HRG Switches TNFR1-Mediated Cell Survival to Apoptosis in Hepatocellular Carcinoma

1 HRG switches TNFR1-mediated cell survival to apoptosis in hepatocellular carcinoma

2 Xuejing Zou1, 2*, Dongyan Zhang2, 3*, Yang Song 2, 3*, Shanshan Liu1, 2, Qian Long1, 2, Liheng

3 Yao 1, 2, Wenwen Li1, 2, Zhijiao Duan1, 2, Dehua Wu2, 3and Li Liu1, 4

4 1. Guangdong Provincial Key Laboratory of Viral Hepatitis Research, Hepatology Unit and

5 Department of Infectious Diseases, Nanfang Hospital, Southern Medical University,

6 Guangzhou 510515, China

7 2. State Key Laboratory of Organ Failure Research, Nanfang Hospital, Southern Medical

8 University, Guangzhou 510515, China

9 3. Department of Radiation Oncology, Nanfang Hospital, Southern Medical University,

10 Guangzhou 510515, China

11 4.Department of Medical Quality Management, Nanfang Hospital, Southern Medical

12 University, Guangzhou 510515, China

13 These authors contributed equally: Xuejing Zou, Dongyan Zhang, Yang Song

14 Running title: HRG as a pro-apoptotic molecular switch in HCC

15 Corresponding authors: Prof. L. Liu, Guangdong Provincial Key Laboratory of Viral

16 Hepatitis Research, Hepatology Unit, Department of Infectious Diseases and Department of

17 Medical Quality Management, Nanfang Hospital, Southern Medical University, Guangzhou

18 510515, China. Phone: 86-18602062738. E-mail: [email protected]; and Prof. D. Wu,

19 Department of Radiation Oncology, Nanfang Hospital, Southern Medical University,

20 Guangzhou 510515, China. Phone: 86-20-62787693; Fax: 86-20-62787631. E-mail:

21 [email protected].

22 Conflict of interest: The authors have no conflicts of interest to declare.

23 Abstract

24 Background: Tumor necrosis factor receptor 1 (TNFR1) signaling plays a pleiotropic role in

25 the development of hepatocellular carcinoma (HCC). The formation of TNFR1-complex I

26 supports cell survival while TNFR1-complex Ⅱ leads to apoptosis, and the underlying

27 mechanisms of the transformation of these TNFR1 complexes in HCC remain poorly defined.

28 Methods: The interaction protein of TNFR1 was identified by GST pulldown assay,

29 immunoprecipitation and mass spectrometry. In vitro and in vivo assay were performed to

30 explore the biological features and mechanisms underlying the regulation of TNFR1 signals

31 by histidine-rich glycoprotein (HRG). Data from the public databases and HCC samples were

32 utilized to analyze the expression and clinical relevance of HRG.

33 Results: HRG directly interacted with TNFR1 and stabilized TNFR1 protein by decreasing

34 the Lys(K)-48 ubiquitination mediated-degradation. The formation of TNFR1-complex Ⅱ was

35 prompted by HRG overexpression via upregulating Lys(K)-63 ubiquitination of TNFR1.

36 Besides, overexpression of HRG suppressed expression of pro-survival genes by impairing

37 the activation of NF-κB signaling in the presence of TNFR1. Moreover, downregulation of

38 HRG was a result of feedback inhibition of NF-κB activation in HCC. In line with the pro-

39 apoptotic switch of TNFR1 signaling after HRG induction, overexpression of HRG inhibited

40 cell proliferation and increased apoptosis in HCC.

41 Conclusions: Our findings illustrate a crucial role for HRG in suppressing HCC via inclining

42 TNFR1 to a pro-apoptotic cellular phenotype. Restoring HRG expression in HCC tissues

43 might be a promising pharmacological approach to blocking tumor progression by shifting

44 cellular fate from cell survival to apoptosis.

46 Graphical abstract: In HCC cells, HRG expression is suppressed by NF-κB activation which

47 supports cell survival. Otherwise, forcing HRG expression increases cell death by enhancing

48 TNFR1-complex II formation and impairing NF-κB signaling.

50 Keywords: histidine-rich glycoprotein, tumor necrosis factor receptor 1, apoptosis

52 Background

53 TNFR1 is dysregulated in various cancers and is associated with malignant progression.

54 Study showed that TNFR1-mediated signaling cooperates with repressed keratinocyte NF-κB

55 in driving skin cancer development [1]. MUC13 interacts with TNFR1 and increases

56 clustering of the TNFR1 signaling complex, thereby amplifying the efficiency of TNF-

57 induced NF-κB activation, which supports colorectal cancer cells to survive under DNA-

58 damaging agents [2]. TNFR1 was also noted to be involved in regulating the tumorigenicity

59 of ovarian cancer [3]. In liver cancer, TNFR1 is reported to be vital for tumor promotion.

60 TNF-α/ TNFR1 signaling participates in the proliferation of oval cells during the

61 preneoplastic stage of liver carcinogenesis and loss of TNFR1 reduces the incidence of tumor

62 formation [4]. TNFR1 signaling contributes to obesity-induced carcinoma promotion as

63 depletion of TNFR1 abolished obesity-enhanced HCC development [5]. Based on such

64 tumor-promoting aspects of TNFR1, efforts have been made to target TNF-α or TNFR1 in

65 various malignancies with pharmaceuticals that include TNF-α inhibitors, TNFR1

66 monoclonal antibodies, and TNFR1-targeting nanomaterials. However, the implements of

67 TNF-α or TNFR1 therapeutic practices are unsatisfactory owing to the dual function and

68 complexity of TNFR1-mediated signaling during cancer development [6-8].

69 TNFR1 governs either survival or death in cancer cells via formation of different

70 TNFR1-complexes [9,10]. Upon TNF-α stimulation, TNFR1 recruits receptor-interacting

71 protein 1 (RIP1) and TNFR1-associated death domain protein (TRADD) to form TNFR1-

72 complex I which increases the expression of a string of pro-survival genes by activating the

73 NF-κB signaling pathway [11,12]. Activation of TNFR1-complex I plays a vital role in

74 tumorigenesis as shown in previous studies that investigated the act of TNF-α in the initiation,

75 development, recurrence and therapy resistance of malignancies such as liver cancer, breast

76 cancer, bladder cancer, renal cell carcinoma and pancreatic cancer [13-17]. Besides, TNF-α

77 stimulation leads to TNFR1 internalization into the cytoplasm and formation of TNFR1-

78 complex Ⅱ, also known as death-inducing signaling complex (DISC). Next, TNFR1 recruits

79 fas-associated death domain protein (FADD) and caspase-8 to increase apoptosis, leading to

80 cell death [18]. Based on the cell death-promoting effect of TNFR1-complex Ⅱ, the potency

81 of human recombinant TNF-α as an anti-tumor therapy was tested in numerous clinical trials

82 but declined owing to the unclear role of the TNFR1-mediated signaling pathway in cancer

83 [6]. Suppressing NF-κB-dependent living signaling while inducing TNFR1-mediated cell

84 apoptosis is an unresolved conundrum for devising medicines based on TNFR1 modulation.

85 TNFR1 signaling is regulated by diverse processes that include ubiquitination,

86 glycosylation, endocytosis, lipid raft recruitment, and so on. Among these, ubiquitination is

87 one of the most central post-transcriptional modifications that controls the stability of TNFR1

88 protein and leads the pro-survival or pro-apoptotic cellular signaling transduction, which

89 determines cancer cell progression [19-22]. Given the limited understanding of governing

90 TNFR1-mediated signaling transduction in HCC, we performed this study to explore the

91 regulation of TNFR1 complex I/Ⅱ and the resulting influence on the cell fate.

92 Researches demonstrated that histidine-rich glycoprotein (HRG) involves both

93 inflammatory promoting effect in chronic liver disease and tumor suppression during the

94 development of HCC [23-25]. HRG was identified as a TNFR1 binding partner in our study.

95 Whether HRG influences the TNFR1 signaling mechanism within cancer cells from a pro-

96 survival to pro-death state has not been explored. A better understanding of the role of HRG

97 in TNFR1-mediated pleiotropic pathways ought to assist in formulating new anticancer

98 therapeutic strategies.

100 Materials and Methods

101 Patients and tissue samples

102 HCC samples and matching noncancerous tissues used in our study were collected from

103 HCC patients who underwent hepatectomy between January 2014 and December 2015 at

104 Nanfang Hospital (Guangzhou, China). Patients enrolled did not receive any anti-tumor

105 treatment before surgery. Prior patient consent and approval from the Institute Research

106 Ethics Committee were obtained for the use of the clinical materials for research.

107 All tissues were stored in a liquid nitrogen container prior to RNA or protein extraction.

108 Cell culture

109 HCC cell lines Huh7 and SMMC-7721 were purchased from the Cell Bank of the

110 Chinese Academy of Sciences (Chinese Academy of Sciences, Shanghai, China). Huh7 and

111 SMMC-7721 cells were incubated in DMEM and RPMI 1640 (Gibco, Grand Island, NY,

112 USA), respectively, with 10% fetal bovine serum (Gibco) at 37 ℃ in a humidified incubator

113 containing 5% CO2. Recombinant human TNF-alpha (PeproTech, Rocky Hill, NJ, USA),

114 FXR agonist GW4064 (Selleck Chemicals, USA), MG132 (Beyotime Biotechnology, China)

115 and cycloheximide (CHX, Sigma-Aldrich, USA) were used to treat cells for experiments.

116 Xenograft assays

117 BALB/c nude mice (4-6 weeks old, Central Laboratory of Animal Science, Southern

118 Medical University, Guangzhou, China) were used for in vivo studies. HRG-overexpressed

119 SMMC-7721 cells and the related controls were suspended at a density of 1×107 per 100 μL

120 and inoculated subcutaneously into the flanks of each mouse. After 30 days, the IVIS Lumina

121 II system (Caliper Life Sciences, Hopkinton, MA, USA) was used to measure the

122 fluorescence intensity of tumor before sacrifice. Xenograft tumors were then removed and

123 weighed. Hematoxylin and eosin (H&E), terminal deoxy-nucleotidyl transferase-mediated

124 dUTP nick-end labeling (TUNEL) assay (In Situ Cell Death Detection Kit, Roche, USA), and

125 immunohistochemical (IHC, Dako, Carpinteria, CA, USA) staining were performed to

126 evaluate the morphology, cell apoptosis, and cell proliferation in all tumor tissues,

127 respectively, according to the manufacturer’s guidelines.

128 Gene-expression datasets

129 TCGA cohort: A cohort containing 365 cases of HCC patients with HRG expression data

130 and follow-up information downloaded from The Cancer Genome Atlas Liver Hepatocellular

131 Carcinoma (TCGA-LIHC; https://tcga-data.nci.nih.gov/tcga/) dataset. GSE14520 cohort: A

132 cohort of HCC patients with HRG expression data and follow-up information downloaded

133 from the GEO database (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE14520).

134 GSE6764 cohort: 75 samples covering different stages of HCV-induced HCC were analyzed

135 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi). Patients were organized according to their

136 HRG expression (from high to low) and then divided into two groups by the median or

137 quartile value. Correlations between HRG expression and overall survival (OS) and

138 progression-free interval (PFI) were analyzed.

139 GST pulldown assay

140 pGEX-6p-1, pGEX-6p-1-GST-TNFR1, and pET-28a-HRG-HIS were transformed into

141 Rosetta (DE3) cells and induced for expression by isopropylthio-β-d-galactoside. The GST

142 pulldown assay was performed according to the manufacturer’s instructions (GST pulldown

143 Kit, BersinBio, Guangzhou, China). Briefly, GST-TNFR1 (bait) was purified by using GSH-

144 beads and then incubated with cell lysates containing HRG-His (prey) overnight. The beads

145 were washed and eluted for western blot detection.

146 Cell transfection, western blot and immunoprecipitation (IP) analysis,

147 immunofluorescence (IF) assay, dual-luciferase reporter assay, quantitative Real-Time

148 PCR (qRT-PCR), 5-ethynyl-20-deoxyuridine (EdU) assays, flow-cytometry assay and

149 Gene set enrichment analysis (GSEA)

150 These methods were performed as previously described [26,27] and were detailed in

151 supplementary materials and methods.

152 Statistical analysis

153 All statistical analyses were performed using SPSS 20.0 software (IBM Corp., Armonk,

154 NY, USA). Student's t-test or one-way analysis of variance (ANOVA) were used to analyze

155 data of the two groups. Two-way analysis of variance was used for multiple comparisons of

156 different groups. Survival curves and time for OS and PFI were conducted using Kaplan-

157 Meier and log-rank tests. Data were reported as the mean ± SD from three independent

158 experiments unless otherwise noted. P values < 0.05 (two-tailed) was considered statistically

159 significant.

160

161 Results

162 HRG directly interacts with TNFR1 in HCC cells

163 In order to investigate the signals representing different TNFR1-complexes under TNF-α

164 stimulation in HCC cells, we detected effectors of TNFR1-complex I (phopsho-P65/P65 and

165 IκB) and TNFR1-complex II (cleaved Caspase-8/Caspase-8 and FADD) in SMMC-7721 cells

166 exposed to TNF-α via western blotting. We found that peak expression of phospho-P65 that

167 indicated the formation of TNFR1-complex I and activation of the NF-κB signaling pathway

168 occurred 15 min after TNF-α stimulation. Apoptosis inducers cleaved Caspase-8 peaked 2 h

169 after TNF-α treatment, suggesting that TNFR1 transformed from complex I to complex II

170 (Figure 1A and Figure S1A). To further trace the transformation of the TNFR1 complex from

171 15 min to 2 h after TNF-α treatment, we applied IF assay and detected the cellular localization

172 of GFP-TNFR1. IF assay images of Huh7 cells showed that TNFR1 was bound to the

173 cytomembrane before TNF-α exposure and translocated to the cytoplasm 2 h later (Figure

174 1B). We next investigated the mechanism that favored the conversion of TNFR1-complex II.

175 A co-IP assay followed by mass spectrometry was performed to identify TNFR1 interactors

176 within 2 h of TNF-α stimulation of Huh7 cells (Figure 1C and Table S1). Nine proteins

177 including HRG were found in the common between the mass spectrometry data and

178 interactors of TNFR1 predicted from the Biogrid database (Figure S1B-C). Furthermore,

179 analysis of TCGA showed that HRG mRNA expression was the most favorable prognostic

180 marker in liver cancer and positively correlated with TNFR1 mRNA levels (Figure S1D-E).

181 To confirm their association, we performed GST pulldown assay and co-IP experiments, and

182 verified that TNFR1 directly bound to HRG (Figure 1D-E). Collectively, these data indicate

183 that HRG is physically associated with TNFR1 and may be a regulator of TNFR1-mediated

184 downstream signaling.

185

186 HRG promotes the formation of TNFR1-complex II

187 Based on the above findings, we hypothesized that HRG induced TNFR1 to form

188 TNFR1-complex II in HCC cells. We therefore transfected increasing doses of Flag-HRG

189 plasmid into Huh7 cells and measured the signals of TNFR1 complex I/II using western

190 blotting. We found that Caspase-8, and cleaved Caspase-8 were upregulated while phospho-

191 P65 was gradually reduced as HRG levels increased (Figure 2A). Also, we found that TNFR1

192 showed a longer half-life in cells stably overexpressing HRG than in control cells after CHX

193 treatment (Figure 2B). The mRNA levels of TNFR1 in HRG stable overexpressing SMMC-

194 7721 and Huh7 cells remained unchanged when compared to control cells as measured by

195 qRT-PCR, suggesting that HRG regulates TNFR1 in a post-transcriptional manner (Figure

196 S2A-C).

197 As protein stability is mainly controlled by ubiquitination [28,29], we hypothesized that

198 HRG maintained TNFR1 expression by reducing the ubiquitination-mediated degradation of

199 TNFR1. We found that TNFR1 ubiquitination levels in HCC cells stably overexpressing HRG

200 were lower than those in control cells, suggesting that overexpression of HRG inhibits the

201 total ubiquitination level of TNFR1 (Figure 2C). Studies have shown that Lys(K)-48

202 ubiquitination mediates protein degradation, and that Lys(K)-63 ubiquitination of TNFR1

203 promotes its internalization and complex II formation [30]. Further exploration into the K48

204 and K63 ubiquitination levels of TNFR1 found that overexpression of HRG reduced the level

205 of K48 ubiquitination which influenced protein degradation, and increased the level of K63

206 ubiquitination of TNFR1 (Figure 2D and Figure S2D). To identify the pivotal E3 ubiquitin

207 ligase that triggered these progress, we first compared the Lys(K)-63 ubiquitination level of

208 TNFR1 between HRG overexpression and control samples in the absence of previously

209 reported E3 ubiquitin ligases (RNF8 and TRAF6) of TNFR1 [30,31]. We found that

210 upregulation of Lys (K)-63 ubiquitination of TNFR1 by HRG was RNF8- and TRAF6-

211 dependent (Figure S2E). Furthermore, LC-MS analysis of TNFR1 co-IP lysates of different

212 groups (control, TNF-α 15 min stimulation, TNF-α 2 h stimulation, and HRG overexpression)

213 showed that UHC-L1, a C-terminal ubiquitin hydrolase, decreases the Lys (K)-63

214 ubiquitination of TNFR1 and disassociated from TNFR1 in the TNF-α 2 h stimulation and

215 HRG overexpression groups compared to that in the control and TNF-α 15 min stimulation

216 groups (Figure S2F and Table S2). Overall, HRG may disrupt the interaction between TNFR1

217 and UHC-L1, thereby increasing RNF8- or TRAF6-mediated Lys (K)-63 ubiquitination of

218 TNFR1.

219 In line with upregulation of Lys (K)-63 ubiquitination, HRG increased the binding of

220 TNFR1 to Caspase-8, indicating that HRG promoted the formation of TNFR1-complex II

221 (Figure 2E). Taken together, these findings showed that the overexpression of HRG increases

222 the stability of TNFR1 protein and promotes the formation of TNFR1-complex II.

223

224 HRG inhibits NF-κB signaling pathway activation

225 Since our data suggest that HRG promotes TNFR1-complex II formation, we next ask if

226 HRG regulates the NF-κB signaling pathway, which may be activated to transcript its anti-

227 apoptotic target genes to suppress TNFR1-complex II induced apoptosis.

228 Immunofluorescence experiments showed that P65 was phosphorylated and underwent

229 nuclear translocation within 15 min of TNF-α stimulation in SMMC-7721 control cells,

230 whereas HRG overexpression inhibited this process (Figure 3A). Meanwhile, HRG

231 knockdown promoted the nuclear translocation of phospho-P65 (Figure S3A). Furthermore,

232 GSEA performed on liver cancer samples in the TCGA database implied that low expression

233 of HRG was positively associated with NF-κB signaling (Figure 3B). We therefore utilized an

234 NF-κB luciferase reporter system and found that HRG suppressed NF-κB luciferase activity

235 (Figure 3C). Next, the expression of BCL2L1, BCL2A1, NFKB1 and MYC mRNA were

236 evaluated in HRG-overexpressed SMMC-7721 cells and its controls to determine whether

237 HRG regulates NF-κB-modulated pro-survival genes. As expected, upregulation of HRG

238 significantly decreased the expression of these genes (Figure 3D). Furthermore, co-expression

239 analyses using ChIPBase v2.0 showed that HRG was negatively correlated with RELA,

240 BCL2L1, CFLAR, and NFKB1 expression (Figure S3B) [32], further suggesting that HRG is a

241 negative regulator of the NF-κB signaling pathway.

242

243 HRG inhibits HCC cell proliferation and promotes cell apoptosis

244 The above results indicated that HRG promoted the formation of TNFR1-complex II and

245 inhibited the activation of the NF-κB signaling pathway, which strongly suggests that HRG

246 plays a role as a tumor suppressor in HCC. To evaluate the biological function of HRG in HCC,

247 Flag-HRG was stably overexpressed in HCC cells via lentiviral transduction (Figure S2C). EdU

248 assays indicated that the proliferation of HRG-overexpressing HCC cells was slower than that

249 of controls (Figure 4A), whereas HRG knockdown enhanced the proliferation of HCC cells

250 (Figure S4A). Recent investigations have noted the post-translational modification of the

251 TNFR1 as a potential anticancer therapeutic strategy [33]. Our work identified that HRG

252 regulated the TNFR1 in a post-translational manner. Therefore, we sought to determine the

253 effect of HRG on 5-fluorouracil-induced apoptosis in HCC cells. FACS analysis displayed a

254 significantly higher percentage of annexin V-positive cells in the HRG-overexpressing group

255 than in controls (Figure 4B). Consistent with our in vitro data, xenograft tumors derived from

256 cells overexpressing Flag-HRG presented lower weights and in vivo luciferase activity than

257 vector-transduced controls (Figure 4C and Figure S4B). TUNEL assays showed a significantly

258 higher rate of apoptosis in Flag-HRG-overexpressing xenograft tumors than in controls (Figure

259 4D). Additionally, levels of the Ki-67 proliferation marker were markedly reduced in xenograft

260 tumors developed from Flag-HRG-overexpressing cells compared with the controls (Figure

261 S4C-D). Collectively, these results demonstrated that HRG inhibits HCC cell proliferation and

262 promotes apoptosis both in vitro and in vivo.

263

264 HRG exerts its biological function via TNFR1

265 Given that HRG promoted the formation of TNFR1-complex II and inhibited NF-κB

266 signaling activation, we next pursued to verify whether HRG functions through regulating

267 TNFR1. The suppression of proliferation by HRG was reversed when TNFR1 was silenced

268 using siRNA (Figure 5A). The suppressive effect of HRG overexpression on NF-κB signaling

269 was also reversed when combined with TNFR1 knockdown in SMMC-7721 cells (Figure

270 5B). Consistent with these findings, the inhibitory effect of HRG on NF-κB-luciferase

271 reporter activity was TNFR1-dependent (Figure 5C). The expression levels of NF-κB target

272 pro-survival genes, which were decreased in the HRG-overexpressing group, were restored

273 with the simultaneous knockdown of TNFR1 (Figure 5D and Figure S5A), indicating that the

274 inhibitory effect of HRG on NF-κB signaling is TNFR1 dependent. Moreover, cellular

275 apoptosis induced by HRG overexpression was also dependent on the presence of TNFR1

276 (Figure S5B). These data suggest that the mediating role of HRG on cell proliferation and

277 apoptosis in HCC cells is executed, at least in part, by TNFR1.

278

279 HRG is downregulated in HCC tissues and inhibited by NF-κB

280 Our previous microarray analysis revealed that expression of HRG was downregulated in

281 HCC tissues when compared with paired non-tumorous samples (n=7, P=0.006; fold change

282 = 29.56) [27]. Furthermore, expression data from the TCGA, GSE14520, and GSE6764

283 datasets showed that HRG was dramatically lower in tumor tissues than in non-tumorous

284 counterparts (Figure 6A–C). Downregulation of HRG in HCC tumor samples was confirmed

285 by qRT-PCR (32 paired HCC samples; Figure 6D) and western blotting (12 matched HCC

286 tissues; Figure 6E).

287 We then explored the mechanism of HRG downregulation in HCC tumor samples, where

288 pan-cancer alteration frequency analysis revealed no homozygous HRG deletions (Figure

289 S6A). Reduced gene expression could also result from promoter methylation or inhibitory

290 transcription factor interference. Indeed, we observed a strong correlation between DNA

291 methylation and HRG mRNA expression using the cBio cancer genomics portal (Figure S6B)

292 [34]. Previous studies had found that HRG was a transcriptional target gene of nuclear bile

293 acid receptor Farnesoid X receptor (FXR) in liver cells [35]. NF-κB binds to FXR and

294 subsequently suppresses its transcriptional activity, leading to the downregulation of FXR

295 downstream genes [36,37]. According to previous studies, HRG mRNA expression might be

296 inhibited by NF-κB activation via the suppression of FXR. To investigate this, we measured

297 HRG mRNA expression in P65-overexpressing SMMC-7721 cells and found it to be

298 downregulated (Figure S6C-D). Moreover, we found that HRG expression was suppressed

299 when Huh7 cells were treated with TNF-α alone, suggesting that NF-κB activation inhibited

300 HRG transcription. FXR agonist increased HRG mRNA expression in Huh7 cell, which was

301 reversed by adding TNF-α; this supported our hypothesis that HRG was reciprocally inhibited

302 by NF-κB via FXR (Figure S6E). Taken together, our results confirmed that HRG was

303 downregulated in HCC tissues and underwent both DNA methylation and negative feedback

304 inhibition following NF-κB activation.

305

306 HRG expression diminishes with cancer progression, and low expression of HRG

307 correlates with poor prognosis in patients with HCC

308 Information from GSE6764 datasets showed that expression of HRG decreased

309 progressively from normal liver tissues to advanced HCC (Figure 6F). Moreover, HRG

310 expression in samples that were clinically diagnosed as non-tumorous as well as those

311 representing stages I, II, and III HCC were extracted from TCGA-LIHC and GSE14520

312 datasets and analyzed. HRG levels decreased as HCC developed and progressed (Figure 6G).

313 GSEA analysis of the TCGA cohort showed that low expression of HRG was positively

314 associated with the gene signatures of poor prognosis (Figure S7A-B). Additionally, survival

315 analysis of TCGA and GSE14520 cohorts showed that patients with high HRG expression

316 exhibited improved overall survival and progression- free interval (Figure 6H and Table S3).

317 These data signified that low HRG expression correlates with worse HCC prognosis. In all,

318 our study revealed that HRG is a regulator of TNFR1 that promotes the formation of TNFR1

319 complex II, which shifts cancer cells from pro-survival to pro-death states. HRG expression in

320 HCC is suppressed by DNA methylation or via feedback inhibition by NF-κB, thereby

321 supporting cancer cells to survive and thrive (Graphical abstract).

322

323 Discussion

324 We demonstrated for the first time that HRG interacts with TNFR1, thus promoting the

325 formation of TNFR1-complex Ⅱ and restraining the activation of NF-κB signaling to suppress

326 HCC. Nonetheless, HRG expression is limited in HCC by negative feedback loop to prevent

327 TNFR1- dependent apoptosis. Accordingly, our investigation revealed that restoring HRG

328 expression in HCC cells might be a new approach to inhibiting tumor progression.

329 The behaviors of TNFR1 in the advancement of HCC are paradoxical. In particular, it

330 has been demonstrated that tumorigenesis was reduced in TNFR1-knockout mice [4],

331 suggesting that TNFR1 functions as a tumor promotor in liver cancer. In contrast, TNFR1

332 promoter -329G/T polymorphism resulting in allele-specific repression of TNFR1 expression

333 is reported to be associated with HCC [38], indicating that TNFR1 acts as a tumor suppressor.

334 Besides, study has shown that TNFR1 had no significant effect on DEN induced

335 hepatocarcinogenesis model [39]. Additionally, patients with high TNFR1 mRNA expression

336 levels showed worse overall survival in TCGA cohort, but no significant difference in

337 GSE14520 cohort (Figure S7C-D). These conflicts may be due to the pleiotropism of TNFR1-

338 mediated pathways. Our study found that HRG promoted TNFR1-complex Ⅱ formation while

339 downregulating the NF-κB activity. These data provide evidence for the dual effects of

340 TNFR1-mediated pathways are controlled by HRG. Therefore, the present work may explain

341 the cancer-promoting effect of TNF-α/TNFR1 in that [9,40], upon TNF-α stimulation, cancer

342 cell signaling pathways shift towards TNF-α/TNFR1-mediated anti-apoptotic signals owing to

343 low HRG expression, and thus to pro-tumor progression and drug resistant states.

344 According to in vitro and in vivo experiments, HRG is critical for TNFR1-induced

345 cellular apoptosis in HCC cells. On the one hand, HRG restricted nuclear translocation of NF-

346 κB upon TNF-α treatment, inhibited downstream anti-apoptotic genes, and reduced TNFR1-

347 mediated cell proliferation. The NF-κB signaling repressing effect of HRG is supported by a

348 recent study that HRG inhibits the activation of pro- inflammatory signaling such as NF-κB

349 [41]. On the other hand, HRG increases interaction between TNFR1 and Caspase8, which

350 forms TNFR1-complex Ⅱ and directly leads cell apoptosis. Similarly, cellular apoptosis

351 induced by HRG has been documented in fibrosarcoma [42]. Thus, we propose a pivotal role

352 for HRG as a molecular switch inclining TNFR1 mediated-survival to apoptosis.

353 Our study found that TNFR1 expression is upregulated by HRG overexpression. Cellular

354 TNFR1 level is reported to be correlated with sensitivity to MLN4924/TNF-induced cell

355 death in multiple myeloma [43]. Increased sensitivity of HCC cells to 5-fluorouracil-induced

356 apoptosis was found with HRG overexpression which enhanced TNFR1 protein stability in

357 the present study, pointing out a possibility that ways to upregulate HRG expression may

358 become an adjuvant approach for cancer treatment. It occurs to our mind that way to recover

359 HRG expression in HCC cells would suppress HCC progression, which was confirmed by

360 experiments performed in HCC cells and nude mice model. Moreover, it is possible that

361 restoring HRG levels in non-immunodeficient mice or patience may exert a better anti-tumor

362 effect owing to its ability to “reeducate” the tumor microenvironment. It is well known that

363 HRG promotes the transformation of M2 tumor-associated macrophages to the M1

364 phenotype, which inhibits tumor angiogenesis and cell proliferation [44,45]. Additionally, it

365 was recently discovered that HRG increased natural killer (NK) cell cytotoxicity against

366 K562 cells by modulating programmed cell death 1 (PD-1) expression [46]. Plus, TNFR1 is

367 widely distributed on the surfaces of various immune system-related cell types such as

368 macrophages and regulatory T cells [47,48]. Further investigation regarding whether HRG

369 influences immune or other cells expressing TNFR1 may lead to revealing novel mechanisms

370 in cancer development for which new therapeutic approaches can be devised.

371 The idea of how to increase HRG level in HCC prompted us to investigate the nature of

372 HRG downregulation in tumor samples and methods to restore its expression. Our study

373 showed that the expression of HRG in HCC samples is extremely low and decreased HRG

374 expression was associated with worse HCC prognosis. Moreover, we found that

375 downregulation of HRG was a result of DNA methylation and feedback inhibition of NF-κB

376 activation. Previous studies have shown that NF-κB interacts with FXR and inhibits its

377 transcriptional activity [49,50]. HRG is reported to be a direct transcriptional target of FXR in

378 hepatocytes, and FXR agonists can effectively upregulate serum HRG levels in mice and

379 healthy human volunteers [35]. Enlightened by these studies, we treated HCC cells with FXR

380 agonists and found that it upregulated HRG mRNA and protein expression in cells and

381 increased their sensitivity to apoptosis induced agent (Figure S6E-F). Herein, we proposed

382 that FXR agonists may contribute to switching from TNFR1-mediated cancer cell survival

383 signaling to pro-apoptotic states, and combined treatments with FXR agonists and pro-

384 apoptotic drugs may produce more potent anti-tumor effects in HCC.

385

386 Conclusions

387 Collectively, our data elucidated a crucial role for HRG as a molecular switch for

388 directing TNFR1-complex I versus II, thereby promoting pro-apoptotic pathways and

389 suppressing HCC progression. As tumors progress, HRG expression is suppressed by NF-κB

390 activation and continuous TNF-α that is produced in an autocrine fashion or introduced via

391 exogenous stimulation. In this situation, TNFR1-complex I forms and promotes NF-κB pro-

392 survival signaling given the lack of inhibition by HRG, thereby maintaining HCC

393 malignancy. In contrast, inducing HRG breaks the vicious cycle of tumor progression by

394 enhancing TNFR1-complex Ⅱ formation. Impairment of NF-κB signaling reverses HRG

395 suppression, which further increases TNFR1-induced cell apoptosis. Therefore, upregulating

396 the HRG-TNFR1-pro-apoptosis pathway may be a promising therapeutic approach for

397 patients with HCC.

398

399 Ethics approval and consent to participate

400 The study (NFEC-201208-K3) was approved by the Ethics Committee of Nanfang Hospital

401 and written informed consent was obtained before any operation performed on patients. All

402 mouse experiments were approved by the Institutional Animal Care and Use Committee of

403 Nanfang Hospital and carried out according to our institution’s guidelines for the use of

404 laboratory animals.

405

406 Abbreviations

407 HRG: Histidine-rich glycoprotein; TNFR1: Tumor necrosis factor receptor 1; HCC:

408 Hepatocellular carcinoma; RIP1: Receptor-interacting protein 1; TRADD: TNFR1-associated

409 death domain protein; DISC: Death-inducing signaling complex; FADD: Fas-associated death

410 domain protein; FXR: Farnesoid X receptor; CHX: Cycloheximide; H&E: Hematoxylin and

411 eosin; TUNEL: Terminal deoxy-nucleotidyl transferase-mediated dUTP nick-end labeling;

412 IHC: Immunohistochemical; TCGA: The Cancer Genome Atlas; GEO: Gene Expression

413 Omnibus; OS: Overall survival; PFI: Progression-free interval; GSEA: Gene set enrichment

414 analysis; IP: Immunoprecipitation; IF: Immunofluorescence; qRT-PCR: Quantitative Real-

415 Time PCR; EdU: 5-ethynyl-20-deoxyuridine; ANOVA: One-way analysis of variance;

416 BCL2L1: Bcl-2-like protein 1; BCL2A1: BCL2 Related Protein A1; NFKB1: Nuclear Factor

417 Kappa B Subunit 1; MYC: MYC Proto-Oncogene; RELA: RELA Proto-Oncogene; CFLAR:

418 CASP8 And FADD Like Apoptosis Regulator.

419

420 Acknowledgements This work was supported by the National Natural Science Foundation of

421 China (Grant Nos. 81773008, 81672756), Guangdong Province Universities and Colleges

422 Pearl River Scholar Funded Scheme (2015), Guangdong Natural Science Foundation (Grant

423 No. 2017A030311023, 2019A1515110629), Guangzhou Science and Technology Program

424 projects (No.201804010044), Local Innovative and Research Teams Project of Guangdong

425 Pearl River Talents Program (2017BT01S131) and Postdoctoral Research Foundation of

426 China (Grant No. 2019M660208).

427

428 Competing interests

429 The authors declare that they have no competing interest.

430 431 References： 432 1. Lind MH, Rozell B, Wallin RP, van Hogerlinden M, Ljunggren HG, Toftgard R, et al. Tumor 433 necrosis factor receptor 1-mediated signaling is required for skin cancer development induced by 434 NF-kappaB inhibition. Proc Natl Acad Sci U S A. 2004; 101: 4972-7. 435 2. Sheng YH, He Y, Hasnain SZ, Wang R, Tong H, Clarke DT, et al. MUC13 protects colorectal 436 cancer cells from death by activating the NF-kappaB pathway and is a potential therapeutic target. 437 Oncogene. 2017; 36: 700-13. 438 3. Charles KA, Kulbe H, Soper R, Escorcio-Correia M, Lawrence T, Schultheis A, et al. The tumor- 439 promoting actions of TNF-alpha involve TNFR1 and IL-17 in ovarian cancer in mice and humans. 440 J Clin Invest. 2009; 119: 3011-23. 441 4. Knight B, Yeoh GC, Husk KL, Ly T, Abraham LJ, Yu C, et al. Impaired preneoplastic changes and

442 liver tumor formation in tumor necrosis factor receptor type 1 knockout mice. J Exp Med. 2000; 443 192: 1809-18. 444 5. Park EJ, Lee JH, Yu GY, He G, Ali SR, Holzer RG, et al. Dietary and genetic obesity promote liver 445 inflammation and tumorigenesis by enhancing IL-6 and TNF expression. Cell. 2010; 140: 197-208. 446 6. Jang MK, Kim HS, Chung YH. Clinical aspects of tumor necrosis factor-alpha signaling in 447 hepatocellular carcinoma. Curr Pharm Des. 2014; 20: 2799-808. 448 7. Bertrand F, Montfort A, Marcheteau E, Imbert C, Gilhodes J, Filleron T, et al. TNFalpha blockade 449 overcomes resistance to anti-PD-1 in experimental melanoma. Nat Commun. 2017; 8: 2256. 450 8. Gomez-Ruiz S, Garcia-Penas A, Prashar S, Rodriguez-Dieguez A, Fischer-Fodor E. Anticancer 451 Applications of Nanostructured Silica-Based Materials Functionalized with Titanocene Derivatives: 452 Induction of Cell Death Mechanism through TNFR1 Modulation. Materials (Basel). 2018; 11: 224. 453 9. Balkwill F. TNF-alpha in promotion and progression of cancer. Cancer Metastasis Rev. 2006; 25: 454 409-16. 455 10. Aggarwal BB. Signalling pathways of the TNF superfamily: a double-edged sword. Nat Rev 456 Immunol. 2003; 3: 745-56. 457 11. Cabal-Hierro L, Lazo PS. Signal transduction by tumor necrosis factor receptors. Cell Signal. 2012; 458 24: 1297-305. 459 12. Rinkenbaugh AL, Baldwin AS. The NF-kappaB Pathway and Cancer Stem Cells. Cells-Basel. 2016; 460 5: 16. 461 13. Tan W, Luo X, Li W, Zhong J, Cao J, Zhu S, et al. TNF-alpha is a potential therapeutic target to 462 overcome sorafenib resistance in hepatocellular carcinoma. Ebiomedicine. 2019; 40: 446-56. 463 14. Ho MY, Tang SJ, Chuang MJ, Cha TL, Li JY, Sun GH, et al. TNF-alpha induces epithelial- 464 mesenchymal transition of renal cell carcinoma cells via a GSK3beta-dependent mechanism. Mol 465 Cancer Res. 2012; 10: 1109-19. 466 15. Yang Z, Lv Y, Lv Y, Wang Y. Meta-analysis shows strong positive association of the TNF-alpha 467 gene with tumor stage in bladder cancer. Urol Int. 2012; 89: 337-41. 468 16. Zhang Z, Lin G, Yan Y, Li X, Hu Y, Wang J, et al. Transmembrane TNF-alpha promotes 469 chemoresistance in breast cancer cells. Oncogene. 2018; 37: 3456-70. 470 17. Meng Q, Liang C, Hua J, Zhang B, Liu J, Zhang Y, et al. A miR-146a-5p/TRAF6/NF-kB p65 axis 471 regulates pancreatic cancer chemoresistance: functional validation and clinical significance. 472 Theranostics. 2020; 10: 3967-79. 473 18. Micheau O, Tschopp J. Induction of TNF receptor I-mediated apoptosis via two sequential signaling 474 complexes. Cell. 2003; 114: 181-90. 475 19. Han L, Zhang D, Tao T, Sun X, Liu X, Zhu G, et al. The role of N-glycan modification of TNFR1 476 in inflammatory microglia activation. Glycoconj J. 2015; 32: 685-93. 477 20. Legler DF, Micheau O, Doucey MA, Tschopp J, Bron C. Recruitment of TNF receptor 1 to lipid 478 rafts is essential for TNFalpha-mediated NF-kappaB activation. Immunity. 2003; 18: 655-64. 479 21. Choi H, Stark RJ, Raja BS, Dikalova A, Lamb FS. Apoptosis signal-regulating kinase 1 activation 480 by Nox1-derived oxidants is required for TNFalpha receptor endocytosis. Am J Physiol Heart Circ 481 Physiol. 2019; 316: H1528-37. 482 22. Walczak H. TNF and ubiquitin at the crossroads of gene activation, cell death, inflammation, and 483 cancer. Immunol Rev. 2011; 244: 9-28. 484 23. Zhang Q, Jiang K, Li Y, Gao D, Sun L, Zhang S, et al. Histidine-rich glycoprotein function in 485 hepatocellular carcinoma depends on its N-glycosylation status, and it regulates cell proliferation

486 by inhibiting Erk1/2 phosphorylation. Oncotarget. 2015; 6: 30222-31. 487 24. Bartneck M, Fech V, Ehling J, Govaere O, Warzecha KT, Hittatiya K, et al. Histidine-rich 488 glycoprotein promotes macrophage activation and inflammation in chronic liver disease. 489 Hepatology. 2016; 63: 1310-24. 490 25. Leebeek FW, Kluft C, Knot EA, De Maat MP. Histidine-rich glycoprotein is elevated in mild liver 491 cirrhosis and decreased in moderate and severe liver cirrhosis. J Lab Clin Med. 1989; 113: 493- 492 7. 493 26. Zhang DY, Zou XJ, Cao CH, Zhang T, Lei L, Qi XL, et al. Identification and Functional 494 Characterization of Long Non-coding RNA MIR22HG as a Tumor Suppressor for Hepatocellular 495 Carcinoma. Theranostics. 2018; 8: 3751-65. 496 27. Cao C, Sun J, Zhang D, Guo X, Xie L, Li X, et al. The long intergenic noncoding RNA UFC1, a 497 target of MicroRNA 34a, interacts with the mRNA stabilizing protein HuR to increase levels of 498 beta-catenin in HCC cells. Gastroenterology. 2015; 148: 415-26. 499 28. Glickman MH, Ciechanover A. The ubiquitin-proteasome proteolytic pathway: destruction for the 500 sake of construction. Physiol Rev. 2002; 82: 373-428. 501 29. Wertz IE, Dixit VM. Ubiquitin-mediated regulation of TNFR1 signaling. Cytokine Growth Factor 502 Rev. 2008; 19: 313-24. 503 30. Fritsch J, Stephan M, Tchikov V, Winoto-Morbach S, Gubkina S, Kabelitz D, et al. Cell fate 504 decisions regulated by K63 ubiquitination of tumor necrosis factor receptor 1. Mol Cell Biol. 2014; 505 34: 3214-28. 506 31. Chang YL, Chen TH, Wu YH, Chen GA, Weng TH, Tseng PH, et al. A novel TLR2-triggered 507 signalling crosstalk synergistically intensifies TNF-mediated IL-6 induction. J Cell Mol Med. 2014; 508 18: 1344-57. 509 32. Zhou KR, Liu S, Sun WJ, Zheng LL, Zhou H, Yang JH, et al. ChIPBase v2.0: decoding 510 transcriptional regulatory networks of non-coding RNAs and protein-coding genes from ChIP-seq 511 data. Nucleic Acids Res. 2017; 45: D43-50. 512 33. Kang K, Lee SR, Piao X, Hur GM. Post-translational modification of the death receptor complex 513 as a potential therapeutic target in cancer. Arch Pharm Res. 2019; 42: 76-87. 514 34. Cerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, et al. The cBio cancer genomics 515 portal: an open platform for exploring multidimensional cancer genomics data. Cancer Discov. 516 2012; 2: 401-4. 517 35. Deuschle U, Birkel M, Hambruch E, Hornberger M, Kinzel O, Perovic-Ottstadt S, et al. The nuclear 518 bile acid receptor FXR controls the liver derived tumor suppressor histidine-rich glycoprotein. Int 519 J Cancer. 2015; 136: 2693-704. 520 36. Gadaleta RM, Oldenburg B, Willemsen EC, Spit M, Murzilli S, Salvatore L, et al. Activation of 521 bile salt nuclear receptor FXR is repressed by pro-inflammatory cytokines activating NF-kappaB 522 signaling in the intestine. Biochim Biophys Acta. 2011; 1812: 851-8. 523 37. Balasubramaniyan N, Ananthanarayanan M, Suchy FJ. Nuclear factor-kappaB regulates the 524 expression of multiple genes encoding liver transport proteins. Am J Physiol Gastrointest Liver 525 Physiol. 2016; 310: G618-28. 526 38. Kim S, Moon SM, Kim YS, Kim JJ, Ryu HJ, Kim YJ, et al. TNFR1 promoter -329G/T 527 polymorphism results in allele-specific repression of TNFR1 expression. Biochem Biophys Res 528 Commun. 2008; 368: 395-401. 529 39. Naugler WE, Sakurai T, Kim S, Maeda S, Kim K, Elsharkawy AM, et al. Gender disparity in liver

530 cancer due to sex differences in MyD88-dependent IL-6 production. Science. 2007; 317: 121-4. 531 . Beg AA, Baltimore D. An essential role for NF-kappaB in preventing TNF-alpha-induced cell death. 532 Science. 1996; 274: 782-4. 533 41. Gao S, Wake H, Gao Y, Wang D, Mori S, Liu K, et al. Histidine-rich glycoprotein ameliorates 534 endothelial barrier dysfunction through regulation of NF-kappaB and MAPK signal pathway. Br J 535 Pharmacol. 2019; 176: 2808-24. 536 42. Olsson AK, Larsson H, Dixelius J, Johansson I, Lee C, Oellig C, et al. A fragment of histidine-rich 537 glycoprotein is a potent inhibitor of tumor vascularization. Cancer Res. 2004; 64: 599-605. 538 43. El-Mesery M, Rosenthal T, Rauert-Wunderlich H, Schreder M, Stuhmer T, Leich E, et al. The 539 NEDD8-activating enzyme inhibitor MLN4924 sensitizes a TNFR1(+) subgroup of multiple 540 myeloma cells for TNF-induced cell death. Cell Death Dis. 2019; 10: 611. 541 44. Bartneck M, Fech V, Ehling J, Govaere O, Warzecha KT, Hittatiya K, et al. Histidine-rich 542 glycoprotein promotes macrophage activation and inflammation in chronic liver disease. 543 Hepatology. 2016; 63: 1310-24. 544 45. Rolny C, Mazzone M, Tugues S, Laoui D, Johansson I, Coulon C, et al. HRG inhibits tumor growth 545 and metastasis by inducing macrophage polarization and vessel normalization through 546 downregulation of PlGF. Cancer Cell. 2011; 19: 31-44. 547 46. Nishimura Y, Wake H, Teshigawara K, Wang D, Sakaguchi M, Otsuka F, et al. Histidine-rich 548 glycoprotein augments natural killer cell function by modulating PD-1 expression via CLEC-1B. 549 Pharmacol Res Perspect. 2019; 7: e481. 550 47. Yang S, Xie C, Chen Y, Wang J, Chen X, Lu Z, et al. Differential roles of TNFalpha-TNFR1 and 551 TNFalpha-TNFR2 in the differentiation and function of CD4(+)Foxp3(+) induced Treg cells in 552 vitro and in vivo periphery in autoimmune diseases. Cell Death Dis. 2019; 10: 27. 553 48. Parameswaran N, Patial S. Tumor necrosis factor-alpha signaling in macrophages. Crit Rev 554 Eukaryot Gene Expr. 2010; 20: 87-103. 555 49. Gadaleta RM, Oldenburg B, Willemsen EC, Spit M, Murzilli S, Salvatore L, et al. Activation of 556 bile salt nuclear receptor FXR is repressed by pro-inflammatory cytokines activating NF-kappaB 557 signaling in the intestine. Biochim Biophys Acta. 2011; 1812: 851-8. 558 50. Balasubramaniyan N, Ananthanarayanan M, Suchy FJ. Nuclear factor-kappaB regulates the 559 expression of multiple genes encoding liver transport proteins. Am J Physiol Gastrointest Liver 560 Physiol. 2016; 310: G618-28.

561 Figure legends 562

563 Figure 1. HRG is a binding partner of TNFR1 in HCC cells. (A) SMMC-7721 cells were

564 treated with TNF-α for different times, and lysates were then immunoblotted for proteins

565 associated with TNFR1 complexes. (B) Green fluorescent protein (GFP)-TNFR1

566 overexpressing Huh7 cells were seeded and treated with TNF-α (100 ng/ml) for 15 or 120

567 min, and 0.3 μM Dil was used to stain the cell membrane for 20 min. A fluorescence

568 microscope was used to image the cells (cell membrane, red; GFP, green). (C) Top: GFP-

569 TNFR1-overexpressing Huh7 cell lysates were precipitated with magnetic beads conjugated

570 with GFP and immunoblotted for GFP-TNFR1, Caspase-8, and GAPDH. Bottom: silver

571 staining. (D) A direct interaction between GST-TNFR1 and HIS-HRG was detected in GST

572 pulldown experiments. Western blot analysis of GST or HIS-tagged proteins of GST-input

573 and pulldown samples. (E) Western blot analysis of whole cell lysate and co-

574 immunoprecipitated samples of IgG, anti-Flag, or anti-TNFR1 were obtained from Huh7 cells

575 48 h after transfected with the indicated plasmids.

576

577 Figure 2. HRG increases the stability of the TNFR1 protein and promotes the formation

578 of TNFR1-complex II in HCC cells. (A) Huh7 cells transfected with concentration-

579 dependent Flag-HRG plasmid and immunoblotted for proteins associated with TNFR1

580 complexes. (B) Protein stability of TNFR1 was determined by collecting the protein samples

581 at 0, 15, 30, 45, 60, and 90 min in the presence of cycloheximide (100 μg/mL) in SMMC-

582 7721 HRG-overexpressing cells and controls. (C) HRG-overexpressing SMMC-7721 and

583 Huh7 cells and their controls were transfected with hemagglutinin (HA)-tagged ubiquitin

584 (Ub) expression vector for 48 h. The HA immunoprecipitation products or whole cell lysates

585 were analyzed by western blotting. (D) Total and K48/K63-specific ubiquitination were

586 detected in SMMC-7721 HRG-overexpressing cells and controls after HA-Ub transfection

587 (48 h) and MG132 treatment (10 μM). (E) HRG-overexpressing SMMC-7721 and Huh7 cells

588 and their controls were precipitated with magnetic beads conjugated to TNFR1, and blotted

589 for Flag-HRG and Caspase-8.

590

591 Figure 3. HRG inhibits the NF-κB signaling pathway in HCC cells. (A) SMMC-7721 cells

592 were stably transfected with Flag-HRG lentivirus and control vector and treated with TNF-α

593 for 15 min, and were then analyzed by immunofluorescence for phospho-P65 (red) and DAPI

594 (blue). (B) Results of gene set enrichment analysis (GSEA) were plotted to visualize the

595 correlation between the expression of HRG and gene signatures of NF-κB signaling in TCGA

596 cohort. (C) The activity of NF-κB was determined using a luciferase assay in Flag-HRG

597 overexpressing and control SMMC-7721 cells. (D) mRNA expression of BCL2L1, BCL2A1,

598 NFKB1, MYC, and RELA were detected by quantitative reverse transcription PCR in Flag-

599 HRG overexpressing and control SMMC-7721 cells. (*, P < 0.05; **, P < 0.01; ***, P <

600 0.001).

601

602 Figure 4. HRG overexpression suppresses proliferation and promotes apoptosis in vitro

603 and in vivo. (A) The effect of HRG overexpression on SMMC-7721 and Huh7 cells was

604 determined using EdU assays. (B) Apoptosis among HRG-overexpressing SMMC-7721 and

605 Huh7 cells and their controls as induced by 25 or 100 μg/mL of 5-fluorouracil was detected

606 using flow cytometry. (C) Left: HRG-overexpressing and control SMMC-7721 cells derived

607 from subcutaneous neoplasms are shown (n=6); Right: statistical plot of the average tumor

608 weights from the subcutaneous xenograft tumor model. (D) TUNEL staining (red) was used

609 to detect apoptotic cells in HRG-overexpressing and control SMMC-7721 cells derived from

610 subcutaneous tumor tissues. (*, P < 0.05; ***, P < 0.001).

611

612 Figure 5. TNFR1 mediates the biological functions of HRG in HCC cells. (A) SMMC-

613 7721 cells were co-transfected with Flag-HRG and TNFR1 siRNA, following which cell

614 proliferation was detected via EdU assays. (B) The expression of phospho-P65, c-MYC, and

615 BCL-2 was detected by western blotting after TNFR1 was silenced and HRG was

616 overexpressed in SMMC-7721 cells. (C) The activity of NF-κB was determined using a

617 luciferase assay in SMMC-7721 cells after transfection with Flag-HRG plasmids and TNFR1

618 siRNA. (D) The mRNA expression levels of BCL2L1, NFΚB1, and MYC in SMMC-7721

619 were detected using qRT-PCR after the cells were transfected with Flag-HRG plasmids and

620 TNFR1 siRNA. (*, P < 0.05; **, P < 0 0.01; ***, P < 0.001; NS = not significant).

621

622 Figure 6. HRG expression is down-regulated in HCC and is correlated with prognosis.

623 (A) Expression of HRG in TCGA cohort (including 342 and 50 tumor and non-tumor

624 samples, respectively). (B) Expression of HRG in the GSE14520 cohort (247 and 241 tumor

625 and non-tumor samples, respectively). (C) Expression of HRG in the GSE6764 cohort (35

626 and 10 tumor and non-tumor samples, respectively). (D) qRT-PCR detection of HRG

627 expression in tumor tissues and adjacent non-tumor tissues in a 32-patient cohort. (E) Western

628 blot analysis was used to detect the expression of HRG protein in 12 pairs of hepatocellular

629 carcinoma (HCC) tissues (T) and their matched normal tissues (N). (F) HRG expression in

630 various patients clinically diagnosed with HCC were analyzed from the GSE6764 cohort

631 (normal liver, n=10; cirrhotic liver tissue, n=13; early HCC, n=18; and advanced HCC, n=17).

632 (G) HRG expression from different patients with HCC were analyzed from TCGA cohort

633 (non-tumor, n=50; stage I, n=155; stage II, n=79; and stage III, n=80) and the GSE14520

634 cohort (non-tumor, n=241, stage I, n=96, stage II, n=78, and stage III, n=51). (H) Kaplan-

635 Meier analysis of overall survival and progression-free interval in TCGA and GSE14520

636 cohorts based on HRG expression status. X-tile software was used to generate optimal cut-off

637 values and separate patients into high and low HRG expression groups. (*, P < 0.05; **, P < 0

638 0.01; ***, P < 0.001).

HRG switches TNFR1-mediated cell survival to apoptosis in hepatocellular carcinoma

Supplementary

Materials and methods

Cell transfection

The lentiviral vector containing human HRG (NM_000412) was purchased from

Genechem Company Ltd (Shanghai, China). Lentiviral vectors containing the HRG gene sequence or the empty vector were introduced into Huh7 and SMMC-7721 cells according to the manufacturer’s instruction. The cells were treated with puromycin (1 μg/mL, GeneChem,

Shanghai, China) for 2 weeks for stable selection. Small interfering RNAs (siRNAs) were used to silence human HRG, TNFRSF1A, RNF8 and TRAF6 genes expression using Lipofectamine

RNAiMAX Transfection Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instruction. The siRNAs were synthesized by Genepharma Company (Suzhou,

China) and the sequence details were listed in Table S4.

Western blotting and immunoprecipitation analysis

Total protein was extracted using RIPA buffer (Beyotime, Shanghai, China) containing protease and phosphatase inhibitors. The protein lysates were separated by 8%/10%/12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride membranes (Millipore, USA). After blocking with 5% milk for 1 h at room temperature, the membranes were incubated with primary antibodies overnight at 4 °C.

After washing, the membranes were incubated with the corresponding secondary antibodies conjugated to horseradish peroxidase. The membrane signals were detected using an enhanced chemiluminescence (ECL) kit (Pierce, USA). Antibodies used are listed in Table S4. For immunoprecipitation, IgG or the specific antibody was incubated with the cell supernatant

(lysed using NP-40 Lysis Buffer (Beyotime, Shanghai, China) containing protease and phosphatase inhibitors) overnight at 4 °C. The cell extracts were then immunoprecipitated with protein A/G magnetic beads (Bbimake, China) according to the manufacturer’s instruction.

Mass spectrometry (MS) analyses were performed by Wininnovate Bio (Shenzhen, China).

Immunofluorescence assay

Huh7 and SMMC-7721 cells were seeded on coverslips for the indicated transfections.

Following incubation for 24-48 h, the cells on the coverslips were washed with phosphate- buffered saline (PBS) three times and fixed with 4% paraformaldehyde for 15 min, and then permeabilized with 0.25% Triton for 5 min. Thereafter, the cells were incubated with anti-pP65

(#3033, CST, USA) antibodies at 4 °C overnight. Following washes, the cells were incubated with rhodamine-conjugated goat antibodies against rabbit IgG (Abcam, Cambridge, UK) at

37 °C for 1 h. The nuclei were stained with DAPI (Abcam, Cambridge, UK) and the cell membranes were stained with Dil (#C1036, Beyotime, Shanghai, China) at 37 °C for 20 min.

The images were captured with a BX51 or BX63 microscope (Olympus, Japan).

Dual-luciferase reporter assay

SMMC-7721 cells stably overexpressing HRG and the corresponding controls were cultured in 24-well plates and co-transfected with a NF-κB luciferase reporter. At 48 h post- transfection, luciferase activity was measured using the Dual-Luciferase Assay Kit (Promega,

Madison, WI) according to the manufacturer’s instructions.

Quantitative real-time PCR (qRT-PCR)

Total RNA was extracted from HCC cells or human tissues using TRIzol® reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. PrimeScript™ 1st

Strand cDNA Synthesis Kit (TaKaRa, Tokyo, Japan) was used for first-strand cDNA synthesis.

Real-time PCR was performed using SYBR® Green PCR kit (TaKaRa, Tokyo, Japan). The primers sequences used for the amplification are shown in Table S4.

5-ethynyl-20-deoxyuridine (EdU) assay

The HCC cell lines transfected with different vectors were seeded into 96-well plates and cultured overnight. Briefly, cells were incubated with 50 μM EdU for 2 h. After EdU-DNA incorporation, the cells were fixed and stained using EdU Cell Proliferation Assay Kit (Ribobio,

Wuhan, China) according to the manufacturer’s instructions.

Flow-cytometry assay

HRG-overexpressing HCC cells and the corresponding controls were stimulated with different doses of 5-fluorouracil. After 48 h, the cells were digested with EDTA-free trypsin and resuspended to generate a single-cell suspension. Apoptotic cells were evaluated using

Annexin-V-APC and 7-AAD Apoptosis Detection Kits (KeyGen BioTECH, Suzhou, China).

The cells were then analyzed with a FACScan flow cytometer using the FlowJo software (Tree

Star Inc., Ashland, OR, USA).

Gene set enrichment analysis (GSEA)

GSEA was used to search gene signatures that correlated with HRG expression in the

TCGA dataset as previously described [25]. Briefly, patients were split into two groups according to the HRG mRNA expression in the TCGA cohort. The GSEA software (GSEA v.

2.0, http://www.broadinstitute.org/gsea) was utilized to analyze, annotate, and interpret enrichment results. Supplementary Data

Figure S1. HRG is associated with TNFR1 in HCC. (A) Protein expression (normalized to

β-actin) was measured at the indicated time points which matched those in Figure 1A. (B) Veen graph of TNFR1 interactors from BIOGRID database (376 interactors, https://thebiogrid.org/) and MS data (232 interactors). (C) The 55–70 kD band region was excised from the gel, and proteins were detected using mass spectrometry, whereupon the mass spectrum of HRG was detected. (D) Survival analysis of 9 genes with 95%CI and P-value were presented as Forest plot. (E) Correlation between mRNA expression of TNFR1 and HRG in the TCGA cohort

(http://www.cbioportal.org/).

Figure S2. Upregulation of Lys (K)-63 ubiquitination of TNFR1 by HRG is RNF8- and

TRAF6-dependent in HCC cells. (A-B) mRNA expression of HRG and TNFR1 was analyzed in SMMC-7721 and Huh7 cells following overexpression of Flag-HRG. (C) Protein expression of Flag-HRG was detected in Flag-HRG overexpressed SMMC-7721 and Huh7 cells and the corresponding controls. (***, P < 0.001; NS = not significant). (D) Total and

K48/K63-specific ubiquitination were detected in Huh7 HRG-overexpressing cells and controls after HA-Ub transfection (48 h) and MG132 treatment (10 μM). (E) K63-specific ubiquitination of TNFR1 of the following Huh7 cells (Scramble, si-RNF8, si-TRAF6, si-

RNF8+NC, si-RNF8+Flag-HRG, siTRAF6+ NC and siTRAF6+ HRG) were immunoprecipitated with TNFR1 antibody and detected by western blot after HA-K63-ub transfection (48 h) and MG132 treatment (10 μM). (F) Veen graph of TNFR1 interactors from

LC-MS analysis of TNFR1 co-IP lysates of different groups (control, TNF-α 15 min stimulation, TNF-α 2 h stimulation, and HRG overexpression).

Figure S3. HRG negatively correlates with the NF-κB signaling pathway in HCC. (A)

SMMC-7721 cells were analyzed by immunofluorescence for phospho-P65 (red) after transfection with either HRG or control siRNA. (B) Correlation between HRG, RELA,

BCL2L1, CFLAR, and NFKB1 were analyzed using ChIPBase v2.0.

Figure S4. HRG inhibits tumor growth and promotes cell apoptosis. (A) SMMC-7721 and

Huh7 cells were transfected with HRG siRNA, and cell proliferation was measured using the

EdU assay. (B) Upper: Representative images of tumors formed in nude mice injected with the

HRG transfected SMMC-7721 and control cells; Bottom: Fluorescence values of the two groups. (C) H&E staining of the subcutaneous tumors in nude mice. (D) Subcutaneous tumor tissues of nude mice were stained immunohistochemically using Ki-67 was stain. (*, P < 0.05;

**, P < 0.01; ***, P < 0.001).

Figure S5. TNFR1 mediates the biological effects of HRG in HCC. (A) mRNA expression of TNFR1 and HRG in SMMC-7721 cells was analyzed using qRT-PCR following transfection with Flag-HRG and TNFR1 siRNA. (B) SMMC-7721 cells were transfected with Flag-HRG plasmid and TNFR1 siRNA, and then immunoblotted for the expression of Flag-HRG, TNFR1,

Caspase3, and cleave-Caspase3 proteins. (*, P < 0.05; **, P < 0.01; NS = not significant).

Figure S6. HRG expression is down-regulated in HCC and inhibited by NF-κB and DNA methylation. (A) Alteration in HRG gene: Data queried from the cBioPortal shows the alteration frequency of HRG gene in the different cancer types. Y-axis represents the alteration frequency of HRG gene (colors represent the type of alterations as shown in the figure). The frequency of alterations is sorted on X-axis according to cancer types. (B) Negative correlation between the mRNA expression of HRG and HRG methylation (Pearson r = −0.59; P < 0.001).

Line represents linear regression of data (y = −9.99x + 18.15; r2 = 0.35). (C) SMMC-7721 cells were analyzed by immunofluorescence for phospho-P65 (red) after transfection with either P65 plasmid or control vector. (D) HRG mRNA level in SMMC-7721 was analyzed using qRT-PCR following transfection with P65 plasmid (corresponding to Figure S6C). (E) mRNA expression of HRG in TNF-α-and GW4064-treated Huh7 cells was analyzed by qRT-PCR. (F) Expression of apoptotic protein was analyzed in Huh7 cells treated with 5-Fu and/combined GW4064 by western blotting. (*, P < 0.05; **, P < 0.01).

Figure S7. Correlation between HRG or TNFR1 expression and prognosis in HCC. (A-B) Results of GSEA were plotted to visualize the correlation between the expression of HRG and gene signatures of liver cancer survival and recurrence in the TCGA cohort. (C-D) Kaplan-

Meier analysis of overall survival in TCGA and GSE14520 cohorts based on TNFRSF1A expression status. X-tile software was used to generate optimal cut-off values and separate patients into high and low TNFRSF1A expression groups. Table S1. Interactors of TNFR1. Related to Figure 1C and Figure S1B. Description 1. TNFR1 interactors within 2 h of TNF-α stimulation of Huh7 cells. 232 Proteins were found by mass spectrometry. 2. 179 Interactors of TNFR1 downloaded from BioGRID website. Table S1-1. TNFR1 interactors within 2 h of TNF-α stimulation of Huh7 cells. 232 Proteins were found by mass spectrometry. Protein Avg. Protein ID Accession -10lgP Coverage (%) Coverage (%) 1 Area 1 #Peptides #Unique #Spec 1 Description Group Mass 10 3 O00571|DDX3X_HUMAN 282.89 58 58 1.57E+08 42 12 75 73244 ATP-dependent RNA helicase DDX3X OS=Homo sapiens GN=DDX3X PE=1 SV=3 1 6 P11940|PABP1_HUMAN 281.42 53 53 9.31E+08 47 25 115 70671 Polyadenylate-binding protein 1 OS=Homo sapiens GN=PABPC1 PE=1 SV=2 9 4 Q92499|DDX1_HUMAN 281.29 50 50 3.42E+08 41 41 75 82432 ATP-dependent RNA helicase DDX1 OS=Homo sapiens GN=DDX1 PE=1 SV=2 11 5 Q13310|PABP4_HUMAN 275.09 49 49 3.48E+08 40 21 74 70783 Polyadenylate-binding protein 4 OS=Homo sapiens GN=PABPC4 PE=1 SV=1 22 2 O43148|MCES_HUMAN 267.18 64 64 2.88E+08 33 30 51 54844 mRNA cap guanine-N7 methyltransferase OS=Homo sapiens GN=RNMT PE=1 SV=1 14 13 P05783|K1C18_HUMAN 266.25 61 61 5.27E+08 34 31 70 48058 Keratin type I cytoskeletal 18 OS=Homo sapiens GN=KRT18 PE=1 SV=2 16 7 P51659|DHB4_HUMAN 264.56 52 52 2.33E+08 38 36 62 79686 Peroxisomal multifunctional enzyme type 2 OS=Homo sapiens GN=HSD17B4 PE=1 SV=3 5 17 Q15233|NONO_HUMAN 262.5 46 46 6.72E+08 39 32 89 54232 Non-POU domain-containing octamer-binding protein OS=Homo sapiens GN=NONO PE=1 SV=4 2 1 Q13283|G3BP1_HUMAN 262.07 68 68 1.54E+09 27 23 107 52164 Ras GTPase-activating protein-binding protein 1 OS=Homo sapiens GN=G3BP1 PE=1 SV=1 7 12 Q96PK6|RBM14_HUMAN 260.77 40 40 1.39E+09 37 37 87 69492 RNA-binding protein 14 OS=Homo sapiens GN=RBM14 PE=1 SV=2 6 20 Q9UN86|G3BP2_HUMAN 259.95 52 52 1.39E+09 32 28 88 54121 Ras GTPase-activating protein-binding protein 2 OS=Homo sapiens GN=G3BP2 PE=1 SV=2 12 31 Q14103|HNRPD_HUMAN 255.07 44 44 8.28E+08 33 24 74 38434 Heterogeneous nuclear ribonucleoprotein D0 OS=Homo sapiens GN=HNRNPD PE=1 SV=1 3 8 P60709|ACTB_HUMAN 253.34 71 71 1.80E+07 35 1 91 41737 Actin cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 4 9 P63261|ACTG_HUMAN 253.24 71 71 3.48E+06 35 1 90 41793 Actin cytoplasmic 2 OS=Homo sapiens GN=ACTG1 PE=1 SV=1 19 15 O15523|DDX3Y_HUMAN 252.64 42 42 6.98E+06 31 1 54 73154 ATP-dependent RNA helicase DDX3Y OS=Homo sapiens GN=DDX3Y PE=1 SV=2 15 10 P17844|DDX5_HUMAN 251 52 52 3.58E+08 39 23 69 69148 Probable ATP-dependent RNA helicase DDX5 OS=Homo sapiens GN=DDX5 PE=1 SV=1 8 16 Q9NZI8|IF2B1_HUMAN 250.01 54 54 6.20E+08 37 33 82 63481 Insulin-like growth factor 2 mRNA-binding protein 1 OS=Homo sapiens GN=IGF2BP1 PE=1 SV=2 23 14 Q7Z417|NUFP2_HUMAN 247.41 45 45 2.70E+08 27 27 51 76121 Nuclear fragile X mental retardation-interacting protein 2 OS=Homo sapiens GN=NUFIP2 PE=1 SV=1 18 60 Q01844|EWS_HUMAN 244.58 24 24 1.41E+09 27 27 55 68478 RNA-binding protein EWS OS=Homo sapiens GN=EWSR1 PE=1 SV=1 25 11 O00425|IF2B3_HUMAN 239.01 54 54 1.11E+08 31 25 50 63705 Insulin-like growth factor 2 mRNA-binding protein 3 OS=Homo sapiens GN=IGF2BP3 PE=1 SV=2 27 18 P11021|GRP78_HUMAN 237.9 48 48 1.21E+08 27 25 42 72333 78 kDa glucose-regulated protein OS=Homo sapiens GN=HSPA5 PE=1 SV=2 30 23 O43390|HNRPR_HUMAN 232.38 38 38 8.00E+07 25 16 39 70943 Heterogeneous nuclear ribonucleoprotein R OS=Homo sapiens GN=HNRNPR PE=1 SV=1 13 84 P35637|FUS_HUMAN 232.15 20 20 1.98E+09 26 19 70 53426 RNA-binding protein FUS OS=Homo sapiens GN=FUS PE=1 SV=1 34 22 O60506|HNRPQ_HUMAN 232.01 44 44 6.23E+07 25 17 36 69603 Heterogeneous nuclear ribonucleoprotein Q OS=Homo sapiens GN=SYNCRIP PE=1 SV=2 35 24 P11142|HSP7C_HUMAN 229.28 42 42 1.28E+08 25 18 36 70898 Heat shock cognate 71 kDa protein OS=Homo sapiens GN=HSPA8 PE=1 SV=1 17 34 P38159|RBMX_HUMAN 227.85 53 53 1.60E+08 32 28 59 42332 RNA-binding motif protein X chromosome OS=Homo sapiens GN=RBMX PE=1 SV=3 29 63 O14979|HNRDL_HUMAN 224.06 26 26 1.57E+08 24 16 40 46438 Heterogeneous nuclear ribonucleoprotein D-like OS=Homo sapiens GN=HNRNPDL PE=1 SV=3 33 27 Q92841|DDX17_HUMAN 220.51 33 33 4.46E+07 25 12 36 80273 Probable ATP-dependent RNA helicase DDX17 OS=Homo sapiens GN=DDX17 PE=1 SV=2 28 21 Q9Y6M1|IF2B2_HUMAN 218.75 47 47 7.52E+07 23 20 42 66121 Insulin-like growth factor 2 mRNA-binding protein 2 OS=Homo sapiens GN=IGF2BP2 PE=1 SV=2 44 29 P04264|K2C1_HUMAN 210.32 37 37 2.02E+07 23 11 27 66039 Keratin type II cytoskeletal 1 OS=Homo sapiens GN=KRT1 PE=1 SV=6 32 43 Q92804|RBP56_HUMAN 208.26 43 43 3.24E+08 18 11 37 61830 TATA-binding protein-associated factor 2N OS=Homo sapiens GN=TAF15 PE=1 SV=1 38 36 P05787|K2C8_HUMAN 206.55 41 41 1.63E+07 22 5 31 53704 Keratin type II cytoskeletal 8 OS=Homo sapiens GN=KRT8 PE=1 SV=7 53 38 P38646|GRP75_HUMAN 203.34 26 26 3.71E+07 16 14 20 73681 Stress-70 protein mitochondrial OS=Homo sapiens GN=HSPA9 PE=1 SV=2 49 32 P0DMV9|HS71B_HUMAN 200.04 35 35 1.50E+07 18 9 23 70052 Heat shock 70 kDa protein 1B OS=Homo sapiens GN=HSPA1B PE=1 SV=1 49 33 P0DMV8|HS71A_HUMAN 200.04 35 35 1.50E+07 18 9 23 70052 Heat shock 70 kDa protein 1A OS=Homo sapiens GN=HSPA1A PE=1 SV=1 46 41 P26599|PTBP1_HUMAN 197.4 38 38 8.32E+07 17 16 26 57221 Polypyrimidine tract-binding protein 1 OS=Homo sapiens GN=PTBP1 PE=1 SV=1 24 51 P63267|ACTH_HUMAN 197.01 38 38 3.79E+06 22 1 50 41877 Actin gamma-enteric smooth muscle OS=Homo sapiens GN=ACTG2 PE=1 SV=1 45 42 P28300|LYOX_HUMAN 195.18 48 48 7.99E+07 16 16 27 46944 Protein-lysine 6-oxidase OS=Homo sapiens GN=LOX PE=1 SV=2 37 66 Q12905|ILF2_HUMAN 194.61 34 34 1.39E+08 17 15 35 43062 Interleukin enhancer-binding factor 2 OS=Homo sapiens GN=ILF2 PE=1 SV=2 31 68 Q6S8J3|POTEE_HUMAN 193.86 13 13 6.54E+06 17 2 38 121363 POTE ankyrin domain family member E OS=Homo sapiens GN=POTEE PE=2 SV=3 43 37 Q9Y3I0|RTCB_HUMAN 193.19 39 39 8.79E+07 16 15 27 55210 tRNA-splicing ligase RtcB homolog OS=Homo sapiens GN=RTCB PE=1 SV=1 56 62 P26196|DDX6_HUMAN 192.44 34 34 6.26E+07 14 13 19 54417 Probable ATP-dependent RNA helicase DDX6 OS=Homo sapiens GN=DDX6 PE=1 SV=2 47 40 P12956|XRCC6_HUMAN 191.58 32 32 5.80E+07 17 16 24 69843 X-ray repair cross-complementing protein 6 OS=Homo sapiens GN=XRCC6 PE=1 SV=2 50 39 Q9BUJ2|HNRL1_HUMAN 190.65 21 21 7.32E+07 16 15 23 95739 Heterogeneous nuclear ribonucleoprotein U-like protein 1 OS=Homo sapiens GN=HNRNPUL1 PE=1 SV=2 57 45 P13010|XRCC5_HUMAN 189.25 22 22 2.78E+07 15 14 18 82705 X-ray repair cross-complementing protein 5 OS=Homo sapiens GN=XRCC5 PE=1 SV=3 51 61 Q00839|HNRPU_HUMAN 185.91 18 18 5.63E+07 17 15 21 90585 Heterogeneous nuclear ribonucleoprotein U OS=Homo sapiens GN=HNRNPU PE=1 SV=6 40 49 Q8WXF1|PSPC1_HUMAN 185.86 30 30 5.49E+07 17 14 29 58744 Paraspeckle component 1 OS=Homo sapiens GN=PSPC1 PE=1 SV=1 55 53 P61978|HNRPK_HUMAN 184.66 32 32 4.70E+07 12 10 19 50976 Heterogeneous nuclear ribonucleoprotein K OS=Homo sapiens GN=HNRNPK PE=1 SV=1 KH domain-containing RNA-binding signal transduction-associated protein 1 OS=Homo sapiens GN=KHDRBS1 41 67 Q07666|KHDR1_HUMAN 180.6 29 29 1.14E+08 16 12 28 48227 PE=1 SV=1 48 44 Q7Z739|YTHD3_HUMAN 178.79 30 30 2.05E+07 14 6 23 63861 YTH domain-containing family protein 3 OS=Homo sapiens GN=YTHDF3 PE=1 SV=1 68 48 Q15436|SC23A_HUMAN 177.15 21 21 1.66E+07 12 12 13 86161 Protein transport protein Sec23A OS=Homo sapiens GN=SEC23A PE=1 SV=2 64 58 Q9NQ94|A1CF_HUMAN 176.92 25 25 2.40E+07 13 12 15 65202 APOBEC1 complementation factor OS=Homo sapiens GN=A1CF PE=1 SV=1 59 64 P31943|HNRH1_HUMAN 175.75 30 30 2.82E+07 12 8 17 49229 Heterogeneous nuclear ribonucleoprotein H OS=Homo sapiens GN=HNRNPH1 PE=1 SV=4 65 59 P52272|HNRPM_HUMAN 168.97 20 20 2.74E+07 12 11 14 77516 Heterogeneous nuclear ribonucleoprotein M OS=Homo sapiens GN=HNRNPM PE=1 SV=3 39 74 Q562R1|ACTBL_HUMAN 167.3 22 22 5.78E+05 12 1 30 42003 Beta-actin-like protein 2 OS=Homo sapiens GN=ACTBL2 PE=1 SV=2 61 52 P14866|HNRPL_HUMAN 165.26 30 30 3.52E+07 12 11 16 64133 Heterogeneous nuclear ribonucleoprotein L OS=Homo sapiens GN=HNRNPL PE=1 SV=2 58 114 Q99729|ROAA_HUMAN 162.17 17 17 3.04E+07 9 7 18 36225 Heterogeneous nuclear ribonucleoprotein A/B OS=Homo sapiens GN=HNRNPAB PE=1 SV=2 74 85 P68104|EF1A1_HUMAN 161.43 20 20 1.26E+07 9 7 11 50141 Elongation factor 1-alpha 1 OS=Homo sapiens GN=EEF1A1 PE=1 SV=1 74 86 Q5VTE0|EF1A3_HUMAN 161.43 20 20 1.26E+07 9 7 11 50185 Putative elongation factor 1-alpha-like 3 OS=Homo sapiens GN=EEF1A1P5 PE=5 SV=1 60 55 P13645|K1C10_HUMAN 160.05 22 22 1.75E+07 12 8 17 58827 Keratin type I cytoskeletal 10 OS=Homo sapiens GN=KRT10 PE=1 SV=6 88 87 P68363|TBA1B_HUMAN 157.45 25 25 1.33E+06 7 1 10 50152 Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 89 88 Q9BQE3|TBA1C_HUMAN 156.87 25 25 6.96E+05 7 1 10 49895 Tubulin alpha-1C chain OS=Homo sapiens GN=TUBA1C PE=1 SV=1 89 89 Q71U36|TBA1A_HUMAN 156.87 25 25 6.96E+05 7 1 10 50136 Tubulin alpha-1A chain OS=Homo sapiens GN=TUBA1A PE=1 SV=1 83 77 P62753|RS6_HUMAN 156.44 39 39 1.92E+07 9 8 10 28681 40S ribosomal protein S6 OS=Homo sapiens GN=RPS6 PE=1 SV=1 67 65 O95793|STAU1_HUMAN 156.02 23 23 2.08E+07 10 10 13 63182 Double-stranded RNA-binding protein Staufen homolog 1 OS=Homo sapiens GN=STAU1 PE=1 SV=2 70 70 Q9NYL9|TMOD3_HUMAN 154.1 34 34 3.07E+07 8 8 12 39595 Tropomodulin-3 OS=Homo sapiens GN=TMOD3 PE=1 SV=1 98 73 P10809|CH60_HUMAN 153.38 18 18 7.02E+06 8 8 8 61055 60 kDa heat shock protein mitochondrial OS=Homo sapiens GN=HSPD1 PE=1 SV=2 62 57 P08670|VIME_HUMAN 153.31 30 30 1.58E+07 13 9 16 53652 Vimentin OS=Homo sapiens GN=VIM PE=1 SV=4 63 120 P06753|TPM3_HUMAN 151.79 22 22 3.26E+07 9 9 16 32950 Tropomyosin alpha-3 chain OS=Homo sapiens GN=TPM3 PE=1 SV=2 103 103 Q5SSJ5|HP1B3_HUMAN 147.92 14 14 1.01E+07 7 7 7 61207 Heterochromatin protein 1-binding protein 3 OS=Homo sapiens GN=HP1BP3 PE=1 SV=1 87 81 Q15637|SF01_HUMAN 145.52 16 16 1.22E+07 9 9 10 68330 Splicing factor 1 OS=Homo sapiens GN=SF1 PE=1 SV=4 73 71 P15880|RS2_HUMAN 145.04 30 30 1.80E+07 8 8 11 31324 40S ribosomal protein S2 OS=Homo sapiens GN=RPS2 PE=1 SV=2 72 92 P07910|HNRPC_HUMAN 144.03 26 26 3.47E+07 9 9 11 33670 Heterogeneous nuclear ribonucleoproteins C1/C2 OS=Homo sapiens GN=HNRNPC PE=1 SV=4 78 79 P62241|RS8_HUMAN 143.15 53 53 2.11E+07 10 10 11 24205 40S ribosomal protein S8 OS=Homo sapiens GN=RPS8 PE=1 SV=2 93 91 P14618|KPYM_HUMAN 142.34 24 24 9.43E+06 7 7 9 57937 Pyruvate kinase PKM OS=Homo sapiens GN=PKM PE=1 SV=4 66 96 Q9BYJ9|YTHD1_HUMAN 142.05 14 14 1.41E+05 8 1 14 60874 YTH domain-containing family protein 1 OS=Homo sapiens GN=YTHDF1 PE=1 SV=1 107 98 P04406|G3P_HUMAN 140.66 27 27 8.13E+06 7 6 7 36053 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 75 93 Q9NUD5|ZCHC3_HUMAN 138.09 19 19 1.42E+07 8 6 11 43618 Zinc finger CCHC domain-containing protein 3 OS=Homo sapiens GN=ZCCHC3 PE=1 SV=1 96 106 P07437|TBB5_HUMAN 136.74 16 16 3.87E+06 6 1 8 49671 Tubulin beta chain OS=Homo sapiens GN=TUBB PE=1 SV=2 52 80 P46781|RS9_HUMAN 133.46 40 40 5.87E+07 13 11 20 22591 40S ribosomal protein S9 OS=Homo sapiens GN=RPS9 PE=1 SV=3 100 121 O95429|BAG4_HUMAN 130.58 15 15 8.31E+06 6 6 8 49594 BAG family molecular chaperone regulator 4 OS=Homo sapiens GN=BAG4 PE=1 SV=1 69 115 P23246|SFPQ_HUMAN 128.95 9 9 7.39E+06 7 4 12 76150 Splicing factor proline- and glutamine-rich OS=Homo sapiens GN=SFPQ PE=1 SV=2 81 75 P35908|K22E_HUMAN 128.19 16 16 4.48E+06 9 5 10 65433 Keratin type II cytoskeletal 2 epidermal OS=Homo sapiens GN=KRT2 PE=1 SV=2 115 124 Q96EP5|DAZP1_HUMAN 127.62 17 17 1.02E+07 5 5 6 43383 DAZ-associated protein 1 OS=Homo sapiens GN=DAZAP1 PE=1 SV=1 110 108 P23396|RS3_HUMAN 127.34 35 35 1.03E+07 7 7 7 26688 40S ribosomal protein S3 OS=Homo sapiens GN=RPS3 PE=1 SV=2 160 253 Q6UN15|FIP1_HUMAN 124.94 6 6 4.76E+06 3 3 4 66526 Pre-mRNA 3'-end-processing factor FIP1 OS=Homo sapiens GN=FIP1L1 PE=1 SV=1 132 144 P51991|ROA3_HUMAN 124.48 20 20 6.06E+06 5 4 5 39595 Heterogeneous nuclear ribonucleoprotein A3 OS=Homo sapiens GN=HNRNPA3 PE=1 SV=2 84 82 P62280|RS11_HUMAN 123.41 47 47 1.35E+07 9 7 10 18431 40S ribosomal protein S11 OS=Homo sapiens GN=RPS11 PE=1 SV=3 76 113 P39023|RL3_HUMAN 122.21 14 14 7.79E+06 7 6 11 46109 60S ribosomal protein L3 OS=Homo sapiens GN=RPL3 PE=1 SV=2 117 169 P52597|HNRPF_HUMAN 119.67 13 13 9.33E+05 5 1 6 45672 Heterogeneous nuclear ribonucleoprotein F OS=Homo sapiens GN=HNRNPF PE=1 SV=3 112 131 Q8NCA5|FA98A_HUMAN 119.65 12 12 5.23E+06 5 4 7 55401 Protein FAM98A OS=Homo sapiens GN=FAM98A PE=1 SV=1 131 143 Q9NWB1|RFOX1_HUMAN 119.6 12 12 6.64E+06 4 4 5 42784 RNA binding protein fox-1 homolog 1 OS=Homo sapiens GN=RBFOX1 PE=1 SV=2 131 154 O43251|RFOX2_HUMAN 119.6 12 12 6.64E+06 4 4 5 41374 RNA binding protein fox-1 homolog 2 OS=Homo sapiens GN=RBFOX2 PE=1 SV=3 99 110 Q9UBU9|NXF1_HUMAN 118.37 14 14 5.14E+06 7 6 8 70182 Nuclear RNA export factor 1 OS=Homo sapiens GN=NXF1 PE=1 SV=1 158 182 Q99856|ARI3A_HUMAN 118.33 9 9 2.83E+06 3 3 4 62889 AT-rich interactive domain-containing protein 3A OS=Homo sapiens GN=ARID3A PE=1 SV=2 167 192 Q00577|PURA_HUMAN 115.79 20 20 3.40E+06 4 4 4 34911 Transcriptional activator protein Pur-alpha OS=Homo sapiens GN=PURA PE=1 SV=2 136 172 Q8N684|CPSF7_HUMAN 113.2 10 10 9.14E+06 4 4 5 52050 Cleavage and polyadenylation specificity factor subunit 7 OS=Homo sapiens GN=CPSF7 PE=1 SV=1 101 151 P62263|RS14_HUMAN 111.87 26 26 8.69E+06 6 6 8 16273 40S ribosomal protein S14 OS=Homo sapiens GN=RPS14 PE=1 SV=3 135 153 P10412|H14_HUMAN 109.97 26 26 1.70E+07 5 5 5 21865 Histone H1.4 OS=Homo sapiens GN=HIST1H1E PE=1 SV=2 86 118 Q8NC51|PAIRB_HUMAN 109.07 16 16 1.15E+07 5 5 10 44965 Plasminogen activator inhibitor 1 RNA-binding protein OS=Homo sapiens GN=SERBP1 PE=1 SV=2 80 100 P35527|K1C9_HUMAN 108.77 15 15 1.04E+07 8 7 10 62064 Keratin type I cytoskeletal 9 OS=Homo sapiens GN=KRT9 PE=1 SV=3 97 133 Q9Y5A9|YTHD2_HUMAN 105.55 7 7 1.28E+06 5 1 8 62334 YTH domain-containing family protein 2 OS=Homo sapiens GN=YTHDF2 PE=1 SV=2 122 275 P60866|RS20_HUMAN 105.25 25 25 1.06E+07 4 4 6 13373 40S ribosomal protein S20 OS=Homo sapiens GN=RPS20 PE=1 SV=1 133 146 P31483|TIA1_HUMAN 104.41 11 11 5.96E+06 4 4 5 42963 Nucleolysin TIA-1 isoform p40 OS=Homo sapiens GN=TIA1 PE=1 SV=3 165 158 P62987|RL40_HUMAN 103.76 31 31 5.69E+06 4 4 4 14728 Ubiquitin-60S ribosomal protein L40 OS=Homo sapiens GN=UBA52 PE=1 SV=2 165 159 P62979|RS27A_HUMAN 103.76 26 26 5.69E+06 4 4 4 17965 Ubiquitin-40S ribosomal protein S27a OS=Homo sapiens GN=RPS27A PE=1 SV=2 165 160 P0CG47|UBB_HUMAN 103.76 17 17 5.69E+06 4 4 4 25762 Polyubiquitin-B OS=Homo sapiens GN=UBB PE=1 SV=1 165 163 P0CG48|UBC_HUMAN 103.76 6 6 5.69E+06 4 4 4 77039 Polyubiquitin-C OS=Homo sapiens GN=UBC PE=1 SV=3 166 161 P18621|RL17_HUMAN 102.35 23 23 3.21E+06 4 4 4 21397 60S ribosomal protein L17 OS=Homo sapiens GN=RPL17 PE=1 SV=3 119 165 P62266|RS23_HUMAN 101.55 28 28 8.63E+06 5 4 6 15808 40S ribosomal protein S23 OS=Homo sapiens GN=RPS23 PE=1 SV=3 148 147 P22626|ROA2_HUMAN 101.27 14 14 4.25E+06 4 3 4 37430 Heterogeneous nuclear ribonucleoproteins A2/B1 OS=Homo sapiens GN=HNRNPA2B1 PE=1 SV=2 134 135 P51114|FXR1_HUMAN 101.09 10 10 3.08E+06 5 4 5 69721 Fragile X mental retardation syndrome-related protein 1 OS=Homo sapiens GN=FXR1 PE=1 SV=3 108 123 P08621|RU17_HUMAN 100.87 11 11 6.48E+06 7 7 7 51557 U1 small nuclear ribonucleoprotein 70 kDa OS=Homo sapiens GN=SNRNP70 PE=1 SV=2 138 190 Q15717|ELAV1_HUMAN 100.81 12 12 2.48E+06 3 3 5 36092 ELAV-like protein 1 OS=Homo sapiens GN=ELAVL1 PE=1 SV=2 111 112 P26373|RL13_HUMAN 100.43 28 28 8.66E+06 7 6 7 24261 60S ribosomal protein L13 OS=Homo sapiens GN=RPL13 PE=1 SV=4 164 157 P62851|RS25_HUMAN 96.35 35 35 1.54E+07 4 4 4 13742 40S ribosomal protein S25 OS=Homo sapiens GN=RPS25 PE=1 SV=1 147 140 P36578|RL4_HUMAN 95.73 11 11 2.53E+06 4 4 4 47697 60S ribosomal protein L4 OS=Homo sapiens GN=RPL4 PE=1 SV=5 156 141 Q07065|CKAP4_HUMAN 94.91 9 9 4.03E+06 4 4 4 66023 Cytoskeleton-associated protein 4 OS=Homo sapiens GN=CKAP4 PE=1 SV=2 137 180 P62913|RL11_HUMAN 91.32 20 20 7.35E+06 5 5 5 20252 60S ribosomal protein L11 OS=Homo sapiens GN=RPL11 PE=1 SV=2 159 183 Q12906|ILF3_HUMAN 91.09 4 4 5.38E+06 3 3 4 95339 Interleukin enhancer-binding factor 3 OS=Homo sapiens GN=ILF3 PE=1 SV=3 139 204 P62249|RS16_HUMAN 90.39 21 21 8.70E+06 4 4 5 16445 40S ribosomal protein S16 OS=Homo sapiens GN=RPS16 PE=1 SV=2 150 224 P09651|ROA1_HUMAN 88.57 10 10 1.50E+06 4 2 4 38747 Heterogeneous nuclear ribonucleoprotein A1 OS=Homo sapiens GN=HNRNPA1 PE=1 SV=5 224 202 P16401|H15_HUMAN 88.13 15 15 7.78E+06 3 3 3 22580 Histone H1.5 OS=Homo sapiens GN=HIST1H1B PE=1 SV=3 223 200 P62829|RL23_HUMAN 88.07 27 27 3.20E+06 3 3 3 14865 60S ribosomal protein L23 OS=Homo sapiens GN=RPL23 PE=1 SV=1 354 284 P04196|HRG_HUMAN 87.98 5 5 9.77E+05 2 2 2 59578 Histidine-rich glycoprotein OS=Homo sapiens GN=HRG PE=1 SV=1 229 277 Q49A26|GLYR1_HUMAN 86.65 5 5 1.33E+06 2 2 3 60556 Putative oxidoreductase GLYR1 OS=Homo sapiens GN=GLYR1 PE=1 SV=3 149 162 P61247|RS3A_HUMAN 86.14 21 21 2.18E+06 4 4 4 29945 40S ribosomal protein S3a OS=Homo sapiens GN=RPS3A PE=1 SV=2 120 203 P16989|YBOX3_HUMAN 85.62 10 10 7.48E+06 3 3 6 40090 Y-box-binding protein 3 OS=Homo sapiens GN=YBX3 PE=1 SV=4 228 230 P07355|ANXA2_HUMAN 84.55 9 9 6.84E+05 3 2 3 38604 Annexin A2 OS=Homo sapiens GN=ANXA2 PE=1 SV=2 151 247 P35579|MYH9_HUMAN 83.87 2 2 3.68E+05 3 1 4 226530 Myosin-9 OS=Homo sapiens GN=MYH9 PE=1 SV=4 176 231 Q06787|FMR1_HUMAN 82.44 6 6 1.36E+06 3 3 3 71175 Synaptic functional regulator FMR1 OS=Homo sapiens GN=FMR1 PE=1 SV=1 207 260 Q52LJ0|FA98B_HUMAN 81.13 8 8 3.68E+05 2 1 3 37191 Protein FAM98B OS=Homo sapiens GN=FAM98B PE=1 SV=1 170 276 P63173|RL38_HUMAN 79.69 36 36 3.60E+06 2 2 4 8218 60S ribosomal protein L38 OS=Homo sapiens GN=RPL38 PE=1 SV=2 KH domain-containing RNA-binding signal transduction-associated protein 3 OS=Homo sapiens GN=KHDRBS3 114 221 O75525|KHDR3_HUMAN 78.23 7 7 6.67E+05 4 1 6 38800 PE=1 SV=1 260 238 Q14157|UBP2L_HUMAN 77.44 3 3 2.23E+06 2 2 2 114534 Ubiquitin-associated protein 2-like OS=Homo sapiens GN=UBAP2L PE=1 SV=2 157 173 Q14444|CAPR1_HUMAN 76.93 6 6 6.40E+06 4 4 4 78366 Caprin-1 OS=Homo sapiens GN=CAPRIN1 PE=1 SV=2 296 258 P84098|RL19_HUMAN 76.59 14 14 2.13E+06 2 2 2 23466 60S ribosomal protein L19 OS=Homo sapiens GN=RPL19 PE=1 SV=1 295 244 P62917|RL8_HUMAN 76.51 11 11 5.69E+05 2 2 2 28025 60S ribosomal protein L8 OS=Homo sapiens GN=RPL8 PE=1 SV=2 353 281 Q14498|RBM39_HUMAN 73.91 5 5 1.91E+06 2 2 2 59380 RNA-binding protein 39 OS=Homo sapiens GN=RBM39 PE=1 SV=2 352 279 P08708|RS17_HUMAN 73.87 16 16 4.31E+05 2 2 2 15550 40S ribosomal protein S17 OS=Homo sapiens GN=RPS17 PE=1 SV=2 205 248 P23588|IF4B_HUMAN 70.74 5 5 3.95E+05 3 2 3 69151 Eukaryotic translation initiation factor 4B OS=Homo sapiens GN=EIF4B PE=1 SV=2 457 315 Q7Z5Q1|CPEB2_HUMAN 67.79 3 3 5.58E+05 1 1 1 64944 Cytoplasmic polyadenylation element-binding protein 2 OS=Homo sapiens GN=CPEB2 PE=2 SV=3 457 338 Q8NE35|CPEB3_HUMAN 67.79 2 2 5.58E+05 1 1 1 76014 Cytoplasmic polyadenylation element-binding protein 3 OS=Homo sapiens GN=CPEB3 PE=1 SV=2 457 340 Q17RY0|CPEB4_HUMAN 67.79 2 2 5.58E+05 1 1 1 80152 Cytoplasmic polyadenylation element-binding protein 4 OS=Homo sapiens GN=CPEB4 PE=1 SV=1 152 259 Q8N7X1|RMXL3_HUMAN 67.51 2 2 8.37E+05 3 1 4 114938 RNA-binding motif protein X-linked-like-3 OS=Homo sapiens GN=RBMXL3 PE=2 SV=2 355 285 P62854|RS26_HUMAN 65.72 21 21 5.55E+06 2 2 2 13015 40S ribosomal protein S26 OS=Homo sapiens GN=RPS26 PE=1 SV=3 361 306 Q96L21|RL10L_HUMAN 64.85 8 8 2.04E+06 2 2 2 24519 60S ribosomal protein L10-like OS=Homo sapiens GN=RPL10L PE=1 SV=3 361 307 P27635|RL10_HUMAN 64.85 8 8 2.04E+06 2 2 2 24604 60S ribosomal protein L10 OS=Homo sapiens GN=RPL10 PE=1 SV=4 168 220 O60832|DKC1_HUMAN 63.39 7 7 3.58E+06 3 3 4 57674 H/ACA ribonucleoprotein complex subunit 4 OS=Homo sapiens GN=DKC1 PE=1 SV=3 358 300 P62995|TRA2B_HUMAN 61.95 7 7 2.31E+05 2 2 2 33666 Transformer-2 protein homolog beta OS=Homo sapiens GN=TRA2B PE=1 SV=1 225 215 Q5T9A4|ATD3B_HUMAN 61.9 5 5 2.07E+06 3 3 3 72573 ATPase family AAA domain-containing protein 3B OS=Homo sapiens GN=ATAD3B PE=1 SV=1 484 354 P46776|RL27A_HUMAN 61.68 7 7 3.03E+06 1 1 1 16561 60S ribosomal protein L27a OS=Homo sapiens GN=RPL27A PE=1 SV=2 356 293 P25398|RS12_HUMAN 61.41 18 18 5.54E+05 2 2 2 14515 40S ribosomal protein S12 OS=Homo sapiens GN=RPS12 PE=1 SV=3 297 263 Q02878|RL6_HUMAN 60.72 6 6 1.26E+06 2 2 2 32728 60S ribosomal protein L6 OS=Homo sapiens GN=RPL6 PE=1 SV=3 483 345 P46782|RS5_HUMAN 60.52 7 7 1.23E+06 1 1 1 22876 40S ribosomal protein S5 OS=Homo sapiens GN=RPS5 PE=1 SV=4 302 353 Q92504|S39A7_HUMAN 59.88 3 3 9.87E+05 1 1 2 50118 Zinc transporter SLC39A7 OS=Homo sapiens GN=SLC39A7 PE=1 SV=2 360 304 P48047|ATPO_HUMAN 59.56 12 12 6.28E+05 2 2 2 23277 ATP synthase subunit O mitochondrial OS=Homo sapiens GN=ATP5O PE=1 SV=1 169 227 P61160|ARP2_HUMAN 59.26 8 8 1.94E+05 3 2 4 44761 Actin-related protein 2 OS=Homo sapiens GN=ACTR2 PE=1 SV=1 511 364 P33993|MCM7_HUMAN 59 2 2 2.84E+05 1 1 1 81308 DNA replication licensing factor MCM7 OS=Homo sapiens GN=MCM7 PE=1 SV=4 512 366 P31040|SDHA_HUMAN 57.43 2 2 9.35E+04 1 1 1 72692 Succinate dehydrogenase [ubiquinone] flavoprotein subunit mitochondrial OS=Homo sapiens GN=SDHA PE=1 SV=2 442 343 Q9NVP1|DDX18_HUMAN 56.54 2 2 7.57E+05 1 1 1 75407 ATP-dependent RNA helicase DDX18 OS=Homo sapiens GN=DDX18 PE=1 SV=2 513 367 P47914|RL29_HUMAN 56.48 9 9 3.43E+06 1 1 1 17752 60S ribosomal protein L29 OS=Homo sapiens GN=RPL29 PE=1 SV=2 227 226 P46779|RL28_HUMAN 55.03 18 18 2.51E+06 3 3 3 15747 60S ribosomal protein L28 OS=Homo sapiens GN=RPL28 PE=1 SV=3 514 368 O15372|EIF3H_HUMAN 54.3 5 5 3.66E+05 1 1 1 39930 Eukaryotic translation initiation factor 3 subunit H OS=Homo sapiens GN=EIF3H PE=1 SV=1 300 339 Q9NUQ6|SPS2L_HUMAN 54.18 2 2 5.23E+05 1 1 2 61729 SPATS2-like protein OS=Homo sapiens GN=SPATS2L PE=1 SV=2 363 313 P35268|RL22_HUMAN 53.49 14 14 1.79E+06 2 1 2 14787 60S ribosomal protein L22 OS=Homo sapiens GN=RPL22 PE=1 SV=2 357 299 P08865|RSSA_HUMAN 52.88 9 9 2.35E+06 2 2 2 32854 40S ribosomal protein SA OS=Homo sapiens GN=RPSA PE=1 SV=4 359 301 P26368|U2AF2_HUMAN 51.98 7 7 3.83E+07 2 2 2 53501 Splicing factor U2AF 65 kDa subunit OS=Homo sapiens GN=U2AF2 PE=1 SV=4 516 372 Q86XZ4|SPAS2_HUMAN 51.4 2 2 2.94E+05 1 1 1 59545 Spermatogenesis-associated serine-rich protein 2 OS=Homo sapiens GN=SPATS2 PE=1 SV=1 515 371 Q9ULV4|COR1C_HUMAN 51.36 3 3 5.72E+05 1 1 1 53249 Coronin-1C OS=Homo sapiens GN=CORO1C PE=1 SV=1 517 373 P06748|NPM_HUMAN 49.31 4 4 1.25E+05 1 1 1 32575 Nucleophosmin OS=Homo sapiens GN=NPM1 PE=1 SV=2 518 374 P04843|RPN1_HUMAN 46.71 2 2 4.16E+05 1 1 1 68569 Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 1 OS=Homo sapiens GN=RPN1 PE=1 SV=1 238 858 Q9NS40|KCNH7_HUMAN 46.57 1 1 2.28E+06 3 1 3 135000 Potassium voltage-gated channel subfamily H member 7 OS=Homo sapiens GN=KCNH7 PE=2 SV=2 519 375 Q8IY67|RAVR1_HUMAN 46.41 3 3 8.46E+04 1 1 1 63877 Ribonucleoprotein PTB-binding 1 OS=Homo sapiens GN=RAVER1 PE=1 SV=1 178 4514 Q03001|DYST_HUMAN 45.31 0 0 4.55E+05 3 1 3 860679 Dystonin OS=Homo sapiens GN=DST PE=1 SV=4 366 376 Q06830|PRDX1_HUMAN 44.78 6 6 8.88E+05 1 1 2 22110 Peroxiredoxin-1 OS=Homo sapiens GN=PRDX1 PE=1 SV=1 366 377 Q13162|PRDX4_HUMAN 44.78 4 4 8.88E+05 1 1 2 30540 Peroxiredoxin-4 OS=Homo sapiens GN=PRDX4 PE=1 SV=1 520 379 P60660|MYL6_HUMAN 43.99 6 6 7.42E+05 1 1 1 16930 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 183 691 Q8NEZ4|KMT2C_HUMAN 43.75 0 0 1.52E+06 3 1 3 541376 Histone-lysine N-methyltransferase 2C OS=Homo sapiens GN=KMT2C PE=1 SV=3 362 309 P62701|RS4X_HUMAN 43.03 5 5 1.19E+06 2 2 2 29598 40S ribosomal protein S4 X isoform OS=Homo sapiens GN=RPS4X PE=1 SV=2 521 387 Q5D862|FILA2_HUMAN 42.87 0 0 1.85E+05 1 1 1 248072 Filaggrin-2 OS=Homo sapiens GN=FLG2 PE=1 SV=1 146 432 Q5VU43|MYOME_HUMAN 41.24 1 1 4.43E+05 3 1 4 265077 Myomegalin OS=Homo sapiens GN=PDE4DIP PE=1 SV=1 367 396 P68400|CSK21_HUMAN 39.55 5 5 2.39E+05 1 1 2 45144 Casein kinase II subunit alpha OS=Homo sapiens GN=CSNK2A1 PE=1 SV=1 367 397 Q8NEV1|CSK23_HUMAN 39.55 5 5 2.39E+05 1 1 2 45220 Casein kinase II subunit alpha 3 OS=Homo sapiens GN=CSNK2A3 PE=1 SV=2 482 342 P83731|RL24_HUMAN 38.67 6 6 5.71E+05 1 1 1 17779 60S ribosomal protein L24 OS=Homo sapiens GN=RPL24 PE=1 SV=1 364 321 Q96CW1|AP2M1_HUMAN 37.63 4 4 7.98E+05 2 2 2 49655 AP-2 complex subunit mu OS=Homo sapiens GN=AP2M1 PE=1 SV=2 523 402 Q969Q0|RL36L_HUMAN 37.2 8 8 6.83E+05 1 1 1 12469 60S ribosomal protein L36a-like OS=Homo sapiens GN=RPL36AL PE=1 SV=3 523 403 P83881|RL36A_HUMAN 37.2 8 8 6.83E+05 1 1 1 12441 60S ribosomal protein L36a OS=Homo sapiens GN=RPL36A PE=1 SV=2 522 401 Q86UE4|LYRIC_HUMAN 36.76 2 2 1.16E+06 1 1 1 63837 Protein LYRIC OS=Homo sapiens GN=MTDH PE=1 SV=2 524 404 P50991|TCPD_HUMAN 36.21 3 3 2.75E+05 1 1 1 57924 T-complex protein 1 subunit delta OS=Homo sapiens GN=CCT4 PE=1 SV=4 525 405 P62937|PPIA_HUMAN 36.16 7 7 2.92E+05 1 1 1 18012 Peptidyl-prolyl cis-trans isomerase A OS=Homo sapiens GN=PPIA PE=1 SV=2 186 895 Q9ULL4|PLXB3_HUMAN 35.7 1 1 9.98E+07 3 1 3 206846 Plexin-B3 OS=Homo sapiens GN=PLXNB3 PE=1 SV=2 256 619 P21817|RYR1_HUMAN 34.95 0 0 0.00E+00 2 1 2 565184 Ryanodine receptor 1 OS=Homo sapiens GN=RYR1 PE=1 SV=3 241 1359 P59045|NAL11_HUMAN 34.03 1 1 3.37E+06 2 1 3 117779 NACHT LRR and PYD domains-containing protein 11 OS=Homo sapiens GN=NLRP11 PE=2 SV=2 Peroxisome proliferator-activated receptor gamma coactivator-related protein 1 OS=Homo sapiens GN=PPRC1 PE=1 204 3620 Q5VV67|PPRC1_HUMAN 33.66 1 1 5.24E+06 2 1 3 177543 SV=1 526 408 Q8ND56|LS14A_HUMAN 33.22 3 3 1.55E+05 1 1 1 50530 Protein LSM14 homolog A OS=Homo sapiens GN=LSM14A PE=1 SV=3 527 418 P34897|GLYM_HUMAN 32.81 2 2 4.18E+05 1 1 1 55993 Serine hydroxymethyltransferase mitochondrial OS=Homo sapiens GN=SHMT2 PE=1 SV=3 370 442 P06396|GELS_HUMAN 32.04 3 3 3.68E+05 2 1 2 85697 Gelsolin OS=Homo sapiens GN=GSN PE=1 SV=1 528 425 P17987|TCPA_HUMAN 31.7 4 4 2.18E+05 1 1 1 60344 T-complex protein 1 subunit alpha OS=Homo sapiens GN=TCP1 PE=1 SV=1 529 426 P07305|H10_HUMAN 31.64 7 7 2.99E+05 1 1 1 20863 Histone H1.0 OS=Homo sapiens GN=H1F0 PE=1 SV=3 307 463 Q9UBC5|MYO1A_HUMAN 31.34 1 1 8.58E+06 2 1 2 118401 Unconventional myosin-Ia OS=Homo sapiens GN=MYO1A PE=2 SV=1 402 1580 Q9NRE2|TSH2_HUMAN 30.93 1 1 8.41E+05 2 1 2 115005 Teashirt homolog 2 OS=Homo sapiens GN=TSHZ2 PE=1 SV=3 182 533 Q5THJ4|VP13D_HUMAN 30.11 0 0 1.67E+07 2 1 3 491920 Vacuolar protein sorting-associated protein 13D OS=Homo sapiens GN=VPS13D PE=1 SV=2 530 433 P50990|TCPQ_HUMAN 29.83 2 2 6.55E+05 1 1 1 59621 T-complex protein 1 subunit theta OS=Homo sapiens GN=CCT8 PE=1 SV=4 385 727 Q9BVG8|KIFC3_HUMAN 29.64 2 2 6.78E+05 2 1 2 92775 Kinesin-like protein KIFC3 OS=Homo sapiens GN=KIFC3 PE=1 SV=4 531 434 P47756|CAPZB_HUMAN 29.23 3 3 4.31E+05 1 1 1 31350 F-actin-capping protein subunit beta OS=Homo sapiens GN=CAPZB PE=1 SV=4 255 518 Q9BYK8|HELZ2_HUMAN 27.14 0 0 1.75E+06 2 1 2 294649 Helicase with zinc finger domain 2 OS=Homo sapiens GN=HELZ2 PE=1 SV=6 532 458 P25705|ATPA_HUMAN 25.72 1 1 2.05E+05 1 1 1 59751 ATP synthase subunit alpha mitochondrial OS=Homo sapiens GN=ATP5A1 PE=1 SV=1 456 266 O43790|KRT86_HUMAN 25.03 2 2 8.26E+05 1 1 1 53501 Keratin type II cuticular Hb6 OS=Homo sapiens GN=KRT86 PE=1 SV=1 456 268 P78385|KRT83_HUMAN 25.03 2 2 8.26E+05 1 1 1 54195 Keratin type II cuticular Hb3 OS=Homo sapiens GN=KRT83 PE=1 SV=2 456 272 P78386|KRT85_HUMAN 25.03 2 2 8.26E+05 1 1 1 55802 Keratin type II cuticular Hb5 OS=Homo sapiens GN=KRT85 PE=1 SV=1 456 352 Q14533|KRT81_HUMAN 25.03 2 2 8.26E+05 1 1 1 54928 Keratin type II cuticular Hb1 OS=Homo sapiens GN=KRT81 PE=1 SV=3 456 355 A6NCN2|KR87P_HUMAN 25.03 5 5 8.26E+05 1 1 1 29117 Putative keratin-87 protein OS=Homo sapiens GN=KRT87P PE=5 SV=4 534 467 Q13242|SRSF9_HUMAN 24.38 3 3 4.11E+06 1 1 1 25542 Serine/arginine-rich splicing factor 9 OS=Homo sapiens GN=SRSF9 PE=1 SV=1 534 468 Q07955|SRSF1_HUMAN 24.38 3 3 4.11E+06 1 1 1 27745 Serine/arginine-rich splicing factor 1 OS=Homo sapiens GN=SRSF1 PE=1 SV=2 309 608 O75369|FLNB_HUMAN 23.48 1 1 8.54E+05 2 2 2 278162 Filamin-B OS=Homo sapiens GN=FLNB PE=1 SV=2 282 802 Q9C075|K1C23_HUMAN 22.85 1 1 0.00E+00 1 1 2 48131 Keratin type I cytoskeletal 23 OS=Homo sapiens GN=KRT23 PE=1 SV=2 282 1333 Q13618|CUL3_HUMAN 22.85 1 1 0.00E+00 1 1 2 88930 Cullin-3 OS=Homo sapiens GN=CUL3 PE=1 SV=2 282 1376 O15117|FYB_HUMAN 22.85 1 1 0.00E+00 1 1 2 85387 FYN-binding protein OS=Homo sapiens GN=FYB PE=1 SV=2 282 3298 O15014|ZN609_HUMAN 22.85 0 0 0.00E+00 1 1 2 151191 Zinc finger protein 609 OS=Homo sapiens GN=ZNF609 PE=1 SV=2 197 593 Q9H501|ESF1_HUMAN 22.71 1 1 5.39E+08 1 1 3 98796 ESF1 homolog OS=Homo sapiens GN=ESF1 PE=1 SV=1 197 1004 O15021|MAST4_HUMAN 22.71 0 0 5.39E+08 1 1 3 284376 Microtubule-associated serine/threonine-protein kinase 4 OS=Homo sapiens GN=MAST4 PE=1 SV=3 371 484 P28290|SSFA2_HUMAN 22.7 1 1 2.98E+07 1 1 2 138386 Sperm-specific antigen 2 OS=Homo sapiens GN=SSFA2 PE=1 SV=3 537 482 Q9P281|BAHC1_HUMAN 22.65 0 0 4.86E+05 1 1 1 276929 BAH and coiled-coil domain-containing protein 1 OS=Homo sapiens GN=BAHCC1 PE=1 SV=3 486 456 Q15678|PTN14_HUMAN 22.08 1 1 7.60E+05 1 1 1 135261 Tyrosine-protein phosphatase non-receptor type 14 OS=Homo sapiens GN=PTPN14 PE=1 SV=2 540 583 Q96L91|EP400_HUMAN 21.86 0 0 3.89E+06 1 1 1 343487 E1A-binding protein p400 OS=Homo sapiens GN=EP400 PE=1 SV=4 570 1090 Q8NEG7|DEN6B_HUMAN 21.5 1 1 4.38E+07 1 1 1 66464 Protein DENND6B OS=Homo sapiens GN=DENND6B PE=2 SV=1 492 714 Q92823|NRCAM_HUMAN 21.24 0 0 1.02E+07 1 1 1 143889 Neuronal cell adhesion molecule OS=Homo sapiens GN=NRCAM PE=1 SV=3 488 573 Q8WWH4|ASZ1_HUMAN 21.02 3 3 8.19E+06 1 1 1 53458 Ankyrin repeat SAM and basic leucine zipper domain-containing protein 1 OS=Homo sapiens GN=ASZ1 PE=2 SV=1 539 579 P24046|GBRR1_HUMAN 20.71 4 4 1.41E+06 1 1 1 55883 Gamma-aminobutyric acid receptor subunit rho-1 OS=Homo sapiens GN=GABRR1 PE=2 SV=2 541 586 A6NJB7|PRR19_HUMAN 20.48 2 2 1.50E+06 1 1 1 38716 Proline-rich protein 19 OS=Homo sapiens GN=PRR19 PE=1 SV=1 377 594 Q569K6|CC157_HUMAN 20.21 1 1 3.57E+06 1 1 2 83941 Coiled-coil domain-containing protein 157 OS=Homo sapiens GN=CCDC157 PE=2 SV=3 Table S1-2. 179 Interactors of TNFR1 downloaded from BioGRID website. SWISS- SWISS- Systematic Systematic REFSEQ TREMBL #BioGRID PROT TREMBL PROT Entrez Gene Entrez Gene BioGRID ID BioGRID ID Name Name Official Symbol Official Symbol Experimental Source Accessions Accessions Interaction Synonyms Interactor A Synonyms Interactor B Experimental System Publication Source Throughput Accessions Accessions Accessions REFSEQ Accessions Interactor B Interactor A Interactor B Interactor A Interactor B Interactor Interactor Interactor A Interactor B System Type Database Interactor Interactor ID Interactor Interactor A Interactor A B A B A B 2532656 1489078 7132 4263557 112986 HpV16gp1 - E6 TNFRSF1A - CD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:11934887 Low Throughput BIOGRID P03126 Q547J2 NP_041325 P19438 - NP_001333021|NP_001333020|NP_001056 2532657 1489078 7132 4263557 112986 HpV16gp1 - E6 TNFRSF1A - CD120a|FPF|MS5|TBP1|TNTwo-hybrid physical PUBMED:11934887 Low Throughput BIOGRID P03126 Q547J2 NP_041325 P19438 - NP_001333021|NP_001333020|NP_001056 2561499 1489078 7132 4263557 112986 HpV16gp1 - E6 TNFRSF1A - CD120a|FPF|MS5|TBP1|TNTwo-hybrid physical PUBMED:15073179 Low Throughput BIOGRID P03126 Q547J2 NP_041325 P19438 - NP_001333021|NP_001333020|NP_001056 1104634 122011 7132 125755 112986 - - CSNK1A1L TNFRSF1A CK1 CD120a|FPF|MS5|TBP1|TNBiochemical Activity physical PUBMED:8051045 Low Throughput BIOGRID Q8N752 - NP_660204 P19438 - NP_001333021|NP_001333020|NP_001056 872561 81858 7132 123608 112986 PSEC0216 - SHARPIN TNFRSF1A SIPL1 CD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:23746843 Low Throughput BIOGRID Q9H0F6 Q6PJD5 NP_112236 P19438 - NP_001333021|NP_001333020|NP_001056 1447853 81556 7132 123520 112986 - - VWA9 TNFRSF1A C15orf44 CD120a|FPF|MS5|TBP1|TNAffinity Capture-MS physical PUBMED:26496610 High Throughput BIOGRID Q96SY0 B4DWZ3 NP_00119398P19438 - NP_001333021|NP_001333020|NP_001056 2603807 79155 7132 122573 112986 RP3-474M20.- TNIP2 TNFRSF1A ABIN2|FLIP1|KLIP CD120a|FPF|MS5|TBP1|TNAffinity Capture-MS physical PUBMED:30561431 High Throughput BIOGRID Q8NFZ5 D6RGJ2 NP_077285|NP19438 - NP_001333021|NP_001333020|NP_001056 2515707 57561 7132 121616 112986 - - ARRDC3 TNFRSF1A TLIMP CD120a|FPF|MS5|TBP1|TNAffinity Capture-MS physical PUBMED:29416926 Low Throughput BIOGRID Q96B67 - NP_065852 P19438 - NP_001333021|NP_001333020|NP_001056 2605716 55312 7132 120594 112986 RP11-422N19- RFK TNFRSF1A RIFK CD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:19641494 Low Throughput BIOGRID Q969G6 B2RDZ2 NP_060809 P19438 - NP_001333021|NP_001333020|NP_001056 1515735 55072 7132 120389 112986 - - RNF31 TNFRSF1A HOIP|ZIBRA CD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:26670046 Low Throughput BIOGRID Q96EP0 - NP_060469|NP19438 - NP_001333021|NP_001333020|NP_001056 1447852 51808 7132 119734 112986 - - PHAX TNFRSF1A RNUXA CD120a|FPF|MS5|TBP1|TNAffinity Capture-MS physical PUBMED:26496610 High Throughput BIOGRID Q9H814 - NP_115553 P19438 - NP_001333021|NP_001333020|NP_001056 728072 28986 7132 118807 112986 - - MAGEH1 TNFRSF1A APR-1|APR1|MAGEH CD120a|FPF|MS5|TBP1|TNReconstituted Complex physical PUBMED:21418516 Low Throughput BIOGRID Q9H213 - NP_054780 P19438 - NP_001333021|NP_001333020|NP_001056 716030 26133 7132 117569 112986 - - TRPC4AP TNFRSF1A C20orf188|PPP1R158|TRR CD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:20458742 Low Throughput BIOGRID Q8TEL6 - NP_955400|NP19438 - NP_001333021|NP_001333020|NP_001056 693348 25999 7132 117475 112986 - - CLIP3 TNFRSF1A CLIPR-59|CLIPR59|RSNL1CD120a|FPF|MS5|TBP1|TNTwo-hybrid physical PUBMED:22297296 Low Throughput BIOGRID Q96DZ5 - NP_056341|NP19438 - NP_001333021|NP_001333020|NP_001056 894572 22926 7132 116586 112986 - - ATF6 TNFRSF1A ATF6A CD120a|FPF|MS5|TBP1|TNTwo-hybrid physical PUBMED:21988832 High Throughput BIOGRID P18850 A8K383 NP_031374 P19438 - NP_001333021|NP_001333020|NP_001056 315070 11035 7132 116224 112986 - - RIPK3 TNFRSF1A RIP3 CD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:10339433 Low Throughput BIOGRID Q9Y572 - NP_006862 P19438 - NP_001333021|NP_001333020|NP_001056 894430 10935 7132 116136 112986 - - PRDX3 TNFRSF1A AOP-1|AOP1|HBC189|MERCD120a|FPF|MS5|TBP1|TNTwo-hybrid physical PUBMED:21988832 High Throughput BIOGRID P30048 - NP_00128920P19438 - NP_001333021|NP_001333020|NP_001056 957483 10617 7132 115863 112986 - - STAMBP TNFRSF1A AMSH|MICCAP CD120a|FPF|MS5|TBP1|TNBiochemical Activity physical PUBMED:24980434 Low Throughput BIOGRID O95630 - NP_006454|NP19438 - NP_001333021|NP_001333020|NP_001056 1447851 10492 7132 115755 112986 RP1-3J17.2 - SYNCRIP TNFRSF1A GRY-RBP|GRYRBP|HNRNCD120a|FPF|MS5|TBP1|TNAffinity Capture-MS physical PUBMED:26496610 High Throughput BIOGRID O60506 B7Z645|Q59GLNP_00124070P19438 - NP_001333021|NP_001333020|NP_001056 2603761 10318 7132 115602 112986 - - TNIP1 TNFRSF1A ABIN-1|NAF1|VAN|nip40- CD120a|FPF|MS5|TBP1|TNAffinity Capture-MS physical PUBMED:30561431 High Throughput BIOGRID Q15025 B7Z8K2|A8K4NNP_00123931P19438 - NP_001333021|NP_001333020|NP_001056 835936 10133 7132 115436 112986 RP11-730A19- OPTN TNFRSF1A ALS12|FIP2|GLC1E|HIP7|HCD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:22675546 Low Throughput BIOGRID Q96CV9 - NP_068815|NP19438 - NP_001333021|NP_001333020|NP_001056 2494194 9825 7132 115163 112986 - - SPATA2 TNFRSF1A PD1|PPP1R145|tamo CD120a|FPF|MS5|TBP1|TNAffinity Capture-MS physical PUBMED:27307491 High Throughput BIOGRID Q9UM82 A8K0S9|B4DIDNP_00112924P19438 - NP_001333021|NP_001333020|NP_001056 472075 9577 7132 114946 112986 - - BRE TNFRSF1A BRCC4|BRCC45 CD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:15465831 Low Throughput BIOGRID Q9NXR7 - NP_954663|NP19438 - NP_001333021|NP_001333020|NP_001056 315098 9530 7132 114906 112986 - - BAG4 TNFRSF1A BAG-4|SODD CD120a|FPF|MS5|TBP1|TNReconstituted Complex physical PUBMED:11909948 Low Throughput BIOGRID O95429 - NP_00119180P19438 - NP_001333021|NP_001333020|NP_001056 605115 9099 7132 114553 112986 - - USP2 TNFRSF1A UBP41|USP9 CD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:22179575 Low Throughput BIOGRID O75604 - NP_004196|NP19438 - NP_001333021|NP_001333020|NP_001056 957487 9025 7132 114492 112986 - - RNF8 TNFRSF1A hRNF8 CD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:24980434 Low Throughput BIOGRID O76064 - NP_898901|NP19438 - NP_001333021|NP_001333020|NP_001056 2397393 8837 7132 114364 112986 - - CFLAR TNFRSF1A CASH|CASP8AP1|CLARP CD120a|FPF|MS5|TBP1|TNPhenotypic Suppression genetic PUBMED:28494239 Low Throughput BIOGRID O15519 B4E361|A0A02NP_00118944P19438 - NP_001333021|NP_001333020|NP_001056 244349 8772 7132 114302 112986 GIG3 - FADD TNFRSF1A MORT1 CD120a|FPF|MS5|TBP1|TNCo-purification physical PUBMED:15659383 Low Throughput BIOGRID Q13158 - NP_003815 P19438 - NP_001333021|NP_001333020|NP_001056 276163 8767 7132 114300 112986 WUGSC:H_R- RIPK2 TNFRSF1A CARD3|CARDIAK|CCK|GCD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:9642260 Low Throughput BIOGRID O43353 - NP_003812 P19438 - NP_001333021|NP_001333020|NP_001056 314871 8741 7132 114278 112986 UNQ383/PRO- TNFSF13 TNFRSF1A APRIL|CD256|TALL-2|TALCD120a|FPF|MS5|TBP1|TNReconstituted Complex physical PUBMED:10706119 Low Throughput BIOGRID O75888 Q2QBA2|B3KRNP_00118555P19438 - NP_001333021|NP_001333020|NP_001056 286794 8737 7132 114274 112986 - - RIPK1 TNFRSF1A RIP|RIP1 CD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:11002422 Low Throughput BIOGRID Q13546 A0A024QZU0 NP_003795|NP19438 - NP_001333021|NP_001333020|NP_001056 315083 8717 7132 114257 112986 - - TRADD TNFRSF1A Hs.89862 CD120a|FPF|MS5|TBP1|TNTwo-hybrid physical PUBMED:8565075 Low Throughput BIOGRID Q15628 - NP_003780|NP19438 - NP_001333021|NP_001333020|NP_001056 2691935 8717 7132 114257 112986 - - TRADD TNFRSF1A Hs.89862 CD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:23429285 Low Throughput BIOGRID Q15628 - NP_003780|NP19438 - NP_001333021|NP_001333020|NP_001056 2603419 8517 7132 114089 112986 - - IKBKG TNFRSF1A AMCBX1|FIP-3|FIP3|Fip3pCD120a|FPF|MS5|TBP1|TNAffinity Capture-MS physical PUBMED:30561431 High Throughput BIOGRID Q9Y6K9 A0A087X1B1 NP_003630|NP19438 - NP_001333021|NP_001333020|NP_001056 301252 8439 7132 114019 112986 - - NSMAF TNFRSF1A FAN CD120a|FPF|MS5|TBP1|TNTwo-hybrid physical PUBMED:8808629 Low Throughput BIOGRID Q92636 - NP_003571|NP19438 - NP_001333021|NP_001333020|NP_001056 2379271 7706 7132 113500 112986 - - TRIM25 TNFRSF1A EFP|RNF147|Z147|ZNF147 CD120a|FPF|MS5|TBP1|TNAffinity Capture-RNA physical PUBMED:29117863 High Throughput BIOGRID Q14258 - NP_005073 P19438 - NP_001333021|NP_001333020|NP_001056 244348 7430 7132 113271 112986 - - EZR TNFRSF1A CVIL|CVL|HEL-S-105|VIL CD120a|FPF|MS5|TBP1|TNCo-purification physical PUBMED:15659383 Low Throughput BIOGRID P15311 - NP_003370|NP19438 - NP_001333021|NP_001333020|NP_001056 957484 7345 7132 113192 112986 - - UCHL1 TNFRSF1A HEL-117|NDGOA|PARK5|PCD120a|FPF|MS5|TBP1|TN Biochemical Activity physical PUBMED:24980434 Low Throughput BIOGRID P09936 V9HW74 NP_004172 P19438 - NP_001333021|NP_001333020|NP_001056 281461 7341 7132 113188 112986 OK/SW-cl.43 - SUMO1 TNFRSF1A DAP1|GMP1|OFC10|PIC1| CD120a|FPF|MS5|TBP1|TNTwo-hybrid physical PUBMED:8906799 Low Throughput BIOGRID P63165 A0A024R3Z2 NP_00100578P19438 - NP_001333021|NP_001333020|NP_001056 281465 7341 7132 113188 112986 OK/SW-cl.43 - SUMO1 TNFRSF1A DAP1|GMP1|OFC10|PIC1| CD120a|FPF|MS5|TBP1|TNReconstituted Complex physical PUBMED:8906799 Low Throughput BIOGRID P63165 A0A024R3Z2 NP_00100578P19438 - NP_001333021|NP_001333020|NP_001056 288392 7329 7132 113177 112986 LA16c-358B7- UBE2I TNFRSF1A C358B7.1|P18|UBC9 CD120a|FPF|MS5|TBP1|TNTwo-hybrid physical PUBMED:9563508 Low Throughput BIOGRID P63279 B0QYN7|A8K5NP_003336|NP19438 - NP_001333021|NP_001333020|NP_001056 288394 7329 7132 113177 112986 LA16c-358B7- UBE2I TNFRSF1A C358B7.1|P18|UBC9 CD120a|FPF|MS5|TBP1|TNReconstituted Complex physical PUBMED:9563508 Low Throughput BIOGRID P63279 B0QYN7|A8K5NP_003336|NP19438 - NP_001333021|NP_001333020|NP_001056 2603648 7186 7132 113038 112986 - - TRAF2 TNFRSF1A MGC:45012|TRAP|TRAP3 CD120a|FPF|MS5|TBP1|TNAffinity Capture-MS physical PUBMED:30561431 High Throughput BIOGRID Q12933 A0A024R8H5 NP_066961 P19438 - NP_001333021|NP_001333020|NP_001056 717842 7185 7132 113037 112986 - - TRAF1 TNFRSF1A EBI6|MGC:10353 CD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:19287455 Low Throughput BIOGRID Q13077 - NP_005649|NP19438 - NP_001333021|NP_001333020|NP_001056 717837 7133 7132 112987 112986 - - TNFRSF1B TNFRSF1A CD120b|TBPII|TNF-R-II|TCD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:19287455 Low Throughput BIOGRID P20333 - NP_001057 P19438 - NP_001333021|NP_001333020|NP_001056 16453 7132 5708 112986 111681 - - TNFRSF1A PSMD2 CD120a|FPF|MS5|TBP1|TNP97|RPN1|S2|TRAP2 Two-hybrid physical PUBMED:7601280 Low Throughput BIOGRID P19438 - NP_00133302Q13200 - NP_001265637|NP_001265638|NP_002799 16454 7132 5708 112986 111681 - - TNFRSF1A PSMD2 CD120a|FPF|MS5|TBP1|TNP97|RPN1|S2|TRAP2 Two-hybrid physical PUBMED:9126987 Low Throughput BIOGRID P19438 - NP_00133302Q13200 - NP_001265637|NP_001265638|NP_002799 239508 7132 7341 112986 113188 - OK/SW-cl.43TNFRSF1A SUMO1 CD120a|FPF|MS5|TBP1|TNDAP1|GMP1|OFC10|PIC1| Two-hybrid physical PUBMED:10187798 Low Throughput BIOGRID P19438 - NP_00133302P63165 A0A024R3Z2NP_001005782|NP_001005781|NP_003343 243391 7132 2177 112986 108474 - - TNFRSF1A FANCD2 CD120a|FPF|MS5|TBP1|TNFA-D2|FA4|FACD|FAD|FAAffinity Capture-MS physical PUBMED:14743216 High Throughput BIOGRID P19438 - NP_00133302Q9BXW9 A0A024R2G2NP_149075|NP_001306913|NP_001018125 243392 7132 7124 112986 112979 - DADB-70P7. TNFRSF1A TNF CD120a|FPF|MS5|TBP1|TNDIF|TNF-alpha|TNFA|TNFAffinity Capture-MS physical PUBMED:14743216 High Throughput BIOGRID P19438 - NP_00133302P01375 Q5STB3 NP_000585 244296 7132 8795 112986 114323 - UNQ160/PROTNFRSF1A TNFRSF10B CD120a|FPF|MS5|TBP1|TNCD262|DR5|KILLER|KILL Co-purification physical PUBMED:15659383 Low Throughput BIOGRID P19438 - NP_00133302O14763 Q7Z2I8 NP_671716|NP_003833 253299 7132 26133 112986 117569 - - TNFRSF1A TRPC4AP CD120a|FPF|MS5|TBP1|TNC20orf188|PPP1R158|TRR Affinity Capture-Western physical PUBMED:14585990 Low Throughput BIOGRID P19438 - NP_00133302Q8TEL6 - NP_955400|NP_056453 253300 7132 26133 112986 117569 - - TNFRSF1A TRPC4AP CD120a|FPF|MS5|TBP1|TNC20orf188|PPP1R158|TRR Reconstituted Complex physical PUBMED:14585990 Low Throughput BIOGRID P19438 - NP_00133302Q8TEL6 - NP_955400|NP_056453 275674 7132 8915 112986 114429 - RP11-234D19TNFRSF1A BCL10 CD120a|FPF|MS5|TBP1|TNCARMEN|CIPER|CLAP|IMTwo-hybrid physical PUBMED:10400625 Low Throughput BIOGRID P19438 - NP_00133302O95999 - NP_001307644|NP_003912 275962 7132 10131 112986 115435 - - TNFRSF1A TRAP1 CD120a|FPF|MS5|TBP1|TNHSP 75|HSP75|HSP90L|TRReconstituted Complex physical PUBMED:7876093 Low Throughput BIOGRID P19438 - NP_00133302Q12931 Q53FS6 NP_001258978|NP_057376 NP_116756|NP_001221|NP_116758|NP_11675 276095 7132 843 112986 107293 - - TNFRSF1A CASP10 CD120a|FPF|MS5|TBP1|TNALPS2|FLICE2|MCH4 Affinity Capture-Western physical PUBMED:9045686 Low Throughput BIOGRID P19438 - NP_00133302Q92851 - 9|NP 001193453|NP 001193471 277760 7132 4049 112986 110227 - DAMA-25N1 TNFRSF1A LTA CD120a|FPF|MS5|TBP1|TNLT|TNFB|TNFSF1 Co-crystal Structure physical PUBMED:8387891 Low Throughput BIOGRID P19438 - NP_00133302P01374 Q5STV3 NP_000586|NP_001153212 279673 7132 9530 112986 114906 - - TNFRSF1A BAG4 CD120a|FPF|MS5|TBP1|TNBAG-4|SODD Affinity Capture-Western physical PUBMED:9915703 Low Throughput BIOGRID P19438 - NP_00133302O95429 - NP_001191807|NP_004865 279675 7132 8717 112986 114257 - - TNFRSF1A TRADD CD120a|FPF|MS5|TBP1|TNHs.89862 Affinity Capture-Western physical PUBMED:9915703 Low Throughput BIOGRID P19438 - NP_00133302Q15628 - NP_003780|NP_001310481 NP_001308784|NP_001308785|NP_001308786| 280037 7132 3716 112986 109919 - - TNFRSF1A JAK1 CD120a|FPF|MS5|TBP1|TNJAK1A|JAK1B|JTK3 Reconstituted Complex physical PUBMED:9510175 Low Throughput BIOGRID P19438 - NP_00133302P23458 - NP_001308781|NP_001308782|NP_001308783| NP 001307852|NP 002218 NP_001309123|NP_001309133|NP_004963|NP 280038 7132 3717 112986 109920 - - TNFRSF1A JAK2 CD120a|FPF|MS5|TBP1|TNJTK10|THCYT3 Reconstituted Complex physical PUBMED:9510175 Low Throughput BIOGRID P19438 - NP_00133302O60674 - _001309125|NP_001309124 NP_001309123|NP_001309133|NP_004963|NP 280039 7132 3717 112986 109920 - - TNFRSF1A JAK2 CD120a|FPF|MS5|TBP1|TNJTK10|THCYT3 Affinity Capture-Western physical PUBMED:9510175 Low Throughput BIOGRID P19438 - NP_00133302O60674 - 001309125|NP 001309124 281731 7132 6772 112986 112649 - - TNFRSF1A STAT1 CD120a|FPF|MS5|TBP1|TNCANDF7|IMD31A|IMD31BAffinity Capture-Western physical PUBMED:10848577 Low Throughput BIOGRID P19438 - NP_00133302P42224 - NP_644671|NP_009330 NP_001275659|NP_004929|NP_001275660|NP 283187 7132 1612 112986 107982 - - TNFRSF1A DAPK1 CD120a|FPF|MS5|TBP1|TNDAPK Affinity Capture-Western physical PUBMED:12911633 Low Throughput BIOGRID P19438 - NP_00133302P53355 Q59H88|B4DH 001275658 NP_003630|NP_001138727|NP_001308326|NP 283272 7132 8517 112986 114089 - - TNFRSF1A IKBKG CD120a|FPF|MS5|TBP1|TNAMCBX1|FIP-3|FIP3|Fip3pAffinity Capture-Western physical PUBMED:10755617 Low Throughput BIOGRID P19438 - NP_00133302Q9Y6K9 A0A087X1B1 _001308325|NP_001093327|NP_001093326 286741 7132 8717 112986 114257 - - TNFRSF1A TRADD CD120a|FPF|MS5|TBP1|TNHs.89862 Affinity Capture-Western physical PUBMED:10187805 Low Throughput BIOGRID P19438 - NP_00133302Q15628 - NP_003780|NP_001310481 289131 7132 7132 112986 112986 - - TNFRSF1A TNFRSF1A CD120a|FPF|MS5|TBP1|TNCD120a|FPF|MS5|TBP1|TNTwo-hybrid physical PUBMED:8077196 Low Throughput BIOGRID P19438 - NP_00133302P19438 - NP_001333021|NP_001333020|NP_001056 297437 7132 8717 112986 114257 - - TNFRSF1A TRADD CD120a|FPF|MS5|TBP1|TNHs.89862 Affinity Capture-Western physical PUBMED:9082980 Low Throughput BIOGRID P19438 - NP_00133302Q15628 - NP_003780|NP_001310481 301253 7132 8439 112986 114019 - - TNFRSF1A NSMAF CD120a|FPF|MS5|TBP1|TNFAN Affinity Capture-Western physical PUBMED:8808629 Low Throughput BIOGRID P19438 - NP_00133302Q92636 - NP_003571|NP_001138244 304431 7132 3551 112986 109767 - - TNFRSF1A IKBKB CD120a|FPF|MS5|TBP1|TNIKK-beta|IKK2|IKKB|IMD Biochemical Activity physical PUBMED:11002417 Low Throughput BIOGRID P19438 - NP_00133302O14920 - NP_001547|NP_001177649|NP_001229707 NP_001263241|NP_001263240|NP_001263236| 305107 7132 8996 112986 114477 - - TNFRSF1A NOL3 CD120a|FPF|MS5|TBP1|TNARC|FCM|MYP|NOP|NOPPhenotypic Suppression genetic PUBMED:9560245 Low Throughput BIOGRID P19438 - NP_00133302O60936 Q5TZN6 NP_001263238|NP_001263248|NP_001171986| NP 001171987|NP 003937 314394 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:8985253 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 314395 7132 8738 112986 114275 - - TNFRSF1A CRADD CD120a|FPF|MS5|TBP1|TNMRT34|RAIDD Affinity Capture-Western physical PUBMED:8985253 Low Throughput BIOGRID P19438 - NP_00133302P78560 F5H7C2|Q53XNP_003796 314396 7132 835 112986 107285 - - TNFRSF1A CASP2 CD120a|FPF|MS5|TBP1|TNCASP-2|ICH1|NEDD-2|NE Affinity Capture-Western physical PUBMED:8985253 Low Throughput BIOGRID P19438 - NP_00133302P42575 A0A087WYMNP_116765|NP_116764|NP_001215 NP_001129416|NP_001129415|NP_569830|NP 315071 7132 8567 112986 114136 - - TNFRSF1A MADD CD120a|FPF|MS5|TBP1|TNDENN|IG20|RAB3GEP Reconstituted Complex physical PUBMED:9115275 Low Throughput BIOGRID P19438 - NP_00133302Q8WXG6 - _569828|NP_569829|NP_569832|NP_569831|N P 569827|NP 003673|NP 569826 315079 7132 8717 112986 114257 - - TNFRSF1A TRADD CD120a|FPF|MS5|TBP1|TNHs.89862 Affinity Capture-Western physical PUBMED:8612133 Low Throughput BIOGRID P19438 - NP_00133302Q15628 - NP_003780|NP_001310481 315080 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:8612133 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 315081 7132 7186 112986 113038 - - TNFRSF1A TRAF2 CD120a|FPF|MS5|TBP1|TNMGC:45012|TRAP|TRAP3 Affinity Capture-Western physical PUBMED:8612133 Low Throughput BIOGRID P19438 - NP_00133302Q12933 A0A024R8H5NP_066961 315082 7132 8717 112986 114257 - - TNFRSF1A TRADD CD120a|FPF|MS5|TBP1|TNHs.89862 Affinity Capture-Western physical PUBMED:8565075 Low Throughput BIOGRID P19438 - NP_00133302Q15628 - NP_003780|NP_001310481 315089 7132 7185 112986 113037 - - TNFRSF1A TRAF1 CD120a|FPF|MS5|TBP1|TNEBI6|MGC:10353 Affinity Capture-Western physical PUBMED:8565075 Low Throughput BIOGRID P19438 - NP_00133302Q13077 - NP_005649|NP_001177876|NP_001177874 315090 7132 7186 112986 113038 - - TNFRSF1A TRAF2 CD120a|FPF|MS5|TBP1|TNMGC:45012|TRAP|TRAP3 Affinity Capture-Western physical PUBMED:8565075 Low Throughput BIOGRID P19438 - NP_00133302Q12933 A0A024R8H5NP_066961 315091 7132 8772 112986 114302 - GIG3 TNFRSF1A FADD CD120a|FPF|MS5|TBP1|TNMORT1 Affinity Capture-Western physical PUBMED:8565075 Low Throughput BIOGRID P19438 - NP_00133302Q13158 - NP_003815 315092 7132 7132 112986 112986 - - TNFRSF1A TNFRSF1A CD120a|FPF|MS5|TBP1|TNCD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:10875917 Low Throughput BIOGRID P19438 - NP_00133302P19438 - NP_001333021|NP_001333020|NP_001056 315095 7132 7132 112986 112986 - - TNFRSF1A TNFRSF1A CD120a|FPF|MS5|TBP1|TNCD120a|FPF|MS5|TBP1|TNFRET physical PUBMED:10875917 Low Throughput BIOGRID P19438 - NP_00133302P19438 - NP_001333021|NP_001333020|NP_001056 315099 7132 3312 112986 109544 - - TNFRSF1A HSPA8 CD120a|FPF|MS5|TBP1|TNHEL-33|HEL-S-72p|HSC54 Reconstituted Complex physical PUBMED:11909948 Low Throughput BIOGRID P19438 - NP_00133302P11142 V9HW22|Q53NP_694881|NP_006588 315101 7132 5708 112986 111681 - - TNFRSF1A PSMD2 CD120a|FPF|MS5|TBP1|TNP97|RPN1|S2|TRAP2 Reconstituted Complex physical PUBMED:7601280 Low Throughput BIOGRID P19438 - NP_00133302Q13200 - NP_001265637|NP_001265638|NP_002799 315102 7132 8396 112986 113985 - - TNFRSF1A PIP4K2B CD120a|FPF|MS5|TBP1|TNPI5P4KB|PIP5K2B|PIP5KITwo-hybrid physical PUBMED:9038203 Low Throughput BIOGRID P19438 - NP_00133302P78356 - NP_003550 315103 7132 8396 112986 113985 - - TNFRSF1A PIP4K2B CD120a|FPF|MS5|TBP1|TNPI5P4KB|PIP5K2B|PIP5KIReconstituted Complex physical PUBMED:9038203 Low Throughput BIOGRID P19438 - NP_00133302P78356 - NP_003550 315104 7132 8396 112986 113985 - - TNFRSF1A PIP4K2B CD120a|FPF|MS5|TBP1|TNPI5P4KB|PIP5K2B|PIP5KIAffinity Capture-Western physical PUBMED:9038203 Low Throughput BIOGRID P19438 - NP_00133302P78356 - NP_003550 315644 7132 8717 112986 114257 - - TNFRSF1A TRADD CD120a|FPF|MS5|TBP1|TNHs.89862 Affinity Capture-Western physical PUBMED:8943045 Low Throughput BIOGRID P19438 - NP_00133302Q15628 - NP_003780|NP_001310481 315645 7132 7186 112986 113038 - - TNFRSF1A TRAF2 CD120a|FPF|MS5|TBP1|TNMGC:45012|TRAP|TRAP3 Affinity Capture-Western physical PUBMED:8943045 Low Throughput BIOGRID P19438 - NP_00133302Q12933 A0A024R8H5NP_066961 315646 7132 329 112986 106826 - - TNFRSF1A BIRC2 CD120a|FPF|MS5|TBP1|TNAPI1|HIAP2|Hiap-2|MIHB| Affinity Capture-Western physical PUBMED:8943045 Low Throughput BIOGRID P19438 - NP_00133302Q13490 - NP_001243092|NP_001157|NP_001243095 NP_001308784|NP_001308785|NP_001308786| 317800 7132 3716 112986 109919 - - TNFRSF1A JAK1 CD120a|FPF|MS5|TBP1|TNJAK1A|JAK1B|JTK3 Affinity Capture-Western physical PUBMED:11801527 Low Throughput BIOGRID P19438 - NP_00133302P23458 - NP_001308781|NP_001308782|NP_001308783| NP 001307852|NP 002218 321809 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:18939944 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 321810 7132 8717 112986 114257 - - TNFRSF1A TRADD CD120a|FPF|MS5|TBP1|TNHs.89862 Affinity Capture-Western physical PUBMED:18939944 Low Throughput BIOGRID P19438 - NP_00133302Q15628 - NP_003780|NP_001310481 321811 7132 330 112986 106827 - - TNFRSF1A BIRC3 CD120a|FPF|MS5|TBP1|TNAIP1|API2|CIAP2|HAIP1|HAffinity Capture-Western physical PUBMED:18939944 Low Throughput BIOGRID P19438 - NP_00133302Q13489 - NP_892007|NP_001156 327584 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:18724939 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 327968 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:18621737 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 429341 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:16968706 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 NP_954663|NP_001248769|NP_001316043|NP 472077 7132 9577 112986 114946 - - TNFRSF1A BRE CD120a|FPF|MS5|TBP1|TNBRCC4|BRCC45 Affinity Capture-Western physical PUBMED:15465831 Low Throughput BIOGRID P19438 - NP_00133302Q9NXR7 - _001316044|NP_954664|NP_004890|NP_95466 2|NP_001316041|NP_001316042|NP_954661 504439 7132 2534 112986 108810 - RP1-66H14.1 TNFRSF1A FYN CD120a|FPF|MS5|TBP1|TNSLK|SYN|p59-FYN Co-fractionation physical PUBMED:12753742 Low Throughput BIOGRID P19438 - NP_00133302P06241 - NP_002028|NP_694593|NP_694592 NP_001744|NP_001166368|NP_001166366|NP 504440 7132 857 112986 107305 - - TNFRSF1A CAV1 CD120a|FPF|MS5|TBP1|TNBSCL3|CGL3|LCCNS|MSTCo-fractionation physical PUBMED:12753742 Low Throughput BIOGRID P19438 - NP_00133302Q03135 A0A024R757 001166367 559786 7132 330 112986 106827 - - TNFRSF1A BIRC3 CD120a|FPF|MS5|TBP1|TNAIP1|API2|CIAP2|HAIP1|HAffinity Capture-Western physical PUBMED:19815541 Low Throughput BIOGRID P19438 - NP_00133302Q13489 - NP_892007|NP_001156 559787 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:19815541 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 559788 7132 7186 112986 113038 - - TNFRSF1A TRAF2 CD120a|FPF|MS5|TBP1|TNMGC:45012|TRAP|TRAP3 Affinity Capture-Western physical PUBMED:19815541 Low Throughput BIOGRID P19438 - NP_00133302Q12933 A0A024R8H5NP_066961 559789 7132 329 112986 106826 - - TNFRSF1A BIRC2 CD120a|FPF|MS5|TBP1|TNAPI1|HIAP2|Hiap-2|MIHB| Affinity Capture-Western physical PUBMED:19815541 Low Throughput BIOGRID P19438 - NP_00133302Q13490 - NP_001243092|NP_001157|NP_001243095 563909 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:21113135 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 568075 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:20825417 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 568838 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:19773432 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 591383 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:21737329 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 605116 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:22179575 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 605117 7132 7186 112986 113038 - - TNFRSF1A TRAF2 CD120a|FPF|MS5|TBP1|TNMGC:45012|TRAP|TRAP3 Affinity Capture-Western physical PUBMED:22179575 Low Throughput BIOGRID P19438 - NP_00133302Q12933 A0A024R8H5NP_066961 605118 7132 9099 112986 114553 - - TNFRSF1A USP2 CD120a|FPF|MS5|TBP1|TNUBP41|USP9 Affinity Capture-Western physical PUBMED:22179575 Low Throughput BIOGRID P19438 - NP_00133302O75604 - NP_004196|NP_741994|NP_001230688 607609 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:20448643 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 607610 7132 7186 112986 113038 - - TNFRSF1A TRAF2 CD120a|FPF|MS5|TBP1|TNMGC:45012|TRAP|TRAP3 Affinity Capture-Western physical PUBMED:20448643 Low Throughput BIOGRID P19438 - NP_00133302Q12933 A0A024R8H5NP_066961 607611 7132 7128 112986 112983 - RP11-356I2.3TNFRSF1A TNFAIP3 CD120a|FPF|MS5|TBP1|TNA20|OTUD7C|TNFA1P2 Affinity Capture-Western physical PUBMED:20448643 Low Throughput BIOGRID P19438 - NP_00133302P21580 - NP_001257437|NP_001257436|NP_006281 670632 7132 6714 112986 112592 - RP5-823N20. TNFRSF1A SRC CD120a|FPF|MS5|TBP1|TNASV|SRC1|c-SRC|p60-Src Affinity Capture-Western physical PUBMED:15707590 Low Throughput BIOGRID P19438 - NP_00133302P12931 - NP_938033|NP_005408 670633 7132 867 112986 107315 - - TNFRSF1A CBL CD120a|FPF|MS5|TBP1|TNC-CBL|CBL2|FRA11B|NSLAffinity Capture-Western physical PUBMED:15707590 Low Throughput BIOGRID P19438 - NP_00133302P22681 - NP_005179 670634 7132 5290 112986 111308 - - TNFRSF1A PIK3CA CD120a|FPF|MS5|TBP1|TNCLOVE|CWS5|MCAP|MCMAffinity Capture-Western physical PUBMED:15707590 Low Throughput BIOGRID P19438 - NP_00133302P42336 - NP_006209 670640 7132 30011 112986 119029 - RP11-345L8. TNFRSF1A SH3KBP1 CD120a|FPF|MS5|TBP1|TNCD2BP3|CIN85|GIG10|HSBAffinity Capture-Western physical PUBMED:15707590 Low Throughput BIOGRID P19438 - NP_00133302Q96B97 Q5JPT6 NP_001171889|NP_114098|NP_001019837 NP_001191216|NP_001191217|NP_001191214| NP_001191215|NP_002447|NP_001191223|NP _001191222|NP_001191221|NP_001191220|NP 677061 7132 4582 112986 110669 - RP11-263K19TNFRSF1A MUC1 CD120a|FPF|MS5|TBP1|TNADMCKD|ADMCKD1|CA Affinity Capture-Western physical PUBMED:18037881 Low Throughput BIOGRID P19438 - NP_00133302P15941 A0A087X2A4_001191224|NP_001191226|NP_001191225|NP _001191219|NP_001191218|NP_001037858|NP _001037857|NP_001037856|NP_001037855|NP _001018017|NP_001018016 NP_663306|NP_003179|NP_663304|NP_66330 677062 7132 6885 112986 112748 - RP1-154G14. TNFRSF1A MAP3K7 CD120a|FPF|MS5|TBP1|TNMEKK7|TAK1|TGF1a Affinity Capture-Western physical PUBMED:18037881 Low Throughput BIOGRID P19438 - NP_00133302O43318 - 5 679350 7132 8717 112986 114257 - - TNFRSF1A TRADD CD120a|FPF|MS5|TBP1|TNHs.89862 Affinity Capture-Western physical PUBMED:18776134 Low Throughput BIOGRID P19438 - NP_00133302Q15628 - NP_003780|NP_001310481 679352 7132 7186 112986 113038 - - TNFRSF1A TRAF2 CD120a|FPF|MS5|TBP1|TNMGC:45012|TRAP|TRAP3 Affinity Capture-Western physical PUBMED:18776134 Low Throughput BIOGRID P19438 - NP_00133302Q12933 A0A024R8H5NP_066961 682435 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:22733818 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 683480 7132 7375 112986 113221 - - TNFRSF1A USP4 CD120a|FPF|MS5|TBP1|TNUNP|Unph Affinity Capture-Western physical PUBMED:21331078 Low Throughput BIOGRID P19438 - NP_00133302Q13107 A0A024R2X6NP_003354|NP_001238806|NP_955475 NP_663306|NP_003179|NP_663304|NP_66330 683481 7132 6885 112986 112748 - RP1-154G14. TNFRSF1A MAP3K7 CD120a|FPF|MS5|TBP1|TNMEKK7|TAK1|TGF1a Affinity Capture-Western physical PUBMED:21331078 Low Throughput BIOGRID P19438 - NP_00133302O43318 - 5 683482 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:21331078 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 683484 7132 3551 112986 109767 - - TNFRSF1A IKBKB CD120a|FPF|MS5|TBP1|TNIKK-beta|IKK2|IKKB|IMD Affinity Capture-Western physical PUBMED:21331078 Low Throughput BIOGRID P19438 - NP_00133302O14920 - NP_001547|NP_001177649|NP_001229707 685188 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:16115877 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 NP_663306|NP_003179|NP_663304|NP_66330 685190 7132 6885 112986 112748 - RP1-154G14. TNFRSF1A MAP3K7 CD120a|FPF|MS5|TBP1|TNMEKK7|TAK1|TGF1a Affinity Capture-Western physical PUBMED:16115877 Low Throughput BIOGRID P19438 - NP_00133302O43318 - 5 692879 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:22848449 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 693350 7132 25999 112986 117475 - - TNFRSF1A CLIP3 CD120a|FPF|MS5|TBP1|TNCLIPR-59|CLIPR59|RSNL Affinity Capture-Western physical PUBMED:22297296 Low Throughput BIOGRID P19438 - NP_00133302Q96DZ5 - NP_056341|NP_001186499 693351 7132 8717 112986 114257 - - TNFRSF1A TRADD CD120a|FPF|MS5|TBP1|TNHs.89862 Affinity Capture-Western physical PUBMED:22297296 Low Throughput BIOGRID P19438 - NP_00133302Q15628 - NP_003780|NP_001310481 NP_663777|NP_003291|NP_001186356|NP_66 696920 7132 7187 112986 113039 - - TNFRSF1A TRAF3 CD120a|FPF|MS5|TBP1|TNCAP-1|CAP1|CD40bp|CRAReconstituted Complex physical PUBMED:7859281 Low Throughput BIOGRID P19438 - NP_00133302Q13114 A6NHG8 3778 696922 7132 7185 112986 113037 - - TNFRSF1A TRAF1 CD120a|FPF|MS5|TBP1|TNEBI6|MGC:10353 Reconstituted Complex physical PUBMED:7859281 Low Throughput BIOGRID P19438 - NP_00133302Q13077 - NP_005649|NP_001177876|NP_001177874 696974 7132 7186 112986 113038 - - TNFRSF1A TRAF2 CD120a|FPF|MS5|TBP1|TNMGC:45012|TRAP|TRAP3 Affinity Capture-Western physical PUBMED:11821416 Low Throughput BIOGRID P19438 - NP_00133302Q12933 A0A024R8H5NP_066961 696975 7132 8717 112986 114257 - - TNFRSF1A TRADD CD120a|FPF|MS5|TBP1|TNHs.89862 Affinity Capture-Western physical PUBMED:11821416 Low Throughput BIOGRID P19438 - NP_00133302Q15628 - NP_003780|NP_001310481 696976 7132 951475 112986 1205534 - HCVgp1 TNFRSF1A HCVgp1 CD120a|FPF|MS5|TBP1|TN- Affinity Capture-Western physical PUBMED:11821416 Low Throughput BIOGRID P19438 - NP_00133302- - NP_671491 696977 7132 3551 112986 109767 - - TNFRSF1A IKBKB CD120a|FPF|MS5|TBP1|TNIKK-beta|IKK2|IKKB|IMD Affinity Capture-Western physical PUBMED:11821416 Low Throughput BIOGRID P19438 - NP_00133302O14920 - NP_001547|NP_001177649|NP_001229707 716027 7132 7220 112986 113071 - - TNFRSF1A TRPC1 CD120a|FPF|MS5|TBP1|TNHTRP-1|TRP1 Affinity Capture-Western physical PUBMED:20458742 Low Throughput BIOGRID P19438 - NP_00133302P48995 - NP_003295|NP_001238774 NP_001129427|NP_001129428|NP_001129429| 716028 7132 7223 112986 113074 - RP11-10M8.1TNFRSF1A TRPC4 CD120a|FPF|MS5|TBP1|TNHTRP-4|HTRP4|TRP4 Affinity Capture-Western physical PUBMED:20458742 Low Throughput BIOGRID P19438 - NP_00133302Q9UBN4 Q3KR50 NP 057263|NP 003297|NP 001129430 716029 7132 7224 112986 113075 - RP1-68D15.2 TNFRSF1A TRPC5 CD120a|FPF|MS5|TBP1|TNPPP1R159|TRP5 Affinity Capture-Western physical PUBMED:20458742 Low Throughput BIOGRID P19438 - NP_00133302Q9UL62 - NP_036603 716225 7132 7186 112986 113038 - - TNFRSF1A TRAF2 CD120a|FPF|MS5|TBP1|TNMGC:45012|TRAP|TRAP3 Affinity Capture-Western physical PUBMED:20333651 Low Throughput BIOGRID P19438 - NP_00133302Q12933 A0A024R8H5NP_066961 716353 7132 8717 112986 114257 - - TNFRSF1A TRADD CD120a|FPF|MS5|TBP1|TNHs.89862 Affinity Capture-Western physical PUBMED:21724995 Low Throughput BIOGRID P19438 - NP_00133302Q15628 - NP_003780|NP_001310481 716928 7132 1147 112986 107569 - - TNFRSF1A CHUK CD120a|FPF|MS5|TBP1|TNIKBKA|IKK-alpha|IKK1|IKAffinity Capture-Western physical PUBMED:21724995 Low Throughput BIOGRID P19438 - NP_00133302O15111 - NP_001269|NP_001307857 716929 7132 3551 112986 109767 - - TNFRSF1A IKBKB CD120a|FPF|MS5|TBP1|TNIKK-beta|IKK2|IKKB|IMD Affinity Capture-Western physical PUBMED:21724995 Low Throughput BIOGRID P19438 - NP_00133302O14920 - NP_001547|NP_001177649|NP_001229707 716930 7132 3551 112986 109767 - - TNFRSF1A IKBKB CD120a|FPF|MS5|TBP1|TNIKK-beta|IKK2|IKKB|IMD Reconstituted Complex physical PUBMED:21724995 Low Throughput BIOGRID P19438 - NP_00133302O14920 - NP_001547|NP_001177649|NP_001229707 717169 7132 2885 112986 109142 - - TNFRSF1A GRB2 CD120a|FPF|MS5|TBP1|TNASH|EGFRBP-GRB2|Grb3 Affinity Capture-Western physical PUBMED:19289468 Low Throughput BIOGRID P19438 - NP_00133302P62993 B0LPF3 NP_002077|NP_987102 717170 7132 6654 112986 112537 - - TNFRSF1A SOS1 CD120a|FPF|MS5|TBP1|TNGF1|GGF1|GINGF|HGF|NSAffinity Capture-Western physical PUBMED:19289468 Low Throughput BIOGRID P19438 - NP_00133302Q07889 G5E9C8 NP_005624 718005 7132 8717 112986 114257 - - TNFRSF1A TRADD CD120a|FPF|MS5|TBP1|TNHs.89862 Two-hybrid physical PUBMED:7758105 Low Throughput BIOGRID P19438 - NP_00133302Q15628 - NP_003780|NP_001310481 718016 7132 7186 112986 113038 - - TNFRSF1A TRAF2 CD120a|FPF|MS5|TBP1|TNMGC:45012|TRAP|TRAP3 Affinity Capture-Western physical PUBMED:15743837 Low Throughput BIOGRID P19438 - NP_00133302Q12933 A0A024R8H5NP_066961 718895 7132 8717 112986 114257 - - TNFRSF1A TRADD CD120a|FPF|MS5|TBP1|TNHs.89862 Affinity Capture-Western physical PUBMED:11035039 Low Throughput BIOGRID P19438 - NP_00133302Q15628 - NP_003780|NP_001310481 718898 7132 8772 112986 114302 - GIG3 TNFRSF1A FADD CD120a|FPF|MS5|TBP1|TNMORT1 Affinity Capture-Western physical PUBMED:11035039 Low Throughput BIOGRID P19438 - NP_00133302Q13158 - NP_003815 718901 7132 22029 112986 204302 - RP23-9N11.6 TNFRSF1A Traf1 CD120a|FPF|MS5|TBP1|TN4732496E14Rik Affinity Capture-Western physical PUBMED:11035039 Low Throughput BIOGRID P19438 - NP_00133302P39428 - NP_033447 719531 7132 153090 112986 127478 - RP11-298A17TNFRSF1A DAB2IP CD120a|FPF|MS5|TBP1|TNAF9Q34|AIP-1|AIP1|DIP1/Affinity Capture-Western physical PUBMED:15310755 Low Throughput BIOGRID P19438 - NP_00133302Q5VWQ8 - NP_619723|NP_115941 NP_001135441|NP_001341|NP_001241646|NP 721289 7132 1616 112986 107985 - DADB-159G1TNFRSF1A DAXX CD120a|FPF|MS5|TBP1|TNBING2|DAP6|EAP1 Two-hybrid physical PUBMED:9215629 Low Throughput BIOGRID P19438 - NP_00133302Q9UER7 Q53F85|A0A0 _001135442 NP_001135441|NP_001341|NP_001241646|NP 721292 7132 1616 112986 107985 - DADB-159G1TNFRSF1A DAXX CD120a|FPF|MS5|TBP1|TNBING2|DAP6|EAP1 Reconstituted Complex physical PUBMED:9215629 Low Throughput BIOGRID P19438 - NP_00133302Q9UER7 Q53F85|A0A0 _001135442 NP_663306|NP_003179|NP_663304|NP_66330 823033 7132 6885 112986 112748 - RP1-154G14. TNFRSF1A MAP3K7 CD120a|FPF|MS5|TBP1|TNMEKK7|TAK1|TGF1a Affinity Capture-Western physical PUBMED:16260783 Low Throughput BIOGRID P19438 - NP_00133302O43318 - 5 824577 7132 5579 112986 111565 - - TNFRSF1A PRKCB CD120a|FPF|MS5|TBP1|TNPKC-beta|PKCB|PRKCB1|PAffinity Capture-Western physical PUBMED:11078718 Low Throughput BIOGRID P19438 - NP_00133302P05771 - NP_997700|NP_002729 824579 7132 5580 112986 111566 - - TNFRSF1A PRKCD CD120a|FPF|MS5|TBP1|TNALPS3|CVID9|MAY1|PKCAffinity Capture-Western physical PUBMED:11078718 Low Throughput BIOGRID P19438 - NP_00133302Q05655 A0A024R328 NP_997704|NP_001303256|NP_006245 827362 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:16611992 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 827363 7132 8717 112986 114257 - - TNFRSF1A TRADD CD120a|FPF|MS5|TBP1|TNHs.89862 Affinity Capture-Western physical PUBMED:16611992 Low Throughput BIOGRID P19438 - NP_00133302Q15628 - NP_003780|NP_001310481 827364 7132 7186 112986 113038 - - TNFRSF1A TRAF2 CD120a|FPF|MS5|TBP1|TNMGC:45012|TRAP|TRAP3 Affinity Capture-Western physical PUBMED:16611992 Low Throughput BIOGRID P19438 - NP_00133302Q12933 A0A024R8H5NP_066961 827365 7132 8772 112986 114302 - GIG3 TNFRSF1A FADD CD120a|FPF|MS5|TBP1|TNMORT1 Affinity Capture-Western physical PUBMED:16611992 Low Throughput BIOGRID P19438 - NP_00133302Q13158 - NP_003815 832525 7132 329 112986 106826 - - TNFRSF1A BIRC2 CD120a|FPF|MS5|TBP1|TNAPI1|HIAP2|Hiap-2|MIHB| Affinity Capture-Western physical PUBMED:18022363 Low Throughput BIOGRID P19438 - NP_00133302Q13490 - NP_001243092|NP_001157|NP_001243095 832526 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:18022363 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 832527 7132 7186 112986 113038 - - TNFRSF1A TRAF2 CD120a|FPF|MS5|TBP1|TNMGC:45012|TRAP|TRAP3 Affinity Capture-Western physical PUBMED:18022363 Low Throughput BIOGRID P19438 - NP_00133302Q12933 A0A024R8H5NP_066961 NP_001309123|NP_001309133|NP_004963|NP 856675 7132 3717 112986 109920 - - TNFRSF1A JAK2 CD120a|FPF|MS5|TBP1|TNJTK10|THCYT3 Affinity Capture-Western physical PUBMED:18606683 Low Throughput BIOGRID P19438 - NP_00133302O60674 - _001309125|NP_001309124 856676 7132 6714 112986 112592 - RP5-823N20. TNFRSF1A SRC CD120a|FPF|MS5|TBP1|TNASV|SRC1|c-SRC|p60-Src Affinity Capture-Western physical PUBMED:18606683 Low Throughput BIOGRID P19438 - NP_00133302P12931 - NP_938033|NP_005408 NP_852665|NP_852664|NP_001229395|NP_85 856678 7132 5295 112986 111313 - - TNFRSF1A PIK3R1 CD120a|FPF|MS5|TBP1|TNAGM7|GRB1|IMD36|p85|p Affinity Capture-Western physical PUBMED:18606683 Low Throughput BIOGRID P19438 - NP_00133302P27986 - 2556 856679 7132 10657 112986 115900 - - TNFRSF1A KHDRBS1 CD120a|FPF|MS5|TBP1|TNSam68|p62|p68 Affinity Capture-Western physical PUBMED:18606683 Low Throughput BIOGRID P19438 - NP_00133302Q07666 - NP_006550|NP_001258807 NP_663306|NP_003179|NP_663304|NP_66330 858496 7132 6885 112986 112748 - RP1-154G14. TNFRSF1A MAP3K7 CD120a|FPF|MS5|TBP1|TNMEKK7|TAK1|TGF1a Affinity Capture-Western physical PUBMED:18949366 Low Throughput BIOGRID P19438 - NP_00133302O43318 - 5 858497 7132 3551 112986 109767 - - TNFRSF1A IKBKB CD120a|FPF|MS5|TBP1|TNIKK-beta|IKK2|IKKB|IMD Affinity Capture-Western physical PUBMED:18949366 Low Throughput BIOGRID P19438 - NP_00133302O14920 - NP_001547|NP_001177649|NP_001229707 858498 7132 1147 112986 107569 - - TNFRSF1A CHUK CD120a|FPF|MS5|TBP1|TNIKBKA|IKK-alpha|IKK1|IKAffinity Capture-Western physical PUBMED:18949366 Low Throughput BIOGRID P19438 - NP_00133302O15111 - NP_001269|NP_001307857 858499 7132 5499 112986 111493 - - TNFRSF1A PPP1CA CD120a|FPF|MS5|TBP1|TNPP-1A|PP1A|PP1alpha|PPPAffinity Capture-Western physical PUBMED:18949366 Low Throughput BIOGRID P19438 - NP_00133302P62136 - NP_001008709|NP_996756|NP_002699 858500 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:18949366 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 860256 7132 7124 112986 112979 - DADB-70P7. TNFRSF1A TNF CD120a|FPF|MS5|TBP1|TNDIF|TNF-alpha|TNFA|TNFFar Western physical PUBMED:2170559 Low Throughput BIOGRID P19438 - NP_00133302P01375 Q5STB3 NP_000585 884980 7132 7124 112986 112979 - DADB-70P7. TNFRSF1A TNF CD120a|FPF|MS5|TBP1|TNDIF|TNF-alpha|TNFA|TNFReconstituted Complex physical PUBMED:8288897 Low Throughput BIOGRID P19438 - NP_00133302P01375 Q5STB3 NP_000585 884981 7132 4049 112986 110227 - DAMA-25N1 TNFRSF1A LTA CD120a|FPF|MS5|TBP1|TNLT|TNFB|TNFSF1 Reconstituted Complex physical PUBMED:8288897 Low Throughput BIOGRID P19438 - NP_00133302P01374 Q5STV3 NP_000586|NP_001153212 894179 7132 7132 112986 112986 - - TNFRSF1A TNFRSF1A CD120a|FPF|MS5|TBP1|TNCD120a|FPF|MS5|TBP1|TNTwo-hybrid physical PUBMED:21988832 High Throughput BIOGRID P19438 - NP_00133302P19438 - NP_001333021|NP_001333020|NP_001056 894719 7132 29979 112986 119007 - - TNFRSF1A UBQLN1 CD120a|FPF|MS5|TBP1|TNDA41|DSK2|PLIC-1|UBQNTwo-hybrid physical PUBMED:21988832 High Throughput BIOGRID P19438 - NP_00133302Q9UMX0 A0A024R258 NP_444295|NP_038466 914452 7132 8717 112986 114257 - - TNFRSF1A TRADD CD120a|FPF|MS5|TBP1|TNHs.89862 Affinity Capture-Western physical PUBMED:24130170 Low Throughput BIOGRID P19438 - NP_00133302Q15628 - NP_003780|NP_001310481 914453 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:24130170 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 942379 7132 7186 112986 113038 - - TNFRSF1A TRAF2 CD120a|FPF|MS5|TBP1|TNMGC:45012|TRAP|TRAP3 Affinity Capture-Western physical PUBMED:24735611 Low Throughput BIOGRID P19438 - NP_00133302Q12933 A0A024R8H5NP_066961 957485 7132 9025 112986 114492 - - TNFRSF1A RNF8 CD120a|FPF|MS5|TBP1|TNhRNF8 Affinity Capture-Western physical PUBMED:24980434 Low Throughput BIOGRID P19438 - NP_00133302O76064 - NP_898901|NP_003949 1032622 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:15258597 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 1035259 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:18450452 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 1415241 7132 8439 112986 114019 - - TNFRSF1A NSMAF CD120a|FPF|MS5|TBP1|TNFAN Affinity Capture-Western physical PUBMED:10187805 Low Throughput BIOGRID P19438 - NP_00133302Q92636 - NP_003571|NP_001138244 1416638 7132 329 112986 106826 - - TNFRSF1A BIRC2 CD120a|FPF|MS5|TBP1|TNAPI1|HIAP2|Hiap-2|MIHB| Affinity Capture-Western physical PUBMED:25681446 Low Throughput BIOGRID P19438 - NP_00133302Q13490 - NP_001243092|NP_001157|NP_001243095 1416639 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:25681446 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 1417127 7132 8717 112986 114257 - - TNFRSF1A TRADD CD120a|FPF|MS5|TBP1|TNHs.89862 Affinity Capture-Western physical PUBMED:15310755 Low Throughput BIOGRID P19438 - NP_00133302Q15628 - NP_003780|NP_001310481 1505016 7132 7124 112986 112979 - DADB-70P7. TNFRSF1A TNF CD120a|FPF|MS5|TBP1|TNDIF|TNF-alpha|TNFA|TNFCo-localization physical PUBMED:25241761 High Throughput BIOGRID P19438 - NP_00133302P01375 Q5STB3 NP_000585 1505017 7132 7186 112986 113038 - - TNFRSF1A TRAF2 CD120a|FPF|MS5|TBP1|TNMGC:45012|TRAP|TRAP3 Co-localization physical PUBMED:25241761 High Throughput BIOGRID P19438 - NP_00133302Q12933 A0A024R8H5NP_066961 1505018 7132 3551 112986 109767 - - TNFRSF1A IKBKB CD120a|FPF|MS5|TBP1|TNIKK-beta|IKK2|IKKB|IMD Co-localization physical PUBMED:25241761 High Throughput BIOGRID P19438 - NP_00133302O14920 - NP_001547|NP_001177649|NP_001229707 1507979 7132 7189 112986 113041 - - TNFRSF1A TRAF6 CD120a|FPF|MS5|TBP1|TNMGC:3310|RNF85 Affinity Capture-Western physical PUBMED:24758719 Low Throughput BIOGRID P19438 - NP_00133302Q9Y4K3 - NP_004611|NP_665802 1507980 7132 8717 112986 114257 - - TNFRSF1A TRADD CD120a|FPF|MS5|TBP1|TNHs.89862 Affinity Capture-Western physical PUBMED:24758719 Low Throughput BIOGRID P19438 - NP_00133302Q15628 - NP_003780|NP_001310481 1507983 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:24758719 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 NP_001167639|NP_001167638|NP_001128524| 1508440 7132 6850 112986 112717 - - TNFRSF1A SYK CD120a|FPF|MS5|TBP1|TNp72-Syk Affinity Capture-Western physical PUBMED:26212014 Low Throughput BIOGRID P19438 - NP_00133302P43405 A0A024R244 NP 003168 1508442 7132 7186 112986 113038 - - TNFRSF1A TRAF2 CD120a|FPF|MS5|TBP1|TNMGC:45012|TRAP|TRAP3 Affinity Capture-Western physical PUBMED:26212014 Low Throughput BIOGRID P19438 - NP_00133302Q12933 A0A024R8H5NP_066961 1512542 7132 7128 112986 112983 - RP11-356I2.3TNFRSF1A TNFAIP3 CD120a|FPF|MS5|TBP1|TNA20|OTUD7C|TNFA1P2 Affinity Capture-Western physical PUBMED:26802121 Low Throughput BIOGRID P19438 - NP_00133302P21580 - NP_001257437|NP_001257436|NP_006281 1512543 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:26802121 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 1522015 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:25388546 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 1522164 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:24098568 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 1522165 7132 7128 112986 112983 - RP11-356I2.3TNFRSF1A TNFAIP3 CD120a|FPF|MS5|TBP1|TNA20|OTUD7C|TNFA1P2 Affinity Capture-Western physical PUBMED:24098568 Low Throughput BIOGRID P19438 - NP_00133302P21580 - NP_001257437|NP_001257436|NP_006281 1522166 7132 1540 112986 107920 - HSPC057 TNFRSF1A CYLD CD120a|FPF|MS5|TBP1|TNBRSS|CDMT|CYLD1|CYL Affinity Capture-Western physical PUBMED:24098568 Low Throughput BIOGRID P19438 - NP_00133302Q9NQC7 A0A024R6T1NP_001035877|NP_001035814|NP_056062 1528156 7132 5594 112986 111580 - - TNFRSF1A MAPK1 CD120a|FPF|MS5|TBP1|TNERK|ERK-2|ERK2|ERT1|MReconstituted Complex physical PUBMED:19850087 Low Throughput BIOGRID P19438 - NP_00133302P28482 Q1HBJ4|Q499NP_002736|NP_620407 2208045 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:27552911 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 2208046 7132 1540 112986 107920 - HSPC057 TNFRSF1A CYLD CD120a|FPF|MS5|TBP1|TNBRSS|CDMT|CYLD1|CYL Affinity Capture-Western physical PUBMED:27552911 Low Throughput BIOGRID P19438 - NP_00133302Q9NQC7 A0A024R6T1NP_001035877|NP_001035814|NP_056062 2208047 7132 8717 112986 114257 - - TNFRSF1A TRADD CD120a|FPF|MS5|TBP1|TNHs.89862 Affinity Capture-Western physical PUBMED:27552911 Low Throughput BIOGRID P19438 - NP_00133302Q15628 - NP_003780|NP_001310481 NP_003630|NP_001138727|NP_001308326|NP 2208048 7132 8517 112986 114089 - - TNFRSF1A IKBKG CD120a|FPF|MS5|TBP1|TNAMCBX1|FIP-3|FIP3|Fip3pAffinity Capture-Western physical PUBMED:27552911 Low Throughput BIOGRID P19438 - NP_00133302Q9Y6K9 A0A087X1B1 _001308325|NP_001093327|NP_001093326 2208049 7132 55072 112986 120389 - - TNFRSF1A RNF31 CD120a|FPF|MS5|TBP1|TNHOIP|ZIBRA Affinity Capture-Western physical PUBMED:27552911 Low Throughput BIOGRID P19438 - NP_00133302Q96EP0 - NP_060469|NP_001297261 NP_001310885|NP_001310889|NP_001310887| 2208050 7132 10616 112986 115862 - RP5-852M4.4TNFRSF1A RBCK1 CD120a|FPF|MS5|TBP1|TNC20orf18|HOIL-1|HOIL1|PAffinity Capture-Western physical PUBMED:27552911 Low Throughput BIOGRID P19438 - NP_00133302Q9BYM8 - NP 006453|NP 112506 2208051 7132 81858 112986 123608 - PSEC0216 TNFRSF1A SHARPIN CD120a|FPF|MS5|TBP1|TNSIPL1 Affinity Capture-Western physical PUBMED:27552911 Low Throughput BIOGRID P19438 - NP_00133302Q9H0F6 Q6PJD5 NP_112236 2208052 7132 7316 112986 113164 - - TNFRSF1A UBC CD120a|FPF|MS5|TBP1|TNHMG20 Affinity Capture-Western physical PUBMED:27552911 Low Throughput BIOGRID P19438 - NP_00133302P0CG48 - NP_066289 2208761 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:27321185 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 2208762 7132 7186 112986 113038 - - TNFRSF1A TRAF2 CD120a|FPF|MS5|TBP1|TNMGC:45012|TRAP|TRAP3 Affinity Capture-Western physical PUBMED:27321185 Low Throughput BIOGRID P19438 - NP_00133302Q12933 A0A024R8H5NP_066961 2217509 7132 8717 112986 114257 - - TNFRSF1A TRADD CD120a|FPF|MS5|TBP1|TNHs.89862 Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q15628 - NP_003780|NP_001310481 2218562 7132 286205 112986 130333 - - TNFRSF1A SCAI CD120a|FPF|MS5|TBP1|TNC9orf126|NET40 Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q8N9R8 - NP_775961|NP_001138349 2220382 7132 26127 112986 117566 - HSPC123 TNFRSF1A FGFR1OP2 CD120a|FPF|MS5|TBP1|TNHSPC123-like|WIT3.0 Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q9NVK5 - NP_001165358|NP_001165359|NP_056448 NP_061828|NP_001268648|NP_001268649|NP 2220703 7132 7314 112986 113162 - - TNFRSF1A UBB CD120a|FPF|MS5|TBP1|TN- Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302P0CG47 Q5U5U6 _001268645|NP_001268646|NP_001268647 2221605 7132 7124 112986 112979 - DADB-70P7. TNFRSF1A TNF CD120a|FPF|MS5|TBP1|TNDIF|TNF-alpha|TNFA|TNFAffinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302P01375 Q5STB3 NP_000585 NP_001291349|NP_001298107|NP_001298108| 2221680 7132 7871 112986 113620 - UNQ1847/PRTNFRSF1A SLMAP CD120a|FPF|MS5|TBP1|TNSLAP Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q14BN4 - NP_001291352|NP_001291350|NP_001291351| NP 009090 2224263 7132 3607 112986 109820 - - TNFRSF1A FOXK2 CD120a|FPF|MS5|TBP1|TNILF|ILF-1|ILF1 Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q01167 - NP_004505 2225811 7132 53373 112986 119760 - - TNFRSF1A TPCN1 CD120a|FPF|MS5|TBP1|TNTPC1 Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q9ULQ1 B3KSG7|B7Z NP_060371|NP_001288143|NP_001137291 2226627 7132 545 112986 107027 - - TNFRSF1A ATR CD120a|FPF|MS5|TBP1|TNFCTCS|FRP1|MEC1|SCKLAffinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q13535 - NP_001175 2227918 7132 51704 112986 119688 - - TNFRSF1A GPRC5B CD120a|FPF|MS5|TBP1|TNRAIG-2|RAIG2 Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q9NZH0 A0A024QYXNP_001291700|NP_057319 2228110 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 2228566 7132 221937 112986 128769 - - TNFRSF1A FOXK1 CD120a|FPF|MS5|TBP1|TNFOXK1L Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302P85037 - NP_001032242 2229145 7132 27340 112986 118152 - - TNFRSF1A UTP20 CD120a|FPF|MS5|TBP1|TNDRIM Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302O75691 - NP_055318 2230860 7132 85369 112986 124497 - - TNFRSF1A STRIP1 CD120a|FPF|MS5|TBP1|TNFAM40A|FAR11A Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q5VSL9 - NP_149079|NP_001257697 2232232 7132 6801 112986 112674 - - TNFRSF1A STRN CD120a|FPF|MS5|TBP1|TNSG2NA Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302O43815 - NP_003153 NP_001332854|NP_001077422|NP_001332853| 2232664 7132 63892 112986 121972 - - TNFRSF1A THADA CD120a|FPF|MS5|TBP1|TNGITA Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q6YHU6 - NP_001332852|NP_001258573|NP_001258572| NP 071348 2232744 7132 22845 112986 116517 - UNQ2422/PRTNFRSF1A DOLK CD120a|FPF|MS5|TBP1|TNCDG1M|DK|DK1|SEC59|T Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q9UPQ8 - NP_055723 NP_001273990|NP_001273991|NP_001273989| 2232938 7132 27342 112986 118154 - - TNFRSF1A RABGEF1 CD120a|FPF|MS5|TBP1|TNRABEX5|RAP1|rabex-5 Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q9UJ41 A0A024RDL6 NP_055319 2234427 7132 2870 112986 109128 - - TNFRSF1A GRK6 CD120a|FPF|MS5|TBP1|TNGPRK6 Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302P43250 B3KPS5 NP_002073|NP_001004106|NP_001004105 2234476 7132 23351 112986 116933 - - TNFRSF1A KHNYN CD120a|FPF|MS5|TBP1|TNKIAA0323 Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302O15037 A8K6L5 NP_056114|NP_001277185|NP_001277186 2234520 7132 80143 112986 123136 - RP5-1000E10TNFRSF1A SIKE1 CD120a|FPF|MS5|TBP1|TNSIKE Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q9BRV8 - NP_001095866|NP_079349 NP_001094289|NP_001191023|NP_955776|NP 2234886 7132 25843 112986 117369 - CGI-95 TNFRSF1A MOB4 CD120a|FPF|MS5|TBP1|TN2C4D|MOB1|MOB3|MOBKAffinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q9Y3A3 A0A024R3X9 _056202 2235029 7132 84975 112986 124404 - UNQ832/PROTNFRSF1A MFSD5 CD120a|FPF|MS5|TBP1|TNhsMOT2 Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q6N075 - NP_116278|NP_001164261 2236245 7132 81839 112986 123595 - - TNFRSF1A VANGL1 CD120a|FPF|MS5|TBP1|TNKITENIN|LPP2|STB2|STBAffinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q8TAA9 A0A024R0E3NP_620409|NP_001165882|NP_001165883 NP_055252|NP_001258887|NP_001258886|NP 2237573 7132 27173 112986 118050 - CGI-08 TNFRSF1A SLC39A1 CD120a|FPF|MS5|TBP1|TNZIP1|ZIRTL Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q9NY26 - _001258890|NP_001258889|NP_001258888 2238668 7132 23223 112986 116829 - RP11-452K12TNFRSF1A RRP12 CD120a|FPF|MS5|TBP1|TNKIAA0690 Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q5JTH9 B3KMR5 NP_055994|NP_001138586|NP_001271266 2239181 7132 990 112986 107426 - - TNFRSF1A CDC6 CD120a|FPF|MS5|TBP1|TNCDC18L|HsCDC18|HsCDCAffinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q99741 A0A024R1S2NP_001245 2240289 7132 29966 112986 118999 - - TNFRSF1A STRN3 CD120a|FPF|MS5|TBP1|TNSG2NA Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q13033 - NP_055389|NP_001077362 2241929 7132 80204 112986 123173 - UG063H01 TNFRSF1A FBXO11 CD120a|FPF|MS5|TBP1|TNFBX11|PRMT9|UBR6|VIT1Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q86XK2 - NP_079409|NP_001177203 NP_001138433|NP_004998|NP_001138435|NP 2243396 7132 4795 112986 110862 - DADB-70P7.2TNFRSF1A NFKBIL1 CD120a|FPF|MS5|TBP1|TNIKBL|LST1|NFKBIL Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q9UBC1 A8K778|Q5ST 001138434 2244419 7132 10445 112986 115710 - - TNFRSF1A MCRS1 CD120a|FPF|MS5|TBP1|TNICP22BP|INO80Q|MCRS2 Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q96EZ8 A0A024R134 NP_006328|NP_001265270|NP_001012300 NP_001333504|NP_001333505|NP_001374|NP 2245099 7132 1801 112986 108135 - - TNFRSF1A DPH1 CD120a|FPF|MS5|TBP1|TNDPH2L|DPH2L1|OVCA1 Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q9BZG8 B3KQW7 _001333503 2248184 7132 55813 112986 120923 - - TNFRSF1A UTP6 CD120a|FPF|MS5|TBP1|TNC17orf40|HCA66 Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q9NYH9 - NP_060898 2250411 7132 57216 112986 121454 - - TNFRSF1A VANGL2 CD120a|FPF|MS5|TBP1|TNLPP1|LTAP|STB1|STBM|SAffinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q9ULK5 A8K4L6 NP_065068 NP_001284586|NP_001284585|NP_001284584| 2251163 7132 11004 112986 116195 - RP11-269F19TNFRSF1A KIF2C CD120a|FPF|MS5|TBP1|TNCT139|KNSL6|MCAK Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q99661 B7Z6Q6|B7Z7 NP 006836 2251168 7132 1454 112986 107838 - RP1-5O6.1 TNFRSF1A CSNK1E CD120a|FPF|MS5|TBP1|TNCKIepsilon|HCKIE Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302P49674 Q5U045 NP_001885|NP_689407 2251918 7132 9213 112986 114647 - RP11-46A10. TNFRSF1A XPR1 CD120a|FPF|MS5|TBP1|TNSYG1|X3 Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q9UBH6 A0A024R911 NP_004727|NP_001129141|NP_001315591 2252312 7132 29888 112986 118941 - - TNFRSF1A STRN4 CD120a|FPF|MS5|TBP1|TNZIN|zinedin Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q9NRL3 Q59GV6 NP_001034966|NP_037535 2254672 7132 94039 112986 125102 - - TNFRSF1A ZNF101 CD120a|FPF|MS5|TBP1|TNHZF12 Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q8IZC7 - NP_001287878|NP_149981 NP_057113|NP_001309209|NP_001309211|NP 2255667 7132 51635 112986 119649 - CGI-86 TNFRSF1A DHRS7 CD120a|FPF|MS5|TBP1|TNSDR34C1|retDSR4|retSDR Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q9Y394 - _001309210 2257703 7132 57498 112986 121565 - - TNFRSF1A KIDINS220 CD120a|FPF|MS5|TBP1|TNARMS Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q9ULH0 Q7Z322 NP_065789 2258309 7132 9248 112986 114674 - - TNFRSF1A GPR50 CD120a|FPF|MS5|TBP1|TNH9|Mel1c Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q13585 - NP_004215 2259086 7132 9928 112986 115256 - - TNFRSF1A KIF14 CD120a|FPF|MS5|TBP1|TN- Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q15058 - NP_055690|NP_001292721 2259616 7132 84135 112986 123907 - - TNFRSF1A UTP15 CD120a|FPF|MS5|TBP1|TNNET21 Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q8TED0 - NP_001271360|NP_115551|NP_001271359 2260556 7132 100507290 112986 936163 - - TNFRSF1A ZNF865 CD120a|FPF|MS5|TBP1|TN- Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302P0CJ78 - NP_001182534 2260958 7132 55890 112986 120980 - PSEC0087 TNFRSF1A GPRC5C CD120a|FPF|MS5|TBP1|TNRAIG-3|RAIG3 Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q9NQ84 Q9BSP0|A0ANP_071319|NP_061123 2263435 7132 23534 112986 117080 - - TNFRSF1A TNPO3 CD120a|FPF|MS5|TBP1|TNIPO12|LGMD1F|MTR10A| Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q9Y5L0 B3KMX1|A0ANP_001177957|NP_036602 2263500 7132 56704 112986 121191 - - TNFRSF1A JPH1 CD120a|FPF|MS5|TBP1|TNJP-1|JP1 Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q9HDC5 Q86VR1|Q7ZNP_065698|NP_001304759 2264209 7132 27166 112986 118045 - CGI-106 TNFRSF1A PRELID1 CD120a|FPF|MS5|TBP1|TNPRELI|PX19|SBBI12 Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q9Y255 - NP_037369|NP_001258757 NP_001306979|NP_001306980|NP_060656|NP 2266154 7132 55732 112986 120851 - RP1-97P20.1 TNFRSF1A C1orf112 CD120a|FPF|MS5|TBP1|TN- Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q9NSG2 A0A024R922 001306976 NP_001139732|NP_079055|NP_001139731|NP 2267018 7132 79837 112986 122928 - - TNFRSF1A PIP4K2C CD120a|FPF|MS5|TBP1|TNPIP5K2C Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q8TBX8 B3KQV3 001139730 2267207 7132 64327 112986 122137 - tcag7.573 TNFRSF1A LMBR1 CD120a|FPF|MS5|TBP1|TNACHP|C7orf2|DIF14|LSS|PAffinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q8WVP7 Q8NDP7 NP_071903 2267234 7132 80727 112986 123277 - - TNFRSF1A TTYH3 CD120a|FPF|MS5|TBP1|TN- Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q9C0H2 Q8WYU9|A0 NP_079526 2269428 7132 64786 112986 122296 - - TNFRSF1A TBC1D15 CD120a|FPF|MS5|TBP1|TNRAB7-GAP Affinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q8TC07 A8K8E1 NP_073608|NP_001139686|NP_001139685 2269937 7132 51444 112986 119545 - HSD4 TNFRSF1A RNF138 CD120a|FPF|MS5|TBP1|TNHSD-4|NARF|STRIN|hNARAffinity Capture-MS physical PUBMED:28514442 High Throughput BIOGRID P19438 - NP_00133302Q8WVD3 - NP_001178253|NP_937761|NP_057355 2346583 7132 55072 112986 120389 - - TNFRSF1A RNF31 CD120a|FPF|MS5|TBP1|TNHOIP|ZIBRA Affinity Capture-Western physical PUBMED:27591049 Low Throughput BIOGRID P19438 - NP_00133302Q96EP0 - NP_060469|NP_001297261 2346584 7132 1540 112986 107920 - HSPC057 TNFRSF1A CYLD CD120a|FPF|MS5|TBP1|TNBRSS|CDMT|CYLD1|CYL Affinity Capture-Western physical PUBMED:27591049 Low Throughput BIOGRID P19438 - NP_00133302Q9NQC7 A0A024R6T1NP_001035877|NP_001035814|NP_056062 2346592 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:27591049 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 2385776 7132 7124 112986 112979 - DADB-70P7. TNFRSF1A TNF CD120a|FPF|MS5|TBP1|TNDIF|TNF-alpha|TNFA|TNFReconstituted Complex physical PUBMED:15173183 Low Throughput BIOGRID P19438 - NP_00133302P01375 Q5STB3 NP_000585 2399210 7132 7124 112986 112979 - DADB-70P7. TNFRSF1A TNF CD120a|FPF|MS5|TBP1|TNDIF|TNF-alpha|TNFA|TNFReconstituted Complex physical PUBMED:11448951 Low Throughput BIOGRID P19438 - NP_00133302P01375 Q5STB3 NP_000585 2469196 7132 56957 112986 121281 - RP11-212K13TNFRSF1A OTUD7B CD120a|FPF|MS5|TBP1|TNCEZANNE|ZA20D1 Affinity Capture-Western physical PUBMED:28817177 Low Throughput BIOGRID P19438 - NP_00133302Q6GQQ9 - NP_064590 2469197 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:28817177 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 2485540 7132 7186 112986 113038 - - TNFRSF1A TRAF2 CD120a|FPF|MS5|TBP1|TNMGC:45012|TRAP|TRAP3 Affinity Capture-Western physical PUBMED:28388439 Low Throughput BIOGRID P19438 - NP_00133302Q12933 A0A024R8H5NP_066961 2485541 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:28388439 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 2518399 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:29431638 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 2605707 7132 55312 112986 120594 - RP11-422N19TNFRSF1A RFK CD120a|FPF|MS5|TBP1|TNRIFK Two-hybrid physical PUBMED:19641494 Low Throughput BIOGRID P19438 - NP_00133302Q969G6 B2RDZ2 NP_060809 2605708 7132 55312 112986 120594 - RP11-422N19TNFRSF1A RFK CD120a|FPF|MS5|TBP1|TNRIFK Affinity Capture-Western physical PUBMED:19641494 Low Throughput BIOGRID P19438 - NP_00133302Q969G6 B2RDZ2 NP_060809 2605712 7132 1535 112986 107915 - - TNFRSF1A CYBA CD120a|FPF|MS5|TBP1|TNp22-PHOX Affinity Capture-Western physical PUBMED:19641494 Low Throughput BIOGRID P19438 - NP_00133302P13498 B4DT46 NP_000092 2605713 7132 27035 112986 117966 - RP1-146H21. TNFRSF1A NOX1 CD120a|FPF|MS5|TBP1|TNGP91-2|MOX1|NOH-1|NOHAffinity Capture-Western physical PUBMED:19641494 Low Throughput BIOGRID P19438 - NP_00133302Q9Y5S8 Q1ZYL4|A6NNP_008983|NP_039249|NP_001258744 2605714 7132 1536 112986 107916 - - TNFRSF1A CYBB CD120a|FPF|MS5|TBP1|TNAMCBX2|CGD|GP91-1|GPAffinity Capture-Western physical PUBMED:19641494 Low Throughput BIOGRID P19438 - NP_00133302P04839 - NP_000388 2605715 7132 5879 112986 111817 - MIG5 TNFRSF1A RAC1 CD120a|FPF|MS5|TBP1|TNRac-1|TC-25|p21-Rac1 Affinity Capture-Western physical PUBMED:19641494 Low Throughput BIOGRID P19438 - NP_00133302P63000 A4D2P1|A4DNP_008839|NP_061485 2609037 7132 7124 112986 112979 - DADB-70P7. TNFRSF1A TNF CD120a|FPF|MS5|TBP1|TNDIF|TNF-alpha|TNFA|TNFAffinity Capture-MS physical PUBMED:30420664 Low Throughput BIOGRID P19438 - NP_00133302P01375 Q5STB3 NP_000585 2609038 7132 8717 112986 114257 - - TNFRSF1A TRADD CD120a|FPF|MS5|TBP1|TNHs.89862 Affinity Capture-MS physical PUBMED:30420664 Low Throughput BIOGRID P19438 - NP_00133302Q15628 - NP_003780|NP_001310481 2609039 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-MS physical PUBMED:30420664 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 2609040 7132 7186 112986 113038 - - TNFRSF1A TRAF2 CD120a|FPF|MS5|TBP1|TNMGC:45012|TRAP|TRAP3 Affinity Capture-MS physical PUBMED:30420664 Low Throughput BIOGRID P19438 - NP_00133302Q12933 A0A024R8H5NP_066961 2609144 7132 329 112986 106826 - - TNFRSF1A BIRC2 CD120a|FPF|MS5|TBP1|TNAPI1|HIAP2|Hiap-2|MIHB| Affinity Capture-MS physical PUBMED:30420664 Low Throughput BIOGRID P19438 - NP_00133302Q13490 - NP_001243092|NP_001157|NP_001243095 2609145 7132 330 112986 106827 - - TNFRSF1A BIRC3 CD120a|FPF|MS5|TBP1|TNAIP1|API2|CIAP2|HAIP1|HAffinity Capture-MS physical PUBMED:30420664 Low Throughput BIOGRID P19438 - NP_00133302Q13489 - NP_892007|NP_001156 NP_663306|NP_003179|NP_663304|NP_66330 2609146 7132 6885 112986 112748 - RP1-154G14. TNFRSF1A MAP3K7 CD120a|FPF|MS5|TBP1|TNMEKK7|TAK1|TGF1a Affinity Capture-MS physical PUBMED:30420664 Low Throughput BIOGRID P19438 - NP_00133302O43318 - 5 2609147 7132 23118 112986 116740 - RP1-111D6.3 TNFRSF1A TAB2 CD120a|FPF|MS5|TBP1|TNCHTD2|MAP3K7IP2|TAB-Affinity Capture-MS physical PUBMED:30420664 Low Throughput BIOGRID P19438 - NP_00133302Q9NYJ8 B4DIR9 NP_001278964|NP_055908|NP_001278963 2609148 7132 55072 112986 120389 - - TNFRSF1A RNF31 CD120a|FPF|MS5|TBP1|TNHOIP|ZIBRA Affinity Capture-MS physical PUBMED:30420664 Low Throughput BIOGRID P19438 - NP_00133302Q96EP0 - NP_060469|NP_001297261 NP_001310885|NP_001310889|NP_001310887| 2609149 7132 10616 112986 115862 - RP5-852M4.4TNFRSF1A RBCK1 CD120a|FPF|MS5|TBP1|TNC20orf18|HOIL-1|HOIL1|PAffinity Capture-MS physical PUBMED:30420664 Low Throughput BIOGRID P19438 - NP_00133302Q9BYM8 - NP 006453|NP 112506 2609150 7132 81858 112986 123608 - PSEC0216 TNFRSF1A SHARPIN CD120a|FPF|MS5|TBP1|TNSIPL1 Affinity Capture-MS physical PUBMED:30420664 Low Throughput BIOGRID P19438 - NP_00133302Q9H0F6 Q6PJD5 NP_112236 2609151 7132 9825 112986 115163 - - TNFRSF1A SPATA2 CD120a|FPF|MS5|TBP1|TNPD1|PPP1R145|tamo Affinity Capture-MS physical PUBMED:30420664 Low Throughput BIOGRID P19438 - NP_00133302Q9UM82 A8K0S9|B4D NP_001129245|NP_006029 2609152 7132 1540 112986 107920 - HSPC057 TNFRSF1A CYLD CD120a|FPF|MS5|TBP1|TNBRSS|CDMT|CYLD1|CYL Affinity Capture-MS physical PUBMED:30420664 Low Throughput BIOGRID P19438 - NP_00133302Q9NQC7 A0A024R6T1NP_001035877|NP_001035814|NP_056062 NP_003630|NP_001138727|NP_001308326|NP 2609153 7132 8517 112986 114089 - - TNFRSF1A IKBKG CD120a|FPF|MS5|TBP1|TNAMCBX1|FIP-3|FIP3|Fip3pAffinity Capture-MS physical PUBMED:30420664 Low Throughput BIOGRID P19438 - NP_00133302Q9Y6K9 A0A087X1B1 _001308325|NP_001093327|NP_001093326 2609154 7132 1147 112986 107569 - - TNFRSF1A CHUK CD120a|FPF|MS5|TBP1|TNIKBKA|IKK-alpha|IKK1|IKAffinity Capture-MS physical PUBMED:30420664 Low Throughput BIOGRID P19438 - NP_00133302O15111 - NP_001269|NP_001307857 2609155 7132 3551 112986 109767 - - TNFRSF1A IKBKB CD120a|FPF|MS5|TBP1|TNIKK-beta|IKK2|IKKB|IMD Affinity Capture-MS physical PUBMED:30420664 Low Throughput BIOGRID P19438 - NP_00133302O14920 - NP_001547|NP_001177649|NP_001229707 2609156 7132 7128 112986 112983 - RP11-356I2.3TNFRSF1A TNFAIP3 CD120a|FPF|MS5|TBP1|TNA20|OTUD7C|TNFA1P2 Affinity Capture-MS physical PUBMED:30420664 Low Throughput BIOGRID P19438 - NP_00133302P21580 - NP_001257437|NP_001257436|NP_006281 NP_001239314|NP_001239315|NP_001239319| NP_001245383|NP_001245384|NP_001245385| 2609157 7132 10318 112986 115602 - - TNFRSF1A TNIP1 CD120a|FPF|MS5|TBP1|TNABIN-1|NAF1|VAN|nip40-Affinity Capture-MS physical PUBMED:30420664 Low Throughput BIOGRID P19438 - NP_00133302Q15025 B7Z8K2|A8K NP_006049|NP_001239321|NP_001239320|NP 001239322 2609158 7132 79155 112986 122573 - RP3-474M20.TNFRSF1A TNIP2 CD120a|FPF|MS5|TBP1|TNABIN2|FLIP1|KLIP Affinity Capture-MS physical PUBMED:30420664 Low Throughput BIOGRID P19438 - NP_00133302Q8NFZ5 D6RGJ2 NP_077285|NP_001154999|NP_001278945 2609159 7132 29110 112986 118878 - - TNFRSF1A TBK1 CD120a|FPF|MS5|TBP1|TNNAK|T2K Affinity Capture-MS physical PUBMED:30420664 Low Throughput BIOGRID P19438 - NP_00133302Q9UHD2 - NP_037386 2609160 7132 10010 112986 115328 - - TNFRSF1A TANK CD120a|FPF|MS5|TBP1|TNI-TRAF|ITRAF|TRAF2 Affinity Capture-MS physical PUBMED:30420664 Low Throughput BIOGRID P19438 - NP_00133302Q92844 B2R7S3|Q6N NP_004171|NP_001186064|NP_597841 2609161 7132 9641 112986 115000 - RP11-534L20TNFRSF1A IKBKE CD120a|FPF|MS5|TBP1|TNIKK-E|IKK-i|IKKE|IKKI Affinity Capture-MS physical PUBMED:30420664 Low Throughput BIOGRID P19438 - NP_00133302Q14164 A0A075B7B4NP_001180250|NP_001180251|NP_054721 NP_001308656|NP_001308657|NP_037379|NP 2609162 7132 27429 112986 118165 - - TNFRSF1A HTRA2 CD120a|FPF|MS5|TBP1|TNOMI|PARK13|PRSS25 Affinity Capture-MS physical PUBMED:30420664 Low Throughput BIOGRID P19438 - NP_00133302O43464 - 659540 2640865 7132 894 112986 107334 - - TNFRSF1A CCND2 CD120a|FPF|MS5|TBP1|TNKIAK0002|MPPH3 FRET physical PUBMED:28205554 High Throughput BIOGRID P19438 - NP_00133302P30279 - NP_001750 2641306 7132 207 112986 106710 - - TNFRSF1A AKT1 CD120a|FPF|MS5|TBP1|TNAKT|CWS6|PKB|PKB-ALPFRET physical PUBMED:28205554 High Throughput BIOGRID P19438 - NP_00133302P31749 B0LPE5|B3KVNP_001014432|NP_005154|NP_001014431 2641307 7132 1021 112986 107456 - - TNFRSF1A CDK6 CD120a|FPF|MS5|TBP1|TNMCPH12|PLSTIRE FRET physical PUBMED:28205554 High Throughput BIOGRID P19438 - NP_00133302Q00534 - NP_001138778|NP_001250 2641308 7132 1030 112986 107464 - RP11-149I2.1TNFRSF1A CDKN2B CD120a|FPF|MS5|TBP1|TNCDK4I|INK4B|MTS2|P15|TFRET physical PUBMED:28205554 High Throughput BIOGRID P19438 - NP_00133302P42772 K7PPU3 NP_004927|NP_511042 2641309 7132 6794 112986 112670 - - TNFRSF1A STK11 CD120a|FPF|MS5|TBP1|TNLKB1|PJS|hLKB1 FRET physical PUBMED:28205554 High Throughput BIOGRID P19438 - NP_00133302Q15831 - NP_000446 2641310 7132 7132 112986 112986 - - TNFRSF1A TNFRSF1A CD120a|FPF|MS5|TBP1|TNCD120a|FPF|MS5|TBP1|TNFRET physical PUBMED:28205554 High Throughput BIOGRID P19438 - NP_00133302P19438 - NP_001333021|NP_001333020|NP_001056 2690935 7132 8717 112986 114257 - - TNFRSF1A TRADD CD120a|FPF|MS5|TBP1|TNHs.89862 Affinity Capture-Western physical PUBMED:29108854 Low Throughput BIOGRID P19438 - NP_00133302Q15628 - NP_003780|NP_001310481 2690936 7132 7186 112986 113038 - - TNFRSF1A TRAF2 CD120a|FPF|MS5|TBP1|TNMGC:45012|TRAP|TRAP3 Affinity Capture-Western physical PUBMED:29108854 Low Throughput BIOGRID P19438 - NP_00133302Q12933 A0A024R8H5NP_066961 2691936 7132 147138 112986 127037 - - TNFRSF1A TMC8 CD120a|FPF|MS5|TBP1|TNEV2|EVER2|EVIN2 Affinity Capture-Western physical PUBMED:23429285 Low Throughput BIOGRID P19438 - NP_00133302Q8IU68 B3KXZ8|A0ANP_689681 2691937 7132 8737 112986 114274 - - TNFRSF1A RIPK1 CD120a|FPF|MS5|TBP1|TNRIP|RIP1 Affinity Capture-Western physical PUBMED:23429285 Low Throughput BIOGRID P19438 - NP_00133302Q13546 A0A024QZU0NP_003795|NP_001303990 2603141 7128 7132 112983 112986 RP11-356I2.3- TNFAIP3 TNFRSF1A A20|OTUD7C|TNFA1P2 CD120a|FPF|MS5|TBP1|TNAffinity Capture-MS physical PUBMED:30561431 High Throughput BIOGRID P21580 - NP_00125743P19438 - NP_001333021|NP_001333020|NP_001056 255890 7124 7132 112979 112986 DADB-70P7. - TNF TNFRSF1A DIF|TNF-alpha|TNFA|TNFCD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:12887920 Low Throughput BIOGRID P01375 Q5STB3 NP_000585 P19438 - NP_001333021|NP_001333020|NP_001056 504441 7124 7132 112979 112986 DADB-70P7. - TNF TNFRSF1A DIF|TNF-alpha|TNFA|TNFCD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:12753742 Low Throughput BIOGRID P01375 Q5STB3 NP_000585 P19438 - NP_001333021|NP_001333020|NP_001056 505677 7124 7132 112979 112986 DADB-70P7. - TNF TNFRSF1A DIF|TNF-alpha|TNFA|TNFCD120a|FPF|MS5|TBP1|TNAffinity Capture-MS physical PUBMED:15485837 Low Throughput BIOGRID P01375 Q5STB3 NP_000585 P19438 - NP_001333021|NP_001333020|NP_001056 592953 7124 7132 112979 112986 DADB-70P7. - TNF TNFRSF1A DIF|TNF-alpha|TNFA|TNFCD120a|FPF|MS5|TBP1|TNReconstituted Complex physical PUBMED:22099304 Low Throughput BIOGRID P01375 Q5STB3 NP_000585 P19438 - NP_001333021|NP_001333020|NP_001056 724406 7124 7132 112979 112986 DADB-70P7. - TNF TNFRSF1A DIF|TNF-alpha|TNFA|TNFCD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:23032187 Low Throughput BIOGRID P01375 Q5STB3 NP_000585 P19438 - NP_001333021|NP_001333020|NP_001056 835938 7124 7132 112979 112986 DADB-70P7. - TNF TNFRSF1A DIF|TNF-alpha|TNFA|TNFCD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:22675546 Low Throughput BIOGRID P01375 Q5STB3 NP_000585 P19438 - NP_001333021|NP_001333020|NP_001056 872566 7124 7132 112979 112986 DADB-70P7. - TNF TNFRSF1A DIF|TNF-alpha|TNFA|TNFCD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:23746843 Low Throughput BIOGRID P01375 Q5STB3 NP_000585 P19438 - NP_001333021|NP_001333020|NP_001056 887650 7124 7132 112979 112986 DADB-70P7. - TNF TNFRSF1A DIF|TNF-alpha|TNFA|TNFCD120a|FPF|MS5|TBP1|TNReconstituted Complex physical PUBMED:9568681 Low Throughput BIOGRID P01375 Q5STB3 NP_000585 P19438 - NP_001333021|NP_001333020|NP_001056 890918 7124 7132 112979 112986 DADB-70P7. - TNF TNFRSF1A DIF|TNF-alpha|TNFA|TNFCD120a|FPF|MS5|TBP1|TNReconstituted Complex physical PUBMED:1310388 Low Throughput BIOGRID P01375 Q5STB3 NP_000585 P19438 - NP_001333021|NP_001333020|NP_001056 901926 7124 7132 112979 112986 DADB-70P7. - TNF TNFRSF1A DIF|TNF-alpha|TNFA|TNFCD120a|FPF|MS5|TBP1|TNReconstituted Complex physical PUBMED:8182064 Low Throughput BIOGRID P01375 Q5STB3 NP_000585 P19438 - NP_001333021|NP_001333020|NP_001056 937550 7124 7132 112979 112986 DADB-70P7. - TNF TNFRSF1A DIF|TNF-alpha|TNFA|TNFCD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:24726327 Low Throughput BIOGRID P01375 Q5STB3 NP_000585 P19438 - NP_001333021|NP_001333020|NP_001056 957481 7124 7132 112979 112986 DADB-70P7. - TNF TNFRSF1A DIF|TNF-alpha|TNFA|TNFCD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:24980434 Low Throughput BIOGRID P01375 Q5STB3 NP_000585 P19438 - NP_001333021|NP_001333020|NP_001056 1102876 7124 7132 112979 112986 DADB-70P7. - TNF TNFRSF1A DIF|TNF-alpha|TNFA|TNFCD120a|FPF|MS5|TBP1|TNReconstituted Complex physical PUBMED:8805640 Low Throughput BIOGRID P01375 Q5STB3 NP_000585 P19438 - NP_001333021|NP_001333020|NP_001056 1195697 7124 7132 112979 112986 DADB-70P7. - TNF TNFRSF1A DIF|TNF-alpha|TNFA|TNFCD120a|FPF|MS5|TBP1|TNAffinity Capture-MS physical PUBMED:26186194 High Throughput BIOGRID P01375 Q5STB3 NP_000585 P19438 - NP_001333021|NP_001333020|NP_001056 1510649 7124 7132 112979 112986 DADB-70P7. - TNF TNFRSF1A DIF|TNF-alpha|TNFA|TNFCD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:25911380 Low Throughput BIOGRID P01375 Q5STB3 NP_000585 P19438 - NP_001333021|NP_001333020|NP_001056 1515728 7124 7132 112979 112986 DADB-70P7. - TNF TNFRSF1A DIF|TNF-alpha|TNFA|TNFCD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:26670046 Low Throughput BIOGRID P01375 Q5STB3 NP_000585 P19438 - NP_001333021|NP_001333020|NP_001056 2208963 7124 7132 112979 112986 DADB-70P7. - TNF TNFRSF1A DIF|TNF-alpha|TNFA|TNFCD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:27560715 Low Throughput BIOGRID P01375 Q5STB3 NP_000585 P19438 - NP_001333021|NP_001333020|NP_001056 2494154 7124 7132 112979 112986 DADB-70P7. - TNF TNFRSF1A DIF|TNF-alpha|TNFA|TNFCD120a|FPF|MS5|TBP1|TNAffinity Capture-MS physical PUBMED:27307491 High Throughput BIOGRID P01375 Q5STB3 NP_000585 P19438 - NP_001333021|NP_001333020|NP_001056 2494762 7124 7132 112979 112986 DADB-70P7. - TNF TNFRSF1A DIF|TNF-alpha|TNFA|TNFCD120a|FPF|MS5|TBP1|TNAffinity Capture-MS physical PUBMED:27545878 High Throughput BIOGRID P01375 Q5STB3 NP_000585 P19438 - NP_001333021|NP_001333020|NP_001056 2494832 7124 7132 112979 112986 DADB-70P7. - TNF TNFRSF1A DIF|TNF-alpha|TNFA|TNFCD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:27545878 Low Throughput BIOGRID P01375 Q5STB3 NP_000585 P19438 - NP_001333021|NP_001333020|NP_001056 2609170 7124 7132 112979 112986 DADB-70P7. - TNF TNFRSF1A DIF|TNF-alpha|TNFA|TNFCD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:30420664 Low Throughput BIOGRID P01375 Q5STB3 NP_000585 P19438 - NP_001333021|NP_001333020|NP_001056 901813 6868 7132 112731 112986 - - ADAM17 TNFRSF1A ADAM18|CD156B|CSVP|NCD120a|FPF|MS5|TBP1|TNBiochemical Activity physical PUBMED:17010968 Low Throughput BIOGRID P78536 B2RNB2 NP_003174 P19438 - NP_001333021|NP_001333020|NP_001056 887079 6714 7132 112592 112986 RP5-823N20. - SRC TNFRSF1A ASV|SRC1|c-SRC|p60-Src CD120a|FPF|MS5|TBP1|TNBiochemical Activity physical PUBMED:9237663 Low Throughput BIOGRID P12931 - NP_938033|NP19438 - NP_001333021|NP_001333020|NP_001056 894135 6449 7132 112347 112986 - - SGTA TNFRSF1A SGT|alphaSGT|hSGT CD120a|FPF|MS5|TBP1|TNTwo-hybrid physical PUBMED:21988832 High Throughput BIOGRID O43765 - NP_003012 P19438 - NP_001333021|NP_001333020|NP_001056 287805 5708 7132 111681 112986 - - PSMD2 TNFRSF1A P97|RPN1|S2|TRAP2 CD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:9126987 Low Throughput BIOGRID Q13200 - NP_00126563P19438 - NP_001333021|NP_001333020|NP_001056 244352 5599 7132 111585 112986 - - MAPK8 TNFRSF1A JNK|JNK-46|JNK1|JNK1A2CD120a|FPF|MS5|TBP1|TNCo-purification physical PUBMED:15659383 Low Throughput BIOGRID P45983 A1L4K2 NP_00131025P19438 - NP_001333021|NP_001333020|NP_001056 606925 5594 7132 111580 112986 - - MAPK1 TNFRSF1A ERK|ERK-2|ERK2|ERT1|MCD120a|FPF|MS5|TBP1|TNBiochemical Activity physical PUBMED:11606045 Low Throughput BIOGRID P28482 Q1HBJ4|Q499GNP_002736|NP19438 - NP_001333021|NP_001333020|NP_001056 1528155 5594 7132 111580 112986 - - MAPK1 TNFRSF1A ERK|ERK-2|ERK2|ERT1|MCD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:19850087 Low Throughput BIOGRID P28482 Q1HBJ4|Q499GNP_002736|NP19438 - NP_001333021|NP_001333020|NP_001056 824581 5580 7132 111566 112986 - - PRKCD TNFRSF1A ALPS3|CVID9|MAY1|PKCCD120a|FPF|MS5|TBP1|TNBiochemical Activity physical PUBMED:11078718 Low Throughput BIOGRID Q05655 A0A024R328 NP_997704|NP19438 - NP_001333021|NP_001333020|NP_001056 715511 4653 7132 110736 112986 - - MYOC TNFRSF1A GLC1A|GPOA|JOAG|JOAGCD120a|FPF|MS5|TBP1|TNTwo-hybrid physical PUBMED:16289162 Low Throughput BIOGRID Q99972 - NP_000252 P19438 - NP_001333021|NP_001333020|NP_001056 244353 4478 7132 110584 112986 - - MSN TNFRSF1A HEL70 CD120a|FPF|MS5|TBP1|TNCo-purification physical PUBMED:15659383 Low Throughput BIOGRID P26038 V9HWC0 NP_002435 P19438 - NP_001333021|NP_001333020|NP_001056 316466 4050 7132 110228 112986 DAAP-90L16 - LTB TNFRSF1A TNFC|TNFSF3|p33 CD120a|FPF|MS5|TBP1|TNReconstituted Complex physical PUBMED:7995952 Low Throughput BIOGRID Q06643 Q5STB2 NP_033666|NP19438 - NP_001333021|NP_001333020|NP_001056 890920 4049 7132 110227 112986 DAMA-25N1 - LTA TNFRSF1A LT|TNFB|TNFSF1 CD120a|FPF|MS5|TBP1|TNReconstituted Complex physical PUBMED:1310388 Low Throughput BIOGRID P01374 Q5STV3 NP_000586|NP19438 - NP_001333021|NP_001333020|NP_001056 901928 4049 7132 110227 112986 DAMA-25N1 - LTA TNFRSF1A LT|TNFB|TNFSF1 CD120a|FPF|MS5|TBP1|TNReconstituted Complex physical PUBMED:8182064 Low Throughput BIOGRID P01374 Q5STV3 NP_000586|NP19438 - NP_001333021|NP_001333020|NP_001056 283270 3551 7132 109767 112986 - - IKBKB TNFRSF1A IKK-beta|IKK2|IKKB|IMD CD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:10755617 Low Throughput BIOGRID O14920 - NP_001547|NP19438 - NP_001333021|NP_001333020|NP_001056 716927 3551 7132 109767 112986 - - IKBKB TNFRSF1A IKK-beta|IKK2|IKKB|IMD CD120a|FPF|MS5|TBP1|TNBiochemical Activity physical PUBMED:21724995 Low Throughput BIOGRID O14920 - NP_001547|NP19438 - NP_001333021|NP_001333020|NP_001056 893807 3273 7132 109509 112986 - - HRG TNFRSF1A HPRG|HRGP|THPH11 CD120a|FPF|MS5|TBP1|TNTwo-hybrid physical PUBMED:21988832 High Throughput BIOGRID P04196 - NP_000403 P19438 - NP_001333021|NP_001333020|NP_001056 1447850 3184 7132 109425 112986 - - HNRNPD TNFRSF1A AUF1|AUF1A|HNRPD|P37 CD120a|FPF|MS5|TBP1|TNAffinity Capture-MS physical PUBMED:26496610 High Throughput BIOGRID Q14103 A0A024RDF4|ANP_00100381P19438 - NP_001333021|NP_001333020|NP_001056 893768 2998 7132 109253 112986 - - GYS2 TNFRSF1A - CD120a|FPF|MS5|TBP1|TNTwo-hybrid physical PUBMED:21988832 High Throughput BIOGRID P54840 - NP_068776 P19438 - NP_001333021|NP_001333020|NP_001056 276938 2885 7132 109142 112986 - - GRB2 TNFRSF1A ASH|EGFRBP-GRB2|Grb3-CD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:10359574 Low Throughput BIOGRID P62993 B0LPF3 NP_002077|NP19438 - NP_001333021|NP_001333020|NP_001056 664159 1994 7132 108309 112986 - - ELAVL1 TNFRSF1A ELAV1|HUR|Hua|MelG CD120a|FPF|MS5|TBP1|TNAffinity Capture-RNA physical PUBMED:19322201 High Throughput BIOGRID Q15717 - NP_001410 P19438 - NP_001333021|NP_001333020|NP_001056 1067386 1956 7132 108276 112986 - - EGFR TNFRSF1A ERBB|ERBB1|HER1|NISBDCD120a|FPF|MS5|TBP1|TNTwo-hybrid physical PUBMED:25402006 Low Throughput BIOGRID P00533 - NP_00133382P19438 - NP_001333021|NP_001333020|NP_001056 1506065 1956 7132 108276 112986 - - EGFR TNFRSF1A ERBB|ERBB1|HER1|NISBDCD120a|FPF|MS5|TBP1|TNPCA physical PUBMED:24658140 High Throughput BIOGRID P00533 - NP_00133382P19438 - NP_001333021|NP_001333020|NP_001056 716926 1147 7132 107569 112986 - - CHUK TNFRSF1A IKBKA|IKK-alpha|IKK1|IKCD120a|FPF|MS5|TBP1|TNBiochemical Activity physical PUBMED:21724995 Low Throughput BIOGRID O15111 - NP_001269|NP19438 - NP_001333021|NP_001333020|NP_001056 244354 843 7132 107293 112986 - - CASP10 TNFRSF1A ALPS2|FLICE2|MCH4 CD120a|FPF|MS5|TBP1|TNCo-purification physical PUBMED:15659383 Low Throughput BIOGRID Q92851 - NP_116756|NP19438 - NP_001333021|NP_001333020|NP_001056 244355 841 7132 107291 112986 - - CASP8 TNFRSF1A ALPS2B|CAP4|Casp-8|FLICCD120a|FPF|MS5|TBP1|TNCo-purification physical PUBMED:15659383 Low Throughput BIOGRID Q14790 A0A024R3Z8 NP_203520|NP19438 - NP_001333021|NP_001333020|NP_001056 315106 840 7132 107290 112986 RP11-211N11- CASP7 TNFRSF1A CASP-7|CMH-1|ICE-LAP3 CD120a|FPF|MS5|TBP1|TNBiochemical Activity physical PUBMED:11755217 Low Throughput BIOGRID P55210 B4DWA2 NP_203124|NP19438 - NP_001333021|NP_001333020|NP_001056 244347 637 7132 107106 112986 - - BID TNFRSF1A FP497 CD120a|FPF|MS5|TBP1|TNCo-purification physical PUBMED:15659383 Low Throughput BIOGRID P55957 B2ZP79|A8ASINP_00123149P19438 - NP_001333021|NP_001333020|NP_001056 244357 396 7132 106889 112986 - - ARHGDIA TNFRSF1A GDIA1|HEL-S-47e|NPHS8| CD120a|FPF|MS5|TBP1|TNCo-purification physical PUBMED:15659383 Low Throughput BIOGRID P52565 J3QQX2|V9HWNP_00128817P19438 - NP_001333021|NP_001333020|NP_001056 244356 387 7132 106880 112986 - - RHOA TNFRSF1A ARH12|ARHA|RHO12|RHOCD120a|FPF|MS5|TBP1|TNCo-purification physical PUBMED:15659383 Low Throughput BIOGRID P61586 Q9BVT0|A0A0NP_00130087P19438 - NP_001333021|NP_001333020|NP_001056 244351 356 7132 106852 112986 - - FASLG TNFRSF1A ALPS1B|APT1LG1|APTL|CCD120a|FPF|MS5|TBP1|TNCo-purification physical PUBMED:15659383 Low Throughput BIOGRID P48023 Q53ZZ1 NP_000630|NP19438 - NP_001333021|NP_001333020|NP_001056 504446 356 7132 106852 112986 - - FASLG TNFRSF1A ALPS1B|APT1LG1|APTL|CCD120a|FPF|MS5|TBP1|TNAffinity Capture-Western physical PUBMED:12753742 Low Throughput BIOGRID P48023 Q53ZZ1 NP_000630|NP19438 - NP_001333021|NP_001333020|NP_001056 244350 355 7132 106851 112986 RP11-399O19- FAS TNFRSF1A ALPS1A|APO-1|APT1|CD9CD120a|FPF|MS5|TBP1|TNCo-purification physical PUBMED:15659383 Low Throughput BIOGRID P25445 Q59FU8 NP_690610|NP19438 - NP_001333021|NP_001333020|NP_001056 2603857 329 7132 106826 112986 - - BIRC2 TNFRSF1A API1|HIAP2|Hiap-2|MIHB|RCD120a|FPF|MS5|TBP1|TNAffinity Capture-MS physical PUBMED:30561431 High Throughput BIOGRID Q13490 - NP_00124309P19438 - NP_001333021|NP_001333020|NP_001056 Table S2. LC-MS analysis of TNFR1 co-IP lysates of different groups. Related to Figure S2F. Description LC-MS analysis of TNFR1 co-IP lysates of different groups (control, TNF-α 15 min stimulation, TNF-α 2 h stimulation, and HRG overexpression) to identify novel E3 ubiquitin ligases or deubiquitinates of TNFR1. Coverage #Spec Coverage Coverage Coverage Coverage #Spec (%) TNF-α #Spec #Spec #Spec overexpre (%) (%) (%) TNF- (%) TNF- control control TNF-α 2h overexpression TNF-α Protein Protein Coverage overexpres 15min control control TNF-α 2h ssion Avg. Accession -10lgP control control α 15min α 2h (co- (co-IP: (co-IP: (co-IP: HRG (co-IP: #Peptides #Unique 15min Description Group ID (%) sion HRG (co-IP: (co-IP: (co-IP: (co-IP: HRG (co- Mass (co-IP: (co-IP: (co-IP: IP: IgG) TNFR1) TNFR1) TNFR1) (co-IP: (co-IP: TNFR1) IgG) TNFR1) TNFR1) IP: IgG) TNFR1) TNFR1) TNFR1) TNFR1) TNFR1) TNFR1) 3 10 sp|Q15149|PLEC_HUMAN 483.76 61 1 48 56 46 32 1.61E+06 5.88E+09 1.05E+10 4.81E+09 1.60E+09 358 316 17 568 708 378 213 531796 Plectin OS=Homo sapiens OX=9606 GN=PLEC PE=1 SV=3 5 11 sp|P35579|MYH9_HUMAN 404.63 59 51 43 51 52 42 9.41E+08 1.63E+09 1.36E+09 2.32E+09 1.94E+09 151 106 212 240 225 285 266 226530 Myosin-9 OS=Homo sapiens OX=9606 GN=MYH9 PE=1 SV=4 1 5 sp|P23246|SFPQ_HUMAN 395.2 72 50 70 69 66 64 1.16E+09 2.56E+10 3.08E+10 3.28E+10 2.16E+10 117 95 101 712 767 787 818 76150 Splicing factor proline- and glutamine-rich OS=Homo sapiens OX=9606 GN=SFPQ PE=1 SV=2 2 3 sp|Q15233|NONO_HUMAN 388.42 78 55 76 78 78 75 9.48E+08 2.47E+10 2.63E+10 3.11E+10 1.83E+10 104 83 98 551 506 556 440 54232 Non-POU domain-containing octamer-binding protein OS=Homo sapiens OX=9606 GN=NONO PE=1 SV=4 4 1 sp|P11940|PABP1_HUMAN 373.03 81 75 66 78 79 71 4.10E+08 1.53E+09 2.38E+09 3.06E+09 1.50E+09 88 19 150 261 333 407 238 70671 Polyadenylate-binding protein 1 OS=Homo sapiens OX=9606 GN=PABPC1 PE=1 SV=2 38 32 sp|P58107|EPIPL_HUMAN 354.67 19 1 12 17 11 5 5.36E+08 8.22E+08 6.27E+08 5.89E+07 101 75 5 94 121 71 21 555666 Epiplakin OS=Homo sapiens OX=9606 GN=EPPK1 PE=1 SV=3 21 23 sp|Q7Z406|MYH14_HUMAN 349.68 46 14 28 39 36 26 2.00E+07 3.95E+08 8.90E+08 6.51E+08 4.43E+08 95 63 34 90 134 102 81 227868 Myosin-14 OS=Homo sapiens OX=9606 GN=MYH14 PE=1 SV=2 8 2 sp|Q13310|PABP4_HUMAN 348.2 72 49 51 66 64 56 3.57E+08 1.44E+09 1.87E+09 2.29E+09 1.42E+09 63 29 94 156 191 213 155 70783 Polyadenylate-binding protein 4 OS=Homo sapiens OX=9606 GN=PABPC4 PE=1 SV=1 6 4 sp|Q8WXF1|PSPC1_HUMAN 345.87 67 26 62 65 66 61 9.00E+07 6.18E+09 8.18E+09 9.01E+09 4.42E+09 76 56 20 235 247 270 180 58744 Paraspeckle component 1 OS=Homo sapiens OX=9606 GN=PSPC1 PE=1 SV=1 20 20 sp|Q92900|RENT1_HUMAN 343.56 52 27 41 46 50 33 1.97E+08 1.12E+09 1.20E+09 1.61E+09 6.11E+08 53 50 32 98 102 133 79 124345 Regulator of nonsense transcripts 1 OS=Homo sapiens OX=9606 GN=UPF1 PE=1 SV=2 32 27 sp|P15924|DESP_HUMAN 343.09 38 1 31 28 21 13 1.12E+09 8.18E+08 5.76E+08 1.86E+08 118 100 11 134 111 71 44 331774 Desmoplakin OS=Homo sapiens OX=9606 GN=DSP PE=1 SV=3 35 28 sp|P35580|MYH10_HUMAN 328.96 37 24 20 24 27 19 8.23E+07 1.16E+08 1.29E+08 2.38E+08 9.07E+07 75 39 61 65 67 80 72 228997 Myosin-10 OS=Homo sapiens OX=9606 GN=MYH10 PE=1 SV=3 12 8 sp|Q9NZI8|IF2B1_HUMAN 326.01 63 50 58 51 52 52 1.42E+09 3.71E+09 4.79E+09 6.19E+09 2.93E+09 61 48 96 151 146 165 126 63481 Insulin-like growth factor 2 mRNA-binding protein 1 OS=Homo sapiens OX=9606 GN=IGF2BP1 PE=1 SV=2 22 13 sp|Q5T9A4|ATD3B_HUMAN 318.8 59 14 39 51 47 37 1.28E+06 3.25E+08 5.41E+08 4.36E+08 1.06E+08 48 14 11 131 124 104 71 72573 ATPase family AAA domain-containing protein 3B OS=Homo sapiens OX=9606 GN=ATAD3B PE=1 SV=1 16 73 sp|P60709|ACTB_HUMAN 318.75 75 74 57 57 58 57 3.09E+07 2.42E+06 6.56E+07 9.92E+07 9.41E+07 43 2 103 100 113 134 90 41737 Actin cytoplasmic 1 OS=Homo sapiens OX=9606 GN=ACTB PE=1 SV=1 17 74 sp|P63261|ACTG_HUMAN 317.91 75 74 52 57 58 57 9.79E+06 1.62E+07 2.26E+07 1.26E+07 42 1 102 97 109 134 84 41793 Actin cytoplasmic 2 OS=Homo sapiens OX=9606 GN=ACTG1 PE=1 SV=1 7 50 sp|Q9H361|PABP3_HUMAN 315.98 42 33 33 40 37 33 9.45E+06 4.45E+07 6.48E+07 6.12E+07 50 2 90 163 189 229 150 70031 Polyadenylate-binding protein 3 OS=Homo sapiens OX=9606 GN=PABPC3 PE=1 SV=2 13 33 sp|Q13283|G3BP1_HUMAN 315.28 67 49 61 52 62 50 6.83E+08 3.09E+09 3.32E+09 4.23E+09 2.30E+09 28 24 71 164 144 158 128 52164 Ras GTPase-activating protein-binding protein 1 OS=Homo sapiens OX=9606 GN=G3BP1 PE=1 SV=1 24 18 sp|P09874|PARP1_HUMAN 314.2 50 44 39 37 43 35 8.66E+08 8.44E+08 6.73E+08 1.18E+09 6.55E+08 53 48 95 91 62 104 66 113084 Poly [ADP-ribose] polymerase 1 OS=Homo sapiens OX=9606 GN=PARP1 PE=1 SV=4 40 25 sp|Q08211|DHX9_HUMAN 314.15 43 23 27 39 32 26 2.15E+08 5.39E+08 7.77E+08 7.27E+08 4.15E+08 55 49 46 67 72 72 45 140958 ATP-dependent RNA helicase A OS=Homo sapiens OX=9606 GN=DHX9 PE=1 SV=4 19 12 sp|Q9HCE1|MOV10_HUMAN 312.91 59 29 49 46 53 43 1.81E+08 1.12E+09 1.23E+09 1.57E+09 6.51E+08 64 60 37 108 97 124 77 113671 Helicase MOV-10 OS=Homo sapiens OX=9606 GN=MOV10 PE=1 SV=2 28 36 sp|P05783|K1C18_HUMAN 311.32 64 45 61 55 57 55 1.88E+08 1.44E+09 1.95E+09 1.66E+09 7.68E+08 43 26 43 91 113 97 57 48058 Keratin type I cytoskeletal 18 OS=Homo sapiens OX=9606 GN=KRT18 PE=1 SV=2 43 21 sp|Q7Z417|NUFP2_HUMAN 310.05 52 34 44 46 52 46 3.33E+08 8.62E+08 1.69E+09 1.99E+09 9.98E+08 32 30 33 52 74 79 54 76121 Nuclear fragile X mental retardation-interacting protein 2 OS=Homo sapiens OX=9606 GN=NUFIP2 PE=1 SV=1 25 19 sp|Q14694|UBP10_HUMAN 309.71 56 39 44 48 48 30 2.07E+08 4.05E+09 1.24E+09 1.57E+09 8.80E+08 39 37 38 109 107 111 56 87134 Ubiquitin carboxyl-terminal hydrolase 10 OS=Homo sapiens OX=9606 GN=USP10 PE=1 SV=2 30 26 sp|Q8WWM7|ATX2L_HUMA 308.14 44 25 35 43 35 28 3.53E+08 1.48E+09 2.15E+09 2.16E+09 1.41E+09 42 41 36 87 100 100 75 113374 Ataxin-2-like protein OS=Homo sapiens OX=9606 GN=ATXN2L PE=1 SV=2 18 37 sp|Q9NVI7|ATD3A_HUMAN 307.47 56 18 49 48 49 42 3.15E+06 3.92E+08 5.10E+08 4.04E+08 1.43E+08 51 14 13 136 118 109 78 71369 ATPase family AAA domain-containing protein 3A OS=Homo sapiens OX=9606 GN=ATAD3A PE=1 SV=2 37 39 sp|Q7L2E3|DHX30_HUMAN 306.82 50 19 40 41 41 26 8.24E+07 9.42E+08 7.71E+08 8.70E+08 3.46E+08 60 55 24 91 83 87 47 133938 ATP-dependent RNA helicase DHX30 OS=Homo sapiens OX=9606 GN=DHX30 PE=1 SV=1 54 29 sp|Q00610|CLH1_HUMAN 306.81 33 20 23 16 29 11 1.91E+08 4.90E+08 1.84E+08 5.94E+08 1.11E+08 50 46 38 63 32 67 24 191613 Clathrin heavy chain 1 OS=Homo sapiens OX=9606 GN=CLTC PE=1 SV=5 70 31 sp|Q9Y520|PRC2C_HUMAN 306.78 25 8 15 18 15 15 7.80E+07 2.49E+08 3.78E+08 3.70E+08 2.08E+08 55 52 22 37 50 48 37 316911 Protein PRRC2C OS=Homo sapiens OX=9606 GN=PRRC2C PE=1 SV=4 42 30 sp|Q04637|IF4G1_HUMAN 304.41 35 16 25 29 29 24 1.10E+08 8.30E+08 6.08E+08 7.99E+08 3.30E+08 52 42 29 81 62 73 49 175490 Eukaryotic translation initiation factor 4 gamma 1 OS=Homo sapiens OX=9606 GN=EIF4G1 PE=1 SV=4 29 15 sp|O00425|IF2B3_HUMAN 303.55 54 41 48 49 47 44 2.68E+08 8.53E+08 1.28E+09 1.35E+09 7.88E+08 40 28 52 76 101 102 67 63705 Insulin-like growth factor 2 mRNA-binding protein 3 OS=Homo sapiens OX=9606 GN=IGF2BP3 PE=1 SV=2 69 24 sp|Q9P2E9|RRBP1_HUMAN 303.49 38 24 29 23 24 25 6.94E+07 2.30E+08 1.30E+08 1.57E+08 1.40E+08 45 37 45 52 32 34 41 152456 Ribosome-binding protein 1 OS=Homo sapiens OX=9606 GN=RRBP1 PE=1 SV=5 58 57 sp|Q14444|CAPR1_HUMAN 303.1 49 31 33 37 36 28 3.50E+08 1.89E+09 1.69E+09 1.99E+09 1.14E+09 40 38 33 53 52 47 33 78366 Caprin-1 OS=Homo sapiens OX=9606 GN=CAPRIN1 PE=1 SV=2 15 6 sp|P05787|K2C8_HUMAN 302.75 64 43 60 59 61 55 1.54E+08 2.59E+09 4.78E+09 3.85E+09 2.12E+09 52 34 43 137 161 175 82 53704 Keratin type II cytoskeletal 8 OS=Homo sapiens OX=9606 GN=KRT8 PE=1 SV=7 33 14 sp|O00571|DDX3X_HUMAN 298.63 62 57 45 60 60 43 5.29E+08 8.30E+08 1.09E+09 1.21E+09 5.58E+08 45 36 73 69 78 91 60 73244 ATP-dependent RNA helicase DDX3X OS=Homo sapiens OX=9606 GN=DDX3X PE=1 SV=3 27 9 sp|P52272|HNRPM_HUMAN 297.05 61 41 43 53 55 44 1.78E+08 7.46E+08 1.10E+09 1.39E+09 7.34E+08 43 41 40 76 110 120 57 77516 Heterogeneous nuclear ribonucleoprotein M OS=Homo sapiens OX=9606 GN=HNRNPM PE=1 SV=3 14 109 sp|Q9UN86|G3BP2_HUMAN 296.9 41 36 40 38 38 34 3.94E+08 1.83E+09 1.58E+09 2.68E+09 1.58E+09 27 22 54 137 128 149 158 54121 Ras GTPase-activating protein-binding protein 2 OS=Homo sapiens OX=9606 GN=G3BP2 PE=1 SV=2 23 17 sp|P51114|FXR1_HUMAN 295.55 53 31 38 48 52 41 1.89E+08 8.13E+08 1.19E+09 1.42E+09 7.31E+08 46 37 37 85 102 121 89 69721 Fragile X mental retardation syndrome-related protein 1 OS=Homo sapiens OX=9606 GN=FXR1 PE=1 SV=3 62 42 sp|P54886|P5CS_HUMAN 293.05 44 16 32 41 31 9 2.29E+09 3.92E+08 9.15E+08 3.06E+08 3.19E+07 37 35 25 52 95 37 7 87302 Delta-1-pyrroline-5-carboxylate synthase OS=Homo sapiens OX=9606 GN=ALDH18A1 PE=1 SV=2 45 160 sp|P67809|YBOX1_HUMAN 291.47 78 66 66 69 72 71 3.35E+08 7.12E+08 1.87E+09 2.11E+09 1.22E+09 30 20 24 54 65 73 59 35924 Y-box-binding protein 1 OS=Homo sapiens OX=9606 GN=YBX1 PE=1 SV=3 59 16 sp|P10809|CH60_HUMAN 287.62 58 24 43 51 49 29 4.25E+07 3.35E+08 7.08E+08 6.48E+08 1.91E+08 33 32 13 43 69 65 29 61055 60 kDa heat shock protein mitochondrial OS=Homo sapiens OX=9606 GN=HSPD1 PE=1 SV=2 44 47 sp|P17844|DDX5_HUMAN 285.5 51 40 39 41 48 35 1.31E+08 4.72E+08 4.68E+08 1.34E+09 2.64E+08 43 26 38 59 56 83 49 69148 Probable ATP-dependent RNA helicase DDX5 OS=Homo sapiens OX=9606 GN=DDX5 PE=1 SV=1 76 38 sp|P51116|FXR2_HUMAN 284.24 49 24 32 46 44 29 4.75E+07 1.76E+08 3.90E+08 4.57E+08 1.98E+08 33 24 17 38 41 51 33 74223 Fragile X mental retardation syndrome-related protein 2 OS=Homo sapiens OX=9606 GN=FXR2 PE=1 SV=2 48 35 sp|P26599|PTBP1_HUMAN 284.19 63 52 46 39 52 33 3.37E+08 5.20E+08 6.60E+08 7.96E+08 2.89E+08 32 23 62 55 47 62 34 57221 Polypyrimidine tract-binding protein 1 OS=Homo sapiens OX=9606 GN=PTBP1 PE=1 SV=1 77 120 sp|P22626|ROA2_HUMAN 283.85 61 52 49 54 56 48 3.87E+08 4.25E+08 5.33E+08 7.98E+08 5.13E+08 26 18 38 30 35 47 29 37430 Heterogeneous nuclear ribonucleoproteins A2/B1 OS=Homo sapiens OX=9606 GN=HNRNPA2B1 PE=1 SV=2 90 45 sp|A3KMH1|VWA8_HUMAN 282.88 30 1 18 22 18 12 3.18E+06 2.45E+08 2.74E+08 2.48E+08 9.66E+07 50 47 3 38 49 46 22 214823 von Willebrand factor A domain-containing protein 8 OS=Homo sapiens OX=9606 GN=VWA8 PE=1 SV=2 47 59 sp|Q12906|ILF3_HUMAN 275.8 45 34 32 33 36 35 4.24E+08 7.67E+08 6.28E+08 9.13E+08 5.73E+08 45 35 54 49 53 52 61 95339 Interleukin enhancer-binding factor 3 OS=Homo sapiens OX=9606 GN=ILF3 PE=1 SV=3 50 22 sp|Q9Y6M1|IF2B2_HUMAN 275.4 50 38 40 44 42 47 1.34E+08 3.33E+08 4.20E+08 4.46E+08 2.79E+08 33 24 40 45 54 57 50 66121 Insulin-like growth factor 2 mRNA-binding protein 2 OS=Homo sapiens OX=9606 GN=IGF2BP2 PE=1 SV=2 49 116 sp|P31943|HNRH1_HUMAN 273.96 49 41 42 43 48 35 8.49E+07 1.94E+08 3.55E+08 3.89E+08 1.51E+08 24 10 42 51 60 61 41 49229 Heterogeneous nuclear ribonucleoprotein H OS=Homo sapiens OX=9606 GN=HNRNPH1 PE=1 SV=4 66 40 sp|P11142|HSP7C_HUMAN 270.65 43 29 38 35 37 29 1.72E+08 2.73E+08 3.79E+08 5.44E+08 2.61E+08 29 22 32 47 48 50 32 70898 Heat shock cognate 71 kDa protein OS=Homo sapiens OX=9606 GN=HSPA8 PE=1 SV=1 51 43 sp|Q00839|HNRPU_HUMAN 269.84 41 31 27 29 28 26 2.29E+08 5.19E+08 6.40E+08 7.22E+08 4.21E+08 40 35 40 47 51 57 46 90585 Heterogeneous nuclear ribonucleoprotein U OS=Homo sapiens OX=9606 GN=HNRNPU PE=1 SV=6 145 46 sp|Q14157|UBP2L_HUMAN 269.72 29 14 7 24 29 18 3.65E+07 2.98E+07 1.82E+08 2.95E+08 8.01E+07 22 22 11 7 27 40 17 114534 Ubiquitin-associated protein 2-like OS=Homo sapiens OX=9606 GN=UBAP2L PE=1 SV=2 99 44 sp|P48634|PRC2A_HUMAN 266.4 27 4 14 17 20 15 1.93E+07 1.80E+08 2.22E+08 2.23E+08 1.57E+08 36 35 8 26 40 43 25 228861 Protein PRRC2A OS=Homo sapiens OX=9606 GN=PRRC2A PE=1 SV=3 31 68 sp|P62701|RS4X_HUMAN 264.72 74 62 68 72 68 59 2.15E+08 1.29E+09 9.99E+08 1.31E+09 5.54E+08 33 28 39 103 86 101 66 29598 40S ribosomal protein S4 X isoform OS=Homo sapiens OX=9606 GN=RPS4X PE=1 SV=2 198 51 sp|P51659|DHB4_HUMAN 263.44 42 13 21 35 24 16 2.27E+07 4.54E+07 1.43E+08 7.17E+07 5.62E+07 25 23 8 13 25 14 14 79686 Peroxisomal multifunctional enzyme type 2 OS=Homo sapiens OX=9606 GN=HSD17B4 PE=1 SV=3 73 48 sp|Q9NQ94|A1CF_HUMAN 263.41 42 26 37 37 37 30 8.21E+07 3.83E+08 3.70E+08 3.61E+08 1.26E+08 27 22 21 47 47 47 26 65202 APOBEC1 complementation factor OS=Homo sapiens OX=9606 GN=A1CF PE=1 SV=1 52 49 sp|Q92841|DDX17_HUMAN 262.29 46 31 42 42 37 33 1.22E+08 3.08E+08 3.59E+08 4.18E+08 1.78E+08 35 20 31 60 52 52 43 80273 Probable ATP-dependent RNA helicase DDX17 OS=Homo sapiens OX=9606 GN=DDX17 PE=1 SV=2 109 41 sp|Q6PKG0|LARP1_HUMAN 261.27 39 12 24 34 29 13 3.58E+07 2.35E+08 2.73E+08 2.86E+08 6.72E+07 35 28 11 32 37 38 16 123510 La-related protein 1 OS=Homo sapiens OX=9606 GN=LARP1 PE=1 SV=2 41 218 sp|P68133|ACTS_HUMAN 260.89 35 34 30 30 32 31 2.84E+07 2.97E+07 3.96E+07 4.73E+07 5.83E+06 27 1 52 59 61 74 55 42051 Actin alpha skeletal muscle OS=Homo sapiens OX=9606 GN=ACTA1 PE=1 SV=1 41 219 sp|P68032|ACTC_HUMAN 260.89 35 34 30 30 32 31 2.84E+07 2.97E+07 3.96E+07 4.73E+07 5.83E+06 27 1 52 59 61 74 55 42019 Actin alpha cardiac muscle 1 OS=Homo sapiens OX=9606 GN=ACTC1 PE=1 SV=1 75 56 sp|P61978|HNRPK_HUMAN 260.51 58 51 32 47 49 39 7.45E+08 2.86E+08 5.66E+08 6.65E+08 3.79E+08 28 23 62 24 31 35 33 50976 Heterogeneous nuclear ribonucleoprotein K OS=Homo sapiens OX=9606 GN=HNRNPK PE=1 SV=1 87 66 sp|P11388|TOP2A_HUMAN 259.62 30 19 14 17 20 17 8.27E+07 5.12E+07 5.62E+07 1.03E+08 1.26E+08 47 28 35 21 34 38 36 174384 DNA topoisomerase 2-alpha OS=Homo sapiens OX=9606 GN=TOP2A PE=1 SV=3 9 192 sp|P62269|RS18_HUMAN 259.27 71 55 71 71 71 70 2.75E+08 5.22E+09 5.86E+09 5.82E+09 2.95E+09 34 30 38 210 234 198 130 17719 40S ribosomal protein S18 OS=Homo sapiens OX=9606 GN=RPS18 PE=1 SV=3 Heterogeneous nuclear ribonucleoprotein U-like protein 1 OS=Homo sapiens OX=9606 GN=HNRNPUL1 PE=1 119 61 sp|Q9BUJ2|HNRL1_HUMAN 257.75 36 22 21 29 25 17 1.35E+08 2.03E+08 2.75E+08 3.03E+08 1.37E+08 26 23 25 21 30 24 24 95739 SV=2 71 134 sp|P09651|ROA1_HUMAN 257.21 55 38 37 44 48 44 3.21E+08 1.68E+08 8.61E+08 9.86E+08 7.04E+08 33 9 41 23 34 66 29 38747 Heterogeneous nuclear ribonucleoprotein A1 OS=Homo sapiens OX=9606 GN=HNRNPA1 PE=1 SV=5 83 60 sp|P12956|XRCC6_HUMAN 257.1 41 38 27 29 33 25 2.44E+08 2.92E+08 2.22E+08 3.87E+08 1.97E+08 26 24 41 31 27 43 29 69843 X-ray repair cross-complementing protein 6 OS=Homo sapiens OX=9606 GN=XRCC6 PE=1 SV=2 74 55 sp|P07437|TBB5_HUMAN 254.48 68 62 26 39 43 25 1.22E+08 2.49E+07 8.07E+07 9.13E+07 2.88E+07 27 5 74 26 32 35 19 49671 Tubulin beta chain OS=Homo sapiens OX=9606 GN=TUBB PE=1 SV=2 KH domain-containing RNA-binding signal transduction-associated protein 1 OS=Homo sapiens OX=9606 34 113 sp|Q07666|KHDR1_HUMAN 253.93 46 45 28 26 25 22 5.22E+09 2.90E+08 2.44E+08 3.40E+08 2.29E+08 42 26 232 38 37 35 26 48227 GN=KHDRBS1 PE=1 SV=1 144 63 sp|P13645|K1C10_HUMAN 253.1 44 37 20 31 28 25 8.70E+07 4.11E+07 4.84E+07 3.25E+07 1.32E+08 23 13 30 16 18 17 23 58827 Keratin type I cytoskeletal 10 OS=Homo sapiens OX=9606 GN=KRT10 PE=1 SV=6 79 75 sp|O60506|HNRPQ_HUMAN 252.37 45 28 30 27 41 21 1.23E+08 1.42E+08 1.64E+08 2.64E+08 6.96E+07 30 17 36 37 30 46 27 69603 Heterogeneous nuclear ribonucleoprotein Q OS=Homo sapiens OX=9606 GN=SYNCRIP PE=1 SV=2 81 69 sp|Q9NUD5|ZCHC3_HUMAN 251.89 59 37 50 44 50 40 4.04E+07 2.06E+08 2.55E+08 3.66E+08 1.66E+08 24 20 17 43 41 43 27 43547 Zinc finger CCHC domain-containing protein 3 OS=Homo sapiens OX=9606 GN=ZCCHC3 PE=1 SV=2 60 83 sp|Q9BQE3|TBA1C_HUMAN 250.81 52 37 47 40 41 38 4.40E+06 2.00E+06 2.09E+06 19 2 35 53 61 50 18 49895 Tubulin alpha-1C chain OS=Homo sapiens OX=9606 GN=TUBA1C PE=1 SV=1 112 77 sp|P43243|MATR3_HUMAN 250.81 31 17 22 25 21 21 5.14E+07 1.99E+08 2.34E+08 2.79E+08 1.80E+08 23 19 18 26 31 28 28 94623 Matrin-3 OS=Homo sapiens OX=9606 GN=MATR3 PE=1 SV=2 36 87 sp|P23396|RS3_HUMAN 250.65 87 72 76 86 87 69 3.35E+08 1.33E+09 9.18E+08 1.57E+09 8.21E+08 29 28 41 88 73 82 60 26688 40S ribosomal protein S3 OS=Homo sapiens OX=9606 GN=RPS3 PE=1 SV=2 95 65 sp|P11021|BIP_HUMAN 250.28 38 33 32 35 35 30 1.18E+08 2.72E+08 2.79E+08 3.82E+08 1.54E+08 23 20 22 29 31 36 29 72333 Endoplasmic reticulum chaperone BiP OS=Homo sapiens OX=9606 GN=HSPA5 PE=1 SV=2 57 78 sp|P68363|TBA1B_HUMAN 249.74 52 41 47 43 41 34 1.26E+07 1.11E+07 2.10E+07 1.57E+07 5.48E+06 19 1 41 51 63 49 17 50152 Tubulin alpha-1B chain OS=Homo sapiens OX=9606 GN=TUBA1B PE=1 SV=1 182 54 sp|P02751|FINC_HUMAN 249.47 13 6 7 6 8 8 4.12E+07 5.40E+07 4.92E+07 9.63E+07 7.09E+07 28 25 17 15 13 19 14 272318 Fibronectin OS=Homo sapiens OX=9606 GN=FN1 PE=1 SV=5 143 80 sp|P63010|AP2B1_HUMAN 247.93 25 12 17 15 18 17 2.61E+07 9.54E+07 8.09E+07 1.33E+08 6.63E+07 25 14 14 26 21 28 19 104553 AP-2 complex subunit beta OS=Homo sapiens OX=9606 GN=AP2B1 PE=1 SV=1 88 150 sp|P38159|RBMX_HUMAN 247.58 43 32 35 36 35 41 1.46E+08 2.68E+08 4.06E+08 4.01E+08 3.77E+08 24 17 26 37 34 36 31 42332 RNA-binding motif protein X chromosome OS=Homo sapiens OX=9606 GN=RBMX PE=1 SV=3 121 52 sp|Q9NZB2|F120A_HUMAN 247.53 31 12 24 19 26 21 2.64E+07 1.19E+08 1.12E+08 1.62E+08 8.15E+07 31 27 11 31 24 37 21 121888 Constitutive coactivator of PPAR-gamma-like protein 1 OS=Homo sapiens OX=9606 GN=FAM120A PE=1 SV=2 129 79 sp|P49916|DNLI3_HUMAN 246.67 29 23 14 13 18 21 1.14E+08 9.57E+07 5.73E+07 2.00E+08 1.47E+08 31 28 28 21 18 27 24 112907 DNA ligase 3 OS=Homo sapiens OX=9606 GN=LIG3 PE=1 SV=2 123 86 sp|P19338|NUCL_HUMAN 246.49 31 23 18 20 26 9 1.01E+08 1.53E+08 1.54E+08 3.48E+08 4.59E+07 26 19 27 19 23 41 12 76615 Nucleolin OS=Homo sapiens OX=9606 GN=NCL PE=1 SV=3 82 62 sp|P68371|TBB4B_HUMAN 245.01 64 54 26 35 39 25 3.69E+07 5.56E+07 7.33E+07 4.70E+07 2.09E+07 24 2 67 24 30 33 17 49831 Tubulin beta-4B chain OS=Homo sapiens OX=9606 GN=TUBB4B PE=1 SV=1 111 58 sp|Q9NR30|DDX21_HUMAN 244.59 40 11 26 30 29 23 8.41E+06 1.25E+08 2.03E+08 2.78E+08 1.16E+08 32 22 6 33 33 37 21 87344 Nucleolar RNA helicase 2 OS=Homo sapiens OX=9606 GN=DDX21 PE=1 SV=5 68 110 sp|P15880|RS2_HUMAN 243.93 61 39 52 47 56 50 1.81E+08 1.24E+09 1.09E+09 1.30E+09 9.52E+08 27 23 18 49 49 51 39 31324 40S ribosomal protein S2 OS=Homo sapiens OX=9606 GN=RPS2 PE=1 SV=2 46 92 sp|P61247|RS3A_HUMAN 243.44 68 53 52 52 64 54 2.46E+08 1.16E+09 1.16E+09 1.41E+09 6.92E+08 33 30 29 67 64 72 49 29945 40S ribosomal protein S3a OS=Homo sapiens OX=9606 GN=RPS3A PE=1 SV=2 104 88 sp|O95782|AP2A1_HUMAN 242.81 36 18 23 20 27 25 2.40E+07 1.17E+08 1.09E+08 1.42E+08 9.51E+07 32 20 17 30 24 36 31 107546 AP-2 complex subunit alpha-1 OS=Homo sapiens OX=9606 GN=AP2A1 PE=1 SV=3 63 148 sp|Q12905|ILF2_HUMAN 241.22 52 39 36 37 46 30 2.70E+08 4.28E+08 4.82E+08 5.85E+08 3.49E+08 21 19 34 44 43 48 47 43062 Interleukin enhancer-binding factor 2 OS=Homo sapiens OX=9606 GN=ILF2 PE=1 SV=2 98 84 sp|P13010|XRCC5_HUMAN 240.36 45 33 23 19 31 20 1.60E+08 2.25E+08 1.32E+08 2.52E+08 1.21E+08 36 31 38 28 18 31 29 82705 X-ray repair cross-complementing protein 5 OS=Homo sapiens OX=9606 GN=XRCC5 PE=1 SV=3 78 70 sp|Q06787|FMR1_HUMAN 240.1 51 21 29 34 39 28 3.40E+07 1.70E+08 2.74E+08 3.54E+08 1.52E+08 35 24 17 36 43 49 29 71175 Synaptic functional regulator FMR1 OS=Homo sapiens OX=9606 GN=FMR1 PE=1 SV=1 223 72 sp|P49327|FAS_HUMAN 238.48 12 4 7 6 9 2 8.99E+06 2.80E+07 4.92E+07 6.49E+07 8.67E+06 27 21 7 13 17 20 5 273424 Fatty acid synthase OS=Homo sapiens OX=9606 GN=FASN PE=1 SV=3 102 98 sp|Q9Y2W1|TR150_HUMAN 238.25 24 10 14 16 17 21 6.77E+07 2.82E+08 3.79E+08 4.31E+08 4.67E+08 26 23 12 30 28 30 36 108666 Thyroid hormone receptor-associated protein 3 OS=Homo sapiens OX=9606 GN=THRAP3 PE=1 SV=2 252 53 sp|Q01082|SPTB2_HUMAN 237.14 14 3 6 3 9 6 7.67E+06 2.56E+07 1.03E+07 3.86E+07 2.16E+07 29 22 6 10 6 15 13 274608 Spectrin beta chain non-erythrocytic 1 OS=Homo sapiens OX=9606 GN=SPTBN1 PE=1 SV=2 94 100 sp|Q9Y3I0|RTCB_HUMAN 236.26 42 23 29 38 41 28 8.12E+07 2.27E+08 4.10E+08 4.07E+08 1.94E+08 21 18 15 29 35 44 25 55210 RNA-splicing ligase RtcB homolog OS=Homo sapiens OX=9606 GN=RTCB PE=1 SV=1 107 220 sp|P16989|YBOX3_HUMAN 235.6 54 12 31 54 45 35 2.37E+07 6.47E+07 5.73E+07 2.29E+07 15 6 8 27 37 34 32 40090 Y-box-binding protein 3 OS=Homo sapiens OX=9606 GN=YBX3 PE=1 SV=4 86 206 sp|P62753|RS6_HUMAN 235.31 46 36 41 41 41 39 7.97E+07 5.61E+08 5.13E+08 7.23E+08 4.35E+08 22 18 21 34 39 43 30 28681 40S ribosomal protein S6 OS=Homo sapiens OX=9606 GN=RPS6 PE=1 SV=1 64 124 sp|Q15717|ELAV1_HUMAN 235.05 61 42 58 60 54 56 1.57E+08 5.27E+08 6.08E+08 6.83E+08 3.10E+08 24 18 26 49 52 56 33 36092 ELAV-like protein 1 OS=Homo sapiens OX=9606 GN=ELAVL1 PE=1 SV=2 160 340 sp|P25398|RS12_HUMAN 234.67 77 42 40 66 77 41 4.20E+07 1.38E+08 2.07E+08 3.33E+08 1.25E+08 14 13 12 17 23 29 10 14515 40S ribosomal protein S12 OS=Homo sapiens OX=9606 GN=RPS12 PE=1 SV=3 139 127 sp|P26196|DDX6_HUMAN 234.57 47 19 34 33 41 30 4.11E+07 1.81E+08 1.92E+08 3.44E+08 9.53E+07 18 15 10 26 25 36 16 54417 Probable ATP-dependent RNA helicase DDX6 OS=Homo sapiens OX=9606 GN=DDX6 PE=1 SV=2 227 111 sp|O15027|SC16A_HUMAN 234.09 24 23 0 0 1 0 2.54E+08 36 32 52 2 2 3 2 251891 Protein transport protein Sec16A OS=Homo sapiens OX=9606 GN=SEC16A PE=1 SV=4 137 114 sp|Q5T0N5|FBP1L_HUMAN 233.77 41 1 28 29 38 24 1.97E+06 1.72E+08 2.01E+08 2.72E+08 1.01E+08 28 26 1 29 29 38 17 70066 Formin-binding protein 1-like OS=Homo sapiens OX=9606 GN=FNBP1L PE=1 SV=3 124 133 sp|P14866|HNRPL_HUMAN 233.49 47 44 19 31 27 25 4.20E+08 1.35E+08 1.85E+08 1.46E+08 1.09E+08 18 17 49 17 24 19 14 64133 Heterogeneous nuclear ribonucleoprotein L OS=Homo sapiens OX=9606 GN=HNRNPL PE=1 SV=2 215 96 sp|Q96PK6|RBM14_HUMAN 232.24 33 16 15 17 21 27 7.98E+07 8.25E+07 1.76E+08 2.17E+08 1.90E+08 18 18 10 12 13 15 17 69492 RNA-binding protein 14 OS=Homo sapiens OX=9606 GN=RBM14 PE=1 SV=2 122 85 sp|P11387|TOP1_HUMAN 231.04 34 21 27 19 24 17 8.25E+07 3.27E+08 1.65E+08 2.24E+08 1.25E+08 29 27 19 36 20 29 20 90726 DNA topoisomerase 1 OS=Homo sapiens OX=9606 GN=TOP1 PE=1 SV=2 93 104 sp|O43390|HNRPR_HUMAN 230.4 30 24 24 22 26 20 7.93E+07 9.75E+07 1.32E+08 1.10E+08 7.15E+07 23 11 30 33 28 36 23 70943 Heterogeneous nuclear ribonucleoprotein R OS=Homo sapiens OX=9606 GN=HNRNPR PE=1 SV=1 85 142 sp|P55795|HNRH2_HUMAN 229.83 40 25 28 35 39 30 8.60E+06 1.15E+07 4.28E+07 6.93E+07 3.72E+07 19 6 25 26 39 45 33 49264 Heterogeneous nuclear ribonucleoprotein H2 OS=Homo sapiens OX=9606 GN=HNRNPH2 PE=1 SV=1 147 183 sp|P51991|ROA3_HUMAN 229.62 41 24 28 29 34 31 5.89E+07 1.14E+08 1.43E+08 2.02E+08 1.29E+08 23 13 12 21 17 31 20 39595 Heterogeneous nuclear ribonucleoprotein A3 OS=Homo sapiens OX=9606 GN=HNRNPA3 PE=1 SV=2 136 91 sp|Q02880|TOP2B_HUMAN 229.06 19 10 7 10 10 13 1.79E+07 1.89E+07 2.07E+07 4.65E+07 3.24E+07 34 15 23 13 28 20 28 183266 DNA topoisomerase 2-beta OS=Homo sapiens OX=9606 GN=TOP2B PE=1 SV=3 101 90 sp|P04264|K2C1_HUMAN 227.94 36 29 23 25 18 24 6.26E+07 5.32E+07 5.89E+07 3.59E+07 1.28E+08 26 12 28 32 31 24 27 66039 Keratin type II cytoskeletal 1 OS=Homo sapiens OX=9606 GN=KRT1 PE=1 SV=6 91 173 sp|P07910|HNRPC_HUMAN 227.77 46 36 36 40 37 34 1.27E+08 1.68E+08 2.43E+08 3.49E+08 2.87E+08 21 8 22 31 34 37 30 33670 Heterogeneous nuclear ribonucleoproteins C1/C2 OS=Homo sapiens OX=9606 GN=HNRNPC PE=1 SV=4 116 76 sp|Q92499|DDX1_HUMAN 227.71 33 19 19 31 24 17 5.09E+07 1.81E+08 2.27E+08 2.77E+08 7.92E+07 22 20 17 24 37 37 14 82432 ATP-dependent RNA helicase DDX1 OS=Homo sapiens OX=9606 GN=DDX1 PE=1 SV=2 108 108 sp|O95793|STAU1_HUMAN 227.58 38 22 32 32 31 27 6.49E+07 2.82E+08 2.78E+08 3.05E+08 1.50E+08 19 17 18 30 34 36 19 63182 Double-stranded RNA-binding protein Staufen homolog 1 OS=Homo sapiens OX=9606 GN=STAU1 PE=1 SV=2 103 128 sp|Q9BVA1|TBB2B_HUMAN 227.27 48 38 18 27 28 19 4.06E+06 3.96E+06 18 1 56 20 23 26 15 49953 Tubulin beta-2B chain OS=Homo sapiens OX=9606 GN=TUBB2B PE=1 SV=1 103 129 sp|Q13885|TBB2A_HUMAN 227.27 48 38 18 27 28 19 4.06E+06 3.96E+06 18 1 56 20 23 26 15 49907 Tubulin beta-2A chain OS=Homo sapiens OX=9606 GN=TUBB2A PE=1 SV=1 161 101 sp|Q2Q1W2|LIN41_HUMAN 226.94 25 9 21 21 22 13 2.13E+07 1.76E+08 1.83E+08 2.05E+08 7.82E+07 17 17 7 26 25 20 11 93385 E3 ubiquitin-protein ligase TRIM71 OS=Homo sapiens OX=9606 GN=TRIM71 PE=1 SV=1 106 315 sp|P16401|H15_HUMAN 226.78 37 25 32 25 37 27 2.97E+08 1.17E+09 4.69E+08 9.31E+08 8.00E+08 16 12 23 38 20 26 32 22580 Histone H1.5 OS=Homo sapiens OX=9606 GN=H1-5 PE=1 SV=3 149 226 sp|P62241|RS8_HUMAN 226.74 62 47 44 50 56 43 1.06E+08 4.18E+08 5.52E+08 5.86E+08 1.95E+08 16 15 10 21 24 29 15 24205 40S ribosomal protein S8 OS=Homo sapiens OX=9606 GN=RPS8 PE=1 SV=2 65 329 sp|P62829|RL23_HUMAN 226.74 60 51 60 60 60 59 9.29E+07 6.56E+08 1.13E+09 1.03E+09 6.68E+08 16 12 13 54 61 56 27 14865 60S ribosomal protein L23 OS=Homo sapiens OX=9606 GN=RPL23 PE=1 SV=1 183 105 sp|Q96CW1|AP2M1_HUMAN 225.67 46 16 24 33 37 28 1.61E+07 7.93E+07 1.52E+08 1.91E+08 9.74E+07 20 19 8 13 19 24 13 49655 AP-2 complex subunit mu OS=Homo sapiens OX=9606 GN=AP2M1 PE=1 SV=2 100 147 sp|P35749|MYH11_HUMAN 225.04 12 8 7 8 8 8 0.00E+00 30 1 24 30 30 26 33 227337 Myosin-11 OS=Homo sapiens OX=9606 GN=MYH11 PE=1 SV=3 125 168 sp|P68104|EF1A1_HUMAN 224.03 38 37 24 30 30 25 4.59E+07 8.33E+07 1.22E+08 1.01E+08 1.99E+07 17 9 21 21 26 36 18 50141 Elongation factor 1-alpha 1 OS=Homo sapiens OX=9606 GN=EEF1A1 PE=1 SV=1 125 169 sp|Q5VTE0|EF1A3_HUMAN 224.03 38 37 24 30 30 25 4.59E+07 8.33E+07 1.22E+08 1.01E+08 1.99E+07 17 9 21 21 26 36 18 50185 Putative elongation factor 1-alpha-like 3 OS=Homo sapiens OX=9606 GN=EEF1A1P5 PE=5 SV=1 169 103 sp|P63244|RACK1_HUMAN 220.71 60 36 44 43 52 42 5.07E+07 6.98E+08 1.29E+08 1.70E+08 1.09E+08 19 19 16 21 16 20 13 35077 Receptor of activated protein C kinase 1 OS=Homo sapiens OX=9606 GN=RACK1 PE=1 SV=3 157 388 sp|P10412|H14_HUMAN 219.44 38 17 32 26 38 26 1.03E+08 4.86E+07 9.10E+07 7.20E+07 15 3 12 22 20 24 15 21865 Histone H1.4 OS=Homo sapiens OX=9606 GN=H1-4 PE=1 SV=2 225 130 sp|P38646|GRP75_HUMAN 218.31 30 15 16 19 20 16 2.74E+07 3.73E+07 2.44E+08 6.70E+07 3.08E+07 18 15 12 11 16 13 10 73681 Stress-70 protein mitochondrial OS=Homo sapiens OX=9606 GN=HSPA9 PE=1 SV=2 263 119 sp|Q8WWI1|LMO7_HUMAN 218.05 15 5 0 8 10 9 1.24E+07 2.86E+07 3.06E+07 4.22E+07 18 16 9 2 10 12 14 192694 LIM domain only protein 7 OS=Homo sapiens OX=9606 GN=LMO7 PE=1 SV=3 53 414 sp|P62805|H4_HUMAN 216.86 68 65 67 63 64 60 9.91E+08 1.56E+09 1.48E+09 1.81E+09 1.70E+09 21 21 35 49 41 55 48 11367 Histone H4 OS=Homo sapiens OX=9606 GN=H4C1 PE=1 SV=2 96 126 sp|P36578|RL4_HUMAN 216.8 43 20 37 42 36 15 8.17E+07 1.61E+08 1.17E+08 1.42E+08 2.83E+07 18 18 51 40 25 24 7 47697 60S ribosomal protein L4 OS=Homo sapiens OX=9606 GN=RPL4 PE=1 SV=5 138 178 sp|P52597|HNRPF_HUMAN 216.58 35 24 25 35 33 24 4.91E+07 1.19E+08 1.89E+08 1.94E+08 1.30E+08 16 10 20 21 25 29 19 45672 Heterogeneous nuclear ribonucleoprotein F OS=Homo sapiens OX=9606 GN=HNRNPF PE=1 SV=3 208 95 sp|P78527|PRKDC_HUMAN 216.48 8 3 5 2 3 3 1.37E+07 4.18E+07 1.12E+07 2.49E+07 1.80E+07 29 23 10 24 9 14 12 469093 DNA-dependent protein kinase catalytic subunit OS=Homo sapiens OX=9606 GN=PRKDC PE=1 SV=3 367 135 sp|Q7Z2W4|ZCCHV_HUMAN 216.22 23 4 3 18 13 7 7.36E+06 6.63E+06 5.80E+07 5.42E+07 1.27E+07 14 14 3 2 11 8 4 101431 Zinc finger CCCH-type antiviral protein 1 OS=Homo sapiens OX=9606 GN=ZC3HAV1 PE=1 SV=3 280 172 sp|Q9Y262|EIF3L_HUMAN 214.05 27 5 14 16 19 15 2.02E+06 6.63E+07 5.26E+07 3.82E+07 2.25E+07 14 13 2 12 8 10 10 66727 Eukaryotic translation initiation factor 3 subunit L OS=Homo sapiens OX=9606 GN=EIF3L PE=1 SV=1 270 284 sp|Q00577|PURA_HUMAN 214.02 31 25 26 28 28 27 4.92E+07 4.79E+07 9.87E+07 1.13E+08 2.32E+07 10 7 8 10 10 12 8 34911 Transcriptional activator protein Pur-alpha OS=Homo sapiens OX=9606 GN=PURA PE=1 SV=2 80 163 sp|P62280|RS11_HUMAN 213.7 77 66 69 68 77 66 2.03E+08 7.98E+08 7.67E+08 7.65E+08 6.89E+08 22 17 23 34 37 48 29 18431 40S ribosomal protein S11 OS=Homo sapiens OX=9606 GN=RPS11 PE=1 SV=3 97 125 sp|Q9UN81|LORF1_HUMAN 213.65 48 22 36 34 44 38 6.41E+07 4.04E+08 5.13E+08 6.32E+08 2.52E+08 20 18 11 28 42 38 25 40056 LINE-1 retrotransposable element ORF1 protein OS=Homo sapiens OX=9606 GN=L1RE1 PE=1 SV=1 Lipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex mitochondrial 224 107 sp|P11182|ODB2_HUMAN 213.34 48 46 3 4 5 12 2.80E+08 9.17E+05 9.06E+05 1.11E+07 26 21 49 3 3 3 6 53487 OS=Homo sapiens OX=9606 GN=DBT PE=1 SV=3 Pre-mRNA-splicing factor ATP-dependent RNA helicase DHX15 OS=Homo sapiens OX=9606 GN=DHX15 PE=1 162 94 sp|O43143|DHX15_HUMAN 213.13 27 12 19 17 21 16 2.43E+07 8.77E+07 1.01E+08 1.28E+08 8.01E+07 20 17 8 20 21 22 18 90933 SV=2 233 174 sp|Q99856|ARI3A_HUMAN 212.72 30 20 11 14 18 24 9.07E+07 3.21E+07 6.17E+07 6.62E+07 1.12E+08 13 12 14 7 12 10 14 62889 AT-rich interactive domain-containing protein 3A OS=Homo sapiens OX=9606 GN=ARID3A PE=1 SV=2 135 383 sp|P62263|RS14_HUMAN 212.54 70 40 69 42 40 49 9.26E+07 5.05E+08 4.36E+08 4.95E+08 4.09E+08 13 13 11 28 22 22 32 16273 40S ribosomal protein S14 OS=Homo sapiens OX=9606 GN=RPS14 PE=1 SV=3 283 136 sp|Q99613|EIF3C_HUMAN 212.14 21 3 18 8 10 11 5.66E+06 6.18E+07 2.50E+07 5.09E+07 3.57E+07 18 16 2 17 6 9 10 105344 Eukaryotic translation initiation factor 3 subunit C OS=Homo sapiens OX=9606 GN=EIF3C PE=1 SV=1 Eukaryotic translation initiation factor 3 subunit C-like protein OS=Homo sapiens OX=9606 GN=EIF3CL PE=1 283 137 sp|B5ME19|EIFCL_HUMAN 212.14 21 3 18 8 10 11 5.66E+06 6.18E+07 2.50E+07 5.09E+07 3.57E+07 18 16 2 17 6 9 10 105473 SV=1 166 324 sp|P16403|H12_HUMAN 211.97 39 25 34 25 39 25 1.29E+07 8.88E+07 4.52E+07 7.61E+07 1.54E+07 14 1 13 21 19 22 14 21365 Histone H1.2 OS=Homo sapiens OX=9606 GN=H1-2 PE=1 SV=2 177 153 sp|P38919|IF4A3_HUMAN 211.54 38 25 26 28 32 23 3.62E+07 7.25E+07 9.83E+07 1.35E+08 7.93E+07 18 14 12 18 16 20 16 46871 Eukaryotic initiation factor 4A-III OS=Homo sapiens OX=9606 GN=EIF4A3 PE=1 SV=4 187 97 sp|O94973|AP2A2_HUMAN 211.46 25 7 14 17 22 14 3.77E+07 2.59E+07 4.82E+07 2.58E+07 21 9 6 16 14 23 17 103960 AP-2 complex subunit alpha-2 OS=Homo sapiens OX=9606 GN=AP2A2 PE=1 SV=2 153 155 sp|P18124|RL7_HUMAN 211.05 58 16 55 46 49 44 1.57E+07 2.38E+08 1.30E+08 1.93E+08 1.10E+08 20 16 5 33 19 26 13 29226 60S ribosomal protein L7 OS=Homo sapiens OX=9606 GN=RPL7 PE=1 SV=1 105 413 sp|Q02539|H11_HUMAN 210.91 42 27 37 31 42 27 2.14E+07 1.47E+08 9.12E+07 1.85E+08 9.09E+07 12 6 8 45 30 35 22 21842 Histone H1.1 OS=Homo sapiens OX=9606 GN=H1-1 PE=1 SV=3 172 389 sp|P16402|H13_HUMAN 210.55 35 17 30 24 35 17 4.42E+06 1.71E+06 4.87E+06 13 1 12 20 19 21 13 22350 Histone H1.3 OS=Homo sapiens OX=9606 GN=H1-3 PE=1 SV=2 185 164 sp|P04406|G3P_HUMAN 209.9 48 40 38 44 42 9 8.29E+07 8.31E+07 2.57E+08 2.52E+08 2.75E+07 14 13 14 12 25 21 2 36053 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens OX=9606 GN=GAPDH PE=1 SV=3 304 122 sp|Q13813|SPTN1_HUMAN 208.26 11 3 3 2 6 3 1.15E+07 1.14E+07 8.58E+06 4.46E+07 2.25E+07 22 18 6 6 4 11 9 284538 Spectrin alpha chain non-erythrocytic 1 OS=Homo sapiens OX=9606 GN=SPTAN1 PE=1 SV=3 237 190 sp|P05388|RLA0_HUMAN 207.18 49 34 31 31 36 34 4.55E+07 7.81E+07 1.19E+08 1.34E+08 5.80E+07 15 13 11 13 9 12 11 34274 60S acidic ribosomal protein P0 OS=Homo sapiens OX=9606 GN=RPLP0 PE=1 SV=1 133 167 sp|Q32P51|RA1L2_HUMAN 207.14 58 27 26 43 49 31 1.25E+07 6.72E+06 1.27E+07 26 2 26 18 21 37 15 34225 Heterogeneous nuclear ribonucleoprotein A1-like 2 OS=Homo sapiens OX=9606 GN=HNRNPA1L2 PE=2 SV=2 220 112 sp|P08670|VIME_HUMAN 205.02 47 4 27 33 25 15 3.83E+07 7.45E+07 4.06E+07 1.86E+07 20 14 5 18 21 13 8 53652 Vimentin OS=Homo sapiens OX=9606 GN=VIM PE=1 SV=4 212 102 sp|P08238|HS90B_HUMAN 204.97 32 22 17 16 19 12 2.87E+07 5.07E+07 6.04E+07 1.03E+08 3.55E+07 21 10 14 13 14 17 9 83264 Heat shock protein HSP 90-beta OS=Homo sapiens OX=9606 GN=HSP90AB1 PE=1 SV=4 118 175 sp|Q07955|SRSF1_HUMAN 204.74 56 38 44 53 53 48 6.99E+07 2.55E+08 2.05E+08 4.26E+08 2.99E+08 17 16 16 24 23 31 32 27745 Serine/arginine-rich splicing factor 1 OS=Homo sapiens OX=9606 GN=SRSF1 PE=1 SV=2 165 176 sp|Q9Y224|RTRAF_HUMAN 204.72 53 18 39 50 39 38 1.83E+07 1.01E+08 7.22E+08 9.37E+08 1.29E+08 14 13 6 14 22 31 14 28068 RNA transcription translation and transport factor protein OS=Homo sapiens OX=9606 GN=RTRAF PE=1 SV=1 190 132 sp|Q14152|EIF3A_HUMAN 204.5 18 3 13 7 13 5 6.71E+06 8.02E+07 2.44E+07 2.23E+08 2.18E+07 28 22 6 21 14 24 10 166569 Eukaryotic translation initiation factor 3 subunit A OS=Homo sapiens OX=9606 GN=EIF3A PE=1 SV=1 221 165 sp|P60842|IF4A1_HUMAN 203.35 38 23 23 27 33 21 2.09E+07 6.70E+07 6.38E+07 6.59E+07 3.06E+07 15 11 8 12 17 20 8 46154 Eukaryotic initiation factor 4A-I OS=Homo sapiens OX=9606 GN=EIF4A1 PE=1 SV=1 175 230 sp|P46782|RS5_HUMAN 203.21 43 27 39 34 39 36 4.67E+07 2.61E+08 2.38E+08 3.66E+08 1.32E+08 13 13 11 21 20 21 11 22876 40S ribosomal protein S5 OS=Homo sapiens OX=9606 GN=RPS5 PE=1 SV=4 186 246 sp|O14979|HNRDL_HUMAN 202.76 30 23 10 16 12 11 1.28E+08 3.28E+07 4.10E+07 4.05E+07 3.34E+07 18 11 26 12 14 16 8 46438 Heterogeneous nuclear ribonucleoprotein D-like OS=Homo sapiens OX=9606 GN=HNRNPDL PE=1 SV=3 141 115 sp|Q9NYF8|BCLF1_HUMAN 200.3 24 7 16 19 19 15 3.39E+07 1.50E+08 1.53E+08 1.18E+08 1.11E+08 23 20 7 34 25 19 26 106122 Bcl-2-associated transcription factor 1 OS=Homo sapiens OX=9606 GN=BCLAF1 PE=1 SV=2 cAMP-dependent protein kinase type II-alpha regulatory subunit OS=Homo sapiens OX=9606 GN=PRKAR2A PE=1 314 141 sp|P13861|KAP2_HUMAN 199.09 44 0 24 43 31 6 4.01E+07 8.65E+07 4.03E+07 8.81E+06 15 12 0 8 17 11 2 45518 SV=2 294 158 sp|Q10570|CPSF1_HUMAN 198.47 13 5 6 6 5 7 1.03E+07 3.02E+07 2.19E+07 2.29E+07 1.74E+07 19 13 8 9 9 5 8 160883 Cleavage and polyadenylation specificity factor subunit 1 OS=Homo sapiens OX=9606 GN=CPSF1 PE=1 SV=2 306 221 sp|Q14258|TRI25_HUMAN 198.31 24 1 15 19 19 11 2.41E+06 5.01E+07 4.76E+07 4.42E+07 1.92E+07 12 12 1 11 10 10 7 70974 E3 ubiquitin/ISG15 ligase TRIM25 OS=Homo sapiens OX=9606 GN=TRIM25 PE=1 SV=2 142 240 sp|P62081|RS7_HUMAN 198.19 54 49 36 36 43 38 8.72E+07 4.19E+08 2.13E+08 3.70E+08 2.67E+08 15 15 23 22 15 23 26 22127 40S ribosomal protein S7 OS=Homo sapiens OX=9606 GN=RPS7 PE=1 SV=1 150 460 sp|P08708|RS17_HUMAN 196.7 53 52 41 53 53 33 4.63E+07 1.49E+08 3.04E+08 4.63E+08 1.55E+08 11 11 10 14 25 36 13 15550 40S ribosomal protein S17 OS=Homo sapiens OX=9606 GN=RPS17 PE=1 SV=2 72 262 sp|P62249|RS16_HUMAN 196.67 60 58 59 59 53 54 1.48E+08 1.02E+09 8.86E+08 9.27E+08 4.89E+08 16 16 20 51 41 39 40 16445 40S ribosomal protein S16 OS=Homo sapiens OX=9606 GN=RPS16 PE=1 SV=2 251 156 sp|Q71RC2|LARP4_HUMAN 196.32 25 9 14 19 15 10 2.60E+07 5.98E+07 7.26E+07 7.55E+07 2.41E+07 15 14 5 12 15 14 6 80596 La-related protein 4 OS=Homo sapiens OX=9606 GN=LARP4 PE=1 SV=3 67 256 sp|P62277|RS13_HUMAN 196.01 61 44 50 56 56 48 2.26E+08 9.93E+08 9.31E+08 8.73E+08 5.03E+08 17 11 56 49 35 33 31 17222 40S ribosomal protein S13 OS=Homo sapiens OX=9606 GN=RPS13 PE=1 SV=2 204 234 sp|P62424|RL7A_HUMAN 195.75 41 19 30 38 29 19 2.53E+07 1.26E+08 1.68E+08 1.59E+08 7.08E+07 13 11 5 19 23 19 5 29996 60S ribosomal protein L7a OS=Homo sapiens OX=9606 GN=RPL7A PE=1 SV=2 273 189 sp|Q9Y3F4|STRAP_HUMAN 195.54 42 23 20 35 37 25 2.41E+07 2.66E+07 3.91E+07 8.09E+07 2.81E+07 11 11 8 6 11 14 7 38438 Serine-threonine kinase receptor-associated protein OS=Homo sapiens OX=9606 GN=STRAP PE=1 SV=1 256 138 sp|Q9NUL3|STAU2_HUMAN 195.41 38 5 20 19 23 15 1.53E+07 5.26E+07 6.25E+07 5.26E+07 4.26E+07 18 15 4 14 14 12 7 62609 Double-stranded RNA-binding protein Staufen homolog 2 OS=Homo sapiens OX=9606 GN=STAU2 PE=1 SV=2 250 131 sp|Q96I24|FUBP3_HUMAN 195.05 36 11 22 24 31 11 7.80E+06 7.06E+07 9.15E+07 1.31E+08 2.43E+07 18 15 3 12 13 17 7 61640 Far upstream element-binding protein 3 OS=Homo sapiens OX=9606 GN=FUBP3 PE=1 SV=2 206 412 sp|Q16629|SRSF7_HUMAN 194.95 30 22 30 27 27 27 8.59E+07 2.34E+08 3.40E+08 3.51E+08 3.54E+08 10 9 11 15 15 13 17 27367 Serine/arginine-rich splicing factor 7 OS=Homo sapiens OX=9606 GN=SRSF7 PE=1 SV=1 156 143 sp|P35908|K22E_HUMAN 194.92 26 18 13 12 13 18 1.19E+07 1.25E+07 2.13E+07 1.91E+07 2.76E+07 18 8 18 21 18 16 22 65433 Keratin type II cytoskeletal 2 epidermal OS=Homo sapiens OX=9606 GN=KRT2 PE=1 SV=2 248 210 sp|Q9NUQ6|SPS2L_HUMAN 194.84 27 8 19 20 24 14 3.95E+06 7.21E+07 7.19E+07 8.26E+07 4.26E+07 10 10 3 14 15 14 7 61729 SPATS2-like protein OS=Homo sapiens OX=9606 GN=SPATS2L PE=1 SV=2 235 117 sp|Q9C075|K1C23_HUMAN 194.01 51 0 29 48 34 17 9.89E+07 1.82E+08 5.76E+07 2.57E+07 16 13 0 14 22 14 6 48131 Keratin type I cytoskeletal 23 OS=Homo sapiens OX=9606 GN=KRT23 PE=1 SV=2 397 203 sp|Q9Y5X1|SNX9_HUMAN 194 29 29 0 2 2 2 1.71E+08 1.64E+06 1.56E+06 6.38E+05 14 13 22 0 1 1 1 66592 Sorting nexin-9 OS=Homo sapiens OX=9606 GN=SNX9 PE=1 SV=1 209 370 sp|Q01844|EWS_HUMAN 193.67 15 14 13 14 15 15 1.63E+08 2.56E+08 2.57E+08 4.05E+08 2.38E+08 9 9 11 15 15 14 14 68478 RNA-binding protein EWS OS=Homo sapiens OX=9606 GN=EWSR1 PE=1 SV=1 320 223 sp|P18887|XRCC1_HUMAN 193.57 22 13 11 10 10 17 3.17E+07 3.48E+07 4.94E+07 4.61E+07 3.83E+07 11 9 9 7 6 5 10 69477 DNA repair protein XRCC1 OS=Homo sapiens OX=9606 GN=XRCC1 PE=1 SV=2 266 146 sp|P07900|HS90A_HUMAN 193.1 23 14 15 11 15 9 5.64E+06 2.14E+07 1.17E+07 2.34E+07 4.57E+06 15 6 11 12 9 11 6 84660 Heat shock protein HSP 90-alpha OS=Homo sapiens OX=9606 GN=HSP90AA1 PE=1 SV=5 295 149 sp|Q9H0A0|NAT10_HUMAN 192.93 21 2 4 7 11 13 4.22E+06 1.20E+07 3.30E+07 4.68E+07 4.94E+07 19 18 2 4 9 11 13 115730 RNA cytidine acetyltransferase OS=Homo sapiens OX=9606 GN=NAT10 PE=1 SV=2 174 310 sp|Q13151|ROA0_HUMAN 192.9 34 15 28 31 31 22 2.88E+07 8.82E+07 1.37E+08 1.67E+08 7.02E+07 13 8 8 17 19 27 13 30841 Heterogeneous nuclear ribonucleoprotein A0 OS=Homo sapiens OX=9606 GN=HNRNPA0 PE=1 SV=1 173 195 sp|P05141|ADT2_HUMAN 192.57 41 22 36 41 34 21 1.14E+07 8.89E+07 8.97E+07 6.56E+07 2.78E+07 14 6 11 17 26 19 10 32852 ADP/ATP translocase 2 OS=Homo sapiens OX=9606 GN=SLC25A5 PE=1 SV=7 347 151 sp|Q07065|CKAP4_HUMAN 192.32 33 6 13 17 20 10 4.36E+06 2.78E+07 2.79E+07 2.73E+07 2.16E+07 16 15 4 6 8 8 5 66023 Cytoskeleton-associated protein 4 OS=Homo sapiens OX=9606 GN=CKAP4 PE=1 SV=2 277 184 sp|P0DMV8|HS71A_HUMAN 191.96 22 7 17 13 14 13 4.26E+06 5.74E+06 3.60E+06 2.30E+06 13 2 4 14 10 9 8 70052 Heat shock 70 kDa protein 1A OS=Homo sapiens OX=9606 GN=HSPA1A PE=1 SV=1 277 185 sp|P0DMV9|HS71B_HUMAN 191.96 22 7 17 13 14 13 4.26E+06 5.74E+06 3.60E+06 2.30E+06 13 2 4 14 10 9 8 70052 Heat shock 70 kDa protein 1B OS=Homo sapiens OX=9606 GN=HSPA1B PE=1 SV=1 168 299 sp|P84103|SRSF3_HUMAN 191.87 53 38 43 38 50 50 1.49E+08 2.33E+08 3.10E+08 4.63E+08 3.13E+08 12 10 14 17 17 21 18 19330 Serine/arginine-rich splicing factor 3 OS=Homo sapiens OX=9606 GN=SRSF3 PE=1 SV=1 272 154 sp|P60228|EIF3E_HUMAN 191.37 38 4 31 18 25 20 1.09E+06 8.24E+07 3.41E+07 5.27E+07 3.87E+07 16 15 2 15 8 10 11 52221 Eukaryotic translation initiation factor 3 subunit E OS=Homo sapiens OX=9606 GN=EIF3E PE=1 SV=1 322 157 sp|Q9UKV8|AGO2_HUMAN 191.06 19 2 9 14 8 10 1.60E+06 3.44E+07 1.92E+07 2.57E+07 1.46E+07 14 10 2 10 10 7 7 97208 Protein argonaute-2 OS=Homo sapiens OX=9606 GN=AGO2 PE=1 SV=3 218 418 sp|P35637|FUS_HUMAN 190.36 14 13 10 10 11 11 3.89E+07 7.58E+07 9.22E+07 1.25E+08 6.21E+07 11 5 14 12 13 15 11 53426 RNA-binding protein FUS OS=Homo sapiens OX=9606 GN=FUS PE=1 SV=1 126 239 sp|P61254|RL26_HUMAN 189.08 61 33 59 55 61 46 2.08E+07 6.89E+07 6.90E+07 7.84E+07 6.43E+07 14 2 10 30 22 32 28 17258 60S ribosomal protein L26 OS=Homo sapiens OX=9606 GN=RPL26 PE=1 SV=1 179 486 sp|P84090|ERH_HUMAN 187.98 62 49 60 62 55 54 3.13E+07 3.42E+08 5.25E+08 5.63E+08 4.14E+08 9 8 6 17 21 19 18 12259 Enhancer of rudimentary homolog OS=Homo sapiens OX=9606 GN=ERH PE=1 SV=1 113 323 sp|P62750|RL23A_HUMAN 187.87 47 44 44 47 47 44 1.01E+08 5.78E+08 7.18E+08 8.63E+08 6.31E+08 14 13 13 30 26 25 37 17695 60S ribosomal protein L23a OS=Homo sapiens OX=9606 GN=RPL23A PE=1 SV=1 132 201 sp|P27635|RL10_HUMAN 187.01 64 24 33 43 57 41 2.65E+07 1.65E+08 1.72E+08 2.16E+08 1.79E+08 19 18 8 30 26 31 23 24604 60S ribosomal protein L10 OS=Homo sapiens OX=9606 GN=RPL10 PE=1 SV=4 485 217 sp|Q7KZI7|MARK2_HUMAN 186.8 19 0 8 10 6 11 1.19E+07 1.99E+07 1.44E+07 1.68E+07 12 8 0 4 6 4 7 87911 Serine/threonine-protein kinase MARK2 OS=Homo sapiens OX=9606 GN=MARK2 PE=1 SV=2 120 280 sp|P60660|MYL6_HUMAN 186.73 66 66 56 66 66 56 1.62E+08 3.52E+08 4.43E+08 6.15E+08 4.64E+08 10 9 15 18 31 39 22 16930 Myosin light polypeptide 6 OS=Homo sapiens OX=9606 GN=MYL6 PE=1 SV=2 117 338 sp|Q9BYX7|ACTBM_HUMAN 186.6 21 17 18 16 16 16 8.94E+06 1.79E+07 1.71E+07 2.91E+06 12 1 24 24 25 28 27 42016 Putative beta-actin-like protein 3 OS=Homo sapiens OX=9606 GN=POTEKP PE=5 SV=1 264 159 sp|Q9H2U1|DHX36_HUMAN 186.58 16 1 10 10 12 6 2.05E+07 2.77E+07 3.45E+07 7.49E+06 15 12 1 12 16 13 7 114760 ATP-dependent DNA/RNA helicase DHX36 OS=Homo sapiens OX=9606 GN=DHX36 PE=1 SV=2 131 273 sp|P39019|RS19_HUMAN 185.47 59 37 56 40 52 46 7.46E+07 4.88E+08 2.43E+08 3.66E+08 1.74E+08 15 13 15 29 25 31 19 16060 40S ribosomal protein S19 OS=Homo sapiens OX=9606 GN=RPS19 PE=1 SV=2 55 180 sp|P46781|RS9_HUMAN 184.73 56 47 56 52 52 45 1.58E+08 1.04E+09 8.05E+08 8.82E+08 5.24E+08 23 23 20 55 49 48 50 22591 40S ribosomal protein S9 OS=Homo sapiens OX=9606 GN=RPS9 PE=1 SV=3 155 188 sp|Q06830|PRDX1_HUMAN 184.29 64 51 60 49 49 42 4.31E+07 1.06E+08 9.96E+07 7.32E+07 4.24E+07 14 10 13 25 22 22 14 22110 Peroxiredoxin-1 OS=Homo sapiens OX=9606 GN=PRDX1 PE=1 SV=1 260 216 sp|P14373|TRI27_HUMAN 183.7 26 2 17 23 21 18 1.28E+06 7.59E+07 1.15E+08 9.23E+07 4.82E+07 11 11 1 10 18 13 8 58490 Zinc finger protein RFP OS=Homo sapiens OX=9606 GN=TRIM27 PE=1 SV=1 189 387 sp|P62899|RL31_HUMAN 183.53 58 33 39 46 56 42 1.51E+08 2.15E+08 2.02E+08 2.42E+08 1.26E+08 10 10 33 8 10 16 9 14463 60S ribosomal protein L31 OS=Homo sapiens OX=9606 GN=RPL31 PE=1 SV=1 238 224 sp|A0AV96|RBM47_HUMAN 183.45 24 18 16 22 18 7 1.35E+07 2.13E+07 4.37E+07 4.18E+07 6.49E+06 11 8 9 14 16 13 4 64099 RNA-binding protein 47 OS=Homo sapiens OX=9606 GN=RBM47 PE=1 SV=2 176 166 sp|Q96HS1|PGAM5_HUMAN 183.03 72 32 48 39 54 38 4.28E+07 1.59E+08 1.22E+08 1.35E+08 1.37E+08 18 18 11 19 14 21 17 32004 Serine/threonine-protein phosphatase PGAM5 mitochondrial OS=Homo sapiens OX=9606 GN=PGAM5 PE=1 SV=2

205 250 sp|O43809|CPSF5_HUMAN 182.75 45 34 29 35 39 36 3.84E+07 1.18E+08 1.06E+08 1.50E+08 7.08E+07 11 11 10 13 19 18 11 26227 Cleavage and polyadenylation specificity factor subunit 5 OS=Homo sapiens OX=9606 GN=NUDT21 PE=1 SV=1 246 145 sp|O75534|CSDE1_HUMAN 182.73 22 9 12 12 11 12 2.37E+07 4.26E+07 3.37E+07 3.16E+07 2.31E+07 17 16 7 13 11 13 9 88885 Cold shock domain-containing protein E1 OS=Homo sapiens OX=9606 GN=CSDE1 PE=1 SV=2 286 186 sp|Q99959|PKP2_HUMAN 181.02 20 6 8 12 15 7 6.02E+06 2.46E+07 7.07E+07 3.38E+07 1.51E+07 13 11 4 9 11 11 8 97415 Plakophilin-2 OS=Homo sapiens OX=9606 GN=PKP2 PE=1 SV=2 344 179 sp|Q92945|FUBP2_HUMAN 180.74 26 11 10 13 13 10 2.29E+07 3.74E+07 3.73E+07 4.22E+07 3.17E+07 14 12 6 6 7 6 6 73115 Far upstream element-binding protein 2 OS=Homo sapiens OX=9606 GN=KHSRP PE=1 SV=4 267 347 sp|Q92804|RBP56_HUMAN 180.71 19 18 8 7 16 9 3.48E+07 3.84E+06 1.64E+07 5.04E+07 4.39E+06 11 5 14 6 6 15 6 61830 TATA-binding protein-associated factor 2N OS=Homo sapiens OX=9606 GN=TAF15 PE=1 SV=1 287 204 sp|P06733|ENOA_HUMAN 180.66 31 24 18 16 26 8 3.01E+07 2.58E+07 7.21E+07 1.13E+08 5.85E+06 12 11 10 6 10 13 3 47169 Alpha-enolase OS=Homo sapiens OX=9606 GN=ENO1 PE=1 SV=2 449 350 sp|Q14257|RCN2_HUMAN 179.67 35 35 0 9 23 0 1.13E+08 3.45E+06 1.38E+07 10 9 16 0 2 5 0 36876 Reticulocalbin-2 OS=Homo sapiens OX=9606 GN=RCN2 PE=1 SV=1 313 193 sp|P06576|ATPB_HUMAN 179.63 29 22 11 19 26 7 2.37E+07 1.49E+07 3.62E+07 5.22E+07 2.87E+06 12 10 9 4 7 15 3 56560 ATP synthase subunit beta mitochondrial OS=Homo sapiens OX=9606 GN=ATP5F1B PE=1 SV=3 310 213 sp|Q8WVM0|TFB1M_HUMAN 179.53 31 3 22 20 20 24 6.64E+05 5.69E+07 4.23E+07 4.91E+07 5.90E+07 11 11 1 12 8 8 9 39543 Dimethyladenosine transferase 1 mitochondrial OS=Homo sapiens OX=9606 GN=TFB1M PE=1 SV=1 199 215 sp|Q6ZN17|LN28B_HUMAN 178.72 55 34 33 36 37 38 1.53E+07 8.18E+07 9.49E+07 9.48E+07 6.89E+07 11 9 8 19 16 16 15 27084 Protein lin-28 homolog B OS=Homo sapiens OX=9606 GN=LIN28B PE=1 SV=1 278 209 sp|Q10567|AP1B1_HUMAN 178.05 13 4 9 5 9 8 4.16E+05 12 1 5 14 8 9 9 104637 AP-1 complex subunit beta-1 OS=Homo sapiens OX=9606 GN=AP1B1 PE=1 SV=2 305 152 sp|O94832|MYO1D_HUMAN 177.64 20 2 8 3 11 11 7.72E+06 4.72E+07 1.87E+07 5.57E+07 5.57E+07 18 17 2 10 4 11 11 116202 Unconventional myosin-Id OS=Homo sapiens OX=9606 GN=MYO1D PE=1 SV=2 247 314 sp|P62917|RL8_HUMAN 177.1 29 16 26 25 27 21 1.47E+07 1.33E+08 1.37E+08 1.30E+08 8.16E+07 11 11 5 13 13 10 11 28025 60S ribosomal protein L8 OS=Homo sapiens OX=9606 GN=RPL8 PE=1 SV=2 167 415 sp|P18621|RL17_HUMAN 177.07 35 18 34 34 34 35 2.02E+07 1.92E+08 2.32E+08 2.36E+08 1.54E+08 11 11 7 17 20 27 17 21397 60S ribosomal protein L17 OS=Homo sapiens OX=9606 GN=RPL17 PE=1 SV=3 217 271 sp|P62979|RS27A_HUMAN 176.41 65 36 42 46 57 35 6.80E+05 6.75E+06 12 2 8 17 14 17 11 17965 Ubiquitin-40S ribosomal protein S27a OS=Homo sapiens OX=9606 GN=RPS27A PE=1 SV=2 296 205 sp|P00352|AL1A1_HUMAN 175.43 29 17 15 23 25 0 1.36E+07 2.35E+07 6.37E+07 3.64E+07 11 10 7 8 13 12 0 54862 Retinal dehydrogenase 1 OS=Homo sapiens OX=9606 GN=ALDH1A1 PE=1 SV=2 358 264 sp|Q15424|SAFB1_HUMAN 175.14 15 9 6 10 8 6 1.25E+07 9.45E+06 1.50E+07 2.00E+07 10 3 7 4 7 6 5 102642 Scaffold attachment factor B1 OS=Homo sapiens OX=9606 GN=SAFB PE=1 SV=4 210 311 sp|Q14103|HNRPD_HUMAN 175.1 26 22 17 21 21 13 1.02E+08 2.63E+07 9.46E+07 9.02E+07 5.21E+07 14 9 18 11 15 18 7 38434 Heterogeneous nuclear ribonucleoprotein D0 OS=Homo sapiens OX=9606 GN=HNRNPD PE=1 SV=1 164 479 sp|P46776|RL27A_HUMAN 175.06 42 36 36 23 27 41 4.02E+07 2.16E+08 1.72E+08 2.36E+08 1.52E+08 8 7 13 24 14 16 22 16561 60S ribosomal protein L27a OS=Homo sapiens OX=9606 GN=RPL27A PE=1 SV=2 180 208 sp|O43432|IF4G3_HUMAN 174.89 9 3 6 5 5 4 3.98E+06 8.95E+06 3.72E+06 6.21E+06 3.11E+06 14 4 8 24 16 17 13 176651 Eukaryotic translation initiation factor 4 gamma 3 OS=Homo sapiens OX=9606 GN=EIF4G3 PE=1 SV=2 268 252 sp|P39023|RL3_HUMAN 174.1 25 12 15 21 23 15 2.95E+07 9.82E+07 1.16E+08 9.27E+07 9.15E+07 11 10 7 8 10 12 11 46109 60S ribosomal protein L3 OS=Homo sapiens OX=9606 GN=RPL3 PE=1 SV=2 311 211 sp|Q15393|SF3B3_HUMAN 173.83 11 4 7 8 8 6 7.16E+06 2.69E+07 2.77E+07 2.93E+07 1.46E+07 11 9 4 6 11 10 6 135577 Splicing factor 3B subunit 3 OS=Homo sapiens OX=9606 GN=SF3B3 PE=1 SV=4 468 199 sp|P55265|DSRAD_HUMAN 173.37 12 4 6 4 3 4 6.72E+06 2.75E+07 1.56E+07 6.88E+06 1.02E+07 13 12 4 6 5 3 4 136066 Double-stranded RNA-specific adenosine deaminase OS=Homo sapiens OX=9606 GN=ADAR PE=1 SV=4 361 227 sp|Q99700|ATX2_HUMAN 173.01 12 2 5 5 7 7 3.38E+06 2.63E+07 2.72E+07 3.53E+07 3.64E+07 10 10 2 5 6 9 7 140283 Ataxin-2 OS=Homo sapiens OX=9606 GN=ATXN2 PE=1 SV=2 297 281 sp|Q04837|SSBP_HUMAN 173 67 47 47 51 48 33 2.74E+07 7.42E+07 7.20E+07 6.80E+07 1.01E+08 10 9 7 7 10 9 8 17260 Single-stranded DNA-binding protein mitochondrial OS=Homo sapiens OX=9606 GN=SSBP1 PE=1 SV=1 340 200 sp|Q02878|RL6_HUMAN 172.69 47 3 16 18 38 20 3.73E+06 4.79E+07 2.30E+07 1.89E+08 1.39E+08 12 10 1 7 6 11 7 32728 60S ribosomal protein L6 OS=Homo sapiens OX=9606 GN=RPL6 PE=1 SV=3 195 478 sp|P84098|RL19_HUMAN 172.59 29 16 25 23 24 21 1.50E+07 1.07E+08 1.16E+08 1.49E+08 8.12E+07 10 9 3 17 14 27 11 23466 60S ribosomal protein L19 OS=Homo sapiens OX=9606 GN=RPL19 PE=1 SV=1 349 235 sp|Q96QR8|PURB_HUMAN 172.55 36 11 12 20 26 21 1.76E+06 7.36E+06 1.28E+07 2.13E+07 2.18E+07 13 7 5 6 5 7 8 33241 Transcriptional activator protein Pur-beta OS=Homo sapiens OX=9606 GN=PURB PE=1 SV=3 115 229 sp|P62244|RS15A_HUMAN 171.88 68 39 57 58 62 45 8.15E+07 8.74E+08 7.88E+08 7.92E+08 3.95E+08 17 15 10 31 27 32 29 14840 40S ribosomal protein S15a OS=Homo sapiens OX=9606 GN=RPS15A PE=1 SV=2 300 191 sp|Q8IWR0|Z3H7A_HUMAN 171.56 16 11 3 10 12 5 2.33E+07 9.99E+06 2.65E+07 3.46E+07 2.93E+07 15 13 9 5 8 10 7 110538 Zinc finger CCCH domain-containing protein 7A OS=Homo sapiens OX=9606 GN=ZC3H7A PE=1 SV=1 448 339 sp|P60174|TPIS_HUMAN 170.67 33 9 10 15 28 7 5.69E+06 7.99E+06 2.24E+07 2.44E+07 8.78E+05 8 7 3 3 5 9 2 30791 Triosephosphate isomerase OS=Homo sapiens OX=9606 GN=TPI1 PE=1 SV=3 130 505 sp|P62841|RS15_HUMAN 170.31 51 43 50 48 48 26 1.41E+08 1.40E+08 1.43E+08 1.24E+08 6.13E+07 7 5 34 34 22 18 10 17040 40S ribosomal protein S15 OS=Homo sapiens OX=9606 GN=RPS15 PE=1 SV=2 254 207 sp|Q9UKM9|RALY_HUMAN 170.29 35 18 25 23 22 35 2.17E+07 5.55E+07 5.88E+07 6.72E+07 9.06E+07 12 8 6 11 10 11 14 32463 RNA-binding protein Raly OS=Homo sapiens OX=9606 GN=RALY PE=1 SV=1 343 181 sp|Q9HAU5|RENT2_HUMAN 170.06 11 1 5 7 6 3 6.04E+06 1.37E+07 2.11E+07 1.96E+07 8.29E+06 15 14 1 6 10 9 4 147810 Regulator of nonsense transcripts 2 OS=Homo sapiens OX=9606 GN=UPF2 PE=1 SV=1 196 344 sp|P62987|RL40_HUMAN 169.93 56 44 56 52 56 45 7.04E+07 9.25E+07 1.17E+07 5.84E+07 11 1 8 21 18 16 12 14728 Ubiquitin-60S ribosomal protein L40 OS=Homo sapiens OX=9606 GN=UBA52 PE=1 SV=2 197 416 sp|P46783|RS10_HUMAN 169.71 42 18 41 32 41 28 2.49E+07 1.08E+08 7.30E+07 1.46E+08 5.16E+07 9 8 6 19 17 21 11 18898 40S ribosomal protein S10 OS=Homo sapiens OX=9606 GN=RPS10 PE=1 SV=1 316 259 sp|P34931|HS71L_HUMAN 169.08 19 5 15 12 12 10 1.42E+06 11 1 3 11 9 6 8 70375 Heat shock 70 kDa protein 1-like OS=Homo sapiens OX=9606 GN=HSPA1L PE=1 SV=2 239 257 sp|P62995|TRA2B_HUMAN 168.7 35 11 28 26 25 21 1.97E+07 5.27E+07 6.77E+07 1.16E+08 1.15E+08 11 7 5 12 10 9 20 33666 Transformer-2 protein homolog beta OS=Homo sapiens OX=9606 GN=TRA2B PE=1 SV=1 148 492 sp|Q99878|H2A1J_HUMAN 168.36 45 36 44 36 37 36 6.09E+07 1.02E+08 9.62E+07 1.48E+08 9.38E+07 10 1 17 18 24 25 16 13936 Histone H2A type 1-J OS=Homo sapiens OX=9606 GN=H2AC14 PE=1 SV=3 148 493 sp|Q96KK5|H2A1H_HUMAN 168.36 45 36 44 36 37 36 6.09E+07 1.02E+08 9.62E+07 1.48E+08 9.38E+07 10 1 17 18 24 25 16 13906 Histone H2A type 1-H OS=Homo sapiens OX=9606 GN=H2AC12 PE=1 SV=3 148 494 sp|P0C0S8|H2A1_HUMAN 168.36 44 35 43 35 36 35 6.09E+07 1.02E+08 9.62E+07 1.48E+08 9.38E+07 10 1 17 18 24 25 16 14091 Histone H2A type 1 OS=Homo sapiens OX=9606 GN=H2AC11 PE=1 SV=2 148 495 sp|P20671|H2A1D_HUMAN 168.36 44 35 43 35 36 35 6.09E+07 1.02E+08 9.62E+07 1.48E+08 9.38E+07 10 1 17 18 24 25 16 14107 Histone H2A type 1-D OS=Homo sapiens OX=9606 GN=H2AC7 PE=1 SV=2 148 512 sp|Q9BTM1|H2AJ_HUMAN 168.36 44 36 43 36 36 36 6.09E+07 1.02E+08 9.62E+07 1.48E+08 9.38E+07 10 1 17 18 24 25 16 14019 Histone H2A.J OS=Homo sapiens OX=9606 GN=H2AJ PE=1 SV=1 84 394 sp|P57053|H2BFS_HUMAN 168.23 45 41 45 45 45 45 6.82E+07 1.71E+08 1.28E+08 2.39E+08 1.60E+08 10 2 31 32 38 37 32 13944 Histone H2B type F-S OS=Homo sapiens OX=9606 GN=H2BS1 PE=1 SV=2 84 395 sp|Q99879|H2B1M_HUMAN 168.23 45 41 45 45 45 45 6.82E+07 1.71E+08 1.28E+08 2.39E+08 1.60E+08 10 2 31 32 38 37 32 13989 Histone H2B type 1-M OS=Homo sapiens OX=9606 GN=H2BC14 PE=1 SV=3 84 396 sp|Q93079|H2B1H_HUMAN 168.23 45 41 45 45 45 45 6.82E+07 1.71E+08 1.28E+08 2.39E+08 1.60E+08 10 2 31 32 38 37 32 13892 Histone H2B type 1-H OS=Homo sapiens OX=9606 GN=H2BC9 PE=1 SV=3 84 397 sp|Q5QNW6|H2B2F_HUMAN 168.23 45 41 45 45 45 45 6.82E+07 1.71E+08 1.28E+08 2.39E+08 1.60E+08 10 2 31 32 38 37 32 13920 Histone H2B type 2-F OS=Homo sapiens OX=9606 GN=H2BC18 PE=1 SV=3 84 398 sp|Q99880|H2B1L_HUMAN 168.23 45 41 45 45 45 45 6.82E+07 1.71E+08 1.28E+08 2.39E+08 1.60E+08 10 2 31 32 38 37 32 13952 Histone H2B type 1-L OS=Homo sapiens OX=9606 GN=H2BC13 PE=1 SV=3 84 399 sp|Q99877|H2B1N_HUMAN 168.23 45 41 45 45 45 45 6.82E+07 1.71E+08 1.28E+08 2.39E+08 1.60E+08 10 2 31 32 38 37 32 13922 Histone H2B type 1-N OS=Homo sapiens OX=9606 GN=H2BC15 PE=1 SV=3 84 400 sp|O60814|H2B1K_HUMAN 168.23 45 41 45 45 45 45 6.82E+07 1.71E+08 1.28E+08 2.39E+08 1.60E+08 10 2 31 32 38 37 32 13890 Histone H2B type 1-K OS=Homo sapiens OX=9606 GN=H2BC12 PE=1 SV=3 84 401 sp|P62807|H2B1C_HUMAN 168.23 45 41 45 45 45 45 6.82E+07 1.71E+08 1.28E+08 2.39E+08 1.60E+08 10 2 31 32 38 37 32 13906 Histone H2B type 1-C/E/F/G/I OS=Homo sapiens OX=9606 GN=H2BC4 PE=1 SV=4 84 402 sp|P58876|H2B1D_HUMAN 168.23 45 41 45 45 45 45 6.82E+07 1.71E+08 1.28E+08 2.39E+08 1.60E+08 10 2 31 32 38 37 32 13936 Histone H2B type 1-D OS=Homo sapiens OX=9606 GN=H2BC5 PE=1 SV=2 265 471 sp|Q8NCA5|FA98A_HUMAN 167.69 14 12 12 14 12 12 1.89E+07 1.36E+08 1.02E+08 1.35E+08 4.00E+07 7 7 4 12 13 15 5 55272 Protein FAM98A OS=Homo sapiens OX=9606 GN=FAM98A PE=1 SV=2 171 331 sp|P0DMR1|HNRC4_HUMAN 167.29 26 15 17 22 18 14 0.00E+00 12 1 9 18 23 20 14 32029 Heterogeneous nuclear ribonucleoprotein C-like 4 OS=Homo sapiens OX=9606 GN=HNRNPCL4 PE=3 SV=1 171 332 sp|B7ZW38|HNRC3_HUMAN 167.29 26 15 17 22 18 14 0.00E+00 12 1 9 18 23 20 14 32029 Heterogeneous nuclear ribonucleoprotein C-like 3 OS=Homo sapiens OX=9606 GN=HNRNPCL3 PE=2 SV=1 365 197 sp|Q14671|PUM1_HUMAN 167.1 11 0 6 5 7 6 2.62E+07 1.98E+07 1.94E+08 1.64E+07 12 10 0 7 6 8 8 126473 Pumilio homolog 1 OS=Homo sapiens OX=9606 GN=PUM1 PE=1 SV=3 354 309 sp|Q96CD2|COAC_HUMAN 166.36 42 0 31 31 25 36 3.98E+07 1.05E+08 5.09E+07 1.22E+08 7 7 0 6 9 8 7 22395 Phosphopantothenoylcysteine decarboxylase OS=Homo sapiens OX=9606 GN=PPCDC PE=1 SV=2 390 245 sp|P35249|RFC4_HUMAN 166.24 29 13 16 10 25 6 8.90E+06 1.56E+07 9.08E+06 3.06E+07 9.36E+06 10 10 4 6 3 11 3 39682 Replication factor C subunit 4 OS=Homo sapiens OX=9606 GN=RFC4 PE=1 SV=2 391 267 sp|P35251|RFC1_HUMAN 166.01 10 4 5 5 7 1 6.20E+06 1.34E+07 1.23E+07 2.56E+07 1.80E+06 11 8 3 6 6 8 2 128254 Replication factor C subunit 1 OS=Homo sapiens OX=9606 GN=RFC1 PE=1 SV=4 2-oxoisovalerate dehydrogenase subunit alpha mitochondrial OS=Homo sapiens OX=9606 GN=BCKDHA PE=1 814 228 sp|P12694|ODBA_HUMAN 165.51 31 31 0 0 0 0 8.05E+07 10 10 13 0 0 0 0 50471 SV=2 444 375 sp|Q9BY77|PDIP3_HUMAN 165.34 24 10 12 16 15 17 1.81E+07 1.82E+07 2.16E+07 3.18E+07 1.85E+07 6 6 3 4 6 5 5 46089 Polymerase delta-interacting protein 3 OS=Homo sapiens OX=9606 GN=POLDIP3 PE=1 SV=2 315 212 sp|Q9UMS4|PRP19_HUMAN 165.12 30 8 22 15 19 12 9.30E+06 2.48E+07 3.08E+07 6.43E+07 3.55E+07 11 10 3 9 6 13 7 55181 Pre-mRNA-processing factor 19 OS=Homo sapiens OX=9606 GN=PRPF19 PE=1 SV=1 336 321 sp|Q16630|CPSF6_HUMAN 165.08 19 15 11 9 14 6 1.80E+07 2.27E+07 2.12E+07 3.46E+07 1.39E+07 9 8 7 7 6 8 4 59210 Cleavage and polyadenylation specificity factor subunit 6 OS=Homo sapiens OX=9606 GN=CPSF6 PE=1 SV=2 159 496 sp|P04908|H2A1B_HUMAN 165.01 44 35 43 35 36 35 1.36E+07 1.62E+07 1.90E+07 3.39E+07 3.65E+07 10 1 17 16 19 23 17 14135 Histone H2A type 1-B/E OS=Homo sapiens OX=9606 GN=H2AC4 PE=1 SV=2 159 497 sp|Q7L7L0|H2A3_HUMAN 165.01 44 35 43 35 36 35 1.36E+07 1.62E+07 1.90E+07 3.39E+07 3.65E+07 10 1 17 16 19 23 17 14121 Histone H2A type 3 OS=Homo sapiens OX=9606 GN=H2AW PE=1 SV=3 159 498 sp|Q93077|H2A1C_HUMAN 165.01 44 35 43 35 36 35 1.36E+07 1.62E+07 1.90E+07 3.39E+07 3.65E+07 10 1 17 16 19 23 17 14105 Histone H2A type 1-C OS=Homo sapiens OX=9606 GN=H2AC6 PE=1 SV=3 290 268 sp|Q15366|PCBP2_HUMAN 164.54 34 20 19 22 25 27 2.17E+07 4.33E+07 7.60E+07 8.54E+07 4.22E+07 8 4 6 6 9 13 8 38580 Poly(rC)-binding protein 2 OS=Homo sapiens OX=9606 GN=PCBP2 PE=1 SV=1 417 248 sp|P35527|K1C9_HUMAN 163.6 19 6 4 5 12 9 9.66E+06 2.61E+07 2.38E+07 3.12E+07 4.21E+07 9 8 3 4 4 6 8 62064 Keratin type I cytoskeletal 9 OS=Homo sapiens OX=9606 GN=KRT9 PE=1 SV=3 257 345 sp|P08865|RSSA_HUMAN 162.78 32 24 28 32 32 22 3.85E+07 7.52E+07 9.47E+07 1.38E+08 2.90E+07 8 8 10 9 11 15 6 32854 40S ribosomal protein SA OS=Homo sapiens OX=9606 GN=RPSA PE=1 SV=4 638 255 sp|O43852|CALU_HUMAN 162.37 31 31 0 0 0 0 2.42E+08 11 11 16 0 0 0 0 37107 Calumenin OS=Homo sapiens OX=9606 GN=CALU PE=1 SV=2 398 253 sp|Q9BYJ9|YTHD1_HUMAN 161.45 22 11 13 15 14 14 3.81E+06 1.34E+07 4.82E+07 3.04E+07 1.83E+07 10 7 4 5 6 6 5 60874 YTH domain-containing family protein 1 OS=Homo sapiens OX=9606 GN=YTHDF1 PE=1 SV=1 230 448 sp|P83731|RL24_HUMAN 161.4 34 19 33 33 33 29 3.36E+07 1.89E+08 2.08E+08 2.43E+08 1.58E+08 7 7 5 14 16 15 9 17779 60S ribosomal protein L24 OS=Homo sapiens OX=9606 GN=RPL24 PE=1 SV=1 234 278 sp|Q96SI9|STRBP_HUMAN 161.34 14 7 8 9 8 11 7.12E+05 7.90E+05 5.32E+06 12 2 8 9 15 12 11 73653 Spermatid perinuclear RNA-binding protein OS=Homo sapiens OX=9606 GN=STRBP PE=1 SV=1 312 482 sp|P19105|ML12A_HUMAN 161.3 41 19 19 35 35 30 4.12E+07 7.21E+07 1.27E+08 1.84E+08 1.63E+08 7 7 4 4 8 12 10 19794 Myosin regulatory light chain 12A OS=Homo sapiens OX=9606 GN=MYL12A PE=1 SV=2 312 483 sp|O14950|ML12B_HUMAN 161.3 41 19 19 35 34 30 4.12E+07 7.21E+07 1.27E+08 1.84E+08 1.63E+08 7 7 4 4 8 12 10 19779 Myosin regulatory light chain 12B OS=Homo sapiens OX=9606 GN=MYL12B PE=1 SV=2 383 432 sp|P06748|NPM_HUMAN 161.27 23 21 7 16 16 6 3.17E+07 1.19E+07 2.23E+07 3.77E+07 1.65E+07 8 6 10 3 4 7 3 32575 Nucleophosmin OS=Homo sapiens OX=9606 GN=NPM1 PE=1 SV=2 181 430 sp|P60866|RS20_HUMAN 161.27 43 31 43 43 42 40 1.34E+08 4.92E+08 3.72E+08 5.37E+08 2.50E+08 10 8 9 26 20 12 12 13373 40S ribosomal protein S20 OS=Homo sapiens OX=9606 GN=RPS20 PE=1 SV=1 385 485 sp|Q07020|RL18_HUMAN 160.82 31 9 31 26 25 14 4.82E+06 1.22E+08 6.78E+07 7.37E+07 1.76E+07 7 6 2 9 7 6 3 21634 60S ribosomal protein L18 OS=Homo sapiens OX=9606 GN=RPL18 PE=1 SV=2 378 261 sp|Q86TG7|PEG10_HUMAN 160.15 19 1 11 5 12 11 1.76E+06 3.46E+07 1.15E+07 1.71E+07 1.69E+07 10 9 1 7 4 7 7 80173 Retrotransposon-derived protein PEG10 OS=Homo sapiens OX=9606 GN=PEG10 PE=1 SV=2 534 302 sp|O15371|EIF3D_HUMAN 159.63 23 2 6 5 21 6 1.65E+06 1.30E+07 6.59E+06 4.46E+07 1.83E+07 8 7 1 3 2 9 4 63973 Eukaryotic translation initiation factor 3 subunit D OS=Homo sapiens OX=9606 GN=EIF3D PE=1 SV=1 241 484 sp|Q86V81|THOC4_HUMAN 159.34 36 26 26 26 36 26 2.41E+07 6.56E+07 1.22E+08 2.14E+08 9.02E+07 6 6 7 10 13 17 8 26888 THO complex subunit 4 OS=Homo sapiens OX=9606 GN=ALYREF PE=1 SV=3 506 276 sp|P14618|KPYM_HUMAN 159.13 25 5 2 15 20 8 1.89E+06 0.00E+00 3.40E+07 2.80E+07 1.28E+07 10 8 2 1 4 9 4 57937 Pyruvate kinase PKM OS=Homo sapiens OX=9606 GN=PKM PE=1 SV=4 379 196 sp|Q9UM54|MYO6_HUMAN 158.43 13 3 5 2 11 2 1.47E+07 1.12E+07 7.48E+05 4.97E+07 9.97E+06 15 13 6 5 2 12 2 149691 Unconventional myosin-VI OS=Homo sapiens OX=9606 GN=MYO6 PE=1 SV=4 213 451 sp|P02768|ALBU_HUMAN 158.31 11 8 5 8 6 5 2.76E+06 10 1 15 11 13 12 16 69367 Serum albumin OS=Homo sapiens OX=9606 GN=ALB PE=1 SV=2 473 408 sp|O00303|EIF3F_HUMAN 157.63 21 7 11 8 15 13 3.47E+06 2.09E+07 1.79E+07 4.37E+07 2.47E+07 6 6 2 5 2 8 5 37564 Eukaryotic translation initiation factor 3 subunit F OS=Homo sapiens OX=9606 GN=EIF3F PE=1 SV=1 279 371 sp|P62913|RL11_HUMAN 157.31 37 26 30 33 37 31 5.79E+07 1.53E+08 1.43E+08 1.77E+08 9.75E+07 12 10 6 9 9 12 9 20252 60S ribosomal protein L11 OS=Homo sapiens OX=9606 GN=RPL11 PE=1 SV=2 92 403 sp|P33778|H2B1B_HUMAN 156.39 44 40 37 44 44 44 9.83E+06 2.17E+07 3.40E+07 2.24E+07 9 1 29 26 35 36 28 13950 Histone H2B type 1-B OS=Homo sapiens OX=9606 GN=H2BC3 PE=1 SV=2 92 404 sp|P06899|H2B1J_HUMAN 156.39 44 40 37 44 44 44 9.83E+06 2.17E+07 3.40E+07 2.24E+07 9 1 29 26 35 36 28 13904 Histone H2B type 1-J OS=Homo sapiens OX=9606 GN=H2BC11 PE=1 SV=3 92 405 sp|P23527|H2B1O_HUMAN 156.39 44 40 37 44 44 44 9.83E+06 2.17E+07 3.40E+07 2.24E+07 9 1 29 26 35 36 28 13906 Histone H2B type 1-O OS=Homo sapiens OX=9606 GN=H2BC17 PE=1 SV=3 92 406 sp|Q16778|H2B2E_HUMAN 156.39 44 40 37 44 44 44 9.83E+06 2.17E+07 3.40E+07 2.24E+07 9 1 29 26 35 36 28 13920 Histone H2B type 2-E OS=Homo sapiens OX=9606 GN=H2BC21 PE=1 SV=3 434 300 sp|Q9Y5A9|YTHD2_HUMAN 156.15 15 7 3 13 6 7 6.36E+06 4.29E+07 1.90E+07 2.52E+07 9 4 5 2 8 4 5 62334 YTH domain-containing family protein 2 OS=Homo sapiens OX=9606 GN=YTHDF2 PE=1 SV=2 780 320 sp|O00567|NOP56_HUMAN 156 14 0 3 3 11 8 2.04E+06 3.43E+06 1.43E+07 9.63E+06 7 6 0 1 1 5 5 66050 Nucleolar protein 56 OS=Homo sapiens OX=9606 GN=NOP56 PE=1 SV=4 321 562 sp|P61513|RL37A_HUMAN 155.85 49 0 48 48 49 41 6.57E+07 1.50E+08 9.36E+07 5.44E+07 6 6 0 10 13 9 5 10275 60S ribosomal protein L37a OS=Homo sapiens OX=9606 GN=RPL37A PE=1 SV=2 427 277 sp|P07237|PDIA1_HUMAN 155.26 18 11 7 13 11 3 1.27E+07 3.49E+07 7.29E+07 1.77E+07 2.74E+07 9 7 5 4 8 5 2 57116 Protein disulfide-isomerase OS=Homo sapiens OX=9606 GN=P4HB PE=1 SV=3 289 376 sp|P62906|RL10A_HUMAN 155 34 17 20 17 20 21 1.08E+07 6.66E+07 5.77E+07 5.13E+07 3.28E+07 6 6 3 12 10 8 8 24831 60S ribosomal protein L10a OS=Homo sapiens OX=9606 GN=RPL10A PE=1 SV=2 677 313 sp|Q7L2H7|EIF3M_HUMAN 154.72 25 8 13 7 17 5 2.66E+06 1.39E+07 5.60E+06 1.83E+07 5.74E+05 7 7 2 5 2 5 1 42503 Eukaryotic translation initiation factor 3 subunit M OS=Homo sapiens OX=9606 GN=EIF3M PE=1 SV=1 466 304 sp|P52292|IMA1_HUMAN 154.27 20 9 12 11 14 10 6.34E+06 1.01E+07 1.07E+07 1.81E+07 4.62E+06 8 7 4 4 4 6 4 57862 Importin subunit alpha-1 OS=Homo sapiens OX=9606 GN=KPNA2 PE=1 SV=1 332 238 sp|P13639|EF2_HUMAN 153.84 12 4 6 8 11 4 5.53E+06 1.65E+07 4.29E+07 4.67E+07 5.38E+06 10 9 3 6 8 10 4 95338 Elongation factor 2 OS=Homo sapiens OX=9606 GN=EEF2 PE=1 SV=4 201 225 sp|P26373|RL13_HUMAN 153.24 45 27 37 37 37 40 1.80E+07 1.86E+08 1.78E+08 1.94E+08 1.30E+08 11 9 6 18 15 15 19 24261 60S ribosomal protein L13 OS=Homo sapiens OX=9606 GN=RPL13 PE=1 SV=4 203 516 sp|P42766|RL35_HUMAN 152.65 43 26 34 31 39 30 1.32E+07 2.78E+08 2.17E+08 4.20E+08 1.48E+08 8 7 4 15 18 19 16 14551 60S ribosomal protein L35 OS=Homo sapiens OX=9606 GN=RPL35 PE=1 SV=2 308 232 sp|Q13242|SRSF9_HUMAN 151.72 48 14 15 22 27 23 3.30E+06 1.43E+07 3.68E+07 3.47E+07 1.31E+07 10 9 3 9 9 10 8 25542 Serine/arginine-rich splicing factor 9 OS=Homo sapiens OX=9606 GN=SRSF9 PE=1 SV=1 494 527 sp|P19438|TNR1A_HUMAN 151.66 20 0 2 11 17 5 9.97E+06 3.49E+07 3.00E+07 5.08E+07 7 7 0 2 6 7 5 50495 Tumor necrosis factor receptor superfamily member 1A OS=Homo sapiens OX=9606 GN=TNFRSF1A PE=1 SV=1 484 359 sp|Q14151|SAFB2_HUMAN 151.58 10 5 3 8 1 7 7.09E+05 9.19E+05 9 1 5 3 6 2 5 107474 Scaffold attachment factor B2 OS=Homo sapiens OX=9606 GN=SAFB2 PE=1 SV=1 202 632 sp|P62847|RS24_HUMAN 150.77 26 26 26 26 26 26 2.54E+07 2.04E+08 2.15E+08 2.53E+08 1.33E+08 4 4 4 17 16 18 17 15423 40S ribosomal protein S24 OS=Homo sapiens OX=9606 GN=RPS24 PE=1 SV=1 511 237 sp|Q9H7E2|TDRD3_HUMAN 150.48 19 1 8 5 7 13 1.41E+07 1.45E+07 2.08E+07 2.45E+07 10 8 1 5 3 4 6 73185 Tudor domain-containing protein 3 OS=Homo sapiens OX=9606 GN=TDRD3 PE=1 SV=1 455 251 sp|Q9BYK8|HELZ2_HUMAN 150.43 5 1 3 3 1 0 5.33E+06 1.82E+07 1.81E+07 5.48E+06 1.20E+06 13 9 4 6 7 3 1 294649 Helicase with zinc finger domain 2 OS=Homo sapiens OX=9606 GN=HELZ2 PE=1 SV=6 414 288 sp|Q9H074|PAIP1_HUMAN 150.41 29 5 4 16 9 19 4.62E+06 1.31E+07 6.01E+07 8.26E+07 3.33E+07 12 8 2 2 7 5 9 53525 Polyadenylate-binding protein-interacting protein 1 OS=Homo sapiens OX=9606 GN=PAIP1 PE=1 SV=1 919 360 sp|P41091|IF2G_HUMAN 150.13 18 5 2 6 6 12 2.84E+06 1.15E+07 7.41E+06 1.39E+07 1.58E+07 7 7 2 1 2 3 4 51110 Eukaryotic translation initiation factor 2 subunit 3 OS=Homo sapiens OX=9606 GN=EIF2S3 PE=1 SV=3 282 465 sp|P62266|RS23_HUMAN 149.14 37 20 37 34 33 37 2.75E+07 2.29E+08 2.16E+08 2.51E+08 1.35E+08 7 5 5 10 10 8 11 15808 40S ribosomal protein S23 OS=Homo sapiens OX=9606 GN=RPS23 PE=1 SV=3 399 351 sp|Q13347|EIF3I_HUMAN 148.59 23 9 15 15 20 14 3.00E+06 2.35E+07 1.71E+07 4.37E+07 2.71E+07 7 6 4 5 5 6 6 36502 Eukaryotic translation initiation factor 3 subunit I OS=Homo sapiens OX=9606 GN=EIF3I PE=1 SV=1 317 269 sp|P50914|RL14_HUMAN 148.53 38 8 21 26 27 30 1.03E+07 5.95E+07 7.12E+07 8.38E+07 5.74E+07 9 8 3 7 7 11 9 23432 60S ribosomal protein L14 OS=Homo sapiens OX=9606 GN=RPL14 PE=1 SV=4 388 306 sp|P25705|ATPA_HUMAN 148.35 17 8 7 7 12 4 7.81E+06 1.68E+07 2.53E+07 2.48E+07 6.39E+06 11 7 6 5 5 7 3 59751 ATP synthase subunit alpha mitochondrial OS=Homo sapiens OX=9606 GN=ATP5F1A PE=1 SV=1 443 274 sp|O43707|ACTN4_HUMAN 148.07 12 3 4 7 9 3 7.11E+05 6.23E+06 3.17E+06 1.07E+07 6.94E+06 9 5 2 3 6 9 2 104854 Alpha-actinin-4 OS=Homo sapiens OX=9606 GN=ACTN4 PE=1 SV=2 574 352 sp|P07355|ANXA2_HUMAN 147.13 24 15 5 18 22 3 2.15E+06 5.32E+06 7 1 4 2 5 6 1 38604 Annexin A2 OS=Homo sapiens OX=9606 GN=ANXA2 PE=1 SV=2 983 334 sp|Q9Y2X3|NOP58_HUMAN 146.98 19 0 5 6 12 8 1.54E+06 2.54E+06 7.78E+06 1.63E+07 7 7 0 2 2 4 3 59578 Nucleolar protein 58 OS=Homo sapiens OX=9606 GN=NOP58 PE=1 SV=1 480 233 sp|P49750|YLPM1_HUMAN 146.78 7 2 1 5 2 4 5.24E+06 1.50E+06 1.24E+07 5.46E+06 1.63E+07 10 9 3 1 6 4 6 241643 YLP motif-containing protein 1 OS=Homo sapiens OX=9606 GN=YLPM1 PE=1 SV=4 515 521 sp|Q02543|RL18A_HUMAN 146.39 31 7 18 24 18 12 2.75E+06 1.91E+07 2.93E+07 2.29E+07 2.03E+07 7 7 1 6 5 4 4 20762 60S ribosomal protein L18a OS=Homo sapiens OX=9606 GN=RPL18A PE=1 SV=2 392 236 sp|Q9Y5B9|SP16H_HUMAN 146.18 10 0 6 6 9 7 2.52E+07 2.04E+07 4.08E+07 1.99E+07 10 9 0 6 5 8 7 119914 FACT complex subunit SPT16 OS=Homo sapiens OX=9606 GN=SUPT16H PE=1 SV=1 487 282 sp|Q9NVP1|DDX18_HUMAN 145.37 15 1 6 5 11 8 2.26E+07 1.65E+07 3.45E+07 1.32E+07 9 8 1 4 3 9 4 75407 ATP-dependent RNA helicase DDX18 OS=Homo sapiens OX=9606 GN=DDX18 PE=1 SV=2 404 266 sp|Q9UDY2|ZO2_HUMAN 145.17 11 9 2 2 3 3 1.56E+07 4.24E+06 4.94E+06 8.88E+06 3.91E+06 11 9 11 3 4 3 4 133958 Tight junction protein ZO-2 OS=Homo sapiens OX=9606 GN=TJP2 PE=1 SV=2 348 391 sp|Q15365|PCBP1_HUMAN 144.86 23 13 16 20 23 20 8.08E+06 1.14E+07 2.71E+07 2.98E+07 9.55E+06 6 3 3 5 7 9 7 37498 Poly(rC)-binding protein 1 OS=Homo sapiens OX=9606 GN=PCBP1 PE=1 SV=2 410 286 sp|O43175|SERA_HUMAN 144.55 17 8 4 11 13 6 3.24E+06 2.91E+06 1.39E+07 1.76E+07 2.36E+06 11 7 7 3 5 7 3 56651 D-3-phosphoglycerate dehydrogenase OS=Homo sapiens OX=9606 GN=PHGDH PE=1 SV=4 651 455 sp|Q9BRJ7|TIRR_HUMAN 144.53 31 3 27 20 18 9 8.13E+06 6.13E+06 9.41E+06 3.59E+06 7 5 1 5 4 4 2 23338 Tudor-interacting repair regulator protein OS=Homo sapiens OX=9606 GN=NUDT16L1 PE=1 SV=1 678 378 sp|Q86XZ4|SPAS2_HUMAN 144.26 19 7 0 7 19 10 1.09E+06 1.28E+07 2.11E+07 8.86E+06 6 6 2 0 3 7 3 59545 Spermatogenesis-associated serine-rich protein 2 OS=Homo sapiens OX=9606 GN=SPATS2 PE=1 SV=1 413 260 sp|Q08945|SSRP1_HUMAN 144.07 16 6 7 4 10 8 5.66E+06 1.53E+07 8.08E+06 1.70E+07 1.60E+07 11 8 5 4 2 9 5 81075 FACT complex subunit SSRP1 OS=Homo sapiens OX=9606 GN=SSRP1 PE=1 SV=1 634 564 sp|Q6UN15|FIP1_HUMAN 144.01 10 8 4 6 6 6 1.18E+07 1.49E+07 1.75E+07 1.51E+07 1.76E+07 4 4 3 2 3 4 4 66526 Pre-mRNA 3'-end-processing factor FIP1 OS=Homo sapiens OX=9606 GN=FIP1L1 PE=1 SV=1 512 337 sp|P40937|RFC5_HUMAN 143.96 23 3 10 7 8 20 2.09E+06 6.85E+06 5.05E+06 1.30E+06 1.51E+07 8 7 1 6 3 3 7 38497 Replication factor C subunit 5 OS=Homo sapiens OX=9606 GN=RFC5 PE=1 SV=1 1379 566 sp|Q15691|MARE1_HUMAN 143.37 26 0 7 18 20 6 1.82E+06 1.31E+07 7.86E+06 1.29E+06 5 5 0 1 3 3 1 29999 Microtubule-associated protein RP/EB family member 1 OS=Homo sapiens OX=9606 GN=MAPRE1 PE=1 SV=3 718 487 sp|Q5BKZ1|ZN326_HUMAN 142.68 14 3 5 9 6 11 1.51E+06 5.36E+06 1.06E+07 7.47E+06 7.43E+06 6 5 1 2 4 3 4 65654 DBIRD complex subunit ZNF326 OS=Homo sapiens OX=9606 GN=ZNF326 PE=1 SV=2 662 361 sp|P09327|VILI_HUMAN 142.52 10 4 4 6 6 4 4.45E+06 4.59E+06 1.29E+07 1.64E+07 7.03E+06 7 6 2 3 4 4 2 92695 Villin-1 OS=Homo sapiens OX=9606 GN=VIL1 PE=1 SV=4 711 305 sp|Q8WUM4|PDC6I_HUMAN 142.5 10 3 6 3 5 3 1.37E+06 4.45E+06 4.04E+06 5.37E+06 1.07E+06 8 7 2 4 2 4 2 96023 Programmed cell death 6-interacting protein OS=Homo sapiens OX=9606 GN=PDCD6IP PE=1 SV=1 384 446 sp|P09211|GSTP1_HUMAN 142.44 49 29 29 36 41 5 2.30E+07 1.91E+07 4.28E+07 4.66E+07 2.41E+06 6 6 4 7 7 8 1 23356 Glutathione S-transferase P OS=Homo sapiens OX=9606 GN=GSTP1 PE=1 SV=2 418 316 sp|Q9BQ39|DDX50_HUMAN 142.41 11 4 7 3 8 5 6.22E+06 1.96E+05 8 2 2 8 3 7 3 82565 ATP-dependent RNA helicase DDX50 OS=Homo sapiens OX=9606 GN=DDX50 PE=1 SV=1 483 292 sp|P55884|EIF3B_HUMAN 142.35 10 2 6 3 6 2 2.21E+06 5.75E+07 1.60E+07 3.37E+07 1.56E+07 9 8 2 8 3 5 3 92482 Eukaryotic translation initiation factor 3 subunit B OS=Homo sapiens OX=9606 GN=EIF3B PE=1 SV=3 435 317 sp|P46777|RL5_HUMAN 142.04 34 6 8 19 17 20 9.84E+06 4.30E+06 2.31E+07 2.77E+07 1.44E+07 9 8 3 3 7 6 5 34363 60S ribosomal protein L5 OS=Homo sapiens OX=9606 GN=RPL5 PE=1 SV=3 639 326 sp|O95985|TOP3B_HUMAN 141.99 10 1 5 6 5 4 5.72E+05 5.85E+06 9.62E+06 7.81E+06 5.56E+06 7 6 1 4 4 4 3 96662 DNA topoisomerase 3-beta-1 OS=Homo sapiens OX=9606 GN=TOP3B PE=1 SV=1 591 291 sp|Q9UQ35|SRRM2_HUMAN 141.96 5 0 3 1 1 2 1.44E+07 2.03E+06 5.04E+06 7.47E+06 11 8 3 6 2 2 3 299616 Serine/arginine repetitive matrix protein 2 OS=Homo sapiens OX=9606 GN=SRRM2 PE=1 SV=2 540 254 sp|O75152|ZC11A_HUMAN 141.73 15 0 6 4 7 7 2.56E+07 3.07E+07 2.24E+07 1.14E+07 9 9 0 5 3 6 5 89131 Zinc finger CCCH domain-containing protein 11A OS=Homo sapiens OX=9606 GN=ZC3H11A PE=1 SV=3 216 422 sp|P62851|RS25_HUMAN 141.67 45 22 31 31 36 38 6.56E+07 4.30E+08 3.88E+08 4.58E+08 2.48E+08 9 7 5 14 12 22 13 13742 40S ribosomal protein S25 OS=Homo sapiens OX=9606 GN=RPS25 PE=1 SV=1 777 289 sp|Q08378|GOGA3_HUMAN 141.39 8 1 4 1 2 1 3.28E+07 2.32E+06 2.29E+06 6.39E+07 1.74E+06 9 8 2 3 1 3 2 167354 Golgin subfamily A member 3 OS=Homo sapiens OX=9606 GN=GOLGA3 PE=1 SV=2 411 504 sp|P67936|TPM4_HUMAN 141.1 30 15 8 8 24 19 1.32E+07 1.31E+07 8.47E+06 9 5 7 3 3 8 4 28522 Tropomyosin alpha-4 chain OS=Homo sapiens OX=9606 GN=TPM4 PE=1 SV=3 589 354 sp|Q14690|RRP5_HUMAN 140.18 5 0 3 2 1 1 8.08E+06 2.93E+06 4.46E+06 10 7 1 7 4 3 2 208699 Protein RRP5 homolog OS=Homo sapiens OX=9606 GN=PDCD11 PE=1 SV=3 288 590 sp|P62854|RS26_HUMAN 139.82 44 34 34 44 38 34 3.84E+07 4.99E+08 4.25E+08 3.87E+08 1.57E+08 5 4 6 10 12 10 5 13015 40S ribosomal protein S26 OS=Homo sapiens OX=9606 GN=RPS26 PE=1 SV=3 178 919 sp|P62861|RS30_HUMAN 139.69 20 17 20 20 20 20 8.84E+06 2.43E+08 5.51E+08 4.50E+08 2.67E+08 5 5 1 19 24 17 21 6648 40S ribosomal protein S30 OS=Homo sapiens OX=9606 GN=FAU PE=1 SV=1 635 429 sp|P00338|LDHA_HUMAN 139.66 18 10 5 11 14 3 3.82E+06 1.03E+07 9.67E+06 1.88E+07 1.25E+06 6 5 4 2 3 5 1 36689 L-lactate dehydrogenase A chain OS=Homo sapiens OX=9606 GN=LDHA PE=1 SV=2 453 456 sp|P04792|HSPB1_HUMAN 139.07 37 20 17 8 25 22 1.37E+07 2.53E+07 1.15E+07 4.27E+07 3.04E+07 6 6 3 5 1 4 9 22783 Heat shock protein beta-1 OS=Homo sapiens OX=9606 GN=HSPB1 PE=1 SV=2 599 436 sp|P55072|TERA_HUMAN 138.43 9 7 2 6 7 2 3.82E+06 3.30E+06 5.52E+06 1.11E+07 2.84E+06 7 4 5 2 4 5 1 89322 Transitional endoplasmic reticulum ATPase OS=Homo sapiens OX=9606 GN=VCP PE=1 SV=4 274 303 sp|O95758|PTBP3_HUMAN 137.75 15 8 7 9 13 8 1.21E+06 5.59E+06 4.61E+06 12 3 8 8 9 12 9 59690 Polypyrimidine tract-binding protein 3 OS=Homo sapiens OX=9606 GN=PTBP3 PE=1 SV=2 994 489 sp|P23526|SAHH_HUMAN 137.73 14 0 9 6 11 6 8.94E+06 5.21E+06 1.49E+07 2.65E+06 5 5 0 3 2 4 2 47716 Adenosylhomocysteinase OS=Homo sapiens OX=9606 GN=AHCY PE=1 SV=4 976 534 sp|O95831|AIFM1_HUMAN 137.7 9 2 2 2 6 5 1.12E+06 1.97E+06 2.48E+06 6.48E+06 2.94E+06 5 4 1 1 1 4 3 66901 Apoptosis-inducing factor 1 mitochondrial OS=Homo sapiens OX=9606 GN=AIFM1 PE=1 SV=1 323 330 sp|P22087|FBRL_HUMAN 137.45 25 7 21 25 17 12 2.44E+06 3.55E+07 3.55E+07 3.62E+07 2.04E+07 8 6 3 8 9 9 6 33784 rRNA 2'-O-methyltransferase fibrillarin OS=Homo sapiens OX=9606 GN=FBL PE=1 SV=2 389 594 sp|P0DP24|CALM2_HUMAN 136.65 34 12 33 24 33 23 8.22E+05 3.65E+07 2.07E+07 6.18E+07 1.83E+07 6 5 3 7 4 10 3 16838 Calmodulin-2 OS=Homo sapiens OX=9606 GN=CALM2 PE=1 SV=1 389 595 sp|P0DP23|CALM1_HUMAN 136.65 34 12 33 24 33 23 8.22E+05 3.65E+07 2.07E+07 6.18E+07 1.83E+07 6 5 3 7 4 10 3 16838 Calmodulin-1 OS=Homo sapiens OX=9606 GN=CALM1 PE=1 SV=1 389 596 sp|P0DP25|CALM3_HUMAN 136.65 34 12 33 24 33 23 8.22E+05 3.65E+07 2.07E+07 6.18E+07 1.83E+07 6 5 3 7 4 10 3 16838 Calmodulin-3 OS=Homo sapiens OX=9606 GN=CALM3 PE=1 SV=1 598 325 sp|P21980|TGM2_HUMAN 136.47 15 3 2 6 9 4 3.80E+06 1.73E+06 9.53E+06 1.82E+07 6.15E+06 9 7 2 2 4 6 3 77329 Protein-glutamine gamma-glutamyltransferase 2 OS=Homo sapiens OX=9606 GN=TGM2 PE=1 SV=2 301 426 sp|P61353|RL27_HUMAN 136.46 54 26 51 26 54 26 1.24E+07 7.89E+07 4.09E+08 9.96E+07 4.22E+07 8 7 3 11 8 11 6 15798 60S ribosomal protein L27 OS=Homo sapiens OX=9606 GN=RPL27 PE=1 SV=2 284 393 sp|P06730|IF4E_HUMAN 136.27 37 29 32 37 32 18 1.86E+07 1.49E+08 1.25E+08 2.95E+08 5.02E+07 6 6 5 12 9 13 5 25097 Eukaryotic translation initiation factor 4E OS=Homo sapiens OX=9606 GN=EIF4E PE=1 SV=2 447 441 sp|P57721|PCBP3_HUMAN 136.16 18 9 12 15 18 11 4.22E+06 4.41E+06 5 1 2 4 6 7 4 39465 Poly(rC)-binding protein 3 OS=Homo sapiens OX=9606 GN=PCBP3 PE=1 SV=2 647 335 sp|P42167|LAP2B_HUMAN 135.77 22 12 3 9 13 9 1.01E+06 8 1 4 1 3 4 3 50670 Lamina-associated polypeptide 2 isoforms beta/gamma OS=Homo sapiens OX=9606 GN=TMPO PE=1 SV=2 1509 409 sp|Q92615|LAR4B_HUMAN 135.14 11 0 4 2 4 2 5.89E+06 2.30E+06 3.40E+06 3.69E+06 6 6 0 2 1 2 2 80552 La-related protein 4B OS=Homo sapiens OX=9606 GN=LARP4B PE=1 SV=3 326 543 sp|O75494|SRS10_HUMAN 135.08 20 15 9 9 9 10 8.95E+06 3.11E+07 1.61E+07 4.72E+07 4.82E+07 6 5 3 6 8 7 9 31301 Serine/arginine-rich splicing factor 10 OS=Homo sapiens OX=9606 GN=SRSF10 PE=1 SV=1 526 290 sp|Q99459|CDC5L_HUMAN 134.94 12 1 2 11 10 3 1.41E+06 1.82E+06 1.12E+07 9.22E+06 5.03E+06 8 7 1 2 7 6 2 92251 Cell division cycle 5-like protein OS=Homo sapiens OX=9606 GN=CDC5L PE=1 SV=2 492 524 sp|Q8N684|CPSF7_HUMAN 134.81 13 8 11 0 12 9 9.80E+06 2.82E+07 3.18E+07 1.37E+07 6 4 3 7 0 6 5 52050 Cleavage and polyadenylation specificity factor subunit 7 OS=Homo sapiens OX=9606 GN=CPSF7 PE=1 SV=1 685 531 sp|Q14498|RBM39_HUMAN 134.48 11 5 2 8 8 11 2.48E+06 0.00E+00 1.44E+07 1.19E+07 1.08E+07 4 4 2 1 4 4 4 59380 RNA-binding protein 39 OS=Homo sapiens OX=9606 GN=RBM39 PE=1 SV=2 1186 318 sp|Q96JE7|SC16B_HUMAN 134.06 8 8 0 0 0 0 2.71E+07 7 7 9 0 0 0 0 116604 Protein transport protein Sec16B OS=Homo sapiens OX=9606 GN=SEC16B PE=1 SV=2 626 355 sp|P42166|LAP2A_HUMAN 133.96 14 6 3 6 9 8 8.42E+06 6.63E+06 8 1 3 2 3 4 4 75492 Lamina-associated polypeptide 2 isoform alpha OS=Homo sapiens OX=9606 GN=TMPO PE=1 SV=2 438 425 sp|P61326|MGN_HUMAN 133.56 49 14 39 25 25 34 4.25E+06 3.35E+06 3.79E+06 3.09E+05 6 1 1 8 5 5 5 17164 Protein mago nashi homolog OS=Homo sapiens OX=9606 GN=MAGOH PE=1 SV=1 433 474 sp|P32969|RL9_HUMAN 133.19 33 19 18 22 27 9 1.42E+07 1.94E+07 2.61E+07 4.21E+07 8.99E+06 6 5 5 5 5 5 2 21863 60S ribosomal protein L9 OS=Homo sapiens OX=9606 GN=RPL9 PE=1 SV=1 471 435 sp|P63104|1433Z_HUMAN 132.85 26 16 24 22 11 11 7.35E+06 4.66E+07 8.69E+07 7.48E+06 3.47E+06 6 3 3 6 6 4 3 27745 14-3-3 protein zeta/delta OS=Homo sapiens OX=9606 GN=YWHAZ PE=1 SV=1 134 461 sp|P84243|H33_HUMAN 132.78 35 35 34 34 29 34 4.02E+08 7.49E+08 6.62E+08 1.01E+09 8.76E+08 13 7 26 20 17 27 25 15328 Histone H3.3 OS=Homo sapiens OX=9606 GN=H3-3A PE=1 SV=2 134 462 sp|Q16695|H31T_HUMAN 132.78 35 35 34 34 29 34 4.02E+08 7.49E+08 6.62E+08 1.01E+09 8.76E+08 13 7 26 20 17 27 25 15508 Histone H3.1t OS=Homo sapiens OX=9606 GN=H3-4 PE=1 SV=3 134 463 sp|P68431|H31_HUMAN 132.78 35 35 34 34 29 34 4.02E+08 7.49E+08 6.62E+08 1.01E+09 8.76E+08 13 7 26 20 17 27 25 15404 Histone H3.1 OS=Homo sapiens OX=9606 GN=H3C1 PE=1 SV=2 134 464 sp|Q71DI3|H32_HUMAN 132.78 35 35 34 34 29 34 4.02E+08 7.49E+08 6.62E+08 1.01E+09 8.76E+08 13 7 26 20 17 27 25 15388 Histone H3.2 OS=Homo sapiens OX=9606 GN=H3C15 PE=1 SV=3 364 499 sp|Q3MHD2|LSM12_HUMAN 132.31 32 15 32 32 32 25 2.40E+07 7.98E+07 1.35E+08 1.51E+08 7.80E+07 5 4 4 8 6 7 4 21701 Protein LSM12 homolog OS=Homo sapiens OX=9606 GN=LSM12 PE=1 SV=2 338 480 sp|Q99729|ROAA_HUMAN 132.12 18 12 13 12 16 8 9.50E+06 1.32E+07 2.70E+07 3.81E+07 1.20E+07 6 5 5 6 9 9 3 36225 Heterogeneous nuclear ribonucleoprotein A/B OS=Homo sapiens OX=9606 GN=HNRNPAB PE=1 SV=2 222 541 sp|Q5XKE5|K2C79_HUMAN 131.92 10 5 6 5 6 6 2.00E+06 9 1 10 17 13 12 13 57836 Keratin type II cytoskeletal 79 OS=Homo sapiens OX=9606 GN=KRT79 PE=1 SV=2 769 470 sp|Q9NNW5|WDR6_HUMAN 131.63 8 0 6 6 3 2 1.12E+07 9.30E+06 4.92E+06 4.10E+05 7 5 0 5 4 3 2 121724 WD repeat-containing protein 6 OS=Homo sapiens OX=9606 GN=WDR6 PE=1 SV=1 440 346 sp|Q9H0D6|XRN2_HUMAN 131.31 11 9 3 5 5 4 1.53E+07 7.49E+06 1.45E+07 8.07E+06 1.00E+07 8 7 6 4 4 5 3 108583 5'-3' exoribonuclease 2 OS=Homo sapiens OX=9606 GN=XRN2 PE=1 SV=1 633 421 sp|O75874|IDHC_HUMAN 130.84 16 6 4 12 14 0 1.98E+06 2.29E+06 1.77E+07 2.03E+07 6 6 2 2 5 7 0 46659 Isocitrate dehydrogenase [NADP] cytoplasmic OS=Homo sapiens OX=9606 GN=IDH1 PE=1 SV=2 387 287 sp|P40429|RL13A_HUMAN 130.61 38 9 31 7 24 25 3.12E+06 4.04E+07 2.18E+07 6.50E+07 3.49E+07 12 8 2 9 3 7 6 23577 60S ribosomal protein L13a OS=Homo sapiens OX=9606 GN=RPL13A PE=1 SV=2 559 342 sp|Q7Z739|YTHD3_HUMAN 129.66 14 11 3 7 6 6 7.36E+06 2.33E+06 7.68E+06 1.95E+06 8 3 5 2 4 3 4 63861 YTH domain-containing family protein 3 OS=Homo sapiens OX=9606 GN=YTHDF3 PE=1 SV=1 475 424 sp|Q96A72|MGN2_HUMAN 129.51 49 20 39 25 25 34 1.36E+06 4.55E+06 7.03E+06 1.12E+07 3.32E+06 6 1 2 5 5 5 5 17276 Protein mago nashi homolog 2 OS=Homo sapiens OX=9606 GN=MAGOHB PE=1 SV=1 KH domain-containing RNA-binding signal transduction-associated protein 3 OS=Homo sapiens OX=9606 229 362 sp|O75525|KHDR3_HUMAN 129.32 23 23 10 7 5 3 2.52E+07 4.34E+06 14 4 32 10 8 6 3 38800 GN=KHDRBS3 PE=1 SV=1 679 423 sp|Q13595|TRA2A_HUMAN 128.86 22 5 15 9 15 9 7.05E+06 5.01E+07 2.49E+07 4.54E+07 2.52E+07 7 5 1 6 2 4 2 32689 Transformer-2 protein homolog alpha OS=Homo sapiens OX=9606 GN=TRA2A PE=1 SV=1 727 563 sp|Q8IYB3|SRRM1_HUMAN 128.72 8 0 2 5 6 0 7.16E+06 7.14E+06 1.75E+07 4 4 0 4 4 6 0 102335 Serine/arginine repetitive matrix protein 1 OS=Homo sapiens OX=9606 GN=SRRM1 PE=1 SV=2 933 510 sp|P05198|IF2A_HUMAN 128.5 18 11 2 10 10 8 7.48E+06 1.34E+06 5.80E+06 6.21E+06 8.49E+06 5 5 3 1 3 3 2 36112 Eukaryotic translation initiation factor 2 subunit 1 OS=Homo sapiens OX=9606 GN=EIF2S1 PE=1 SV=3 469 263 sp|O43663|PRC1_HUMAN 128.19 19 5 6 7 8 7 6.09E+06 1.42E+07 1.20E+07 1.61E+07 4.14E+07 12 10 4 5 4 5 4 71607 Protein regulator of cytokinesis 1 OS=Homo sapiens OX=9606 GN=PRC1 PE=1 SV=2 576 438 sp|P49411|EFTU_HUMAN 128.06 18 8 8 12 12 0 7.50E+05 1.20E+07 1.61E+07 5.01E+06 7 5 5 4 5 4 0 49542 Elongation factor Tu mitochondrial OS=Homo sapiens OX=9606 GN=TUFM PE=1 SV=2 1057 568 sp|Q12849|GRSF1_HUMAN 128.04 12 2 6 10 8 2 3.52E+06 3.68E+06 7.04E+06 1.26E+07 3.35E+06 4 4 1 2 3 3 1 53126 G-rich sequence factor 1 OS=Homo sapiens OX=9606 GN=GRSF1 PE=1 SV=3 763 336 sp|P51398|RT29_HUMAN 127.95 21 5 13 11 4 10 2.35E+06 1.43E+07 7.39E+06 4.78E+06 3.66E+06 7 6 2 4 3 1 3 45566 28S ribosomal protein S29 mitochondrial OS=Homo sapiens OX=9606 GN=DAP3 PE=1 SV=1 735 328 sp|P00367|DHE3_HUMAN 127.24 18 6 7 14 6 0 1.90E+06 1.27E+07 1.56E+07 7.67E+06 8 7 2 4 6 2 0 61398 Glutamate dehydrogenase 1 mitochondrial OS=Homo sapiens OX=9606 GN=GLUD1 PE=1 SV=2 755 420 sp|Q96RR1|PEO1_HUMAN 126.89 12 0 6 11 7 1 1.92E+06 1.00E+07 5.38E+06 7 5 0 3 5 5 1 77154 Twinkle protein mitochondrial OS=Homo sapiens OX=9606 GN=TWNK PE=1 SV=1 684 333 sp|Q15020|SART3_HUMAN 126.42 11 6 1 4 4 4 4.78E+06 1.47E+06 2.99E+08 1.60E+06 9 6 4 2 3 3 3 109935 Squamous cell carcinoma antigen recognized by T-cells 3 OS=Homo sapiens OX=9606 GN=SART3 PE=1 SV=1 258 545 sp|P01861|IGHG4_HUMAN 126.41 21 20 2 2 2 2 9.57E+06 9 2 44 1 2 1 2 35941 Immunoglobulin heavy constant gamma 4 OS=Homo sapiens OX=9606 GN=IGHG4 PE=1 SV=1 648 665 sp|Q9Y5S9|RBM8A_HUMAN 126.22 32 0 17 32 32 11 8.69E+06 1.71E+07 3.21E+07 1.61E+07 3 3 0 3 5 6 2 19889 RNA-binding protein 8A OS=Homo sapiens OX=9606 GN=RBM8A PE=1 SV=1 373 1037 sp|P63173|RL38_HUMAN 125.96 36 36 34 31 36 14 1.80E+07 7.24E+07 4.98E+07 6.27E+07 3.72E+07 4 4 5 8 4 9 2 8218 60S ribosomal protein L38 OS=Homo sapiens OX=9606 GN=RPL38 PE=1 SV=2 550 517 sp|P62888|RL30_HUMAN 125.88 44 14 39 35 30 30 3.63E+06 1.79E+07 2.43E+07 1.86E+07 9.74E+06 5 4 2 4 5 5 3 12784 60S ribosomal protein L30 OS=Homo sapiens OX=9606 GN=RPL30 PE=1 SV=2 535 584 sp|Q13148|TADBP_HUMAN 125.1 15 6 13 8 12 7 2.38E+06 1.42E+07 1.44E+07 1.97E+07 7.64E+06 6 4 2 6 3 5 3 44740 TAR DNA-binding protein 43 OS=Homo sapiens OX=9606 GN=TARDBP PE=1 SV=1 713 457 sp|Q6P2Q9|PRP8_HUMAN 124.86 4 1 1 2 2 0 9.64E+05 1.15E+07 8.41E+05 10 5 3 2 5 3 1 273599 Pre-mRNA-processing-splicing factor 8 OS=Homo sapiens OX=9606 GN=PRPF8 PE=1 SV=2 838 518 sp|P61313|RL15_HUMAN 124.78 22 0 11 15 11 11 3.59E+07 2.23E+07 2.20E+07 1.35E+07 5 5 0 4 4 3 2 24146 60S ribosomal protein L15 OS=Homo sapiens OX=9606 GN=RPL15 PE=1 SV=2 416 501 sp|P30050|RL12_HUMAN 124.75 33 29 23 15 28 18 2.00E+07 2.03E+07 4.40E+07 5.73E+07 1.98E+07 5 5 5 5 4 6 5 17819 60S ribosomal protein L12 OS=Homo sapiens OX=9606 GN=RPL12 PE=1 SV=1 612 356 sp|P46779|RL28_HUMAN 124.74 44 12 25 20 19 26 1.29E+06 2.14E+07 8.31E+06 1.34E+07 1.96E+07 7 6 2 4 4 3 4 15747 60S ribosomal protein L28 OS=Homo sapiens OX=9606 GN=RPL28 PE=1 SV=3 757 500 sp|P31942|HNRH3_HUMAN 123.71 16 12 8 2 2 5 2.46E+07 4.47E+07 5.22E+07 2.99E+06 6 5 7 3 1 1 2 36926 Heterogeneous nuclear ribonucleoprotein H3 OS=Homo sapiens OX=9606 GN=HNRNPH3 PE=1 SV=2 947 506 sp|Q9BRZ2|TRI56_HUMAN 123.3 9 3 4 3 5 1 1.84E+06 6.43E+07 1.14E+07 1.73E+07 9.09E+06 5 5 1 4 2 3 1 81488 E3 ubiquitin-protein ligase TRIM56 OS=Homo sapiens OX=9606 GN=TRIM56 PE=1 SV=3 1076 349 sp|P30101|PDIA3_HUMAN 123.04 18 0 5 9 9 1 2.74E+06 7.85E+06 9.44E+06 8 6 0 2 4 3 1 56782 Protein disulfide-isomerase A3 OS=Homo sapiens OX=9606 GN=PDIA3 PE=1 SV=4 548 551 sp|P55735|SEC13_HUMAN 123 28 28 3 7 0 0 6.29E+07 5.06E+05 1.32E+06 5 5 17 1 1 0 0 35541 Protein SEC13 homolog OS=Homo sapiens OX=9606 GN=SEC13 PE=1 SV=3 436 368 sp|Q9Y3B7|RM11_HUMAN 122.49 40 3 38 29 29 24 3.41E+07 2.89E+07 4.30E+07 1.32E+07 8 7 1 9 5 6 3 20683 39S ribosomal protein L11 mitochondrial OS=Homo sapiens OX=9606 GN=MRPL11 PE=1 SV=1 362 535 sp|P62937|PPIA_HUMAN 122.49 36 8 20 29 25 15 0.00E+00 1.98E+07 4.99E+07 6.90E+07 1.59E+07 6 5 1 4 12 9 3 18012 Peptidyl-prolyl cis-trans isomerase A OS=Homo sapiens OX=9606 GN=PPIA PE=1 SV=2 737 520 sp|Q86U42|PABP2_HUMAN 122.18 16 11 4 14 11 8 1.78E+07 8.68E+06 3.46E+07 3.37E+07 2.46E+07 5 5 4 1 4 3 2 32749 Polyadenylate-binding protein 2 OS=Homo sapiens OX=9606 GN=PABPN1 PE=1 SV=3 567 434 sp|P09661|RU2A_HUMAN 122.09 24 5 18 13 9 17 1.68E+06 2.20E+07 2.36E+07 7.10E+06 1.22E+07 7 6 1 5 4 2 6 28416 U2 small nuclear ribonucleoprotein A' OS=Homo sapiens OX=9606 GN=SNRPA1 PE=1 SV=2 920 515 sp|Q09028|RBBP4_HUMAN 121.97 13 5 4 8 7 3 5.26E+06 2.60E+06 1.76E+07 9.92E+06 6.98E+06 6 5 2 2 3 4 1 47656 Histone-binding protein RBBP4 OS=Homo sapiens OX=9606 GN=RBBP4 PE=1 SV=3 629 589 sp|P35250|RFC2_HUMAN 121.63 15 15 11 11 11 8 1.25E+07 1.69E+07 1.12E+07 1.64E+07 8.86E+06 4 4 4 3 3 3 2 39157 Replication factor C subunit 2 OS=Homo sapiens OX=9606 GN=RFC2 PE=1 SV=3 245 651 sp|P0DOX5|IGG1_HUMAN 121.58 9 6 3 3 2 2 2.74E+06 9 1 42 2 4 2 3 49329 Immunoglobulin gamma-1 heavy chain OS=Homo sapiens OX=9606 PE=1 SV=2 1083 530 sp|A1L020|MEX3A_HUMAN 121.49 12 0 2 9 6 7 1.75E+06 5.04E+06 4.52E+06 5 3 0 1 4 2 3 54173 RNA-binding protein MEX3A OS=Homo sapiens OX=9606 GN=MEX3A PE=1 SV=1 565 1512 sp|O14921|RGS13_HUMAN 120.38 37 37 18 18 18 18 3.05E+07 4.13E+07 1.55E+07 4.72E+06 2.68E+06 3 3 7 3 4 1 2 19135 Regulator of G-protein signaling 13 OS=Homo sapiens OX=9606 GN=RGS13 PE=1 SV=1 219 608 sp|Q96A08|H2B1A_HUMAN 120.18 33 21 21 21 21 33 2.18E+06 7 1 11 11 15 12 17 14167 Histone H2B type 1-A OS=Homo sapiens OX=9606 GN=H2BC1 PE=1 SV=3 1181 552 sp|P39060|COIA1_HUMAN 120.18 4 2 1 1 0 1 1.19E+06 4.24E+06 5.58E+06 0.00E+00 7 6 2 3 1 1 1 178187 Collagen alpha-1(XVIII) chain OS=Homo sapiens OX=9606 GN=COL18A1 PE=1 SV=5 452 437 sp|Q13247|SRSF6_HUMAN 119.67 17 11 15 6 15 13 8.78E+06 1.84E+07 1.22E+07 2.19E+07 2.38E+07 6 3 5 5 2 6 5 39587 Serine/arginine-rich splicing factor 6 OS=Homo sapiens OX=9606 GN=SRSF6 PE=1 SV=2 652 511 sp|P01344|IGF2_HUMAN 119.44 29 0 29 29 12 22 1.16E+07 1.05E+07 3.92E+06 7.24E+06 5 3 0 5 5 2 4 20140 Insulin-like growth factor II OS=Homo sapiens OX=9606 GN=IGF2 PE=1 SV=1 563 477 sp|P14625|ENPL_HUMAN 119.35 8 2 6 4 6 0 1.92E+06 1.63E+07 7.50E+06 1.71E+07 7 4 2 4 4 8 0 92469 Endoplasmin OS=Homo sapiens OX=9606 GN=HSP90B1 PE=1 SV=1 339 591 sp|P98179|RBM3_HUMAN 119.27 35 27 17 19 35 24 6.60E+07 4.67E+06 2.09E+07 7.90E+07 1.56E+07 4 4 11 2 5 11 3 17170 RNA-binding protein 3 OS=Homo sapiens OX=9606 GN=RBM3 PE=1 SV=1 516 633 sp|P0DOX8|IGL1_HUMAN 118.95 17 17 0 0 0 0 1.88E+08 7 1 20 0 0 0 0 22830 Immunoglobulin lambda-1 light chain OS=Homo sapiens OX=9606 PE=1 SV=1 543 648 sp|P09493|TPM1_HUMAN 117.59 14 7 7 7 14 11 1.59E+06 7.97E+05 5 1 3 3 3 7 3 32709 Tropomyosin alpha-1 chain OS=Homo sapiens OX=9606 GN=TPM1 PE=1 SV=2 533 533 sp|Q9Y3Y2|CHTOP_HUMAN 117.5 21 10 21 17 17 10 1.46E+06 2.64E+07 1.94E+07 3.13E+07 1.47E+07 4 4 2 6 3 5 3 26397 Chromatin target of PRMT1 protein OS=Homo sapiens OX=9606 GN=CHTOP PE=1 SV=2 1561 538 sp|Q6ZRV2|FA83H_HUMAN 117.36 7 1 1 6 0 0 9.75E+05 3.62E+06 6 4 2 1 4 0 0 127122 Protein FAM83H OS=Homo sapiens OX=9606 GN=FAM83H PE=1 SV=3 1366 363 sp|Q8N163|CCAR2_HUMAN 117.36 8 4 1 1 0 3 4.92E+06 1.90E+06 1.48E+06 2.08E+06 7 6 3 1 1 0 3 102902 Cell cycle and apoptosis regulator protein 2 OS=Homo sapiens OX=9606 GN=CCAR2 PE=1 SV=2 1444 539 sp|Q9Y230|RUVB2_HUMAN 116.53 11 1 1 3 5 4 2.75E+06 4.97E+06 1.66E+06 5 4 1 1 2 2 2 51157 RuvB-like 2 OS=Homo sapiens OX=9606 GN=RUVBL2 PE=1 SV=3 708 1262 sp|P62857|RS28_HUMAN 116.5 41 17 30 35 41 17 5.13E+06 2.55E+07 3.34E+07 5.38E+07 5.39E+06 4 4 1 2 3 8 1 7841 40S ribosomal protein S28 OS=Homo sapiens OX=9606 GN=RPS28 PE=1 SV=1 690 546 sp|P09496|CLCA_HUMAN 116.48 21 11 3 14 19 17 1.88E+06 8.86E+06 2.11E+07 1.25E+07 5 4 2 1 3 5 4 27077 Clathrin light chain A OS=Homo sapiens OX=9606 GN=CLTA PE=1 SV=1 1027 707 sp|P63167|DYL1_HUMAN 116.37 51 12 37 0 51 37 1.89E+06 3.71E+06 2.49E+07 1.09E+07 3 3 1 2 0 5 3 10366 Dynein light chain 1 cytoplasmic OS=Homo sapiens OX=9606 GN=DYNLL1 PE=1 SV=1 795 654 sp|Q96KR1|ZFR_HUMAN 115.21 6 3 3 3 3 4 5.98E+05 4.79E+05 1.12E+06 1.21E+06 1.78E+06 5 3 2 3 2 3 3 117012 Zinc finger RNA-binding protein OS=Homo sapiens OX=9606 GN=ZFR PE=1 SV=2 333 523 sp|P35268|RL22_HUMAN 114.94 48 20 30 38 30 36 3.59E+07 1.46E+08 1.02E+08 1.60E+08 1.13E+08 7 7 5 7 7 7 7 14787 60S ribosomal protein L22 OS=Homo sapiens OX=9606 GN=RPL22 PE=1 SV=2 1527 593 sp|Q01581|HMCS1_HUMAN 114.86 10 2 2 10 2 0 2.21E+06 2.28E+06 3.96E+07 5.41E+06 4 4 1 1 4 1 0 57294 Hydroxymethylglutaryl-CoA synthase cytoplasmic OS=Homo sapiens OX=9606 GN=HMGCS1 PE=1 SV=2 721 587 sp|Q13263|TIF1B_HUMAN 114 11 4 3 8 8 3 1.96E+06 2.34E+06 8.58E+06 8.64E+06 3.21E+06 5 4 1 2 4 5 2 88550 Transcription intermediary factor 1-beta OS=Homo sapiens OX=9606 GN=TRIM28 PE=1 SV=5 504 586 sp|P32119|PRDX2_HUMAN 113.86 23 10 6 15 15 10 7.57E+05 3.06E+06 3.17E+06 7.81E+05 5 4 3 4 4 6 3 21892 Peroxiredoxin-2 OS=Homo sapiens OX=9606 GN=PRDX2 PE=1 SV=5 608 475 sp|P09012|SNRPA_HUMAN 113.59 27 0 16 13 9 23 3.20E+07 2.12E+07 1.91E+07 1.37E+07 6 3 0 5 4 3 4 31280 U1 small nuclear ribonucleoprotein A OS=Homo sapiens OX=9606 GN=SNRPA PE=1 SV=3 Interferon-inducible double-stranded RNA-dependent protein kinase activator A OS=Homo sapiens OX=9606 839 557 sp|O75569|PRKRA_HUMAN 113.37 14 3 12 8 10 9 2.76E+06 1.56E+07 1.53E+07 2.47E+07 3.60E+07 4 4 1 4 2 3 3 34404 GN=PRKRA PE=1 SV=1 641 547 sp|P04004|VTNC_HUMAN 113.23 11 1 11 5 3 5 2.08E+06 1.78E+06 1.36E+06 5 2 2 6 4 2 2 54306 Vitronectin OS=Homo sapiens OX=9606 GN=VTN PE=1 SV=1 945 431 sp|Q8WV44|TRI41_HUMAN 112.51 10 10 1 1 1 0 2.20E+07 7 5 7 1 1 2 0 71670 E3 ubiquitin-protein ligase TRIM41 OS=Homo sapiens OX=9606 GN=TRIM41 PE=1 SV=3 Serine/threonine-protein phosphatase PP1-alpha catalytic subunit OS=Homo sapiens OX=9606 GN=PPP1CA PE=1 493 548 sp|P62136|PP1A_HUMAN 112.12 18 13 8 9 8 10 3.05E+07 3.78E+06 2.88E+06 6.24E+06 1.14E+07 6 4 6 4 3 5 3 37512 SV=1 154 697 sp|P62273|RS29_HUMAN 112.06 48 34 46 48 48 46 2.08E+07 3.71E+08 4.54E+08 6.04E+08 2.06E+08 5 4 2 13 32 21 27 6677 40S ribosomal protein S29 OS=Homo sapiens OX=9606 GN=RPS29 PE=1 SV=2 586 692 sp|P42677|RS27_HUMAN 111.89 40 40 25 25 40 40 2.62E+07 3.08E+07 4.43E+07 6.03E+07 6.23E+07 3 3 4 2 2 6 4 9461 40S ribosomal protein S27 OS=Homo sapiens OX=9606 GN=RPS27 PE=1 SV=3 2458 628 sp|P27797|CALR_HUMAN 111.49 9 2 3 3 4 0 2.01E+06 9.15E+05 1.89E+06 6.49E+06 3 3 1 1 1 1 0 48142 Calreticulin OS=Homo sapiens OX=9606 GN=CALR PE=1 SV=1 689 419 sp|O60832|DKC1_HUMAN 111.39 13 0 1 5 8 6 4.08E+06 1.45E+07 4.83E+06 8 6 0 1 3 5 5 57674 H/ACA ribonucleoprotein complex subunit DKC1 OS=Homo sapiens OX=9606 GN=DKC1 PE=1 SV=3 1106 519 sp|O14744|ANM5_HUMAN 111.13 8 0 5 7 2 5 4.30E+06 7.34E+06 2.01E+06 3.88E+06 5 5 0 2 4 1 3 72684 Protein arginine N-methyltransferase 5 OS=Homo sapiens OX=9606 GN=PRMT5 PE=1 SV=4 292 699 sp|Q99996|AKAP9_HUMAN 110.66 3 0 1 1 1 1 2.49E+06 4.20E+08 16 3 3 10 11 8 7 452990 A-kinase anchor protein 9 OS=Homo sapiens OX=9606 GN=AKAP9 PE=1 SV=4 2-oxoisovalerate dehydrogenase subunit beta mitochondrial OS=Homo sapiens OX=9606 GN=BCKDHB PE=1 1562 617 sp|P21953|ODBB_HUMAN 110.41 11 11 0 0 0 0 2.51E+07 4 3 7 0 0 0 0 43123 SV=2 1026 690 sp|P18669|PGAM1_HUMAN 110.31 18 6 6 18 10 0 1.98E+06 3.61E+06 1.82E+07 1.14E+07 3 3 1 1 5 4 0 28804 Phosphoglycerate mutase 1 OS=Homo sapiens OX=9606 GN=PGAM1 PE=1 SV=2 771 1127 sp|P01703|LV140_HUMAN 110.27 18 18 0 0 0 0 3.32E+07 6 3 14 0 0 0 0 12302 Immunoglobulin lambda variable 1-40 OS=Homo sapiens OX=9606 GN=IGLV1-40 PE=1 SV=2 640 407 sp|P26641|EF1G_HUMAN 110.21 14 9 7 6 5 6 1.03E+07 1.10E+07 1.46E+07 2.22E+07 2.81E+06 6 6 4 3 3 2 4 50119 Elongation factor 1-gamma OS=Homo sapiens OX=9606 GN=EEF1G PE=1 SV=3 352 467 sp|Q8NC51|PAIRB_HUMAN 110.09 16 15 12 13 16 12 1.43E+07 2.19E+07 2.39E+07 3.54E+07 2.53E+07 7 4 6 5 6 7 5 44965 Plasminogen activator inhibitor 1 RNA-binding protein OS=Homo sapiens OX=9606 GN=SERBP1 PE=1 SV=2 1617 662 sp|O00299|CLIC1_HUMAN 110.01 17 0 12 12 10 5 5.84E+06 8.42E+06 4.31E+06 3.19E+06 3 3 0 2 2 2 1 26923 Chloride intracellular channel protein 1 OS=Homo sapiens OX=9606 GN=CLIC1 PE=1 SV=4 1114 472 sp|Q9UKF6|CPSF3_HUMAN 109.15 10 1 2 7 1 4 3.50E+06 4.41E+06 1.44E+07 1.14E+08 6 5 1 2 4 1 2 77486 Cleavage and polyadenylation specificity factor subunit 3 OS=Homo sapiens OX=9606 GN=CPSF3 PE=1 SV=1 1203 576 sp|Q9Y295|DRG1_HUMAN 108.5 14 4 3 1 11 4 9.27E+05 1.33E+06 4.93E+06 9.92E+05 5 3 2 1 1 3 2 40542 Developmentally-regulated GTP-binding protein 1 OS=Homo sapiens OX=9606 GN=DRG1 PE=1 SV=1 1445 656 sp|P15531|NDKA_HUMAN 108.32 25 8 11 25 11 11 1.59E+06 8.03E+06 3.24E+07 6.38E+06 6.30E+06 3 3 1 1 4 1 1 17149 Nucleoside diphosphate kinase A OS=Homo sapiens OX=9606 GN=NME1 PE=1 SV=1 1445 688 sp|P22392|NDKB_HUMAN 108.32 25 8 11 25 11 11 1.59E+06 8.03E+06 3.24E+07 6.38E+06 6.30E+06 3 3 1 1 4 1 1 17298 Nucleoside diphosphate kinase B OS=Homo sapiens OX=9606 GN=NME2 PE=1 SV=1 794 458 sp|Q9H6S0|YTDC2_HUMAN 107.67 6 1 2 2 3 0 4.56E+06 3.05E+06 3.96E+06 9 6 2 3 3 4 1 160248 3'-5' RNA helicase YTHDC2 OS=Homo sapiens OX=9606 GN=YTHDC2 PE=1 SV=2 372 716 sp|P02792|FRIL_HUMAN 107.6 22 22 18 22 18 0 2.22E+07 1.45E+07 5.92E+07 2.34E+07 3 3 4 9 9 5 0 20020 Ferritin light chain OS=Homo sapiens OX=9606 GN=FTL PE=1 SV=2 1115 649 sp|P05387|RLA2_HUMAN 107.5 77 31 0 56 27 10 9.63E+05 8.55E+06 1.15E+07 1.36E+06 4 4 2 0 4 3 1 11665 60S acidic ribosomal protein P2 OS=Homo sapiens OX=9606 GN=RPLP2 PE=1 SV=1 736 428 sp|Q96T37|RBM15_HUMAN 107.16 8 2 5 3 2 3 1.38E+05 5.97E+06 1.70E+06 6.65E+05 8.01E+06 7 5 2 3 3 3 3 107188 RNA-binding protein 15 OS=Homo sapiens OX=9606 GN=RBM15 PE=1 SV=2 276 601 sp|P0C0S5|H2AZ_HUMAN 106.56 31 31 23 23 23 23 1.15E+07 2.01E+07 1.77E+07 5.01E+06 1.71E+07 6 2 10 9 9 9 9 13553 Histone H2A.Z OS=Homo sapiens OX=9606 GN=H2AZ1 PE=1 SV=2 276 602 sp|Q71UI9|H2AV_HUMAN 106.56 31 31 23 23 23 23 1.15E+07 2.01E+07 1.77E+07 5.01E+06 1.71E+07 6 2 10 9 9 9 9 13509 Histone H2A.V OS=Homo sapiens OX=9606 GN=H2AZ2 PE=1 SV=3 1072 578 sp|O75367|H2AY_HUMAN 106.49 14 4 0 1 5 10 1.99E+06 3.71E+07 5.28E+06 6 3 3 0 1 3 3 39617 Core histone macro-H2A.1 OS=Homo sapiens OX=9606 GN=MACROH2A1 PE=1 SV=4 1964 629 sp|P56537|IF6_HUMAN 105.96 23 4 0 9 14 6 1.49E+06 1.90E+06 5.02E+06 5.08E+05 4 4 1 0 2 2 1 26599 Eukaryotic translation initiation factor 6 OS=Homo sapiens OX=9606 GN=EIF6 PE=1 SV=1 1202 549 sp|Q96MU7|YTDC1_HUMAN 105.95 6 0 3 3 2 5 4.78E+06 4.40E+06 0.00E+00 1.59E+07 4 4 0 3 2 1 3 84700 YTH domain-containing protein 1 OS=Homo sapiens OX=9606 GN=YTHDC1 PE=1 SV=3 1794 741 sp|Q13895|BYST_HUMAN 105.5 10 0 3 0 7 4 2.34E+06 6.97E+06 2.96E+06 4 3 0 2 0 2 2 49601 Bystin OS=Homo sapiens OX=9606 GN=BYSL PE=1 SV=3 642 553 sp|Q9P2I0|CPSF2_HUMAN 105.11 7 4 2 1 3 3 2.77E+06 3.71E+06 4.44E+06 5.52E+06 5.53E+06 6 4 4 3 1 4 2 88487 Cleavage and polyadenylation specificity factor subunit 2 OS=Homo sapiens OX=9606 GN=CPSF2 PE=1 SV=2 1447 862 sp|Q9H0S4|DDX47_HUMAN 104.42 8 7 3 8 7 0 7.03E+05 1.39E+06 1.86E+06 2.67E+06 3 2 2 1 3 2 0 50647 Probable ATP-dependent RNA helicase DDX47 OS=Homo sapiens OX=9606 GN=DDX47 PE=1 SV=1 1401 635 sp|P36542|ATPG_HUMAN 104.42 14 4 0 10 6 2 2.22E+06 1.45E+07 1.35E+06 4 3 1 0 3 2 1 32996 ATP synthase subunit gamma mitochondrial OS=Homo sapiens OX=9606 GN=ATP5F1C PE=1 SV=1 1422 643 sp|Q96PU8|QKI_HUMAN 104.01 15 15 1 1 5 0 5.55E+06 1.14E+06 4 3 5 1 1 1 0 37671 Protein quaking OS=Homo sapiens OX=9606 GN=QKI PE=1 SV=1 1053 502 sp|O75643|U520_HUMAN 103.99 3 1 1 1 1 1 8.36E+05 1.30E+06 2.60E+06 1.46E+06 7.86E+05 7 5 2 2 2 2 2 244505 U5 small nuclear ribonucleoprotein 200 kDa helicase OS=Homo sapiens OX=9606 GN=SNRNP200 PE=1 SV=2 906 644 sp|P12814|ACTN1_HUMAN 103.57 7 1 1 5 3 0 2.43E+06 5 1 1 1 5 4 0 103058 Alpha-actinin-1 OS=Homo sapiens OX=9606 GN=ACTN1 PE=1 SV=2 1367 513 sp|P12268|IMDH2_HUMAN 103.24 11 5 2 6 0 4 2.60E+06 2.69E+06 9.28E+06 1.22E+06 5 3 3 1 2 0 2 55805 Inosine-5'-monophosphate dehydrogenase 2 OS=Homo sapiens OX=9606 GN=IMPDH2 PE=1 SV=2 1099 537 sp|Q15637|SF01_HUMAN 103.17 9 1 5 3 0 6 3.90E+06 1.77E+06 1.34E+07 5 4 1 3 2 0 4 68330 Splicing factor 1 OS=Homo sapiens OX=9606 GN=SF1 PE=1 SV=4 680 829 sp|O00159|MYO1C_HUMAN 103.08 5 4 4 0 2 4 1.69E+05 3.60E+06 1.53E+06 1.51E+06 6 2 6 3 1 1 3 121682 Unconventional myosin-Ic OS=Homo sapiens OX=9606 GN=MYO1C PE=1 SV=4 1006 646 sp|Q92522|H1X_HUMAN 102.96 19 0 14 14 19 14 9.38E+06 7.35E+06 1.28E+07 4.43E+06 3 3 0 3 2 4 2 22487 Histone H1.10 OS=Homo sapiens OX=9606 GN=H1-10 PE=1 SV=1 1510 705 sp|Q8NI27|THOC2_HUMAN 102.77 3 0 0 2 1 1 2.93E+06 1.55E+06 2.47E+06 6 3 1 0 3 1 2 182774 THO complex subunit 2 OS=Homo sapiens OX=9606 GN=THOC2 PE=1 SV=2 891 561 sp|Q9UBB4|ATX10_HUMAN 102.71 11 0 7 9 5 0 5.79E+06 1.15E+07 5.55E+06 5 4 0 5 3 4 0 53489 Ataxin-10 OS=Homo sapiens OX=9606 GN=ATXN10 PE=1 SV=1 969 653 sp|Q9NUL7|DDX28_HUMAN 102.21 10 0 4 7 5 1 1.78E+06 2.08E+06 1.98E+06 5 3 0 2 4 3 1 59581 Probable ATP-dependent RNA helicase DDX28 OS=Homo sapiens OX=9606 GN=DDX28 PE=1 SV=2 921 725 sp|Q16540|RM23_HUMAN 101.98 21 0 15 15 16 5 1.04E+07 1.07E+07 3.84E+06 2.72E+06 3 3 0 3 2 4 1 17781 39S ribosomal protein L23 mitochondrial OS=Homo sapiens OX=9606 GN=MRPL23 PE=1 SV=1 302 1214 sp|Q59GN2|R39L5_HUMAN 101.91 33 20 33 33 33 29 5.02E+06 1.88E+08 3.49E+08 3.78E+08 1.33E+08 3 2 2 9 14 9 6 6323 Putative 60S ribosomal protein L39-like 5 OS=Homo sapiens OX=9606 GN=RPL39P5 PE=5 SV=2 302 1215 sp|P62891|RL39_HUMAN 101.91 33 20 33 33 33 29 5.02E+06 1.88E+08 3.49E+08 3.78E+08 1.33E+08 3 2 2 9 14 9 6 6407 60S ribosomal protein L39 OS=Homo sapiens OX=9606 GN=RPL39 PE=1 SV=2 610 758 sp|Q15007|FL2D_HUMAN 101.54 8 1 8 5 8 8 3.18E+06 1.79E+06 2.61E+06 6.16E+06 4 2 1 5 3 5 3 44244 Pre-mRNA-splicing regulator WTAP OS=Homo sapiens OX=9606 GN=WTAP PE=1 SV=2 643 734 sp|P05386|RLA1_HUMAN 100.81 80 14 14 80 52 14 1.16E+07 8.24E+06 2.44E+07 3.48E+07 5.41E+05 3 3 2 2 5 5 1 11514 60S acidic ribosomal protein P1 OS=Homo sapiens OX=9606 GN=RPLP1 PE=1 SV=1 1359 733 sp|Q9H9G7|AGO3_HUMAN 100.66 5 0 3 3 2 2 1.23E+07 1.23E+07 4 1 0 4 2 1 1 97360 Protein argonaute-3 OS=Homo sapiens OX=9606 GN=AGO3 PE=1 SV=2 1380 609 sp|Q8WXX5|DNJC9_HUMAN 100.55 21 4 13 4 12 4 5.28E+05 6.17E+06 1.59E+06 6.35E+06 2.51E+06 4 4 1 3 1 2 1 29910 DnaJ homolog subfamily C member 9 OS=Homo sapiens OX=9606 GN=DNAJC9 PE=1 SV=1 2206 544 sp|Q15417|CNN3_HUMAN 100.4 22 22 0 0 0 0 1.15E+07 5 5 5 0 0 0 0 36414 Calponin-3 OS=Homo sapiens OX=9606 GN=CNN3 PE=1 SV=1 756 476 sp|P27448|MARK3_HUMAN 100.32 8 0 1 7 2 3 3.51E+06 7 2 0 2 6 2 4 84428 MAP/microtubule affinity-regulating kinase 3 OS=Homo sapiens OX=9606 GN=MARK3 PE=1 SV=5 1770 647 sp|Q8N3C0|ASCC3_HUMAN 100.09 2 0 1 0 1 1 4.82E+06 2.54E+06 5.52E+06 4 3 1 2 0 1 2 251458 Activating signal cointegrator 1 complex subunit 3 OS=Homo sapiens OX=9606 GN=ASCC3 PE=1 SV=3 1131 886 sp|Q99873|ANM1_HUMAN 99.77 8 0 4 8 8 4 5.50E+06 6.70E+06 7.61E+06 7.06E+06 2 2 0 2 3 3 2 42462 Protein arginine N-methyltransferase 1 OS=Homo sapiens OX=9606 GN=PRMT1 PE=1 SV=3 Nascent polypeptide-associated complex subunit alpha muscle-specific form OS=Homo sapiens OX=9606 1048 825 sp|E9PAV3|NACAM_HUMAN 99.72 1 1 1 1 1 1 4.24E+06 4.72E+06 1.36E+07 1.27E+07 8.28E+06 2 2 3 1 2 2 2 205419 GN=NACA PE=1 SV=1 1048 1261 sp|Q13765|NACA_HUMAN 99.72 13 13 7 13 13 13 4.24E+06 4.72E+06 1.36E+07 1.27E+07 8.28E+06 2 2 3 1 2 2 2 23384 Nascent polypeptide-associated complex subunit alpha OS=Homo sapiens OX=9606 GN=NACA PE=1 SV=1 827 603 sp|Q9BQ67|GRWD1_HUMAN 99.66 10 0 7 9 10 6 6.64E+06 1.20E+07 1.12E+07 4.23E+06 4 3 0 3 3 4 3 49419 Glutamate-rich WD repeat-containing protein 1 OS=Homo sapiens OX=9606 GN=GRWD1 PE=1 SV=1 1814 658 sp|P62910|RL32_HUMAN 99.49 22 0 22 17 10 0 1.90E+07 1.07E+07 5.25E+06 3 3 0 3 2 1 0 15860 60S ribosomal protein L32 OS=Homo sapiens OX=9606 GN=RPL32 PE=1 SV=2 298 663 sp|Q13162|PRDX4_HUMAN 99.04 11 11 7 4 7 6 6.78E+05 4 1 6 8 11 10 6 30540 Peroxiredoxin-4 OS=Homo sapiens OX=9606 GN=PRDX4 PE=1 SV=1 1382 637 sp|P29692|EF1D_HUMAN 98.9 17 9 4 9 4 0 5.17E+06 8.48E+06 2.78E+06 1.83E+07 3 3 3 2 1 1 0 31122 Elongation factor 1-delta OS=Homo sapiens OX=9606 GN=EEF1D PE=1 SV=5 960 522 sp|Q9C0J8|WDR33_HUMAN 98.22 4 1 2 3 0 2 1.71E+06 4.19E+06 7.44E+06 4.12E+06 5 4 2 3 3 1 2 145891 pre-mRNA 3' end processing protein WDR33 OS=Homo sapiens OX=9606 GN=WDR33 PE=1 SV=2 1880 473 sp|P40926|MDHM_HUMAN 97.86 23 0 0 12 17 0 9.82E+06 5.63E+06 5 5 0 0 3 3 0 35503 Malate dehydrogenase mitochondrial OS=Homo sapiens OX=9606 GN=MDH2 PE=1 SV=3 728 698 sp|P61981|1433G_HUMAN 97.46 15 3 11 13 3 3 3.28E+06 1.14E+07 4 2 1 4 5 3 1 28303 14-3-3 protein gamma OS=Homo sapiens OX=9606 GN=YWHAG PE=1 SV=2 2263 708 sp|P61604|CH10_HUMAN 97.42 30 14 14 30 0 0 9.25E+05 1.57E+06 6.39E+06 3 3 1 1 3 0 0 10932 10 kDa heat shock protein mitochondrial OS=Homo sapiens OX=9606 GN=HSPE1 PE=1 SV=2 1218 742 sp|Q15084|PDIA6_HUMAN 97.27 9 3 6 4 8 0 1.04E+06 1.59E+06 1.33E+06 4.32E+06 4 2 1 3 2 3 0 48121 Protein disulfide-isomerase A6 OS=Homo sapiens OX=9606 GN=PDIA6 PE=1 SV=1 673 555 sp|O76021|RL1D1_HUMAN 97.25 13 0 4 2 8 6 8.34E+05 3.56E+06 2.77E+06 6 4 0 3 3 4 5 54973 Ribosomal L1 domain-containing protein 1 OS=Homo sapiens OX=9606 GN=RSL1D1 PE=1 SV=3 Heterogeneous nuclear ribonucleoprotein U-like protein 2 OS=Homo sapiens OX=9606 GN=HNRNPUL2 PE=1 616 784 sp|Q1KMD3|HNRL2_HUMAN 96.57 5 1 5 3 0 2 3.96E+06 1.43E+06 3.62E+06 4 2 6 4 3 0 1 85105 SV=1 2209 774 sp|P15559|NQO1_HUMAN 95.98 12 2 0 7 10 0 9.17E+06 1.91E+07 4 3 1 0 1 3 0 30868 NAD(P)H dehydrogenase [quinone] 1 OS=Homo sapiens OX=9606 GN=NQO1 PE=1 SV=1 1405 775 sp|Q15436|SC23A_HUMAN 95.82 5 2 2 4 0 2 4.80E+06 8.00E+05 1.61E+07 7.93E+05 4 3 2 1 3 0 1 86161 Protein transport protein Sec23A OS=Homo sapiens OX=9606 GN=SEC23A PE=1 SV=2 1260 571 sp|Q12996|CSTF3_HUMAN 95.52 7 3 3 2 2 3 1.56E+07 4.80E+06 3.47E+06 4.19E+06 8.79E+06 5 4 2 2 1 2 2 82922 Cleavage stimulation factor subunit 3 OS=Homo sapiens OX=9606 GN=CSTF3 PE=1 SV=1 1736 1004 sp|Q9NWH9|SLTM_HUMAN 95.43 5 3 0 2 2 2 0.00E+00 3.68E+06 1.29E+06 2.41E+06 3 3 1 0 2 1 1 117149 SAFB-like transcription modulator OS=Homo sapiens OX=9606 GN=SLTM PE=1 SV=2 1403 756 sp|Q05048|CSTF1_HUMAN 95.37 10 6 6 6 4 4 2.48E+06 5.65E+06 5.10E+06 2.04E+06 2.09E+06 3 3 2 2 2 1 1 48358 Cleavage stimulation factor subunit 1 OS=Homo sapiens OX=9606 GN=CSTF1 PE=1 SV=1 1909 641 sp|P30048|PRDX3_HUMAN 95.3 16 0 5 10 11 0 1.49E+06 3.41E+06 6.07E+06 4 3 0 1 2 3 0 27693 Thioredoxin-dependent peroxide reductase mitochondrial OS=Homo sapiens OX=9606 GN=PRDX3 PE=1 SV=3 Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 2 OS=Homo sapiens OX=9606 GN=RPN2 2022 920 sp|P04844|RPN2_HUMAN 95.27 5 0 3 0 5 0 5.62E+05 1.58E+06 2 2 0 1 0 3 0 69284 PE=1 SV=3 240 1091 sp|Q9UPN3|MACF1_HUMAN 94.57 1 0 1 1 1 0 1.02E+07 14 1 5 15 15 11 9 838323 Microtubule-actin cross-linking factor 1 isoforms 1/2/3/5 OS=Homo sapiens OX=9606 GN=MACF1 PE=1 SV=4 659 661 sp|Q02241|KIF23_HUMAN 94.18 5 1 3 2 1 2 6.67E+06 1.83E+07 3.06E+06 2.44E+06 6 2 2 4 2 1 2 110059 Kinesin-like protein KIF23 OS=Homo sapiens OX=9606 GN=KIF23 PE=1 SV=3 1616 657 sp|P33176|KINH_HUMAN 94.11 8 4 1 1 3 0 1.52E+06 6.28E+05 1.31E+06 1.95E+06 6 5 3 1 1 2 0 109685 Kinesin-1 heavy chain OS=Homo sapiens OX=9606 GN=KIF5B PE=1 SV=1 1966 806 sp|P29558|RBMS1_HUMAN 93.99 7 0 5 0 5 5 2.89E+06 3.09E+06 3.41E+06 3 2 0 2 0 2 2 44505 RNA-binding motif single-stranded-interacting protein 1 OS=Homo sapiens OX=9606 GN=RBMS1 PE=1 SV=3 262 1290 sp|P01782|HV309_HUMAN 93.77 19 14 19 19 18 18 2.02E+06 4.42E+08 6.82E+08 4.74E+08 3.60E+08 3 1 1 10 18 12 9 12945 Immunoglobulin heavy variable 3-9 OS=Homo sapiens OX=9606 GN=IGHV3-9 PE=1 SV=2 262 1291 sp|A0A0A0MS15|HV349_HUM 93.77 19 13 19 19 18 18 2.02E+06 4.42E+08 6.82E+08 4.74E+08 3.60E+08 3 1 1 10 18 12 9 13056 Immunoglobulin heavy variable 3-49 OS=Homo sapiens OX=9606 GN=IGHV3-49 PE=3 SV=1 847 526 sp|Q9UNQ2|DIM1_HUMAN 93.71 18 4 10 12 10 2 1.98E+06 9.83E+06 1.59E+07 6.26E+06 6 5 1 5 3 3 1 35236 Probable dimethyladenosine transferase OS=Homo sapiens OX=9606 GN=DIMT1 PE=1 SV=1 1563 670 sp|P02794|FRIH_HUMAN 93.36 17 13 7 7 7 11 4.17E+06 3.11E+06 2.41E+06 2.17E+06 3.34E+06 3 3 2 1 1 1 2 21226 Ferritin heavy chain OS=Homo sapiens OX=9606 GN=FTH1 PE=1 SV=2 816 723 sp|P27348|1433T_HUMAN 93.28 11 3 5 9 3 9 4.89E+06 3.35E+06 3 1 1 3 4 3 2 27764 14-3-3 protein theta OS=Homo sapiens OX=9606 GN=YWHAQ PE=1 SV=1 857 684 sp|P42704|LPPRC_HUMAN 93.06 3 1 1 2 1 1 1.26E+06 2.27E+06 2.20E+06 1.25E+06 6 2 2 3 3 2 1 157904 Leucine-rich PPR motif-containing protein mitochondrial OS=Homo sapiens OX=9606 GN=LRPPRC PE=1 SV=3 1071 569 sp|P33993|MCM7_HUMAN 93.06 7 1 3 3 2 1 1.89E+06 9.57E+06 1.58E+06 1.89E+06 6 4 1 4 2 1 1 81308 DNA replication licensing factor MCM7 OS=Homo sapiens OX=9606 GN=MCM7 PE=1 SV=4 2983 639 sp|Q96FV9|THOC1_HUMAN 92.98 7 0 2 0 0 4 7.44E+05 4.03E+06 3 3 0 1 0 0 2 75666 THO complex subunit 1 OS=Homo sapiens OX=9606 GN=THOC1 PE=1 SV=1 1381 613 sp|Q8NFW8|NEUA_HUMAN 92.93 11 1 10 0 7 4 5.79E+06 1.05E+07 1.85E+06 4 3 1 3 0 3 1 48379 N-acylneuraminate cytidylyltransferase OS=Homo sapiens OX=9606 GN=CMAS PE=1 SV=2 2108 611 sp|O43684|BUB3_HUMAN 92.68 13 4 0 0 9 4 9.75E+05 6.70E+06 2.67E+06 4 4 1 0 0 3 1 37155 Mitotic checkpoint protein BUB3 OS=Homo sapiens OX=9606 GN=BUB3 PE=1 SV=1 1477 623 sp|Q9Y2R9|RT07_HUMAN 91.18 19 5 10 10 15 0 2.76E+06 2.33E+07 1.39E+07 1.03E+07 4 4 1 2 2 3 0 28134 28S ribosomal protein S7 mitochondrial OS=Homo sapiens OX=9606 GN=MRPS7 PE=1 SV=2 826 579 sp|Q9BZI7|REN3B_HUMAN 91.06 8 2 5 5 8 4 1.06E+06 4.81E+06 1.01E+07 1.73E+07 7.25E+06 4 4 1 2 3 4 2 57762 Regulator of nonsense transcripts 3B OS=Homo sapiens OX=9606 GN=UPF3B PE=1 SV=1 353 667 sp|Q9UKA9|PTBP2_HUMAN 91 7 4 3 4 4 6 9.54E+05 6 1 5 5 6 7 7 57491 Polypyrimidine tract-binding protein 2 OS=Homo sapiens OX=9606 GN=PTBP2 PE=1 SV=1 770 645 sp|Q9UL41|PNMA3_HUMAN 90.98 8 1 4 5 4 3 1.42E+06 1.72E+06 1.47E+06 5 2 1 4 4 3 2 52376 Paraneoplastic antigen Ma3 OS=Homo sapiens OX=9606 GN=PNMA3 PE=1 SV=3 2207 565 sp|Q96T60|PNKP_HUMAN 90.93 8 3 2 0 2 1 4.99E+06 3.29E+06 1.39E+06 5 4 2 1 0 1 1 57076 Bifunctional polynucleotide phosphatase/kinase OS=Homo sapiens OX=9606 GN=PNKP PE=1 SV=1 892 582 sp|Q9H0U4|RAB1B_HUMAN 90.89 22 5 10 17 13 10 3.62E+05 1.61E+06 3.12E+06 1.11E+06 4 2 1 2 3 4 2 22171 Ras-related protein Rab-1B OS=Homo sapiens OX=9606 GN=RAB1B PE=1 SV=1 892 583 sp|P62820|RAB1A_HUMAN 90.89 21 5 10 17 13 10 3.62E+05 1.61E+06 3.12E+06 1.11E+06 4 2 1 2 3 4 2 22678 Ras-related protein Rab-1A OS=Homo sapiens OX=9606 GN=RAB1A PE=1 SV=3 2394 948 sp|Q13064|MKRN3_HUMAN 90.68 9 0 3 6 3 6 1.98E+06 2.26E+05 1.83E+06 2 2 0 1 1 1 1 55645 Probable E3 ubiquitin-protein ligase makorin-3 OS=Homo sapiens OX=9606 GN=MKRN3 PE=1 SV=1 1478 696 sp|P23284|PPIB_HUMAN 90.63 19 6 6 12 4 6 4.36E+06 3.39E+06 1.17E+07 5.65E+06 0.00E+00 4 3 2 1 3 1 1 23743 Peptidyl-prolyl cis-trans isomerase B OS=Homo sapiens OX=9606 GN=PPIB PE=1 SV=2 2335 634 sp|P27694|RFA1_HUMAN 90.52 6 6 0 0 0 2 5.61E+06 1.84E+06 3 3 3 0 0 0 1 68138 Replication protein A 70 kDa DNA-binding subunit OS=Homo sapiens OX=9606 GN=RPA1 PE=1 SV=2 1384 759 sp|Q9NYL9|TMOD3_HUMAN 90.26 11 0 11 6 10 4 6.86E+06 2.92E+06 1.30E+07 3.66E+06 3 2 0 3 1 2 2 39595 Tropomodulin-3 OS=Homo sapiens OX=9606 GN=TMOD3 PE=1 SV=1 3068 674 sp|Q9BX40|LS14B_HUMAN 90.04 13 0 0 7 6 0 2.84E+06 1.61E+07 3 3 0 0 1 2 0 42071 Protein LSM14 homolog B OS=Homo sapiens OX=9606 GN=LSM14B PE=1 SV=1 1480 792 sp|Q96EP5|DAZP1_HUMAN 90.03 9 8 5 0 5 1 9.96E+06 7.02E+06 6.42E+06 3 2 2 3 0 2 1 43383 DAZ-associated protein 1 OS=Homo sapiens OX=9606 GN=DAZAP1 PE=1 SV=1 2158 897 sp|P48047|ATPO_HUMAN 89.89 12 6 0 12 6 6 1.43E+06 5.64E+06 3.19E+06 0.00E+00 2 2 1 0 2 1 1 23277 ATP synthase subunit O mitochondrial OS=Homo sapiens OX=9606 GN=ATP5PO PE=1 SV=1 1353 625 sp|Q5SSJ5|HP1B3_HUMAN 89.81 9 3 3 5 6 0 1.03E+06 3.91E+06 5.03E+06 1.07E+07 5 4 2 1 2 3 0 61207 Heterochromatin protein 1-binding protein 3 OS=Homo sapiens OX=9606 GN=HP1BP3 PE=1 SV=1 2055 875 sp|Q14974|IMB1_HUMAN 89.73 4 1 2 2 3 0 1.10E+06 2.10E+06 3.80E+06 3 2 1 1 1 2 0 97170 Importin subunit beta-1 OS=Homo sapiens OX=9606 GN=KPNB1 PE=1 SV=2 329 626 sp|P83881|RL36A_HUMAN 88.88 28 7 21 28 27 27 6.82E+06 9.14E+07 1.09E+08 7.15E+07 4.86E+07 6 4 2 8 8 10 5 12441 60S ribosomal protein L36a OS=Homo sapiens OX=9606 GN=RPL36A PE=1 SV=2 412 767 sp|Q66GS9|CP135_HUMAN 88.42 4 2 3 1 1 1 2.09E+06 9 1 5 8 4 4 4 133490 Centrosomal protein of 135 kDa OS=Homo sapiens OX=9606 GN=CEP135 PE=1 SV=2 2032 620 sp|Q9UJS0|CMC2_HUMAN 88.38 6 0 2 2 6 0 2.40E+06 3.36E+06 6.16E+06 3 3 0 1 1 3 0 74176 Calcium-binding mitochondrial carrier protein Aralar2 OS=Homo sapiens OX=9606 GN=SLC25A13 PE=1 SV=2 1130 729 sp|Q99623|PHB2_HUMAN 87.89 11 2 5 8 7 2 2.46E+06 9.49E+06 4.05E+06 4 2 2 2 2 3 1 33296 Prohibitin-2 OS=Homo sapiens OX=9606 GN=PHB2 PE=1 SV=2 1301 600 sp|P62826|RAN_HUMAN 87.74 21 11 5 10 15 5 3.38E+06 3.89E+06 9.77E+06 1.50E+07 1.90E+06 4 4 2 1 2 3 1 24423 GTP-binding nuclear protein Ran OS=Homo sapiens OX=9606 GN=RAN PE=1 SV=3 1581 615 sp|P06746|DPOLB_HUMAN 87.5 16 7 0 1 1 7 8.58E+06 3.19E+06 4 3 3 0 2 1 1 38178 DNA polymerase beta OS=Homo sapiens OX=9606 GN=POLB PE=1 SV=3 1265 947 sp|Q7Z7K6|CENPV_HUMAN 87.39 12 8 12 12 12 12 1.17E+06 5.24E+06 1.15E+07 1.51E+07 4.42E+06 2 2 1 2 2 2 2 29946 Centromere protein V OS=Homo sapiens OX=9606 GN=CENPV PE=1 SV=1 815 619 sp|Q9HCD5|NCOA5_HUMAN 87.26 9 1 4 9 7 3 7.20E+06 1.47E+07 4.69E+06 6.15E+06 4 3 1 3 4 3 2 65536 Nuclear receptor coactivator 5 OS=Homo sapiens OX=9606 GN=NCOA5 PE=1 SV=2 1348 841 sp|O00411|RPOM_HUMAN 87.26 3 0 1 1 1 1 1.34E+06 1.26E+06 1.25E+06 4 2 1 2 1 2 2 138620 DNA-directed RNA polymerase mitochondrial OS=Homo sapiens OX=9606 GN=POLRMT PE=1 SV=2 2370 554 sp|Q6P2E9|EDC4_HUMAN 86.85 4 0 1 1 1 1 1.86E+06 1.88E+06 5.13E+05 9.55E+05 4 4 0 1 1 1 1 151661 Enhancer of mRNA-decapping protein 4 OS=Homo sapiens OX=9606 GN=EDC4 PE=1 SV=1 2589 929 sp|P29401|TKT_HUMAN 86.81 6 0 3 3 6 0 1.33E+06 2.20E+06 5.02E+06 2 2 0 1 1 2 0 67878 Transketolase OS=Homo sapiens OX=9606 GN=TKT PE=1 SV=3 1653 631 sp|Q16891|MIC60_HUMAN 86.45 7 2 3 3 0 3 9.13E+05 1.23E+06 6.29E+05 5 3 2 1 2 0 2 83678 MICOS complex subunit MIC60 OS=Homo sapiens OX=9606 GN=IMMT PE=1 SV=1 1583 798 sp|Q96SB4|SRPK1_HUMAN 86.26 5 1 3 1 2 2 5.31E+06 6.95E+06 2.31E+06 4 1 1 2 1 1 1 74325 SRSF protein kinase 1 OS=Homo sapiens OX=9606 GN=SRPK1 PE=1 SV=2 1341 768 sp|Q5T280|CI114_HUMAN 86.08 8 0 6 6 6 5 6.37E+06 5.17E+06 6.12E+06 3.46E+06 3 2 0 2 2 2 2 42009 Putative methyltransferase C9orf114 OS=Homo sapiens OX=9606 GN=SPOUT1 PE=1 SV=3 299 1768 sp|Q8NF91|SYNE1_HUMAN 86.08 1 0 0 0 0 0 1.11E+06 17 1 5 10 10 7 8 1011108 Nesprin-1 OS=Homo sapiens OX=9606 GN=SYNE1 PE=1 SV=4 738 695 sp|Q9UL18|AGO1_HUMAN 85.54 4 1 4 2 2 2 3.41E+06 2.58E+06 3.35E+06 4 1 1 5 3 3 2 97214 Protein argonaute-1 OS=Homo sapiens OX=9606 GN=AGO1 PE=1 SV=3 1383 679 sp|P35232|PHB_HUMAN 85.41 14 0 6 14 4 2 1.99E+06 4.22E+06 5.23E+06 4 3 0 2 4 1 1 29804 Prohibitin OS=Homo sapiens OX=9606 GN=PHB PE=1 SV=1 2587 686 sp|Q9UGR2|Z3H7B_HUMAN 85.26 4 0 0 1 2 1 5.38E+05 5.92E+06 1.63E+06 3 3 0 0 1 2 1 109858 Zinc finger CCCH domain-containing protein 7B OS=Homo sapiens OX=9606 GN=ZC3H7B PE=1 SV=2 2588 702 sp|P30086|PEBP1_HUMAN 84.96 28 0 11 17 10 0 1.28E+06 2.02E+06 9.97E+05 3 3 0 1 2 1 0 21057 Phosphatidylethanolamine-binding protein 1 OS=Homo sapiens OX=9606 GN=PEBP1 PE=1 SV=3 1560 532 sp|Q9H6R4|NOL6_HUMAN 84.83 5 0 0 1 4 3 3.93E+05 5.10E+07 1.29E+06 5 4 0 0 1 4 2 127593 Nucleolar protein 6 OS=Homo sapiens OX=9606 GN=NOL6 PE=1 SV=2 2417 843 sp|P23588|IF4B_HUMAN 84.69 6 3 0 0 2 3 3.40E+06 4.61E+05 1.85E+06 3 2 1 0 0 1 2 69151 Eukaryotic translation initiation factor 4B OS=Homo sapiens OX=9606 GN=EIF4B PE=1 SV=2 1910 721 sp|P07737|PROF1_HUMAN 84.5 33 10 10 0 23 10 2.51E+06 2.05E+05 8.82E+07 5.12E+05 3 3 1 1 0 3 1 15054 Profilin-1 OS=Homo sapiens OX=9606 GN=PFN1 PE=1 SV=2 744 730 sp|Q13045|FLII_HUMAN 84.49 3 1 2 0 0 1 1.64E+06 8.17E+05 4 2 2 4 2 2 3 144751 Protein flightless-1 homolog OS=Homo sapiens OX=9606 GN=FLII PE=1 SV=2 1195 802 sp|P48681|NEST_HUMAN 84.4 3 1 1 1 1 0 1.11E+06 4.20E+06 8.98E+05 7 3 2 3 1 2 0 177438 Nestin OS=Homo sapiens OX=9606 GN=NES PE=1 SV=2 1654 778 sp|Q00059|TFAM_HUMAN 84.4 12 3 12 0 4 7 1.96E+06 1.29E+07 1.45E+07 1.13E+07 3 3 1 3 0 1 2 29097 Transcription factor A mitochondrial OS=Homo sapiens OX=9606 GN=TFAM PE=1 SV=1 Succinate dehydrogenase [ubiquinone] flavoprotein subunit mitochondrial OS=Homo sapiens OX=9606 GN=SDHA 3611 1443 sp|P31040|SDHA_HUMAN 84.38 3 1 0 0 2 0 1.43E+05 2 1 1 0 0 1 0 72692 PE=1 SV=2 952 622 sp|Q9H6W3|RIOX1_HUMAN 84.11 7 1 5 1 1 2 2.68E+07 5.60E+06 6 4 2 5 1 1 2 71086 Ribosomal oxygenase 1 OS=Homo sapiens OX=9606 GN=RIOX1 PE=1 SV=2 Structural maintenance of chromosomes flexible hinge domain-containing protein 1 OS=Homo sapiens OX=9606 1370 1491 sp|A6NHR9|SMHD1_HUMAN 83.62 2 0 0 0 1 1 3.67E+05 6 1 3 1 0 1 3 226372 GN=SMCHD1 PE=1 SV=2 2371 1061 sp|Q9NX58|LYAR_HUMAN 83.61 4 0 0 4 4 0 2.75E+06 2.02E+06 2 2 0 0 2 2 0 43615 Cell growth-regulating nucleolar protein OS=Homo sapiens OX=9606 GN=LYAR PE=1 SV=2 1116 650 sp|Q13838|DX39B_HUMAN 83.46 7 2 4 7 6 4 2.12E+06 1.42E+07 1.32E+07 9.57E+06 9.63E+06 3 3 1 2 3 2 2 48991 Spliceosome RNA helicase DDX39B OS=Homo sapiens OX=9606 GN=DDX39B PE=1 SV=1 1116 652 sp|O00148|DX39A_HUMAN 83.46 7 2 4 7 6 4 2.12E+06 1.42E+07 1.32E+07 9.57E+06 9.63E+06 3 3 1 2 3 2 2 49130 ATP-dependent RNA helicase DDX39A OS=Homo sapiens OX=9606 GN=DDX39A PE=1 SV=2 568 604 sp|Q00325|MPCP_HUMAN 83.3 9 2 9 9 9 1 3.61E+06 5.63E+07 5.30E+07 3.87E+07 4 3 2 5 5 5 1 40095 Phosphate carrier protein mitochondrial OS=Homo sapiens OX=9606 GN=SLC25A3 PE=1 SV=2 2153 717 sp|P47756|CAPZB_HUMAN 83.11 13 4 4 0 8 5 1.94E+06 0.00E+00 3.71E+06 1.73E+06 3 3 1 1 0 2 1 31350 F-actin-capping protein subunit beta OS=Homo sapiens OX=9606 GN=CAPZB PE=1 SV=4 1565 791 sp|P55209|NP1L1_HUMAN 83.04 8 1 5 5 5 3 2.19E+06 3.93E+06 6.26E+06 5.91E+06 3 2 2 1 1 2 1 45374 Nucleosome assembly protein 1-like 1 OS=Homo sapiens OX=9606 GN=NAP1L1 PE=1 SV=1 2594 1123 sp|Q6P6C2|ALKB5_HUMAN 82.93 10 0 3 7 7 3 1.71E+06 1.04E+06 1.82E+06 1.17E+06 2 2 0 1 1 1 1 44256 RNA demethylase ALKBH5 OS=Homo sapiens OX=9606 GN=ALKBH5 PE=1 SV=2 1402 671 sp|Q9Y3U8|RL36_HUMAN 82.88 29 0 29 9 18 18 1.52E+07 6.88E+06 1.96E+07 1.77E+07 3 3 0 3 1 2 2 12254 60S ribosomal protein L36 OS=Homo sapiens OX=9606 GN=RPL36 PE=1 SV=3 1173 616 sp|P78332|RBM6_HUMAN 82.86 5 0 1 2 3 0 4.09E+06 2.53E+06 7 4 1 2 3 2 0 128644 RNA-binding protein 6 OS=Homo sapiens OX=9606 GN=RBM6 PE=1 SV=5 2336 837 sp|P49588|SYAC_HUMAN 82.85 3 0 3 0 1 0 3.85E+06 3 2 0 2 0 1 0 106810 Alanine--tRNA ligase cytoplasmic OS=Homo sapiens OX=9606 GN=AARS1 PE=1 SV=2 2459 812 sp|O75127|PTCD1_HUMAN 82.14 4 2 0 0 3 0 1.37E+06 2.03E+06 3 2 2 0 0 2 0 78856 Pentatricopeptide repeat-containing protein 1 mitochondrial OS=Homo sapiens OX=9606 GN=PTCD1 PE=1 SV=2 1965 752 sp|P26368|U2AF2_HUMAN 81.46 7 0 3 2 5 2 1.60E+06 2.11E+06 9.03E+06 1.72E+06 3 2 0 2 1 2 1 53501 Splicing factor U2AF 65 kDa subunit OS=Homo sapiens OX=9606 GN=U2AF2 PE=1 SV=4 2659 655 sp|Q9UHB6|LIMA1_HUMAN 81.17 7 1 3 0 2 0 2.95E+06 9.65E+05 0.00E+00 4 3 1 1 0 2 0 85226 LIM domain and actin-binding protein 1 OS=Homo sapiens OX=9606 GN=LIMA1 PE=1 SV=1 1227 731 sp|Q9UBQ5|EIF3K_HUMAN 81.11 15 0 10 3 11 7 4.53E+06 2.42E+06 3.17E+07 8.93E+06 4 3 0 2 1 4 2 25060 Eukaryotic translation initiation factor 3 subunit K OS=Homo sapiens OX=9606 GN=EIF3K PE=1 SV=1 984 882 sp|P53396|ACLY_HUMAN 80.8 3 1 1 2 2 1 3.47E+06 8.53E+05 8.37E+05 4 2 2 2 2 3 2 120839 ATP-citrate synthase OS=Homo sapiens OX=9606 GN=ACLY PE=1 SV=3 2155 800 sp|Q9BZE4|NOG1_HUMAN 80.31 4 1 2 0 4 0 1.04E+06 1.02E+07 3 2 2 1 0 2 0 73965 Nucleolar GTP-binding protein 1 OS=Homo sapiens OX=9606 GN=GTPBP4 PE=1 SV=3 1287 1280 sp|O75531|BAF_HUMAN 80.06 35 27 27 0 35 0 1.53E+07 2.53E+06 6.24E+06 2 2 4 1 0 4 0 10059 Barrier-to-autointegration factor OS=Homo sapiens OX=9606 GN=BANF1 PE=1 SV=1 3749 2396 sp|Q9NX24|NHP2_HUMAN 79.87 12 0 12 0 0 12 1.39E+06 6.44E+05 1 1 0 1 0 0 1 17201 H/ACA ribonucleoprotein complex subunit 2 OS=Homo sapiens OX=9606 GN=NHP2 PE=1 SV=1 2111 924 sp|P26640|SYVC_HUMAN 79.67 2 2 0 0 1 0 8.93E+05 1.06E+06 3 2 4 0 0 1 0 140476 Valine--tRNA ligase OS=Homo sapiens OX=9606 GN=VARS1 PE=1 SV=4 774 706 sp|P49207|RL34_HUMAN 79.55 21 13 21 21 21 21 2.88E+06 2.67E+07 1.94E+07 1.16E+07 1.65E+07 3 2 2 3 3 3 3 13293 60S ribosomal protein L34 OS=Homo sapiens OX=9606 GN=RPL34 PE=1 SV=3 2664 945 sp|Q9Y383|LC7L2_HUMAN 79.43 6 0 0 3 3 4 3.44E+06 2.68E+06 1.03E+06 2 2 0 0 1 1 1 46514 Putative RNA-binding protein Luc7-like 2 OS=Homo sapiens OX=9606 GN=LUC7L2 PE=1 SV=2 2661 834 sp|Q9H7E9|CH033_HUMAN 79.15 19 0 7 10 10 2 8.82E+05 1.26E+06 1.94E+06 3 2 0 1 1 1 1 24992 UPF0488 protein C8orf33 OS=Homo sapiens OX=9606 GN=C8orf33 PE=1 SV=1 1451 1319 sp|O75607|NPM3_HUMAN 79.06 12 9 9 12 9 9 1.04E+06 1.18E+06 1.68E+06 2.18E+06 2.95E+05 2 1 1 2 2 2 1 19344 Nucleoplasmin-3 OS=Homo sapiens OX=9606 GN=NPM3 PE=1 SV=3 934 722 sp|P08579|RU2B_HUMAN 79.04 13 0 8 8 9 12 3.53E+06 1.67E+06 4 1 0 3 3 2 3 25486 U2 small nuclear ribonucleoprotein B'' OS=Homo sapiens OX=9606 GN=SNRPB2 PE=1 SV=1 2264 709 sp|Q13185|CBX3_HUMAN 79 23 0 0 8 0 23 3.59E+06 8.67E+06 3 3 0 0 1 0 4 20811 Chromobox protein homolog 3 OS=Homo sapiens OX=9606 GN=CBX3 PE=1 SV=4 2056 885 sp|Q9H329|E41LB_HUMAN 78.97 3 0 1 1 2 1 2.32E+06 3.61E+06 3.43E+06 3 2 0 1 1 2 1 99712 Band 4.1-like protein 4B OS=Homo sapiens OX=9606 GN=EPB41L4B PE=2 SV=2 2164 1092 sp|P07305|H10_HUMAN 78.96 11 0 11 7 11 0 9.08E+06 1.66E+06 8.59E+06 2 2 0 2 1 2 0 20863 Histone H1.0 OS=Homo sapiens OX=9606 GN=H1-0 PE=1 SV=3 Multifunctional procollagen lysine hydroxylase and glycosyltransferase LH3 OS=Homo sapiens OX=9606 1008 789 sp|O60568|PLOD3_HUMAN 78.64 4 1 3 3 1 1 1.03E+06 2.78E+05 4 2 2 3 3 1 2 84785 GN=PLOD3 PE=1 SV=1 995 575 sp|P17612|KAPCA_HUMAN 78.56 11 1 10 4 1 1 1.67E+07 2.73E+06 5 3 2 4 2 2 1 40590 cAMP-dependent protein kinase catalytic subunit alpha OS=Homo sapiens OX=9606 GN=PRKACA PE=1 SV=2 1702 1276 sp|Q8IXM3|RM41_HUMAN 78.06 16 0 11 16 16 5 6.99E+05 5.67E+06 6.57E+06 2.75E+06 2 2 0 1 2 3 1 15383 39S ribosomal protein L41 mitochondrial OS=Homo sapiens OX=9606 GN=MRPL41 PE=1 SV=1 479 1033 sp|Q14204|DYHC1_HUMAN 77.99 1 0 1 0 0 0 1.02E+06 8 1 2 6 7 4 2 532412 Cytoplasmic dynein 1 heavy chain 1 OS=Homo sapiens OX=9606 GN=DYNC1H1 PE=1 SV=5 1696 577 sp|P19474|RO52_HUMAN 77.94 12 4 6 2 0 0 2.78E+06 1.31E+07 1.06E+06 5 5 2 3 1 0 0 54170 E3 ubiquitin-protein ligase TRIM21 OS=Homo sapiens OX=9606 GN=TRIM21 PE=1 SV=1 1302 827 sp|P13667|PDIA4_HUMAN 77.72 5 2 2 3 1 1 4.17E+06 3.35E+06 4 2 2 3 2 1 1 72933 Protein disulfide-isomerase A4 OS=Homo sapiens OX=9606 GN=PDIA4 PE=1 SV=2 1926 1268 sp|P04075|ALDOA_HUMAN 77.51 9 3 3 9 9 0 1.61E+06 6.20E+06 7.23E+06 8.59E+06 2 2 1 1 2 2 0 39420 Fructose-bisphosphate aldolase A OS=Homo sapiens OX=9606 GN=ALDOA PE=1 SV=2 1697 664 sp|P17987|TCPA_HUMAN 77.42 8 0 3 4 6 1 2.49E+06 1.04E+06 1.56E+06 4 2 0 2 1 3 1 60344 T-complex protein 1 subunit alpha OS=Homo sapiens OX=9606 GN=TCP1 PE=1 SV=1 1073 893 sp|O75533|SF3B1_HUMAN 77.36 3 1 2 1 0 0 2.78E+06 2.75E+06 6 1 4 3 2 1 0 145830 Splicing factor 3B subunit 1 OS=Homo sapiens OX=9606 GN=SF3B1 PE=1 SV=3 1582 618 sp|Q9UGN5|PARP2_HUMAN 77.16 8 1 0 3 1 7 2.34E+06 1.37E+06 5 2 1 0 1 1 4 66206 Poly [ADP-ribose] polymerase 2 OS=Homo sapiens OX=9606 GN=PARP2 PE=1 SV=2 2021 864 sp|P33992|MCM5_HUMAN 76.61 3 0 0 3 2 0 8.98E+06 2.76E+06 2 2 0 0 3 1 0 82286 DNA replication licensing factor MCM5 OS=Homo sapiens OX=9606 GN=MCM5 PE=1 SV=5 1568 876 sp|P23528|COF1_HUMAN 76.4 14 14 14 7 14 0 1.30E+07 4.01E+07 2.65E+07 4.12E+07 2 2 2 2 1 2 0 18502 Cofilin-1 OS=Homo sapiens OX=9606 GN=CFL1 PE=1 SV=3 4354 2395 sp|Q9Y333|LSM2_HUMAN 76.25 20 0 0 20 0 0 1.77E+06 1 1 0 0 1 0 0 10835 U6 snRNA-associated Sm-like protein LSm2 OS=Homo sapiens OX=9606 GN=LSM2 PE=1 SV=1 1584 807 sp|P17480|UBF1_HUMAN 76.18 6 1 2 2 2 2 4.95E+05 3.71E+06 3.49E+06 1.96E+06 5 2 1 1 2 1 2 89406 Nucleolar transcription factor 1 OS=Homo sapiens OX=9606 GN=UBTF PE=1 SV=1 319 891 sp|Q5TZA2|CROCC_HUMAN 76.1 3 0 2 1 2 1 1.08E+06 10 1 1 10 7 10 8 228521 Rootletin OS=Homo sapiens OX=9606 GN=CROCC PE=1 SV=1 1769 612 sp|O00139|KIF2A_HUMAN 75.7 8 0 4 0 2 2 2.53E+06 1.46E+07 1.67E+05 5 4 0 2 0 2 2 79955 Kinesin-like protein KIF2A OS=Homo sapiens OX=9606 GN=KIF2A PE=1 SV=3 1659 1263 sp|Q15388|TOM20_HUMAN 75.54 17 0 17 17 9 9 1.43E+07 2.12E+07 1.95E+07 1.31E+07 2 2 0 3 2 1 1 16298 Mitochondrial import receptor subunit TOM20 homolog OS=Homo sapiens OX=9606 GN=TOMM20 PE=1 SV=1 3394 962 sp|Q15293|RCN1_HUMAN 74.78 9 9 0 0 0 0 1.59E+07 2 2 2 0 0 0 0 38890 Reticulocalbin-1 OS=Homo sapiens OX=9606 GN=RCN1 PE=1 SV=1 437 675 sp|P62318|SMD3_HUMAN 74.78 21 13 21 15 21 13 1.07E+07 3.99E+07 3.15E+07 4.56E+07 1.93E+07 3 3 2 7 6 6 3 13916 Small nuclear ribonucleoprotein Sm D3 OS=Homo sapiens OX=9606 GN=SNRPD3 PE=1 SV=1 2006 965 sp|O15042|SR140_HUMAN 74.73 3 2 1 0 1 0 1.33E+06 3.75E+06 4 1 2 1 0 2 0 118292 U2 snRNP-associated SURP motif-containing protein OS=Homo sapiens OX=9606 GN=U2SURP PE=1 SV=2 1815 881 sp|O14893|GEMI2_HUMAN 74.69 10 7 0 5 8 2 2.14E+05 6.53E+05 4.02E+06 1.88E+06 3 2 2 0 1 2 1 31585 Gem-associated protein 2 OS=Homo sapiens OX=9606 GN=GEMIN2 PE=1 SV=1 2054 727 sp|Q9H444|CHM4B_HUMAN 74.65 13 2 11 0 4 4 4.66E+06 1.34E+06 3.23E+06 3 2 1 2 0 1 1 24950 Charged multivesicular body protein 4b OS=Homo sapiens OX=9606 GN=CHMP4B PE=1 SV=1 1423 780 sp|P22234|PUR6_HUMAN 74.61 6 4 1 4 0 2 4.95E+06 4 1 3 1 2 0 2 47079 Multifunctional protein ADE2 OS=Homo sapiens OX=9606 GN=PAICS PE=1 SV=3 604 1993 sp|Q9P2P6|STAR9_HUMAN 74.54 1 0 0 0 0 0 2.17E+06 9 1 5 3 2 4 1 516351 StAR-related lipid transfer protein 9 OS=Homo sapiens OX=9606 GN=STARD9 PE=1 SV=3 350 870 sp|Q86UP3|ZFHX4_HUMAN 74.36 1 0 0 1 0 1 1.95E+06 5.10E+06 2.96E+06 7 2 7 6 7 5 5 393732 Zinc finger homeobox protein 4 OS=Homo sapiens OX=9606 GN=ZFHX4 PE=1 SV=1 1347 805 sp|P27816|MAP4_HUMAN 74.18 3 1 0 1 1 1 2.51E+06 2.68E+06 2.38E+06 3.50E+06 3 2 1 1 1 1 1 121005 Microtubule-associated protein 4 OS=Homo sapiens OX=9606 GN=MAP4 PE=1 SV=3 2688 2398 sp|Q13501|SQSTM_HUMAN 73.26 6 6 6 6 0 6 2.62E+06 2.20E+06 7.59E+06 5.07E+06 1 1 1 1 1 0 1 47687 Sequestosome-1 OS=Homo sapiens OX=9606 GN=SQSTM1 PE=1 SV=1 2793 850 sp|Q13573|SNW1_HUMAN 73.15 6 0 1 3 2 0 2.01E+06 5.28E+05 3 2 0 1 1 1 0 61495 SNW domain-containing protein 1 OS=Homo sapiens OX=9606 GN=SNW1 PE=1 SV=1 668 1732 sp|Q8IVF4|DYH10_HUMAN 73.09 1 0 0 0 0 0 7.38E+07 7 1 4 1 3 3 3 514845 Dynein heavy chain 10 axonemal OS=Homo sapiens OX=9606 GN=DNAH10 PE=1 SV=4 2518 1271 sp|P63000|RAC1_HUMAN 73.04 11 0 11 0 7 7 4.42E+06 4.81E+05 1.58E+06 2 2 0 2 0 1 1 21450 Ras-related C3 botulinum toxin substrate 1 OS=Homo sapiens OX=9606 GN=RAC1 PE=1 SV=1 3093 1960 sp|P17096|HMGA1_HUMAN 72.7 23 0 0 0 23 23 5.77E+06 2.06E+07 1 1 0 0 0 1 2 11676 High mobility group protein HMG-I/HMG-Y OS=Homo sapiens OX=9606 GN=HMGA1 PE=1 SV=3 1262 902 sp|P46087|NOP2_HUMAN 72.64 3 0 2 3 1 1 1.82E+06 1.59E+06 3 1 0 2 3 2 2 89302 Probable 28S rRNA (cytosine(4447)-C(5))-methyltransferase OS=Homo sapiens OX=9606 GN=NOP2 PE=1 SV=2 961 810 sp|Q5VU43|MYOME_HUMAN 72.16 1 1 1 0 0 0 1.08E+06 5 1 3 2 3 2 1 265100 Myomegalin OS=Homo sapiens OX=9606 GN=PDE4DIP PE=1 SV=3 1219 889 sp|Q5JSZ5|PRC2B_HUMAN 72.14 2 1 0 0 0 1 5.90E+06 6 1 4 1 1 1 2 242964 Protein PRRC2B OS=Homo sapiens OX=9606 GN=PRRC2B PE=1 SV=2 674 907 sp|Q9UBC5|MYO1A_HUMAN 71.82 5 2 0 1 2 1 5.28E+06 3.75E+06 7 1 7 1 2 2 2 118401 Unconventional myosin-Ia OS=Homo sapiens OX=9606 GN=MYO1A PE=1 SV=1 2156 831 sp|P49756|RBM25_HUMAN 71.68 5 1 2 0 2 2 1.73E+06 1.55E+06 9.33E+05 4 2 1 1 0 1 2 100186 RNA-binding protein 25 OS=Homo sapiens OX=9606 GN=RBM25 PE=1 SV=3 2057 989 sp|Q9BXS6|NUSAP_HUMAN 71.12 6 0 6 6 3 0 2.24E+06 2.35E+06 1.66E+06 2 2 0 2 2 1 0 49452 Nucleolar and spindle-associated protein 1 OS=Homo sapiens OX=9606 GN=NUSAP1 PE=1 SV=1 2160 998 sp|P52294|IMA5_HUMAN 71.1 3 0 3 1 1 1 3.34E+06 2 1 0 2 1 1 1 60222 Importin subunit alpha-5 OS=Homo sapiens OX=9606 GN=KPNA1 PE=1 SV=3 NADH dehydrogenase [ubiquinone] iron-sulfur protein 3 mitochondrial OS=Homo sapiens OX=9606 GN=NDUFS3 3607 1270 sp|O75489|NDUS3_HUMAN 70.72 10 0 5 0 5 0 5.31E+06 9.12E+05 2 2 0 1 0 1 0 30242 PE=1 SV=1 2271 1266 sp|Q96EY1|DNJA3_HUMAN 70.5 6 0 3 0 2 6 5.75E+06 3.18E+06 6.74E+06 2 2 0 2 0 1 2 52489 DnaJ homolog subfamily A member 3 mitochondrial OS=Homo sapiens OX=9606 GN=DNAJA3 PE=1 SV=2 1427 970 sp|Q99575|POP1_HUMAN 70.34 3 1 0 0 2 0 7.67E+05 5 1 2 1 1 3 0 114709 Ribonucleases P/MRP protein subunit POP1 OS=Homo sapiens OX=9606 GN=POP1 PE=1 SV=2 457 1854 sp|Q5CZC0|FSIP2_HUMAN 70.18 1 0 0 0 0 0 2.09E+06 8 1 7 4 4 2 4 780624 Fibrous sheath-interacting protein 2 OS=Homo sapiens OX=9606 GN=FSIP2 PE=2 SV=4 1544 821 sp|P40938|RFC3_HUMAN 70.13 7 0 7 7 7 4 5.37E+06 4.02E+06 6.83E+06 2.34E+06 2 2 0 2 2 2 1 40556 Replication factor C subunit 3 OS=Homo sapiens OX=9606 GN=RFC3 PE=1 SV=2 1981 2399 sp|P63220|RS21_HUMAN 69.9 18 18 0 18 18 18 4.03E+05 1.32E+06 2.49E+06 5.87E+05 1 1 1 0 2 2 1 9111 40S ribosomal protein S21 OS=Homo sapiens OX=9606 GN=RPS21 PE=1 SV=1 2159 910 sp|Q01105|SET_HUMAN 69.42 8 3 3 8 3 0 2.42E+06 2.16E+06 6.30E+06 2.48E+06 2 2 1 1 2 1 0 33489 Protein SET OS=Homo sapiens OX=9606 GN=SET PE=1 SV=3 2159 1267 sp|P0DME0|SETLP_HUMAN 69.42 8 3 3 8 3 0 2.42E+06 2.16E+06 6.30E+06 2.48E+06 2 2 1 1 2 1 0 34882 Protein SETSIP OS=Homo sapiens OX=9606 GN=SETSIP PE=1 SV=1 912 1073 sp|Q9Y285|SYFA_HUMAN 69.19 3 1 2 3 2 2 1.03E+06 3 1 1 3 4 2 2 57564 Phenylalanine--tRNA ligase alpha subunit OS=Homo sapiens OX=9606 GN=FARSA PE=1 SV=3 733 816 sp|P78371|TCPB_HUMAN 69.05 5 5 3 3 3 1 8.09E+05 9.13E+05 2.05E+06 2.49E+06 4 1 5 3 2 2 1 57488 T-complex protein 1 subunit beta OS=Homo sapiens OX=9606 GN=CCT2 PE=1 SV=4 549 833 sp|P62258|1433E_HUMAN 68.74 8 8 8 8 8 8 4.01E+06 9.66E+06 1.13E+07 1.34E+07 5.32E+06 2 1 3 4 5 5 2 29174 14-3-3 protein epsilon OS=Homo sapiens OX=9606 GN=YWHAE PE=1 SV=1 Serine/threonine-protein phosphatase PP1-gamma catalytic subunit OS=Homo sapiens OX=9606 GN=PPP1CC PE=1 1263 912 sp|P36873|PP1G_HUMAN 68.46 8 4 3 3 8 4 1.15E+06 3.80E+06 5.44E+05 2 1 1 2 1 4 1 36984 SV=1 3354 1071 sp|P0DN76|U2AF5_HUMAN 68.37 6 0 0 6 5 0 6.93E+05 9.94E+05 2 2 0 0 1 1 0 27872 Splicing factor U2AF 35 kDa subunit-like protein OS=Homo sapiens OX=9606 GN=U2AF1L5 PE=1 SV=1 3354 1072 sp|Q01081|U2AF1_HUMAN 68.37 6 0 0 6 5 0 6.93E+05 9.94E+05 2 2 0 0 1 1 0 27872 Splicing factor U2AF 35 kDa subunit OS=Homo sapiens OX=9606 GN=U2AF1 PE=1 SV=3 3354 1878 sp|Q8WU68|U2AF4_HUMAN 68.37 6 0 0 6 5 0 6.93E+05 9.94E+05 2 2 0 0 1 1 0 25744 Splicing factor U2AF 26 kDa subunit OS=Homo sapiens OX=9606 GN=U2AF1L4 PE=1 SV=2 1215 1330 sp|Q8TDM6|DLG5_HUMAN 68.28 2 0 1 0 0 1 2.94E+06 5 1 1 3 0 2 3 213866 Disks large homolog 5 OS=Homo sapiens OX=9606 GN=DLG5 PE=1 SV=4 810 866 sp|Q9NW13|RBM28_HUMAN 68.11 4 1 2 2 2 1 2.27E+06 5 1 1 3 3 4 1 85738 RNA-binding protein 28 OS=Homo sapiens OX=9606 GN=RBM28 PE=1 SV=3 462 2027 sp|P02549|SPTA1_HUMAN 68.09 2 1 1 1 0 0 3.77E+06 6.29E+06 8 1 9 3 4 3 2 280013 Spectrin alpha chain erythrocytic 1 OS=Homo sapiens OX=9606 GN=SPTA1 PE=1 SV=5 3010 1943 sp|Q9BYD3|RM04_HUMAN 67.98 5 5 0 2 5 0 2.25E+06 1.73E+06 2 1 1 0 1 1 0 34919 39S ribosomal protein L4 mitochondrial OS=Homo sapiens OX=9606 GN=MRPL4 PE=1 SV=1 2667 1538 sp|Q9Y4P3|TBL2_HUMAN 67.97 4 1 0 3 3 3 2.27E+06 2.35E+06 1.62E+06 2 1 1 0 1 1 1 49798 Transducin beta-like protein 2 OS=Homo sapiens OX=9606 GN=TBL2 PE=1 SV=1 2666 1274 sp|Q9ULV4|COR1C_HUMAN 67.78 4 4 2 0 2 0 3.35E+06 1.34E+06 4.81E+06 2 2 2 1 0 1 0 53249 Coronin-1C OS=Homo sapiens OX=9606 GN=CORO1C PE=1 SV=1 520 971 sp|Q8WXW3|PIBF1_HUMAN 67.63 4 2 1 2 3 3 2.29E+07 7.86E+06 3.16E+06 6 1 5 3 3 6 3 89805 Progesterone-induced-blocking factor 1 OS=Homo sapiens OX=9606 GN=PIBF1 PE=1 SV=2 2167 1121 sp|Q5T6F2|UBAP2_HUMAN 67.61 3 0 1 3 3 0 7.62E+05 3.00E+06 4.16E+06 2 2 0 1 2 2 0 117115 Ubiquitin-associated protein 2 OS=Homo sapiens OX=9606 GN=UBAP2 PE=1 SV=1 801 860 sp|O43896|KIF1C_HUMAN 67.24 2 0 1 1 1 1 1.71E+06 2.07E+06 2.23E+06 3 1 0 4 3 4 2 122947 Kinesin-like protein KIF1C OS=Homo sapiens OX=9606 GN=KIF1C PE=1 SV=3 1882 1003 sp|E9PRG8|CK098_HUMAN 66.96 15 0 15 15 11 11 1.00E+07 1.20E+07 1.23E+07 6.05E+06 2 1 0 2 2 1 1 14234 Uncharacterized protein C11orf98 OS=Homo sapiens OX=9606 GN=C11orf98 PE=4 SV=2 4355 2400 sp|P62310|LSM3_HUMAN 66.68 21 0 0 0 21 0 3.51E+05 1 1 0 0 0 1 0 11845 U6 snRNA-associated Sm-like protein LSm3 OS=Homo sapiens OX=9606 GN=LSM3 PE=1 SV=2 1846 790 sp|Q12899|TRI26_HUMAN 66.65 5 0 4 2 2 1 2.78E+06 8.73E+05 9.60E+05 3 2 0 2 1 1 1 62166 Tripartite motif-containing protein 26 OS=Homo sapiens OX=9606 GN=TRIM26 PE=1 SV=1 2109 720 sp|P78362|SRPK2_HUMAN 66.6 5 1 1 3 2 0 2.99E+06 2.26E+06 4 2 1 1 2 1 0 77527 SRSF protein kinase 2 OS=Homo sapiens OX=9606 GN=SRPK2 PE=1 SV=3 3161 1492 sp|Q6SJ96|TBPL2_HUMAN 66.43 4 1 0 0 0 3 2.55E+06 2 1 2 0 0 0 1 41525 TATA box-binding protein-like protein 2 OS=Homo sapiens OX=9606 GN=TBPL2 PE=2 SV=1 2208 718 sp|Q8NBJ5|GT251_HUMAN 65.96 7 0 0 7 3 0 7.82E+06 3.80E+06 4 3 0 0 4 1 0 71636 Procollagen galactosyltransferase 1 OS=Homo sapiens OX=9606 GN=COLGALT1 PE=1 SV=1 428 824 sp|Q9NRL2|BAZ1A_HUMAN 65.88 3 0 1 1 1 2 2.45E+05 7 1 1 6 4 6 7 178702 Bromodomain adjacent to zinc finger domain protein 1A OS=Homo sapiens OX=9606 GN=BAZ1A PE=1 SV=2 2528 1652 sp|O43324|MCA3_HUMAN 65.54 6 0 0 0 6 6 1.17E+06 3.17E+05 2 1 0 0 0 1 2 19811 Eukaryotic translation elongation factor 1 epsilon-1 OS=Homo sapiens OX=9606 GN=EEF1E1 PE=1 SV=1 2595 1156 sp|Q16643|DREB_HUMAN 65.51 4 1 0 0 3 3 1.34E+06 1.19E+06 2 1 2 0 0 1 1 71429 Drebrin OS=Homo sapiens OX=9606 GN=DBN1 PE=1 SV=4 2614 2255 sp|A6NHT5|HMX3_HUMAN 65.47 4 0 4 4 4 4 1.63E+07 1.29E+07 1.48E+07 9.46E+06 1 1 0 1 1 1 1 37825 Homeobox protein HMX3 OS=Homo sapiens OX=9606 GN=HMX3 PE=1 SV=1 394 6633 sp|O75417|DPOLQ_HUMAN 65.41 1 1 1 1 0 0 5.33E+06 2.62E+07 2.19E+07 6 1 5 6 5 4 4 289617 DNA polymerase theta OS=Homo sapiens OX=9606 GN=POLQ PE=1 SV=2 1214 765 sp|Q13243|SRSF5_HUMAN 65.22 9 3 5 4 5 5 6.77E+05 3 1 1 2 1 3 2 31264 Serine/arginine-rich splicing factor 5 OS=Homo sapiens OX=9606 GN=SRSF5 PE=1 SV=1 1479 753 sp|Q01130|SRSF2_HUMAN 65.15 14 4 11 0 14 11 2.99E+05 1.73E+06 2.05E+06 3 1 1 2 0 3 2 25476 Serine/arginine-rich splicing factor 2 OS=Homo sapiens OX=9606 GN=SRSF2 PE=1 SV=4 1007 728 sp|Q0JRZ9|FCHO2_HUMAN 64.74 4 1 1 1 4 1 8.54E+05 4 2 2 1 2 4 2 88924 F-BAR domain only protein 2 OS=Homo sapiens OX=9606 GN=FCHO2 PE=1 SV=2 3603 1142 sp|Q96P11|NSUN5_HUMAN 64.41 6 0 0 4 2 0 3.34E+05 5.25E+06 2 2 0 0 1 1 0 46692 Probable 28S rRNA (cytosine-C(5))-methyltransferase OS=Homo sapiens OX=9606 GN=NSUN5 PE=1 SV=2 2079 1374 sp|O14578|CTRO_HUMAN 64.22 1 0 1 0 0 0 2.14E+06 4 1 1 2 1 0 0 231429 Citron Rho-interacting kinase OS=Homo sapiens OX=9606 GN=CIT PE=1 SV=2 3446 1669 sp|Q12874|SF3A3_HUMAN 64.06 2 1 2 0 0 0 2.51E+06 2 1 1 1 0 0 0 58849 Splicing factor 3A subunit 3 OS=Homo sapiens OX=9606 GN=SF3A3 PE=1 SV=1 2283 2401 sp|P47914|RL29_HUMAN 63.79 9 9 9 9 9 9 4.96E+06 1.98E+07 2.72E+07 2.68E+07 2.26E+07 1 1 1 1 1 1 1 17752 60S ribosomal protein L29 OS=Homo sapiens OX=9606 GN=RPL29 PE=1 SV=2 1055 2628 sp|Q9NR48|ASH1L_HUMAN 63.77 1 0 0 0 0 0 1.71E+05 7 1 1 2 1 1 4 332790 Histone-lysine N-methyltransferase ASH1L OS=Homo sapiens OX=9606 GN=ASH1L PE=1 SV=2 1168 1152 sp|Q6PIF6|MYO7B_HUMAN 63.77 5 4 0 0 0 0 1.96E+08 9 6 8 0 0 0 1 241597 Unconventional myosin-VIIb OS=Homo sapiens OX=9606 GN=MYO7B PE=1 SV=2 766 1969 sp|Q5XPI4|RN123_HUMAN 63.67 3 1 1 0 1 1 2.46E+05 7 1 3 4 1 4 2 148514 E3 ubiquitin-protein ligase RNF123 OS=Homo sapiens OX=9606 GN=RNF123 PE=1 SV=1 4318 2171 sp|P04040|CATA_HUMAN 63.62 5 0 0 0 5 0 2.38E+06 1 1 0 0 0 1 0 59756 Catalase OS=Homo sapiens OX=9606 GN=CAT PE=1 SV=3 1969 1494 sp|Q8TAA3|PSMA8_HUMAN 63.35 7 0 7 7 5 2 1.64E+06 2.05E+06 1.90E+06 2 1 0 2 2 1 1 28530 Proteasome subunit alpha-type 8 OS=Homo sapiens OX=9606 GN=PSMA8 PE=2 SV=3 571 2275 sp|Q8WXX0|DYH7_HUMAN 63.22 1 0 0 0 0 1 3.90E+06 6 1 2 4 4 1 4 461163 Dynein heavy chain 7 axonemal OS=Homo sapiens OX=9606 GN=DNAH7 PE=1 SV=2 3515 1353 sp|O95486|SC24A_HUMAN 63.21 1 0 0 1 1 0 1.42E+05 1.88E+05 1 1 0 0 1 1 0 119749 Protein transport protein Sec24A OS=Homo sapiens OX=9606 GN=SEC24A PE=1 SV=2 1197 1864 sp|Q4G0P3|HYDIN_HUMAN 63.06 1 0 0 0 0 0 1.62E+07 7 1 2 2 2 2 1 575900 Hydrocephalus-inducing protein homolog OS=Homo sapiens OX=9606 GN=HYDIN PE=1 SV=3 2663 926 sp|P11586|C1TC_HUMAN 63.05 4 1 0 2 1 0 4.12E+05 7.57E+05 3 2 1 0 1 1 0 101559 C-1-tetrahydrofolate synthase cytoplasmic OS=Homo sapiens OX=9606 GN=MTHFD1 PE=1 SV=3 2984 871 sp|P35611|ADDA_HUMAN 62.69 5 1 2 0 0 2 1.15E+06 8.80E+05 3 2 1 1 0 0 1 80955 Alpha-adducin OS=Homo sapiens OX=9606 GN=ADD1 PE=1 SV=2 458 3395 sp|Q8IVF2|AHNK2_HUMAN 62.62 1 0 0 0 0 0 1.78E+07 7 1 6 3 5 2 4 616641 Protein AHNAK2 OS=Homo sapiens OX=9606 GN=AHNAK2 PE=1 SV=2 3626 2018 sp|P00387|NB5R3_HUMAN 62.21 4 0 0 4 4 0 1.86E+06 2.08E+06 1 1 0 0 1 1 0 34235 NADH-cytochrome b5 reductase 3 OS=Homo sapiens OX=9606 GN=CYB5R3 PE=1 SV=3 1537 873 sp|Q08J23|NSUN2_HUMAN 62.08 3 0 1 1 3 1 2.89E+06 4 1 0 1 1 3 2 86471 RNA cytosine C(5)-methyltransferase NSUN2 OS=Homo sapiens OX=9606 GN=NSUN2 PE=1 SV=2 1844 745 sp|O15372|EIF3H_HUMAN 61.99 10 3 10 3 3 0 1.39E+06 3.31E+07 1.11E+06 2.30E+06 3 3 1 3 1 1 0 39930 Eukaryotic translation initiation factor 3 subunit H OS=Homo sapiens OX=9606 GN=EIF3H PE=1 SV=1 3509 927 sp|Q96D71|REPS1_HUMAN 61.87 3 0 0 0 2 1 1.73E+06 5.94E+05 2 2 0 0 0 1 1 86662 RalBP1-associated Eps domain-containing protein 1 OS=Homo sapiens OX=9606 GN=REPS1 PE=1 SV=3 1425 832 sp|P78344|IF4G2_HUMAN 61.81 5 1 3 1 2 1 1.10E+06 1.85E+06 4 2 1 2 1 3 1 102362 Eukaryotic translation initiation factor 4 gamma 2 OS=Homo sapiens OX=9606 GN=EIF4G2 PE=1 SV=1 2660 788 sp|Q9Y617|SERC_HUMAN 61.5 8 0 0 4 3 1 1.88E+06 8.98E+05 4 2 0 0 2 1 1 40423 Phosphoserine aminotransferase OS=Homo sapiens OX=9606 GN=PSAT1 PE=1 SV=2 583 746 sp|P61160|ARP2_HUMAN 61.49 6 2 2 3 3 5 3.13E+06 4 1 4 2 4 5 3 44761 Actin-related protein 2 OS=Homo sapiens OX=9606 GN=ACTR2 PE=1 SV=1 3393 931 sp|Q9Y4C2|TCAF1_HUMAN 61.34 2 0 1 1 0 0 1.76E+06 1.91E+06 2 2 0 1 1 0 0 102126 TRPM8 channel-associated factor 1 OS=Homo sapiens OX=9606 GN=TCAF1 PE=1 SV=3 2154 797 sp|O60701|UGDH_HUMAN 61.29 5 0 4 1 2 0 2.64E+06 1.70E+06 3 2 0 2 2 1 0 55024 UDP-glucose 6-dehydrogenase OS=Homo sapiens OX=9606 GN=UGDH PE=1 SV=1 828 1219 sp|Q96QU1|PCD15_HUMAN 61.28 2 1 0 0 0 1 2.57E+06 6 1 5 1 1 2 3 216067 Protocadherin-15 OS=Homo sapiens OX=9606 GN=PCDH15 PE=1 SV=2 1623 1161 sp|P37108|SRP14_HUMAN 61.17 20 10 10 10 10 10 2.77E+06 7.35E+05 3.53E+06 6.82E+06 0.00E+00 2 2 2 1 1 2 1 14570 Signal recognition particle 14 kDa protein OS=Homo sapiens OX=9606 GN=SRP14 PE=1 SV=2 2265 836 sp|Q9HC36|MRM3_HUMAN 61.09 4 0 1 4 1 0 1.28E+06 3.07E+06 1.56E+06 2 2 0 1 2 1 0 47020 rRNA methyltransferase 3 mitochondrial OS=Homo sapiens OX=9606 GN=MRM3 PE=1 SV=2 970 1012 sp|Q13617|CUL2_HUMAN 61 3 1 1 1 1 1 3.23E+06 3 1 1 1 2 2 3 86983 Cullin-2 OS=Homo sapiens OX=9606 GN=CUL2 PE=1 SV=2 3069 747 sp|P02545|LMNA_HUMAN 60.93 6 0 0 6 0 0 8.93E+06 3 3 0 0 3 0 0 74140 Prelamin-A/C OS=Homo sapiens OX=9606 GN=LMNA PE=1 SV=1 875 1163 sp|Q5HYC2|K2026_HUMAN 60.89 1 0 1 1 0 0 4.13E+07 9.59E+07 5 2 1 3 4 1 0 228085 Uncharacterized protein KIAA2026 OS=Homo sapiens OX=9606 GN=KIAA2026 PE=2 SV=2 767 2481 sp|Q9UQD0|SCN8A_HUMAN 60.88 1 1 1 1 0 1 4.00E+06 3.60E+06 4.20E+06 4.23E+06 4 1 2 4 4 1 3 225278 Sodium channel protein type 8 subunit alpha OS=Homo sapiens OX=9606 GN=SCN8A PE=1 SV=1 3391 809 sp|Q9H0J9|PAR12_HUMAN 60.82 3 0 0 0 3 0 5.08E+06 2 2 0 0 0 2 0 79064 Protein mono-ADP-ribosyltransferase PARP12 OS=Homo sapiens OX=9606 GN=PARP12 PE=1 SV=1 3510 943 sp|Q15459|SF3A1_HUMAN 60.82 3 0 1 2 0 0 6.47E+05 1.01E+06 2 2 0 1 1 0 0 88886 Splicing factor 3A subunit 1 OS=Homo sapiens OX=9606 GN=SF3A1 PE=1 SV=1 3156 1272 sp|Q13011|ECH1_HUMAN 60.67 7 0 0 4 7 0 2.80E+05 3.53E+06 2 2 0 0 1 2 0 35816 Delta(3 5)-Delta(2 4)-dienoyl-CoA isomerase mitochondrial OS=Homo sapiens OX=9606 GN=ECH1 PE=1 SV=2 3157 1279 sp|Q13200|PSMD2_HUMAN 60.56 3 0 2 2 1 0 0.00E+00 1.88E+06 1.15E+06 2 2 0 1 1 1 0 100200 26S proteasome non-ATPase regulatory subunit 2 OS=Homo sapiens OX=9606 GN=PSMD2 PE=1 SV=3 1622 1138 sp|P59190|RAB15_HUMAN 60.53 8 8 5 5 5 5 0.00E+00 2 1 2 1 1 2 1 24391 Ras-related protein Rab-15 OS=Homo sapiens OX=9606 GN=RAB15 PE=1 SV=1 3512 1029 sp|P06744|G6PI_HUMAN 60.47 6 0 0 3 3 0 1.00E+06 2 1 0 0 1 1 0 63147 Glucose-6-phosphate isomerase OS=Homo sapiens OX=9606 GN=GPI PE=1 SV=4 3605 1227 sp|Q86TB9|PATL1_HUMAN 60.3 3 0 1 0 2 0 5.74E+06 6.90E+05 2 2 0 1 0 1 0 86850 Protein PAT1 homolog 1 OS=Homo sapiens OX=9606 GN=PATL1 PE=1 SV=2 782 1877 sp|Q9UFH2|DYH17_HUMAN 60.1 1 0 0 0 0 0 2.54E+07 8 1 3 2 3 2 3 509318 Dynein heavy chain 17 axonemal OS=Homo sapiens OX=9606 GN=DNAH17 PE=1 SV=3 848 830 sp|Q9Y6D9|MD1L1_HUMAN 59.99 5 1 1 3 1 2 2.31E+06 6.98E+05 5 2 2 3 4 1 3 83067 Mitotic spindle assembly checkpoint protein MAD1 OS=Homo sapiens OX=9606 GN=MAD1L1 PE=1 SV=2 3750 2403 sp|Q15043|S39AE_HUMAN 59.96 3 0 0 3 3 0 2.59E+06 1.44E+06 1 1 0 0 1 1 0 54212 Metal cation symporter ZIP14 OS=Homo sapiens OX=9606 GN=SLC39A14 PE=1 SV=3 3742 1659 sp|Q9Y3D9|RT23_HUMAN 59.96 8 5 0 0 3 0 1.17E+06 2 1 1 0 0 1 0 21771 28S ribosomal protein S23 mitochondrial OS=Homo sapiens OX=9606 GN=MRPS23 PE=1 SV=2 1912 779 sp|Q15650|TRIP4_HUMAN 59.61 9 2 3 0 3 1 1.03E+06 6.04E+05 1.39E+06 5 3 3 1 0 1 1 66146 Activating signal cointegrator 1 OS=Homo sapiens OX=9606 GN=TRIP4 PE=1 SV=4 1084 785 sp|Q96SN8|CK5P2_HUMAN 59.38 3 1 2 0 0 1 2.57E+06 6 2 2 4 1 1 2 215036 CDK5 regulatory subunit-associated protein 2 OS=Homo sapiens OX=9606 GN=CDK5RAP2 PE=1 SV=5 1564 689 sp|Q8IX01|SUGP2_HUMAN 59.36 4 0 4 1 1 1 5.27E+06 3.15E+06 1.29E+06 1.67E+06 3 3 0 3 2 1 1 120207 SURP and G-patch domain-containing protein 2 OS=Homo sapiens OX=9606 GN=SUGP2 PE=1 SV=2 592 2791 sp|Q9P225|DYH2_HUMAN 59.31 1 0 0 0 1 0 5.93E+06 7.28E+06 7.31E+06 8 1 1 4 3 6 3 507703 Dynein heavy chain 2 axonemal OS=Homo sapiens OX=9606 GN=DNAH2 PE=1 SV=3 1630 1569 sp|Q96DH6|MSI2H_HUMAN 59.31 5 0 2 5 2 5 1.12E+06 4.04E+05 3 1 0 3 1 1 2 35197 RNA-binding protein Musashi homolog 2 OS=Homo sapiens OX=9606 GN=MSI2 PE=1 SV=1 2157 890 sp|P59998|ARPC4_HUMAN 59.22 12 3 5 7 5 5 2.77E+06 3.25E+06 4.03E+06 2.41E+06 3 2 1 1 1 1 1 19667 Actin-related protein 2/3 complex subunit 4 OS=Homo sapiens OX=9606 GN=ARPC4 PE=1 SV=3 3104 2405 sp|Q9BQC6|RT63_HUMAN 59.08 13 0 13 0 13 0 1.24E+07 1.14E+07 1 1 0 2 0 1 0 12266 Ribosomal protein 63 mitochondrial OS=Homo sapiens OX=9606 GN=MRPL57 PE=1 SV=1 1847 826 sp|Q93009|UBP7_HUMAN 59.07 3 0 0 3 0 0 5.31E+06 4 3 0 1 5 0 0 128302 Ubiquitin carboxyl-terminal hydrolase 7 OS=Homo sapiens OX=9606 GN=USP7 PE=1 SV=2 3176 2404 sp|P11233|RALA_HUMAN 58.96 7 0 7 7 7 0 2.05E+06 1.74E+06 1.15E+06 1 1 0 1 1 1 0 23567 Ras-related protein Ral-A OS=Homo sapiens OX=9606 GN=RALA PE=1 SV=1 2210 781 sp|P06493|CDK1_HUMAN 58.75 8 4 3 3 0 3 1.06E+06 1.47E+06 3 1 2 1 1 0 1 34095 Cyclin-dependent kinase 1 OS=Homo sapiens OX=9606 GN=CDK1 PE=1 SV=3 1567 863 sp|Q15029|U5S1_HUMAN 58.51 3 1 1 3 1 0 2.45E+06 8.01E+06 7.34E+06 3 2 1 1 3 2 0 109436 116 kDa U5 small nuclear ribonucleoprotein component OS=Homo sapiens OX=9606 GN=EFTUD2 PE=1 SV=1 862 1040 sp|Q6Y7W6|GGYF2_HUMAN 58.47 2 0 0 2 2 0 7.62E+05 5.07E+05 3 1 0 2 3 3 2 150070 GRB10-interacting GYF protein 2 OS=Homo sapiens OX=9606 GN=GIGYF2 PE=1 SV=1 3163 1553 sp|P31689|DNJA1_HUMAN 58.33 5 0 3 3 0 1 2.52E+06 2.49E+06 2 1 0 1 1 0 1 44868 DnaJ homolog subfamily A member 1 OS=Homo sapiens OX=9606 GN=DNAJA1 PE=1 SV=2 2161 1039 sp|Q14676|MDC1_HUMAN 58.32 2 0 0 0 1 1 1.08E+07 1.29E+06 3 2 1 0 0 1 2 226664 Mediator of DNA damage checkpoint protein 1 OS=Homo sapiens OX=9606 GN=MDC1 PE=1 SV=3 1816 957 sp|Q8IX12|CCAR1_HUMAN 58.27 3 0 0 1 3 1 8.75E+05 3.02E+06 1.27E+06 4 2 0 1 1 3 1 132821 Cell division cycle and apoptosis regulator protein 1 OS=Homo sapiens OX=9606 GN=CCAR1 PE=1 SV=2 3080 1438 sp|P83111|LACTB_HUMAN 58.26 4 2 0 0 4 0 5.19E+05 2.05E+07 2 2 1 0 0 2 0 60694 Serine beta-lactamase-like protein LACTB mitochondrial OS=Homo sapiens OX=9606 GN=LACTB PE=1 SV=2

730 1049 sp|Q9NX05|F120C_HUMAN 58.16 4 0 2 3 2 1 7.69E+05 1.13E+06 6 1 0 4 5 3 2 120588 Constitutive coactivator of PPAR-gamma-like protein 2 OS=Homo sapiens OX=9606 GN=FAM120C PE=1 SV=3 3075 1241 sp|O75400|PR40A_HUMAN 58.05 2 0 0 0 0 2 1.92E+06 3 2 0 0 0 0 3 108805 Pre-mRNA-processing factor 40 homolog A OS=Homo sapiens OX=9606 GN=PRPF40A PE=1 SV=2 3751 2406 sp|P52565|GDIR1_HUMAN 57.68 7 0 0 7 7 0 3.69E+06 3.90E+06 1 1 0 0 1 1 0 23207 Rho GDP-dissociation inhibitor 1 OS=Homo sapiens OX=9606 GN=ARHGDIA PE=1 SV=3 3738 1326 sp|P08758|ANXA5_HUMAN 57.43 10 5 0 0 5 0 7.17E+05 2.57E+05 2 2 1 0 0 1 0 35937 Annexin A5 OS=Homo sapiens OX=9606 GN=ANXA5 PE=1 SV=2 2310 817 sp|P13535|MYH8_HUMAN 57.37 2 0 0 0 1 0 7.87E+06 3 1 1 0 0 1 1 222760 Myosin-8 OS=Homo sapiens OX=9606 GN=MYH8 PE=1 SV=3 1368 813 sp|P51812|KS6A3_HUMAN 57.11 4 1 1 2 1 2 5.82E+05 5.85E+05 3 2 1 2 2 1 2 83736 Ribosomal protein S6 kinase alpha-3 OS=Homo sapiens OX=9606 GN=RPS6KA3 PE=1 SV=1 3158 1282 sp|O15234|CASC3_HUMAN 57.04 6 0 4 0 2 4 5.13E+06 4.65E+06 1.52E+06 2 2 0 1 0 1 1 76278 Protein CASC3 OS=Homo sapiens OX=9606 GN=CASC3 PE=1 SV=2 2597 1292 sp|Q9NUK0|MBNL3_HUMAN 56.8 5 0 3 3 2 3 8.43E+05 1.09E+06 6.51E+05 2 1 0 1 1 1 1 38532 Muscleblind-like protein 3 OS=Homo sapiens OX=9606 GN=MBNL3 PE=1 SV=2 2468 1444 sp|Q92552|RT27_HUMAN 56.66 4 0 3 3 4 0 8.37E+05 1.15E+06 1.23E+06 2 1 0 1 1 2 0 47611 28S ribosomal protein S27 mitochondrial OS=Homo sapiens OX=9606 GN=MRPS27 PE=1 SV=3 3165 1579 sp|Q9NUW8|TYDP1_HUMAN 56.5 3 1 0 0 3 0 1.73E+06 2 1 1 0 0 2 0 68420 Tyrosyl-DNA phosphodiesterase 1 OS=Homo sapiens OX=9606 GN=TDP1 PE=1 SV=2 3752 2410 sp|P61626|LYSC_HUMAN 56.34 8 8 0 0 0 8 1.52E+06 2.96E+06 1 1 1 0 0 0 1 16537 Lysozyme C OS=Homo sapiens OX=9606 GN=LYZ PE=1 SV=1 1221 1334 sp|P42694|HELZ_HUMAN 55.92 2 0 1 1 1 0 2.17E+06 3.93E+06 5 1 1 2 3 2 1 218968 Probable helicase with zinc finger domain OS=Homo sapiens OX=9606 GN=HELZ PE=1 SV=2 1566 803 sp|P51648|AL3A2_HUMAN 55.54 6 0 3 4 1 1 7.89E+06 4 1 0 3 2 1 1 54848 Aldehyde dehydrogenase family 3 member A2 OS=Homo sapiens OX=9606 GN=ALDH3A2 PE=1 SV=1 3741 1537 sp|Q9Y320|TMX2_HUMAN 55.33 7 0 2 0 5 0 2.83E+06 6.58E+04 2 2 0 1 0 1 0 34038 Thioredoxin-related transmembrane protein 2 OS=Homo sapiens OX=9606 GN=TMX2 PE=1 SV=1 3071 865 sp|P17174|AATC_HUMAN 55.18 8 3 0 3 5 0 1.26E+06 3.00E+06 2.04E+07 2 2 1 0 1 1 0 46248 Aspartate aminotransferase cytoplasmic OS=Homo sapiens OX=9606 GN=GOT1 PE=1 SV=3 1074 1447 sp|Q13535|ATR_HUMAN 55.04 1 1 0 0 0 0 7.85E+06 3.94E+06 4 2 3 3 1 1 1 301365 Serine/threonine-protein kinase ATR OS=Homo sapiens OX=9606 GN=ATR PE=1 SV=3 3740 1528 sp|Q53EZ4|CEP55_HUMAN 54.66 3 1 2 0 0 0 1.18E+07 2 1 1 1 0 0 0 54178 Centrosomal protein of 55 kDa OS=Homo sapiens OX=9606 GN=CEP55 PE=1 SV=3 3627 2061 sp|Q8IZ83|A16A1_HUMAN 54.61 2 0 2 2 0 0 5.95E+05 8.91E+05 1 1 0 1 1 0 0 85127 Aldehyde dehydrogenase family 16 member A1 OS=Homo sapiens OX=9606 GN=ALDH16A1 PE=1 SV=2 687 776 sp|O95816|BAG2_HUMAN 54.52 12 0 2 2 2 12 0.00E+00 4 1 0 3 3 3 6 23772 BAG family molecular chaperone regulator 2 OS=Homo sapiens OX=9606 GN=BAG2 PE=1 SV=1 Arf-GAP with Rho-GAP domain ANK repeat and PH domain-containing protein 1 OS=Homo sapiens OX=9606 858 1779 sp|Q96P48|ARAP1_HUMAN 54.47 2 0 1 1 1 2 0.00E+00 5 1 2 2 2 2 3 162191 GN=ARAP1 PE=1 SV=3 1787 1826 sp|Q8N7X0|ADGB_HUMAN 54.45 2 1 1 1 0 0 8.32E+06 7.83E+06 5 1 2 3 1 0 0 189712 Androglobin OS=Homo sapiens OX=9606 GN=ADGB PE=2 SV=3 1755 801 sp|Q14683|SMC1A_HUMAN 54.42 3 0 2 0 2 0 2.14E+06 1.26E+05 5 2 0 3 1 2 0 143233 Structural maintenance of chromosomes protein 1A OS=Homo sapiens OX=9606 GN=SMC1A PE=1 SV=2 1619 877 sp|P08754|GNAI3_HUMAN 54.25 6 3 5 1 1 5 1.43E+06 3.64E+06 2.04E+06 3 1 1 2 1 1 2 40532 Guanine nucleotide-binding protein G(i) subunit alpha OS=Homo sapiens OX=9606 GN=GNAI3 PE=1 SV=3 3074 1109 sp|O95639|CPSF4_HUMAN 54.2 12 0 4 0 0 8 3.29E+06 3.72E+06 2 2 0 1 0 0 2 30255 Cleavage and polyadenylation specificity factor subunit 4 OS=Homo sapiens OX=9606 GN=CPSF4 PE=1 SV=1 3012 2041 sp|O43172|PRP4_HUMAN 53.96 3 0 3 3 3 0 1.04E+06 1.02E+06 1.13E+06 1 1 0 1 1 1 0 58449 U4/U6 small nuclear ribonucleoprotein Prp4 OS=Homo sapiens OX=9606 GN=PRPF4 PE=1 SV=2 2211 819 sp|P01009|A1AT_HUMAN 53.93 5 4 2 1 0 0 7.08E+05 3 1 2 1 2 0 0 46737 Alpha-1-antitrypsin OS=Homo sapiens OX=9606 GN=SERPINA1 PE=1 SV=3 3177 2414 sp|O60783|RT14_HUMAN 53.57 12 0 0 0 12 12 3.63E+06 1.00E+06 1 1 0 0 0 2 1 15139 28S ribosomal protein S14 mitochondrial OS=Homo sapiens OX=9606 GN=MRPS14 PE=1 SV=1 2018 916 sp|Q9UQE7|SMC3_HUMAN 53.55 3 0 1 3 0 0 3.22E+06 1.04E+06 3 2 0 1 4 0 0 141541 Structural maintenance of chromosomes protein 3 OS=Homo sapiens OX=9606 GN=SMC3 PE=1 SV=2 2312 906 sp|P12883|MYH7_HUMAN 53.29 3 2 0 0 0 0 0.00E+00 3 1 2 0 0 0 1 223095 Myosin-7 OS=Homo sapiens OX=9606 GN=MYH7 PE=1 SV=5 2915 928 sp|O15226|NKRF_HUMAN 53.08 3 1 3 0 0 0 8.45E+05 9.63E+06 2 2 1 2 0 0 0 77673 NF-kappa-B-repressing factor OS=Homo sapiens OX=9606 GN=NKRF PE=1 SV=2 1916 960 sp|P20700|LMNB1_HUMAN 52.92 3 1 1 1 1 3 6.68E+06 2 1 1 1 1 1 2 66408 Lamin-B1 OS=Homo sapiens OX=9606 GN=LMNB1 PE=1 SV=2 3598 921 sp|P49757|NUMB_HUMAN 52.92 3 0 0 0 3 0 5.39E+06 2 2 0 0 0 2 0 70804 Protein numb homolog OS=Homo sapiens OX=9606 GN=NUMB PE=1 SV=2 2985 946 sp|Q9Y446|PKP3_HUMAN 52.88 3 0 1 0 2 0 8.69E+05 1.00E+06 2 2 0 1 0 1 0 87082 Plakophilin-3 OS=Homo sapiens OX=9606 GN=PKP3 PE=1 SV=1 978 2305 sp|P0C091|FREM3_HUMAN 52.76 1 0 1 0 1 1 8.24E+06 5 1 0 3 1 4 3 238177 FRAS1-related extracellular matrix protein 3 OS=Homo sapiens OX=9606 GN=FREM3 PE=3 SV=2 Calcium/calmodulin-dependent protein kinase type II subunit delta OS=Homo sapiens OX=9606 GN=CAMK2D 3511 1006 sp|Q13557|KCC2D_HUMAN 52.71 6 2 4 0 0 0 1.10E+06 2 1 1 1 0 0 0 56369 PE=1 SV=3 3392 861 sp|Q9BZH6|WDR11_HUMAN 52.58 2 0 1 1 0 0 5.93E+05 7.45E+06 2 2 0 1 1 0 0 136685 WD repeat-containing protein 11 OS=Homo sapiens OX=9606 GN=WDR11 PE=1 SV=1 476 1781 sp|P20585|MSH3_HUMAN 52.35 1 0 1 1 1 0 2.04E+07 3.41E+07 2.78E+07 3 1 1 5 7 6 2 127412 DNA mismatch repair protein Msh3 OS=Homo sapiens OX=9606 GN=MSH3 PE=1 SV=4 2217 1207 sp|Q6AI08|HEAT6_HUMAN 52.32 3 1 0 1 0 0 1.76E+06 4 1 2 0 1 1 1 128781 HEAT repeat-containing protein 6 OS=Homo sapiens OX=9606 GN=HEATR6 PE=1 SV=1 3753 2412 sp|P60900|PSA6_HUMAN 52.21 5 5 0 5 0 0 7.92E+05 2.95E+06 1 1 1 0 1 0 0 27399 Proteasome subunit alpha type-6 OS=Homo sapiens OX=9606 GN=PSMA6 PE=1 SV=1 2689 2421 sp|P07148|FABPL_HUMAN 51.87 9 9 9 0 9 9 3.21E+06 7.72E+06 8.02E+06 3.15E+06 1 1 1 1 0 1 1 14208 Fatty acid-binding protein liver OS=Homo sapiens OX=9606 GN=FABP1 PE=1 SV=1 3073 1036 sp|Q9NY61|AATF_HUMAN 51.75 3 1 1 0 0 1 1.51E+06 3 1 1 1 0 0 1 63133 Protein AATF OS=Homo sapiens OX=9606 GN=AATF PE=1 SV=1 3630 2223 sp|O95232|LC7L3_HUMAN 51.74 4 0 4 0 0 4 3.79E+06 1.02E+06 1 1 0 1 0 0 1 51466 Luc7-like protein 3 OS=Homo sapiens OX=9606 GN=LUC7L3 PE=1 SV=2 1361 2020 sp|Q14008|CKAP5_HUMAN 51.73 1 0 0 1 0 0 1.83E+07 5 1 2 2 2 0 1 225493 Cytoskeleton-associated protein 5 OS=Homo sapiens OX=9606 GN=CKAP5 PE=1 SV=3 1896 2135 sp|O43149|ZZEF1_HUMAN 51.68 1 1 0 0 0 0 7.04E+05 4 1 3 1 1 0 1 331075 Zinc finger ZZ-type and EF-hand domain-containing protein 1 OS=Homo sapiens OX=9606 GN=ZZEF1 PE=1 SV=6 1546 1153 sp|P08183|MDR1_HUMAN 51.61 2 1 0 1 1 0 1.08E+07 3.59E+06 4.22E+06 4 2 2 1 1 3 0 141478 ATP-dependent translocase ABCB1 OS=Homo sapiens OX=9606 GN=ABCB1 PE=1 SV=3 1280 4583 sp|Q8IVV2|LOXH1_HUMAN 51.35 1 0 0 1 0 1 1.46E+07 1.89E+07 1.02E+07 6.06E+06 5 1 1 2 3 1 2 235676 Lipoxygenase homology domain-containing protein 1 OS=Homo sapiens OX=9606 GN=LOXHD1 PE=2 SV=4 1913 799 sp|Q15907|RB11B_HUMAN 51.27 13 0 0 13 11 5 3.39E+06 2.87E+06 6.06E+05 3 2 0 0 3 2 1 24488 Ras-related protein Rab-11B OS=Homo sapiens OX=9606 GN=RAB11B PE=1 SV=4 2321 1287 sp|Q15032|R3HD1_HUMAN 51.17 2 0 2 0 0 0 1.07E+06 2 1 0 2 0 0 1 120696 R3H domain-containing protein 1 OS=Homo sapiens OX=9606 GN=R3HDM1 PE=1 SV=3 2919 1245 sp|P53992|SC24C_HUMAN 51.16 2 1 0 0 0 0 7.93E+05 3 1 1 0 1 0 1 118325 Protein transport protein Sec24C OS=Homo sapiens OX=9606 GN=SEC24C PE=1 SV=3 2212 874 sp|Q8NDT2|RB15B_HUMAN 51.15 3 1 2 0 0 0 6.31E+05 3 1 4 1 0 0 0 97205 Putative RNA-binding protein 15B OS=Homo sapiens OX=9606 GN=RBM15B PE=1 SV=3 Brefeldin A-inhibited guanine nucleotide-exchange protein 2 OS=Homo sapiens OX=9606 GN=ARFGEF2 PE=1 2435 4818 sp|Q9Y6D5|BIG2_HUMAN 51.06 1 1 0 0 0 0 1.20E+06 3 1 3 0 1 0 0 202037 SV=3 1817 963 sp|Q14011|CIRBP_HUMAN 50.88 10 0 10 0 3 3 1.68E+06 3 1 0 4 0 1 1 18648 Cold-inducible RNA-binding protein OS=Homo sapiens OX=9606 GN=CIRBP PE=1 SV=1 2835 984 sp|P98082|DAB2_HUMAN 50.8 4 0 0 0 3 2 4.39E+06 8.75E+05 2 2 0 0 0 1 1 82448 Disabled homolog 2 OS=Homo sapiens OX=9606 GN=DAB2 PE=1 SV=3 4357 2415 sp|Q02978|M2OM_HUMAN 50.75 5 0 0 5 0 0 9.46E+05 1 1 0 0 1 0 0 34062 Mitochondrial 2-oxoglutarate/malate carrier protein OS=Homo sapiens OX=9606 GN=SLC25A11 PE=1 SV=3 4356 2413 sp|P37837|TALDO_HUMAN 50.69 4 0 0 0 4 0 2.48E+06 1 1 0 0 0 1 0 37540 Transaldolase OS=Homo sapiens OX=9606 GN=TALDO1 PE=1 SV=2 3076 1304 sp|Q53G59|KLH12_HUMAN 50.67 3 0 1 3 0 0 1.26E+06 2 1 0 1 2 0 0 63277 Kelch-like protein 12 OS=Homo sapiens OX=9606 GN=KLHL12 PE=1 SV=2 3355 1143 sp|Q8IUD2|RB6I2_HUMAN 50.66 2 1 0 1 0 0 6.35E+06 7.63E+06 2 2 1 0 1 0 0 128086 ELKS/Rab6-interacting/CAST family member 1 OS=Homo sapiens OX=9606 GN=ERC1 PE=1 SV=1 3618 1761 sp|Q9UBP9|GULP1_HUMAN 50.55 5 2 4 0 0 0 5.73E+06 2 1 1 1 0 0 0 34490 PTB domain-containing engulfment adapter protein 1 OS=Homo sapiens OX=9606 GN=GULP1 PE=1 SV=1 3070 766 sp|O75821|EIF3G_HUMAN 50.48 16 0 4 0 8 4 5.07E+05 0.00E+00 7.00E+05 3 3 0 1 0 1 1 35611 Eukaryotic translation initiation factor 3 subunit G OS=Homo sapiens OX=9606 GN=EIF3G PE=1 SV=2 2418 918 sp|P10398|ARAF_HUMAN 50.47 2 0 1 0 2 1 5.27E+07 2 1 0 1 0 2 1 67585 Serine/threonine-protein kinase A-Raf OS=Homo sapiens OX=9606 GN=ARAF PE=1 SV=2 3178 2422 sp|P69905|HBA_HUMAN 50.42 11 0 11 11 0 0 3.99E+06 1.75E+07 1 1 0 1 2 0 0 15258 Hemoglobin subunit alpha OS=Homo sapiens OX=9606 GN=HBA1 PE=1 SV=2 Voltage-dependent L-type calcium channel subunit alpha-1S OS=Homo sapiens OX=9606 GN=CACNA1S PE=1 503 4069 sp|Q13698|CAC1S_HUMAN 50.34 2 0 1 1 1 1 2.03E+05 5 1 0 6 4 5 5 212349 SV=4 1920 1016 sp|P57723|PCBP4_HUMAN 50.18 7 0 0 7 2 2 7.65E+06 2 1 0 0 2 2 2 41482 Poly(rC)-binding protein 4 OS=Homo sapiens OX=9606 GN=PCBP4 PE=2 SV=1 1424 782 sp|P63162|RSMN_HUMAN 50.09 10 3 6 3 3 7 2.69E+06 5.99E+06 5.78E+06 7.31E+06 5.67E+06 3 3 1 2 1 1 3 24614 Small nuclear ribonucleoprotein-associated protein N OS=Homo sapiens OX=9606 GN=SNRPN PE=1 SV=1 1424 783 sp|P14678|RSMB_HUMAN 50.09 10 3 6 3 3 7 2.69E+06 5.99E+06 5.78E+06 7.31E+06 5.67E+06 3 3 1 2 1 1 3 24610 Small nuclear ribonucleoprotein-associated proteins B and B' OS=Homo sapiens OX=9606 GN=SNRPB PE=1 SV=2 3102 2272 sp|P50402|EMD_HUMAN 50.06 5 5 0 5 5 0 7.32E+05 1.89E+06 1.36E+06 1 1 1 0 1 1 0 28994 Emerin OS=Homo sapiens OX=9606 GN=EMD PE=1 SV=1 1064 1203 sp|Q5UIP0|RIF1_HUMAN 49.82 1 0 0 0 0 1 1.41E+07 3 1 0 3 2 1 3 274464 Telomere-associated protein RIF1 OS=Homo sapiens OX=9606 GN=RIF1 PE=1 SV=2 2008 2282 sp|Q9Y618|NCOR2_HUMAN 49.79 1 0 0 0 0 0 2.96E+07 4 1 3 1 1 0 0 273654 Nuclear receptor corepressor 2 OS=Homo sapiens OX=9606 GN=NCOR2 PE=1 SV=3 1587 1112 sp|Q86XP1|DGKH_HUMAN 49.67 2 0 0 0 1 1 3.04E+07 8.21E+06 3 1 1 1 0 3 2 134865 Diacylglycerol kinase eta OS=Homo sapiens OX=9606 GN=DGKH PE=1 SV=1 2924 1614 sp|P30041|PRDX6_HUMAN 49.51 5 0 5 5 5 0 3.75E+06 4.24E+06 4.89E+06 1 1 0 1 1 1 0 25035 Peroxiredoxin-6 OS=Homo sapiens OX=9606 GN=PRDX6 PE=1 SV=3 2078 1341 sp|Q6ZMV9|KIF6_HUMAN 49.44 3 1 1 0 0 2 6.16E+06 4 1 2 1 0 0 2 92569 Kinesin-like protein KIF6 OS=Homo sapiens OX=9606 GN=KIF6 PE=1 SV=3 Epidermal growth factor receptor kinase substrate 8-like protein 3 OS=Homo sapiens OX=9606 GN=EPS8L3 PE=1 3519 1559 sp|Q8TE67|ES8L3_HUMAN 49.13 2 0 0 0 2 2 2.47E+06 2.13E+06 1 1 0 0 0 1 1 66861 SV=2 4358 2424 sp|Q9NUI1|DECR2_HUMAN 49.12 4 0 0 4 0 0 3.07E+06 1 1 0 0 1 0 0 30778 Peroxisomal 2 4-dienoyl-CoA reductase OS=Homo sapiens OX=9606 GN=DECR2 PE=1 SV=1 4084 1529 sp|Q9H840|GEMI7_HUMAN 49.08 10 0 0 0 0 10 6.82E+05 1 1 0 0 0 0 1 14537 Gem-associated protein 7 OS=Homo sapiens OX=9606 GN=GEMIN7 PE=1 SV=1 Nucleotide-binding oligomerization domain-containing protein 1 OS=Homo sapiens OX=9606 GN=NOD1 PE=1 1142 959 sp|Q9Y239|NOD1_HUMAN 48.93 3 1 2 1 2 0 1.09E+07 4.64E+06 1.04E+07 4 2 1 3 3 2 0 107691 SV=1 3162 1505 sp|Q6YN16|HSDL2_HUMAN 48.78 3 0 1 2 0 1 6.32E+05 2 1 0 1 1 0 1 45395 Hydroxysteroid dehydrogenase-like protein 2 OS=Homo sapiens OX=9606 GN=HSDL2 PE=1 SV=1 1594 1893 sp|Q8TDY2|RBCC1_HUMAN 48.77 2 0 1 0 0 1 1.28E+06 5 1 1 1 1 1 2 183090 RB1-inducible coiled-coil protein 1 OS=Homo sapiens OX=9606 GN=RB1CC1 PE=1 SV=3 1459 2197 sp|P26006|ITA3_HUMAN 48.75 2 2 0 0 0 0 1.48E+06 3 1 3 2 2 0 1 116612 Integrin alpha-3 OS=Homo sapiens OX=9606 GN=ITGA3 PE=1 SV=5 3754 2423 sp|P30040|ERP29_HUMAN 48.63 6 0 0 6 6 0 2.25E+06 2.23E+06 1 1 0 0 1 1 0 28993 Endoplasmic reticulum resident protein 29 OS=Homo sapiens OX=9606 GN=ERP29 PE=1 SV=4 2993 1350 sp|O75390|CISY_HUMAN 48.44 2 2 0 2 2 0 6.15E+05 2.33E+06 1.86E+06 1 1 1 0 1 1 0 51712 Citrate synthase mitochondrial OS=Homo sapiens OX=9606 GN=CS PE=1 SV=2 2272 1295 sp|P10599|THIO_HUMAN 48.41 17 0 0 17 17 9 3.21E+06 4.79E+06 1.67E+06 2 2 0 0 2 2 1 11737 Thioredoxin OS=Homo sapiens OX=9606 GN=TXN PE=1 SV=3 917 4764 sp|Q86UK0|ABCAC_HUMAN 48.1 1 0 1 0 1 1 9.28E+06 7.58E+06 5 1 0 3 2 3 4 293235 ATP-binding cassette sub-family A member 12 OS=Homo sapiens OX=9606 GN=ABCA12 PE=1 SV=3 2226 1698 sp|H7BZ55|CRCC2_HUMAN 48.07 1 1 0 0 0 0 1.13E+07 3 1 5 0 0 0 0 185640 Putative ciliary rootlet coiled-coil protein 2 OS=Homo sapiens OX=9606 GN=CROCC2 PE=5 SV=4 3290 1671 sp|Q96AG4|LRC59_HUMAN 47.96 4 0 4 4 0 0 1.62E+06 1.36E+06 1 1 0 1 1 0 0 34930 Leucine-rich repeat-containing protein 59 OS=Homo sapiens OX=9606 GN=LRRC59 PE=1 SV=1 2130 3279 sp|P00519|ABL1_HUMAN 47.91 2 1 0 0 0 0 2.93E+06 4 1 3 1 1 0 0 122872 Tyrosine-protein kinase ABL1 OS=Homo sapiens OX=9606 GN=ABL1 PE=1 SV=4 1777 1755 sp|Q9NYU1|UGGG2_HUMAN 47.83 2 1 0 1 1 0 9.19E+06 1.72E+07 1.73E+07 3 1 3 0 1 1 1 174734 UDP-glucose:glycoprotein glucosyltransferase 2 OS=Homo sapiens OX=9606 GN=UGGT2 PE=1 SV=4 2834 979 sp|P42285|MTREX_HUMAN 47.74 3 0 1 1 0 0 3.72E+07 1.89E+06 3 2 1 1 1 0 0 117805 Exosome RNA helicase MTR4 OS=Homo sapiens OX=9606 GN=MTREX PE=1 SV=3 3451 1937 sp|Q16637|SMN_HUMAN 47.72 3 0 3 3 0 0 3.63E+06 2.58E+06 1 1 0 1 1 0 0 31849 Survival motor neuron protein OS=Homo sapiens OX=9606 GN=SMN1 PE=1 SV=1 4359 2431 sp|O15143|ARC1B_HUMAN 47.59 3 0 0 0 0 3 9.19E+05 1 1 0 0 0 0 1 40950 Actin-related protein 2/3 complex subunit 1B OS=Homo sapiens OX=9606 GN=ARPC1B PE=1 SV=3 1918 981 sp|Q96JC1|VPS39_HUMAN 47.58 3 0 1 1 2 1 8.93E+05 4 1 0 2 1 1 2 101809 Vam6/Vps39-like protein OS=Homo sapiens OX=9606 GN=VPS39 PE=1 SV=2 798 2162 sp|Q9Y4A5|TRRAP_HUMAN 47.57 1 0 1 0 0 0 3.98E+06 5 1 0 4 3 2 2 437603 Transformation/transcription domain-associated protein OS=Homo sapiens OX=9606 GN=TRRAP PE=1 SV=3 4315 1955 sp|Q6IQ16|SPOPL_HUMAN 47.44 4 0 0 0 0 4 1.21E+06 1 1 0 0 0 0 1 44647 Speckle-type POZ protein-like OS=Homo sapiens OX=9606 GN=SPOPL PE=1 SV=1 3164 1574 sp|Q9UNS2|CSN3_HUMAN 47.35 4 0 0 4 3 0 5.24E+05 7.53E+05 2 1 0 0 2 1 0 47873 COP9 signalosome complex subunit 3 OS=Homo sapiens OX=9606 GN=COPS3 PE=1 SV=3 1264 932 sp|Q8IUF8|RIOX2_HUMAN 47.32 5 2 4 1 1 0 3.65E+05 3 1 2 3 2 1 0 52800 Ribosomal oxygenase 2 OS=Homo sapiens OX=9606 GN=RIOX2 PE=1 SV=1 3624 1950 sp|Q96EV2|RBM33_HUMAN 47.2 1 1 0 0 0 0 9.73E+05 2 1 1 0 0 0 1 129986 RNA-binding protein 33 OS=Homo sapiens OX=9606 GN=RBM33 PE=1 SV=3 2917 1160 sp|Q9H1I8|ASCC2_HUMAN 47.02 2 1 1 0 1 0 0.00E+00 6.00E+05 1.31E+06 2 2 1 1 0 1 0 86360 Activating signal cointegrator 1 complex subunit 2 OS=Homo sapiens OX=9606 GN=ASCC2 PE=1 SV=3 3077 1315 sp|Q9NR56|MBNL1_HUMAN 46.98 5 0 0 3 2 3 2.35E+06 1.41E+07 2 1 0 0 1 1 1 41817 Muscleblind-like protein 1 OS=Homo sapiens OX=9606 GN=MBNL1 PE=1 SV=2 1388 3280 sp|Q9BTC0|DIDO1_HUMAN 46.89 2 0 0 0 0 1 1.89E+06 5 1 1 2 1 0 3 243870 Death-inducer obliterator 1 OS=Homo sapiens OX=9606 GN=DIDO1 PE=1 SV=5 1574 5913 sp|Q96QE3|ATAD5_HUMAN 46.84 1 0 0 0 0 1 2.04E+06 5 1 1 1 1 1 3 207569 ATPase family AAA domain-containing protein 5 OS=Homo sapiens OX=9606 GN=ATAD5 PE=1 SV=4 2671 1578 sp|Q6I9Y2|THOC7_HUMAN 46.83 7 2 5 0 5 5 3.29E+06 2.07E+06 1.29E+06 2 1 1 1 0 1 1 23743 THO complex subunit 7 homolog OS=Homo sapiens OX=9606 GN=THOC7 PE=1 SV=3 1919 1005 sp|Q14807|KIF22_HUMAN 46.82 4 1 3 0 0 0 5.96E+05 3 1 4 2 0 0 0 73262 Kinesin-like protein KIF22 OS=Homo sapiens OX=9606 GN=KIF22 PE=1 SV=5 1819 1119 sp|P69849|NOMO3_HUMAN 46.74 2 1 0 0 0 1 4.02E+06 1.28E+07 4 2 2 1 1 0 2 134133 Nodal modulator 3 OS=Homo sapiens OX=9606 GN=NOMO3 PE=3 SV=2 1819 1120 sp|Q15155|NOMO1_HUMAN 46.74 2 1 0 0 0 1 4.02E+06 1.28E+07 4 2 2 1 1 0 2 134324 Nodal modulator 1 OS=Homo sapiens OX=9606 GN=NOMO1 PE=1 SV=5 1819 1128 sp|Q5JPE7|NOMO2_HUMAN 46.74 2 1 0 0 0 1 4.02E+06 1.28E+07 4 2 2 1 1 0 2 139439 Nodal modulator 2 OS=Homo sapiens OX=9606 GN=NOMO2 PE=1 SV=1 2460 923 sp|Q9Y4W6|AFG32_HUMAN 46.58 3 1 2 1 0 0 1.12E+06 3 1 1 2 1 0 0 88584 AFG3-like protein 2 OS=Homo sapiens OX=9606 GN=AFG3L2 PE=1 SV=2 4313 1832 sp|P61289|PSME3_HUMAN 46.38 6 0 0 0 6 0 2.21E+06 1 1 0 0 0 1 0 29506 Proteasome activator complex subunit 3 OS=Homo sapiens OX=9606 GN=PSME3 PE=1 SV=1 2374 1416 sp|Q7L576|CYFP1_HUMAN 46.2 1 0 0 0 0 0 3.55E+06 3 1 1 0 0 2 1 145182 Cytoplasmic FMR1-interacting protein 1 OS=Homo sapiens OX=9606 GN=CYFIP1 PE=1 SV=1 4360 2432 sp|Q15185|TEBP_HUMAN 46.06 8 0 0 8 0 0 9.41E+05 1 1 0 0 1 0 0 18697 Prostaglandin E synthase 3 OS=Homo sapiens OX=9606 GN=PTGES3 PE=1 SV=1 Voltage-dependent calcium channel subunit alpha-2/delta-3 OS=Homo sapiens OX=9606 GN=CACNA2D3 PE=1 1432 1418 sp|Q8IZS8|CA2D3_HUMAN 46.01 1 0 1 0 1 0 5.61E+06 9.39E+06 3 1 0 4 0 3 1 123011 SV=1 935 1324 sp|P18077|RL35A_HUMAN 45.96 16 7 16 7 7 7 1.18E+07 2.41E+07 3.40E+07 2.09E+07 2.50E+07 2 2 2 3 3 1 2 12538 60S ribosomal protein L35a OS=Homo sapiens OX=9606 GN=RPL35A PE=1 SV=2 3737 1316 sp|Q9NVN8|GNL3L_HUMAN 45.91 7 0 0 3 3 0 6.85E+05 7.16E+05 2 2 0 0 1 1 0 65573 Guanine nucleotide-binding protein-like 3-like protein OS=Homo sapiens OX=9606 GN=GNL3L PE=1 SV=1 3159 1338 sp|Q9Y265|RUVB1_HUMAN 45.88 6 2 4 4 0 0 2.18E+06 6.38E+05 9.98E+05 2 2 1 1 1 0 0 50228 RuvB-like 1 OS=Homo sapiens OX=9606 GN=RUVBL1 PE=1 SV=1 3602 1139 sp|Q9H6F5|CCD86_HUMAN 45.84 9 0 0 2 6 0 2.20E+06 2.21E+06 2 2 0 0 1 1 0 40236 Coiled-coil domain-containing protein 86 OS=Homo sapiens OX=9606 GN=CCDC86 PE=1 SV=1 1797 1449 sp|Q69YN4|VIR_HUMAN 45.83 1 0 0 1 0 0 3.33E+05 2 1 1 1 2 0 1 202023 Protein virilizer homolog OS=Homo sapiens OX=9606 GN=VIRMA PE=1 SV=2 3516 1362 sp|Q8N5C6|SRBD1_HUMAN 45.68 2 1 0 1 0 0 1.46E+06 2 1 1 0 1 0 0 111776 S1 RNA-binding domain-containing protein 1 OS=Homo sapiens OX=9606 GN=SRBD1 PE=1 SV=2 3599 961 sp|Q8N9N2|ASCC1_HUMAN 45.58 4 2 2 0 0 0 5.29E+05 3.34E+06 2 2 1 1 0 0 0 45510 Activating signal cointegrator 1 complex subunit 1 OS=Homo sapiens OX=9606 GN=ASCC1 PE=1 SV=1 RNA-binding motif protein Y chromosome family 1 member E OS=Homo sapiens OX=9606 GN=RBMY1E PE=1 1246 852 sp|A6NEQ0|RBY1E_HUMAN 45.57 4 3 2 1 1 1 1.28E+07 3 1 2 3 2 1 1 55759 SV=1 RNA-binding motif protein Y chromosome family 1 member A1 OS=Homo sapiens OX=9606 GN=RBMY1A1 1246 853 sp|P0DJD3|RBY1A_HUMAN 45.57 4 3 2 1 1 1 1.28E+07 3 1 2 3 2 1 1 55784 PE=1 SV=1 RNA-binding motif protein Y chromosome family 1 member D OS=Homo sapiens OX=9606 GN=RBMY1D PE=2 1246 854 sp|P0C7P1|RBY1D_HUMAN 45.57 4 3 2 1 1 1 1.28E+07 3 1 2 3 2 1 1 55775 SV=1 RNA-binding motif protein Y chromosome family 1 member C OS=Homo sapiens OX=9606 GN=RBMY1C PE=1 1246 855 sp|P0DJD4|RBY1C_HUMAN 45.57 4 3 2 1 1 1 1.28E+07 3 1 2 3 2 1 1 55784 SV=1 RNA-binding motif protein Y chromosome family 1 member B OS=Homo sapiens OX=9606 GN=RBMY1B PE=2 1246 856 sp|A6NDE4|RBY1B_HUMAN 45.57 4 3 2 1 1 1 1.28E+07 3 1 2 3 2 1 1 55835 SV=2 RNA-binding motif protein Y chromosome family 1 member F/J OS=Homo sapiens OX=9606 GN=RBMY1F PE=1 1246 857 sp|Q15415|RBY1F_HUMAN 45.57 4 3 2 1 1 1 1.28E+07 3 1 2 3 2 1 1 55728 SV=2 2914 883 sp|Q9NY12|GAR1_HUMAN 45.4 6 0 3 3 3 0 3.69E+06 2 1 0 1 1 1 0 22348 H/ACA ribonucleoprotein complex subunit 1 OS=Homo sapiens OX=9606 GN=GAR1 PE=1 SV=1 3600 1042 sp|Q9UHX1|PUF60_HUMAN 45.4 5 1 0 0 4 0 2.78E+06 2 1 1 0 0 1 0 59876 Poly(U)-binding-splicing factor PUF60 OS=Homo sapiens OX=9606 GN=PUF60 PE=1 SV=1 4361 2433 sp|Q9NQT5|EXOS3_HUMAN 45.3 5 0 0 0 5 0 0.00E+00 1 1 0 0 0 1 0 29572 Exosome complex component RRP40 OS=Homo sapiens OX=9606 GN=EXOSC3 PE=1 SV=3 Phosphatidylinositol 4 5-bisphosphate 3-kinase catalytic subunit delta isoform OS=Homo sapiens OX=9606 748 1428 sp|O00329|PK3CD_HUMAN 45.29 3 1 1 0 0 1 3.77E+06 5 1 1 3 3 4 2 119479 GN=PIK3CD PE=1 SV=2 2603 1712 sp|A0A0C4DH31|HV118_HUM 45.18 11 7 0 0 0 4 4.59E+07 3 2 3 0 0 0 1 12820 Immunoglobulin heavy variable 1-18 OS=Homo sapiens OX=9606 GN=IGHV1-18 PE=3 SV=1 3072 896 sp|Q9H089|LSG1_HUMAN 45.17 3 1 2 0 1 0 5.47E+06 3 1 1 1 0 1 0 75225 Large subunit GTPase 1 homolog OS=Homo sapiens OX=9606 GN=LSG1 PE=1 SV=2 1529 1347 sp|Q5T1M5|FKB15_HUMAN 44.87 2 0 0 0 1 1 2.97E+06 1.27E+05 3 1 1 0 0 3 2 133630 FK506-binding protein 15 OS=Homo sapiens OX=9606 GN=FKBP15 PE=1 SV=2 Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 1 OS=Homo sapiens OX=9606 GN=RPN1 2318 1044 sp|P04843|RPN1_HUMAN 44.79 2 1 1 1 0 1 4.39E+05 2 1 1 1 1 0 1 68569 PE=1 SV=1 1571 2468 sp|Q8TBY9|CF251_HUMAN 44.73 1 1 0 0 0 0 7.64E+05 3 1 1 1 2 1 1 129952 Cilia- and flagella-associated protein 251 OS=Homo sapiens OX=9606 GN=WDR66 PE=1 SV=2 2031 7447 sp|P25391|LAMA1_HUMAN 44.73 1 0 0 0 0 0 3.51E+07 5 1 1 0 1 1 2 337084 Laminin subunit alpha-1 OS=Homo sapiens OX=9606 GN=LAMA1 PE=1 SV=2 2142 7627 sp|Q14997|PSME4_HUMAN 44.72 1 0 1 0 0 0 3.22E+06 4 1 1 2 0 1 1 211332 Proteasome activator complex subunit 4 OS=Homo sapiens OX=9606 GN=PSME4 PE=1 SV=2 3356 1190 sp|Q8NE71|ABCF1_HUMAN 44.68 2 0 2 0 0 1 1.13E+06 2 1 0 1 0 0 1 95926 ATP-binding cassette sub-family F member 1 OS=Homo sapiens OX=9606 GN=ABCF1 PE=1 SV=2 3179 2434 sp|Q99497|PARK7_HUMAN 44.62 8 0 0 8 8 0 5.95E+06 1.47E+07 1 1 0 0 2 1 0 19891 Parkinson disease protein 7 OS=Homo sapiens OX=9606 GN=PARK7 PE=1 SV=2 3955 1477 sp|P21796|VDAC1_HUMAN 44.62 4 0 0 4 0 0 1.72E+06 1 1 0 0 1 0 0 30773 Voltage-dependent anion-selective channel protein 1 OS=Homo sapiens OX=9606 GN=VDAC1 PE=1 SV=2 3240 867 sp|Q9Y623|MYH4_HUMAN 44.53 1 0 0 0 0 0 1.89E+06 2 1 1 1 0 0 0 223069 Myosin-4 OS=Homo sapiens OX=9606 GN=MYH4 PE=2 SV=2 3240 868 sp|Q9UKX2|MYH2_HUMAN 44.53 1 0 0 0 0 0 1.89E+06 2 1 1 1 0 0 0 223042 Myosin-2 OS=Homo sapiens OX=9606 GN=MYH2 PE=1 SV=1 2470 1866 sp|Q6R327|RICTR_HUMAN 44.48 2 0 0 1 0 0 1.15E+07 3 1 1 0 2 0 1 192216 Rapamycin-insensitive companion of mTOR OS=Homo sapiens OX=9606 GN=RICTOR PE=1 SV=1 3082 1489 sp|P02458|CO2A1_HUMAN 44.39 1 0 1 0 1 0 1.38E+08 2.11E+08 1 1 0 1 0 1 0 141786 Collagen alpha-1(II) chain OS=Homo sapiens OX=9606 GN=COL2A1 PE=1 SV=3 2933 2265 sp|Q9NSY1|BMP2K_HUMAN 44.25 1 1 0 0 1 1 1.31E+06 4.51E+06 1.39E+06 1 1 1 0 0 1 1 129171 BMP-2-inducible protein kinase OS=Homo sapiens OX=9606 GN=BMP2K PE=1 SV=2 3269 1046 sp|Q8ND56|LS14A_HUMAN 44.18 3 0 2 0 1 0 6.00E+05 2 1 0 1 0 1 0 50530 Protein LSM14 homolog A OS=Homo sapiens OX=9606 GN=LSM14A PE=1 SV=3 4317 2073 sp|Q9BY43|CHM4A_HUMAN 44.14 6 0 0 0 0 6 3.18E+06 1 1 0 0 0 0 1 25098 Charged multivesicular body protein 4a OS=Homo sapiens OX=9606 GN=CHMP4A PE=1 SV=3 3628 2118 sp|P61956|SUMO2_HUMAN 44.12 13 0 0 13 13 0 4.61E+06 5.39E+06 1 1 0 0 1 1 0 10871 Small ubiquitin-related modifier 2 OS=Homo sapiens OX=9606 GN=SUMO2 PE=1 SV=3 3628 2435 sp|Q6EEV6|SUMO4_HUMAN 44.12 13 0 0 13 13 0 4.61E+06 5.39E+06 1 1 0 0 1 1 0 10685 Small ubiquitin-related modifier 4 OS=Homo sapiens OX=9606 GN=SUMO4 PE=1 SV=2 3628 2436 sp|P55854|SUMO3_HUMAN 44.12 12 0 0 12 12 0 4.61E+06 5.39E+06 1 1 0 0 1 1 0 11637 Small ubiquitin-related modifier 3 OS=Homo sapiens OX=9606 GN=SUMO3 PE=1 SV=2 1511 1744 sp|Q96JM4|LRIQ1_HUMAN 43.74 1 1 0 0 1 0 1.89E+07 3 1 2 1 1 3 0 199299 Leucine-rich repeat and IQ domain-containing protein 1 OS=Homo sapiens OX=9606 GN=LRRIQ1 PE=2 SV=3 2997 1409 sp|Q9NXC5|MIO_HUMAN 43.73 1 0 1 1 1 0 9.19E+05 2 1 0 1 1 1 0 98584 GATOR complex protein MIOS OS=Homo sapiens OX=9606 GN=MIOS PE=1 SV=2 1982 2439 sp|Q9NP79|VTA1_HUMAN 43.68 5 0 5 5 5 5 1.04E+06 1.08E+06 2.09E+06 4.99E+05 1 1 0 1 2 2 1 33879 Vacuolar protein sorting-associated protein VTA1 homolog OS=Homo sapiens OX=9606 GN=VTA1 PE=1 SV=1 4363 2444 sp|P05109|S10A8_HUMAN 43.61 12 12 0 0 0 0 2.84E+06 1 1 1 0 0 0 0 10835 Protein S100-A8 OS=Homo sapiens OX=9606 GN=S100A8 PE=1 SV=1 3098 2132 sp|Q01658|NC2B_HUMAN 43.44 8 0 8 8 0 8 1.06E+06 1.69E+06 1.49E+06 1 1 0 1 1 0 1 19444 Protein Dr1 OS=Homo sapiens OX=9606 GN=DR1 PE=1 SV=1 2609 2077 sp|P55769|NH2L1_HUMAN 43.39 9 0 9 9 9 9 5.42E+06 5.47E+06 5.34E+06 5.07E+06 1 1 0 1 1 1 1 14174 NHP2-like protein 1 OS=Homo sapiens OX=9606 GN=SNU13 PE=1 SV=3 3755 2438 sp|P08621|RU17_HUMAN 43.36 3 0 0 0 3 3 2.43E+06 0.00E+00 1 1 0 0 0 1 1 51557 U1 small nuclear ribonucleoprotein 70 kDa OS=Homo sapiens OX=9606 GN=SNRNP70 PE=1 SV=2 1925 1231 sp|P27986|P85A_HUMAN 43.33 3 0 1 1 1 3 5.06E+06 3 1 0 1 1 1 3 83598 Phosphatidylinositol 3-kinase regulatory subunit alpha OS=Homo sapiens OX=9606 GN=PIK3R1 PE=1 SV=2 2613 2192 sp|Q6DD87|ZN787_HUMAN 43.07 3 0 3 3 3 3 2.27E+06 2.95E+06 2.90E+06 2.56E+06 1 1 0 1 1 1 1 40428 Zinc finger protein 787 OS=Homo sapiens OX=9606 GN=ZNF787 PE=1 SV=4 2123 1971 sp|Q9BZA8|PC11Y_HUMAN 43.02 1 0 0 1 0 1 3.68E+06 3 1 0 1 2 0 2 146774 Protocadherin-11 Y-linked OS=Homo sapiens OX=9606 GN=PCDH11Y PE=1 SV=1 2123 1984 sp|Q9BZA7|PC11X_HUMAN 43.02 1 0 0 1 0 1 3.68E+06 3 1 0 1 2 0 2 147558 Protocadherin-11 X-linked OS=Homo sapiens OX=9606 GN=PCDH11X PE=2 SV=1 3520 1607 sp|Q9HB71|CYBP_HUMAN 42.98 6 0 6 6 0 0 8.36E+05 1.10E+06 1 1 0 1 1 0 0 26210 Calcyclin-binding protein OS=Homo sapiens OX=9606 GN=CACYBP PE=1 SV=2 778 1888 sp|Q8IZT6|ASPM_HUMAN 42.55 1 1 0 0 0 0 1.54E+06 3 1 5 1 2 1 1 409801 Abnormal spindle-like microcephaly-associated protein OS=Homo sapiens OX=9606 GN=ASPM PE=1 SV=2 4087 1678 sp|Q15633|TRBP2_HUMAN 42.28 3 0 0 0 0 3 2.33E+06 1 1 0 0 0 0 1 39039 RISC-loading complex subunit TARBP2 OS=Homo sapiens OX=9606 GN=TARBP2 PE=1 SV=3 3759 2457 sp|Q8IZQ5|SELH_HUMAN 42 8 8 8 0 0 0 2.15E+06 1.46E+06 1 1 1 1 0 0 0 13453 Selenoprotein H OS=Homo sapiens OX=9606 GN=SELENOH PE=1 SV=2 1914 933 sp|B3EWF7|EP2A2_HUMAN 41.94 6 1 3 1 3 3 1.21E+07 6.39E+06 6.27E+06 3 1 1 1 1 2 1 35169 Laforin isoform 9 OS=Homo sapiens OX=9606 GN=EPM2A PE=1 SV=1 3084 1516 sp|P16435|NCPR_HUMAN 41.93 2 0 0 1 1 0 1.55E+07 2 1 0 0 2 1 0 76690 NADPH--cytochrome P450 reductase OS=Homo sapiens OX=9606 GN=POR PE=1 SV=2 3180 2461 sp|P82930|RT34_HUMAN 41.82 4 4 0 4 4 0 1.36E+06 1.69E+06 2.13E+06 1 1 1 0 1 1 0 25650 28S ribosomal protein S34 mitochondrial OS=Homo sapiens OX=9606 GN=MRPS34 PE=1 SV=2 4195 2037 sp|P53007|TXTP_HUMAN 41.72 4 0 0 0 4 0 7.98E+06 1 1 0 0 0 1 0 34013 Tricarboxylate transport protein mitochondrial OS=Homo sapiens OX=9606 GN=SLC25A1 PE=1 SV=2 2033 1124 sp|P52209|6PGD_HUMAN 41.67 3 2 0 1 3 0 5.56E+05 2.47E+06 2 1 1 0 2 2 0 53140 6-phosphogluconate dehydrogenase decarboxylating OS=Homo sapiens OX=9606 GN=PGD PE=1 SV=3 1052 1474 sp|Q12802|AKP13_HUMAN 41.56 0 0 0 0 0 0 3.77E+08 3.57E+08 3.82E+08 3.83E+08 3.64E+08 3 2 4 1 2 2 1 307550 A-kinase anchor protein 13 OS=Homo sapiens OX=9606 GN=AKAP13 PE=1 SV=2 1340 2737 sp|Q8N2C7|UNC80_HUMAN 41.37 1 0 0 0 0 0 1.07E+06 2.82E+06 3.12E+06 4 1 1 0 2 2 3 363391 Protein unc-80 homolog OS=Homo sapiens OX=9606 GN=UNC80 PE=1 SV=2 2284 2443 sp|P62304|RUXE_HUMAN 41.36 12 0 0 12 12 12 1.89E+06 2.56E+06 2.30E+05 1 1 0 0 2 2 1 10804 Small nuclear ribonucleoprotein E OS=Homo sapiens OX=9606 GN=SNRPE PE=1 SV=1 3995 1945 sp|Q86TX2|ACOT1_HUMAN 41.16 3 0 0 0 3 0 2.29E+06 1 1 0 0 0 1 0 46277 Acyl-coenzyme A thioesterase 1 OS=Homo sapiens OX=9606 GN=ACOT1 PE=1 SV=1 3995 2445 sp|P49753|ACOT2_HUMAN 41.16 2 0 0 0 2 0 2.29E+06 1 1 0 0 0 1 0 53219 Acyl-coenzyme A thioesterase 2 mitochondrial OS=Homo sapiens OX=9606 GN=ACOT2 PE=1 SV=6 1458 2124 sp|Q96KQ4|ASPP1_HUMAN 41.1 2 0 0 1 0 0 1.40E+06 3 1 5 1 1 1 0 119565 Apoptosis-stimulating of p53 protein 1 OS=Homo sapiens OX=9606 GN=PPP1R13B PE=1 SV=3 2461 1010 sp|Q13435|SF3B2_HUMAN 41.09 4 1 1 1 0 2 1.62E+06 3 1 1 1 1 0 1 100228 Splicing factor 3B subunit 2 OS=Homo sapiens OX=9606 GN=SF3B2 PE=1 SV=2 Pleckstrin homology domain-containing family A member 5 OS=Homo sapiens OX=9606 GN=PLEKHA5 PE=1 3612 1475 sp|Q9HAU0|PKHA5_HUMAN 41.05 1 0 0 0 0 1 1.72E+06 2 1 0 0 1 0 1 127464 SV=1 3739 1484 sp|P09936|UCHL1_HUMAN 41.04 8 0 2 6 0 0 1.79E+06 2 1 0 1 1 0 0 24824 Ubiquitin carboxyl-terminal hydrolase isozyme L1 OS=Homo sapiens OX=9606 GN=UCHL1 PE=1 SV=2 3000 1460 sp|O00257|CBX4_HUMAN 40.92 4 2 0 0 0 2 7.57E+06 3 1 2 0 0 0 1 61368 E3 SUMO-protein ligase CBX4 OS=Homo sapiens OX=9606 GN=CBX4 PE=1 SV=3 4367 2459 sp|Q9Y2Q9|RT28_HUMAN 40.9 5 5 0 0 0 0 2.05E+06 1 1 1 0 0 0 0 20843 28S ribosomal protein S28 mitochondrial OS=Homo sapiens OX=9606 GN=MRPS28 PE=1 SV=1 2267 1154 sp|O43242|PSMD3_HUMAN 40.8 5 3 2 0 1 0 5.10E+05 4 1 2 2 0 1 0 60978 26S proteasome non-ATPase regulatory subunit 3 OS=Homo sapiens OX=9606 GN=PSMD3 PE=1 SV=2 3513 1117 sp|Q13769|THOC5_HUMAN 40.31 2 0 1 0 1 0 0.00E+00 2 1 0 1 0 1 0 78508 THO complex subunit 5 homolog OS=Homo sapiens OX=9606 GN=THOC5 PE=1 SV=2 2882 968 sp|Q86UE4|LYRIC_HUMAN 40.26 8 4 1 3 0 0 1.97E+06 9.39E+05 3 2 1 1 1 0 0 63837 Protein LYRIC OS=Homo sapiens OX=9606 GN=MTDH PE=1 SV=2 2520 1354 sp|Q9UBC2|EP15R_HUMAN 40.24 1 0 1 1 0 0 4.30E+05 1.12E+06 1 1 0 1 1 0 0 94255 Epidermal growth factor receptor substrate 15-like 1 OS=Homo sapiens OX=9606 GN=EPS15L1 PE=1 SV=1 844 1898 sp|Q8WXE9|STON2_HUMAN 40.23 1 1 1 1 1 1 1.76E+07 1.64E+07 2.64E+07 8.65E+07 9.55E+06 1 1 2 2 3 4 2 101165 Stonin-2 OS=Homo sapiens OX=9606 GN=STON2 PE=1 SV=1 1971 1610 sp|Q9H000|MKRN2_HUMAN 40.16 3 1 3 1 1 1 3.66E+06 2 1 1 2 1 1 1 46940 Probable E3 ubiquitin-protein ligase makorin-2 OS=Homo sapiens OX=9606 GN=MKRN2 PE=1 SV=2 4196 2199 sp|A2NJV5|KV229_HUMAN 40.09 6 6 0 0 0 0 4.38E+06 1 1 1 0 0 0 0 13085 Immunoglobulin kappa variable 2-29 OS=Homo sapiens OX=9606 GN=IGKV2-29 PE=3 SV=2 4196 2200 sp|A0A075B6S2|KVD29_HUM 40.09 6 6 0 0 0 0 4.38E+06 1 1 1 0 0 0 0 13143 Immunoglobulin kappa variable 2D-29 OS=Homo sapiens OX=9606 GN=IGKV2D-29 PE=3 SV=1 Probable non-functional immunoglobulin kappa variable 2D-24 OS=Homo sapiens OX=9606 GN=IGKV2D-24 PE=5 4196 2495 sp|A0A075B6R9|KVD24_HUM 40.09 6 6 0 0 0 0 4.38E+06 1 1 1 0 0 0 0 13079 SV=1 4196 2496 sp|A0A0C4DH68|KV224_HUM 40.09 6 6 0 0 0 0 4.38E+06 1 1 1 0 0 0 0 13079 Immunoglobulin kappa variable 2-24 OS=Homo sapiens OX=9606 GN=IGKV2-24 PE=3 SV=1 4196 2497 sp|A0A0A0MRZ7|KVD26_HU 40.09 6 6 0 0 0 0 4.38E+06 1 1 1 0 0 0 0 13297 Immunoglobulin kappa variable 2D-26 OS=Homo sapiens OX=9606 GN=IGKV2D-26 PE=3 SV=1 2278 2116 sp|Q03989|ARI5A_HUMAN 39.74 2 2 1 0 0 1 3.63E+06 2 1 3 1 0 0 1 64074 AT-rich interactive domain-containing protein 5A OS=Homo sapiens OX=9606 GN=ARID5A PE=1 SV=2 1354 2867 sp|Q13115|DUS4_HUMAN 39.65 2 2 2 2 2 2 1.52E+06 3.52E+07 2.06E+07 2.16E+07 2.08E+07 2 1 1 4 1 1 1 42953 Dual specificity protein phosphatase 4 OS=Homo sapiens OX=9606 GN=DUSP4 PE=1 SV=1 2515 1217 sp|Q8N697|S15A4_HUMAN 39.63 3 0 0 1 0 2 0.00E+00 3 1 0 0 1 0 2 62034 Solute carrier family 15 member 4 OS=Homo sapiens OX=9606 GN=SLC15A4 PE=1 SV=1 2096 2201 sp|Q9UPV0|CE164_HUMAN 39.51 1 0 0 1 0 0 3.91E+06 3 1 0 0 3 1 1 164313 Centrosomal protein of 164 kDa OS=Homo sapiens OX=9606 GN=CEP164 PE=1 SV=3 1430 1243 sp|P51800|CLCKA_HUMAN 39.43 3 0 2 1 1 2 7.77E+06 6.95E+06 3 1 0 3 1 2 2 75285 Chloride channel protein ClC-Ka OS=Homo sapiens OX=9606 GN=CLCNKA PE=1 SV=1 3757 2452 sp|O43791|SPOP_HUMAN 39.32 3 0 0 3 3 0 2.52E+06 2.41E+06 1 1 0 0 1 1 0 42132 Speckle-type POZ protein OS=Homo sapiens OX=9606 GN=SPOP PE=1 SV=1 4364 2453 sp|P50991|TCPD_HUMAN 39.32 3 0 0 0 3 0 1.45E+06 1 1 0 0 0 1 0 57924 T-complex protein 1 subunit delta OS=Homo sapiens OX=9606 GN=CCT4 PE=1 SV=4 4365 2455 sp|P11279|LAMP1_HUMAN 39.29 3 0 0 3 0 0 1.79E+06 1 1 0 0 1 0 0 44882 Lysosome-associated membrane glycoprotein 1 OS=Homo sapiens OX=9606 GN=LAMP1 PE=1 SV=3 3758 2454 sp|P49458|SRP09_HUMAN 39.29 13 0 0 13 13 0 5.84E+06 1.21E+07 1 1 0 0 1 1 0 10112 Signal recognition particle 9 kDa protein OS=Homo sapiens OX=9606 GN=SRP9 PE=1 SV=2 1153 3137 sp|Q5VW36|FOCAD_HUMAN 39.14 1 0 1 1 0 1 1.78E+06 6.38E+06 0.00E+00 8.17E+06 5.80E+06 3 1 1 3 3 1 2 200071 Focadhesin OS=Homo sapiens OX=9606 GN=FOCAD PE=1 SV=1 3019 2576 sp|Q8IZY2|ABCA7_HUMAN 39.14 1 0 0 0 0 0 5.49E+07 5.55E+07 2 1 0 1 1 0 1 234347 Phospholipid-transporting ATPase ABCA7 OS=Homo sapiens OX=9606 GN=ABCA7 PE=1 SV=3 4194 2022 sp|O00308|WWP2_HUMAN 39.1 2 0 0 0 2 0 0.00E+00 1 1 0 0 0 1 0 98912 NEDD4-like E3 ubiquitin-protein ligase WWP2 OS=Homo sapiens OX=9606 GN=WWP2 PE=1 SV=2 2229 1995 sp|Q5ST30|SYVM_HUMAN 38.86 2 0 0 1 0 1 6.27E+05 3 1 0 0 2 1 2 118490 Valine--tRNA ligase mitochondrial OS=Homo sapiens OX=9606 GN=VARS2 PE=1 SV=2 2836 1384 sp|P22455|FGFR4_HUMAN 38.84 2 2 0 0 0 1 6.72E+06 2 1 2 0 0 0 1 87954 Fibroblast growth factor receptor 4 OS=Homo sapiens OX=9606 GN=FGFR4 PE=1 SV=2 1967 899 sp|Q86UK7|ZN598_HUMAN 38.65 3 0 1 2 0 1 2.18E+07 3 2 0 2 2 0 1 98637 E3 ubiquitin-protein ligase ZNF598 OS=Homo sapiens OX=9606 GN=ZNF598 PE=1 SV=1 2469 1605 sp|Q9NZB8|MOCS1_HUMAN 38.6 3 1 0 1 1 0 0.00E+00 3 1 1 0 2 1 0 70105 Molybdenum cofactor biosynthesis protein 1 OS=Homo sapiens OX=9606 GN=MOCS1 PE=1 SV=3 3397 1379 sp|O95461|LARG1_HUMAN 38.58 3 1 0 0 3 0 3.01E+05 2 1 1 0 0 1 0 88066 LARGE xylosyl- and glucuronyltransferase 1 OS=Homo sapiens OX=9606 GN=LARGE1 PE=1 SV=1 2837 1482 sp|Q2M1P5|KIF7_HUMAN 38.49 1 0 1 1 0 0 2.72E+06 5.10E+06 2 1 1 1 1 0 0 150587 Kinesin-like protein KIF7 OS=Homo sapiens OX=9606 GN=KIF7 PE=1 SV=2 4366 2458 sp|P28072|PSB6_HUMAN 38.44 5 0 0 0 5 0 1.02E+06 1 1 0 0 0 1 0 25358 Proteasome subunit beta type-6 OS=Homo sapiens OX=9606 GN=PSMB6 PE=1 SV=4 1663 1343 sp|Q8TD06|AGR3_HUMAN 38.07 10 3 3 0 10 10 3.12E+05 4.65E+05 2 1 2 1 0 2 2 19171 Anterior gradient protein 3 OS=Homo sapiens OX=9606 GN=AGR3 PE=1 SV=1 3092 1942 sp|A0A0B4J2H0|HV69D_HUM 38.07 11 7 0 0 0 4 1.19E+07 3 2 2 0 0 0 1 12660 Immunoglobulin heavy variable 1-69D OS=Homo sapiens OX=9606 GN=IGHV1-69D PE=1 SV=1 S phase cyclin A-associated protein in the endoplasmic reticulum OS=Homo sapiens OX=9606 GN=SCAPER PE=1 3399 1470 sp|Q9BY12|SCAPE_HUMAN 38.05 2 0 1 0 0 0 5.44E+05 2 1 1 1 0 0 0 158287 SV=2 4322 2342 sp|P49406|RM19_HUMAN 37.87 3 3 0 0 0 0 1.41E+06 1 1 1 0 0 0 0 33535 39S ribosomal protein L19 mitochondrial OS=Homo sapiens OX=9606 GN=MRPL19 PE=1 SV=2 623 4703 sp|Q8IYD8|FANCM_HUMAN 37.82 1 0 1 0 0 1 6.19E+06 7.20E+06 3 1 2 4 3 3 4 232190 Fanconi anemia group M protein OS=Homo sapiens OX=9606 GN=FANCM PE=1 SV=2 Dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex mitochondrial 1795 1031 sp|P36957|ODO2_HUMAN 37.67 3 1 2 2 2 0 8.64E+05 7.66E+05 1.02E+06 2 1 1 1 1 1 0 48755 OS=Homo sapiens OX=9606 GN=DLST PE=1 SV=4 3760 2469 sp|P48730|KC1D_HUMAN 37.61 3 0 0 3 0 3 2.85E+06 1.11E+06 1 1 0 0 1 0 1 47330 Casein kinase I isoform delta OS=Homo sapiens OX=9606 GN=CSNK1D PE=1 SV=2 4319 2214 sp|Q14247|SRC8_HUMAN 37.61 2 2 0 0 0 0 1.94E+06 1 1 1 0 0 0 0 61586 Src substrate cortactin OS=Homo sapiens OX=9606 GN=CTTN PE=1 SV=2 3018 2562 sp|P23378|GCSP_HUMAN 37.59 1 0 1 0 0 0 4.85E+06 2 1 1 1 0 0 0 112730 Glycine dehydrogenase (decarboxylating) mitochondrial OS=Homo sapiens OX=9606 GN=GLDC PE=1 SV=2 3191 3073 sp|Q9NWZ5|UCKL1_HUMAN 37.51 2 1 0 0 1 0 1.31E+06 2 1 2 0 0 1 0 61141 Uridine-cytidine kinase-like 1 OS=Homo sapiens OX=9606 GN=UCKL1 PE=1 SV=2 3609 1392 sp|Q8NAT2|TDRD5_HUMAN 37.24 1 0 1 0 0 0 2.07E+06 2 1 0 2 0 0 0 109737 Tudor domain-containing protein 5 OS=Homo sapiens OX=9606 GN=TDRD5 PE=1 SV=3 3889 1518 sp|Q92614|MY18A_HUMAN 37.18 1 0 0 1 0 0 8.85E+05 1 1 0 0 1 0 0 233113 Unconventional myosin-XVIIIa OS=Homo sapiens OX=9606 GN=MYO18A PE=1 SV=3 1657 1145 sp|Q13202|DUS8_HUMAN 37.15 2 0 1 1 2 1 2.84E+07 2 1 0 1 1 3 1 65827 Dual specificity protein phosphatase 8 OS=Homo sapiens OX=9606 GN=DUSP8 PE=1 SV=2 1823 1748 sp|O15550|KDM6A_HUMAN 37.12 1 0 1 0 0 1 2.11E+05 3 1 0 2 1 1 2 154176 Lysine-specific demethylase 6A OS=Homo sapiens OX=9606 GN=KDM6A PE=1 SV=2 2916 1058 sp|P07195|LDHB_HUMAN 36.97 7 2 0 5 0 0 1.23E+06 2 1 1 0 1 0 0 36639 L-lactate dehydrogenase B chain OS=Homo sapiens OX=9606 GN=LDHB PE=1 SV=2 2163 1082 sp|O00541|PESC_HUMAN 36.95 2 0 1 1 2 1 7.17E+05 2 1 0 1 1 2 1 68003 Pescadillo homolog OS=Homo sapiens OX=9606 GN=PES1 PE=1 SV=1 2534 1952 sp|P47755|CAZA2_HUMAN 36.93 3 0 3 3 3 3 3.89E+06 5.51E+06 7.44E+06 4.45E+06 1 1 0 1 1 1 1 32949 F-actin-capping protein subunit alpha-2 OS=Homo sapiens OX=9606 GN=CAPZA2 PE=1 SV=3 2534 1953 sp|P52907|CAZA1_HUMAN 36.93 3 0 3 3 3 3 3.89E+06 5.51E+06 7.44E+06 4.45E+06 1 1 0 1 1 1 1 32923 F-actin-capping protein subunit alpha-1 OS=Homo sapiens OX=9606 GN=CAPZA1 PE=1 SV=3 1665 1726 sp|O60308|CE104_HUMAN 36.78 2 2 1 1 1 1 6.07E+06 2 1 3 1 1 1 1 104448 Centrosomal protein of 104 kDa OS=Homo sapiens OX=9606 GN=CEP104 PE=1 SV=1 Voltage-dependent calcium channel subunit alpha-2/delta-4 OS=Homo sapiens OX=9606 GN=CACNA2D4 PE=1 1858 2333 sp|Q7Z3S7|CA2D4_HUMAN 36.65 1 0 0 0 0 1 1.34E+03 2 1 0 1 1 2 2 127938 SV=2 3097 2107 sp|O00267|SPT5H_HUMAN 36.6 2 1 0 1 0 0 9.14E+05 3 1 1 0 2 0 0 121000 Transcription elongation factor SPT5 OS=Homo sapiens OX=9606 GN=SUPT5H PE=1 SV=1 3761 2472 sp|O00231|PSD11_HUMAN 36.59 3 0 0 3 3 0 7.27E+05 7.98E+05 1 1 0 0 1 1 0 47464 26S proteasome non-ATPase regulatory subunit 11 OS=Homo sapiens OX=9606 GN=PSMD11 PE=1 SV=3 3209 4080 sp|Q8NDI1|EHBP1_HUMAN 36.49 1 0 0 0 0 1 2.81E+06 3 1 1 0 0 0 2 140017 EH domain-binding protein 1 OS=Homo sapiens OX=9606 GN=EHBP1 PE=1 SV=3 1495 2131 sp|Q9P2K8|E2AK4_HUMAN 36.48 2 2 0 0 0 0 1.01E+07 2 1 3 1 1 0 1 186909 eIF-2-alpha kinase GCN2 OS=Homo sapiens OX=9606 GN=EIF2AK4 PE=1 SV=3 3258 1001 sp|Q9BPW8|NIPS1_HUMAN 36.32 5 0 5 0 0 0 2.27E+06 2 1 0 2 0 0 0 33310 Protein NipSnap homolog 1 OS=Homo sapiens OX=9606 GN=NIPSNAP1 PE=1 SV=1 3189 2941 sp|Q9ULW0|TPX2_HUMAN 36.16 2 1 0 0 0 1 4.13E+05 2 1 2 0 0 0 1 85653 Targeting protein for Xklp2 OS=Homo sapiens OX=9606 GN=TPX2 PE=1 SV=2 1248 1573 sp|Q68DE3|USF3_HUMAN 35.99 1 1 0 0 0 0 3.12E+07 3.75E+07 3.65E+07 1.90E+07 4.07E+07 2 1 3 1 1 2 1 241650 Basic helix-loop-helix domain-containing protein USF3 OS=Homo sapiens OX=9606 GN=USF3 PE=1 SV=4 3616 1630 sp|Q9BYG3|MK67I_HUMAN 35.66 8 0 0 0 0 8 8.26E+05 2 1 0 0 0 0 2 34222 MKI67 FHA domain-interacting nucleolar phosphoprotein OS=Homo sapiens OX=9606 GN=NIFK PE=1 SV=1 1267 1146 sp|O95208|EPN2_HUMAN 35.65 3 3 3 1 2 3 1.49E+06 5.07E+06 8.29E+06 5.32E+06 2 1 3 2 1 1 2 68482 Epsin-2 OS=Homo sapiens OX=9606 GN=EPN2 PE=1 SV=3 2762 2748 sp|Q9Y4I1|MYO5A_HUMAN 35.56 1 0 0 0 0 0 1.93E+08 3 1 1 0 1 0 1 215403 Unconventional myosin-Va OS=Homo sapiens OX=9606 GN=MYO5A PE=1 SV=2 4368 2482 sp|P35613|BASI_HUMAN 35.42 4 0 0 4 0 0 0.00E+00 1 1 0 0 1 0 0 42200 Basigin OS=Homo sapiens OX=9606 GN=BSG PE=1 SV=2 2026 3141 sp|Q14669|TRIPC_HUMAN 35.33 1 0 0 1 0 0 8.89E+06 2 1 0 1 2 2 0 220432 E3 ubiquitin-protein ligase TRIP12 OS=Homo sapiens OX=9606 GN=TRIP12 PE=1 SV=1 3085 1577 sp|P07359|GP1BA_HUMAN 35.28 3 0 1 0 0 2 0.00E+00 3 1 0 1 0 0 2 71540 Platelet glycoprotein Ib alpha chain OS=Homo sapiens OX=9606 GN=GP1BA PE=1 SV=2 2833 935 sp|Q86SG6|NEK8_HUMAN 35.08 3 0 1 2 0 0 6.02E+06 3 1 0 1 2 0 0 74806 Serine/threonine-protein kinase Nek8 OS=Homo sapiens OX=9606 GN=NEK8 PE=1 SV=1 3448 1859 sp|Q9UEY8|ADDG_HUMAN 35.07 2 0 0 0 2 0 1.87E+06 1 1 0 0 0 1 0 79155 Gamma-adducin OS=Homo sapiens OX=9606 GN=ADD3 PE=1 SV=1 2246 3566 sp|Q9NRM1|ENAM_HUMAN 34.69 1 1 0 0 0 1 1.24E+06 3 1 1 1 0 1 2 128785 Enamelin OS=Homo sapiens OX=9606 GN=ENAM PE=1 SV=3 Maestro heat-like repeat-containing protein family member 2B OS=Homo sapiens OX=9606 GN=MROH2B PE=2 2860 4359 sp|Q7Z745|MRO2B_HUMAN 34.59 1 0 0 0 1 0 8.05E+06 3 1 0 0 1 2 0 180780 SV=3 2705 3453 sp|Q7Z5J8|ANKAR_HUMAN 34.59 1 1 0 0 0 0 2.17E+07 2 1 4 0 0 0 0 162025 Ankyrin and armadillo repeat-containing protein OS=Homo sapiens OX=9606 GN=ANKAR PE=2 SV=3 2118 1731 sp|Q6ZW49|PAXI1_HUMAN 34.29 1 0 0 0 1 1 8.71E+06 7.24E+06 2 1 0 0 0 3 1 121341 PAX-interacting protein 1 OS=Homo sapiens OX=9606 GN=PAXIP1 PE=1 SV=2 4090 2163 sp|Q96GA3|LTV1_HUMAN 34.16 2 0 0 0 0 2 1.40E+06 1 1 0 0 0 0 1 54855 Protein LTV1 homolog OS=Homo sapiens OX=9606 GN=LTV1 PE=1 SV=1 4191 1555 sp|Q9HD42|CHM1A_HUMAN 34.08 5 0 0 0 0 5 7.21E+05 1 1 0 0 0 0 1 21703 Charged multivesicular body protein 1a OS=Homo sapiens OX=9606 GN=CHMP1A PE=1 SV=1 3762 2500 sp|P78330|SERB_HUMAN 33.92 6 0 6 6 0 0 2.17E+06 5.88E+06 1 1 0 1 1 0 0 25008 Phosphoserine phosphatase OS=Homo sapiens OX=9606 GN=PSPH PE=1 SV=2 4320 2247 sp|P28288|ABCD3_HUMAN 33.9 2 0 0 2 0 0 7.94E+05 1 1 0 0 1 0 0 75476 ATP-binding cassette sub-family D member 3 OS=Homo sapiens OX=9606 GN=ABCD3 PE=1 SV=1 3527 2249 sp|O15347|HMGB3_HUMAN 33.87 6 0 0 6 0 6 3.65E+06 1.81E+06 1 1 0 0 1 0 1 22980 High mobility group protein B3 OS=Homo sapiens OX=9606 GN=HMGB3 PE=1 SV=4 2378 2165 sp|Q12933|TRAF2_HUMAN 33.81 2 2 1 1 0 0 0.00E+00 2 1 2 1 1 0 0 55859 TNF receptor-associated factor 2 OS=Homo sapiens OX=9606 GN=TRAF2 PE=1 SV=2 3001 1517 sp|P29460|IL12B_HUMAN 33.55 4 2 0 2 0 0 7.68E+06 2 1 1 0 2 0 0 37169 Interleukin-12 subunit beta OS=Homo sapiens OX=9606 GN=IL12B PE=1 SV=1 3781 3419 sp|Q15714|T22D1_HUMAN 33.45 1 0 0 1 0 0 0.00E+00 2 1 1 0 1 0 0 109676 TSC22 domain family protein 1 OS=Homo sapiens OX=9606 GN=TSC22D1 PE=1 SV=3 2796 1812 sp|O60841|IF2P_HUMAN 33.38 1 0 0 0 1 0 4.94E+06 3.22E+06 2 1 0 0 0 2 1 138827 Eukaryotic translation initiation factor 5B OS=Homo sapiens OX=9606 GN=EIF5B PE=1 SV=4 3398 1437 sp|O43815|STRN_HUMAN 33.07 2 2 0 0 0 0 1.18E+06 2 1 2 0 0 0 0 86132 Striatin OS=Homo sapiens OX=9606 GN=STRN PE=1 SV=4 3956 1714 sp|O43818|U3IP2_HUMAN 32.92 2 0 0 0 0 2 9.98E+06 1 1 0 0 0 0 1 51841 U3 small nucleolar RNA-interacting protein 2 OS=Homo sapiens OX=9606 GN=RRP9 PE=1 SV=1 4314 1909 sp|P25205|MCM3_HUMAN 32.62 1 0 0 1 0 0 3.58E+05 1 1 0 0 1 0 0 90981 DNA replication licensing factor MCM3 OS=Homo sapiens OX=9606 GN=MCM3 PE=1 SV=3 2422 1675 sp|Q8NHH1|TTL11_HUMAN 32.55 2 0 2 1 1 0 1.43E+06 2 1 0 2 1 1 0 87612 Tubulin polyglutamylase TTLL11 OS=Homo sapiens OX=9606 GN=TTLL11 PE=1 SV=2 4083 1357 sp|P25789|PSA4_HUMAN 32.5 4 0 0 4 0 0 5.59E+05 1 1 0 0 1 0 0 29484 Proteasome subunit alpha type-4 OS=Homo sapiens OX=9606 GN=PSMA4 PE=1 SV=1 3744 1745 sp|P81605|DCD_HUMAN 32.49 17 0 0 13 0 5 5.29E+06 2 1 0 0 1 0 1 11284 Dermcidin OS=Homo sapiens OX=9606 GN=DCD PE=1 SV=2 3633 2508 sp|P14314|GLU2B_HUMAN 32.39 2 0 0 2 2 0 1.10E+06 7.39E+05 1 1 0 0 1 1 0 59426 Glucosidase 2 subunit beta OS=Homo sapiens OX=9606 GN=PRKCSH PE=1 SV=2 2687 2340 sp|O60662|KLH41_HUMAN 32.33 2 1 1 1 0 1 4.04E+06 2 1 1 1 1 0 1 68037 Kelch-like protein 41 OS=Homo sapiens OX=9606 GN=KLHL41 PE=1 SV=2 2794 1089 sp|O43148|MCES_HUMAN 32.2 5 0 1 4 4 0 6.21E+05 2.21E+05 2 1 0 1 1 1 0 54844 mRNA cap guanine-N7 methyltransferase OS=Homo sapiens OX=9606 GN=RNMT PE=1 SV=1 3183 2543 sp|P01624|KV315_HUMAN 32.15 8 8 0 0 0 0 4.86E+07 1 1 2 0 0 0 0 12496 Immunoglobulin kappa variable 3-15 OS=Homo sapiens OX=9606 GN=IGKV3-15 PE=1 SV=2 Probable non-functional immunoglobulin kappa variable 3-7 OS=Homo sapiens OX=9606 GN=IGKV3-7 PE=5 3183 2544 sp|A0A075B6H7|KV37_HUMA 32.15 8 8 0 0 0 0 4.86E+07 1 1 2 0 0 0 0 12783 SV=1 3183 2545 sp|A0A0C4DH55|KVD07_HU 32.15 8 8 0 0 0 0 4.86E+07 1 1 2 0 0 0 0 13148 Immunoglobulin kappa variable 3D-7 OS=Homo sapiens OX=9606 GN=IGKV3D-7 PE=3 SV=5 3340 2761 sp|Q5H8C1|FREM1_HUMAN 32.02 1 0 0 0 0 0 5.61E+07 2 1 1 0 1 0 0 244152 FRAS1-related extracellular matrix protein 1 OS=Homo sapiens OX=9606 GN=FREM1 PE=1 SV=3 3920 1532 sp|Q8IVI9|NOSTN_HUMAN 31.93 5 0 0 0 0 5 1.07E+06 1 1 0 0 0 0 1 57660 Nostrin OS=Homo sapiens OX=9606 GN=NOSTRIN PE=1 SV=2 3604 1199 sp|Q9Y2Q3|GSTK1_HUMAN 31.75 8 2 6 0 0 0 1.41E+06 2 1 1 1 0 0 0 25497 Glutathione S-transferase kappa 1 OS=Homo sapiens OX=9606 GN=GSTK1 PE=1 SV=3 3450 1919 sp|Q6L9W6|B4GN3_HUMAN 31.61 1 0 0 1 0 1 1.05E+07 2 1 0 0 1 0 1 114975 Beta-1 4-N-acetylgalactosaminyltransferase 3 OS=Homo sapiens OX=9606 GN=B4GALNT3 PE=1 SV=2 3309 1166 sp|Q8IWX8|CHERP_HUMAN 31.55 2 0 2 0 0 0 4.21E+06 2 2 0 2 0 0 0 103702 Calcium homeostasis endoplasmic reticulum protein OS=Homo sapiens OX=9606 GN=CHERP PE=1 SV=3 2901 5715 sp|Q14315|FLNC_HUMAN 31.39 0 0 0 0 0 0 9.97E+06 2 1 2 0 0 0 1 291020 Filamin-C OS=Homo sapiens OX=9606 GN=FLNC PE=1 SV=3 3521 1639 sp|Q9HAY6|BCDO1_HUMAN 31.24 1 0 0 1 1 0 5.99E+05 1.01E+06 1 1 0 0 1 1 0 62637 Beta beta-carotene 15 15'-dioxygenase OS=Homo sapiens OX=9606 GN=BCO1 PE=1 SV=1 2490 4580 sp|Q12830|BPTF_HUMAN 31.23 1 0 0 0 0 1 7.02E+06 2 1 0 1 1 0 2 338262 Nucleosome-remodeling factor subunit BPTF OS=Homo sapiens OX=9606 GN=BPTF PE=1 SV=3 3338 2507 sp|Q9P275|UBP36_HUMAN 31.16 1 0 0 0 0 1 2.01E+06 2 1 1 0 0 0 1 122908 Ubiquitin carboxyl-terminal hydrolase 36 OS=Homo sapiens OX=9606 GN=USP36 PE=1 SV=4 3684 4450 sp|O43747|AP1G1_HUMAN 31.09 1 0 1 1 0 0 1.83E+07 2 1 0 1 1 0 0 91351 AP-1 complex subunit gamma-1 OS=Homo sapiens OX=9606 GN=AP1G1 PE=1 SV=5 4369 2517 sp|P56134|ATPK_HUMAN 30.97 14 0 0 14 0 0 9.90E+05 1 1 0 0 1 0 0 10918 ATP synthase subunit f mitochondrial OS=Homo sapiens OX=9606 GN=ATP5MF PE=1 SV=3 2884 1296 sp|Q9UHL0|DDX25_HUMAN 30.84 3 0 0 1 2 0 2.37E+06 2 1 0 0 1 1 0 54692 ATP-dependent RNA helicase DDX25 OS=Homo sapiens OX=9606 GN=DDX25 PE=1 SV=2 4323 2541 sp|Q9H0H5|RGAP1_HUMAN 30.79 3 3 0 0 0 0 1.23E+06 1 1 1 0 0 0 0 71027 Rac GTPase-activating protein 1 OS=Homo sapiens OX=9606 GN=RACGAP1 PE=1 SV=1 3461 2839 sp|Q7Z7M0|MEGF8_HUMAN 30.68 0 0 0 0 0 0 2.30E+06 1 1 1 0 0 0 0 303100 Multiple epidermal growth factor-like domains protein 8 OS=Homo sapiens OX=9606 GN=MEGF8 PE=1 SV=2 Brefeldin A-inhibited guanine nucleotide-exchange protein 3 OS=Homo sapiens OX=9606 GN=ARFGEF3 PE=1 3259 2194 sp|Q5TH69|BIG3_HUMAN 30.49 1 0 0 0 1 0 2.76E+06 2 1 1 0 0 1 0 240649 SV=3 3620 1818 sp|Q15139|KPCD1_HUMAN 30.43 2 0 1 2 0 0 1.09E+06 2 1 0 1 1 0 0 101704 Serine/threonine-protein kinase D1 OS=Homo sapiens OX=9606 GN=PRKD1 PE=1 SV=2 3396 1297 sp|P45880|VDAC2_HUMAN 30.32 6 0 0 4 0 2 2.27E+06 2 1 0 0 1 0 1 31567 Voltage-dependent anion-selective channel protein 2 OS=Homo sapiens OX=9606 GN=VDAC2 PE=1 SV=2 2716 4420 sp|Q9H2B4|S26A1_HUMAN 30.01 2 1 1 1 0 1 1.44E+06 2 1 1 1 1 0 1 75016 Sulfate anion transporter 1 OS=Homo sapiens OX=9606 GN=SLC26A1 PE=1 SV=2 3401 1824 sp|Q8TCY9|URGCP_HUMAN 29.95 1 0 1 0 0 1 0.00E+00 3.84E+06 2 2 0 1 0 0 1 104987 Up-regulator of cell proliferation OS=Homo sapiens OX=9606 GN=URGCP PE=1 SV=2 2034 1192 sp|P51532|SMCA4_HUMAN 29.85 0 0 0 0 0 0 2.57E+06 9.46E+06 9.93E+06 6.16E+06 1 1 1 1 1 0 2 184644 Transcription activator BRG1 OS=Homo sapiens OX=9606 GN=SMARCA4 PE=1 SV=2 2034 1759 sp|P51531|SMCA2_HUMAN 29.85 0 0 0 0 0 0 2.57E+06 9.46E+06 9.93E+06 6.16E+06 1 1 1 1 1 0 2 181278 Probable global transcription activator SNF2L2 OS=Homo sapiens OX=9606 GN=SMARCA2 PE=1 SV=2 A disintegrin and metalloproteinase with thrombospondin motifs 9 OS=Homo sapiens OX=9606 GN=ADAMTS9 2568 4651 sp|Q9P2N4|ATS9_HUMAN 29.82 1 0 0 0 0 1 1.56E+05 2 1 0 1 1 0 2 216490 PE=1 SV=4 2025 2833 sp|Q9HD67|MYO10_HUMAN 29.78 1 1 0 0 0 0 2.90E+06 6.43E+06 9.32E+06 2 1 2 1 0 0 1 237345 Unconventional myosin-X OS=Homo sapiens OX=9606 GN=MYO10 PE=1 SV=3 3518 1550 sp|P47895|AL1A3_HUMAN 29.24 3 0 1 0 2 0 1.91E+06 2 1 0 1 0 1 0 56109 Aldehyde dehydrogenase family 1 member A3 OS=Homo sapiens OX=9606 GN=ALDH1A3 PE=1 SV=2 3615 1563 sp|P00558|PGK1_HUMAN 29.13 8 0 0 8 0 0 5.26E+06 2 2 0 0 2 0 0 44615 Phosphoglycerate kinase 1 OS=Homo sapiens OX=9606 GN=PGK1 PE=1 SV=3 3105 2471 sp|P05455|LA_HUMAN 28.86 2 0 2 2 2 0 1.64E+06 1.61E+06 1.61E+06 1 1 0 1 1 1 0 46837 Lupus La protein OS=Homo sapiens OX=9606 GN=SSB PE=1 SV=2 2473 2182 sp|Q96R84|OR1F2_HUMAN 28.84 4 0 2 0 2 4 1.28E+07 1.26E+07 8.65E+06 2 1 0 1 0 1 2 34944 Putative olfactory receptor 1F2 OS=Homo sapiens OX=9606 GN=OR1F2P PE=5 SV=2 2230 2010 sp|Q96CB9|NSUN4_HUMAN 28.83 3 0 2 3 0 2 1.63E+07 1.81E+07 2.26E+07 2 1 0 1 2 0 1 43089 5-methylcytosine rRNA methyltransferase NSUN4 OS=Homo sapiens OX=9606 GN=NSUN4 PE=1 SV=2 4370 2560 sp|Q7KZF4|SND1_HUMAN 28.82 1 0 1 0 0 0 5.36E+06 1 1 0 1 0 0 0 101997 Staphylococcal nuclease domain-containing protein 1 OS=Homo sapiens OX=9606 GN=SND1 PE=1 SV=1 3279 1611 sp|Q13523|PRP4B_HUMAN 28.78 2 0 0 1 0 0 1.28E+04 2 1 0 0 1 0 1 116987 Serine/threonine-protein kinase PRP4 homolog OS=Homo sapiens OX=9606 GN=PRPF4B PE=1 SV=3 4086 1644 sp|Q15287|RNPS1_HUMAN 28.76 3 0 0 0 0 3 2.12E+06 1 1 0 0 0 0 1 34208 RNA-binding protein with serine-rich domain 1 OS=Homo sapiens OX=9606 GN=RNPS1 PE=1 SV=1 3400 1615 sp|Q14684|RRP1B_HUMAN 28.42 2 0 0 0 2 0 4.36E+06 2 1 0 0 0 2 0 84428 Ribosomal RNA processing protein 1 homolog B OS=Homo sapiens OX=9606 GN=RRP1B PE=1 SV=3 3637 2790 sp|Q8TF05|PP4R1_HUMAN 28.38 1 0 0 0 0 1 4.57E+06 2 1 0 0 0 0 2 107004 Serine/threonine-protein phosphatase 4 regulatory subunit 1 OS=Homo sapiens OX=9606 GN=PPP4R1 PE=1 SV=1 2697 2754 sp|Q9NRX1|PNO1_HUMAN 28.25 8 0 2 2 6 2 1.09E+06 2 1 0 1 1 1 1 27924 RNA-binding protein PNO1 OS=Homo sapiens OX=9606 GN=PNO1 PE=1 SV=1 1-phosphatidylinositol 4 5-bisphosphate phosphodiesterase zeta-1 OS=Homo sapiens OX=9606 GN=PLCZ1 PE=1 2539 2493 sp|Q86YW0|PLCZ1_HUMAN 28.18 2 0 1 2 0 1 3.35E+06 2 1 0 1 2 0 1 70411 SV=1 3550 3569 sp|P14735|IDE_HUMAN 27.98 1 1 0 0 0 0 4.13E+07 2 1 1 0 0 0 1 117968 Insulin-degrading enzyme OS=Homo sapiens OX=9606 GN=IDE PE=1 SV=4 2935 2293 sp|Q8TDZ2|MICA1_HUMAN 27.98 1 1 0 1 0 1 4.63E+06 2.60E+06 2 1 1 0 1 0 1 117875 [F-actin]-monooxygenase MICAL1 OS=Homo sapiens OX=9606 GN=MICAL1 PE=1 SV=2 3194 3237 sp|Q8IZF3|AGRF4_HUMAN 27.83 3 0 0 0 1 3 7.20E+06 2 1 0 0 0 1 2 77719 Adhesion G protein-coupled receptor F4 OS=Homo sapiens OX=9606 GN=ADGRF4 PE=1 SV=3 3629 2181 sp|P45844|ABCG1_HUMAN 27.2 2 0 0 1 0 1 3.60E+05 2 1 0 0 1 0 1 75592 ATP-binding cassette sub-family G member 1 OS=Homo sapiens OX=9606 GN=ABCG1 PE=1 SV=3 4374 2763 sp|P82673|RT35_HUMAN 27.05 3 3 0 0 0 0 6.05E+05 1 1 1 0 0 0 0 36844 28S ribosomal protein S35 mitochondrial OS=Homo sapiens OX=9606 GN=MRPS35 PE=1 SV=1 4373 2684 sp|Q96GC5|RM48_HUMAN 26.9 6 0 0 0 0 6 1.27E+06 1 1 0 0 0 0 1 23935 39S ribosomal protein L48 mitochondrial OS=Homo sapiens OX=9606 GN=MRPL48 PE=1 SV=2 2750 2185 sp|Q13948|CASP_HUMAN 26.87 2 0 0 2 0 1 2.66E+07 2 1 0 0 2 0 1 77455 Protein CASP OS=Homo sapiens OX=9606 GN=CUX1 PE=1 SV=2 2750 2387 sp|P39880|CUX1_HUMAN 26.87 1 0 0 1 0 0 2.66E+07 2 1 0 0 2 0 1 164187 Homeobox protein cut-like 1 OS=Homo sapiens OX=9606 GN=CUX1 PE=1 SV=3 3472 3497 sp|Q9HCJ5|ZSWM6_HUMAN 26.62 1 0 0 0 1 0 6.84E+05 2 1 0 0 0 2 0 133470 Zinc finger SWIM domain-containing protein 6 OS=Homo sapiens OX=9606 GN=ZSWIM6 PE=1 SV=2 3614 1523 sp|P08195|4F2_HUMAN 26.41 3 0 1 2 0 0 1.00E+06 2 1 0 1 1 0 0 67994 4F2 cell-surface antigen heavy chain OS=Homo sapiens OX=9606 GN=SLC3A2 PE=1 SV=3 3769 2849 sp|A0A0C4DH25|KVD20_HU 26.36 8 8 0 0 0 0 1.06E+07 1 1 2 0 0 0 0 12515 Immunoglobulin kappa variable 3D-20 OS=Homo sapiens OX=9606 GN=IGKV3D-20 PE=3 SV=1 4372 2669 sp|P51149|RAB7A_HUMAN 26.32 6 0 0 0 6 0 4.11E+06 1 1 0 0 0 1 0 23490 Ras-related protein Rab-7a OS=Homo sapiens OX=9606 GN=RAB7A PE=1 SV=1 4371 2663 sp|Q9HBH1|DEFM_HUMAN 26.04 3 0 3 0 0 0 2.18E+06 1 1 0 1 0 0 0 27013 Peptide deformylase mitochondrial OS=Homo sapiens OX=9606 GN=PDF PE=1 SV=1 3676 4142 sp|Q8NHM5|KDM2B_HUMAN 25.62 1 0 0 1 0 0 6.12E+06 2 1 1 0 1 0 0 152614 Lysine-specific demethylase 2B OS=Homo sapiens OX=9606 GN=KDM2B PE=1 SV=1 Membrane-associated guanylate kinase WW and PDZ domain-containing protein 1 OS=Homo sapiens OX=9606 3953 1213 sp|Q96QZ7|MAGI1_HUMAN 25.2 1 0 1 0 0 0 4.29E+06 1 1 0 1 0 0 0 164580 GN=MAGI1 PE=1 SV=3 2819 3427 sp|Q8N7Z5|ANR31_HUMAN 24.76 1 0 0 0 1 0 3.82E+06 4.65E+06 2 1 0 0 1 2 0 210814 Ankyrin repeat domain-containing protein 31 OS=Homo sapiens OX=9606 GN=ANKRD31 PE=2 SV=2 3540 3159 sp|P43246|MSH2_HUMAN 24.76 1 0 0 1 0 0 0.00E+00 1 1 0 0 1 0 0 104743 DNA mismatch repair protein Msh2 OS=Homo sapiens OX=9606 GN=MSH2 PE=1 SV=1 3517 1439 sp|Q9UHI6|DDX20_HUMAN 24.68 2 0 2 0 0 0 1.33E+06 1 1 0 1 0 0 0 92241 Probable ATP-dependent RNA helicase DDX20 OS=Homo sapiens OX=9606 GN=DDX20 PE=1 SV=2 3243 1978 sp|Q8WXA3|RUFY2_HUMAN 24.45 2 1 0 0 0 1 1.44E+06 2 1 1 0 0 0 1 70010 RUN and FYVE domain-containing protein 2 OS=Homo sapiens OX=9606 GN=RUFY2 PE=1 SV=3 4088 1894 sp|O60443|GSDME_HUMAN 24.27 6 6 0 0 0 0 1.74E+05 1 1 1 0 0 0 0 54555 Gasdermin-E OS=Homo sapiens OX=9606 GN=GSDME PE=1 SV=2 4380 3244 sp|Q05C16|LRC63_HUMAN 24.22 1 1 0 0 0 0 4.64E+06 1 1 1 0 0 0 0 66309 Leucine-rich repeat-containing protein 63 OS=Homo sapiens OX=9606 GN=LRRC63 PE=2 SV=2 4093 2607 sp|Q9NP71|MLXPL_HUMAN 24.12 1 0 1 0 0 0 4.77E+06 1 1 0 1 0 0 0 93073 Carbohydrate-responsive element-binding protein OS=Homo sapiens OX=9606 GN=MLXIPL PE=1 SV=1 3999 2086 sp|Q86U06|RBM23_HUMAN 24.03 6 6 0 0 0 0 4.95E+06 1 1 1 0 0 0 0 48731 Probable RNA-binding protein 23 OS=Homo sapiens OX=9606 GN=RBM23 PE=1 SV=1 4379 3214 sp|A0A1B0GVZ6|MB3LB_HU 23.74 4 4 0 0 0 0 3.73E+06 1 1 1 0 0 0 0 22665 Methyl-CpG-binding domain protein 3-like 2B OS=Homo sapiens OX=9606 GN=MBD3L2B PE=3 SV=1 4379 3215 sp|A6NJ08|MB3L5_HUMAN 23.74 4 4 0 0 0 0 3.73E+06 1 1 1 0 0 0 0 22976 Putative methyl-CpG-binding domain protein 3-like 5 OS=Homo sapiens OX=9606 GN=MBD3L5 PE=5 SV=1 4379 3216 sp|A6NE82|MB3L3_HUMAN 23.74 4 4 0 0 0 0 3.73E+06 1 1 1 0 0 0 0 23095 Putative methyl-CpG-binding domain protein 3-like 3 OS=Homo sapiens OX=9606 GN=MBD3L3 PE=5 SV=1 4379 3217 sp|A6NDZ8|MB3L4_HUMAN 23.74 4 4 0 0 0 0 3.73E+06 1 1 1 0 0 0 0 23121 Putative methyl-CpG-binding domain protein 3-like 4 OS=Homo sapiens OX=9606 GN=MBD3L4 PE=5 SV=1 4379 3218 sp|Q8NHZ7|MB3L2_HUMAN 23.74 4 4 0 0 0 0 3.73E+06 1 1 1 0 0 0 0 22994 Methyl-CpG-binding domain protein 3-like 2 OS=Homo sapiens OX=9606 GN=MBD3L2 PE=1 SV=3 2236 2745 sp|P25067|CO8A2_HUMAN 23.38 1 0 1 1 1 1 1.16E+07 2.03E+07 9.00E+06 7.98E+06 1 1 0 1 2 1 1 67244 Collagen alpha-2(VIII) chain OS=Homo sapiens OX=9606 GN=COL8A2 PE=1 SV=2 4376 2992 sp|P05023|AT1A1_HUMAN 23.38 1 0 0 1 0 0 8.43E+05 1 1 0 0 1 0 0 112896 Sodium/potassium-transporting ATPase subunit alpha-1 OS=Homo sapiens OX=9606 GN=ATP1A1 PE=1 SV=1 4377 2995 sp|O14828|SCAM3_HUMAN 23.34 5 0 0 5 0 0 1.13E+06 1 1 0 0 1 0 0 38287 Secretory carrier-associated membrane protein 3 OS=Homo sapiens OX=9606 GN=SCAMP3 PE=1 SV=3 2382 2649 sp|Q92896|GSLG1_HUMAN 23.1 1 1 0 0 0 0 6.04E+08 1 1 3 0 0 0 0 134552 Golgi apparatus protein 1 OS=Homo sapiens OX=9606 GN=GLG1 PE=1 SV=2 4382 3874 sp|Q14202|ZMYM3_HUMAN 22.11 1 1 0 0 0 0 8.07E+05 1 1 1 0 0 0 0 152379 Zinc finger MYM-type protein 3 OS=Homo sapiens OX=9606 GN=ZMYM3 PE=1 SV=2 4326 3097 sp|Q9HD33|RM47_HUMAN 22.08 5 0 0 5 0 0 1.41E+06 1 1 0 0 1 0 0 29450 39S ribosomal protein L47 mitochondrial OS=Homo sapiens OX=9606 GN=MRPL47 PE=1 SV=2 4103 3062 sp|P47736|RPGP1_HUMAN 21.92 2 0 0 0 2 0 1.29E+07 1 1 0 0 0 1 0 73361 Rap1 GTPase-activating protein 1 OS=Homo sapiens OX=9606 GN=RAP1GAP PE=1 SV=2 4328 3293 sp|Q16849|PTPRN_HUMAN 21.87 1 1 0 0 0 0 2.52E+06 1 1 1 0 0 0 0 105847 Receptor-type tyrosine-protein phosphatase-like N OS=Homo sapiens OX=9606 GN=PTPRN PE=1 SV=1 3954 1450 sp|Q15555|MARE2_HUMAN 21.8 6 6 0 0 0 0 1.68E+07 1 1 1 0 0 0 0 37031 Microtubule-associated protein RP/EB family member 2 OS=Homo sapiens OX=9606 GN=MAPRE2 PE=1 SV=1 3666 3719 sp|Q8N5J4|SPIC_HUMAN 21.79 3 3 0 0 0 0 6.68E+06 1 1 2 0 0 0 0 29180 Transcription factor Spi-C OS=Homo sapiens OX=9606 GN=SPIC PE=1 SV=1 4325 3071 sp|P43694|GATA4_HUMAN 21.51 4 4 0 0 0 0 0.00E+00 1 1 1 0 0 0 0 44565 Transcription factor GATA-4 OS=Homo sapiens OX=9606 GN=GATA4 PE=1 SV=2 4097 2904 sp|Q6ZMP0|THSD4_HUMAN 21.44 1 0 0 1 0 0 1.03E+07 1 1 0 0 1 0 0 112450 Thrombospondin type-1 domain-containing protein 4 OS=Homo sapiens OX=9606 GN=THSD4 PE=2 SV=2 3997 2005 sp|Q8NDV3|SMC1B_HUMAN 21.29 1 0 0 1 0 0 1.52E+07 1 1 0 0 1 0 0 143907 Structural maintenance of chromosomes protein 1B OS=Homo sapiens OX=9606 GN=SMC1B PE=2 SV=2 4384 4301 sp|P04433|KV311_HUMAN 21.21 8 8 0 0 0 0 3.84E+06 1 1 1 0 0 0 0 12575 Immunoglobulin kappa variable 3-11 OS=Homo sapiens OX=9606 GN=IGKV3-11 PE=1 SV=1 3118 3288 sp|Q6IEE8|SN12L_HUMAN 20.91 2 0 2 2 2 0 4.15E+06 1.26E+07 6.41E+06 1 1 0 1 1 1 0 67096 Schlafen family member 12-like OS=Homo sapiens OX=9606 GN=SLFN12L PE=2 SV=4 3564 4402 sp|Q7Z443|PK1L3_HUMAN 20.74 1 1 0 0 0 0 1.13E+07 1 1 2 0 0 0 0 195892 Polycystic kidney disease protein 1-like 3 OS=Homo sapiens OX=9606 GN=PKD1L3 PE=1 SV=1 4335 4019 sp|Q68CK6|ACS2B_HUMAN 20.34 1 1 0 0 0 0 9.81E+05 1 1 1 0 0 0 0 64271 Acyl-coenzyme A synthetase ACSM2B mitochondrial OS=Homo sapiens OX=9606 GN=ACSM2B PE=1 SV=2 4335 4020 sp|Q08AH3|ACS2A_HUMAN 20.34 1 1 0 0 0 0 9.81E+05 1 1 1 0 0 0 0 64223 Acyl-coenzyme A synthetase ACSM2A mitochondrial OS=Homo sapiens OX=9606 GN=ACSM2A PE=1 SV=2 3206 3825 sp|Q8WX92|NELFB_HUMAN 20.17 1 0 1 1 0 1 9.26E+06 1.50E+07 1.17E+07 1 1 0 1 1 0 1 65697 Negative elongation factor B OS=Homo sapiens OX=9606 GN=NELFB PE=1 SV=1 4337 4503 sp|P06737|PYGL_HUMAN 20.03 1 1 0 0 0 0 8.80E+06 1 1 1 0 0 0 0 97149 Glycogen phosphorylase liver form OS=Homo sapiens OX=9606 GN=PYGL PE=1 SV=4 Table S3. Association between classical clinic-pathologic parameters and HRG expression in TCGA and the GSE14520 cohort. Related to Figure 6. Description 1. Correlation between HRG expression and HCC clinicopathologic features in TCGA cohort. 2. Univariate and multivariate analyses of OS in TCGA HCC patients by Cox regression analysis. 3. Correlation between HRG expression and HCC clinicopathologic features in GSE14520 cohort. 4. Univariate and multivariate analyses of OS in GSE14520 HCC patients by Cox regression analysis. Table S3-1. Correlation between HRG expression and HCC clinicopathologic features in TCGA cohort.

HRG Expression Variable Total P -Value High Expression Low Expression Gender 365 0.328 Male 246 124 122 Female 119 51 68 Age (year) 365 0.003** ≤50 76 25 57 >50 289 150 139 Family cancer history 316 0.436 Yes 112 56 56 No 204 96 108 Lymphocyte infiltration 232 0.159 Absent 117 66 51 Mild 98 47 51 Severe 17 8 9 Vascular tumor cell invasion 311 0.261 None 205 105 100 Micro 98 45 53 Macro 16 7 9 Neoplasm grade 360 0.009** G1+G2 230 127 103 G3+G4 130 46 84 Pathologic Stage 341 0.002** I+II 254 133 121 III+IV 87 29 58 AFP (ng/ml) 276 0.005** <400 214 115 98 ≥400 63 24 39 Child-pugh classification grade 238 0.916 A 216 109 107 B+C 22 10 12 Liver fibrosis ishak score 209 0.487 ≤4 132 67 65 >4 77 45 32 Relapse 365 0.443 Yes 169 90 79 No 196 119 77

Abbreviations: HRG: Histidine Rich Glycoprotein; AFP: Alpha Fetal Protein. *P < 0.05: the values had statistically significant differences. Table S3-2. Univariate and multivariate analyses of OS in TCGA HCC patients by Cox regression analysis. Variable Univariate analysis Multivariate analysis Hazard Hazard Ratio CI (95%) P -Value CI (95%) P -Value Ratio Gender 0.82 0.58-1.2 0.28

Age (year) 1.1 0.72-1.7 0.62

Family cancer history 1.2 0.81-1.7 0.42

Lymphocyte infiltration 1.2 0.73-1.9 0.49

Vascular tumor cell 1.3 0.87-2 0.18 invasion

Neoplasm grade 1.1 0.8-1.6 0.47 0.00025 Pathologic Stage 2 1.4-2.9 1.866 1.2719-2.7379 0.00143 ** *** AFP (ng/ml) 1 0.64-1.7 0.87

Child-pugh classification 1.6 0.8-3.3 0.18 grade

Liver fibrosis ishak score 0.8 0.47-1.4 0.43

Relapse 1.4 1-2 0.048* HRG expression 0.59 0.41-0.84 0.0032** 0.626 0.4285-0.9147 0.01549 * Abbreviations: OS: overall survival; CI: confidence interval; HR: hazard radio; *P < 0.05; the values had statistically significant differences. Table S3-3. Correlation between HRG expression and HCC clinicopathologic features in GSE14520 cohort. HRG Expression Variable Total P -Value Low Expression High Expression Gender 242 0.297 Male 211 52 159 Female 31 5 26 Age (year) 242 0.866 ≤50 125 30 95 >50 117 27 90 HBV viral status 224 0.907 AVR-CC 58 14 44 CC 160 36 124 N 6 1 5 ALT(>/<=50U/L) 242 0.289 low 142 30 112 high 100 27 73 Main Tumor Size 241 0.01* (>/<=5 cm) small 153 28 125 large 88 29 59 TNM staging 225 <0.001*** I 96 12 84 II 78 15 63 III 51 24 27 BCLC staging 225 <0.001*** 0 20 2 18 A 152 26 126 B 24 8 16 C 29 15 14 CLIP staging 225 0.002* 0 98 14 84 1 79 18 61 2 35 11 24 3 9 5 4 ＞3 4 3 1 AFP (>/<=300ng/ml) 238 0.005* low 128 21 107 high 110 35 75 Predicted risk 242 <0.001*** Metastasis Signature low 121 9 112 high 121 48 73 Relapse 242 0.033* Yes 136 39 97 No 106 18 88

Abbreviations: HRG: Histidine Rich Glycoprotein; AFP: Alpha Fetal Protein. *P < 0.05: the values had statistically significant differences. Table S3-4. Univariate and multivariate analyses of OS in GSE14520 HCC patients by Cox regression analysis. Variable Univariate analysis Multivariate analysis Hazard Ratio CI (95%) P -Value Hazard Ratio CI (95%) P -Value Gender 0.55 0.26-1.1 0.1 Age (year) 0.9 0.6-1.3 0.6 HBV viral status 0.72 0.46-1.2 0.17 ALT(>/<=50U/L) 1.1 0.75-1.7 0.55 Main Tumor Size 2 1.3-3 0.00086*** 1.6891 1.06-2.692 0.0274* (>/<=5 cm) TNM staging 3 1.8-4.9 1.20E-05*** BCLC staging 5.4 1.3-22 0.018* CLIP staging 2.2 1.4-3.4 0.0011** AFP (>/<=300ng/ml) 1.7 1.1-2.6 0.0087**

Predicted risk 2.2 1.5-3.4 0.00019*** Metastasis Signature Relapse 120 17-860 2.00E-06*** 93.3769 12.9672-672.408 6.67e-06*** HRG expression 0.41 0.27-0.64 5.60E-05*** Abbreviations: OS: overall survival; CI: confidence interval; HR: hazard radio; *P < 0.05; the values had statistically significant differences. Table S4. Sequences and antibodies used in the study. Related to Supplementary materials and methods sections. Description 1. Small-interfering RNA sequences used in this study. 2. List of antibodies used in the present study. 3. The primer sequences included in this study. Table S4-1.Small-interfering RNA sequences used in this study. siRNA Sequence (5’-3’) si-HRG#1 (Forward) GCUCUAGACCUGAUCAAUATT si-HRG#1 (Reverse) UAUUGAUCAGGUCUAGAGCTT si-HRG#2 (Forward) CCCAUGUCCUGCUCAAGUUTT si-HRG#2 (Reverse) AACUUGAGCAGGACAUGGGTT si-TNFR1#1 (Forward) CAGGUUUCUUUCUAAGAGATT si-TNFR1#1 (Reverse) UCUCUUAGAAAGAAACCUGTT si-TNFR1#2 (Forward) GCUUGAAGGAACUACUACUTT si-TNFR1#2 (Reverse) AGUAGUAGUUCCUUCAAGCTT si-RNF8 (Forward) GCUCCAAUGUAUUAUUUGUTT si-RNF8 (Reverse) ACAAAUAAUACAUUGGAGCTT si-TRAF6 (Forward) GAUCCAGGGAUAUGAUGUATT si-TRAF6 (Reverse) UACAUCAUAUCCCUGGAUCTT scramble (Forward) ACGUGACACGUUCGGAGAATT scramble (Reverse) ACGUGACACGUUCGGAGAATT Table S4-2. List of antibodies used in the present study. Antibody WB IP IF IHC Cat. No. Company HRG 1:1000 / / / MAB1869 R&D, MN, USA TNFR1 1:1000 1:100 / / #3736 Cell Signaling Technology, MA, USA PIP1 1:1000 / / / #3493 Cell Signaling Technology, MA, USA P65 1:1000 / / / #8242 Cell Signaling Technology, MA, USA p-P65 1:1000 / 1:100 / #3033 Cell Signaling Technology, MA, USA IκB 1:1000 / / / #4814 Cell Signaling Technology, MA, USA Caspase8 1:1000 / / / 66093-1-Ig Proteintech, IL, USA FADD 1:1000 / / / 14906-1-AP Proteintech, IL, USA GFP 1:1000 1:100 1:100 / RM1008 Beijing Ray, Beijing, China HA 1:1000 / 1:100 / RM1004 Beijing Ray, Beijing, China β-actin 1:1000 / / / RM2001 Beijing Ray, Beijing, China GAPDH 1:1000 / / / RM2002 Beijing Ray, Beijing, China Flag 1:1000 1:100 1:100 / F1804 Sigma-Aldrich, USA Ki-67 / / / 1:100 BS1454 Bioworld Technology, Bloomington, USA MYCBP 1:1000 / / / ab66331 Abcam, Cambridge, UK Bcl-2 1:1000 / / / 1017-1 EPITOMICS, Cambridge, UK RNF8 1:1000 / / / 14112-1-AP Proteintech, IL, USA TRAF6 1:1000 / / / #8028S Cell Signaling Technology, MA, USA Ubiquitin 1:1000 / / / #33959 Cell Signaling Technology, MA, USA Antibody Kit Table S4-3. The primer sequences included in this study. qPCR primer name Sequence (5’-3’) HRG (Forward) AGCCAACAAAGCCCTTGAGA HRG (Reverse) TCTCATGTTCCTGAGGGTCG BCL2L1 (Forward) TGGTTCCTGAGCTTCGCAAT BCL2L1 (Reverse) TTCTGAAGGGAGAGAAAGAGATTCA BCL2A1 (Forward) ACAGGCTGGCTCAGGACTATCT BCL2A1 (Reverse) CTCTGGACGTTTTGCTTGGAC NFKB1 (Forward) CATCCCATGGTGGACTACCT NFKB1 (Reverse) TGGGTCCAGCAGTTACAGTG MYC (Forward) TACAACACCCGAGCAAGGAC MYC (Reverse) GAGGCTGCTGGTTTTCCACT GAPDH (Forward) CCTCCTGTTCGACAGTCAGC GAPDH (Reverse) CCATGGTGTCTGAGCGATGT