Despite the fact that basin of origin is unknown for many soft-bodied taxa, based on the species list of Canadian polychaetes (Ch. 1), nine of twelve genera included in this study have higher diversities in the Pacific. Moreover, since the largest trans-Arctic migration to date occurred 3.5 Ma, it is likely that one major polychaete invasion event began at this time. If the second group of invasions began 3.5 Ma, the first migration would date at 6.6 to 7.3 Ma. Although this early entry cannot be completely ruled out, it is unlikely given the geological history. Dating the beginning of the second invasion at 3.5 Ma would suggest ongoing trans-Arctic migrations between 3 - 2.2 Ma which is improbable given the extensive glaciation and the migration of numerous mammals across the Bering land bridge during this time (Briggs 1970; Herman and Hopkins 1980; Harris 2005). Thus, the most probable times for trans-Arctic marine migrations fall between 3-4 Ma and after 2.2 Ma. Despite the uncertainty associated with dating divergences based on a molecular clock, the derived dates for trans-Arctic migrations of polychaetes in this study 81 correspond with the timing of glacial events in North America. This suggests that polychaetes likely took part in the major Pacific to Atlantic interchange 3.5 Ma. Although these data suggest that molecular divergence rates in trans-Arctic polychaetes are faster than the commonly cited 2%/My, they are congruent with estimates from other investigations on trans-Arctic molluscs and echinoderms (COIII: 3.6 - 6.6%/My, Nikula et al. 2007; COI: 3.9 - 5.3%/My, Wares 2001; COI: 5 - 18%/My, Wares and Cunningham 2001). A relatively high rate of 4.4%/My is consistent with reports of deep divergences in coastal polychaetes and supports the suggestion that 2.2%/My is a lower divergence rate boundary (Jolly et al. 2006). The only other COI calibration for polychaetes (Chevaldonne et al. 2002) is ten-fold lower (0.4%/My) in hydrothermal vent species. These differences in evolutionary rates could be taxon specific as it has been suggested that vent species may evolve slowly (Little and Vrijenhoek 2003; Johnson et al. 2006). Alternatively, the use of considerably different calibration dates could influence evolutionary rate estimates (28.5 Ma in vent species vs. 3.5 Ma in trans-Arctic species). Divergences based on more recent vicariance events may provide more reliable rate estimates, particularly in mitochondrial protein coding genes where multiple substitutions can cause an underestimation of actual divergence rates beyond 10 - 20 Ma (Brown et al. 1979; Avise 2000). The divergence rate estimated in this study is based on the assumption that polychaete species took part in the major faunal interchange approximately 3.5 Ma. While it is clear that staggered Pleistocene migrations followed an initial invasion, divergence times of more recently separated taxa could be inaccurate if rates of divergence are not linear over geological time (Ho et al. 2005; 2007; Penny 2005). In order to correct molecular rates over different time scales, multiple calibration points are 82 required. However, because there were many cold events during the Pleistocene (see Harris 2005), it was not practical to calibrate any one divergence event to a particular time point, thus the degree of rate variation could not be estimated. Since short-term (within-species) mutation rates are faster than long-term (between-species) substitution rates due to the effects of purifying selection (Ho et al. 2005; 2007), the derived divergence dates less than 1 Ma are likely overestimated. The taxa with less than 0.5% intraspecific divergence possibly experienced a range expansion during the present Holocene interglacial (< 14,000 years ago) rather than the previous Eemian interglacial (~125,000 ya; Webb and Bartlein 1992), which would erroneously suggest a slower within-species evolutionary rate (Ho et al. 2005). Thus, a divergence rate of 4.4%/My represents a conservative estimate that may not be suitable for future population-level studies in polychaetes (Ho et al. 2007). Molecular clocks cannot be generalized to all genes or all taxa. The present study focuses on K2P distances of a partial COI gene region in trans-Arctic polychaete species. Noted limitations of this study include the use of a single gene and a single calibration point. While there was strong support for a local clock between closely related species, the application of a global clock across distantly related polychaetes species may not be appropriate. However, a constant rate of 4.4% ± 0.1%/My was congruent between four pairs of polychaete sister taxa from different families (Polynoidae, Sabellidae, Pectinariidae, and Nereididae), suggesting its utility for a range of polychaete species. Further, there was evidence for approximately equal rates of evolution within all families that were tested, indicating the potential for COI as a molecular clock among closely related polychaete taxa. 83 Potential sources of uncertainty associated with evolutionary rate estimates in this study include misassignment of sister species, saturation effects in COI, and an assumed calibration date of 3.5 Ma (Knowlton and Weigt 1998). Sister status of the 12 vicariant pairs in this study is probable as they were reciprocally monophyletic, morphologically similar, and assigned the same Linnaean species name in 11 of 12 cases. Given that the highest divergence in this study (15.97%) is less than the congeneric average in polychaetes (16.5%; Ch. 2), and that substitution saturation does not begin until approximately 16% sequence divergence (Fig. 2), saturation as an explanation for the high congruence between divergent sister taxa was ruled out. Furthermore, because mtDNA evolution is slow enough not to saturate with recurrent mutations over a few million years (Avise 2000), Plio-Pleistocene separations have been suggested as ideal for estimating linear relationships between sequence evolution and time (Hewitt 2001; Wares 2001). Finally, although early migrations through the Bering Strait are possible, there is considerable evidence for the first major seaway flooding at approximately 3.5 Ma as it corresponds to the most abundant and conspicuous trans-Arctic migration to date (Herman and Hopkins 1980; Vermeij 1991). With further accumulation of sister taxa from the North Pacific and Atlantic, an understanding of the timing of migration and speciation will be strengthened. Conclusions The results of this study suggest that rates of mitochondrial divergence in trans- Arctic polychaete species are higher than those in mammals (Brown et al. 1979) and crustaceans (Knowlton and Weigt 1998), but similar to those in other taxa (Wares 2001; Wares and Cunningham 2001; Nikula et al. 2007). Evidence of staggered migrations across the Bering Strait highlights the importance of using multiple taxa to obtain a 84 representative history of a region when calibrating a molecular clock based on vicariance events (Knowlton and Weigt 1998). For example, excluding species from the first cluster would have resulted in overestimated divergence dates of sister taxa in the second cluster. Moreover, focusing on average values would have led to a divergence rate of 2.1% ± 1.5%/My, a plausible yet incorrect estimate with a high standard error. This study additionally demonstrates how sequence data shed light on the evolutionary history and timing of speciation in the absence of a fossil record. 85 100 • Harmothoe rarispina CMC02 (P) Dnet=7.0 • Harmothoe rarispina CMC03 (A) 100 [ Eunoe nodosa CMC02 (A) Eunoe onet=o.24' nodosa CMC02 (P) Harmothoe imbricata CMC02 (A) 100 100 T Harmothoe imbricata CMC01 (A) Dnet=3.2 Harmothoe imbricata CMC01 (P) Dnet=0.51 100 - Lepidonotus squamatus CMC01 (P) — Lepidonotus squamatus CMC02 (A) loo00 r—Pholoep baltica (P) D,M=ISS Pholoe baltica (A) 100 f Pn°t°e /T"nuf0 W on^oi PMoe minuta (P) • Nephtys punctata CMC02 IP) 100 Dnet-6.82 - Nephtys punctata CMC03 (A) 100 Alittasp.CMCOUP) • Alitta virens (A) 1001 Nereisr pelagica CMC01 (P) Nereis pelagica CMC02 (A) Dnet=3.29 r- Clycera capitata CMC02 (A) lOOf"00 ' 100 Dnet=a5!"~2\( - Glycera capitata CMC02 (P) - Glycera capitata CMC01 (P) loor Phyllodoce sp. CMC01 (A) - Phyllodoce sp. CMC01 (P) On«=0.3 100 [ Phyllodoce groenlandica CMC01 (A) OM=OU Phyllodoce groenlandica CMC01 (P) 100 — Myxicola infundibulum CMC01 (A) — Myxicola infundibulum CMC02 (P) 100 Nothria conchylega CMC01 (P) Dnet=6.S7 • Nothria conchylega CMC02 (A) Pectinaria granulata CMC01 (P) 100 Pectinaria granulata CMC03 (A) 100 f Prax7"e"° praetermissa CMC01 (A) onefc<*«•, Praxillella praetermissa CMC01 (P) 100 CirratuluscirratusCMCOl (P) Dner=>4.68 - Cirratulus cirratus CMC02 (A) 100 - Scalibregma inflatum CMC03 (P) 48 - Scalibregma inflatum CMC01 (A) 0.02 Figure 1. Neighbour-joining tree of Kimura two-parameter (K2P) distances for 18 trans- Arctic polychaete species. Nodal support (1000 bootstrap replicates) and net divergences (%K2P) are shown for each Pacific (P) and Atlantic - Eastern Arctic (A) lineage. 86 • Transversions o Transitions 00 0.1 0.2 0.3 0.4 0.5 0.6 0.7 K2P Sequence Divergence Figure 2. Saturation plots of transitions (empty circles) and transversions (solid circles) using all nucleotide positions. 00 00 8 10 12 16 Pairwise Divergence (% K2P) Figure 3. Kimura two-parameter (K2P) pairwise sequence divergences between 20 trans-Arctic polychaete sister taxa and their approximate dates of divergence (million years) assuming constant evolutionary rates over time. Date estimates follow the assumption that the earliest migration event occurred approximately 3.5 Ma. Sister taxa with less than 2% divergence represent populations of one species. Red circles indicate probable recent (Holocene) migrations. SUMMARY AND CONCLUSIONS Chapter summary This thesis has investigated broad-scale diversity and distribution patterns in polychaete species of Canada using both morphological and molecular approaches. Biogeographic distributions based on reports of species over the last 150 years were used to generate a comprehensive species list of the Canadian fauna. For polychaetes, the Arctic and Pacific have the lowest and highest endemism, respectively. In fact, Pacific species account for more than 40% of the Canadian fauna. High similarity between Atlantic and Arctic faunas indicates that the Atlantic played a major role in recolonizing the Arctic following the retreat of glaciers approximately 14,000 years ago (Dunton 1992). The Pacific coast of Canada, however, has few species with ranges extending into Arctic waters. Finally, the high number of cosmopolitan and amphiboreal species suggests that diversity of Canadian polychaetes is currently underestimated. Distribution and diversity patterns were then explored from a molecular approach, using natural clusters formed by DNA barcodes, or BINs, as proxies for species. This study confirmed that DNA barcodes are an effective tool for species identification in polychaetes. Because genetic distances between species were on average 40 times higher than those within species, species assignments were generally straightforward. There was only one case of barcode sharing, but the species involved are known to exchange genes suggesting that hybridization is the explanation. Other cases where divergences between clusters were intermediate (2 - 4%) were usually among Arctic lineages, where species were historically impacted by repeated glaciations causing fragmentation of populations into separate refugia. Two factors apparently driving yet undocumented diversity in 89 polychaetes were vicariance due to the effects of Pleistocene glaciations, and local adaptation to different neighbouring habitats. The detection of large genetic breaks between Pacific and Atlantic-Arctic populations suggests that there are far fewer species with ranges across Canada than previously thought. Moreover, the large number of morphospecies that contained multiple BINs supports the assertion that polychaete diversity is much higher than what is presently accounted for. The third chapter examined patterns in barcode sequence divergence between Pacific and Atlantic morphospecies in relation to vicariance caused by Pleistocene glaciations. The results of this study suggest that polychaete species have experienced range expansions through the Bering Strait and subsequent isolation multiple times over the past 3.5 million years. Although it is likely that each species migrated over the Bering Strait on more than one occasion, most vicariant sister taxa showed only one apparent divergence event. This might reflect recurrent selective sweeps removing variation that was introduced in earlier migrations. Based on highly congruent divergences of sister taxa that separated during the first trans-Arctic interchange, a molecular clock of 4.4%/My was calculated. Evidence for a local clock between closely related species and within families supports the potential for the barcode region of COI as a molecular clock among polychaetes. Future directions Cryptic species are increasingly being identified by various molecular methods, however, there is a lack of consensus regarding their official documentation in the taxonomic system (Westheide and Schmidt 2003). The standardized and public nature of DNA barcode records linked to voucher specimens is crucial in addressing this issue. The 90 barcode approach led to the discovery of many provisional polychaete species; this was expected since only a fraction of polychaete species are formally described. Barcode records alone provide valuable information about the distribution, biology, and diversity of species. Conventional taxonomic work is still critical to the task of describing biodiversity, but vouchered provisional species can be formally examined at any time so that phenotypic descriptions are not required prior to probing biodiversity and the factors that influence it. This study emphasizes the utility of DNA barcodes beyond species identification and discovery. The DNA barcode initiative will generate the largest, most taxonomically broad dataset of homologous DNA sequences to date. This has far reaching implications for the study of evolutionary biology. For the first time, species from widespread geographic regions can be compared from one platform, ultimately leading to a better understanding of biodiversity, barriers to gene flow, and the process of speciation. 91 LITERATURE CITED Addison, J.A., and Hart, M.W. 2005. Colonization, dispersal, and hybridization influence phylogeography of North Atlantic sea urchins {Strongylocentrotus droebachiensis). Evolution 59: 532-543. Aguado, T.M., Nygren, A., and Siddall, M.E. 2007. Phylogeny of Syllidae (Polychaeta) based on combined molecular analysis of nuclear and mitochondrial genes. Cladistics 23: 552-564. Aitken, A.E., and Fournier, J. 1993. Macrobenthos communities of Cambridge, McBeth and Itirbilung Fiords, Baffin Island, Northwest Territories, Canada. Arctic 46: 60- 71. Atkinson, E.G., and Wacasey, J.W. 1989a. Benthic invertebrates collected from Hudson Bay, Canada, 1953 to 1965. Can. Dat. Rep. Fish. Aquat. Sci. 744: 1-121. Atkinson, E.G., and Wacasey, J.W. 19896. Benthic invertebrates collected from Hudson Strait, Foxe Channel and Foxe Basin, Canada, 1949-1970. Can. Dat. Rep. Fish. Aquat. Sci. 746: 1-98. Atkinson, E.G., and Wacasey, J.W. 1989c. Benthic invertebrates collected from the western Canadian Arctic 1951 to 1985. Can. Dat. Rep. Fish. Aquat. Sci. 745: 1- 132. Averincev, V.G. 1980. Chauvinelia arctica, sp. n. (Acrocirridae, Polychaeta) from the Canadian plain. Zool. Institut. Akad. Nauk. USSR. 25: 57-62. Avise, J.C. 2000. Phylogeography: the history and formation of species. Harvard University Press, Cambridge, MA. 92 Avise, J.C., Walker, D., and Johns, G.C. 1998. Speciation durations and Pleistocene effects on vertebrate phylogeography. Proc. R. Soc. Lond. B 265: 1707-1712. Bakken, T., and Wilson, R.S. 2005. Phylogeny of nereidids (Polychaeta, Nereididae) with paragnaths. Zool. Script. 34: 507-547. Banse, K. 1973. The ventral parapodial cirrus of the benthic Phyllodocidae (Polychaeta), with special reference to Clavadoce Hartman and Bergstroemia Banse. J. Nat. Hist. 7: 683-689. Banse, K., and Hobson, K.D. 1974. Benthic errantiate polychaetes of British Columbia and Washington. Fisheries and Marine Service, Ottawa, ON. Banse, K., and Nichols, F.H. 1968. Two new species and three new records of benthic polychaetes from Puget Sound (Washington). Proc. Biol. Soc. Wash. 81: 223-230. Barnich, R., and Fiege, D. 2009. Revision of the genus Harmothoe Kinberg, 1856 (Polychaeta: Polynoidae) in the Northeast Atlantic. Zootaxa 2104: 1-76. Bastrop, R., and Blank, M. 2006. Multiple invasions - a polychaete genus enters the Baltic Sea. Biol. Inv. 8: 1195-1200. Bastrop, R., Jurss, K., and Sturmbauer, C. 1998. Cryptic species in a marine polychaete and their independent introduction from North America to Europe. Mol. Biol. Evol. 15: 97-103. Bazin, E., Glemin, S., and Galtier, N. 2006. Population size does not influence mitochondrial genetic diversity in animals. Science 312: 570-572. Beals, C.S. 1968. Science, history and Hudson Bay. Department of Energy, Mines and Resources, Ottawa, ON. 93 Bensasson, D., Zhang, D.X., Hartl, D.L., and Hewitt, G.M. 2001. Mitochondrial pseudogenes: evolution's misplaced witnesses. Trends Ecol. Evol. 16: 314-321. Berkeley, C. 1967. A checklist of Polychaeta recorded from British Columbia since 1923, with references to name changes, descriptions, and synonymies. I. Errantia. Can. J. Zool. 45: 1048-1059. Berkeley, C. 1968. A checklist of Polychaeta recorded from British Columbia since 1923, with references to name changes, descriptions, and synonymies. II. Sedentaria. Can. J. Zool. 46: 557-567. Berkeley, C. 1972. Further records of Polychaeta new to British Columbia with comments on some others. Can. J. Zool. 50: 451-456. Berkeley, E. 1924. Polychaetous annelids from the Nanaimo District. Part 2. Phyllodocidae to Nereidae. Contrib. Can. Biol. Fish. 2: 287-294. Berkeley, E. 1927. Polychaetous annelids from the Nanaimo District. Part 3. Leodicidae to Spionidae. Contrib. Can. Biol. Fish. 3: 407-422. Berkeley, E., and Berkeley, C. 1942. North Pacific Polychaeta, chiefly from the west coast of Vancouver Island, Alaska and Bering Sea. Can. J. Res. 20: 183-208. Berkeley, E., and Berkeley, C. 1943. Polychaeta from Hudson Bay. J. Fish. Res. Board Can. 6: 129-132. Berkeley, E., and Berkeley, C. 1944. Polychaetes from the Western Canadian Arctic Region. Can. J. Res. 22: 1-5. Berkeley, E., and Berkeley, C. 1948. Annelida, Polychaeta 9b (1) Errantia. Canadian Pacific Fauna. Fisheries Research Board of Canada, Toronto, ON. 94 Berkeley, E., and Berkeley, C. 1952. Annelida, Polychaeta 9b (2) Sedentaria. Canadian Pacific Fauna. Fisheries Research Board of Canada, Toronto, ON. Bhaud, M.R., and Petti, M.A.V. 2001. Spiochaetopterus nonatoi, a new species of Chaetopteridae (Polychaeta) from Brazil: biogeographical consequences. J. Mar. Biol. Ass. U.K. 81:225-234. Bhaud, M., Koh, B.S., and Martin, D. 2006. New systematic results based on chaetal hard structures in Mesochaetopterus (Polychaeta). Sci. Mar. 70S3: 35-44. Bilyard, G.R., and Carey Jr., A.G. 1979. Distribution of Western Beaufort Sea polychaetous annelids. Mar. Biol. 54: 329-339. Blake, J. A. 1991. Revision of some genera and species of Cirratulidae (Polychaeta) from the Western North Atlantic. Ophelia Suppl. 5: 17-30. Blake, J. A. 1996a. Family Orbiniidae Hartman, 1942. In Taxonomic atlas of the benthic fauna of the Santa Maria Basin and Western Santa Barbara Channel. Edited by J. A. Blake, B. Hilbig, and P.H. Scott. Santa Barbara Museum of Natural History, Santa Barbara, CA. pp. 1 -26. Blake, J. A. 19966. Family Paraonidae Cerruti, 1909. In Taxonomic atlas of the benthic fauna of the Santa Maria Basin and Western Santa Barbara Channel. Edited by J.A. Blake, B. Hilbig, and P.H. Scott. Santa Barbara Museum of Natural History, Santa Barbara, CA. pp. 27-70. Blake, J.A., and Dean, D. 1973. Polychaetous annelids collected by the R/V Hero from Baffin Island, Davis Strait and West Greenland in 1968. S. Cal. Acad. Sci. 72: 31- 39. 95 Bleidorn, C, Kruse, I., Albrecht, S., and Bartolomaeus, T. 2006. Mitochondrial sequence data expose the putative cosmopolitan polychaete Scoloplos armiger (Annelida, Orbiniidae) as a species complex [online]. BMC Evol. Biol. 6: 47. doi:10.1186/1471-2148-6-47. Bluhm, B.A., MacDonald, I.R., Debenham, C, and Iken, K. 2005. Macro- and megabenthic communities in the high Arctic Canada Basin: initial findings. Polar Biol. 28: 218-231. Boggemann, M. 2002. Revision of the Glyceridae Grube 1850 (Annelida: Polychaeta). Abhandlungen der Senckenbergischen Naturforschenden Gesellschaft, Frankfurt, Germany. Bouchet, P. 2006. The magnitude of marine biodiversity. In The exploration of marine biodiversity: scientific and technical challenges. Edited by CM. Duarte. Fundacion BBVA, Madrid, ES. pp. 31-64. Breton, S. Dufresne, F., Desrosier, G., and Blier, P.U. 2003. Population structure of two northern hemisphere polychaetes, Neanthes virens and Hediste diversicolor (Nereididae), with different life-history traits. Mar. Biol. 142: 707-715. Briggs, J.C. 1970. A faunal history of the North Atlantic Ocean. Syst. Zool. 19: 19-34. Briggs, J.C. 1974. Marine zoogeography. McGraw-Hill, New York and London. Bromley, J.E.C. 1979. A preliminary checklist of marine fauna of Minas Basin and Minas Channel. Proc. Nova Scotia Inst. Sci. 29: 517-541. Brown, S., Rouse, G., Hutchings, P., and Colgan, D. 1999. Assessing the usefulness of histone H3, U2 snRNA and 28S rDNA in analyses of polychaete relationships. Aus. J. Zool. 47: 499-516. 96 Brown, W.M., George, M.J., and Wilson, A.C. 1979. Rapid evolution of animal mitochondrial DNA. Proc. Natl. Acad. Sci. USA 76: 1967-1971. Brunei, P., Bosse, L., and Lamarche, G. 1998. Catalogue of the marine invertebrates of the estuary and Gulf of Saint Lawrence. Can. Spec. Publ. Fish. Aquat. Sci. 126: 135-157. Chamberlin, R.V. 1920. Annelids, parasitic worms, protozoans, etc. Part B: Polychaeta. In Report of the Canadian Arctic expedition 1913-1918. Edited by T. Mulvey. Canadian Institute for Historical Microreproductions, Ottawa, ON. pp. 1-41. Chang, C.H., and Chen, J.H. 2005. Taxonomic status and intraspecific phylogeography of two sibling species of Metaphire (Oligochaeta: Megascolecidae) in Taiwan. Pedobiologia 49: 591-600. Chang, C.H., Rougerie, R., and Chen, J.H. 2009. Identifying earthworms through DNA barcodes: pitfalls and promise. Pedobiologia 52: 171-180. Chapman, A.S., and Kostylev, V.E. 2008. Distribution, abundance and diversity of benthic species from the Beaufort Sea and western Amundsen Gulf - a summary of data collected between 1951 and 2000. Geological Survey of Canada, Dartmouth, NS. Chevaldonne, P., Jollivet, D., Desbruyeres, D., Lutz, R.A., and Vrijenhoek, R.C. 2002. Sister-species of eastern Pacific hydrothermal vent worms (Ampharetidae, Alvinellidae, Vestimentifera) provide new mitochondrial COI clock calibration. Cah. Biol. Mar. 43: 367-370. 97 Clare, EX., Kerr, K.C.R., von Konigslow, T.E., Wilson, J.J., and Hebert, P.D.N. 2008. Diagnosing mitochondrial DNA diversity: applications of a sentinel gene approach. J. Mol. Evol. 66: 362-367. Clare, EX., Lim, B.K., Engstrom, M.D., Eger, J.L., and Hebert, P.D.N. 2006. DNA barcoding of Neotropical bats: species identification and discovery within Guyana. Mol. Ecol. Notes 7: 184-190. Clement, M., Posada, D., and Crandall, K.A. 2000. TCS: a computer program to estimate gene genealogies. Mol. Ecol. 9: 1657-1659. Coachman, L.K., and Barnes, C.A. 1961. The contribution of Bering Sea water to the Arctic Ocean. Arctic 14: 145-61. Collins, T.M., Frazer, K., Palmer, R., Vermeij, G.J., and Wesley, M.B. 1996. Evolutionary history of northern hemisphere Nucella (Gastropoda, Muricidae): molecular, morphological, ecological, and paleontological evidence. Evolution 50: 2287-2304. Colwell, R.K. 2006. Estimates: Statistical estimation of species richness and shared species from samples, Version 8.2.0 Persistent URL: Colwell, R.K., Mao, C.X., and Chang, J. 2004. Interpolating, extrapolating, and comparing incidence-based species accumulation curves. Ecology 85: 2717-2727. Conlan, K., Aitken, A., Hendrycks, E., McClelland, C, and Melling, H. 2008. Distribution patterns of Canadian Beaufort Shelf macrobenthos. J. Mar. Syst. 74: 864-886. Coyne, J.A., and Orr, H.A. 2004. Speciation. Sinauer Associates, Sunderland, MA. 98 Cunningham, C.W., and Collins, T.M. 1998. Beyond area relationships: extinction and recolonization in molecular marine biogeography. In Molecular approaches to ecology and evolution. Edited by R. DeSalle, and B. Schierwater. Birkhauser Verlag, Basel, pp. 297-321. Curtis, M.A. 1972. Depth distributions of benthic polychaetes in two fiords on Ellesmere Island, N.W.T. J. Fish. Res. Board Can. 29: 1319-1327. Curtis, M.A. 1979. A list of benthic polychaetes from Godhavn, West Greenland, with remarks on new records for Greenland. Astarte 12: 1-3. Cusson, M., Archambault, P., and Aitken, A. 2007. Biodiversity of benthic assemblages on the Arctic continental shelf: historical data from Canada. Mar. Ecol. Prog. Ser. 331: 291-304. Darling, K.F., Kucera, M., and Wade, CM. 2007. Global molecular phylogeography reveals persistent Arctic circumpolar isolation in a marine planktonic protist. Proc. Natl. Acad. Sci. USA 104: 5002-5007. Dauvin, J.C., Bachelet, G., and Bellan, G. 2006. Biodiversity and biogeographic relationships of the polychaete fauna in French Atlantic and Mediterranean waters. Sci. Mar. 70S3: 259-267. Dauvin, J.C., Dewarumez, J.M., and Gentil, F. 2003. Liste actualisee des especes d'annelides polychetes presentes en Manche. Cah. Biol. Mar. 44: 67-95. Davenport, D. 1950. Studies in the physiology of commensalism. 1. The polynoid genus Arctonoe. Biol. Bull. 98: 81-93. Day, J.H. 1967. A monograph on the Polychaeta of Southern Africa Part I. Errantia. British Museum (Natural History). London. 99 Dean, D. 1987. Trochochaeta pettiboneae, a new species (Polychaeta: Trochochaetidae) from the Gulf of Maine with additional comments on T. carica. Bull. Biol. Soc. Wash. 7: 46-49. deWaard, J.R., Laundry, J.F., Schmidt, B.C., Derhousoff, J., McLean, J.A., and Humble, L.M. 2009. In the dark in a large urban park: DNA barcodes illuminate cryptic and introduced moth species [online]. Biodiv. Cons. 18: 14. doi: 10.1007/sl0531- 009-9682-7. Dietz, R.S., and Shumway, G. 1961. Arctic basin geomorphology. Bull. Geol. Soc. Amer. 72: 1319-1330. Dodson, J.J., Tremblay, S., Colombani, F., Carscadden, J.E., and Lecomte, F. 2007. Trans-Arctic dispersals and the evolution of a circumpolar marine fish species complex, the capelin (Mallotus villosus). Mol. Ecol. 16: 5030-5043. Drake, C.A., McCarthy, D.A., and von Dohlen, CD. 2007. Molecular relationships and species divergence among Phragmatopoma spp. (Polychaeta: Sabellaridae) in the Americas. Mar. Biol. 150: 345-358. Drummond, A.J., Ashton, B., Cheung, M., Heled, J., Kearse, M., Moir, R., Stones-Havas, S., Thierer, T., and Wilson, A. 2009. Geneious v4.6. Available from http://www.geneious.com/. Dunbar, M.J., and Moore, D.M. 1980. Marine life and its environment in the Canadian Eastern Arctic: a biogeographic study. McGill University, Montreal, QC. Dunton, K. 1992. Arctic biogeography: the paradox of the marine benthic fauna and flora. Trends Ecol. Evol. 7: 183-189. 100 Durham, J.W., and MacNeil, F.S. 1967. Cenozoic migrations of marine invertebrates through the Bering Strait region. In The Bering Land Bridge. Edited by D.M. Hopkins. Stanford University Press, Stanford, CA. pp. 326-349. Dyke, A.S., Dale, J.E., and McNeely, R.N. 1996. Marine molluscs as indicators of environmental change in glaciated North America and Greenland during the last 18,000 years. Geogr. Phys. Quat. 50: 125-184. Eklof, J., Pleijel, F., and Sundberg, P. 2007. Phylogeny of benthic Phyllodocidae (Polychaeta) based on morphological and molecular data. Mol. Phyl. Evol. 45: 261-271. Ellis, D.V. 1955. Arctic and subarctic examples of intertidal zonation. Arctic 8: 224-236. Ellis, D.V. 1960. Marine infaunal benthos in Arctic North America. Arctic Institute of North America, Montreal, PQ. Ellis, D.V. 1961. Some observations on the shore fauna of Baffin Island. Arctic 14: 224- 235. Fauchald, K. 1982. Revision oiOnuphis, Nothria and Paradiopatra. (Polychaeta: Onuphidae) based upon type material. Smithsonian Contrib. Zool. 356: 1-109. Fauchald, K. 1984. Polychaete distribution patterns, or: can animals with Palaeozoic cousins show large-scale geographic patterns? In Proceedings of the first international polychaete conference. Edited by P.A. Hutching. The Linnean Society of New South Wales, Sydney, NSW. pp. 1-6. Fauchald, K. 2009. World Polychaeta database [online]. Available from http://www.marinespecies.org [accessed 12 April 2009]. 101 Fauchald, K., and Rouse, G. 1997. Polychaete systematics: past and present. Zool. Script. 26:71-138. Felsenstein, J. 1981. Evolutionary trees from DNA sequences: a maximum likelihood approach. J. Mol. Evol. 32: 79-81. Fitzhugh, K. 1990. A revision of the genus Fabricia Blainville, 1828 (Polychaeta: Sabellidae: Fabriciinae). Sarsia 75: 1-16. Floyd, R., Abebe, E., Papert, A., and Blaxter, M. 2002. Molecular barcodes for soil nematode identification. Mol. Ecol. 11: 839-850. Folmer, O., Black, M., Hoeh, W., Lutz, R., and Vrijenhoek, R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotech. 3: 294-299. Ford, E., and Hutchings, P. 2005. An analysis of morphological characters of Owenia useful to distinguish species: description of three new species of Owenia (Oweniidae: Polychaeta) from Australian waters. Mar. Ecol. 26: 181-196. Fournier, J.A. 1991. New species of Microphthalmus (Polychaeta: Hesionidae) from the Pacific Northwest. Bull. Mar. Sci. 48: 208-213. Fournier, J., and Pocklington, P. 1984. The sublittoral polychaete fauna of the Bras d'Or Lakes, Nova Scotia, Canada. In Proceedings of the first international polychaete conference. Edited by P. A. Hutchings. Linnean Society of New South Wales, Sydney, NSW. pp. 254-275. Gagaev, S.Y. 2008. Sigambra healyae sp. n., a new species of polychaete (Polychaeta: Pilargidae) from the Canadian Basin of the Arctic Ocean. Russ. J. Mar. Biol. 34: 73-75. 102 Giangrande, A., and Licciano, M. 2004. Factors influencing latitudinal pattern of biodiversity: an example using Sabellidae (Annelida, Polychaeta). Biodiv. Cons. 13:1633-1646. Glasby, C.J. 2005. Polychaete distribution patterns revisited: an historical explanation. Mar. Ecol. 26: 235-245. Glasby, C.J., Hutchings, P.A., Fauchald, K., Paxton, H., Rouse, G.W., Watson Russel, C, and Wilson, R.S. 2000. Class Polychaeta. In Polychaetes & Allies. The southern synthesis. Fauna of Australia. Vol. 4 A. Polychaeta, Myzostomida, Pogonophora, Echiura, Sipuncula. Edited by P.L. Beesley, G.J.B. Ross, and C.J. Glasby. CSIRO Publishing, Melbourne, VIC. pp. 1-296. Glover, A.G., Goetze, E., Dahlgren, T.G., and Smith, C.R. 2005. Morphology, reproductive biology and genetic structure of the whale-fall and hydrothermal vent specialist, Bathykurila guaymasensis Pettibone, 1989 (Annelida: Polynoidae). Mar. Ecol. 26: 223-234. Grainger, E.H. 1954. Polychaetous annelids of Ungava Bay, Hudson Strait, Frobisher Bay and Cumberland Sound. J. Fish. Res. Board Can. 11: 507-527. Grant, W.S., and Stahl, G. 1988. Evolution of Atlantic and Pacific cod: loss of genetic variation and gene expression in Pacific cod. Evolution 42: 138-146. Grassle, J.F., and Maciolek, N.J. 1992. Deep-Sea species richness: regional and local diversity estimates from quantitative bottom samples. Am. Nat. 139: 313-341. Graur, D., and Li, W.S. 2000. Fundamentals of molecular evolution, 2nd edition. Sinauer Assoc. Sunderland, MA. 103 Harris, S.A. 2005. Thermal history of the Arctic Ocean environs adjacent to North America during the last 3.5 Ma and a possible mechanism for the cause of the cold events (major glaciations and permafrost events). Prog. Phys. Geog. 29: 218- 237. Harrison, M.K., and Crespi, B.J. 1999. Phylogenetics of Cancer crabs (Crustacea: Decapoda: Brachyura). Mol. Phyl. Evol. 12: 186-199. Hart, M.W., Byrne, M., and Smith, M.J. 1997. Molecular phylogenetic analysis of life- history evolution in asterinid starfish. Evolution 51: 1848-1861. Hartman, O. 1938. Review of the annelid worms of the family Nephtyidae from the northeast Pacific, with descriptions of five new species. Proc. US Natl. Mus. 85: 143-158. Hartman, O. 1948. The polychaetous annelids of Alaska. Pac. Sci. 2: 1-58. Hartman, O. 1959. Catalogue of the polychaetous annelids of the world. Parts I & II. Allan Hancock Found. Occ. Pap. 23: 1-628. Hebert, P.D.N., Cywinska, A., Ball, S.L., and deWaard, J.R. 2003a. Biological identifications through DNA barcodes. Proc. R. Soc. Lond. B Biol. Sci. 270: 313- 321. Hebert, P.D.N., Penton, E.H., Burns, J.M., Janzen, D.H., and Hallwachs, W. 2004a. Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptesfulgerator. Proc. Natl. Acad. Sci. USA 101: 14812-14817. Hebert, P.D.N., Ratnasingham, S., and deWaard, J.R. 20036. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc. R. Soc. Lond. B 270 (Suppl.): S96-S99. 104 Hebert, P.D.N., Stoeckle, M.Y., Zemlak, T.S., and Francis, CM. 20046. Identifications of birds through DNA barcodes. PLoS Biol. 2: 1657-1663. Herman, Y., and Hopkins, D.M. 1980. Arctic oceanic climate in Late Cenozoic times. Science 209: 557-562. Hewitt, G.M. 2001. Speciation, hybrid zones and phylogeography - or seeing genes in space and time. Mol. Ecol. 10: 537-549. Hewitt, G.M. 2004. Genetic consequences of climatic oscillations in the Quaternary. Phil. Trans. R. Soc. Lond. B 359: 183-195. Ho, S.Y.W., Phillips, M.J., Cooper, A., and Drummond, A.J. 2005. Time dependency of molecular rate estimates and systematic overestimation of recent divergence times. Mol. Biol. Evol. 22: 1561-1568. Ho, S.Y.W., Sapiro, B., Phillips, M.J., Cooper, A., and Drummond, A.J. 2007. Evidence for time dependency of molecular rate estimates. Syst. Biol. 56: 515-522. Hoba?k, A., and Weider, L.J. 1999. A circumpolar study of Arctic biodiversity: phylogeographic patterns in the Daphniapulex complex. Ambio 28: 245-250. Hobson, K.D., and Banse, K. 1981. Sedentariate and archiannelid polychaetes of British Columbia and Washington. Department of Fisheries and Oceans, Ottawa, ON. Holthe, T. 1978. The zoogeography of the Terebellomorpha (Polychaeta) of the northern European waters. Sarsia63: 191-198. Holthe, T. 1986. Polychaeta terebellomorpha. Norwegian University Press, Norway. Huang, J., Xu, Q., Sun, Z.J., Tang, G.L., and Su, Z.Y. 2007. Identifying earthworms through DNA barcodes. Pedobiologia 51: 301-309. 105 Hurtado, L.A., Lutz, R.A., and Vrijenhoek, R.C. 2004. Distinct patterns of genetic differentiation among annelids of eastern Pacific hydrothermal vents. Mol. Ecol. 13:2603-2615. Hutchings, P. 1998. Biodiversity and functioning of polychaetes in benthic sediments. Biodiv. Cons. 7: 1133-1145. Hutchings, P., and Fauchald, C. 2000. Class Polychaeta. Definition and general description. In Polychaetes and allies: the southern synthesis. Edited by P.L. Beesley, G.J.B. Ross, and C.J Glasby. CSIRO Publishing, Melbourne, VIC. pp. 1- 3 Hutchings, P., and Peart, R. 2002. A review of the genera of Pectinariidae (Polychaeta) together with a description of the Australian fauna. Rec. Aust. Mus. 54: 99-127. Iannotta, M.A., Gambi, M.C., and Patti, F.P. 2009. Molecular evidence of intraspecific variability in Lysidice ninetta (Polychaeta: Eunicidae) in the Mediterranean Sea. Aquat. Biol. 6: 121-132. Ivanova, N.V., Fazekas, A.J., and Hebert, P.D.N. 2008. Semi-automated, membrane- based protocol for DNA isolation from plants. Plant Mol. Biol. Rep. 26: 186-198. Ivanova, N.V., Zemlak, T.S., Hanner, R.H., and Hebert, P.D.N. 2007. Universal primer cocktails for fish DNA barcoding. Mol. Ecol. Notes 7: 544-548. Janzen, D.H., Hallwachs, W., Blandin, P., Burns, J.M., Cadiou, J.M., Chacon, I., Dapkey, T., Deans, A.R., Epstein, M.E., Espinoza, B., Franclemont, J.G., Haber, W.A., Hajibabaei, M., Hall, J.P.W., Hebert, P.D.N., Gauld, I.D., Harvey, D.J., Hausmann, A., Kitching. I.J., Lafontaine, D., Landry, J.F., Lemaire, C, Miller, J.Y., Miller, J.S., Miller, L., Miller, S.E., Montero, J., Munroe, E., Green, S.R., 106 Ratnasingham, S., Rawlins, J.E., Robbins, R.K., Rodriguez, J.J., Rougerie, R., Sharkey, M.J., Smith, M.A., Solis, M.A., Sullivan, J.B., Thiaucourt, P., Wahl, D.B., Weller, S.J., Whitfield, J.B., Willmott, K.R., Wood, D.M., Woodley, N.E., and Wilson, J.J. 2009. Integration of DNA barcoding into an ongoing inventory of complex tropical biodiversity. Mol. Ecol. Res. 9: 1-26. Jirkov, LA. 1985. Amphicteis ninonae sp. n. (Polychaeta, Ampharetidae) from the northern waters. Zool. Zhurnal 64: 1894-1898. Jirkov, LA. 2001. Polychaeta of the Arctic Ocean. Yanus-K, Moscow, RU. Johnson, H.P. 1901. The Polychaeta of the Puget Sound region. Proc. Boston Soc. Nat. Hist. 29:381-437. Johnson, S.B., Young, C.R., Jones, W.J., Waren, A., and Vrijenhoek, R.C. 2006. Migration, isolation, and speciation of hydrothermal vent limpets (Gastropoda; Lepetodrilidae) across the Blanco Transform Fault. Biol. Bull. 210: 140-157. Jolly, M.T., Jollivet, D., Gentil, F., Thiebaut, E., and Viard, F. 2005. Sharp genetic break between Atlantic and English Channel populations of the polychaete Pectinaria koreni, along the North coast of France. Heredity 94: 23-32. Jolly, M.T., Viard, F., Gentil, F., Thiebauts, E., and Jollivet, D. 2006. Comparative phylogeography of two coastal polychaete tubeworms in the Northeast Atlantic supports shared history and vicariant events. Mol. Ecol. 15: 1841-1855. Jones, D.T. 2007. Improving the accuracy of transmembrane protein topology prediction using evolutionary information. Bioinformatics 23: 538-544. Jumars, P. A. 1974. A generic revision of the Dorvilleidae (Polychaeta), with six new species from the deep North Pacific. Zool. J. Linn. Soc. 54: 101-135. 107 Kato, T., and Pleijel, F. 2002. A revision of Notophyllum Oersted, 1843 (Phyllodocidae, Polychaeta). J. Nat. Hist. 36: 1135-1178. Kenny, R. 1969. Effects of temperature, salinity and substrate on distribution of Clymenella torquata (Leidy), Polychaeta. Ecology 50: 624-631. Kerr, K.C.R., Lijtmaer, D.A., Barreira, A.S., Hebert, P.D.N., and Tubaro, P.L. 2009. Probing evolutionary patterns in Neotropical birds through DNA barcodes [online]. PLoS One 4: 2. doi: 10.1371/journal.pone.0004379. Kerr, K.C.R., Stoeckle, M.Y., Dove, C.J., Weigt, L.A., Francis, CM., and Hebert, P.D.N. 2007. Comprehensive DNA barcode coverage of North American birds. Mol. Ecol. Notes 7: 535-543. Kimura, M. 1980. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16: 111-120. Klicka, J., and Zink, R.M. 1997. The importance of recent ice ages in speciation: a failed paradigm. Science 277: 1666-1670. Knight-Jones, P. 1998. A revision of Sabella, Bispira and Stylomma (Polychaeta: Sabellidae). Zool. J. Linn. Soc. 123: 385-467. Knight-Jones, P., Knight-Jones, E.W., and Dales, R.P. 1979. Spirorbidae (Polychaeta: Sedentaria) from Alaska to Panama. J. Zool. 189: 419-458. Knowlton, N. 1993. Sibling species in the sea. Annu. Rev. Ecol. Syst. 24: 189-216. Knowlton, N. 2000. Molecular genetic analyses of species boundaries in the sea. Hydrobiologia 420: 73-90. 108 Knowlton, N., Weigt, L.A., Solorzano, L.A., Mills, D.K., and Bermingham, E. 1993. Divergence in proteins, mitochondrial DNA, and reproductive compatibility across the Isthmus of Panama. Science 260: 1629-1632. Knowlton, N., and Weigt, L.A. 1998. New dates and new rates for divergences across the Isthmus of Panama. Proc. R. Soc. Lond. B 265: 2257-2263. Knox, G.A., and Lowry, J.K. 1977. A comparison between the benthos of the Southern Ocean and the North Polar Ocean with special reference to the Amphipoda and the Polychaeta. In Polar oceans. Edited by M.J. Dunbar. Arctic Institute of North America, Calgary, AB. pp. 423-462. Koh, B., Bhaud, M.R., and Jirkov, LA. 2003. Two new species of Owenia (Annelida: Polychaeta) in the northern part of the North Atlantic Ocean and remarks on previously erected species from the same area. Sarsia 88: 175-188. Kumar, S. 1996. PHYLTEST. Version 2.0. Pennsylvania State University, University Park. Kupriyanova, E.K., and Badyaev, A.V. 1998. Ecological correlates of arctic Serpulidae (Annelida, Polychaeta) distributions. Ophelia 49: 181-193. Lana, P.C., Santos, C.S.G., Garraffoni, A.R.S., Oliveira, V.M., and Radashevsky, V. 2006. Checklist of polychaete species from Parana State (Southern Brazil). Check List 2: 30-63. Laudien, J., Herrmann, M., and Arntz, W.E. 2007. Soft bottom species richness and diversity as a function of depth and iceberg scour in Arctic glacial Kongsfjorden (Svalbard). Polar Biol. 30: 1035-1046. 109 Lessios, H.A., Kessing, B.D., Robertson, D.R., and Paulay, G. 1999. Phylogeography of the pantropical sea urchin Eucidaris in relation to land barriers and ocean currents. Evolution 53: 806-817. Levenstein, R.Y. 1981. Some pecularities of the distribution of the family Polynoidae from the Canada basin of the Artie Ocean. Acad. Sci. USSR. 115: 26-36. Light, W.J.H. 1991. Systematic revision of the genera of the polychaete subfamily Maldanidae Arwidsson. Ophelia Suppl. 5: 133-146. Linkletter, L.E. 1977. Checklist of marine fauna and flora of the Bay of Fundy. Huntsman Marine Laboratory, St. Andrews, NB. Little, C.T.S., and Vrijenhoek, R.C. 2003. Are hydrothermal vent animals living fossils? Trends Ecol. Evol. 18: 582-588. Lovell, L.L. 1997. A review of six species of Nephtys (Cuvier, 1817) (Nephtyidae: Polychaeta) described from the eastern Pacific. Bull. Mar. Sci. 60: 350-363. MacDonald, I.R., Bluhm, B.A., Iken, K., Gagaev, S., and Strong, S. 2009. Benthic macrofauna and megafauna assemblages in the Arctic deep-sea Canada Basin [online]. Deep-Sea Res. II doi:10.1016/j.dsr2.2009.08.012. Maciolek, N.J. 1985. A revision of the genus Prionospio Malmgren, with special emphasis on species from the Atlantic Ocean, and new records of species belonging to the genera Apoprionospio Foster and Paraprionospio Caullery (Polychaeta, Annelida, Spionidae). Zool. J. Linn. Soc. 84: 325-383. Maciolek, N.J. 1990. A redescription of some species belonging to the genera Spio and Microspio (Polychaeta: Annelida) and descriptions of three new species from the northwestern Atlantic Ocean. J. Nat. Hist. 24: 1109-1141. 110 Mackie, A.S.Y. 1987. A review of species currently assigned to the genus Leitoscoloplos Day, 1977 (Polychaeta: Orbiniidae), with descriptions of species newly referred to Scoloplos Blainville, 1828. Sarsia72: 1-28. Mackie, A.S.Y., Parmiter, C, and Tong, L.K.Y. 1997. Distribution and diversity of Polychaeta in the Southern Irish Sea. Bull. Mar. Sci. 60: 467-481. Mallet, J. 2007. Hybrid speciation. Nature. 446: 279-283. Maltagliati, F., Peru, A.P., Casu, M., Rossi, F., Lardicci, C, Curini-Galletti, M., and Castelli, A. 2000. Is Syllis gracilis (Polychaeta: Syllidae) a species complex? An allozyme perspective. Mar. Biol. 136: 871-879. Manchenko, G.P., and Radashevsky, V.I. 1993. Genetic differences between two sibling species of the Polydora ciliata complex (Polychaeta: Spionidae). Biochem. Syst. Ecol. 21: 543-548. Marincovich Jr., L., and Gladenkov, A.Y. 1999. Evidence for an early opening of the Bering Strait. Nature 397: 149-151. Marincovich Jr., L., and Gladenkov, A.Y. 2001. New evidence for the age of Bering Strait. Quat. Sci. Rev. 20: 329-335. Martin, D., Koh, B.S., Bhaud, M., Dutrieux, E., and Gil, J. 2006. The genus Owenia (Annelida: Polychaeta) in the Persian Gulf, with description of Owenia persica sp. nov. Org. Div. Evol. 6: 325-226. Maurer, D., and Reish, D.J. 1984. Pelagic polychaetes from ice stations (Arlis I and II) in the Arctic Basin. J. Nat. Hist. 18: 381-387. Mcintosh, W.C. 1911. Notes from the Gatty Marine Laboratory, St. Andrews. No. 32. Ann. Mag. Nat. Hist. 7: 145-173. Ill Mendez, N., Linke-Gamenick, I., Forbes, V.E. 2000. Variability in reproductive mode and larval development within the Capitella capitata species complex. Invertebr. Reprod. Dev. 38: 131-142. Messing J. 1983. New M13 vectors for cloning. Met. Enzymol. 101: 20-78. Meyer, C.P., and Paulay, G. 2005. DNA barcoding: error rates based on comprehensive sampling [online]. PLoS Biol. 3: e422. doi:10.1371/journal.pbio.0030422. Nei, M., and Li, W.H. 1979. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc. Natl. Acad. Sci. USA 76: 5269-5273. Nikula, R., Strelkov, P., and Vainola, R. 2007. Diversity and trans-Arctic invasion history of mitochondrial lineages in the North Atlantic Macoma balthica complex (Bivalvia: Tellinidae). Evolution 61: 928-941. Novo, M., Almodovar, A., and Diaz-Cosin, D.J. 2009. High genetic divergence of hormogastrid earthworms (Annelida, Oligochaeta) in the central Iberian Peninsula: evolutionary and demographic implications. Zool. Scr. 38: 537-552. Nygren, A. 2004. Revision of Autolytinae (Syllidae: Polychaeta). Zootaxa 680: 1-314. Olsen, J.L., Stam, W.T., Coyer, J.A., Reusch, T.B.H., Billingham, M., Bostrom, C, Calvert, E., Christie, H., Granger, S., Lumiere, R.A., Milchakova, N., Oudot-Le Secq, M.P., Procaccini, G., Sanjabi, B., Serrao, E., Veldsink, J., Widdicombe, S., and Wyllie-Echeverria, S. 2004. North Atlantic phylogeography and large-scale population differentiation of the seagrass Zostera marina L. Mol. Ecol. 13: 1923-1941. 112 Olsgard, F., Brattegard, T., and Holthe, T. 2003. Polychaetes as surrogates for marine biodiversity: lower taxonomic resolution and indicator groups. Biodiv. Cons. 12: 1033-1049. Olson, M.A., Zajac, R.M., and Russello, M.A. 2009. Estuarine-scale genetic variation in the polychaete Hobsonia florida (Ampharetidae; Annelida) in Long Island Sound and relationships to Pleistocene glaciations. Biol. Bull. 217: 86-94. Osborn, K.J., Rouse, G.W., Goffredi, S.K., and Robinson, B.H. 2007. Description and relationships of Chaetopterus pugaporcinus, an unusual pelagic polychaete (Annelida, Chaetopteridae). Biol. Bull. 212: 40-54. Palumbi, S.R., and Kessing, B.D. 1991. Population biology of the trans-Arctic exchange: mtDNA sequence similarity between Pacific and Atlantic sea urchins. Evolution 45: 1790-1805. Parapar, J. 2006. The genera Myriochele and Myrioglobula (Polychaeta, Oweniidae) in Icelandic waters with the revision of type material of Myriochele heeri Malmgren, 1867, and the description of a new species. J. Nat. Hist. 40: 523-547. Paterson, G.L.J., Glover, A.G., Barrio Frojan, C.R.S., Whitaker, A., Budaeva, N., Chimonides, J., and Doner, S. 2009. A census of abyssal polychaetes. Deep-Sea Res. II56: 1739-1746. Paxton, H. 1986. Generic revision and relationships of the family Onuphidae (Annelida: Polychaeta). Rec. Aust. Mus. 38: 1-74. Pegg, G.G., Sinclair, B., Briskey, L., and Aspden, W.J. 2006. MtDNA barcode identification offish larvae in the southern Great Barrier Reef, Australia. Sci. Mar. 70: 7-12. 113 Penny, D. 2005. Relativity for molecular clocks. Nature 436: 183-184. Pernet, B. 1999. Gamete interactions and genetic differentiation among three sympatric polychaetes. Evolution 53: 435-446. Petersen, M.E. 1999. Reproduction and development in Cirratulidae (Annelida: Polychaeta). Hydrobiol. 402: 107-128. Pettibone, M.H. 1954. Marine polychaete worms from Point Barrow, Alaska, with additional records from the north Atlantic and north Pacific. Proc. US Natl. Mus. 103: 203-356. Pettibone, M.H. 1956. Some polychaete worms of the families Hesionidae, Syllidae, and Nereididae from the east coast of North America, West Indies, and Gulf of Mexico. J. Wash. Acad. Sci. 46: 281-294. Pettibone, M.H. 1961. New species of polychaete worms from the Atlantic Ocean, with a revision of the Dorvilleidae. Proc. Biol. Soc. Wash. 74: 167-186. Pettibone, M.H. 1963a. Marine polychaete worms of the New England region. I. Aphroditidae through Trochochaetidae. US Natl. Mus. Bull. 227: 1-356. Pettibone, M.H. 19636. Revision of some genera of polychaete worms of the family Spionidae, including the description of a new species of Scolelepis. Proc. Biol. Soc. Wash. 76: 89-104. Pettibone, M.H. 1971. Revision of some species referred to Leptonereis, Nicon, and Laeonereis (Polychaeta: Nereididae). Smithsonian Contrib. Zool. 104: 1-53. Pettibone, M.H. 1993. Revision of some species referred to Antinoe, Antinoella, Antinoana, Bylgides, and Harmothoe (Polychaeta: Polynoidae: Harmothoinae). Smithsonian Contrib. Zool. 545: 1-41. 114 Pleijel, F. 1990. A revision of the genus Sige Malmgren (Polychaeta: Phyllodocidae). Zool. J. Linn. Soc. 98: 161-184. Pleijel, F. 1991. Phylogeny and classification of the Phyllodocidae (Polychaeta). Zool. Script. 20: 225-261. Pleijel, F. 1998. Phylogeny and classification of Hesionidae (Polychaeta). Zool. Script. 27: 89-163. Pleijel, F., and Rouse, G.W. 2006. Phyllodocida. In Reproductive biology and phylogeny of Annelida Volume 4. Edited by G.W. Rouse, and F. Pleijel. Science Publishers, Enfield, NH. pp. 438-460. Pleijel, F., Rouse, G., and Nygren, A. 2009. Five colour morphs and three new species of Gyptis (Hesionidae, Annelida) under a jetty in Edithburgh, South Australia. Zool. Scr. 38: 89-99. Pocklington, P. 1989. Polychaetes of eastern Canada. An illustrated key to polychaetes of eastern Canada including the Eastern Arctic. Department of Fisheries and Oceans, Mont-Joli, PQ. Pocklington, P., and Tremblay, M. J. 1987. Faunal zones in the northwest Atlantic based onpolychaete distribution. Can. J. Zool. 65: 391-402. Pocklington, P., and Wells, P.G. 1992. Polychaetes: key taxa for marine environmental quality monitoring. Mar. Pollut. Bull. 24: 593-598. Powell, N.V., and Bousfield, E.L. 1969. Canadian marine invertebrate life. In Animal life in Canada today. National Museum of Natural Science, Ottawa, ON. pp. 14-15. 115 Quijon, P.A., and Snelgrove, P.V.R. 2005. Polychaete assemblages of a sub-arctic Newfoundland fjord: habitat, distribution, and identification. Polar Biol. 28: 495-505. Ratnasingham, S., and Hebert, P.D.N. 2007. BOLD: The Barcode of Life Data System (http://www.barcodinglife.org). Mol. Ecol. Notes 7: 355-364. Ratnasingham, S., and Hebert, P.D.N. (In preparation). Registering Biodiversity, BIN by BIN. Rice, S.A., Stephen, K., and Rice, K.A. 2008. The Polydora cornuta complex (Annelida: Polychaeta) contains populations that are reproductively isolated and genetically distinct. Invert. Biol. 127: 45-64. Rouse, G.W., and Pleijel, F. 2001. Polychaetes. Oxford University Press, London, UK. Rousset, V., Pleijel, F., Rouse, G.W., Erseus, C, and Siddall, M. 2007. A molecular phylogeny of annelids. Cladistics 23: 41-63. Saez, A.G., Probert, I., Geisen, M., Quinn, P., Young, J.R., and Medlin, L.K. 2003. Pseudo-cryptic speciation in coccolithophores. Proc. Natl. Acad. Sci. USA 100: 7163-7168. Sato, M., and Masuda, Y. 1997. Genetic differentiation in two sibling species of the brackish-water polychaete Hediste japonica complex (Nereididae). Mar. Biol. 130: 163-170. Schander, C, and Willassen, E. 2005. What can biological barcoding do for marine biology. Mar. Biol. Res. 1: 79-83. 116 Schuller, M, and Ebbe, B. 2007. Global distributional patterns of selected deep-sea Polychaeta (Annelida) from the Southern Ocean. Deep-Sea Res. II54: 1737- 1751. Sikorski, A.V., and Bick, A. 2004. Revision of Marenzelleria Mesnil, 1896 (Spionidae, Polychaeta). Sarsia89: 253-275. Shih, C.T., Figueira, A.J.G., and Grainger, E.H. 1971. A synopsis of Canadian marine zooplankton. Fisheries Research Board of Canada. Ottawa, ON. Smith, M.A., Andez-Triana, J.F., Roughley, R., and Hebert, P.D.N. 2009. DNA barcode accumulation curves for understudied taxa and areas. Mol. Ecol. Res. 9: 208-216. Smith, M.A., Fisher, B.L., and Hebert, P.D.N. 2005. DNA barcoding for effective biodiversity assessment of a hyperdiverse arthropod group: the ants of Madagascar. Phil. Trans. R. Soc. B 360: 1825-1834. Smith, M.A., Rodriguiz, J.J., Whitfield, J.B., Deans, A.R., Janzen, D.H., Hallwachs, W., and Hebert, P.D.N. 2008. Extreme diversity of tropical parasitoid wasps exposed by iterative integration of natural history, DNA barcoding, morphology, and collections. Proc. Natl. Acad. Sci. USA 105: 12359-12364. Smith, M.A., Woodley, N.E., Janzen, D.H., Hallwachs, W., and Hebert, P.D.N. 2006. DNA barcodes reveal cryptic host-specificity within the presumed polyphagous members of a genus of parasitoid flies (Diptera: Tachinidae). Proc. Natl. Acad. Sci. USA 103: 3657- 3662. Snelgrove, P.V.R. 1997. The importance of marine sediment biodiversity in ecosystem processes. Ambio 26: 578-583. 117 Serensen, T.A. 1948. A method of establishing groups of equal amplitude in plant sociology based on similarity of species content, and its application to analyses of the vegetation on Danish commons. K. Dan. Vidensk. Selsk. Biol. Skr. 5: 1-34. Stanley, H.F., Casey, S., Carnahan, J.M., Goodman, S., Harwood, J., and Wayne, R.K. 1996. Worldwide patterns of mitochondrial DNA differentiation in the harbor seal (Phoca vitulina). Mol. Biol. Evol. 13: 368-382. Stewart, P.L., Pocklington, P., and Cunjak, R.A. 1985. Distribution, abundance and diversity of benthic macroinvertebrates on the Canadian Continental Shelf and Slope of Southern Davis Strait and Ungava Bay. Arctic 38: 281-291. Stimpson, W. 1853. Synopsis of the marine invertebrata of Grand Manan: or the region about the mouth of the Bay of Fundy, New Brunswick. Smithsonian Contrib. Knowl. 6: 1-66. Swofford, D.L. 2002. PAUP*: phylogenetic analysis using parsimony (*and other methods). Version 4.0 beta. Sinauer Associates, Sunderland, MA. Takezaki, N., Rzhetsky, A., and Nei, M. 1995. Phylogenetic test of molecular clock and linearized trees. Mol. Biol. Evol. 12: 823-833. Tamura, K., Dudley, J., Nei, M., and Kumar, S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24: 1596-1599. ten Hove, H.A., and Jansen-Jacobs, M.J. 1984. A revision of the genus Crucigera (Polychaeta: Serpulidae); a proposed methodical approach to serpulids, with special references to variation in Serpula and Hydroides. In Proceedings of the first international polychaete conference. Edited by P.A. Hutchings. The Linnean Society of New South Wales, Sydney, NSW. pp. 143-180. 118 Tovar-Hernandez, M. 2007. Revision of Chone Kroyer, 1856 (Polychaeta: Sabellidae) from North America and descriptions of four new species. J. Nat. Hist. 41: 9-12. Treadwell, A.L. 1937. Polychaetous annelids collected by Captain Robert A. Bartlett in Greenland, Foxe Basin and Labrador. J. Wash. Acad. Sci. 27: 23-26. Treadwell, A.L. 1948. Canadian Atlantic Fauna. 9, Annelida. 9b, Polychaeta. Fisheries Research Board of Canada, Toronto, ON. Trott, T.J. 2004. Cobscook Bay inventory: a historical checklist of marine invertebrates spanning 162 Years. Northeastern Nat. 11: 261-324. Ushakov, P.V. 1965. Polychaeta of the far Eastern Seas of the U.S.S.R. Keys to the fauna of the U.S.S.R. Zoological Institute of the Academy of Sciences of the USSR, Jerusalem, Israel. Vainola, R. 2003. Repeated trans-Arctic invasions in littoral bivalves: molecular zoogeography of the Macoma balthica complex. Mar. Biol. 143: 935-946. van Oppen, M.J.H., Draisma, S.G.A., Olsen, J.L., and Stam, W.T. 1995. Multiple trans- Arctic passages in the red alga Phycodrys rubens: evidence from nuclear rDNA ITS sequences. Mar. Biol. 123: 179-188 Vermeij, G.J. 1991. Anatomy of an invasion: the trans-Arctic interchange. Paleobiology 17: 281-307. Vermeij, G.J., and Roopnarine, P.D. 2008. The coming Arctic invasion. Science 321: 780-781. Vittor, B.A., and Associates, Inc. 1998. Puget Sound benthic community assessment- December 1998. National Ocean Service, U.S. Department of Commerce, Maryland. 119 von Konigslow, T. 2009. Automating tools for scanning, characterizing and analyzing large DNA sequence data sets. M.Sc. thesis, Department of Integrative Biology, University of Guelph, Guelph, ON. Wacasey, J.W., and Atkinson, E.G. 1987. Benthic invertebrates collected from Ungava Bay, Canada, 1947-1951. Can. Tech. Rep. Fish. Aquat. Sci. 1537: 1-68. Ward, R.D., Zemlak, T.S., Innes, B.H., Last, P.R., and Hebert, P.D.N. 2005. DNA barcoding Australia's fish species. Phil. Trans. R. Soc. B 360: 1847-1857. Ward, R.D., and Holmes, B.H. 2007. An analysis of nucleotide and amino acid variability in the barcode region of cytochrome c oxidase I (coxl) in fishes. Mol. Ecol. Notes 7:899-907. Wares, J.P. 2001. Biogeography of Asterias: North Atlantic climate change and speciation. Biol. Bull. 201: 95-103. Wares, J.P., and Cunningham, C.W. 2001. Phylogeography and historical ecology of the North Atlantic intertidal. Evolution 55: 2455-2469. Warren, L.M., Hutchings, P. A., and Doyle, S. 1994. A revision of the genus Mediomastus Hartman, 1944 (Polychaeta: Capitellidae). Rec. Aust. Mus. 46: 227-256. Wayne, R.K. 1992. On the use of morphologic and molecular genetic characters to investigate species status. Cons. Biol. 6: 590-592. Webb, T., and Bartlein, P.J. 1992. Global changes during the last 3 million years: climatic controls and biotic responses. Annu. Rev. Ecol. Syst. 23: 141-173. Wehe, T., and Fiege, D. 2002. Annotated checklist of the polychaete species of the seas surrounding the Arabian Peninsula: Red Sea, Gulf of Aden, Arabian Sea, Gulf of Oman, Arabian Gulf. Faun. Arab. 19: 7-238. 120 Weider, L.J., and Hobaek, A. 2000. Phylogeography and arctic biodiversity: a review. Ann. Zool. Fennici 37: 217-231. Wesenburg-Lund, E. 1950. The Polychaeta of West Greenland: with special reference to the fauna of Nordre Stromfjord Kvane and Bredefjord. Meddelelser Om Gronland 151: 1-180. Westheide, W., and Hass-Cordes, E. 2001. Molecular taxonomy: description of a cryptic Petitia species (Polychaeta: Syllidae) from the island of MaheA (Seychelles, Indian Ocean) using RAPD markers and ITS2 sequences. J. Zool. Syst. Evol. Res. 39: 103-111. Westheide, W., and Schmidt, H. 2003. Cosmopolitan versus cryptic meiofaunal polychaete species: an approach to a molecular taxonomy. Helgol. Mar. Res. 57: 1-6. Wilce, R.T. 1990. Role of the Arctic Ocean as a bridge between the Atlantic and Pacific Oceans: fact and hypothesis. In Evolutionary biogeography of the marina algae of the North Atlantic. Edited by D.J. Garbary, and G.R. South. Springer-Verlag, Berlin pp. 323-348. Wilson, R.S. 1988. A review of Eteone Savigny, 1820, Mysta Malmgren, 1865 and Hypereteone Bergstrom, 1914 (Polychaeta: Phyllodocidae). Mem. Mus. Vic. 49: 385-431. Wilson, W.H. 1991. Sexual reproductive modes in polychaetes: classification and diversity. Bull. Mar. Sci. 48: 500-516. 121 Witt, J.D.S., Threloff, D.L., and Hebert, P.D.N. 2006. DNA barcoding reveals extraordinary cryptic diversity in an amphipod genus: implications for desert spring conservation. Mol. Ecol. 15: 3073-3082. Wlodarska-Kowalczuk, M., Sicinski, J., Gromisz, S., Kendall, M.A., and Dahle, S. 2007. Similar soft-bottom polychaete diversity in Arctic and Antarctic marine inlets. Mar. Biol. 151: 607-616. Xia, X., and Xie, Z. 2001 DAMBE: data analysis in molecular biology and evolution. J. Heredity 92: 371-373. Yoder, A.D., and Yang, Z. 2000. Estimation of primate speciation dates using local molecular clocks. Mol. Biol. Evol. 17: 1081-1090. Zhou, X., Adamowicz, S.J., Jacobus, L.M., DeWalt, R.E., and Hebert, P.D.N. 2009. Towards a comprehensive barcode library for Arctic life - Ephemeroptera, Plecoptera, and Trichoptera of Churchill, Manitoba, Canada [online]. Front. Zool. 6: 30. doi:l0.1186/1742-9994-6-30. 122 Appendix 1.1. Alphabetic list of families, genera, and species of polychaetes from five regions throughout Canada: Atlantic (AT), Eastern Arctic Ocean (EAO), Hudson Bay (HB), Pacific (PC), and Western Arctic Ocean (WAO). Authors, synonymies, type localities, and distributional records are reported. Citations are indicated by the following abbreviations (* indicates technical reports): A&F1993 Aitken and Fournier 1993 (EAO) El 1960 Ellis 1960* (EAO) A&W1989a Atkinson and Wacasey 1989a* (EAO, HB) E11961 Ellis 1961 (EAO) A&W1989b Atkinson and Wacasey 1989** (EAO) F&P1984 Fournier and Pocklington 1984 (AT) A&W1989c Atkinson and Wacasey 1989c* (WAO) Fol991 Fournier 1991 (PC) Avl980 Averincev 1980 (WAO) Ga2008 Gagaev 2008 (PC) B&B1942 Berkeley and Berkeley 1942 (PC) Grl954 Grainger 1954 (EAO) B&B1943 Berkeley and Berkeley 1943 (HB) H&B1981 Hobson and Banse 1981 (PC) B&B1944 Berkeley and Berkeley 1944 (WAO) Hal948 Hartman 1948 (PC) B&B1948 Berkeley and Berkeley 1948 (PC) JU985 Jirkov 1985 (WAO) B&B1952 Berkeley and Berkeley 1952 (PC) Jol901 Johnson 1901 (PC) B&C1979 Bilyard and Carey 1979 (WAO) KJ1979 Knight-Jones et al. 1979 (PC) B&D1973 Blake and Dean 1973 (EAO) Lel981 Levenstein 1981 (WAO) B&H1974 Banse and Hobson 1974 (PC) Li 1977 Linkletterl977(AT) B&N1968 Banse and Nichols 1968 (PC) Mcl911 Mcintosh 1911 (AT) B&W2005 Bakken and Wilson 2005 (AT) Pel954 Pettibone 1954 (WAO) Be1924 Berkeley 1924 (PC) Pel961 Pettibone 1961 (AT) Be1927 Berkeley 1927 (PC) Pel 963 Pettibone 1963a (AT, PC) Be1967 Berkeley 1967 (PC) Pel993 Pettibone 1993 (AT, EAO, PC, WAO) Bel968 Berkeley 1968 (PC) P11990 Pleijell990(AT) Be1972 Berkeley 1972 (PC) Pol989 Pocklington 1989 (AT, EAO) B12005 Bluhm et al. 2005 (WAO) Q&S2005 Quijon and Snelgrove 2005 (AT) Bo2002 Boggemann 2002 (AT, PC) Shl971 Shihetal. 1971 (HB) Brl979 Bromley 1979 (AT) Stl853 Stimpson 1853 (AT) Brl998 Brunei etal. 1998 (AT) Stl985 Stewart etal. 1985 (EAO) C&K2008 Chapman and Kostylev 2008* (WAO) To2007 Tovar-Hernandez 2007 (AT, PC) Chi920 Chamberlin 1920 (PC, WAO) Trl937 Treadwell 1937 (AT, EAO) Co2008 Conlan et al. 2008 (WAO) Trl948 Treadwell 1948 (AT) Cul972 Curtis 1972 (EAO) Tt2004 Trott 2004 (AT) Cul979 Curtis 1979 (EAO) Vil998 Vittor and Associates 1998* (PC) Del987 Dean 1987 (AT) W&A1987 Wacasey and Atkinson 1987 (EAO) E11955 Ellis 1955 (EAO) WL1950 Wesenburg-Lund 1950 (EAO) Species Synonymized taxa Region Citation Type Locality Acrocirridae Acrocirrus columbianus PC H&B1981 Pacific Ocean, Banse, 1979 British Columbia Acrocirrus heterochaetus PC Hal 948 Pacific Ocean, Annenkova, 1934 Bering Sea Acrocirrus occipitalis PC H&B1981 Pacific Ocean, Banse, 1979 Oregon and Washington Chauvinelia arctica WAO Avl980 Arctic Ocean, Averincev, 1980 Canada Basin Macrochaeta leictyi Acrocirrus leidyi Verrill, AT Li 1977 Atlantic Ocean, (Verrill, 1882) 1882; Ledon leidyi (Verrill, Tt2004 Woods Hole 1882); Macrochaeta (Ledon) leidyi (Verrill, 1882) Macrochaeta pege Banse, PC H&B1981 Pacific Ocean, 1969 Washington Macrochaeta sexoculata Ledon sexoculata Webster AT Tt2004 Atlantic Ocean, (Webster & Benedict, & Benedict, 1887 Maine 1887) Alciopidae Plotohelmis capitata Rhynchonerella capitata PC Be1967 Pacific Ocean, (Greeff, 1876) Greef, 1876 Algeria Plotohelmis tenuis Corynocephalus tenuis PC Be 1967 Atlantic Ocean, (Apstein, 1900) Apstein, 1900 tropical region Rhynchonerella angelini Kronia angelini Kinberg, PC B&B1948 Pacific Ocean, (Kinberg, 1866) 1866; Callizona angelini Hal 948 China Sea (Kinberg, 1866) Bel967 Rhynchonerella gracilis PC Bel967 Atlantic Ocean, Costa, 1864 Gulf of Naples Vanadis longissima Rhynchonerella longissima PC Be 1967 Atlantic Ocean, (Levinsen, 1885) Levinsen, 1885; Vanadis northern region fasciata Apstein, 1890; Vanadis grandis Izuka, 1914; Vanadis pacifica Uschakov, 1957 Ampharetidae Amage anops (Johnson, Sabellides anops Johnson, PC B&B1942 Pacific Ocean, 1901) 1901 Hal 948 Washington B&B1952 Bel968 H&B1981 Amage auricula AT Pol989 Atlantic Ocean, Malmgren, 1866 Brl998 Sweden EAO WL1950 WAO B&C1979 Ampharete acutifrons Amphicteis acutifrons AT Trl948 Atlantic Ocean, (Grube, 1860) Grube, 1860 Lil977 Greenland Pol989 Brl998 Tt2004 124 Species Synonymized taxa Region Citation Type Locality EAO WL1950 W&A1987 A&W1989C Pol989 PC Be1972 H&B1981 Vil998 WAO Pel954 A&W1989C C&K2008 Ampharete baltica Eliason, AT F&P1984 Atlantic Ocean, 1955 Pol989 Baltic Sea Brl998 EAO Pol 989 Ampharete eupalea PC Hal 948 Arctic Ocean, Chamberlin, 1920 Alaska WAO Chi920 B&B1942 Ampharete flnmarch ica Amphicteis finmarchica M. AT Lil977 Atlantic Ocean, (M. Sars, 1866) Sars, 1866;l Ampharete F&P1984 Norway arctica Malmgren, 1866 Pol989 Brl998 Q&S2005 EAO WL1950 Grl954 B&D1973 Pol989 HB B&B1943 PC B&B1952 H&B1981 WAO A&W1989C C&K2008 Ampharete goesi AT Trl948 Arctic Ocean, Malmgren, 1866 Pol989 Spitsbergen Brl998 EAO WL1950 Cul979 A&W1989b Pol989 PC B&B1942 Hal 948 B&B1952 Bel968 WAO Pel954 Ampharete goesi PC H&B1981 Pacific Ocean, brazhnikovi Annenkova, Japan 1929 Ampharete grubei EAO Grl954 Atlantic Ocean, Malmgren, 1866 Greenland and Europe PC B&B1942 Hal 948 125 Species Synonymized taxa Region Citation Type Locality WAO B&B1942 A mpharete johansen i PC Chi920 Pacific Ocean, Chamberlin, 1920 Hal 948 Alaska A mpharete labrops PC H&B1981 Pacific Ocean, Hartman, 1961 California A mpharete reducta PC Chi920 Pacific Ocean, Chamberlin, 1920 Hal 948 Alaska Ampharete trilobata AT Tt2004 Atlantic Ocean, Webster & Benedict, 1887 Maine Ampharete vega (Wiren, Amphicteis vega Wiren, WAO Pel 954 Pacific Ocean, 1883) 1883 A&W1989C Bering Sea C&K2008 Amphicteis alaskensis PC Hal 948 Pacific Ocean, Moore, 1905 Alaska Amphicteis glabra Moore, PC Hal948 Pacific Ocean, 1905 Alaska Amphicteis gunneri (M. Amphitrite gunneri M. Sars, AT Brl979 Atlantic Ocean, Sars, 1835) 1835 Pol989 Norway Brl998 EAO WL1950 Cul972 Stl985 Pol989 WAO A&W1989C C&K2008 Amphicteis mucronata PC B&B1942 Pacific Ocean, Moore, 1923 B&B1952 California Bel968 H&B1981 Amphicteis ninonae Jirkov, WAO JU985 Arctic Ocean 1985 Amphicteis PC B&B1942 Pacific Ocean, scaphobranchiata Moore, B&B1952 Britsh Columbia 1906 Bel968 H&B1981 Amphicteis sundevalli EAO WL1950 Arctic Ocean, Malmgren, 1866 Grl954 Spitsbergen W&A1987 A&F1993 WAO C&K2008 Amphisamytha bioculata Samytha bioculata Moore, PC B&B1952 Pacific Ocean, (Moore, 1906) 1906 Bel968 British Columbia H&B1981 Anobothrus gracilis Ampharete gracilis AT Trl948 Atlantic Ocean, (Malmgren, 1866) Malmgren, 1866; Sosane Li 1977 Europe gracilis (Malmgren,, 1866) Pol989 Brl998 EAO Pol989 HB B&B1943 PC B&B1952 Bel968 H&B1981 126 Species Synonymized taxa Region Citation Type Locality WAO C&K2008 Asabellides lineata Pseudosabellides lineata EAO Grl954 Arctic Ocean, (Berkeley & Berkeley, Berkeley & Berkeley, 1943 Hudson Bay 1943) HB B&B1943 PC B&B1952 Bel968 H&B1981 WAO B&B1944 Asabellides sibirica Sabellides sibirica Wiren, AT Pol989 Arctic Ocean, (Wiren, 1883) 1883; Pseudosabellides Brl998 Siberia littoralis Berkeley & Berkeley, 1943 EAO Grl954 Cul979 W&A1987 A&W1989b Pol989 HB B&B1943 PC Hal 948 B&B1952 Bel968 H&B1981 WAO Pel954 C&K2008 Auchenoplax crinita AT Pol989 Atlantic Ocean, Ehlers, 1887 Florida Eclysippe sp. WAO B&C1979 Glyphanostomum Samytha pallescens Theel, AT Pol989 Arctic and North pallescens (Theel, 1879) 1879; Glyphanostonum Brl998 Pacific Oceans pallescens (Theel, 1879) EAO WL1950 Cul972 B&D1973 Cul979 SU985 Pol989 WAO B&B1944 A&W1989c C&K2008 Hobsonia florida Amphicteis gunneri floridus PC H&B1981 Atlantic Ocean, (Hartman, 1951) Hartman, 1951 Gulf of Mexico Lysippe labiata Malmgren, AT F&P1984 Arctic Ocean, 1866 Pol989 Spitsbergen Brl998 Q&S2005 EAO WL1950 Grl954 Cul972 B&D1973 Cul979 127 Species Synonymized taxa Region Citation Type Locality W&A1987 A&W1989a Pol989 PC B&B1942 Hal948 B&B1952 Be 1968 H&B1981 WAO B&C1979 A&W1989C C&K2008 Melinna albicincta Mackie Melinna albocinata (Mackie AT Brl998 Atlantic Ocean, & Pleijel, 1995 & Pleijel, 1995) northeastern region Melinna cristata (M. Sars, Sabellides cristata M. Sars, AT Trl948 Atlantic Ocean, 1851) 1851 Lil977 Norway Pol 989 Brl998 Tt2004 EAO WL1950 Grl954 Cul972 W&A1987 Pol989 HB B&B1943 A&W1989a PC B&B1942 Hal948 B&B1952 Bel968 H&B1981 WAO A&W1989C C&K2008 Melinna denticulata PC Hal948 Pacific Ocean, Moore, 1908 Alaska Melinna elisabethae AT F&P1984 Arctic Ocean Mcintosh, 1922 Pol989 EAO B&D1973 Pol989 PC H&B1981 Melinnampharete sp. WAO C&K2008 Melinnopsis annenkovae Melinnexis annenkovae EAO Cul972 Pacific Ocean, (Uschakov, 1952) Uschakov, 1952 Pol989 Kamtchatka Melinnopsis rostrata Melinnides rostrata EAO WL1950 Atlantic Ocean, (Wesenberg-Lund, 1950) Wesenberg-Lund, 1950; Greenland Melinnexis rostrata (Wesenberg-Lund, 1950) Neosabellides sp. AT Pol989 Sabellides borealis M. AT Trl948 Atlantic Ocean, Sars, 1856 F&P1984 Norway Pol989 Brl998 128 Species Synonymized taxa Region Citation Type Locality EAO WL1950 Cul972 Pol989 HB A&W1989a WAO A&W1989c C&K2008 Sabellides octocirrata (M. Sabella octocirrata M. Sars, AT Trl948 Atlantic Ocean, Sars, 1835) 1835 Li 1977 Norway Pol989 Brl998 Tt2004 EAO Cul972 W&A1987 A&W1989b Pol989 HB A&W1989a PC B&B1942 Hal948 WAO C&K2008 Sabellides oculata Asabellides oculata AT Lil977 Atlantic Ocean, Webster, 1879 (Webster, 1879) Brl979 New Jersey Pol989 Brl998 WAO A&W1989C C&K2008 Samytha californiensis PC H&B1981 Pacific Ocean, Hartman, 1969 California Samytha sexcirrata (M. Sabellides sexcirrata M. AT Trl948 Atlantic Ocean, Sars, 1856) Sars, 1856 Lil977 Norway Pol989 Brl998 EAO Pol989 PC B&B1942 Hal948 WAO Chi 920 B&B1944 Samythella elongata Samythella bathycola EAO WL1950 Atlantic Ocean, Verrill, 1873 Uschakov, 1950; Samythella S11985 New England neglecta Wollebaek, 1912 Pol989 Schistocomus hiltoni PC B&B1952 Pacific Ocean, Chamberlin, 1919 Bel968 California H&B1981 Sosanopsis hesslei Banse, PC H&B1981 Pacific Ocean, 1979 Washington Amphinomidae Amphinome rostrata Aphrodita rostrata Pallas, AT Pol989 Indian Ocean, (Pallas, 1766) 1766 Bay of Bengal Chloeia entypa PC B&H1974 Pacific Ocean, Chamberlin, 1919 Mexico Notopygos labiatus PC Bel 967 Pacific Ocean, Mcintosh, 1885 Be1972 Philippine 129 Species Synonymized taxa Region Citation Type Locality Islands Paramphinome Jeffreysii Hipponoe Jeffrey sii AT Pel 963 Atlantic Ocean, (Mcintosh, 1868) Mcintosh, 1868; Pol989 Shetland Islands Paramphinome pule he I la M. Sars, 1869 EAO Stl985 Pol989 Aphroditidae Aphrodita aculeata AT Trl948 Atlantic Ocean, Linnaeus, 1758 Tt2004 Europe EAO WL1950 Aphrodita japonica PC B&B1942 Pacific Ocean, Marenzeller, 1879 B&B48 Japan Hal948 Be1967 B&H1974 Aphrodita longipalpa PC B&B1948 Pacific Ocean, Essenberg, 1917 Bel967 California B&H1974 Aphrodita negligens PC B&B1942 Pacific Ocean, Moore, 1905 B&B48 Washington and B&H1974 Japan Aphrodita parva Moore, PC B&B1948 Pacific Ocean, 1905 Bel967 British Columbia B&H1974 Aphroditella hastata Aphrodita hastata Moore, AT Pel 963 Atlantic Ocean, (Moore, 1905) 1905 Li 1977 Massachusetts F&P1984 Pol989 Brl998 Tt2004 Laetmonice filicornis Laetmonice armata (Verrill, AT Trl948 Atlantic Ocean, Kinberg, 1855 1879); Laetmonice assimilis Pel963 Sweden Mcintosh, 1885; Laetmonice LH977 producta assimilis Pol989 Mcintosh, 1885 Brl998 Tt2004 EAO WL1950 B&D1973 Stl985 Pol989 Laetmonice japonica PC Be1967 Pacific Ocean, Mcintosh, 1885 Be1972 Japan Laetmonice pellucida PC Bel 967 Pacific Ocean, Moore, 1903 B&H1974 Bering Sea Apistobranchidae Apistobranchus (Acmira) Apistobranchus ornatus PC H&B1981 Pacific Ocean, ornatus Hartm an, 1965 Hartman, 1965 California WAO C&K2008 Apistobranchus tullbergi Aricia tullbergi Theel, 1879 AT Pel 963 Arctic Ocean (Theel, 1879) Lil977 130 Species Synonymized taxa Region Citation Type Locality F&P1984 Pol989 Tt2004 EAO Oil 972 Cul979 WAO A&W1989C C&K2008 Apistobranchus typicus Ethocles typicus Webster & AT Trl948 Atlantic Ocean, (Webster & Benedict, Benedict, 1887 Pol989 New England 1887) Brl998 EAO Pol989 Arenicolidae Abarenicola claparedi Arenicola claparedi PC Jol901 Atlantic Ocean, (Levinsen, 1883) Levinsen, 1883 Mediterranean Sea Abarenicola claparedi Abarenicola vagabunda PC Bel968 Pacific Ocean, oceanica (Healy & Wells, oceanica Healy & Wells, H&B1981 Alaska 1959) 1959 Abarenicola claparedi Abarenicola vagabunda PC Bel968 Pacific Ocean, vagabunda Healy & Wells, Healy & Wells, 1959 H&B1981 Washington 1959 Abarenicola pacifica Healy PC Bel968 Pacific Ocean, & Wells, 1959 H&B1981 Washington A barenicola pusilla A renicola pusilla PC B&B1942 Pacific Ocean, (Quatrefages, 1865) Quatrefages, 1865 Hal 948 Chile B&B1952 Arenicola cristata AT Trl948 Atlantic Ocean, Stimpson, 1856 South Carolina Arenicola marina Lumbricus marinus AT Trl948 Atlantic Ocean, (Linnaeus, 1758) Linnaeus, 1758 Lil977 Sweden Brl979 Pol989 Brl998 Tt2004 EAO WL1950 Grl954 E11961 W&A1987 A&W1989b Pol989 HB B&B1943 PC H&B1981 WAO Chi 920 Arenicola marina glacialis Arenicola glacialis PC Hal948 Arctic Ocean, Murdoch, 1885 Murdoch, 1885 Alaska WAO Pel954 Branchiomaldane AT Pol989 Atlantic Ocean, labradorensis Fournier & Canada Barrie, 1987 131 Species Synonymized taxa Region Citation Type Locality Branchiomaldane vincenti PC B&B1952 Atlantic Ocean, Langerhans, 1881 Bel968 Canary Islands H&B1981 Capitellidae Barantolla americana PC H&B1981 Pacific Ocean, Hartman, 1963 California WAO B&C1979 Co2008 Capitella capitata Lumbricus capitatus AT Li 1977 Atlantic Ocean, (Fabricius, 1780) Fabricius, 1780 Brl979 Greenland F&P1984 Pol989 Brl998 Tt2004 EAO WL1950 Grl954 E11961 Oil 979 W&A1987 A&W 1989b Pol989 HB B&B1943 PC Hal 948 B&B1952 Bel968 H&B1981 WAO Chi920 Pel 954 B&C1979 A&W 1989c C&K2008 Capitella dizonata PC H&B1981 Pacific Ocean, Johnson, 1901 Washington Capitellides giardi Mesnil, AT Pol989 Atlantic Ocean, 1897 France EAO Pol989 Decamastus gracilis PC H&B1981 Pacific Ocean, Hartman, 1963 California Heteromastus fdiformis Capitella filiformis AT Li 1977 Atlantic Ocean, (Claparede, 1864) Claparede, 1864 Brl979 Mediterranean Pol989 Sea Brl998 Tt2004 PC Hal948 Bel968 H&B1981 Vil998 WAO B&C1979 C&K2008 Heteromastus filobranchus PC B&B1952 Pacific Ocean, Berkeley & Berkeley, 1932 Bel968 British Columbia H&B1981 132 Species Synonymized taxa Region Citation Type Locality Heteromastus sp. EAO Cul979 Leiochrides pallidior Notomastus pallidior PC B&B1942 Pacific Ocean, (Chamberlin, 1918) Chamberlin, 1918 California Mediomastus ambiseta Capitita ambiseta Hartman, AT Lil977 Pacific Ocean, (Hartman, 1947) 1947 F&P1984 California Pol989 Brl998 Q&S2005 PC H&B1981 Mediomastus californiensis PC Vil998 Pacific Ocean, Hartman, 1944 California Mediomastus capensis PC H&B1981 Atlantic / Indian Day, 1961 Ocean, South Africa Mediomastus sp. WAO Co2008 Notomastus (Clistomastus) Notomastus lineatus PC B&B1952 Atlantic Ocean, lineatus Claparede, 1869 Claparede, 1869 Bel968 Mediterranean H&B1981 Sea Notomastus (Clistomastus) Notomastus tenuis Moore, PC B&B1942 Pacific Ocean, tenuis Moore, 1909 1909 B&B1952 California Be 1968 H&B1981 Notomastus giganteus PC Hal948 Pacific Ocean, Moore, 1906 B&B1952 Alaska and Bel968 British Columbia H&B1981 Notomastus latericeus M. AT LH977 Atlantic Ocean, Sars, 1851 Brl979 Norway F&P1984 Pol989 Brl998 Tt2004 EAO WL1950 Cul972 Stl985 Pol989 A&F1993 HB A&W1989a WAO A&W1989c C&K2008 Notomastus variegatus PC B&B1952 Pacific Ocean, Berkeley & Berkeley, 1950 Be 1968 British Columbia H&B1981 Chaetopteridae Chaetopterus n. sp. Brunei, AT Brl998 Atlantic Ocean, 1998 St. Lawrence Estuary Chaetopterus variopedatus Tricoelia variopedata PC B&B1942 Atlantic Ocean, (Renier, 1804) Renier, 1804 Hal 948 Mediterranean H&B1981 Sea 133 Species Synonymized taxa Region Citation Type Locality Mesochaetopterus taylori PC B&B1942 Pacific Ocean, Potts, 1914 B&B1952 British Columbia Bel968 H&B1981 Phyllochaetopterus PC Bel968 Pacific Ocean, claparedii Mcintosh, 1885 H&B1981 Japan Phyllochaetopterus Phyllochaetopterus pacifica PC B&B1942 Pacific Ocean, prolifica Potts, 1914 MacGinitie & MacGinitie, B&B1952 Washington 1949 Bel968 H&B1981 Phyllochaetopterus sp. EAO B&D1973 Spiochaetopterus costarum Telepsavus costarum PC B&B1942 Atlantic Ocean, (Claparede, 1869) Claparede, 1869 B&B1952 Italy Bel968 H&B1981 Vil998 Spiochaetopterus costarum Spiochaetopterus oculatus AT Brl998 Atlantic Ocean, oculatus Webster, 1879 Webster, 1879 Virginia Spiochaetopterus typicus AT Trl948 Atlantic Ocean, M. Sars, 1856 Pol989 Norway Brl998 EAO WL1950 Cul972 Cul979 Pol989 WAO B&C1979 A&W1989C C&K2008 Chrysopetalidae Chrysopetalum occidentale PC Vil998 Pacific Ocean, Johnson, 1897 California Dysponetus pygmaeus AT Li 1977 Arctic Ocean, Levinsen, 1879 Pol989 Greenland Brl998 Tt2004 EAO WL1950 Pol989 WAO C&K2008 Paleanotus bellis (Johnson, Heteropale bellis Johnson, PC B&H1974 Pacific Ocean, 1897) 1897 California Paleanotus chrysolepis PC B&B1948 Atlantic Ocean, Schmarda, 1861 Hal948 South Africa Be1967 Cirratulidae Aphelochaeta flliformis Cirratulus flliformis AT Brl998 Atlantic Ocean, (Keferstein, 1862) Keferstein, 1862 Europe Aphelochaeta monilaris Tharyx monilaris Hartman, PC Vil998 Pacific Ocean, (Hartman, 1960) 1960 California Aphelochaeta multifilis Tharyx multifilis Moore, PC B&B1942 Pacific Ocean, (Moore, 1909) 1909 B&B1952 California Bel968 134 Species Synonymized taxa Region Citation Type Locality H&B1981 WAO C&K2008 Aphelochaeta parva Thatyx multifilis parvus PC B&B1952 Pacific Ocean, (Berkeley, 1929) Berkeley, 1929; Tharyx Bel968 British Columbia parvus Berkeley, 1929 H&B1981 VU998 Caulleriella alata Chaetozone alata Southern, PC B&B1942 Atlantic Ocean, (Southern, 1914) 1914 B&B1952 Irish seas Bel968 Caulleriella fragilis Cirratulus fragilis Leidy, AT Lil977 Atlantic Ocean, (Leidy, 1855) 1855 Brl979 Rhode Island Caulleriella hamata Tharyx hamatus Hartman, PC Hal948 Pacific Ocean, (Hartman, 1948) 1948 Alaska Caulleriella sp. WAO C&K2008 Chaetozone acuta Banse & PC H&B1981 Pacific Ocean, Hobson, 1968 Washington Chaetozone commonalis PC Vil998 Pacific Ocean, Blake, 1996 California Chaetozone gracilis Tharyx gracilis Moore, 1923 PC B&B1952 Pacific Ocean, (Moore, 1923) Bel968 California Chaetozone setosa AT Trl948 Atlantic Ocean, Malmgren, 1867 LH977 Sweden Brl979 Pol989 Brl998 Tt2004 EAO WL1950 Grl954 Cul972 B&D1973 Cul979 Stl985 W&A1987 A&W1989b Pol989 HB A&W1989a PC B&B1942 B&B1952 Bel968 H&B1981 WAO Pel 954 B&C1979 A&W1989C B12005 C&K2008 Chaetozone setosa AT Mcl911 Atlantic Ocean, canadensis Mcintosh, 1911 Trl948 Canada Chaetozone spinosa WAO C&K2008 Pacific Ocean, Moore, 1903 Japan Cirratulus cingulatus PC Jol901 Pacific Ocean, Johnson, 1901 Puget Sound 135 Species Synonymized taxa Region Citation Type Locality Cirratulus cirratus (O.F. Lumbricus cirratus O.F. AT Trl948 Atlantic Ocean, Mttller, 1776) Milller, 1776 U1977 Europe Brl979 F&P1984 Pol989 Brl998 Tt2004 EAO WL1950 Grl954 B&D1973 Cul979 Pol989 HB B&B1943 PC B&B1942 Hal948 B&B1952 Bel968 H&B1981 WAO Chi920 Pel 954 A&W1989C C&K2008 Cirratulus gayheadius Chaetozone gayheadia AT Pol989 Atlantic Ocean, (Hartman, 1965) Hartman, 1965 New England Cirratulus robustus PC B&B1942 Pacific Ocean, Johnson, 1901 Hal 948 Puget Sound Cirratulus spectabilis Promenia spectabilis PC B&B1952 Pacific Ocean, (Kinberg, 1866) Kinberg, 1866 Bel968 British Columbia H&B1981 Vil998 Cirriformia grandis Cirratulus grandis Verrill, AT Li 1977 Atlantic Ocean, (Verrill, 1873) 1873 New England Dodecaceria concharum AT Li 1977 Atlantic Ocean, 0rsted, 1843 Br 1979 North Sea Brl998 Tt2004 PC B&B1952 Bel968 H&B1981 Dodecaceria fewkesi PC B&B1942 Pacific Ocean, Berkeley & Berkeley, 1954 Bel 968 California H&B1981 Dodecaceria fimbriata Heterocirrus fimbriatus AT Pol989 Atlantic Ocean, (Verrill, 1879) Verrill, 1879 Bay of Fundy Monticellina Cirratulus dorsobranchialis AT Pol989 Atlantic Ocean, dorsobranchialis Kirkegaard, 1959; Tharyx Angola (Kirkegaard, 1959) annulosus Hartman, 1965 Monticellina secunda Tharyx secundus Banse & PC H&B1981 Pacific Ocean, (Banse & Hobson, 1968) Hobson, 1968 Washington Monticellina serratisetis Tharyx serratisetis Banse & PC H&B1981 Pacific Ocean, (Banse & Hobson, 1968) Hobson, 1968 Washington Tharyx acutus Webster & AT Lil977 Atlantic Ocean, Benedict, 1887 Brl979 Maine Brl998 136 Species Synonymized taxa Region Citation Type Locality Tt2004 EAO A&W1989b Pol989 HB B&B1943 A&W1989a WAO B&C1979 A&W1989C C&K2008 Tharyx kirkegaardi Blake, WAO Co2008 Atlantic Ocean, 1991 North Carolina Tharyx marioni (Saint- Heterocirrus marioni Saint- AT Mcl911 Atlantic Ocean, Joseph, 1894) Joseph, 1894; Tharyx Trl948 France marioni (Saint-Joseph, Brl998 1894); Chaetozone whiteavesi Mcintosh, 1911 WAO Co2008 Tharyx similis Webster & AT Tt2004 Atlantic Ocean, Benedict, 1887 Maine Cossuridae Cossura delta Reish, 1958 Cossura soyeri Laubier, PC H&B1981 Atlantic Ocean, 1964 Gulf of Mexico WAO C&K2008 Cossura longocirrata AT Lil977 Atlantic Ocean, Webster & Benedict, 1887 F&P1984 Maine Pol989 Brl998 Tt2004 EAO Cul972 Cul979 Pol989 HB A&W1989a WAO B&C1979 A&W1989C C&K2008 Co2008 Cossura pygodactylata PC Vil998 Pacific Ocean, Jones, 1956 California Ctenodrilidae Ctenodrilus serratus Parthenope serrata PC B&B1952 Atlantic Ocean, (Schmidt, 1857) Schmidt, 1857 Be1968 Mediterranean H&B1981 Sea Zeppelina monostyla Ctenodrilus monostylos EAO Cul972 Germany, in an (Zeppelin, 1883) Zeppelin, 1883; Zeppulinia aquarium monostyla (Zeppelin, 1883) Dinophilidae Dinophilus gyrocilatus AT Brl998 Atlantic Ocean, Schmidt, 1857 Mediterranean Sea 137 Species Synonymized taxa Region Citation Type Locality Dinophilus kincaidi Jones PC H&B1981 Pacific Ocean, & Ferguson, 1957 Washington Trilobodrilus nipponicus PC H&B1981 Pacific Ocean, Uchida & Okuda, 1943 Japan Diurodrilidae Diurodrilus ankeli Ax, PC H&B1981 Pacific Ocean, 1967 Washington Dorvilleidae Dorvillea moniloceras Stauronereis moniloceras PC Bel927 Pacific Ocean, (Moore, 1909) Moore, 1909 B&B1942 California B&B1948 Bel 967 B&H1974 Dorvillea PC Bel927 Pacific Ocean, pseudorubrovittata B&B1948 British Columbia Berkeley, 1927 Hal 948 Be1967 B&H1974 WAO B12005 Enonella bicarinata AT Trl948 Atlantic Ocean, Stimpson, 1854 New Brunswick Meiodorvillea minuta Protodorvillea minuta AT Brl998 Atlantic Ocean, (Hartman, 1965) Hartman, 1965 New England Ophryotrocha bacci AT Pol989 Atlantic Ocean, Parenti, 1961 France Ophryotrocha geryonicola Eteonopsis geryonicola AT Brl998 Atlantic Ocean, (Esmark, 1878) Esmark, 1878 Norway Ophryotrocha gracilis AT Pol989 Atlantic Ocean, Huth, 1933 North Sea Ophryotrocha littoralis Paractius littoralis HB A&W 1989a Arctic Ocean (Levinsen, 1879) Levinsen, 1879 Ophryotrocha puerilis HB B&B1943 Atlantic Ocean, Claparede & Metschnikow, Mediterranean 1869 Sea Ophryotrocha vivipara PC B&H1974 Pacific Ocean, Banse, 1963 Washington Parougia caeca (Webster Staurocephalus caecus AT Pel 963 Atlantic Ocean, & Benedict, 1884) Webster & Benedict, 1884; Brl979 Massachusetts Dorvillea caeca (Webster & Pol989 Benedict, 1884); Brl998 Schistomeringos caeca Tt2004 (Webster & Benedict, 1874); Stauronereis caecus (Webster & Benedict, 1884) EAO Cul972 Stl985 A&W1989b Pol989 PC B&H1974 WAO C&K2008 138 Species Synonymized taxa Region Citation Type Locality Parougia eliasoni (Oug, Schistomeringos eliasoni AT Pol989 Atlantic Ocean, 1978) Oug, 1978 Brl998 Denmark Protodorvillea gaspeensis AT Pel961 Atlantic Ocean, Pettibone, 1961 Pol989 Canada Brl998 Protodorvillea gracilis Stauronereis gracilis PC B&H1974 Pacific Ocean, (Hartman, 1938) Hartman, 1938 California WAO C&K2008 Protodorvillea kefersteini Staurocephalus kefersteini AT Li 1977 Atlantic Ocean, (Mcintosh, 1869) Mcintosh, 1869; Dorvillea Brl979 Scotland kefersteini (Mcintosh, 1869) Pol989 PC Bel967 Protodorvillea recuperata PC B&N1968 Pacific Ocean, Banse & Nichols, 1968 Puget Sound Schistomeringos annulata Stauronereis annulatus PC Bel927 Pacific Ocean, (Moore, 1906) Moore, 1906; Dorvillea B&B1948 Washington annulata (Moore, 1906) Be 1967 B&H1974 WAO C&K2008 Schistomeringos japonica Staurocephalus japon ica PC B&H1974 Pacific Ocean, (Annenkova, 1937) Annenkova, 1937; Dorvillea Sea of Japan japonica (Annenkova, 1937); Stauronereis japonica (Annenkova, 1937) Schistomeringos Stauronereis longicornis PC B&B1948 Pacific Ocean, longicornis (Ehlers, 1901) Ehlers, 1901; Dorvillea Chile rudolphi Berkeley & Berkeley, 1948 Schistomeringos neglecta Staurocephalus neglectus PC B&B1948 Atlantic Ocean, (Fauvel, 1923) Fauvel, 1923; Dorvillea Be1967 France neglecta (Fauvel, 1923) Schistomeringos rudolphi Nereis rudolphi delle EAO Pol989 Atlantic Ocean, (delle Chiaje, 1828) Chiaje, 1828; Dorvillea Mediterranean rudolphi (delle Chiaje, Sea 1828); Dorvillea rudolphii (delle Chiaje, 1828); Staurocephalus ciliatus Ehlers 1868 PC Bel927 B&B1948 Be 1967 B&H1974 Vil998 Schistomeringos rudolphi Dorvillea rudolphi AT Pol989 Atlantic Ocean, anoculata (Hartman, 1965) anoculata Hartman, 1965 New England Eunicidae Eunice aphroditois (Pallas, Nereis aphroditois Pallas, PC Bel 967 Indian Ocean, Sri 1788) 1788 B&H1974 Lanka Eunice biannulata Moore, Leodice biannulata (Moore, PC Bel927 Pacific Ocean, 1904 1904) B&B1942 California B&B1948 139 Species Synonymized taxa Region Citation Type Locality Bel967 Eunice harassii Audouin & Leodice harassii (Audouin PC Bel927 Atlantic Ocean, Milne Edwards, 1833 & Milne Edwards, 1833) France Eunice kobiensis PC B&B1942 Pacific Ocean, Mcintosh, 1885 B&B1948 Japan Bel 967 Eunice norvegica Nereis norvegica Linnaeus, AT Trl948 Atlantic Ocean, (Linnaeus, 1767) 1767; Leodice norvegica Norway (Linnaeus, 1767) Eunice oerstedii Leodice oerstedi Stimpson, AT Trl948 Atlantic Ocean, (Stimpson, 1854) 1854 New Brunswick Eunice pennata (O.F. Nereis pennata O.F. Miiller, AT Pel 963 Atlantic Ocean, Miiller, 1776) 1776 Li 1977 Europe Pol989 Brl998 Tt2004 EAO WL1950 Stl985 Pol989 Eunice valens Leodice valens Chamberlin, PC B&H1974 Pacific Ocean, (Chamberlin, 1919) 1919 California Eunice vivida (Stimpson, Leodice vivida Stimpson, AT Trl948 Atlantic Ocean, 1854) 1854 New Brunswick Eunice websteri Fauchald, PC Hal 948 Atlantic Ocean, 1969 Be1972 Bermuda Euphrosinidae Euphrosine arctia Johnson, Euphrosyne arctia Johnson, PC B&B1948 Pacific Ocean, 1897 1897 Hal948 California Be 1967 B&H1974 Euphrosine armadillo M. Euphrosyne armadillo M. AT Pel963 Atlantic Ocean, Sars, 1851 Sars, 1851 Norway Euphrosine bicirrata Euphrosyne bicirrata PC B&B1948 Pacific Ocean, Moore, 1905 Moore, 1905 Hal 948 Alaska and Be 1967 British Columbia B&H1974 Euphrosine borealis Euphrosyne longisetis AT Trl948 Arctic Ocean, 0rsted, 1843 Treadwell, 1939 Pel 963 Greenland LU977 Pol 989 Brl998 Tt2004 EAO Trl937 WL1950 B&D1973 Stl985 Pol989 HB A&W1989a Euphrosine cirrata M. Euphrosyne cirrata M. Sars, AT Pel963 Atlantic Ocean, Sars, 1862 1862 Pol989 Norway Brl998 140 Species Synonymized taxa Region Citation Type Locality EAO WL1950 Pol989 Euphrosine heterobranchia PC Hal948 Pacific Ocean, Johnson, 1901 B&H1974 Washington Euphrosine hortensis Euphrosyne hortensis PC B&B1942 Pacific Ocean, Moore, 1905 Moore, 1905 B&B1948 Alaska Hal948 Bel967 B&H1974 Euphrosine Euphrosyne multibranchiata PC Hal 948 Pacific Ocean, multibranchiata Essenberg, Essenberg, 1917 Be1967 Alaska 1917 Flabelligeridae Brada inhabilis (Rathke, Siphonostoma inhabile AT Trl948 Atlantic Ocean, 1843) Rathke, ] 843; Brada Li 1977 Norway granosa Stimpson, 1854 Pol989 Brl998 Tt2004 EAO Trl937 WL1950 Grl954 Pol 989 PC Hal 948 WAO Pel954 Brada sachalina PC H&B1981 Pacific Ocean, Annenkova, 1922 Okhotsk Sea Brada sublaevis Stimpson, AT Trl948 Atlantic Ocean, 1854 Tt2004 New Brunswick Brada villosa (Rathke, Siphonostoma villosum AT Trl948 Atlantic Ocean, 1843) Rathke, 1843; Brada setosa Li 1977 Norway Verrill, 1873; Bradapilosa F&P1984 Moore, 1906 Pol989 Brl998 Tt2004 EAO WL1950 Cul972 B&D1973 Cul979 Stl985 Pol989 HB B&B1943 PC Hal 948 B&B1952 Bel968 H&B1981 Vil998 WAO Chi920 Pel954 A&W1989C C&K2008 Diplocirrus glaucus Trophonia glauca WAO C&K2008 Atlantic Ocean, 141 Species Synonymized taxa Region Citation Type Locality (Malmgren, 1867) Malmgren, 1867 Sweden Diplocirrus hirsutus Trophonia hirsuta Hansen, AT Li 1977 Atlantic Ocean, (Hansen, 1878) 1878 Pol 989 North Sea Brl998 EAO WL1950 Pol989 WAO A&W1989C C&K2008 Diplocirrus longisetosus Stylarioides longisetosus AT Brl998 Pacific Ocean, (Marenzeller, 1890) Marenzeller, 1890 Bering Sea EAO Pol989 WAO A&W1989c C&K2008 Flabelligera afflnis M. AT Trl948 Atlantic Ocean, Sars, 1829 Lil977 Norway Brl979 Pol989 Brl998 Tt2004 EAO WL1950 Grl954 Cul979 W&A1987 A&W1989b Pol 989 HB B&B1943 PC H&B1981 WAO Chi920 Pel 954 A&W1989C C&K2008 Flabelligera essenbergae PC Bel968 Pacific Ocean, tenebricosa Berkeley, 1966 British Columbia Flabelligera grubei Siphonostoma grubei AT Lil977 Atlantic Ocean, (Webster & Benedict, Webster & Benedict, 1887 Tt2004 Maine 1887) Flabelligera infundibular is EAO WL1950 Pacific Ocean, Johnson, 1901 Washington PC Hal 948 B&B1952 Bel968 Flabelligera mastigophora WAO C&K2008 Arctic Ocean, Annenkova, 1952 Russia Pherusa affinis (Leidy, Siphonostoma affine Leidy, AT Li 1977 Atlantic Ocean, 1855) 1855 Pol989 New Jersey Brl998 Tt2004 Pherusa arenosa (Webster, Trophonia arenosa Webster, PC B&B1952 Atlantic Ocean, 1879) 1879; Stylarioides arenosa Bel968 Virginia (Webster, 1879) Pherusa aspera (Stimpson, Siphonostoma asperum AT Trl948 Atlantic Ocean, 1854) Stimpson, 1854; Li 1977 New Brunswick 142 Species Synonymized taxa Region Citation Type Locality Stylarioides aspera Tt2004 (Stimpson, 1854) Pherusa eruca (Claparede, Trophonia eruca Claparede, PC H&B1981 Atlantic Ocean, 1870) 1870; Piromis eruca Mediterranean (Claparede, 1870) Sea Pherusa flabellata (M. Trophonia flabellata M. AT Brl998 Atlantic Ocean, Sars in G.O. Sars, 1872) Sars in G.O. Sars, 1872 Norway Pherusa negligens Stylarioides negligens PC B&B1952 Pacific Ocean, (Berkeley & Berkeley, Berkeley & Berkeley, 1950 Bel968 British Columbia 1950) H&B1981 Pherusa papillata Trophonia papillata PC B&B1942 Pacific Ocean, (Johnson, 1901) Johnson, 1901; Stylarioides Hal948 Washington papillata (Johnson, 1901) B&B1952 Bel968 Pherusaplumosa (O.F. Amphitrite plumosa O.F. AT Trl948 Atlantic Ocean, MUller, 1776) Miiller, 1776; Stylarioides Li 1977 Norway plumosa (O.F. Miiller, 1776) Pol989 Brl998 Tt2004 EAO WL1950 Grl954 B&D1973 W&A1987 Pol989 HB A&W1989a PC B&B1942 Hal948 B&B1952 Bel968 H&B1981 WAO A&W1989C C&K2008 Piromis arenosus Kinberg, PC B&B1942 Indian Ocean, 1867 Africa Zorus sarsi Webster & AT Tt2004 Atlantic Ocean, Benedict, 1887 Maine Glyceridae Glycera alba (O.F. Miiller, Nereis alba O.F. Miiller, AT Pol989 Atlantic Ocean, 1776) 1776 Norway Glycera americana Leidy, Glycera rugosa Johnson, PC Be1927 Atlantic Ocean, 1855 1901 B&B1942 Rhode Island B&B1948 Bel967 B&H1974 AT Brl998 Glycera branchiopoda PC Bo2002 Pacific Ocean, Moore, 1911 Mexico and California Glycera capitata Orsted, Hemipodia canadensis AT Trl948 Atlantic Ocean, 1842 Treadwell, 1937; Glycera Pel 963 Greenland mimica Hartman, 1965; Li 1977 Glycera nana Johnson, 1901 Pol989 143 Species Synonymized taxa Region Citation Type Locality Brl998 Tt2004 Q&S2005 EAO WL1950 Grl954 Cul972 B&D1973 Stl985 W&A1987 Pol989 PC Be1927 B&B1942 B&B1948 Hal 948 Bel967 B&H1974 Vil998 WAO Pel 954 Glycera dibranchiata AT Trl948 Atlanatic Ocean, Ehlers, 1868 Pel963 Massachusetts Lil977 Bay Brl979 Pol989 Brl998 Tt2004 Glycera fallax Glycera gigantea PC B&B1942 Atlantic Ocean, Quatrefages, 1850 Quatrefages, 1866 B&B1948 France Be 1967 B&H1974 Glycera lapidum EAO Trl937 Atlantic Ocean, Quatrefages, 1866 Mediterranean Sea Glycera macrobranchia Glycera alba PC Bo2002 Pacific Ocean, Moore, 1911 macrobranchia Moore, California 1911 Glycera oxycephala PC Bo2002 Atlantic Ocean, Ehlers, 1887 Carribbean Sea Glycera paciflca Kinberg, PC Bo2002 Pacific Ocean, 1865 Society Islands Glycera pseudorobusta AT Bo2002 Atlantic Ocean, BSggemann & Fiege, 2001 North Carolina Glycera robusta Ehlers, AT Pel 963 Pacific Ocean, 1868 Lil977 California Pol989 Brl998 PC B&B1942 B&B1948 Bel967 B&H1974 Glycera siphonostoma Lumbricus siphonostoma AT Trl948 Atlantic Ocean, (delle Chiaje, 1825) delle Chiaje, 1825; Glycera Mediterranean siphonostomum (delle Sea Chiaje, 1825) 144 Species Synonymized taxa Region Citation Type Locality PC B&H1974 Glycera tesselata Grube, PC Bel927 Atlantic Ocean, 1863 B&B1948 Mediterranean Be 1967 Sea B&H1974 Glycera tridactyla Glycera convoluta PC B&B1948 Atlantic Ocean, Schmarda, 1861 Keferstein, 1862 Bel967 France B&H1974 Hemipodus simplex Glycera simplex Grube, PC Be 1927 Pacific Ocean, (Grube, 1857) 1857; Hemipodus borealis B&B1942 Chile and Peru Johnson, 1901 B&B1948 Hal948 Bel967 B&H1974 Goniadidae Bathyglycinde lindbergi Glycinde lindbergi PC Bel967 Pacific Ocean, (Uschakov, 1955) Uschakov, 1955 Sea of Okhotsk Glycinde armigera Moore, PC Be1927 Pacific Ocean, 1911 B&B1942 California B&B1948 B&H1974 Vil998 Glycinde picta Berkeley, Glycinde paucignatha PC Bel 927 Pacific Ocean, 1927 Hartmann-Schroder, 1959 B&B1942 British Columbia B&B1948 Hal 948 Bel967 B&H1974 VU998 Glycinde polygnatha PC B&H1974 Pacific Ocean, Hartman, 1950 California Glycinde wireni PC B&B1948 Pacific Ocean, Arwidsson, 1899 Hal 948 Bering Sea Be 1967 WAO Pel954 B12005 Goniada annulata Moore, PC B&B1948 Pacific Ocean, 1905 Hal 948 Alaska and Be 1967 British Columbia B&H1974 Goniada brunnea AT Pol989 Pacific Ocean, Treadwell, 1906 Hawaii PC Be1927 B&B1942 B&B1948 Bel967 B&H1974 Goniada maculata 0rsted, AT Trl948 Atlantic Ocean, 1843 Pel963 Denmark Li 1977 Pol989 Brl998 Tt2004 145 Species Synonymized taxa Region Citation Type Locality Q&S2005 EAO WL1950 PC B&B1942 Hal 948 Goniada norvegica 0rsted, AT Trl948 Atlantic Ocean, 1845 Li 1977 Norway Pol989 Brl998 EAO Pol989 Goniadella gracilis Eone gracilis Verrill, 1873 AT Pol989 Atlantic Ocean, (Verrill, 1873) Brl998 Massachusetts Ophioglycera gigantea AT Pel 963 Atlantic Ocean, Verrill, 1885 Lil977 Rhode Island Brl979 Pol989 Hesionidae Gyptis bruneli (Pettibone, Parahesione bruneli AT Pel961 Atlantic Ocean, 1961) Pettibone, 1961; Paragyptis Pol989 Gulf of St. margaretae Pocklington, Brl998 Lawrence 1984 Gyptis vittata Webster & Oxydromus vittata Webster AT Lil977 Atlantic Ocean, Benedict, 1887 & Benedict, 1887 Tt2004 Maine Heteropodarke PC Vil998 Pacific Ocean, heteromorpha Hartmann- Peru Schroder, 1962 Microphthalmus aberrans Podarke aberrans Webster AT Lil977 Atlantic Ocean, (Webster & Benedict, & Benedict, 1887 Brl979 New England 1887) Pol989 Brl998 Tt2004 EAO Pol989 Microphthalmus coustalini PC Fol991 Pacific Ocean, Fournier, 1991 British Columbia Microphthalmus hystrix PC Fol991 Pacific Ocean, Fournier, 1991 Washington Microphthalmus AT Tt2004 Atlantic Ocean, pettiboneae Riser, 2000 New England Microphthalmus sczelkowii AT Brl979 Atlantic Ocean, Mecznikow, 1865 Pol989 North Sea Micropodarke dubia Kefersteinia dubia Hessle, PC B&H1974 Pacific Ocean, (Hessle, 1925) 1925 Vil998 Japan Nereimyra aphroditoides Nereis aphroditioides EAO WL1950 Arctic Ocean, (Fabrcius, 1780) Fabricius, 1780; Castalia Grl954 Greenland aphroditioides (Fabricius, A&W1989b 1780); Psammate aphroditoides (Fabricius, 1780) HB B&B1943 PC Chi920 Hal 948 146 Species Synonymized taxa Region Citation Type Locality WAO Chi920 Pel954 A&W1989C B12005 C&K2008 Nereimyra multipapillata Castalia multipapillata PC Hal 948 Arctic Ocean, (Theel, 1879) Theel, 1879; Psammate Novaya Zemlya multipapillata (Theel, 1879) Nereimyra punctata (O.F. Nereis punctata O.F. AT Pel963 Atlantic Ocean, Miiller, 1776) Miiller, 1776 F&P1984 Norway Pol989 Brl998 EAO Cul972 Cul979 Pol989 Nereimyra woodsholea Neopodarke woodsholea AT Pol989 Atlantic Ocean, (Hartman, 1965) Hartman, 1965 New England Ophiodromus pugettensis Podarke pugettensis PC B&B1948 Pacific Ocean, (Johnson, 1901) Johnson, 1901 Be 1967 Puget Sound B&H1974 Vil998 Podarkeopsis brevipalpus Oxydromus brevipalpa PC B&H1974 Pacific Ocean, El (Hartmann-Schroder, Hartmann-Schroder, 1959; Vil998 Salvador 1959) Gyptis brevipalpa (Hartmann-Schroder, 1959) Podarkeopsis glabrus Oxydromus arenicolus PC Vil998 Pacific Ocean, (Hartman, 1961) glabrus Hartman, 1961 California Psamathe fusca Johnston, Psamathe cirrhata PC B&B1942 Atlantic Ocean, 1836 Keferstein, 1862; B&B1948 France Kefersteinia cirrata Bel967 (Keferstein, 1862) B&H1974 Histriobdellidae Histriobdella homari AT Brl998 Atlantic Ocean, Beneden, 1858 North Sea Iospilidae Phalocrophorus pictus PC Bel967 Atlantic Ocean, Greeff, 1879 Canary Islands Lopadorrhynchidae Lopadorrhynch us PC Bel967 Atlantic Ocean, uncinatus Fauvel, 1915 Azores, Portugal Pedinosoma curtum PC Bel 967 Atlantic Ocean, Reibisch, 1895 Azores, Portugal Pelagobia longicirrata EAO WL1950 Atlantic Ocean, Greeff, 1879 B&D1973 Canary Islands Lumbrineridae Eranno bicirrata Lumbrineris bicirrata PC Hal 948 Pacific Ocean, (Treadwell, 1929) Treadwell, 1929 B&H1974 Washington Eranno lagunae (Fauchald, Lumbrineris lagunae PC B&H1974 Pacific Ocean, 1970) Fauchald, 1970 California Lumbrinerides acuta Lumbriconereis acuta AT Pol989 Atlantic Ocean, (Verrill, 1875) Verrill, 1875; Lumbrineris Brl998 Rhode Island 147 Species Synonymized taxa Region Citation Type Locality acuta (Verrill, 1875) Lumbrineris acicularum AT Tt2004 Atlantic Ocean, Webster & Benedict, 1887 Maine Lumbrineris bifurcata Lumbriconereis bifurcata PC Be 1927 Pacific Ocean, (Mcintosh, 1885) Mcintosh, 1885 B&B1942 Japan B&B1948 Be1967 Lumbrineris brevicirra Notocirrus brevicirrus PC B&B1942 Pacific Ocean, (Schmarda, 1861) Schmarda, 1861 B&B1948 New South Be 1967 Wales Lumbrineris californiensis PC B&H1974 Pacific Ocean, Hartman, 1944 California Lumbrineris coccinea Nereis coccinea Renier, PC Pel 963 Atlantic Ocean, (Renier, 1804) 1804 Mediterranean Sea Lumbrineris crassicephala AT Pol989 Atlantic Ocean, Hartman, 1965 Bermuda Lumbrineris cruzensis PC B&B1948 Pacific Ocean, Hartman, 1944 Bel967 California B&H1974 Vil998 Lumbrineris fauchaldi EAO B&D1973 Arctic Ocean, Blake, 1972 Pol989 Davis Strait Lumbrineris fragilis (O.F. Lumbricus fragilis O.F. AT Trl937 Atlantic Ocean, Miiller, 1776) Miiller, 1776; Scoletoma Trl948 Denmark fragilis (O.F. Miiller, 1776) Pel 963 Lil977 Brl979 F&P1984 Pol989 Brl998 Tt2004 Q&S2005 EAO WL1950 Grl954 El 1960 Cul972 B&D1973 Cul979 Stl985 W&A1987 A&W1989b Pol989 A&F1993 HB Chi920 B&B1943 A&W1989a PC Hal948 WAO Pel 954 A&W1989C B12005 C&K2008 148 Species Synonymized taxa Region Citation Type Locality Lumbrineris hebes Verrill, Lumbrinereis hebes Verrill, AT Trl948 Atlantic Ocean, 1880 1880 Tt2004 Maine Lumbrineris heteropoda Lumbriconereis heteropoda PC Hal 948 Pacific Ocean, (Marenzeller, 1879) Marenzeller, 1879 Japan Lumbrineris impatiens Lumbriconereis impatiens AT Pel963 Atlantic Ocean, (Claparede, 1868) Claparede, 1868 LU977 France Pol989 EAO WL1950 Stl985 Pol989 WAO Co2008 Lumbrineris inflata Moore, Lumbrinereis cervicalis PC Bel927 Pacific Ocean, 1911 Treadwell, 1922 B&B1942 California B&B1948 Be1967 B&H1974 Lumbrineris japonica Lumbriconereis japonica PC B&H1974 Pacific Ocean, (Marenzeller, 1879) Marenzeller, 1879 Japan Lumbrineris latreilli AT Pel 963 Atlantic Ocean, Audouin & Milne LH977 France Edwards, 1834 Brl979 Pol989 Brl998 EAO WL1950 B&D1973 Stl985 Pol989 PC B&B1942 B&B1948 Hal 948 Bel967 B&H1974 Lumbrineris luti Berkeley Lumbrinereis luti Berkeley PC B&B1948 Pacific Ocean, & Berkeley, 1945 & Berkeley, 1945 Be 1967 British Columbia B&H1974 Lumbrineris minuta Lumbriconereis minuta AT Brl998 Arctic Ocean (Theel, 1879) Theel, 1879; Paraninoe minuta (Theel, 1879) EAO WL1950 Cul972 SH985 HB A&W1989a WAO B&C1979 A&W1989c C&K2008 Lumbrineris pallida PC B&H1974 Pacific Ocean, Hartman, 1944 California Lumbrineris similabris Lumbrinereis similabris PC B&B1942 Arctic Ocean, Treadwell, 1926 Treadwell, 1926 B&B1948 Bering Strait Hal 948 Bel967 B&H1974 149 Species Synonymized taxa Region Citation Type Locality WAO B&B1944 C&K2008 Lumbrineris tenuis Lumbriconereis tenuis AT U1977 Atlantic Ocean, (Verrill, 1873) Verrill, 1873; Scoletoma Brl979 New England tenuis (Verrill, 1873) Pol989 Brl998 Tt2004 EAO Cul972 Pol989 WAO A&W1989c C&K2008 Co2008 Lumbrineris tetraura Notocirrus tetraurus AT Brl998 Atlantic / Indian (Schmarda, 1861) Schmarda, 1861; Scoletoma Ocean, South tetraura (Schmarda, 1861) Africa PC Vil998 Lumbrineris zonata Lumbriconereis zonata PC Bel 927 Pacific Ocean, (Johnson, 1901) Johnson 1901 Hal948 Washington B&H1974 WAO C&K2008 Ninoe gemmea Moore, PC B&B1942 Pacific Ocean, 1911 B&B1948 California Be 1967 B&H1974 Ninoe kinbergi Ehlers, Ninoe kinbergii Ehlers, 1887 AT Trl948 Atlantic Ocean, 1887 Florida Ninoe nigripes Verrill, AT Trl948 Atlantic Ocean, 1873 Pel 963 Massachusetts Li 1977 F&P1984 Pol989 Brl998 Tt2004 Paraninoe simpla (Moore, Ninoe simpla Moore, 1905 PC Hal948 Pacific Ocean, 1905) Alaska Magelonidae Magelona berkeleyi Jones, PC H&B1981 Pacific Ocean, 1971 Puget Sound Magelona hobsonae Jones, PC H&B1981 Pacific Ocean, 1978 Washington Magelona japonica Okuda, PC B&B1952 Pacific Ocean, 1937 Bel968 Japan Magelona longicornis PC Be1927 Pacific Ocean, Johnson, 1901 Bel968 Washington H&B1981 Vil998 Magelona pitelkai PC B&B1952 Pacific Ocean, Hartman, 1944 Bel968 California Magelona sacculata PC H&B1981 Pacific Ocean, Hartman, 1961 California Maldanidae 150 Species Synonymized taxa Region Citation Type Locality Asychis lacera (Moore, Maldane lacera Moore, PC Hal948 Pacific Ocean, 1923) 1923 H&B1981 California Axiothella catenata Axiothea catenata AT Trl948 Arctic Ocean, (Malmgren, 1865) Malmgren, 1865; Pol989 Spitsbergen Paraxiothea catenata Brl998 (Malmgren 1865); Clymene catenata Levinsen 1893 EAO Chi920 WL1950 Grl954 W&A1987 A&W1989b Pol989 HB B&B1943 A&W1989a WAO A&W1989c C&K2008 Axiothella rubcrocincta Clymenella rubrocincta PC B&B1952 Pacific Ocean, (Johnson, 1901) Johnson, 1901 Bel 968 Washington H&B1981 Chirimia biceps (M. Sars, Clymene biceps M. Sars, EAO WL1950 Atlantic Ocean, 1861) 1861; Asychis biceps (M. Pol989 Norway Sars, 1861) A&F1993 PC Bel968 H&B1981 Chirimia similis (Moore, Maldane similis Moore, PC B&B1942 Pacific Ocean, 1906) 1906; Asychis similis Hal 948 Alaska (Moore, 1906) B&B1952 Bel968 H&B1981 Clymenella tentaculata PC Hal948 Pacific Ocean, Moore, 1906 Alaska Clymenella torquata Clymene torquatus Leidy, AT Trl948 Atlantic Ocean, (Leidy, 1855) 1855; Paraxiothea torquata Li 1977 New Jersey (Leidy, 1855) Br 1979 F&P1984 Pol989 Brl998 Tt2004 PC H&B1981 Clymenura (Cephalata) Leiochone columbiana PC B&B1952 Pacific Ocean, columbiana (Berkeley, Berkeley, 1929; Clymenura Be 1968 British Columbia 1929) columbiana (Berkeley, H&B1981 1929) Clymenura borealis Leiochone borealis AT Pol989 Atlantic Ocean, (Arwidsson, 1906) Arwidsson, 1906 Brl998 Norway EAO WL1950 Pol989 WAO A&W1989C C&K2008 Clymenura polaris (Theel, Praxilla polaris Theel, AT F&P1984 Arctic Ocean, 1879) 1879; Leiochone polaris Pol989 Novaya Zemlya (Theel, 1879) 151 Species Synonymized taxa Region Citation Type Locality EAO WL1950 Cul972 WAO A&W1989C C&K2008 Euclymene collaris Praxilla collaris Claparede, AT Trl948 Atlantic Ocean, (Claparede, 1869) 1869; Iphianissa collaris Brl998 Mediterranean (Claparede, 1869) Sea Euclymene oerstedi Clymene oerstedii AT Brl998 Atlantic Ocean, (Claparede, 1863) Claparede, 1863 Mediterranean Sea Euclymene zonalis (Verrill, Praxilla zonalis Verrill, AT Li 1977 Atlantic Ocean, 1874) 1874; Clymenella zonalis Brl979 Maine (Verrill, 1874) F&P1984 Pol989 Brl998 Tt2004 PC B&B1952 Bel968 H&B1981 Heteroclymene robusta EAO WL1950 Atlantic Ocean, Arwidsson, 1906 Norway Isocirrus longiceps Pseudoclymene longiceps PC B&B1952 Pacific Ocean, (Moore, 1923) Moore, 1923 Bel968 California H&B1981 Lumbriclymene constricta Clymenopsis constricta AT Pol989 Arctic Ocean, Wesenberg-Lund, 1948 (Wesenberg-Lund, 1948) Davis Strait EAO WL1950 Lumbriclymene minor AT Pol989 Atlantic Ocean, Arwidsson, 1907 Brl998 Sweden and Arctic Ocean, Greenland EAO WL1950 Pol989 WAO C&K2008 Lumbriclymene nasuta EAO WL1950 Arctic Ocean, Wesenberg-Lund, 1948 Davis Strait Macroclymene sp. PC H&B1981 Maldane glebifex Grube, PC B&B1942 Atlantic Ocean, 1860 B&B1952 Mediterranean Bel 968 Sea H&B1981 Maldane sarsi Malmgren, AT Trl948 Atlantic Ocean, 1865 Li 1977 Sweden and F&P1984 Iceland Pol989 Brl998 EAO WL1950 Grl954 Cul972 Cul979 Stl985 W&A1987 152 Species Synonymized taxa Region Citation Type Locality Pol989 A&F1993 HB B&B1943 A&W1989a PC Hal 948 Bel968 WAO Pel954 A&W 1989c B12005 C&K2008 Co2008 Maldanella davisi EAO WL1950 Arctic Ocean, Wesenberg-Lund, 1948 B&D1973 Davis Strait Pol 989 Maldanella harai (Izuka, Clymene harai Izuka, 1902 PC H&B1981 Pacific Ocean, 1902) Japan Maldanella robusta PC B&B1942 Pacific Ocean, Moore, 1906 Hal 948 Alaska B&B1952 Bel968 H&B1981 Metasychis disparidentata Maldane disparidentata PC B&B1952 Pacific Ocean, (Moore, 1904) Moore, 1904; Asychis Bel 968 California disparidentata (Moore, H&B1981 1904) Microclymene sp. AT Brl998 WAO C&K2008 Micromaldane PC Bel 968 Atlantic Ocean, omithochaeta Mesnil, H&B1981 France 1897 Nicomache (Loxochona) Nicomache quadrispinata AT Pol989 Arctic Ocean, quadrispinata Arwidsson, Arwidsson, 1906 Brl998 Spitsbergen 1906 EAO WL1950 Pol989 HB A&W1989a WAO A&W1989C C&K2008 Nicomache (Nicomache) HB B&B1943 Atlantic Ocean, minor Arwidsson, 1906 Norway Nicomache canadensis AT Trl948 Atlantic Ocean, Mcintosh, 1913 Gulf of St. Lawrence Nicomache lumbricalis Sabella lumbricalis AT Trl948 Arctic Ocean, (Fabricius, 1780) Fabricius, 1780 Li 1977 Greenland F&P1984 Pol 989 Brl998 Tt2004 EAO WL1950 Grl954 Stl985 153 Species Synonymized taxa Region Citation Type Locality A&W1989b Pol989 A&F1993 HB A&W1989a PC B&B1942 Hal 948 B&B1952 Be 1968 H&B1981 WAO Pel 954 A&W1989C C&K2008 Nicomache personata AT Pol989 Pacific Ocean, Johnson, 1901 Brl998 Washington PC Hal 948 B&B1952 Be 1968 H&B1981 WAO Pel954 Notoproctus abyssus AT Pol989 Atlantic Ocean, Hartman & Fauchald, 1971 United States Notoproctus oculatus Notoproctus oculatus AT Pol989 Atlantic Ocean, Arwidsson, 1906 arcticus Arwidsson, 1906 Brl998 Norway EAO WL1950 Pol 989 Notoproctus oculatus EAO WL1950 Atlantic Ocean, minor Arwidsson, 1906 Norway Notoproctus pacificus Lumbriclymene pacifica PC B&B1942 Pacific Ocean, (Moore, 1906) Moore, 1906 Hal948 Alaska B&B1952 Bel968 H&B1981 Notoproctus scutiferus EAO WL1950 Arctic Ocean, Wesenberg-Lund, 1948 Greenland Petaloproctus borealis Petaloproctus tenuis PC Hal 948 Atlantic Ocean, Arwidsson, 1906 borealis Arwidsson, 1906 B&B1952 Sweden Bel968 H&B1981 Petaloproctus tenuis Maldane tenuis Theel, 1879 AT Pol989 Arctic Ocean, (Theel, 1879) Brl998 Novaya Zemlya Q&S2005 EAO Pol989 HB A&W 1989a PC B&B1942 B&B1952 Bel968 WAO Pel 954 C&K2008 Praxillella affmis (M. Sars Clymene affinis M. Sars in EAO Cul972 Atlantic Ocean, inG.O. Sars, 1872) G.O. Sars, 1872 Pol989 Norway HB B&B1943 154 Species Synonymized taxa Region Citation Type Locality PC Bel968 WAO A&W1989c C&K2008 Praxillella affinis pacifica PC B&B1942 Pacific Ocean, Berkeley, 1929 B&B1952 British Columbia Be1968 H&B1981 Praxillella gracilis (M. Clymene gracilis M. Sars, AT Trl948 Atlantic Ocean, Sars, 1861) 1861; Iphianissa gracilis U1977 Norway (M. Sars, 1861) F&P1984 Pol989 Brl998 EAO WL1950 Ell 960 Pol989 A&F1993 PC B&B1952 Bel968 H&B1981 Praxillella praetermissa Praxilla praetermissa AT Trl948 Atlantic Ocean, (Malmgren, 1865) Malmgren, 1865; Iphianissa L11977 Norway praetermissa (Malmgren, F&P1984 1865) Pol989 Brl998 Tt2004 Q&S2005 EAO WL1950 Cul979 Stl985 A&W1989b Pol989 HB A&W1989a PC H&B1981 WAO Pel954 A&W1989C C&K2008 Praxillura longissima AT Brl998 Atlantic Ocean, Arwidsson, 1906 Norway EAO WL1950 Pol989 A&F1993 WAO C&K2008 Praxillura maculata PC H&B1981 Pacific Ocean, Moore, 1923 California Praxillura ornata Verrill, AT F&P1984 Atlantic Ocean, 1880 Pol989 Massachusetts Brl998 Proclymene muelleri (M. Clymene muelleri M. Sars, AT Brl998 Atlantic Ocean, Sars, 1856) 1856 Norway Rhodine bitorquata Moore, PC B&B1952 Pacific Ocean, 1923 Bel968 California H&B1981 155 Species Synonymized taxa Region Citation Type Locality Vil998 Rhodine gracilior Tauber, AT Pol989 Atlantic Ocean, 1879 Brl998 North Sea EAO St 1985 Rhodine loveni Malmgren, AT Trl948 Atlantic Ocean, 1865 Li 1977 Sweden Pol989 Brl998 Tt2004 EAO WL1950 Pol989 WAO A&W1989c C&K2008 Sabaco elongatus (Verrill, Maldane elongata Verrill, AT Pol989 Atlantic Ocean, 1873) 1873; Macroclymene Brl998 Connecticut elongata (Verrill, 1873); Tt2004 Sabaco elongata (Verrill, 1873) Nephtyidae Aglaophamus circinata Nephthys circinata Verrill, AT Pel 963 Atlantic Ocean, (Verrill, 1874) 1874 Li 1977 Maine Pol989 Brl998 Aglaophamus malmgreni Nephthys malmgreni Theel, AT Pel 963 Atlantic Ocean, (Theel, 1879) 1879; Nephtys malmgreni Pol 989 Europe Theel, 1879 Brl998 EAO WL1950 Cul972 B&D1973 Stl985 Pol989 PC Bel924 Hal948 WAO B&B1944 A&W1989C C&K2008 Aglaophamus rubella Nephthys rubella PC B&B1948 Atlantic Ocean, (Michaelsen, 1897) Michaelsen, 1897; Nephtys Bel967 North Sea rubella Michaelsen, 1897 Aglaophamus rubella PC B&H1974 Pacific Ocean, anops Hartman, 1950 British Columbia Micronephthys minuta Nephthys minuta Theel, EAO Cul972 Arctic Ocean (Theel, 1879) 1879; Nephtys minuta Theel, Cul979 1879 A&W1989a HB A&W1989a WAO B&C1979 A&W1989c C&K2008 Co2008 Micronephthys neotena Aglaophamus neotenus AT Brl979 Atlantic Ocean, (Noyes, 1980) Noyes, 1980; Nephtys Pol989 Maine and New 156 Species Synonymized taxa Region Citation Type Locality neotena (Noyes, 1980) Brl998 Brunswick EAO Pol989 WAO A&W1989C C&K2008 Nephtys assignis Hartman, PC Be1924 Pacific Ocean, 1950 B&H1974 California Nephtys assimilis 0rsted, Nephthys assimilis 0rsted, PC Hal948 Atlantic Ocean, 1843 1843 Denmark Nephtys brachycephala Nephthys brachycephala PC Bel967 Pacific Ocean, Moore, 1903 Moore, 1903 B&H1974 Japan Nephtys bucera Ehlers, Nephthys bucera Ehlers, AT Pel 963 Atlantic Ocean, 1868 1868 U1977 Massachusetts Brl979 Pol989 Brl998 Tt2004 Nephtys caeca (Fabricius, Nereis caeca Fabricius, AT Trl948 Arctic Ocean, 1780) 1780; Nephthys caeca E11960 Greenland (Fabricius, 1780); Nephthys Pel963 coeca (Fabricius, 1780) Li 1977 Brl979 Pol989 Brl998 Tt2004 EAO WL1950 Cul979 Pol989 PC Be1924 B&B1942 B&B1948 Hal948 Bel967 B&H1974 Nephtys caecoides Nephthys caecoides PC B&B1942 Pacific Ocean, Hartman, 1938 Hartman, 1938 B&B1948 California Bel967 B&H1974 Vil998 Nephtys califomiensis Nephthys califomiensis PC B&B1942 Pacific Ocean, Hartman, 1938 Hartman, 1938 B&B1948 California Bel967 B&H1974 Nephtys ciliata (O.F. Nereis ciliata O.F. Muller, AT Trl948 Atlantic Ocean, Muller, 1776) 1776; Nephthys ciliata (O.F. Pel963 Norway Muller, 1776) Li 1977 F&P1984 Pol989 Brl998 Tt2004 Q&S2005 EAO Trl937 WL1950 Grl954 157 Species Synonymized taxa Region Citation Type Locality E11960 Cul972 SH985 W&A1987 A&W1989b Pol989 A&F1993 HB B&B1943 A&W1989a PC Be1924 B&B1942 B&B1948 Hal 948 Bel967 B&H1974 WAO Chi920 Pel 954 B&C1979 A&W1989C C&K2008 Nephtys cornuta Berkeley Nephthys cornuta Berkeley PC B&B1948 Pacific Ocean, & Berkeley, 1945 & Berkeley, 1945; Nephtys Bel967 Washington cornuta cornuta Berkeley & B&H1974 Berkeley, 1945 Vil998 WAO C&K2008 Nephtys cornuta PC B&H1974 Pacific Ocean, franciscana Clark & Jones, California 1955 Nephtys discors Ehlers, Nephthys discors Ehlers, AT Pel963 Atlantic Ocean, 1868 1868 U1977 Maine Pol989 Brl998 Tt2004 Nephtys ferruginea Nephthys ferruginea PC B&B1948 Pacific Ocean, Hartman, 1940 Hartman, 1940 Bel 967 California B&H1974 VH998 Nephtys hombergii EAO WL1950 Atlantic Ocean, Savigny, 1818 France Nephtys hudsonica Nepthys hudsonica HB Chi920 Arctic Ocean, Chamberlin, 1920 Chamberlin, 1920 Hudson Bay Nephtys hystricis Nephthys hystricis AT Brl998 Atlantic Ocean, Mcintosh, 1900 Mcintosh, 1900 Mediterranean Sea Nephtys incisa Malmgren, Nephthys incisa Malmgren, AT Trl948 Atlantic Ocean, 1865 1865; Nephthys lawrencii Pel963 Sweden Mcintosh, 1900 Li 1977 F&P1984 Pol989 Brl998 Tt2004 EAO WL1950 B&D1973 Pol989 158 Species Synonymized taxa Region Citation Type Locality Nephtys longosetosa Nephtys longisetosa 0rsted, AT Trl948 Atlantic Ocean, 0rsted, 1843 1843 Pol989 Greenland Brl998 Tt2004 EAO WL1950 Grl954 W&A1987 Pol989 HB B&B1943 PC B&B1942 B&B1948 Be 1967 B&H1974 WAO Pel 954 A&W1989C B12005 C&K2008 Nephtys paradoxa Malm, Nephthys paradoxa Malm, AT Trl948 Atlantic Ocean, 1874 1874; Nephthys canadensis Pel963 Sweden Mcintosh, 1900 Lil977 Pol989 Brl998 Tt2004 EAO WL1950 Pol989 HB B&B1943 A&W1989a WAO Pel954 A&W1989C C&K2008 Nephtys picta Ehlers, 1868 Nephthys picta Ehlers, 1868 AT Trl948 Atlantic Ocean, Li 1977 New England Nephtys punctata Hartman, Nephthys punctata Hartman, PC B&B1942 Pacific Ocean, 1938 1938 B&B1948 Alaska Hal 948 Bel 967 B&H1974 WAO C&K2008 Nephtys rickettsi Hartman, Nephthys rickettsi Hartman, PC Hal948 Pacific Ocean, 1938 1938; Nephtys discors Be1967 Alaska and Pettibone 1954 B&H1974 California WAO Pel 954 Nephtys schmitti Hartman, Nephthys schmitti Hartman, PC Hal 948 Pacific Ocean, 1938 1938 Alaska Nereididae Alitta brandti Malmgren, Neanthes brandti PC Hal 948 Arctic Ocean, 1866 (Malmgren, 1866); Nereis B&H1974 Siberia (Neanthes) brandti (Malmgren, 1866) Alitta grandis (Stimpson, Nereis grandis Stimpson, AT Stl853 Atlantic Ocean, 1853) 1853 Bay of Fundy 159 Species Synonymized taxa Region Citation Type Locality Alitta succinea (Leuckart, Nereis succinea Frey & AT Pel963 Atlantic Ocean, 1847) Leuckart, 1847; Neanthes Li 1977 North Sea succinea (Frey & Leuckart, Pol989 1847); Nereis (Neanthes) Brl998 succinea (Frey & Leuckart, 1847) Alitta virens (M. Sars, Nereis virens M. Sars, 1835; AT Trl948 Atlantic Ocean, 1835) Neanthes virens (M. Sars, Pel963 Norway 1835); Nereis (Neanthes) Lil977 virens M. Sars, 1835 Brl979 Pol989 Brl998 Tt2004 HB A&W1989a PC Be 1924 B&B1942 B&B1948 Hal948 Be 1967 B&H1974 Ceratocephale loveni AT Pel963 Atlantic Ocean, Malmgren, 1867 Pol989 Sweden Brl998 EAO WL1950 Stl985 Pol989 Cheilonereis cyclurus Nereis cyclurus Harrington, PC Be 1924 Pacific Ocean, (Harrington, 1897) 1897 B&B1942 Washington B&B1948 Hal948 Bel967 B&H1974 Composetia hircinicola Nereis hircinicola Eisig, EAO Trl937 Atlantic Ocean, (Eisig, 1870) 1870; Nereis (Ceratonereis) Mediterranean bartletti Treadwell, 1937 Sea Composetia paucidentata Nereis paucidentata Moore, PC B&B1948 Pacific Ocean, (Moore, 1903) 1903; Ceratonereis Hal 948 Bering Sea paucidentata (Moore, Bel 967 \9M); Nereis B&H1974 (Ceratonereis) paucidentata Vil998 Moore, 1903 Composetia scotiae Nereis (Ceratonereis) AT B&W2005 Atlantic Ocean, (Berkeley & Berkeley, scotiae Berkeley & Nova Scotia 1956) Berkeley, 1956 Eunereis longissima Nereis longissima Johnston, EAO WL1950 Atlantic Ocean, (Johnston, 1840) 1840 Ireland Eunereis wailesi (Berkeley Nereis (Eunereis) wailesi PC Bel 967 Pacific Ocean, & Berkeley, 1954) Berkeley & Berkeley, 1954 B&H1974 British Columbia Hediste diversicohr (O.F. Nereis diversicohr O.F. AT Pel963 Atlantic Ocean, Miiller, 1776) MUller, 1776; Neanthes Lil977 Denmark diversicohr (O.F Muller, Brl979 1776) Pol989 Brl998 Tt2004 160 Species Synonymized taxa Region Citation Type Locality EAO WL1950 Hediste japonica (Izuka, Nereis japonica Izuka, PC B&B1948 Pacific Ocean, 1908) 1908; Neanthes japonica Be 1967 Japan (Izuka, 1908);jVere/.s (Nereis) japonica Izuka, 1908 Hediste limnicola Nereis limnicola Johnson, PC Bel967 Pacific Ocean, (Johnson, 1903) 1903; Nereis (Neanthes) B&H1974 California, limnicola Johnson, 1903 freshwater Micronereis nanaimoensis PC Bel 967 Pacific Ocean, Berkeley & Berkeley, 1953 B&H1974 British Columbia Micronereis variegata PC Be1924 Atlantic Ocean, Claparede, 1863 B&B1948 France Neanthes arenaceodentata Nereis arenaceodentata AT Pol989 Atlantic Ocean, (Moore, 1903) Moore, 1903 Massachusetts Nereis callaona (Grube, Nereilepas callaona Grube, PC B&B1942 Pacific Ocean, 1857) 1857; Nereis (Nereis) B&B1948 Peru callaona (Grube, 1857) Nereis eakini Hartman, Nereis (Nereis) eakini PC B&B1948 Pacific Ocean, 1936 Hartman, 1936; Nereis B&H1974 California (Neanthes) eakini Hartman, 1936 Nereis grayi Pettibone, Nereis (Nereis) grayi AT Pol989 Atlantic Ocean, 1956 Pettibone, 1956 Brl998 Massachusetts Nereis grubei (Kinberg, Heteronereis grubei PC Be1967 Pacific Ocean, 1865) Kinberg, \%66;Nereis B&H1974 Chile (Nereis) grubei (Kinberg, 1866) Nereis natans Hartman, PC Bel967 Pacific Ocean, 1936 California Nereis neoneanthes Nereis (Nereis) neoneanthes PC Hal 948 Pacific Ocean, Hartman, 1948 Hartman, 1948 B&H1974 Alaska Nereis pelagica Linnaeus, Nereis (Nereis) pelagica AT Trl937 Atlantic Ocean, 1758 Linnaeus, 1758 Trl948 Europe Pel 963 Li 1977 Brl979 F&P1984 Pol989 Brl998 Tt2004 EAO Chi920 WL1950 Grl954 B&D1973 W&A1987 A&W1989b Pol989 HB B&B1943 A&W1989a PC Chi920 Be 1924 B&B1942 B&B1948 161 Species Synonymized taxa Region Citation Type Locality Hal 948 Be 1967 B&H1974 WAO Chi920 Pel954 A&W1989C C&K2008 Nereis procera Ehlers, Nereis (Nereis) procera PC Be1924 Pacific Ocean, 1868 Ehlers, 1868 B&B1948 Washington Hal 948 Be1967 B&H1974 Vil998 WAO C&K2008 Nereis vexillosa Grube, Nereis (Nereis) vexillosa EAO Trl937 Pacific Ocean, 1851 Grube, 1851 Alaska and Siberia PC Bel 924 B&B1942 B&B1948 Hal 948 Bel967 B&H1974 Nereis zonata Malmgren, AT Li 1977 Arctic Ocean, 1867 F&P1984 Spitsbergen and Pol989 Greenland Brl998 Tt2004 EAO WL1950 Grl954 El 1960 Oil 972 Cul979 Pol989 HB B&B1943 A&W 1989a PC Hal 948 WAO Pel954 A&W1989c C&K2008 Perinereis monterea Nereis (Neanthes) monterea PC B&H1974 Pacific Ocean, (Chamberlin, 1918) Chamberlin, 1918 California Platynereis bicanaliculata Nereis bicanaliculata Baird, PC Bel924 Pacific Ocean, (Baird, 1863) 1863; Nereis agassizi B&B1948 British Columbia Ehlers, 1868; Platynereis Hal948 dumerilii agassizi Ehlers, Bel 967 1868; Nereis notomacula B&H1974 Treadwell, 1914 Vil998 Platynereis dumerilii Nereis dumerilii Audouin & AT Pel963 Atlantic Ocean, (Audouin & Milne Milne Edwards, 1833 France Edwards, 1833) Webster inereis glauca Nereis (Leptonereis) glauca EAO WL1950 Atlantic Ocean, (Claparede, 1870) Claparede, 1870; Leonnates Mediterranean 162 Species Synonymized taxa Region Citation Type Locality glauca (Claparede, 1870) Sea Nerillidae Mesonerilla sp. AT Tt2004 Nerilla antennata Schmidt, PC H&B1981 Atlantic Ocean, 1848 Faeroe Islands Nerilla digitata Wieser, PC H&B1981 Pacific Ocean, 1957 Puget Sound Nerilla inopinata Gray, PC H&B1981 Pacific Ocean, 1968 Washington Nerilla sp. AT Brl998 Oenonidae Arabella (Arabella) Nereis iricolor Montagu, AT Li 1977 Atlantic Ocean, iricolor (Montagu, 1804) 1804; Arabella iricolor Pol989 England (Montagu, 1804); Arabella Brl998 lagunae Chamberlin, 1919 Tt2004 PC Bel927 B&B1942 B&B1948 Be 1967 B&H1974 Arabella sp. WAO C&K2008 Drilonereis canadensis AT Trl948 Atlantic Ocean, Mcintosh, 1903 Canada Drilonereis caulleryi EAO Pol989 Atlantic Ocean, Pettibone, 1957 New England Drilonereis falcata minor PC B&H1974 Atlantic Ocean, Hartman, 1965 New England Drilonereis filum Lumbriconereis filum EAO WL1950 Atlantic Ocean, (Claparede, 1868) Claparede, 1868 Mediterranean Sea PC B&B1942 Hal 948 Be 1967 Drilonereis longa Webster, AT Li 1977 Atlantic Ocean, 1879 Tt2004 Virginia PC B&H1974 Drilonereis magna AT Pel 963 Atlantic Ocean, Webster & Benedict, 1887 Li 1977 Maine Pol989 Brl998 Tt2004 Drilonereis nuda Moore, PC Hal948 Pacific Ocean, 1909 California Notocirrus californiensis PC B&H1974 Pacific Ocean, Hartman, 1944 California Onuphidae Diopatra ornata Moore, Onuphis longibranchiata PC Bel 927 Pacific Ocean, 1911 Berkeley, '.197 2 B&B1942 California 163 Species Synonymized taxa Region Citation Type Locality B&B1948 Bel967 Bel972 B&H1974 Diopatra splendidissima Diopatra californica Moore, PC Bel927 Pacific Ocean, Kinberg, 1865 1904 Ecuador Epidiopatra hupferiana PC Bel967 Atlantic Ocean, Augener, 1918 West Aftica Epidiopatra hupferiana PC B&H1974 Atlantic / Indian monroi Day, 1957 Ocean, South Africa Hyalinoecia bilineata PC Be 1967 Atlantic Ocean, rigida Claparede, 1868 Be 1972 Mediterranean Sea Hyalinoecia tubicola (O.F. Nereis tubicola O.F. Miiller, AT Trl948 Atlantic Ocean, Mtiller, 1776) 1776; Hyalinoecia sicula Pol989 Denmark Quatrefages, 1866 Brl998 EAO WL1950 Mooreonuphis stigmatis Onuphis stigmatis PC B&H1974 Pacific Ocean, (Treadwell, 1922) Treadwell, 1922 Washington Nothria conchylega (M. Onuphis conchylega M. AT Trl948 Atlantic Ocean, Sars, 1835) Sars, 1835; Nothria Pel963 Norway conchilega (M. Sars, 1835); U1977 Onuphis eschrichtii 0rsted, Pol989 1843 Brl998 Tt2004 Q&S2005 EAO WL1950 Grl954 E11960 Cul972 B&D1973 SH985 W&A1987 A&W1989b Pol989 A&F1993 HB A&W1989a PC B&B1942 B&B1948 Hal 948 B&H1974 WAO Chi920 B&B1944 A&W1989C C&K2008 Onuphis elegans (Johnson, Northia elegans Johnson, PC Be 1927 Pacific Ocean, 1901) 1901; Nothria elegans B&B1942 Washington (Johnson, 1901) B&B1948 Bel967 B&H1974 Vil998 164 Species Synonym ized taxa Region Citation Type Locality Onuphis geophiliformis Northia geophiliformis PC Bel927 Pacific Ocean, (Moore, 1903) Moore, 1903; Nothria B&B1948 Japan geophiliformis (Moore, Hal 948 1903) Be 1967 B&H1974 Onuphis holobranchiata Nothria holobranchiata AT Trl948 Pacific Ocean, Marenzeller, 1879 (Marenzeller, 1879) Japan EAO Stl985 Onuphis iridescens Northia iridescens Johnson, PC Bel 927 Pacific Ocean, (Johnson, 1901) 1901; Nothria iridescens B&B1942 British Columbia (Johnson, 1901) B&B1948 Hal948 Be1967 B&H1974 Onuphis opalina (Verrill, Nothria opalina Verrill, AT Pel963 Atlantic Ocean, 1873) 1873 Pol989 New England Brl998 Paradiopatra quadhcuspis Onuphis quadricuspis M. AT Trl948 Atlantic Ocean, (M. Sars in G.O. Sars, Sars in G.O. Sars, 1872; Pel963 Norway 1872) Sarsonuphis quadricuspis Pol989 (M. Sars in G.O. Sars, 1872) Brl998 PC Be1967 WAO B&C1979 C&K2008 Opheliidae Ammotrypane pallida PC Bel968 Pacific Ocean, Hartman, 1960 California Armandia brevis (Moore, Ammotrypane brevis Moore, PC Hal 948 Arctic Ocean, 1906) 1906; Armandia bioculata B&B1952 Alaska Hartman, 1938 Be 1968 H&B1981 Vil998 Euzonus (Thoracophelia) Ophelina mucronata PC B&B1952 Pacific Ocean, mucronata (Treadwell, Treadwell, 1914; Bel968 California 1914) Thoracophelia mucronata H&B1981 (Treadwell, 1914); Euzonus mucronata (Treadwell, 1914) Euzonus (Thoracophelia) Pectinophelia williamsi PC H&B1981 Pacific Ocean, williamsi (Hartman, 1938) Hartman, 1938; Euzonus California williamsi (Hartman, 1938) Euzonus flabelligerus Thoracophelia flabellifera AT Pol989 Atlantic Ocean, (Ziegelmeier, 1955) Ziegelmeier, 1955 North sea Ophelia bicornis Savigny, AT Br 1979 Atlantic Ocean, 1818 Pol989 Mediterranean Sea Ophelia borealis PC Bel968 Atlantic Ocean, Quatrefages, 1866 Greenland Ophelia limacina (Rathke, Ammotrypane limacina AT Trl948 Atlantic Ocean, 1843) Rathke, 1843 Li 1977 Norway Brl979 Pol989 165 Species Synonymized taxa Region Citation Type Locality Brl998 EAO Trl937 WL1950 Grl954 Cul979 A&W1989b Pol989 HB B&B1943 A&W1989a PC B&B1942 Hal948 H&B1981 Vil998 WAO C&K2008 Ophelia radiata (delle Lumbricus radiatus delle AT Trl948 Atlantic Ocean, Chiaje, 1828) Chiaje, 1828 Mediterranean Sea Ophelia rullieri Bellan, AT Pol989 Atlantic Ocean, 1975 Brl998 Quebec Q&S2005 Ophelia verrilli Riser, AT Brl998 Atlantic Ocean, 1987 New England Ophelina abranchiata AT Pol 989 Arctic Ocean, Stop-B0\vitz, 1948 Greenland WAO B&C1979 Ophelina acuminata Ophelia acuminata 0rsted, AT Trl948 Atlantic Ocean, 0rsted, 1843 1843; Ammotrypane Li 1977 Denmark aulogaster Rathke, 1843; Pol989 Ophelina aulogaster Brl998 (Rathke, 1843); Tt2004 Ammotrypane Jimbriata Q&S2005 Verrill, 1873 EAO WL1950 Grl954 E11960 Stl985 W&A1987 A&W1989b Pol989 PC Hal 948 B&B1952 Bel 968 H&B1981 Vil998 WAO A&W1989C C&K2008 Ophelina breviata (Ehlers, Ophelina brevita Ehlers, AT Pol989 Southern Ocean, 1913) 1901; Ammotrypane Brl998 Kaiser Wilhelm breviata Eh lers, 1913; Land Ophelina breviata (Pettibone 1954) EAO Cul972 166 Species Synonymized taxa Region Citation Type Locality A&W1989b Pol989 B12005 PC Bel968 H&B1981 VH998 WAO Pel954 C&K2008 Ophelina cylindricaudata Ammotrypane AT Trl948 Arctic Ocean, (Hansen, 1878) cylindricaudatus Hansen, Pol989 Norway 1878 Brl998 Q&S2005 EAO WL1950 Stl985 Pol989 HB A&W1989a WAO A&W1989C B&C1979 B12005 C&K2008 Tachytrypane Jeffreys ii EAO WL1950 Arctic Ocean, Mcintosh, 1879 Davis Strait Travisia brevis Moore, PC B&B1942 Pacific Ocean, 1923 Hal 948 California B&B1952 Bel968 H&B1981 Travisia carnea Verrill, AT U1977 Atlantic Ocean, 1873 Pol989 New England Brl998 Tt2004 PC Bel968 WAO Pel954 Travisia forbesii Johnston, AT Pol989 Atlantic Ocean, 1840 Brl998 England EAO WL1950 Grl954 Ell 960 W&A1987 A&W1989b Pol989 PC B&B1942 Hal 948 H&B1981 WAO Chi920 A&W1989C C&K2008 Travisia gigas Hartman, PC Bel 968 Pacific Ocean, 1938 California Travisia japonica PC H&B1981 Pacific Ocean, Fujiwara, 1933 Japan Travisia pupa Moore, 1906 PC B&B1942 Pacific Ocean, 167 Species Synonymized taxa Region Citation Type Locality Hal 948 Alaska B&B1952 Be1968 Orbiniidae Califia schmitti (Pettibone, Scoloplos (Scoloplos) AT Pol989 Atlantic Ocean, 1957) schmitti Pettibone, 1957; New England Scoloplos (Califia) schmitti Pettibone, 1957 Leitoscoloplos fragilis Anthostoma fragile Verrill, AT Pel963 Atlantic Ocean, (Verrill, 1873) 1873; Haploscoloplos Li 1977 New England fragilis (Verrill, 1873); Brl979 Scoloplos fragilis (Verrill, Pol989 1873); Scoloplos (Scoloplos) Brl998 fragilis (Verrill, 1873) Tt2004 Leitoscoloplos Scoloplos kerguelensis HB B&B1943 Southern Ocean, kerguelensis (Mcintosh, Mcintosh, 1885; Kerguelen 1885) Haploscoloplos kerguelensis Islands (Mcintosh, 1885) Leitoscoloplos panamensis Haploscoloplos panamensis PC H&B1981 Pacific Ocean, (Monro, 1933) Monro, 1933 Panama WAO C&K2008 Leitoscoloplos pugettensis Scoloplos pugettensis EAO Grl954 Pacific Ocean, (Pettibone, 1957) Pettibone, 1957; Scoloplos Washington elongata Johnson, 1901; Haploscoloplos elongatus Hartman 1948 PC Be 1927 Hal948 Bel968 H&B1981 Vil998 WAO C&K2008 Leitoscoloplos robustus Anthostoma robustum AT Pel 963 Atlantic Ocean, (Verrill, 1873) Verrill, 1873; Lil977 New England Haploscoloplos robustus Pol989 (Verrill 1873); Scoloplos Tt2004 robustus (Verrill 1873); Scoloplos (Scoloplos) robustus (Verrill 1873) EAO Pol989 Naineris dendritica Anthostoma dendriticum PC Bel 927 Pacific Ocean, (Kinberg, 1867) Kinberg, 1867; Naineris Hal 948 British Columbia longa Moore, 1909; H&B1981 Nainereis hespera Chamberlin, 1919 Naineris laevigata (Grube, Aricia laevigata Grube, PC B&B1942 Atlantic Ocean, 1855) 1855 B&B1952 Mediterranean Bel968 Sea Naineris quadricuspida Nais quadricuspida AT Trl948 Arctic Ocean, (Fabricius, 1780) Fabricius, 1780 Pel 963 Greenland Li 1977 168 Species Synonymized taxa Region Citation Type Locality Brl979 Pol989 Brl998 Tt2004 EAO WL1950 E11960 Pol989 PC H&B1981 Naineris uncinata Naineris (Naineris) PC H&B1981 Pacific Ocean, Hartman, 1957 berkeleyorum Pettibone, Vil998 California 1957 Orbinia (Orbinia) swani Orbinia swani Pettibone, AT Pel963 Atlantic Ocean, Pettibone, 1957 1957 Brl979 Maine Pol989 Brl998 Orbinia (Phylo) norvegica Aricia norvegica M. Sars, EAO WL1950 Atlantic Ocean, (M. Sars, 1872) 1872 Pol989 Norway Orbinia armandi Aricia armandi Mcintosh, AT Pol989 Atlantic Ocean, (Mcintosh, 1910) 1910 England Orbinia ornata (Verrill, Aricia ornata Verrill, 1873 AT Brl979 Atlantic Ocean, 1873) Pol989 New England Orbinia sp. WAO C&K2008 Orbiniella nuda Hobson, PC H&B1981 Pacific Ocean, 1976 Washington Phylo felix Kinberg, 1866 Orbinia (Phylo) felix PC H&B1981 Atlantic Ocean, Kinberg, 1866 Brazil Phylo felix asiaticus Wu, Aricia michaelseni Ehlers, PC B&B1952 Pacific Ocean, 1962 1897 Bel968 Yellow Sea Phylo kupfferi (Ehlers, Aricia kupfferi Ehlers, 1875; EAO WL1950 Atlantic Ocean, 1875) Orbinia (Phylo) kupfferi Pol989 Europe (Ehlers, 1875) Protoariciella PC H&B1981 Pacific Ocean, oligobranchia Hobson, British Columbia 1976 Scoloplos (Scoloplos) Scoloplos acmeceps PC Bel968 Pacific Ocean, acmeceps Chamberlin, Chamberlin, 1919 H&B1981 California 1919 Vil998 Scoloplos (Scoloplos) Lumbricus armiger O.F. AT Trl948 Atlantic Ocean, armiger (O.F. Miiller, Miiller, 1776; Scoloplos Pel 963 Norway 1776) armiger (O.F. Miiller, 1776) LH977 Brl979 F&P1984 Pol989 Brl998 Tt2004 Q&S2005 EAO WL1950 Grl954 E11960 E11961 Cul972 B&D1973 Cul979 169 Species Synonymized taxa Region Citation Type Locality SU985 W&A1987 A&W1989b Pol989 HB A&W1989a PC B&B1942 Hal 948 B&B1952 Bel968 H&B1981 WAO Pel954 B&C1979 A&W1989C C&K2008 Scoloplos acutus (Verrill, Leitoscoloplos acutus AT Li 1977 Atlantic Ocean, 1873) Verrill, mi; Scoloplos northwestern (Leitoscoloplos) acutus region (Verrill, 1873); Scoloplos (Scoloplos) acutus (Verrill, 1873) WAO B&C1979 Scoloplos armiger Haploscoloplos alaskensis PC Hal948 Arctic Ocean, alaskensis (Hartman, 1948) Hartman, 1948 Alaska Oweniidae Galathowenia oculata Myriochele oculata Zachs, AT Pol989 Arctic Ocean, (Zachs, 1922) 1922; Owenia oculata Brl998 White Sea (Zachs, 1922) EAO B&D1973 SH985 Pol989 HB A&W1989a PC H&B1981 Vil998 Galathowenia pygidialis Myriochele pygidialis AT Pol989 Pacific Ocean, (Hartman, I960) Hartman, 1960 California Myriochele heeri AT Trl948 Arctic Ocean, Malmgren, 1867 Lil977 Spitsbergen and F&P1984 Greenland Pol989 Brl998 Tt2004 EAO WL1950 El 1960 Cul972 B&D1973 Cul979 Pol989 A&F1993 HB A&W1989a PC B&B1942 B&B1952 170 Species Synonym ized taxa Region Citation Type Locality Be 1968 WAO B&C1979 A&W1989C C&K2008 Owenia fusiformis delle Ammochares fusiformis AT 1Y1948 Atlantic Ocean, Chiaje, 1842 (delle Chiaje, 1842) Li 1977 Mediterranean Pol989 Sea Brl998 Tt2004 EAO WL1950 Grl954 E11960 Oil 972 Cul979 W&A1987 Pol989 A&F1993 HB B&B1943 A&W1989a PC B&B1942 Be 1968 H&B1981 Vil998 WAO B&C1979 A&W1989c C&K2008 Paraonidae Aricidea (Acmira) Aricidea (Acesta) catherinae AT Pol989 Atlantic Ocean, cathehnae Laubier, 1967 Laubier, 1967 Brl998 Mediterranean Tt2004 Sea EAO Stl985 Pol989 WAO Co2008 PC Vil998 Aricidea (Acmira) lopezi Aricidea lopezi Berkeley & PC H&B1981 Pacific Ocean, Berkeley & Berkeley, 1956 Berkeley, 1956; Acmira Vil998 British Columbia lopezi (Berkeley & Berkeley, 1956); Aricidea fauveli Hartman, 1957; Aricidea assimilis Tebble, 1959 WAO C&K2008 Aricidea (Acmira) simplex Aricidea simplex Day, 1963; PC H&B1981 Atlantic Ocean, Day, 1963 Aricidea neosuecica South Africa Hartman, 1965 Aricidea (Allia) ramosa Aricidea ramosa PC H&B1981 Arctic Ocean, Annenkova, 1934 Annenkova, 1934 Vil998 Siberia Aricidea (Aricidea) Aricidea (Allia) albatrossae AT Brl998 Atlantic Ocean, albatrossae Pettibone, Pettibone, 1957 Pol989 northern region 1957 171 Species Synonym ized taxa Region Citation Type Locality WAO Aricidea (Aricidea) wassi AT Pol989 Atlantic Ocean, Pettibone, 1965 Virginia Aricidea jeffreysii Scolecolepis jeffreysii AT Pel 963 Arctic Ocean, (Mcintosh, 1879) Mcintosh, 1879; Aricidea LM977 Davis Strait jeffreysi (Mcintosh, 1879); Aricidea (Aricidea) jeffreysii (Mcintosh, 1879) PC B&B1952 Bel968 WAO A&W1989C C&K2008 Aricidea minuta PC H&B1981 Atlantic Ocean, Southward, 1956 Vil998 Irish Sea Aricidea nolani Webster & AT Pol989 Atlantic Ocean, Benedict, 1887 Tt2004 Maine EAO Pol989 WAO Co2008 Aricidea quadrilobata Aricidea (AIlia) AT Li 1977 Atlantic Ocean, Webster & Benedict, 1887 quadrilobata Webster & Pol989 Maine Benedict, \%%1\ Aricidea Tt2004 (Aricidea) quadrilobata Webster & Benedict, 1887 PC H&B1981 Aricidea suecica Eliason, Aricidea (Allia) suecia AT Pel963 Atlantic Ocean, 1920 Eliason, 1920; Allia suecia Li 1977 Sweden (Eliason, 1920); Aricidea Br 1979 heteroseta Hartman, 1948 Brl998 EAO WL1950 Cul972 B&D1973 Cul979 Stl985 A&W1989b PC Hal 948 WAO B&C1979 A&W1989C C&K2008 Co2008 Aricidea tetrabranchia AT Pol989 Atlantic Ocean, Hartman & Fauchald, 1971 New England Aricidea nschakovi Zachs, Aricidea longicornuta PC B&B1952 Arctic Ocean, 1925 Berkeley & Berkeley, 1950 Be 1968 Kola fjord Cirrophorus branchiatus Paradoneis branchiatus AT Brl998 Atlantic / Indian Ehlers, 1908 (Ehlers, 1908) Ocean, South Africa PC H&B1981 Cirrophorus brevicirratus AT Brl998 Southern Ocean Strelzov, 1973 172 Species Synonymized taxa Region Citation Type Locality Cirrophorus furcatus Aricidea (Cirrophorus) AT Brl998 Pacific Ocean, (Hartman, 1957) furcata Hartman, 1957 California Cirrophorus lyra Paraonis lyra Southern, AT Pel963 Atlantic Ocean, (Southern, 1914) 1914; Paradoneis lyra Brl979 Ireland (Southern, 1914) Pol989 Brl998 PC H&B1981 Levinsenia gracilis Aonides gracilis Tauber AT Pel963 Atlantic Ocean, (Tauber, 1879) 1879; Paraonis gracilis Li 1977 Denmark (Tauber, 1879); Tauberia Pol989 gracilis (Tauber, 1879) Brl998 Tt2004 EAO B&D1973 Stl985 Pol989 PC H&B1981 Vil998 WAO B&C1979 C&K2008 Paradoneis spinifera Paraonis spinifera Hobson, PC H&B1981 Pacific Ocean, (Hobson, 1972) 1972; Paraonella spinifera Vil998 Washington (Hobson, 1972) Paraonella platybranchia Paraonis platybranchia PC H&B1981 Pacific Ocean, (Hartman, 1961) Hartman 1961 California and Panama WAO C&K2008 Paraonis fulgens Aonides fulgens Levinsen, AT Lil977 Atlantic Ocean, (Levinsen, 1883) 1883; Paraonis (Paraonis) Brl979 Denmark fulgens (Levinsen, 1883) Pol989 Brl998 Tt2004 EAO Pol989 Paraonis sp. WAO C&K2008 Parergodrilidae Stygocapitella subterranea PC H&B1981 Atlantic Ocean, Knollner, 1934 Germany Pectinariidae Amphictene moorei Pectinaria (Amphictene) PC H&B1981 Arctic Ocean, (Annenkova, 1929) moorei Annenkova, 1929 Siberia Cistenides brevicoma Pectinaria brevicoma PC B&B1942 Pacific Ocean, (Johnson, 1901) Johnson, 1901; Pectinaria Hal 948 Alaska (Cistenides) brevicoma B&B1952 Johnson, 1901 Bel968 Pectinaria (Amphictene) Amphitrite auricoma AT Trl948 Atlantic Ocean, auricoma (O.F. Miiller, Muller, Ml6; Amphictene Denmark 1776) auricoma (O.F. Muller, 1776); Pectinaria auricoma (O.F. Muller, 1776) PC B&B1942 Hal 948 173 Species Synonymized taxa Region Citation Type Locality B&B1952 Bel968 Bel972 Pectinaria (Cistenides) Cistenides hyperborea AT Trl948 Arctic Ocean, hyperborea (Malmgren, Malmgren, 1866; Cistena Li 1977 Spitsbergen and 1866) hyperborea (Malmgren, F&P1984 Greenland 1866); Pectinaria Pol989 hyperborea (Malmgren, Brl998 1866) EAO WL1950 Grl954 E11960 Cul972 Cul979 W&A1987 A&W1989b Pol989 HB B&B1943 A&W1989a PC B&B1942 Hal948 WAO Pel954 B&C1979 A&W1989C C&K2008 Co2008 Pectinaria (Pectinaria) Nereis cylindraria belgica PC B&B1942 Atlantic Ocean, belgica (Pallas, 1766) Pallas, 1766; Pectinaria Hal948 Belgium belgica (Pallas, 1766) B&B1952 Bel968 Pectinaria (Pectinaria) Pectinaria californiensis PC H&B1981 Pacific Ocean, californiensis (Hartman, Hartman, 1941 California 1941) Pectinaria gouldii (Verrill, Cistenides gouldii Verrill, AT Li 1977 Atlantic Ocean, 1873) 1873; Cistena gouldii Pol989 New England (Verrill, 1873); Pectinaria Brl998 gouldi (Verrill, 1873) Tt2004 Pectinaria granulata Sabella granulata Linnaeus, AT Li 1977 Atlantic Ocean, (Linnaeus, 1767) 1767; Cistenides granulata F&P1984 Europe (Linnaeus, 1767); Pol989 Pectinaria (Cistenides) Brl998 granulata (Linnaeus, 1767); Tt2004 Cistena granulata Q&S2005 (Linnaeus, 1767) EAO Trl937 WL1950 Grl954 El 1960 E11961 Cul972 Cul979 W&A1987 A&W1989b Pol989 174 Species Synonymized taxa Region Citation Type Locality HB Chi920 B&B1943 PC Chi920 B&B1942 Hal948 H&B1981 WAO Chi920 B&B1942 B&B1944 Pel954 A&W1989c C&K2008 Pholoidae Pholoe anoculata Pholoe minuta anoculata AT Pol 989 Atlantic Ocean, Hartman, 1965 Hartman, 1965 New England Pholoe baltica 0rsted, Pholoe tuberculata PC B&B1948 Atlantic Ocean, 1843 Southern, 1914 Be 1967 Oresund Pholoe glabra Hartman, PC Vil998 Pacific Ocean, 1961 California Pholoe longa (O.F. Miiller, Aphrodita longa O.F. AT Pol989 Atlantic Ocean, 1776) Miiller, 1776 Brl998 Greenland EAO Pol 989 WAO C&K2008 Pholoe minuta (Fabricius, Aphrodita minuta Fabricius, AT Trl948 Arctic Ocean, 1780) 1780 Pel 963 Greenland Lil977 Brl979 Pol989 Brl998 Tt2004 EAO WL1950 Grl954 El 1960 Cul972 B&D1973 Cul979 W&A1987 A&W1989b Pol989 HB A&W1989a PC B&B1942 Hal 948 Bel967 B&H1974 WAO Chi920 Pel 954 B&C1979 A&W1989C C&K2008 Co2008 Pholoe tecta Stimpson, AT Brl979 Atlantic Ocean, 175 Species Synonymized taxa Region Citation Type Locality 1854 F&P1984 New Brunswick Pol989 Q&S2005 Pholoides asperus Peisidice aspera Johnson, PC B&B1942 Pacific Ocean, (Johnson, 1897) 1897 B&B1948 California Hal 948 Bel967 B&H1974 Vil998 Phyllodocidae Anaitides arenae (Webster, Phyllodoce arenae Webster, AT Trl948 Atlantic Ocean, 1879) 1879; Phyllodoce Pol989 New Jersey (Anaitides) arenae Webster, Brl998 1879; Anaitides catenula (Verril, 1873) EAO Pol989 Anaitides citrina Phyllodoce citrina EAO WL1950 Arctic Ocean, (Malmgren, 1865) Malmgren, 1865; Spitsbergen and Phyllodoce (Anaitides) Greenland citrina Malmgren, 1865 PC Be 1924 B&B1948 Hal948 Bel967 B&H1974 Anaitides williamsi Phyllodoce (Anaitides) PC B&H1974 Pacific Ocean, Hartman, 1936 williamsi (Hartman, 1936) California Bergstroemia Eulalia (Bergstroemia) PC Be 1924 Pacific Ocean, nigrimaculata (Moore, nigrimaculata Moore, 1909; B&B1942 California 1909) Eulalia nigrimaculata B&B1948 Moore, 1909; Genetyllis Be1967 nigrimaculata (Moore, B&H1974 1909) Eteone barbata Mysta barbata Malmgren, AT Pol989 Atlantic Ocean, (Malmgren, 1865) 1865; Eteone (Mysta) Brl998 Sweden barbata (Malmgren, 1865) EAO Pol989 WAO B&B1942 Pel954 C&K2008 PC Vil998 Eteone californica PC Hal 948 Pacific Ocean, Hartman, 1936 Vil998 California Eteone cylindrica 0rsted, AT Trl948 Arctic Ocean, 1842 Greenland Eteone flava (Fabricius, Nereis flava Fabricius, AT Trl948 Arctic Ocean, 1780) 1780; Eteone sarsii 0rsted, Pel 963 Greenland 1843 Li 1977 Pol989 Brl998 Tt2004 176 Species Synonymized taxa Region Citation Type Locality EAO WL1950 Grl954 E11955 E11960 Oil972 B&D1973 Cul979 Stl985 Pol989 HB A&W1989a WAO Pel 954 B&C1979 A&W1989C C&K2008 Eteone longa (Fabricius, Nereis longa Fabricius, AT Trl948 Arctic Ocean, 1780) 1780; Eteone (Eteone) longa Pel963 Spitsbergen (Fabricius, 1780); Eteone Li 1977 arctica Malmgren, 1867 Brl979 Pol989 Brl998 Tt2004 EAO WL1950 Grl954 E11955 E11960 E11961 Stl985 W&A1987 A&W1989b Pol989 HB B&B1943 A&W1989a PC B&B1948 Bel967 B&H1974 WAO Chi920 Pel 954 A&W1989C C&K2008 Eteone pacifica Hartman, Eteone (Eteone) pacifica PC B&H1974 Pacific Ocean, 1936 Hartman, 1936; Eteone Washington maculata Treadwell, 1922; Eteone spetsbergensis pacifica Berkeley & Berkeley, 1942 WAO C&K2008 Eteone pusilla Orsted, AT Trl948 Atlantic Ocean, 1843 Sweden Eteone spetsbergensis Eteone (Eteone) AT Trl948 Arctic Ocean, Malmgren, 1865 spetsbergensis Malmgren, Pol989 Spitsbergen 1865 Brl998 EAO Pol989 177 Species Synonym ized taxa Region Citation Type Locality PC Be 1924 B&B1942 B&B1948 Hal 948 Be1967 B&H1974 WAO Pel954 Eteone trilineata Webster AT Trl948 Atlantic Ocean, & Benedict, 1887 Li 1977 Maine Pol 989 Tt2004 Eteone tuberculata Eteone (Eteone) tuberculata PC B&H1974 Pacific Ocean, Treadwell, 1922 Treadwell, 1922 Washington Eulalia bilineata Phyllodoce bilineata AT Trl948 Atlantic Ocean, (Johnston, 1840) Johnston, 1840; Eulalia Pel963 England problema Malmgren, 1865; Lil977 Eulalia bilineata Webster & Brl979 Benedict, 1887 Pol989 Brl998 Tt2004 EAO WL1950 Grl954 B&D1973 Stl985 W&A1987 Pol989 PC Be1924 B&B1942 B&B1948 Be1967 Eulalia dubia Webster & AT Trl948 Atlantic Ocean, Benedict, 1884 Massachusetts Eulalia levicornuta Moore, Eulalia (Eulalia) HB B&B1943 Pacific Ocean, 1909 levicornuta Moore, 1909 California PC Bel 924 B&H1974 Eulalia quadrioculata Eulalia (Eulalia) PC B&H1974 Pacific Ocean, Moore, 1906 quadrioculata Moore, 1909 Vil998 Washington Eulalia tripunctata EAO WL1950 Atlantic Ocean, Mcintosh, 1874 Scotland Eulalia viridis (Linnaeus, Nereis viridis Linnaeus, AT Trl948 Atlanatic Ocean, 1767) 1767; Eulalia (Eulalia) Pel 963 North Sea viridis (Linnaeus, 1767) Lil977 Brl979 Pol989 Brl998 Tt2004 EAO WL1950 Pol989 PC Be1924 B&B1942 B&B1948 Hal 948 Bel967 178 Species Synonymized taxa Region Citation Type Locality B&H1974 Eumida longicornuta Eulalia longicornuta Moore, PC B&H1974 Pacific Ocean, (Moore, 1906) 1906; Eulalia (Eumida) Washington longicornuta Moore, 1906 Eumida minuta (Ditlevsen, Eulalia minuta Ditlevsen, WAO Pel 954 Arctic Ocean, 1917) 1917 Davis Strait Eumida sanguinea (0rsted, Eulalia sanguinea 0rsted, AT Trl948 Atlantic Ocean, 1843) 1843; Eulalia (Eumida) Pel 963 Denmark sanguinea 0rsted, 1843 Li 1977 Brl979 Pol989 Brl998 PC Be 1924 B&B1948 Bel967 B&H1974 Eumida sp. HB A&W1989a Hesionura coineaui Eteonides coineaui difficilis PC B&H1974 Pacific Ocean, difficilis (Banse, 1963) Banse, 1963 Washington Hypereteone foliosa Eteone foliosa Quatrefages, AT Pel 963 Atlantic Ocean, (Quatrefages, 1866) 1866; Eteone lactea Brl979 France Claparede, 1868 Pol989 Brl998 Tt2004 Hypereteone heteropoda Eteone heteropoda AT Pel 963 Atlantic Ocean, (Hartman, 1951) Hartman, 1951 Li 1977 Gulf of Mexico Brl979 Pol989 Brl998 Tt2004 Mystides borealis Theel, AT Pel963 Arctic Ocean, 1879 Lil977 Novaya Zemlya Pol989 Brl998 Tt2004 EAO WL1950 A&W1989b Pol989 PC B&H1974 WAO Pel 954 C&K2008 Nereiphylla castanea Carobia castanea PC B&B1948 Pacific Ocean, (Marenzeller, 1879) Marenzeller, 1879; Bel967 Japan Phyllodoce (Genetyllis) B&H1974 castanea (Marenzeller, 1879) Notalia sp. EAO Stl985 Notophyllum foliosum (M. Phyllodoce foliosa M. Sars, PC Hal 948 Atlantic Ocean, Sars, 1835) 1835 Pel963 Norway Notophyllum imbhcatum Notophyllum (Notophyllum) PC Be1924 Pacific Ocean, Moore, 1906 imbricatum Moore, 1906 B&B1942 Alaska B&B1948 179 Species Synonymized taxa Region Citation Type Locality Hal948 Bel967 B&H1974 Paranaitis kosteriensis Anaitis kosteriensis AT Pol989 Atlantic Ocean, (Malmgren, 1867) Malmgren, 1867 Sweden Paranaitis polynoides Anaitis polynoides Moore, PC Be1924 Pacific Ocean, (Moore, 1909) 1909; Phyllodoce B&B1942 California (Paranaitis) polynoides B&B1948 (Moore, 1909) Be1967 B&H1974 Paranaitis speciosa Anaitis speciosa Webster, AT Lil977 Atlantic Ocean, (Webster, 1879) 1879 F&P1984 New Jersey Pol989 Brl998 Tt2004 Paranaitis wahlbergi Anaitis wahlbergi EAO Pol989 Arctic Ocean, (Malmgren, 1865) Malmgren, 1865 Spitsbergen PC Be1967 WAO B&B1944 A&W1989C C&K2008 Phyllodoce (Anaitides) Phyllodoce groenlandica AT Trl948 Arctic Ocean, groenlandica 0rsted, 1843 0rsted, 1843; Anaitides Pel963 Greenland groenlandica (0rsted, Li 1977 1843); Phyllodoce assimilis Brl979 0rsted, 1843; Phyllodoce F&P1984 badia Malmgren, 1867 Pol989 Brl998 Tt2004 EAO WL1950 Grl954 El 1960 Cul972 Stl985 W&A1987 Pol989 HB B&B1943 A&W1989a PC Be 1924 B&B1942 Hal948 Be1967 B&H1974 Vil998 WAO Chi920 Pel954 B&C1979 A&W1989C C&K2008 Phyllodoce (Anaitides) Nereis maculata Linnaeus, AT Trl948 Atlantic Ocean, maculata (Linnaeus, 1767) 1767; Anaitides maculata Li 1977 Europe (Linnaeus, 1767); Brl979 Phyllodoce maculata F&P1984 (Linnaeus, 1767) Pol989 180 Species Synonym ized taxa Region Citation Type Locality Brl998 Tt2004 EAO WL1950 Pol989 HB B&B1943 PC B&B1948 Bel 967 B&H1974 Phyllodoce (Anaitides) Phyllodoce mucosa 0rsted, AT Pel963 Atlantic Ocean, mucosa 0rsted, 1843 1843; Anaitides mucosa Li 1977 Denmark (Orsted, 1843) Brl979 F&P1984 Pol989 Brl998 Tt2004 Q&S2005 EAO WL1950 Cul979 A&W1989b Pol989 HB B&B1943 PC B&B1948 Hal 948 Bel967 B&H1974 WAO C&K2008 Phyllodoce (Anaitides) PC B&H1974 Pacific Ocean, multiseriata Rioja, 1941 Mexico Phyllodoce hartmanae Anaitides hartmanae (Blake PC Vil998 Pacific Ocean, Blake and Walton, 1977 and Walton, 1977) California Phyllodoce lamelligera Nereis lamelligera AT Brl998 Atlantic Ocean, (Linnaeus, 1791) Linnaeus, 1791 Europe Phyllodoce longipes Anaitides longipes (Kinberg, PC VU998 Pacific Ocean, Kinberg, 1866 1866) Chile Phyllodoce madeirensis Phyllodoce (Anaitis) PC B&B1942 Atlantic Ocean, Langerhans, 1880 madeirensis Langerhans, B&B1948 Madeira 1880 Bel967 B&H1974 Phyllodoce medipapillata Anaitides medipapillata PC Hal 948 Pacific Ocean, Moore, 1909 (Moore, 1909) California Protomystides occidentalis Mystides occidentalis EAO WL1950 Arctic Ocean, (Ditlevsen, 1917) Ditlevsen, 1917 Davis Strait Pterocirrus parvoseta Eulalia (Pterocirrus) PC B&H1974 Pacific Ocean, (Banse & Hobson, 1968) parvoseta Banse & Hobson, Washington 1968 Sige bifoliata (Moore, Eulalia (Sige) bifoliata PC Bel 924 Pacific Ocean, 1909) Moore, 1909; Eulalia California bifoliata Berkeley, 1924 Sige fusigera Malmgren, Eumida fusigera AT Pol989 Atlantic Ocean, 1865 (Malmgrean, 1865) Sweden Sige longocirrata (Stop- Eulalia longocirrata Stop- AT PI 1990 Atlantic Ocean, Bowitz, 1948) Bowitz, 1948 northeastern 181 Species Synonymized taxa Region Citation Type Locality region Sige macroceros (Grube, Eulalia (Pterocirrus) PC Be1924 Atlantic Ocean, 1860) macroceros Grube, 1860; B&B1948 Mediterranean Eulalia (Sige) macroceros Be 1967 Sea Grube, 1860; Phyllodoce B&H1974 (Eulalia) macroceros Grube, 1860 Pilargidae Ancistrosyllis groenlandica AT Pel963 Arctic Ocean, Mcintosh, 1879 Pol989 Davis Strait Brl998 EAO WL1950 Stl985 Pol989 PC B&H1974 Otopsis longipes Ditlevsen, PC B&H1974 Atlantic Ocean, 1917 Ireland Pilargis berkeleyae Monro, PC B&B1948 Pacific Ocean, 1933 Bel967 Washington B&H1974 Sigambra healyae Gagaev, WAO Ga2008 Arctic Ocean, 2008 Canada Basin Sigambra setosa Fauchald, PC VM998 Pacific Ocean, 1972 Mexico Sigambra tentaculata Ancistrosyllis tentaculata WAO B&C1979 Atlantic Ocean, (Treadwell, 1941) Treadwell, 1941 New York Synelmis albini Ancistrosyllis albini AT Pol989 Atlantic Ocean, (Langerhans, 1881) Langerhans, 1881 Canary islands Poeobiidae Poeobius meseres Heath, PC Bel968 Pacific Ocean, 1930 California Polygordiidae Polygordius sp. AT Brl998 Polynoidae Acanthicolepis asperrima Polynoe asperrima M. Sars, AT Trl948 Atlantic Ocean, (M. Sars, 1861) 1861 Norway Alentia gelatinosa (M. Polynoe gelatinosa M. Sars, AT Trl948 Atlantic Ocean, Sars, 1835) 1835, Halosydna gelatinosa Norway (M. Sars, 1835) Alentiana aurantiaca Polynoe aurantiaca Verrill, AT Pel 963 Atlantic Ocean, (Verrill, 1885) 1885 Pol989 New England Arcteobia anticostiensis Eupolynoe anticostiensis AT Trl948 Atlantic Ocean, (Mcintosh, 1874) Mcintosh, 1874; Arcteobea Pel 963 Gulf of St. anticostiensis (Mcintosh, Lil977 Lawrence 1874); Eucranta F&P1984 anticostiensis (Mcintosh, Pol989 1874) Brl998 WAO Pel 954 C&K2008 182 Species Synonymized taxa Region Citation Type Locality PC Vil998 Arctonoe caeca (Moore, Eunoe caeca Moore, 1910; PC Be 1967 Pacific Ocean, 1910) Intoshella caeca (Moore, California 1910) Arctonoe fragilis (Baird, Lepidonotus fragilis Baird, PC B&B1948 Pacific Ocean, 1863) 1863 Bel967 Vancouver Island B&H1974 Arctonoe pulchra Polynoe pulchra Johnson, PC B&B1942 Pacific Ocean, (Johnson, 1897) 1897 B&B1948 California Hal948 Bel967 B&H1974 Arctonoe vittata (Grube, Polynoe vittata Grube, PC Chi920 Pacific Ocean, 1855) 1855; Arctonoe lia B&B1942 Alaska Chamberlin, 1920 B&B1948 Hal948 Bel967 B&H1974 Austrolaenilla mollis (M. Laenilla mollis M. Sars in AT Pel 963 Atlantic Ocean, SarsinG.O. Sars,1872) G.O. Sars, 1872; Antinoe Pol 989 Norway mollis CM. Sars in G.O. Brl998 Sars, 1872); Harmothoe mollis (M. Sars in G.O. Sars, 1872) EAO WL1950 B&D1973 Pol989 Bathycanadia diaphana WAO Lel981 Arctic Ocean, Levenstein, 1981 Canada Basin Bathyedithia tuberculata WAO Lel981 Arctic Ocean, Levenstein, 1981 Canada Basin Bathymiranda WAO Lel981 Arctic Ocean, microcephala Levenstein, Canada Basin 1981 Bathypolaria carinata WAO Lel981 Arctic Ocean, Levenstein, 1981 Canada Basin Bylgides belfasttnsis AT Pel993 Atlantic Ocean, Pettibone, 1993 Maine Bylgides elegans (Theel, Bylgia elegans Theel, 1879 AT Pel 993 Arctic Ocean, 1879) Brl998 Novaya Zemlya PC Pel 993 WAO Pel993 Bylgides fusca (Hartman & Antinoana fusca Hartman & AT Pol989 Atlantic Ocean, Fauchald, 1971) Fauchald, 1971 northwestern region Bylgides groenlandicus Antinoe groenlandica AT F&P1984 Arctic Ocean, (Malmgren, 1867) Malmgren, 1867\Antinoella Pol989 Greenland angusta (Verrill, 1874) Brl998 Bylgides macrolepidus Antinoe macrolepida PC B&B1948 Pacific Ocean, (Moore, 1905) Moore, 1905; Antinoella Hal 948 British Columbia macrolepida (Moore, 1905) Bel967 B&H1974 183 Species Synonymized taxa Region Citation Type Locality Pel993 Bylgides promamme Antinoe promamme AT Pol989 Arctic Ocean, (Malmgren, 1867) Malmgren, 1867 Spitsbergen EAO WL1950 Pol989 Pel 993 WAO Pel 993 C&K2008 Bylgides sarsi (Malmgren, Antinoe sarsi Malmgren, AT Trl948 Atlantic Ocean, 1866) 1866; Antinoella sarsi Pel 963 Europe (Malmgren, 1866) Li 1977 Pol989 EAO WL1950 Cul972 B&D1973 Cul979 A&W1989b Pol989 PC Chi920 Hal948 WAO Chi920 Pel 954 B&C1979 A&W1989C C&K2008 Enipo canadensis Nemidia canadensis AT Trl948 Pacific Ocean, (Mcintosh, 1874) Mcintosh, 1874; Polynoe Pel 963 California canadensis (Mcintosh, Pol989 1874); Nemidia microlepida Brl998 Moore, 1910 EAO Pol989 PC B&H1974 Enipo gracilis Verrill, Polynoe gracilis (Verrill, AT Trl948 Atlantic Ocean, 1874 1874); Polynoe gaspeensis Pol989 Maine Mcintosh, IS74; Enipo Brl998 cirrata Treadwell, 1925 EAO Pol989 PC B&B1942 B&B1948 Hal948 Bel967 B&H1974 WAO Pel954 Enipo torelli (Malmgren, Nemidia torelli Malmgren, AT Trl948 Arctic Ocean, 1866) 1866; Nemidia lawrencii Pel 963 Spitsbergen Mcintosh, 1874 Pol989 Brl998 EAO Pol989 WAO C&K2008 184 Species Synonymized taxa Region Citation Type Locality Eucranta villosa Eucranta occidentalis AT Trl948 Atlantic Ocean, Malmgren, 1866 Mcintosh, 1874 Pel963 Sweden Pol989 Brl998 EAO WL1950 Cul972 Pol989 HB A&W1989a WAO A&W1989c C&K2008 Eunoe bathydomus Harmothoe bathydomus EAO WL1950 Atlantic Ocean, (Ditlevsen, 1917) Ditlevsen, 1917 Greenland Eunoe clarki Pettibone, WAO Pel 954 Arctic Ocean, 1951 Alaska Eunoe depressa Moore, HB B&B1943 Pacific Ocean, 1905 Alaska PC Hal948 B&H1974 WAO C&K2008 Eunoe globifera (G.O. Nychia globifera G.O. Sars, EAO WL1950 Atlantic Ocean, Sars, 1873) 1873; Harmothoe globifera Norway (G.O. Sars, 1873) Eunoe nodosa (M. Sars, Polynoe nodosa M. Sars, AT Trl948 Atlantic Ocean, 1861) 1861; Harmothoe nodosa Pel 963 Norway (M. Sars, 1861); Harmothoe Li 1977 (Eunoe) nodosa (M. Sars, Pol989 1861) Brl998 Tt2004 EAO WL1950 Grl954 W&A1987 A&W1989b Pol989 HB B&B1943 PC Hal 948 Bel967 B&H1974 WAO Pel 954 B&B1942 A&W1989c C&K2008 Eunoe oerstedi Malmgren, Harmothoe oerstedi AT Trl948 Atlantic Ocean, 1866 (Malmgren, 1866); Pel 963 northeastern Harmothoe (Eunoe) oerstedi LH977 region (Malmgren, 1866); Eunoe Pol989 barbata Moore, 1910; Brl998 Harmothoe capitulifera Tt2004 Ditlevsen, 1911 EAO Trl937 WL1950 B&D1973 Pol989 185 Species Synonymized taxa Region Citation Type Locality PC B&B1948 Hal948 Be1967 B&H1974 WAO Pel954 A&W1989c C&K2008 Eunoe senta (Moore, 1902) Gattyana senta Moore, 1902 PC B&B1948 Arctic Ocean, Hal 948 Alaska Be1967 B&H1974 Eunoe spinulosa Verrill, Eunoa spinulosa Verrill, AT Trl948 Atlantic Ocean, 1879 1879; Harmothoe (Eunoe) Pel 963 New Brunswick spinulosa (Verrill, 1879) Brl998 Eunoe uniseriata Banse & PC B&H1974 Pacific Ocean, Hobson, 1968 Puget Sound Gattyana amondseni Nychia amondseni AT Trl948 Arctic Ocean, (Malmgren, 1867) Malmgren, 1867 Pel 963 Greenland F&P1984 Pol989 Brl998 EAO WL1950 Grl954 Pol989 PC Hal 948 Gattyana ciliata Moore, PC B&B1948 Pacific Ocean, 1902 Hal 948 Alaska Be 1967 B&H1974 WAO Pel954 Gattyana cirrhosa (Pallas, Aphrodita cirrhosa Pallas, AT Trl948 Atlantic Ocean, 1766) 1766; Gattyana cirrosa Pel963 Europe (Pallas, 1766) Lil977 Brl979 F&P1984 Pol989 Brl998 Tt2004 EAO Trl937 WL1950 Grl954 El 1960 Cul972 B&D1973 Cul979 W&A1987 A&W1989b Pol989 HB B&B1943 A&W 1989a PC B&B1942 B&B1948 Hal948 186 Species Synonymized taxa Region Citation Type Locality Be1967 B&H1974 WAO Chi920 Pel954 A&W1989c C&K2008 Gattyana nutti Pettibone, AT Pel963 Atlantic Ocean, 1955 Pol989 Canada Brl998 EAO B&D1973 Pol989 Gattyana pacifica Harmothoe pacifica PC Jol901 Pacific Ocean, (Johnson, 1901) Johnson, 1901 Puget Sound Gattyana treadwelli PC B&H1974 Pacific Ocean, Pettibone, 1949 Washington and Alaska Gaudichaudius Harmothoe iphionellioides PC B&B1948 Pacific Ocean, iphionelloides (Johnson, Johnson, 1901; Gattyana Hal 948 Washington 1901) iphionellioides (Johnson, Bel967 1901) B&H1974 Grubeopolynoe tuta Polynoe tuta Grube, 1855; PC B&B1942 Pacific Ocean, (Grube, 1855) Polyeunoa tuta (Grube, B&B1948 Alaska 1855) Hal 948 Bel967 B&H1974 Halosydna brevisetosa PC B&B1942 Pacific Ocean, Kinberg, 1856 B&B1948 California Hal 948 Be 1967 B&H1974 Harmothoe abyssicola Polynoe impar Johnston, EAO Trl937 Atlantic Ocean, Bidenkap, 1894 1839; Evarnella impar WL1950 Norway (Johnston, 1839); Harmothoe impar (Johnston, 1839) WAO Chi920 Harmothoe aspera Polynoe aspera Hansen, EAO WL1950 Atlantic Ocean, (Hansen, 1879) 1879 North Sea Harmothoe extenuata Polynoe extenuata Grube, AT Pel 963 Atlantic Ocean, (Grube, 1840) 1840; Harmothoe (Lagisca) Li 1977 Mediterranean extenuata (Grube, 1840); Brl979 Sea Lagisca extenuata F&P1984 (Grube, 1840) Pol989 Brl998 Tt2004 EAO WL1950 B&D1973 W&A1987 A&W1989b Pol989 HB B&B1943 A&W1989a PC B&B1942 Hal948 187 Species Synonymized taxa Region Citation Type Locality Be1967 B&H1974 WAO Pel954 A&W1989c C&K2008 Harmothoe fragilis Moore, Harmothoe (Evarne) fragilis AT Pel963 Pacific Ocean, 1910 Moore, 1910 Pol989 California Brl998 EAO Pol989 PC B&H1974 VH998 Harmothoe glabra Laenilla glabra Malmgren, AT Trl948 Atlantic Ocean, (Malmgren, 1866) 1866; Malmgreniella glabra Mediterranean (Malmgren, 1866); Polynoe Sea longisetis Grube, 1863; Harmothoe longisetis (Grube, 1863) EAO WL1950 Harmothoe hirsuta PC Hal 948 Pacific Ocean, Johnson, 1897 Alaska to California Harmothoe imbricata Aphrodita imbricata AT Chi920 Atlantic Ocean, (Linnaeus, 1767) Linnaeus, 1767 Trl948 North Sea Li 1977 Brl979 F&P1984 Pol989 Brl998 Tt2004 EAO Chi920 Trl937 WL1950 Grl954 E11960 E11961 B&D1973 Cul979 W&A1987 A&W1989b Pol989 HB Chi920 B&B1943 A&W1989a PC Chi920 B&B1942 B&B1948 Hal 948 Be 1967 B&H1974 WAO Chi920 Pel954 B&B1944 A&W1989C 188 Species Synonymized taxa Region Citation Type Locality C&K2008 Harmothoe multisetosa Lagisca multisetosa Moore, PC B&B1942 Pacific Ocean, (Moore, 1902) 1902 B&B1948 Alaska Hal 948 Be1967 B&H1974 WAO B&B1944 C&K2008 Harmothoe rarispina (M. Polynoe rarispina M. Sars, AT Trl948 Atlantic/Arctic Sars, 1861) 1861; Lagisca rarispina (M. Tt2004 Ocean, Norway Sars, 1861); Lagisca rarispina (Malmgren 1866) EAO Chl920 E11955 HB B&B1943 PC B&B1948 Hal948 Be1967 Harmothoe tenebricosa PC Be1967 Pacific Ocean, Moore, 1910 California Harmothoe triannulata PC B&B1948 Pacific Ocean, Moore, 1910 Be 1967 California Hartmania moorei AT Pel 963 Atlantic Ocean, Pettibone, 1955 Li 1977 New England F&P1984 Pol989 Brl998 Q&S2005 EAO Cul972 Cul979 Pol989 WAO C&K2008 Hermadionella truncata Hermadion truncata Moore, PC B&B1948 Pacific Ocean, (Moore, 1902) 1902; Harmothoe (Eunoe) Hal 948 Alaska truncata Moore, 1902 Be1967 B&H1974 Hermilepidonotus robustus Lepidonotus robustus PC Hal948 Pacific Ocean, (Moore, 1905) Moore, 1905 Alaska Hesperonoe adventor Harmothoe adventor WAO C&K2008 Pacific Ocean, (Skogsberg, 1928) Skogsberg 1928 California Hesperonoe complanata Harmothoe complanata PC B&B1948 Pacific Ocean, (Johnson, 1901) Johnson, 1901 Bel 967 Puget Sound B&H1974 Hololepida magna Moore, PC B&B1948 Pacific Ocean, 1905 Hal 948 British Columbia Be1967 B&H1974 Lagisca lamellifera Polynoe lamellifera PC Hal 948 Pacific Ocean, (Marenzeller, 1879) Marenzeller, 1879 Be1967 Japan Lepidametria commensalis AT Lil977 Atlantic Ocean, Webster, 1879 Tt2004 Virginia Lepidasthenia berkeleyae PC Be1967 Pacific Ocean, 189 Species Synonymized taxa Region Citation Type Locality Pettibone, 1948 B&H1974 Puget Sound Lepidasthenia longicirrata Lepidametria longicirrata PC B&B1942 Pacific Ocean, Berkeley, 1923 (Berkeley, 1923) B&B1948 British Columbia Be 1967 Be 1972 B&H1974 Lepidonotus squamatus Aphrodita squamata AT Trl948 Atlantic Ocean, (Linnaeus, 1758) Linnaeus, 1758; Pel963 Europe Lepidonotus caelorus Li 1977 Moore, 1903 Brl979 F&P1984 Pol989 Brl998 Tt2004 PC B&B1942 B&B1948 Hal 948 Bel967 B&H1974 Lepidonotus sp. WAO C&K2008 Macellicephala violacea Oligolepis violacea EAO WL1950 Arctic Ocean, (Levinsen, 1887) Levinsen, 1887 Greenland Malmgreniella lunulata Polynoe lunulata delle PC B&B1948 Atlantic Ocean, (delle Chiaje, 1830) Chiaje, 1830; Harmothoe B&H1974 Mediterranean lunulata (delle Chiaje, 1830) Sea Malmgreniella macginitiei PC Vil998 Pacific Ocean, Pettibone, 1993 California Malmgreniella nigralba Malmgrenia nigralba PC B&B1942 Pacific Ocean, (Berkeley, 1923) Berkeley, 1923; Harmothoe B&B1948 British Columbia nigralba (Berkeley, 1923) Bel 967 Melaenis loveni Malmgren, AT Pol989 Arctic Ocean, 1865 Spitsbergen EAO WL1950 Cul972 Pol989 PC Hal948 WAO Pel 954 A&W1989C C&K2008 Minusculisquama hughesi AT Pol989 Atlantic Ocean, Pettibone, 1983 Brl998 Nova Scotia Phyllosheila wigleyi AT Pel961 Atlantic Ocean, Pettibone, 1961 Massachusetts Polynoe acanellae Verrill, Harmothoe (Hermadion) AT Pel 963 Atlantic Ocean, 1881 acanellae (Verrill, 1881) Massachusetts EAO WL1950 Tenonia priops (Hartman, Harmothoe priops Hartman, PC B&H1974 Pacific Ocean, 1961) 1961; Tenonia kitsapensis Vil998 California Nichols, 1969 Pontodoridae 190 Species Synonymized taxa Region Citation Type Locality Pontodora pelagica Epitoka pelagica Treadwell, PC Bel967 Atlantic Ocean, Greeff, 1879 1943 Canary Islands Protodrilidae Protodriloides cf. chaetifer Protodrilus chaetifer AT Tt2004 Atlantic Ocean, (Remane, 1926) Remane, 1926 Baltic Sea Protodriloides chaetifer Protodrilus chaetifer PC H&B1981 Atlantic Ocean, (Remane, 1926) Remane, 1926 Baltic Sea Protodrilus flabelliger PC H&B1981 Pacific Ocean, Wieser, 1957 Puget Sound Protodrilus sp. AT Brl998 Psammodrilidae Psammodrilus AT Tt2004 Atlantic Ocean, balanoglossoides France Swedmark, 1952 Questidae Questa caudicirra PC H&B1981 Pacific Ocean, Hartman, 1966 California Sabellariidae Idanthyrsus macropalea Hermella macropalea PC B&B1942 Pacific Ocean, (Schmarda, 1861) Schmarda, 1861; B&B1952 Chile Idanthyrsus armatus Bel968 Kinberg, 1866 H&B1981 WAO Pel 954 Idanthyrsus saxicavus Sabellaria saxicava Baird, PC Hal 948 Pacific Ocean, (Baird, 1863) 1863; Idanthyrsus H&B1981 British Columbia ornamentatus (Chamberlin, 1919) Neosabellaria Sabellaria cementarium PC B&B1942 Pacific Ocean, cementarium (Moore, Moore, 1906 Hal948 Washington and 1906) B&B1952 Alaska Bel968 H&B1981 Sabellaria vulgaris Verrill, AT Lil977 Atlantic Ocean, 1873 Brl979 Massachusetts Pol989 Sabellidae Bispira crassicornis (M. Sabella crassicornis M. AT Trl948 Atlantic Ocean, Sars, 1851) Sars, 185\; Sabella Lil977 Norway (Sabella) crassicornis M. F&P1984 Sars, 1S51; Sabella Pol989 spetsbergensis Malmgren, Brl998 1866 Tt2004 EAO WL1950 Cul979 W&A1987 A&W1989b Pol989 HB B&B1943 A&W1989a 191 Species Synonymized taxa Region Citation Type Locality PC Hal 948 B&B1952 Bel968 WAO Pel954 Bispira fabricii (Kroyer, Sabella fabricii KrQyer, EAO Grl954 Arctic Ocean, 1856) 1856 Greenland Branchiomma arctica Sabellastarte arctica EAO WL1950 Arctic Ocean, (Ditlevsen, 1937) Ditlevsen, 1937 Greenland Branchiomma infarcata Sabella infarcata Kroyer, AT Pol989 Arctic Ocean, (Kroyer, 1856) 1856; Sabella infarcta Greenland Kroyer, 1856 EAO WL1950 Cul972 Pol989 HB B&B1943 WAO B&B1944 A&W1989C C&K2008 Chone aurantiaca Megachone aurantiaca PC H&B1981 Pacific Ocean, (Johnson, 1901) Johnson, 1901 To2007 Washington Chone bimaculata Banse PC To2007 Pacific Ocean, & Nichols, 1968 Washington Chone duneri Malmgren, AT Trl948 Arctic Ocean, 1867 F&P1984 Spitsbergen Pol989 Brl998 EAO Trl937 WL1950 El 1960 Cul972 B&D1973 Oil 979 Stl985 Pol989 PC H&B1981 WAO B&B1944 Pel 954 C&K2008 Chone ecaudata (Moore, Jasmineira ecaudata Moore, PC B&B1952 Pacific Ocean, 1923) 1923 Be 1968 California H&B1981 Chone gracilis Moore, PC B&B1942 Pacific Ocean, 1906 Hal948 Alaska B&B1952 Bel 968 Chone infundibuliformis Chone fauveli Mcintosh, AT Trl948 Arctic Ocean, Kroyer, 1856 1916; Chone ungavana Li 1977 Greenland Chamberlin, 1920 Pol989 Brl998 EAO Chi920 WL1950 Grl954 192 Species Synonymized taxa Region Citation Type Locality Cul972 B&D1973 W&A1987 A&W1989b Pol989 HB B&B1943 A&W1989a PC B&B1942 Hal948 B&B1952 Bel968 H&B1981 WAO Pel 954 A&W1989C C&K2008 Chone magna (Moore, Euchone magna Moore, PC H&B1981 Pacific Ocean, 1923) 1923 VH998 California Chone murmanica WAO B&C1979 Arctic Ocean, Lukasch, 1910 Kola Fjord Chone quebecensis Tovar- AT To2007 Atlantic Ocean, Hernandez, 2007 Quebec Demonax leucaspis PC B&B1942 Pacific Ocean, Kinberg, 1867 Isla San Lorenzo Demonax medius (Bush, Parasabella media Bush, PC Hal 948 Pacific Ocean, 1905) 1905; Sabella media (Bush, B&B1952 Alaska 1905) Bel968 H&B1981 Distylidia rugosa (Moore, Distylia rugosa Moore, PC B&B1942 Pacific Ocean, 1904) 1904 B&B1952 California Bel968 Euchone analis (Kroyer, Sabella analis Kroyer, 1856 AT Pol989 Arctic Ocean, 1856) Brl998 Greenland EAO WL1950 Grl954 E11960 Cul972 B&D1973 Cul979 W&A1987 A&W1989b Pol989 A&F1993 HB B&B1943 A&W1989a PC B&B1942 Hal948 B&B1952 Bel 968 H&B1981 WAO Chi920 Pel 954 A&W1989C C&K2008 Euchone elegans Verrill, AT F&P1984 Atlantic Ocean, 193 Species Synonymized taxa Region Citation Type Locality 1873 Pol989 Maine Brl998 Euchone incolor Hartman, AT Pol989 Atlantic Ocean, 1965 Brl998 New England EAO Stl985 Pol989 PC H&B1981 WAO C&K2008 Euchone lawrencii AT Brl998 Atlantic Ocean, Mcintosh, 1916 Canada Euchone papillosa (M. Sabella papillosa M. Sars, AT F&P1984 Atlantic Ocean, Sars, 1851) 1851 Pol989 Norway Brl998 Q&S2005 EAO WL1950 Cul972 B&D1973 A&W1989b Pol989 HB A&W1989a WAO A&W1989C C&K2008 Euchone rosea PC Bel968 Atlantic Ocean, Langerhans, 1884 Madeira Euchone rubrocincta (M. Chone rubrocincta M. Sars, AT Trl948 Atlantic Ocean, Sars, 1862) 1862 LH977 Europe Brl998 Euchone tuberculosa Sabella tuberculosa Kr0yer, AT Trl948 Arctic Ocean, (Kroyer, 1856) 1856 Greenland Eudistylia catharinae PC H&B1981 Pacific Ocean, Banse, 1979 British Columbia Eudistylia polymorpha Bispira polymorpha PC B&B1942 Pacific Ocean, (Johnson, 1901) Johnson, 1901 Hal948 California B&B1952 Bel968 H&B1981 Eudistylia tenella Bush, PC Hal 948 Pacific Ocean, 1905 British Columbia Eudistylia vancouveri Sabella vancouveri Kinberg, PC B&B1942 Pacific Ocean, (Kinberg, 1867) 1867 Hal 948 British Columbia B&B1952 Bel968 H&B1981 Fabricia berkeleyi Banse, Fabricia pacifica Berkeley PC B&B1952 Pacific Ocean, 1956 & Berkeley, 1950; Bel968 British Columbia Fabriciola berkeleyi Banse, H&B1981 1956 Fabricia oregonica Banse, Fabricia sabella oregonica PC H&B1981 Pacific Ocean, 1956 Banse, 1956 Oregon Fabricia stellaris stellaris Tubularia stellaris O.F. AT Li 1977 Atlantic Ocean, (O.F. Miiller, 1774) MQller, 111 A; Fabricia Brl979 Denmark stellaris (O.F Muller, 1774); Pol989 194 Species Synonymized taxa Region Citation Type Locality Amphicora sabella Brl998 Ehrenberg, 1836; Fabricia Tt2004 sabella (Ehrenberg, 1836) EAO WL1950 Grl954 A&W1989b Pol989 HB B&B1943 PC B&B1942 B&B1952 Bel968 H&B1981 Fabriciola berkeleyi PC H&B1981 Pacific Ocean, Banse, 1956 British Columbia Jasmineira elegans Saint- AT Pol989 Atlantic Ocean, Joseph, 1894 Brl998 France Jasmineira pacifica PC H&B1981 Pacific Ocean, Annenkova, 1937 Japan Sea J asm ine ira prince i Chone princei Mcintosh, AT Brl998 Atlantic Ocean, (Mcintosh, 1916) 1916; Euchoneprincei Gulf of St. (Mcintosh, 1916) Lawrence Jasmineira schaudinni EAO B&D1973 Arctic Ocean, Augener, 1912 Pol989 Spitsbergen Laonome kroyeri AT F&P1984 Arctic Ocean, Malmgren, 1866 Pol989 Spitsbergen Brl998 EAO Pol989 PC H&B1981 Vil998 WAO A&W1989c C&K2008 Manayunkia aestuarina Haplobranchus aestuarinus AT Brl979 Atlantic Ocean, (Bourne, 1883) Bourne, 1883; F&P1984 England Haplobranchus aestuerina Pol989 Bourne, 1883 Brl998 PC H&B1981 Megalomma splendida Pseudopotamilla splendida PC B&B1942 Pacific Ocean, (Moore, 1905) Moore, 1905; Branchiomma Hal948 Alaska burrardum Berkeley, 1930 B&B1952 Bel968 H&B1981 Myxicola aesthetica Leptochone aesthetica PC Hal 948 Atlantic Ocean, (Claparede, 1870) Claparede, 1870 B&B1952 Mediterranean Bel968 Sea H&B1981 Myxicola infundibulum Terebella infundibulum AT Trl948 Atlantic Ocean, (Renier, 1804) Renier, 1804; Myxicola Li 1977 Mediterranean steenstrupi Krayer, 1856 F&P1984 Sea Pol989 Brl998 Tt2004 EAO A&F1993 195 Species Synonymized taxa Region Citation Type Locality PC B&B1952 Bel968 Be1972 H&B1981 WAO Pel 954 Oriopsis gracilis Hartman, PC H&B1981 Pacific Ocean, 1969 California WAO C&K2008 Oriopsis minuta (Berkeley Fabricia minuta Berkeley & PC B&B1952 Pacific Ocean, & Berkeley, 1932) Berkeley, 1932 Bel968 British Columbia H&B1981 Oriopsis sp. AT Pol989 Potamethus elongatus Potamilla elongata PC Bel 968 Pacific Ocean, (Treadwell, 1906) Treadwell, 1906 Hawaii Potamilla neglecta (M. Sabella neglecta M. Sars, AT Trl948 Atlantic Ocean, Sars, 1851) 1851 Lil977 Norway Brl979 Pol989 Brl998 Tt2004 EAO WL1950 Grl954 B&D1973 Cul979 Stl985 Pol989 PC Hal948 B&B1952 Bel968 H&B1981 WAO Pel954 A&W1989C C&K2008 Potamilla torelli AT Trl948 Arctic Ocean, Malmgren, 1866 Iceland PC B&B1942 Pse udopotam ilia Potamilla intermedia PC Hal 948 Pacific Ocean, intermedia Moore, 1905 (Moore, 1905) H&B1981 Alaska Pseudopotamilla myriops Potamilla myriops PC H&B1981 Pacific Ocean, (Marenzeller, 1884) Marenzeller, 1884 Japan Pseudopotamilla occelata Potamilla occelata (Moore, PC Hal948 Pacific Ocean, Moore, 1905 1905) B&B1952 Alaska Bel968 H&B1981 Pse udopotam ilia Amphitrite reniformis AT Trl948 Atlantic Ocean, reniformis (Linnaeus, Linnaeus 1788; Potamilla Li 1977 Europe 1788) reniformis (O. F. Miiller, Brl979 1771) F&P1984 Pol989 Brl998 Tt2004 196 Species Synonymized taxa Region Citation Type Locality EAO WL1950 PC B&B1942 B&B1952 Bel968 WAO Pel 954 Sabella pavonina Savigny, AT Trl948 Atlantic Ocean, 1820 Lil977 France Brl998 Sabella penicillus AT Pol989 Atlantic Ocean, Linnaeus, 1767 Europe EAO WL1950 Sabella zonalis Stimpson, AT Lil977 Atlantic Ocean, 1853 New Brunswick Sabellastarte sp. PC H&B1981 Schizobranchia dubia PC Hal 948 Pacific Ocean, Bush, 1905 Alaska Schizobranchia insignis PC B&B1942 Pacific Ocean, Bush, 1905 Hal 948 Alaska B&B1952 Bel968 H&B1981 Saccocirridae Saccocirrus eroticus Gray, PC H&B1981 Pacific Ocean, 1969 Washington Saccocirrus gabriellae PC Be 1968 Atlantic Ocean, Marcus, 1946 Brazil Scalibregmidae Asclerocheilus beringianus PC H&B1981 Pacific Ocean, Uschakov, 1955 Bering Sea Asclerocheilus intermedius Lipobranchius intermedius AT Pol989 Atlantic Ocean, (Saint-Joseph, 1894) Saint-Joseph, 1894; Brl998 France Sclerocheilus minutus Grube, 1863 Axiokebuita millsi AT Pol989 Atlantic Ocean, Pocklington & Fournier, Canada 1987 EAO Pol989 Cryptosclerocheilus EAO B&D1973 Atlantic Ocean, baffinensis Blake, 1972 Pol989 Canada Hyboscolex pacificus Sclerocheilus pacificus PC B&B1952 Pacific Ocean, (Moore, 1909) Moore, 1909; Oncoscolex Bel968 California pacificus (Moore, 1909) H&B1981 Lipobranchius nr. jeffreysii Eumenia jeffreysii AT Pol989 Atlantic Ocean, (Mcintosh, 1869) Mcintosh, 1869 Scotland Polyphysia crassa (Orsted, Eumenia crassa Orsted, AT Trl948 Atlantic Ocean, 1843) 1843 Li 1977 Denmark F&P1984 Pol989 Brl998 197 Species Synonymized taxa Region Citation Type Locality EAO WL1950 Grl954 Cul972 W&A1987 Pol989 A&F1993 WAO A&W1989c C&K2008 Pseudoscalibregma AT Pol989 Atlantic Ocean, aciculata Hartman, 1965 New England Pseudoscalibregma Scalibregma parvum AT Trl948 Atlantic Ocean, parvum (Hansen, 1878) Hansen, 1878; North Sea Lipobranchius longisetosa Theel, 1879 EAO Pol989 Pseudoscalibregma sp. WAO C&K2008 Scalibregma inflatum Scalibregma minutum AT Trl948 Atlantic Ocean, Rathke, 1843 Webster & Benedict, 1887 Lil977 Norway Pol989 Brl998 Tt2004 EAO WL1950 Grl954 El 1960 Cul972 B&D1973 Cul979 Stl985 W&A1987 A&W1989b Pol989 HB A&W1989a PC Hal 948 B&B1952 Bel968 H&B1981 WAO Pel954 B&C1979 A&W1989C C&K2008 Sclerobregma branchiata AT Pol989 Atlantic Ocean, Hartman, 1965 New England Serpulidae Apomatus geniculata Protula geniculata Moore & PC B&B1952 Pacific Ocean, (Moore & Bush, 1904) Bush, 1904; Apomatus Bel968 British Columbia timmsii Pixell, 1912 H&B1981 Chitinopoma serrula Vermilia serrula Stimpson, AT Trl948 Atlantic Ocean, (Stimpson, 1854) 1854; Chitinopoma Lil977 New Brunswick groenlandica (Morch, Pol989 1863); Chitinopoma fabricii Brl998 Levinsen, 1883 Tt2004 198 Species Synonymized taxa Region Citation Type Locality EAO A&W1989b HB A&W 1989a PC B&B1952 Bel968 WAO C&K2008 Crucigera irregularis PC B&B1942 Pacific Ocean, Bush, 1905 Hal 948 Alaska B&B1952 Be1968 H&B1981 Crucigera zygophora Serpula zygophora Johnson, PC B&B1942 Pacific Ocean, (Johnson, 1901) 1901 Hal 948 Washington B&B1952 Bel968 H&B1981 Ditrupa groenlandica EAO WL1950 Arctic Ocean, Mcintosh, 1879 Davis Strait Filograna implexa AT Trl948 Atlantic Ocean, Berkeley, 1828 Li 1977 England Pol989 Tt2004 EAO WL1950 Pol989 Hydroides dianthus Serpula dianthus Verrill, AT Lil977 Atlantic Ocean, (Verrill, 1873) 1873 Tt2004 New Jersey Hydroides norvegicus AT Brl998 Atlantic Ocean, Gunnerus, 1768 Norway EAO WL1950 Leodora abnormis (Bush, Spirorbis abnormis Bush, PC Hal 948 Pacific Ocean, 1905) 1905 Aalaska Leodora valida (Verrill, Spirorbis validus Verrill, AT Trl948 Atlantic Ocean, 1874) 1874; Spirorbis (Leodora) Pol989 Canada validus Verrill, 1874; Spirorbis (Laeospira) validus Verrill, 1874 PC B&B1952 Be1968 H&B1981 Miroserpula injlata Dons, EAO WL1950 Atlantic Ocean, 1931 Norway Placostegus tridentatus Serpula tridentata Fabricius, EAO WL1950 Atlantic Ocean, (Fabricius, 1780) 1780 Norway Pomatoceros triqueter Serpula triquetra Linnaeus, EAO WL1950 Atlantic Ocean, (Linnaeus, 1767) 1767 Europe Protis arctica (Hansen, Protula arctica Hansen, EAO WL1950 Atlantic Ocean, 1878) 1878 North Sea Protolaeospira Spirorbis (Protolaeospira) PC B&B1942 Pacific Ocean, ambilateralis Pixell, 1912 ambilateralis (Pixell, 1912) B&B1952 northeastern Bel968 region H&B1981 Protula americana AT Trl948 Atlantic Ocean, Mcintosh, 1885 Canada 199 Species Synonymized taxa Region Citation Type Locality Protula globifera (Theel, Apomatus globifer Theel, EAO WL1950 Arctic Ocean 1879) 1879 Protula media Stimpson, AT Trl948 Atlantic Ocean, 1854 Pol989 New Brunswick Protula pacifica Pixell, Protula furugelmi Zachs, PC B&B1952 Pacific Ocean, 1912 1933 Bel968 British Columbia H&B1981 Protula tubularia Serpula tubularia Montagu, AT Lil977 Atlantic Ocean, (Montagu, 1803) 1803 England Pseudochitinopoma Hyalopomatopsis PC Hal948 Pacific Ocean, occidentalis (Bush, 1905) occidentalis Bush, 1905 H&B1981 Alaska Salmacina dysteri (Huxley, Protula dysteri Huxley, PC B&B1942 Atlantic Ocean, 1855) 1855 Scotland AT Pol989 Salmacina tribranchiata Filograna tribranchiata PC B&B1952 Pacific Ocean, (Moore, 1923) Moore, 1923; Salmacina Bel968 California dysteri tribranchiata H&B1981 (Moore, 1923) Serpula Columbiana PC Jol901 Pacific Ocean, Johnson, 1901 Puget Sound Serpula vermicularis AT Brl998 Atlantic Ocean, Linnaeus, 1767 Europe EAO WL1950 B&D1973 Pol989 PC Chi920 B&B1942 Hal948 B&B1952 Bel968 H&B1981 Sigalionidae , Ehlersileanira sp. PC Bel 972 Neoleanira tetragona Sigalion tetragonum 0rsted, AT Trl948 Atlantic Ocean, (0rsted, 1845) 1845; Leanira tetragona Pel963 Norway (0rsted, 1845) Pol989 Brl998 Tt2004 EAO B&D1973 Pol989 Sigalion arenicola Verrill, AT Brl979 Atlantic Ocean, 1880 Massachusetts Sthenelais articulata PC B&B1948 Atlantic Ocean, Kinberg, 1855 Bel967 Brazil Sthenelais berkeleyi PC B&H1974 Pacific Ocean, Pettibone, 1971 eastern region Sthenelais boa (Johnston, Sigalion boa Johnston, 1839 AT Brl998 Atlantic Ocean, 1839) Europe Sthenelais fusca Johnson, PC Jol901 Pacific Ocean, 1897 California Sthenelais jeffreysi EAO WL1950 Atlantic Ocean, Mcintosh, 1876 Ireland 200 Species Synonymized taxa Region Citation Type Locality Sthenelais limicola (Ehlers, Sigalion limicola Ehlers, AT Trl948 Atlantic 1864) 1864; Sthenelais (Sigalion) Pel963 Ocean,Mediterra limicola Ehlers, 1864 Li 1977 nean Sea Brl998 Sthenelais tertiaglabra PC B&H1974 Pacific Ocean, Moore, 1910 California Sthenelais verruculosa PC B&B1942 Pacific Ocean, Johnson, 1897 California Sphaerodoridae Clavodorum sp. AT Pol989 Ephesiella abyssorum Sphaerodorum abyssorum EAO WL1950 Atlantic Ocean, (Hansen, 1878) Hansen, 1878 North Sea Sphaerodoropsis biserialis Sphaerodorum biserialis EAO Cul972 Arctic Ocean, (Berkeley & Berkeley, Berkeley & Berkeley, 1944; Nunavut 1944) Ephesiella biserialis (Berkeley & Berkeley, 1944) WAO B&B1944 A&W1989C C&K2008 Sphaerodoridium Sphaerodorum claparedii AT Pol989 Atlantic Ocean, claparedii (Greeff, 1866) Greeff, 1866 English Channel EAO WL1950 Pol989 Sphaerodoropsis corrugata AT Pol989 Atlantic Ocean, Hartman & Fauchald, 1971 New England Sphaerodoropsis minuta Ephesia minuta Webster & AT Pel 963 Atlantic Ocean, (Webster & Benedict, Benedict, 1887; Lil977 Maine 1887) Sphaerodorum minutum F&P1984 (Webster & Benedict, Pol989 1887); Ephesiella minuta Brl998 (Webster and Benedict, Tt2004 1887) EAO A&W1989b Pol989 PC Chi920 B&B1948 Hal 948 Bel967 WAO B&B1944 A&W1989C C&K2008 Sphaerodoropsis Sphaerodorum sphaerulifer PC Vil998 Pacific Ocean, sphaerulifer (Moore, 1909) Moore, 1909 California Sphaerodorum gracilis Ephesia gracilis Rathke, AT Trl948 Atlantic Ocean, (Rathke, 1843) 1843; Ephesiella gracilis Pel963 Norway (Rathke, 1843); Li 1977 Sphaerodorum gracile Pol989 (Rathke, 1843) Brl998 EAO WL1950 B&D1973 Stl985 Pol989 201 Species Synonymized taxa Region Citation Type Locality HB A&W1989a WAO A&W1989C C&K2008 Sphaerodorum papillifer Ephesia papillifer (Moore, EAO Grl954 Pacific Ocean, Moore, 1909 1909) Cul972 California Stl985 W&A1987 HB A&W1989a PC Bel927 B&B1948 Be 1967 WAO B&B1944 A&W1989C Spintheridae Spinther alaskensis PC Hal948 Pacific Ocean, Hartman, 1948 Alaska Spinther citrinus Cryptonota citrina AT Trl937 Atlantic Ocean, (Stimpson, 1854) Stimpson, 1854; Spinther Pel 963 New Brunswick citrina Hartman, 1948 U1977 Pol 989 Brl998 Tt2004 EAO WL1950 Pol989 Spinther oniscoides AT Trl948 Atlantic Ocean, Johnson, 1845 Ireland Spionidae Anaspio boreus PC Chi920 Arctic Ocean, Chamberlin, 1920 Hal948 Alaska Boccardia columbiana Polydora (Boccardia) PC Bel927 Pacific Ocean, Berkeley, 1927 columbiana (Berkeley, B&B1952 British Columbia 1927) Bel968 H&B1981 Boccardiella hamata Polydora (Boccardia) PC Be 1927 Atlantic Ocean, (Webster, 1879) hamata Webster, 1879; B&B1952 Virginia Boccardia hamata Bel968 (Webster, 1879); Boccardia H&B1981 uncata Berkeley, 1927 WAO C&K2008 Boccardia natrix Polydora natrix Soderstrom, PC B&B1952 Pacific Ocean, (Soderstrom, 1920) 1920; Polydora (Boccardia) Bel968 South America natrix Soderstrom, 1920 Boccardia polybranchia Polydora (Leucodore) PC B&B1952 Australia (Haswell, 1885) polybranchia Haswell, Bel968 1885; Polydora (Boccardia) H&B1981 polybranchia Haswell, 1885 Boccardia proboscidea Polydora (Boccardia) PC B&B1952 Pacific Ocean, Hartman, 1940 proboscidea (Hartman, Bel968 California 1940) H&B1981 Boccardia pugettensis Polydora (Boccardia) PC H&B1981 Pacific Ocean, Blake, 1979 pugettensis Blake, 1979 British Columbia 202 Species Synonymized taxa Region Citation Type Locality Dipolydora cardalia Polydora cardalia Berkeley, PC Bel927 Pacific Ocean, (Berkeley, 1927) 1927; Polydora (Polydora) B&B1952 British Columbia cardalia Berkeley, 1927 Bel968 H&B1981 Vil998 Dipolydora caulleryi Polydora caulleryi Mesnil, AT Li 1977 Atlantic Ocean, (Mesnil, 1897) 1897; Polydora (Polydora) Pol989 France brachycephala Hartman, Brl998 1936 EAO Cul972 Cul979 A&W1989b Pol989 PC H&B1981 Vil998 WAO Pel 954 A&W1989c C&K2008 Dipolydora commensalis Polydora commensalis AT Pol989 Atlantic Ocean, (Andrews, 1891) Andrerws, 1891; Polydora Brl998 North Carolina (Polydora) commensalis Andrerws, 1891 PC B&B1952 Bel968 H&B1981 Dipolydora concharum Polydora concharum AT Trl948 Atlantic Ocean, (Verrill, 1880) Verrill, 1880 Li 1977 New England Pol989 and New Brl998 Brunswick Tt2004 EAO B&D1973 Dipolydora giardi (Mesnil, Polydora giardi Mesnil, PC Hal 948 Atlantic Ocean, 1896) 1896; Polydora (Polydora) H&B1981 France g/an/z Mesnil, 1896 Dipolydora quadrilobata Polydora quadrilobata AT Li 1977 Atlantic Ocean, (Jacobi, 1883) Jacobi, 1883; Polydora F&P1984 Germany (Polydora) quadrilobata Pol989 Jacobi, 1883 Brl998 Tt2004 EAO Pol989 HB B&B1943 A&W1989a PC H&B1981 WAO A&W 1989c C&K2008 Dipolydora socialis Leucodore socialis AT Li 1977 Pacific Ocean, (Schmarda, 1861) Schmarda, 1861; Polydora Chile socialis (Schmarda, 1861); Polydora (Polydora) socialis (Schmarda, 1861) PC Hal 948 B&B1952 203 Species Synonym ized taxa Region Citation Type Locality H&B1981 VU998 Dispio sp. WAO C&K2008 Laonice cirrata (M. Sars, Nerine cirrata M. Sars, AT Trl948 Atlantic Ocean, 1851) 1851; Spionides cirratus Lil977 Norway Webster & Benedict, 1887; F&P1984 Scolecolepis cirrata Pol989 Webster & Benedict, 1884; Brl998 Laonice pugettensis Banse Tt2004 &Hobson, 1968 Q&S2005 EAO WL1950 Cul972 Cul979 Stl985 Pol989 A&F1993 HB A&W1989a PC B&B1942 Ha 1948 B&B1952 Bel968 WAO B&C1979 A&W1989c C&K2008 Laonice japonica (Moore, Spionides japonicus Moore, PC Bel927 Pacific Ocean, 1907) 1907 Japan Malacoceros Spio fuliginosus Claparede, EAO Cul972 Atlantic Ocean, (Malacoceros) fuliginosus 1869; Malacoceros Mediterranean (Claparede, 1869) fuliginosus (Claparede, Sea 1869) PC H&B1981 WAO C&K2008 Malacoceros Scolecolepis glutaea Ehlers, PC H&B1981 Pacific Ocean, (Rhynchospio) glutaeus 1897; Malacoceros Strait of (Ehlers, 1897) (Rhynchospio) glutaeus Magellan (Ehlers, 1897) Marenzelleria viridis Scolecolepis viridis Verrill, AT Lil977 Atlantic Ocean, (Verrill, 1873) 1873; Scolecolepides viridis Brl979 New Jersey (Verrill, 1873); Scolelepides Pol989 viridis (Verrill, 1873); Brl998 Scolecolepides arcticus Tt2004 Chamberlin, 1920 EAO Stl985 PC Chi920 Hal 948 WAO C&K2008 Marenzelleria wireni WAO C&K2008 Arctic Ocean, Augener, 1913 Franz Josephland Microspio sp. AT Pol989 Brl998 204 Species Synonym ized taxa Region Citation Type Locality Nerinides sp. WAO Pel954 Paraprionospio pinnata Prionospio pinnata Ehlers, PC Be1927 Pacific Ocean, (Ehlers, 1901) 1901; Paraprionospio B&B1942 Chile tribranchiata Berkeley, B&B1952 1927 Bel 968 H&B1981 Vil998 Poly dor a aggregata Blake, AT Brl998 Atlantic Ocean, 1969 Maine WAO C&K2008 Polydora alloporis Light, Polydora (Polydora) PC H&B1981 Pacific Ocean, 1970 alloporis Light, 1970 California Polydora caeca (0rsted, Leucodore coecum 0rsted, EAO WL1950 Atlantic Ocean, 1843) 1843; Dipolydora coeca Grl954 Denmark (Orsted, 1843); Polydora (Polydora) coeca (0rsted, 1843) HB B&B1943 PC B&B1942 B&B1952 Bel968 WAO A&W1989c C&K2008 Polydora ciliata (Johnston, Leucodore ciliatus Johnston, AT Trl948 Atlantic Ocean, 1838) 1838 Brl979 England Tt2004 EAO WL1950 HB B&B1943 PC B&B1952 Bel968 Polydora cornuta Bosc, AT Pol989 Atlantic Ocean, 1802 Brl998 South Carolina Tt2004 Polydora gracilis Verrill, AT Trl948 Atlantic Ocean, 1880 Tt2004 Rhode Island Polydora ligni Webster, Polydora (Polydora) ligni AT LU977 Atlantic Ocean, 1879 Webster, 1879 Brl979 New Jersey PC B&B1952 Bel968 H&B1981 Polydora magna Berkeley, Polydora caeca magna PC Be 1927 Pacific Ocean, 1927 Berkeley, 1927 B&B1952 British Columbia Bel968 Polydora plena Berkeley Polydora socialis plena PC Bel968 Pacific Ocean, & Berkeley, 1936 Berkeley & Berkeley, 1936 British Columbia Polydora pygidialis Blake Polydora (Polydora) PC H&B1981 Pacific Ocean, & Woodwick, 1971 pygidialis Blake and California Woodwick, 1971; Dipolydora pygidialis (Blake & Woodwick, 1971) 205 Species Synonymized taxa Region Citation Type Locality Polydora spongicola Polydora ciliata spongicola PC B&B1952 Pacific Ocean, Berkeley & Berkeley, 1950 Berkeley & Berkeley, 1950; Bel968 British Columbia Polydora (Polydora) H&B1981 spongicola Berkeley & Berkeley, 1950 Polydora websteri AT Li 1977 Atlantic Ocean, Hartman, 1943 Pol989 New England Brl998 Q&S2005 EAO B&D1973 Pol989 Prionospio (Minuspio) Prionospio cirrifera Wiren, AT Pol989 Pacific Ocean, cirrifera Wiren, 1883 1883; Minuspio cirrifera Brl998 Bering Sea (Wiren, 1883) EAO WL1950 Cul972 Stl985 A&W1989b Pol989 PC B&B1942 Hal 948 B&B1952 Bel968 H&B1981 WAO B&C1979 A&W1989C B&C1979 C&K2008 Co2008 Prionospio (Minuspio) Prionospio multibranchiata PC Bel927 Pacific Ocean, multibranchiata (Berkeley, Berkeley, 1927 Vil998 British Columbia 1927) Prionospio (Prionospio) Prionospio steenstrupi AT Trl948 Atlantic Ocean, steenstrupi Malmgren, Malmgren, 1867; Li 1977 Iceland 1867 Prionospio tenuis (Verrill, F&P1984 1879); Spiophanes tenuis Pol989 Verrill, 1879 Brl998 Tt2004 Q&S2005 EAO WL1950 B&D1973 Stl985 Pol989 PC H&B1981 Vil998 WAO B&C1979 A&W1989C C&K2008 Co2008 Prionospio malmgreni PC Be 1927 Atlantic Ocean, Claparede, 1870 B&B1952 Mediterranean Bel968 Sea WAO Pel 954 C&K2008 206 Species Synonymized taxa Region Citation Type Locality EAO Cul979 Pseudopolydora kempi Polydora (Carazzia) kempi PC Vil998 Indian Ocean, (Southern, 1921) Southern, 1921 Chilka Lake Pseudopolydora kempi Polydora (Pseudopolydora) PC H&B1981 Pacific Ocean, japonica Imajima & kempi japonica Imajima & Japan Hartman, 1964 Hartman, 1964 Pseudopolydora laminifera Neopygospio laminifera PC Bel 968 Pacific Ocean, (Berkeley & Berkeley, Berkeley & Berkeley, 1954 British Columbia 1954) Pygospio elegans Spio rathbuni Webster & AT Trl948 Atlantic Ocean, Claparede, 1863 Benedict, \S&4; Pygospio Li 1977 France minutus Giard, 1894; Spio Brl979 inversa Kuhlgatz, 1898 Pol989 Brl998 Tt2004 EAO WL1950 Cul972 B&D1973 A&W1989b Pol989 HB A&W1989a PC H&B1981 WAO A&W1989c C&K2008 Scolelepis (Nerinides) Scolelepis (Parascolelepis) AT Pol989 Atlantic Ocean, bousfieldi Pettibone, 1963 bousfieldi Pettibone, 1963 Brl998 Gulf of St. Lawrence Scolelepis (Nerinides) Nerinides tridentata AT Brl998 Atlantic Ocean, tridentata (Southern, 1914) Southern, 1914; Scolelepis Ireland (Parascolelepis) tridentata (Southern, 1914) Scolelepis (Scolelepis) Scolecolepis alaskensis PC Hal 948 Pacific Ocean, alaskensis (Treadwell, Treadwell, 1914 Alaska 1914) Scolelepis (Scolelepis) Aonis foliosa Audouin & PC B&B1952 Atlantic Ocean, foliosa (Audouin & Milne Milne Edwards, 1833; Be 1968 France Edwards, 1833) Nerine foliosa (Audouin & H&B1981 Milne Edwards, 1833); Scolelepis foliosa (Audouin & Milne Edwards, 1833) Scolelepis (Scolelepis) Lumbricus squamatus O.F. AT Lil977 Atlantic Ocean, squamata (O.F. Mtiller, Miiller, 1806; Scolelepis Brl979 Denmark 1806) squamata (O.F. Miiller, Pol 989 1806); Scolelepis squamatus Brl998 (O.F. Miiller, 1806); Nerine cirratulus (delle Chiaje, 1831) PC Bel 968 H&B1981 Scolelepis sp. WAO C&K2008 Spio butleri Berkeley & Spio (Spio) butleri Berkeley PC Bel968 Pacific Ocean, Berkeley, 1954 & Berkeley, 1954 H&B1981 British Columbia 207 Species Synonymized taxa Region Citation Type Locality Spio cirrifera (Banse & Paraspio cirrifera Banse & PC H&B1981 Pacific Ocean, Hobson, 1968) Hobson, 1968; Spio (Spio) Vil998 Puget Sound cirrifera (Banse & Hobson, 1968) Spio filicomis (O.F. Nereis filicomis O.F. AT Li 1977 Atlantic Ocean, Muller, 1776) Muller, 1776; Spio (Spio) Brl979 Denmark filicomis (O.F. MUller, Brl979 1776) F&P1984 Pol989 Brl998 Tt2004 EAO WL1950 Grl954 Cul979 W&A1987 Pol 989 HB B&B1943 PC Hal 948 H&B1981 WAO Bel 927 Pel954 Bel 968 C&K2008 Spio filicomis pacifica Spio martinensis pacifica PC B&B1952 Pacific Ocean, Berkeley, 1936 Berkeley, 1927 British Columbia Spio goniocephala Thulin, AT Pol 989 Atlantic Ocean, 1957 Oresund Spio setosa Verrill, 1873 AT Li 1977 Atlantic Ocean, Brl979 New England Pol989 Brl998 Tt2004 Spio theeli (Soderstrom, Microspio theeli AT Brl998 Arctic Ocean, 1920) Soderstrom, 1920 Siberia PC Chi 920 Spio thulini Maciolek, AT Brl998 Atlantic Ocean, 1990 Georges Bank Spiophanes berkeleyorum PC Bel968 Pacific Ocean, Pettibone, 1962 H&B1981 British Columbia VU998 Spiophanes bombyx Spio bombyx Claparede, AT Lil977 Atlantic Ocean, (Claparede, 1870) 1870 Brl979 France Pol989 Brl998 Tt2004 PC Bel927 B&B1952 Bel968 H&B1981 Vil998 Spiophanes cirrata M. Sars PC Be1927 Atlantic Ocean, inG.O. Sars, 1872 B&B1952 Norway Bel968 208 Species Synonymized taxa Region Citation Type Locality Spiophanes kroyeri Grube, AT Pol989 Arctic Ocean, 1860 Brl998 Greenland EAO WL1950 B&D1973 Pol989 PC H&B1981 Spiophanes wigleyi AT Brl979 Atlantic Ocean, Pettibone, 1962 Pol 989 Massachusetts Tt2004 EAO Pol989 Streblospio benedicti AT Li 1977 Atlantic Ocean, Webster, 1879 Brl979 New Jersey Pol989 Tt2004 PC H&B1981 Spirorbidae Bushiella (Jugaria) Serpula granulata Linnaeus, AT Trl948 Arctic Ocean, granulata (Linnaeus, 1767) 1767; Spirorbis granulata Lil977 Greenland (Linnaeus, 1767); Spirorbis granulatus (Linnaeus, 1767); Spirorbis (Pileolaria) granulatus (Linnaeus, 1767); Spirorbis (Laeospira) granulatus (Linnaeus, 1767) EAO B&D1973 HB B&B1943 A&W1989a PC Hal 948 B&B1952 Bel968 H&B1981 Bushiella (Jugaria) Spirorbis quadrangular is AT F&P1984 Atlantic Ocean, quadrangular is (Stimpson, Stimpson, 1854; Jugaria Brl998 Canada 1854) quadrangular is (Stimpson, 1854); Pileolaria quadrangularis (Stimpson, 1854); Spirorbis lineatus Bush, 1905 PC Hal948 WAO Pel954 Bushiella (Jugaria) similis Spirorbis similis Bush, 1905 PC Hal 948 Pacific Ocean, (Bush, 1905) Alaska Circeis armoricana Saint- AT Brl998 Atlantic Ocean, Joseph, 1894 France Circeis spirillum Serpula spirillum Linnaeus, AT Trl948 Atlantic Ocean, (Linnaeus, 1758) 1758; Dexiospira spirillum Li 1977 Europe (Linnaeus, 1758); Spirorbis Brl979 spirillum (Linnaeus, 1758); Pol989 Spirorbis (Circeis) spirillum Brl998 209 Species Synonymized taxa Region Citation Type Locality (Linnaeus, 1758); Spirorbis Tt2004 (Dexiospira) spirillum (Linnaeus, 1758) EAO Chi920 WL1950 Grl954 B&D1973 A&W1989b Pol989 HB Trl937 B&B1943 A&W1989a PC B&B1942 Hal 948 B&B1952 Bel968 H&B1981 WAO Chi920 Janua (Dexiospira) Serpula corrugata Montagu, WAO C&K2008 Atlantic Ocean, corrugata (Montagu, 1803) 1803; Spirorbis corrugatus England (Montagu, 1803); Janua corrugatus (Montagu, 1803) Juana pagenstecheri Spirorbis pagenstecheri HB B&B1943 Atlantic Ocean, (Quatrefages, 1866) Quatrefages, 1866; France Dexiospira pusilloides (Bush, 1905); Spirorbis pusilloides Bush, 1905 PC B&B1952 Bel968 Paradexiospira Spirorbis violaceus AT Trl948 Atlantic Ocean, (Paradexiospira) violacea Levinsen, 1883; Spirorbis Pol989 North Sea (Levinsen, 1883) (Paradexiospira) violaceus Brl998 Levinsen, 1883 Tt2004 EAO WL1950 PC Hal948 H&B1981 Paradexiospira Serpula cancellata AT Trl948 Arctic Ocean, (Spirorbides) cancellata Fabricius, 1780; Spirorbis Pol989 Greenland (Fabricius, 1780) cancellatus (Fabricius, Brl998 1780) EAO WL1950 Pol989 Paradexiospira Serpula vitrea Fabricius, AT Trl948 Arctic Ocean, (Spirorbides) vitrea 1780; Paradexiospira vitrea Pol989 Greenland (Fabricius, 1780) (Fabricius, 1780); Spirorbis Brl998 (Paradexiospira) vitreus (Fabricius, 1780); Spirorbis (Laeospira) variabilis Bush, 1905; Spirorbis (Eulaeospira) variabilis Bush, 1905; Dexiospira semidentata (Bush, 1905); Spirorbis (Paradexiospira) 210 Species Synonymized taxa Region Citation Type Locality nakamurai Uchida, 1971 EAO Pol989 PC Hal948 B&B1952 Bel968 H&B1981 Protolaeospira eximia Spirorbis eximius Bush, PC B&B1952 Pacific Ocean, (Bush, 1905) 1905; Paralaeospira Bel968 California racemosa Pixell, 1912 KJ1979 H&B1981 Protoleodora aspertata Spirorbis asperatus Bush, PC B&B1952 Pacific Ocean, (Bush, 1905) 1905; Spirorbis (Laeospira) Bel968 Alaska medius Pixell, 1912; KJ1979 Laeospira medius (Pixell, 1912) Simplaria potswaldi Pileolaria (Simplicaria) PC KJ1979 Pacific Ocean, (Knight-Jones, 1978) potswaldi Knight-Jones, California 1978 Spirorbis (Laeospira) Laeospira langerhansi PC B&B1952 Panama langerhansi (Caullery & Caullery & Mesnil, 1897; Bel968 Mesnil, 1897) Spirorbis (Pileolaria) H&B1981 langerhansi (Caullery & Mesnil, 1897) Spirorbis (Laeospira) Spirorbis moerchi Levinsen, AT Trl948 Atlantic Ocean, moerchi Levinsen, 1883 1883; Spirorbis (Pileolaria) Pol989 North Sea moerchi Levinsen, 1883; Pileolaria moerchi (Levinsen, 1883) EAO Pol989 PC B&B1952 Bel968 H&B1981 Spirorbis (Spirorbis) Serpula spirorbis Linnaeus, AT Chi920 Atlantic Ocean, spirorbis (Linnaeus, 1758) 1758; Spirorbis spirorbis Trl948 Europe (Linnaeus, 17'58); Spirorbis Lil977 borealis Daudin, 1800; Pol989 Spirorbis (Spirorbis) Brl998 borealis Daudin, 1800; Tt2004 Laeospira borealis (Daudin, 1800) EAO WL1950 Grl954 Pol 989 WAO Chi 920 PC Hal 948 H&B1981 Spirorbis carinatus Serpula carinata Montagu, AT Pol989 Atlantic Ocean, Daudin, 1800 1803 France Spirorbis incongruns Bush, PC Hal 948 Pacific Ocean, 1905 Alaska Spirorbis rugatus Bush, PC Hal 948 Pacific Ocean, 1905 Alaska 211 Species Synonymized taxa Region Citation Type Locality Sternaspidae Sternaspis elegans PC Hal 948 Pacific Ocean, Eysenhardt & Eysenhardt, "Pacific Island" 1821 Sternaspis fossor AT Trl948 Atlantic Ocean, Stimpson, 1854 Tt2004 New Brunswick PC B&B1942 B&B1952 Bel968 WAO B&C1979 Sternaspis scutata (Renier, Echinorhynchus scutatus AT Li 1977 Atlantic Ocean, 1807) Renier, 1807 Brl979 Mediterranean Pol 989 Sea Brl998 Tt2004 EAO WL1950 PC Hal 948 H&B1981 Vil998 WAO Pel954 A&W1989c C&K2008 Syllidae Amblyosyllis finmarchica Gattiola finmarchica AT Pel 963 Atlantic Ocean, (Malmgren, 1867) Malmgren, 1867 Lil977 Norway F&P1984 Pol989 Tt2004 Amblyosyllis lineata alba PC B&B1948 Pacific Ocean, Berkeley, 1923 Be 1967 British Columbia Autolytus emertoni Verrill, Autolytus groenlandicus AT Pel 963 Atlantic Ocean, 1881 Wesenberg-Lund, 1947 Pol989 Massachusetts Brl998 EAO WL1950 Pol989 Autolytus varius PC B&B1948 Pacific Ocean, Treadwell, 1914 California Brania brevipharyngea PC B&H1974 Pacific Ocean, Banse, 1972 Washington Epigamia alexandri Autolytus alexandri AT Li 1977 Arctic Ocean, (Malmgren, 1867) Malmgren, \%61; Autolytus Pol989 Greenland verrilli Marenzeller, 1892; Brl998 Autolytus (Autolytus) verrilli Tt2004 Marenzeller, 1892 EAO WL1950 Grl954 W&A1987 Pol989 PC Chi920 Hal 948 Bel967 212 Species Synonymized taxa Region Citation Type Locality B&H1974 WAO Pel 954 Epigamia magna Berkeley, Autolytus magnus Berkeley, PC B&B1948 Pacific Ocean, 1923 1923; Autolytus (Autolytus) Hal948 British Columbia maguns Berkeley, 1923 Bel967 B&H1974 Erinaceusyllis erinaceus Sphaerosyllis erinaceus AT Li 1977 Atlantic Ocean, (Claparede, 1863) Claparede, 1863; Pol989 France Sphaerosyllis brevifrons Brl998 Webster & Benedict, 1884 Tt2004 WAO Pel954 Eusyllis assimilis PC B&B1948 Atlantic Ocean, Marenzeller, 1875 Be 1967 Mediterranean B&H1974 Sea Eusyllis blomstrandi Eusyllis bloomstrandi AT Pel 963 Arctic Ocean, Malmgren, 1867 Malmgren, 1867 Lil977 Spitsbergen Brl979 Pol989 Brl998 Tt2004 EAO WL1950 Grl954 W&A1987 A&W1989b Pol989 HB A&W1989a PC B&B1948 Be 1967 B&H1974 WAO Pel954 Eusyllis collaris (Hartman, Typosyllis collaris Hartman, PC Hal948 Pacific Ocean, 1948) 1948 Bering Sea Eusyllis lamelligera AT Brl998 Atlantic Ocean, Marion & Bobretzky, 1875 France Eusyllis japonica Imajima PC B&H1974 Pacific Ocean, & Hartman, 1964 Japan Eusyllis phosphorea AT Trl948 Atlantic Ocean, Verrill, 1874 Canada Exogone (Exogone) dispar Paedophylax dispar AT Lil977 Atlantic Ocean, (Webster, 1879) Webster, 1879; Exogone Brl979 Virginia dispar (Webster, 1879) Pol989 Tt2004 EAO Pol989 WAO Pel954 Exogone (Exogone) lourei Exogone lourei Berkeley & PC B&B1942 Pacific Ocean, Berkeley & Berkeley, 1938 Berkeley, 1938 B&B1948 British Columbia Bel967 B&H1974 Vil998 213 Species Synonymized taxa Region Citation Type Locality Exogone (Exogone) Exogone naidina 0rsted, PC B&B1948 Atlantic Ocean, naidina 0rsted, 1845 1845; Exogone gemmifera Bel967 Denmark (Pagenstecher, 1862) B&H1974 WAO Pel954 C&K2008 Exogone (Exogone) Paedophylax veruger AT Pel963 Atlantic Ocean, verugera (Claparede, Claparede, 1868; Exogone U1977 Europe 1868) verugera (Claparede, 1868) Pol989 Brl998 Tt2004 EAO WL1950 A&W1989b B&D1973 Pol 989 PC B&B1942 B&B1948 Bel 967 B&H1974 WAO A&W1989C C&K2008 Exogone (Parexogone) Paedophylax hebes Webster AT Pel963 Atlantic Ocean, hebes (Webster & & Benedict, 1884; Exogone Lil977 Massachusetts Benedict, 1884) hebes (Webster & Benedict, Brl979 1884) Pol989 Brl998 Tt2004 EAO WL1950 Pol989 Exogone (Parexogone) Paedophylax longicirris AT Tt2004 Atlantic Ocean, longicirris (Webster & Webster & Benedict, 1887; Maine Benedict, 1887) Exogone longicirris (Webster & Benedict, 1887) Exogone (Parexogone) Exogone molesta Banse, PC B&H1974 Pacific Ocean, molesta Banse, 1972 1972 Vil998 Washington Exogone (Sylline) brevipes Sylline brevipes Claparede, EAO Stl985 Atlantic Ocean, (Claparede, 1864) 1864; Exogone brevipes Mediterranean (Claparede, 1864) Sea Haplosyllis spongiphila Syllis spongiphila Verril, PC B&H1974 Atlantic Ocean, (Verrill, 1885) 1885; Syllis (Syllis) United States spongiphila Verril, 1885 Myrianida prolifera (O.F. Nereis prolifera O.F. AT Pel 963 Atlantic Ocean, Mttller, 1788) Miiller, 1788; Autolytus Li 1977 Norway prolifer (O.F. Miiller, 1788) Pol989 Brl998 Tt2004 EAO WL1950 Grl954 W&A1987 A&W1989b Pol 989 Myrianida sp. HB A&W1989a Odontosyllis fulgurans PC B&H1974 Pacific Ocean, japonica Imajima, 1966 Japan 214 Species Synonymized taxa Region Citation Type Locality Odontosyllis parva PC B&B1948 Pacific Ocean, Berkeley, 1923 Bel967 British Columbia B&H1974 Odontosyllis phosphorea Odontosyllis phosphorea PC B&B1942 Pacific Ocean, Moore, 1909 nanaimoensis Berkeley, B&B1948 California 1923 Be1967 B&H1974 Parapionosyllis Sphaerosyllis longicirrata AT U1977 Atlantic Ocean, longicirrata (Webster & Webster & Benedict, 1884 Pol989 Massachusetts Benedict, 1884) Brl998 Pionosyllis compacta AT Brl998 Arctic Ocean, Malmgren, 1867 Spitsbergen EAO A&W1989b Pol989 HB A&W 1989a WAO Pel954 Pionosyllis gigantea PC B&B1948 Pacific Ocean, Moore, 1908 Hal948 British Columbia Bel967 and Alaska B&H1974 Pionosyllis magnifica Eusyllis magnifica (Moore, PC Hal 948 Pacific Ocean, Moore, 1906 1906) Bel 967 Washington and B&H1974 Alaska WAO Pel 954 Pionosyllis uraga Imajima, PC B&H1974 Pacific Ocean, 1966 Japan Proceraea cornuta Autolytus cornutus Agassiz, AT Trl948 Atlantic Ocean, (Agassiz, 1862) 1862; Autolytus (Proceraea) Pel 963 New England cornutus Agassiz, 1862 Li 1977 Pol989 Brl998 Tt2004 EAO Pol989 HB Shl971 PC Chi920 Bel967 B&H1974 WAO Chi920 Pel954 Proceraea madeirensis Autolytus fasciatus (Bosc, AT Lil977 Atlantic Ocean, Nygren, 2004 1802) Pol989 Madeira Brl998 Proceraea prismatica Nereis prismatica O.F. AT Trl937 Arctic Ocean, (O.F.Muller, 1776) Muller, 1776; Autolytus Trl948 Greenland prismatica (Fabricius, Pel963 1780); Autolytus Li 1977 (Proceraea) prismatica Pol 989 (Fabricius, 1780); Brl998 Proceraea gracilis Verrill, Tt2004 1874; Autolytus (Proceraea) trilineatus Berkeley & 215 Species Synonymized taxa Region Citation Type Locality Berkeley, 1945 EAO WL1950 Grl954 W&A1987 Pol989 PC B&B1942 B&B1948 Hal948 Bel967 B&H1974 WAO Pel954 Prosphaerosyllis Sphaerosyllis brandhorsti PC B&H1974 Pacific Ocean, brandhorsti (Hartmann- Hartmann-Schroder, 1965 Vil998 Chile Schroder, 1965) Salvatoria clavata Syllis clavata Claparede, AT Pel963 Atlantic Ocean, (Claparede, 1863) 1863; Brania clavata Pol989 France (Claparede, 1863) Brl998 EAO Pol989 Sphaerosyllis PC Vil998 Pacific Ocean, californiensis Hartman, California 1966 Sphaerosyllis hystrix PC B&B1942 Atlantic Ocean, Claparede, 1863 B&B1948 Adriatic Sea Be 1967 B&H1974 Sphaerosyllis latipalpis EAO WL1950 Atlantic Ocean, Levinsen, 1883 Baltic Sea Sphaerosyllis pirifera PC B&B1942 Atlantic Ocean, Claparede, 1868 B&B1948 Mediterranean Be1967 Sea B&H1974 Sphaerosyllis ranunculus PC Vil998 Pacific Ocean, Kudenov & Harris, 1995 California Streptosyllis arenae AT Pol989 Atlantic Ocean, Webster & Benedict, 1884 Brl998 Massachusetts Streptosyllis latipalpa PC B&H1974 Pacific Ocean, Banse, 1968 Puget Sound Streptosyllis varians AT Pel 963 Atlantic Ocean, Webster & Benedict, 1887 Li 1977 Maine Pol989 Brl998 Tt2004 Syllides benedicti Banse, AT Pol989 Atlantic Ocean, 1971 Tt2004 Maine Syllides convolutus Syllides convoluta Webster AT Tt2004 Atlantic Ocean, Webster & Benedict, 1884 & Benedict, 1884 Massachusetts Syllides eburneus Riser, AT Tt2004 Atlantic Ocean, 1997 Massachusetts Syllides longocirratus Syllis longicirrata 0rsted, AT Li 1977 Atlantic Ocean, (0rsted, 1845) 1845; Syllis (Syllides) Br 1979 Norway longocirrata 0rsted, 1845; Tt2004 Syllides longocirrata 216 Species Synonymized taxa Region Citation Type Locality (0rsted, 1845) PC B&H1974 Syllides japonicus Syllides japonica Imajima, AT Pol989 Pacific Ocean, Imajima, 1966 1966 Japan PC B&H1974 Syllides setosa Verrill, AT Brl998 Atlantic Ocean, 1882 Massachusetts Syllides verrilli Moore, AT Pol 989 Atlantic Ocean, 1908 Massachusetts Syllis alternata Moore, Syllis (Typosyllis) alternata PC B&B1948 Pacific Ocean, 1908 Moore, 1908; Typosyllis Hal 948 Alaska alternata (Moore, 1908) Bel967 B&H1974 Vil998 Syllis armillaris (O.F. Nereis armillaris O.F. AT Trl937 Atlantic Ocean, Miiller, 1771) Miiller, 1771; Typosyllis Brl998 Greenland armillaris (O.F. Miiller, 1771) EAO WL1950 B&D1973 PC B&B1942 B&B1948 Hal 948 Bel967 B&H1974 Syllis cornuta Rathke, Syllis (Ehlersia) cornuta AT Pel963 Atlantic Ocean, 1843 Rathke, 1S43; Syllis Li 1977 Norway (Typosyllis) cornuta Rathke, Brl979 1843; Ehlersia cornuta F&P1984 (Rathke, 1843); Ehlersia Pol989 (Syllis) cornuta (Rathke, Brl998 1843); Typosyllis cornuta Tt2004 (Rathke, 1843) EAO WL1950 Grl954 Cul972 Stl985 W&A1987 A&W1989b HB A&W 1989a WAO Pel 954 B&C1979 C&K2008 Co2008 Syllis elongata (Johnson, Pionosyllis elongata PC B&B1942 Pacific Ocean, 1901) Johnson, 1901;5y//« (Syllis) B&B1948 Washington elongata (Johnson, 1901) Hal 948 Bel967 B&H1974 Syllis fasciata Malmgren, Syllis (Typosyllis) fasciata AT Pol989 Arctic Ocean, 1867 Malmgren, 1867; Typosyllis Brl998 Spitsbergen fasciata (Malmgren, 1867) 217 Species Synonymized taxa Region Citation Type Locality EAO WL1950 Grl954 B&D1973 A&W1989b Pol989 HB A&W1989a PC B&B1942 B&B1948 Bel 967 WAO Pel 954 A&W1989c C&K2008 Syllis gracilis Grube, 1840 AT Li 1977 Atlantic Ocean, Br 1979 Mediterranean Pol989 Sea Brl998 Tt2004 EAO Stl985 Pol989 Syllis heterochaeta Moore, Syllis (Ehlersia) PC B&B1942 Pacific Ocean, 1909 heterochaeta MOOTS, 1909; B&B1948 California Ehlersia heterochaeta Be1967 (Moore, 1909); B&H1974 Langerhansia heterochaeta Vil998 (Moore, 1909) Syllis hyalina Grube, 1863 Syllis (Typosyllis) hyalina AT Pol989 Atlantic Ocean, Grube, 1863 Mediterranean Sea HB B&B1943 PC B&B1948 Bel967 B&H1974 Syllis quaternaria Moore, PC Hal948 Arctic Ocean, 1906 Alaska Syllis sclerolaema Ehlers, PC B&B1942 Atlantic Ocean, 1901 B&B1948 South Africa Bel967 Trypanosyllis aeolis Trypanosyllis gemmipara PC B&B1942 Atlantic Ocean, Langerhans, 1879 Johnson, 1901; B&B1948 Madeira Trypanosyllis Hal948 (Trypanedenta) gemmipara Bel967 Johnson, 1901 B&H1974 Trypanosyllis ingens Trypanosyllis PC B&B1952 Pacific Ocean, Johnson, 1902 (Trypanedenta) ingens Bel967 California Johnson, 1902 B&H1974 Typosyllis adamantens Trypanosyllis adamanteus PC B&B1948 Pacific Ocean, (Treadwell, 1914) Treadwell, 1914; Syllis Be 1967 California spenceri Berkeley & Berkeley, 1938 Typosyllis harti (Berkeley Syllis harti Berkeley & PC B&B1942 Pacific Ocean, & Berkeley, 1938) Berkeley, 1938; Syllis B&B1948 British Columbia (Typosyllis) harti Berkeley Be 1967 & Berkeley, 1938 B&H1974 218 Species Synonymized taxa Region Citation Type Locality Typosyllis pigmentata Pionosyllis pigmentata PC Hal 948 Pacific Ocean, (Chamberlin, 1919) Chamberlin, 1919; Syllis B&B1948 California pulchra Berkeley & Be1967 Berkeley, 1938; Syllis B&H1974 (Typosyllis) pulchra Berkeley & Berkeley, 1938 Typosyllis stewarti Syllis stewarti Berkeley & PC B&B1942 Pacific Ocean, (Berkeley & Berkeley, Berkeley, 1942; Syllis B&B1948 British Columbia 1942) (Typosyllis) stewarti Hal 948 Berkeley & Berkeley, 1942 B&H1974 Terebellidae Amaeana occidentalis Amaea occidentalis PC H&B1981 Pacific Ocean, (Hartman, 1944) Hartman, 1944 California Amphitrite affinis Amphitrite intermedia AT Trl948 Arctic Ocean, (Malmgren, 1866) Malmgren, 1866; Lil977 Spitsbergen Neoamphitrite affinis Pol989 (Malmgren 1866); Terebella Brl998 intermedia (Malmgren, Tt2004 1866) EAO WL1950 Grl954 Pol 989 Amphitrite brunnea Terebella brunnea AT Li 1977 Atlantic Ocean, (Stimpson, 1854) Stimpson, 1854 Tt2004 New Brunswick Amphitrite cirrata O.F. AT Trl948 Atlantic Ocean, Muller, 1771 in 1776 Lil977 Iceland Brl979 Pol989 Brl998 Tt2004 EAO Chi920 WL1950 Grl954 Cul979 W&A1987 A&W1989b Pol989 HB A&W1989a PC B&B1942 Hal 948 B&B1952 Bel968 H&B1981 WAO Pel 954 A&W1989c C&K2008 Amphitrite grayi Neoamphitrite grayi AT Brl998 Atlantic Ocean, Malmgren, 1866 (Malmgren, 1866) Sweden Amphitrite groenlandica Neoamphitrite groenlandica AT Trl948 Atlantic Ocean, Malmgren, 1866 (Malmgren, 1866); Pol989 Greenland Terebella groenlandica Brl998 (Malmgren, 1866) 219 Species Synonymized taxa Region Citation Type Locality EAO WL1950 Grl954 W&A1987 Pol989 HB A&W1989a WAO Pel 954 A&W1989c C&K2008 Amphitrite ornata (Leidy, Terebella ornata Leidy, AT Li 1977 Atlantic Ocean, 1855) 1855; Neoamphitrite ornata Brl979 Rhode Island (Leidy, 1855) Pol989 Brl998 Tt2004 Artacama canadensis AT Trl948 Atlantic Ocean, Mcintosh, 1915 Gulf of St. Lawrence Artacama coniferi Moore, Artacama conifera Moore, PC B&B1942 Pacific Ocean, 1905 1905 B&B1952 British Columbia Bel968 H&B1981 Artacama proboscidea AT Trl948 Arctic Ocean, Malmgren, 1866 Lil977 Spitsbergen Pol989 Brl998 Tt2004 EAO WL1950 HB A&W1989a WAO A&W1989C C&K2008 Baffmia hesslei Terebella hesslei AT Pol989 Pacific Ocean, (Annenkova, 1924) Annenkova, 1924 Bering Sea Baffinia multisetosa EAO WL1950 Arctic Ocean, Wesenberg-Lund, 1950 Greenland Betapista dekkerae Banse, PC H&B1981 Pacific Ocean, 1980 British Columbia Eupolymnia Lanice heterobranchia PC Hal948 Pacific Ocean, heterobranchia (Johnson, Johnson, 1901 B&B1952 Puget Sound 1901) Be1968 H&B1981 Eupolymnia nesidensis Amphitrite nesidensis delle AT Trl948 Atlantic Ocean, (delle Chiaje, 1828) Chiaje, 1828; Terebella Mediterranean danielsseni Malmgren, 1866 Sea Eupolymnia sp. EAO B&D1973 Lanassa nordenskioeldi AT Trl948 Arctic Ocean, Malmgren, 1866 Brl998 Spitsbergen Lanassa venusta (Malm, Laphaniella venusta Malm, AT F&P1984 Atlantic Ocean, 1874) 1874 Pol989 Sweden Brl998 EAO Cul972 Cul979 W&A1987 A&W1989b 220 Species Synonymized taxa Region Citation Type Locality Pol989 HB A&W1989a PC Hal 948 WAO Pel954 Lcmassa venusta venusta PC H&B1981 (Malm, 1874) Laphania boecki Laphania boecki hystricis AT Pol989 Atlantic Ocean, Malmgren, 1866 Mcintosh, 1915 Brl998 northern region EAO Grl954 Cul972 W&A1987 Pol989 PC H&B1981 WAO A&W1989c C&K2008 Leaena abranchiata (M. Terebella ebranchiata M. AT Trl948 Atlantic Ocean, Sars, 1865) Sars, 1865; Leaena Pol 989 Norway ebranchiata (M. Sars, 1865) Brl998 EAO WL1950 Grl954 Cul972 Cul979 A&W1989D Pol989 HB B&B1943 PC Hal948 WAO Pel 954 A&W1989C C&K2008 Lysilla loveni Malmgren, AT Pol989 Atlantic Ocean, 1866 Brl998 Sweden EAO Grl954 Cul972 W&A1987 Pol989 HB A&W1989a PC H&B1981 Lysilla pacifica Hessle, PC B&N1968 Pacific Ocean, 1917 Bonin Islands Neoamphitrite edwardsi Terebella edwardsii PC H&B1981 Atlantic Ocean, (Quatrefages, 1865) Quatrefages, 1865 France Neoamphitrite figulus Terebella figulus Dalyell, AT Trl948 Atlantic Ocean, (Dalyell, 1853) 1853; Amphitrite figulus Lil977 England (Dalyell, 1853); Amphitrite Br 1979 johnstoni Malmgren, 1866 F&P1984 Pol989 Brl998 Tt2004 221 Species Synonymized taxa Region Citation Type Locality Neoamphitrite robusta Amphitrite robusta Johnson, PC B&B1942 Pacific Ocean, (Johnson, 1901) 1901 Hal948 Washington B&B1952 Bel968 H&B1981 Neoleprea japonica PC H&B1981 Pacific Ocean, Hessle, 1917 Japan Neoleprea spiralis Amphitrite spiralis Johnson, PC B&B1942 Pacific Ocean, (Johnson, 1901) 1901 Hal948 Washington B&B1952 Bel968 H&B1981 Nicolea venustula Terebella venustula AT Li 1977 Atlantic Ocean, (Montagu, 1818) Montagu, \%\&;Scione Brl979 England venustula (Montagu, 1818) Pol989 Brl998 EAO WL1950 Cul972 Pol989 WAO Chi920 Pel 954 A&W1989c C&K2008 Nicolea zostericola Terebella zostericola AT Pol989 Atlantic Ocean, (0rsted, 1844 inGrube 0rsted, 1844 in Grube 1860 Brl998 Denmark 1860) Tt2004 EAO Grl954 Cul979 W&A1987 A&W1989b Pol989 HB B&B1943 A&W 1989a PC Ha 1948 B&B1952 Bel968 H&B1981 WAO B&B1944 C&K2008 Paramphitrite birulai Amphitrite birulai AT Pol989 Arctic Ocean, (Ssolowiew, 1899) Ssolowiew, 1899 White Sea Pista brevibranchiata Pista brevibranchia PC H&B1981 Pacific Ocean, Moore, 1923 Chamberlin, 1919; Pista California flmbriata Moore, 1923 Pista cristata (O.F. Mtiller, Amphitrite cristata O.F. AT Trl948 Atlantic Ocean, 1776) Miiller, 1776 Pol989 Norway Brl998 EAO Grl954 B&D1973 Stl985 Pol989 PC B&B1942 Hal 948 B&B1852 222 Species Synonymized taxa Region Citation Type Locality Bel968 H&B1981 Pista elongata Moore, Pista groenlandica AT U1977 Pacific Ocean, 1909 Treadwell, 1937 California EAO Trl937 WL1950 Grl954 W&A1987 A&W1989b HB B&B1943 A&W 1989a PC B&B1952 Bel968 H&B1981 WAO Pel 954 A&W1989C C&K2008 Pista fasciata (Grube, Dendrophora fasciata PC Hal 948 Indian Ocean, 1870) Grube, 1870 B&B1952 Red Sea Bel968 Pista flexuosa (Grube, Terebella flexuosa Grube, AT Pol989 Arctic Ocean, 1860) 1860; Axionice flexuosa Brl998 Spitsbergen (Grube, 1860) EAO Trl937 WL1950 Grl954 W&A1987 Pol989 Pista fratrella Chamberlin, PC B&B1942 Pacific Ocean, 1919 B&B1952 California Bel968 Pista maculata (Dalyell, Terebella maculata Dalyell, AT Trl948 Atlantic Ocean, 1853) 1853; Axionice maculata Brl979 England (Dalyell, 1853); Scione F&P1984 lobata Malmgren, 1866 Pol989 Brl998 Tt2004 EAO Pol989 HB B&B1943 Pista moorei Berkeley & PC B&B1942 Pacific Ocean, Berkeley, 1942 B&B1952 British Columbia Bel968 H&B1981 Pista pacifica Berkeley & PC B&B1942 Pacific Ocean, Berkeley, 1942 B&B1952 British Columbia Bel968 H&B1981 Vil998 Polycirrus arcticus M. Leucariste albicans EAO WL1950 Arctic Ocean, Sars, 1865 Malmgren, 1865; Polycirrus Cul972 Spitsbergen albicans (Malmgren, 1865) Polycirrus caliendrum PC B&B1942 Atlantic Ocean, Claparede, 1868 B&B1952 Mediterranean 223 Species Synonymized taxa Region Citation Type Locality Bel968 Sea Polycirrus califomicus PC H&B1981 Pacific Ocean, Moore, 1909 California Polycirrus eximius (Leidy, Torquea eximia Leidy, 1855 AT LH977 Atlantic Ocean, 1855) Brl979 Rhode Island Pol989 Brl998 Tt2004 Polycirrus kerguelensis Ereutho kerguelensis PC B&B1942 Southern Ocean, (Mcintosh, 1885) Mcintosh, 1885 B&B1952 Kerguelen Bel968 Islands Polycirrus medusa Grube, AT Trl948 Atlantic Ocean, 1850 Li 1977 Mediterranean F&P1984 Sea Pol989 Brl998 Tt2004 EAO WL1950 B&D1973 A&W 1989b Pol989 PC Bel968 WAO Pel 954 A&W1989c C&K2008 Polycirrus phosphoreus AT Trl948 Atlantic Ocean, Verrill, 1880 Li 1977 Canada Brl979 F&P1984 Pol989 Tt2004 EAO Pol989 Proclea graffl Leaena graffii Langerhans, AT Pol989 Atlantic Ocean, (Langerhans, 1884) 1884 Brl998 Madeira EAO A&W 1989b Pol989 PC H&B1981 WAO Pel954 C&K2008 Scionella estevanica HB B&B1943 Pacific Ocean, Berkeley & Berkeley, 1942 British Columbia PC B&B1942 B&B1952 Bel968 H&B1981 Scionella japonica Moore, PC B&B1952 Pacific Ocean, 1903 Bel968 Japan Sea H&B1981 WAO C&K2008 Spinosphaera sp. PC Hal 948 224 Species Synonymized taxa Region Citation Type Locality Streblosoma bairdi Grymaea bairdi Malmgren, PC B&B1952 Atlantic Ocean, (Malmgren, 1866) 1866 Bel968 Sweden H&B1981 Streblosoma spiralis Grymaea spiralis Verrill, AT Trl948 Atlantic Ocean, (Verrill, 1874) 1874 U1977 Maine Pol989 Brl998 Terebella ehrenbergi PC B&B1942 Indian Ocean, Grube, 1870 B&B1952 Red Sea Bel968 H&B1981 Thelepus cincinnatus Amphitrite cincinnata AT Trl948 Atlantic Ocean, (Fabricius, 1780) Fabricius, 1780 LU977 Greenland Pol 989 Brl998 Tt2004 EAO Chi920 Trl937 WL1950 Grl954 B&D1973 Cul979 W&A1987 A&W1989b Pol989 HB A&W1989a PC Bel968 H&B1981 WAO Pel954 Thelepus crispus Johnson, PC B&B1942 Pacific Ocean, 1901 Hal 948 Washington to B&B1952 California Bel968 H&B1981 Thelepus hamatus Moore, PC Hal 948 Pacific Ocean, 1905 B&B1952 Alaska Thelepus setosus Phenacia setosa PC B&B1952 Atlantic Ocean, (Quatrefages, 1865) Quatrefages, 1865 Bel968 France H&B1981 Tomopteridae Tomopteris (Johnstonella) Tomopteris duccii Rosa, AT Trl948 Pacific Ocean, duccii Rosa, 1908 1908 Mexico Tomopteris (Johnstonella) Tomopteris helgolandica AT Trl948 Atlantic Ocean, helgolandica Greeff, 1879 Greeff, 1879; Johnstonella Pel963 North Sea catharina Gosse, 1853; Li 1977 Tomopteris catharina Pol 989 (Gosse, 1853) Brl998 Tt2004 Tomopteris (Johnstonella) Tomopteris pacifica Izuka, PC Bel 924 Pacific Ocean, pacifica Izuka, 1914 1914; Tomopteris kefersteini B&B1948 Japan Greeff, 1879; Tomopteris Be 1967 elegans Berkeley 1924; 225 Species Synonymized taxa Region Citation Type Locality Tomopteris renata Berkeley, 1930 Tomopteris cavallii Rosa, AT Pol989 Atlantic Ocean, 1908 Brl998 southern region EAO WL1950 PC Bel967 Tomopteris krampi EAO WL1950 Arctic Ocean, Wesenberg-Lund, 1936 Iceland and Greenland Tomopteris nisseni Rosa, EAO WL1950 Atlantic Ocean, 1908 northern region Tomopteris planktonis AT Trl948 Atlantic Ocean Apstein, 1900 Pol989 EAO WL1950 Grl954 W&A1987 Tomopteris septentrionalis AT Trl948 Atlantic Ocean, Steenstrup, 1849 Pol989 North Sea EAO WL1950 Pol989 PC Bel924 B&B1942 B&B1948 Bel 967 Trichobranchidae Novobranchus pacificus PC Bel968 Pacific Ocean, Berkeley & Berkeley, 1954 H&B1981 British Columbia Terebellides stroemi M. Terebellides stroemii M. AT Trl948 Atlantic Ocean, Sars, 1835 Sars, 1835 Lil977 Norway F&P1984 Pol989 Brl998 Tt2004 Q&S2005 EAO WL1950 Grl954 E11960 Cul972 B&D1973 Cul979 SH985 W&A1987 Pol989 HB B&B1943 A&W 1989a PC B&B1942 Hal948 B&B1952 Bel968 H&B1981 Vil998 226 Species Synonymized taxa Region Citation Type Locality WAO Chi920 B&B1944 Pel 954 B&C1979 A&W1989C B12005 C&K2008 Co2008 Trichobranchus glacialis AT Trl948 Arctic Ocean, Malmgren, 1866 U1977 Spitsbergen Pol989 Brl998 EAO WL1950 Cul979 Pol989 PC B&B1952 Bel968 H&B1981 WAO Pel 954 A&W1989C C&K2008 Trichobranchus roseus Filibranchus roseus Malm, AT Li 1977 Atlantic Ocean, (Malm, 1874) 1874 Sweden Trochochaetidae Trochochaeta carica Disoma carica Birula, 1897; AT Trl948 Arctic Ocean, (Birula, 1897) Nevaya whiteavesi Lil977 Russia Mcintosh, 1911 Brl998 WAO C&K2008 Trochochaeta multisetosa Disoma multisetosum AT Pel 963 Atlantic Ocean, (0rsted, 1843) 0rsted, 1843, Trochochaeta Pol989 Denmark multisetosum (0rsted, 1843) Brl998 Q&S2005 EAO Grl954 Cul979 PC H&B1981 Vil998 WAO C&K2008 Co2008 Trochochaeta pettiboneae AT Del987 Atlantic Ocean, Dean, 1987 Gulf of Maine Trochochaeta watsoni Disoma watsoni Fauvel, AT Lil977 Atlantic Ocean, (Fauvel, 1916) 1916 Pol989 Canada Brl998 Typhloscolecidae Sagitella kowalewskii PC B&B1948 Atlantic Ocean, Wagner, 1872 Bel967 tropical region Travisiopsis levinseni AT Pol989 Atlantic Ocean, Southern, 1910 Ireland EAO WL1950 Travisiopsis lobifera PC Bel 967 Atlantic Ocean, Levinsen, 1885 northern region 227 Species Synonymized taxa Region Citation Type Locality Typhloscolex muelleri Typhloscolex mulleri Busch, EAO Pol989 Atlantic Ocean, Busch, 1851 1851 Mediterranean Sea PC B&B1948 Be 1967 228 Appendix 3.1. List of eighteen trans-Arctic polychaete species pairs with associated Atlantic (St. Andrews (ST); Torngat Mountains (TOR); Churchill (CHU); Igloolik (IGL); Resolute (RES)) and Pacific (Bering Sea (BS); Bamfield (BAM)) collection localities, sample size, and Process IDs in the project "Polychaetes of North America (PONA)" accessed from the Barcode of Life Data Systems (BOLD) www.barcodinglife.org. Species (comp^s'"') Locality No. specimens Process IDs Alitta virensw ST 40 NBPOL003-08 NBPOL004-08 NBPOL005-08 NBPOL009-08 NBPOL008-08 NBPOLO10-08 NBPOLO11-08 NBPOL023-08 NBPOL021-08 NBPOLO 18-08 NBPOLO 19-08 NBPOL178-08 NBPOL177-08 NBPOL 170-08 NBPOL 175-08 NBPOL171-08 NBPOL 172-08 NBPOL070-08 NBPOL049-08 NBPOL048-08 NBPOL047-08 NBPOL050-08 NBPOL052-08 NBPOL053-08 NBPOL051-08 NBPOL069-08 NBPOL063-08 NBPOL066-08 NBPOL099-08 NBPOL 108-08 NBPOL 130-08 NBPOL 161-08 NBPOL414-08 NBPOL416-08 NBPOL001-08 NBPOL200-08 NBPOL 195-08 NBPOL 196-08 NBPOL245-08 NBPOL246-08 229 Species (comparison) Locality No. specimens Process IDs Alitta sp. CMC01(1) BAM BCPOL124-08 BCPOL125-08 <2> Cirratulus cirratus CMC01 BAM BCPOL404-08 (2) Cirratulus cirratus CMC02 CHU CCANN195-09 CCANN738-09 CCANN763-08 Eunoe nodosa CMC02 (3) BS 1 BENTH002-08 Eunoe nodosa CMC02 <3) IGL, RES, 5 CCPOL121-07 TOR CCPOL261-08 CCPOL262-08 LABBI039-09 LABBI059-09 Glycera capitata CMC01(4) BAM 2 BCPOL 170-08 BCPOL206-08 Glycera capitata CMC02 (4'5) CHU, RES, 11 CCANN619-09 TOR CCANN620-09 CCANN621-09 CCANN622-09 CCANN650-09 CCANN651-09 CCANN683-09 CCANN789-09 CCPOL002-07 CCPOL003-07 LABBI045-09 Glycera capitata CMC02 (5) BS 1 BENTH276-08 Harmothoe imbricata CMC01 (6'7) BAM 17 BCPOL044-08 BCPOL049-08 BCPOL050-08 BCPOL051-08 BCPOL054-08 BCPOL057-08 BCPOL058-08 BCPOL062-08 BCPOL069-08 BCPOL070-08 BCPOL 120-08 BCPOL235-08 BCPOL242-08 BCPOL393-08 BCPOL403-08 BCPOL432-08 BCPOL443-08 Harmothoe imbricata CMC01(6) CHU, RES 8 CCANN024-07 CCANN080-07 CCANN324-08 CCANN496-09 CCANN505-09 CCANN793-09 230 Species (comparison) Locality No. specimens Process IDs CCANN794-09 CCPOL155-07 Harmothoe imbricata CMC02 <7) RES, ST 19 CCPOL018-07 CCPOL066-07 CCPOL 126-07 NBPOL012-08 NBPOL013-08 NBPOL014-08 NBPOL015-08 NBPOL016-08 NBPOL017-08 NBPOL039-08 NBPOL149-08 NBPOL150-08 NBPOL151-08 NBPOL153-08 NBPOL 154-08 NBPOL 166-08 NBPOL242-08 NBPOL381-08 NBPOL383-08 Harmothoe rarispina CMC02 (8) BAM 1 BCPOL461-08 Harmothoe rarispina CMC03 <8) CHU, IGL, 17 CCANN191-08 RES, ST CCANN223-08 CCANN224-08 CCANN259-08 CCANN339-08 CCANN438-08 CCANN625-09 CCPOL023-07 CCPOL 117-07 CCPOL 182-07 CCPOL 183-07 CCPOL 187-07 NBPOL 152-08 NBPOL155-08 NBPOL 165-08 NBPOL 167-08 NBPOL213-08 Lepidonotus squamatus CMC01(9) BAM BCPOL343-08 BCPOL344-08 BCPOL3 54-08 BCPOL370-08 BCPOL383-08 Lepidonotus squamatus CMC02(9) ST 21 NBPOL 133-08 NBPOL 134-08 NBPOL135-08 NBPOL 136-08 NBPOL 137-08 NBPOL138-08 231 Species 232 Species (comparison) Locality No. specimens Process IDs Pectinaria granulata CMC03 ' ' CHU, IGL, 40 CCANN006-07 ST CCANN020-07 CCANN068-07 CCANN069-07 CCANN100-08 CCANN101-08 CCANN 102-08 CCANN 103-08 CCANN 104-08 CCANN 105-08 CCANN 106-08 CCANN 107-08 CCANN 180-08 CCANN181-08 CCANN 182-08 CCANN183-08 CCANN235-08 CCANN377-08 CCANN378-08 CCANN379-08 CCANN3 80-08 CCANN497-09 CCANN503-09 CCANN590-09 CCANN629-09 CCANN630-09 CCANN698-09 CCANN699-09 CCANN700-09 CCANN701-09 CCANN702-09 CCANN704-09 CCANN710-09 CCANN841-09 CCPOL191-07 CCPOL202-07 CCPOL278-08 NBPOL090-08 NBPOL091-08 NBPOL092-08 Pholoe baltica (15) BS BEST063-08 Pholoe baltica (15) CHU, RES CCANN814-09 CCPOL294-08 CCPOL302-08 Pholoe minuta BS BEST039-08 BEST040-08 BEST041-08 BEST062-08 Pholoe minuta CHU, RES, 26 CCANN043-07 TOR CCANN044-07 233 Species (comparison) Locality No. specimens Process IDs CCANN045-07 CCANN046-07 CCANN275-08 CCANN281-08 CCANN285-08 CCANN305-08 CCANN319-08 CCANN328-08 CCANN398-08 CCANN402-08 CCANN409-08 CCANN553-09 CCANN569-09 CCANN616-09 CCANN752-09 CCANN812-09 CCANN817-09 CCANN890-09 CCANN891-09 CCPOL055-07 CCPOL056-07 CCPOL058-07 NBPOL301-08 NBPOL337-08 (17) Phyllodoce groenlandica CMC01 BS 1 BENTH252-08 (17) Phyllodoce groenlandica CMC01 CHU 39 CCANN081-07 CCANN082-07 CC ANN 112-08 CC ANN 114-08 CCANN213-08 CCANN282-08 CCANN313-08 CCANN3 52-08 CCANN353-08 CCANN354-08 CCANN356-08 CCANN3 57-08 CCANN358-08 CCANN359-08 CCANN362-08 CCANN365-08 CCANN368-08 CCANN3 73-08 CCANN3 88-08 CCANN422-08 CCANN425-08 CCANN434-08 CCANN440-08 CCANN441-08 CCANN443-08 234 Species (comparison) Locality No. specimens Process IDs CCANN446-08 CCANN448-08 CCANN449-08 CCANN469-08 CCANN470-08 CCANN475-08 CCANN521-09 CCANN624-09 CCANN718-09 CCANN724-09 CCANN777-09 CCANN786-09 CCANN787-09 CCANN806-09 (,8) Phyllodoce sp. CMC01 BS 1 BEST100-08 (18) Phyllodoce sp. CMC01 IGL, RES, 7 CCPOL027-07 TOR CCPOL063-07 CCPOL227-07 CCPOL234-07 CCPOL260-08 LABBI044-09 LABBI047-09 (,9) Praxillellapraetermissa CMC01 BS 1 BEST090-08 (19) Praxillella praetermissa CMC01 CHU 4 CCANN547-09 CCANN552-09 CCANN573-09 CCANN860-09 (2U) Scalibregma inflatum CMC01 CHU, TOR 10 CCANN578-09 CCANN601-09 CCANN602-09 CCANN844-09 LABBI015-09 LABBI023-09 LABBI027-09 LABBI029-09 LABBI043-09 LABBI174-09 (20) Scalibregma inflatum CMC03 BS BEST033-08 BEST089-08 BEST098-08 235 Appendix 3.2. Local rate constancy tests between: (a) sister taxa with >2% divergence, (b) five species that were candidates for calculating a molecular clock, and (c) genera within families. All pairwise calculations were done using the relative rate two-cluster test (Takezaki et al. 1995) in PHYLTEST (Kumar 1996) with the K2P distance metric. Outgroups for each comparison were: (a) same genus or family, (b) Phyllodoce groenlandica, and (c) indicated in parentheses, and obtained from the project "Polychaetes of North America (PONA)" accessed from the Barcode of Life Data Systems (BOLD) www.barcodinglife.org. La and Lb (corresponding to the first and second comparison column, respectively) are the averages of observed number of substitutions per site (branch length) where La = Lb is the null hypothesis under the constancy of a molecular clock. a. Sister taxa Comparison La Lb Z-value P-value Pacific Atlantic Alitta sp. CMC01 Alitta virens 0.081 0.076 0.306 0.760 Cirratulus cirratus CMC01 Cirratulus cirratus CMC02 0.084 0.063 1.312 0.190 Glycera capitata CMC01 Glycera capitata CMC02 0.046 0.041 0.324 0.746 Harmothoe imbricata CMC01 Harmothoe imbricata CMC02 0.024 0.026 0.208 0.835 Harmothoe rarispina CMC02 Harmothoe rarispina CMC03 0.032 0.038 0.534 0.593 Lepidonotus squamatus CMC01 Lepidonotus squamatus CMC02 0.080 0.068 0.718 0.473 Myxicola infundibulum CMC02 Myxicola infundibulum CMC01 0.073 0.085 0.618 0.536 Nephtys punctata CMC02 Nephtys punctata CMC03 0.024 0.044 1.754 0.079 Nereis pelagica CMC01 Nereis pelagica CMC02 0.016 0.018 0.274 0.784 Nothria conchylega CMC01 Nothria conchylega CMC02 0.040 0.027 0.963 0.335 Pectinaria granulata CMC01 Pectinaria granulata CMC03 0.078 0.086 0.396 0.692 Scalibregma inflation CMC03 Scalibregma inflatum CMC01 0.023 0.035 1.124 0.261 b. Trans-Arctic species Comparison La Lb Z-value P-value Cirratulus cirratus CMC01/CMC02 Alitta virens /Alitta sp. CMC01 0.306 0.141 5.204 <0.0001 Cirratulus cirratus CMC01/CMC02 Lepidonotus squamatus CMC01/CMC02 0.300 0.150 4.594 <0.0001 Cirratulus cirratus CMC01/CMC02 Myxicola infundibulum CMC01/CMC02 0.299 0.174 3.698 <0.001 Cirratulus cirratus CMC01/CMC02 Pectinaria granulata CMC01/CMC03 0.299 0.153 4.603 <0.0001 Alitta virens / Alitta sp. CMC01 Lepidonotus squamatus CMC01/CMC02 0.156 0.171 0.641 0.521 Alitta virens /Alitta sp. CMC01 Myxicola infundibulum CMC01/CMC02 0.134 0.174 1.682 0.093 Alitta virens /Alitta sp. CMC01 Pectinaria granulata CMC01/CMC03 0.140 0.159 0.842 0.400 Lepidonotus squamatus CMC01/CMC02 Myxicola infundibulum CMC01/CMC02 0.149 0.174 0.983 0.326 Lepidonotus squamatus CMC01/CMC02 Pectinaria granulata CMC01/CMC03 0.171 0.174 0.134 0.893 Myxicola infundibulum CMC01/CMC02 Pectinaria granulata CMC01/CMC03 0.167 0.147 0.788 0.431 c. Families (outgroup) Comparison La Lb Z-value P-value 1. Pectinariidae (Thelepus cincinnatus) Pectinaria hyperborea Pectinaria granulata CMC01/CMC02/CMC03 0.091 0.093 0.071 0.943 2. Sabellidae (Spio sp.) Myxicola infundibulum CMC01/CMC02 Chone infundibuliformis 0.163 0.150 0.679 0.497 Pseudopotamilla reniformis Chone magna Eudistylia vancouveri 3. Polynoidae (Pholoe baltica) Gattyana cirrhosa Arctonoe fragilis 0.1138 0.1159 0.1603 0.8726 Gattyana ciliata Arctonoe pulchra Harmothoe imbricata CMC01/CMC02 Lepidonotus squamatus CMC01/CMC02 Eunoe depressa Halosydna brevisetosa 4. Cirratulidae {Capitella capitata) Cirratulus cirratus CMC01/CMC02 Chaetozone setosa 0.1774 0.2007 1.117 0.264 Cirratulidae sp. Chaetozone sp. Tharyx sp. Dodecaceria sp. : --.'•; - •-.-; --:--. •' ••'-•• :'- •'= -•- -;;: :: '-••••• -' - ; - ;- 00 5. Nereididae (Scalibregma inflation) Nereis pelagica CMC01/CMC02 Alitta virens 0.1106 0.1233 0.7379 0.4606 Nereis zonata Cheilonereis cyclurus Nereis vexillosa