DOCSLIB.ORG

Morpholino Antisense Oligonucleotides-Zebrafish Catalog Number(S): PZF1245

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Morpholino Antisense Oligonucleotides-Zebrafish Catalog Number(S): PZF1245 Morpholino Antisense Oligonucleotides-Zebrafish Catalog Number(s): PZF1245 Product Description Morpholino antisense oligonucleotides are shipped as prequantitated, sterile, lyophilized white powder. They are provided as a quantity of 50 nanoMoles. Storage The Morpholino antisense oligonucleotides are shipped individually at ambient temperature. They can be stored at room temperature in the lyophilized and the resuspended form. Preparation for Use To resuspend the 50nanoMole quantity provided, add an appropriate volume of sterile water and vortex briefly. Table 1 lists effective concentrations of Morpholino antisense oligonucleotides in various test systems and methodologies. Table 1: Effective concentrations of Morpholinos in various applications Test System or Methodology Morpholino Concentration Diluent Cell-free translation system1 100 nM to 1000 nM Lysate Microinjection into oocytes Inject 1 to 10 nl of 1 mM Sterile water or buffer oligo into 1µl oocyte giving final concentration of 1 to 10 µM in oocyte Scrape loading cells2 1 µM to 20 µM Media Special delivery to cells3 1µM Delivery solution Morpholino Information Phone: 1-888-412-2225 FAX: 1-256-704-4849 [email protected] V11003 For Research Use Only Detailed information for individual Morpholino antisense oligonucleotides is found in the Open Biosystems clone query (http://www.openbiosystems.com/query) ‘Details’ section. To view the ‘Details’ information for a particular Morpholino perform the following simple steps: 1. Enter the Genbank Accession number into the search list box, choose the corresponding search option in step 2, and click “Go” (Figure 1). Examples of search criteria: Genbank Accession Number: AF004521 Figure 1: Open Biosystems Clone Query 2. On the query results page, click the link entitled “Details” (Figure 2) to view detailed information about the clone (Figure 3). Figure 2: Open Biosystems Clone Query Results Phone: 1-888-412-2225 FAX: 1-256-704-4849 [email protected] V11003 For Research Use Only Figure 3: Open Biosystems Clone Query Details Page Appendix 1 contains information regarding the determination of the concentration of the Morpholino in solution. Overview The Morpholino antisense oligonucleotide collection consists of oligonucleotides corresponding to a non-redundant collection of Zebrafish (Danio rerio) genes. Morpholino oligonucleotides are composed of morpholine (1-oxa-4- azacyclohexane) subunits joined by phosphorodiamidate interlinkages. Each Morpholino subunit contains one of the four genetic bases (Adenine, Cytosine, Guanine, or Thymine). James Summerton developed Morpholino oligonucleotides in 1985. The Phone: 1-888-412-2225 FAX: 1-256-704-4849 [email protected] V11003 For Research Use Only Morpholino structural type was developed using a non-traditional backbone comprised of ribonucleosides (Figure 4). The linkage between the subunits is accomplished by a ribose-to-morpholine transformation, thus eliminating the complex hydroxyl coupling reactions associated with deoxyribose linkages (See Figure 5). Figure 4: Ribonucleoside to Morpholino transformation Diagram courtesy of Gene Tools, LLC (http://www.gene-tools.com) Figure 5: Morpholino oligonucleotide assembly Diagram courtesy of Gene Tools, LLC (http://www.gene-tools.com) The key benefit to this alternate backbone structure is its resistance to nucleases, increased water solubility, increased binding affinity, and increased efficacy in both cell-free and cellular systems as compared to synthetic DNA (S- DNA) and Peptide Nucleic Acid (PNA) antisense oligonucleotides4. Useful websites Phone: 1-888-412-2225 FAX: 1-256-704-4849 [email protected] V11003 For Research Use Only Open Biosystems Clone Query http://www.openbiosystems.com/query Gene Tools: Morpholino Antisense Oligos http://www.morpholino.com References 1 Summerton, J., et al. Morpholino and phosphorothioate antisense oligomers compared in cell-free and in-cell systems. Antisense Nucleic Acid Drug Dev. 7:63-70 (1997). 2 Partridge, M., et. al. A simple method for delivering Morpholino antisense oligos into the cytoplasm of cells. Antisense Nucleic Acid Drug Dev. 6:169- 175 (1996). 3 Morcos, P. A. Achieving efficient delivery of Morpholino oligos in cultured cells. Genesis. 30:94-102 (2001). 4 Summerton, J. and Weller, D. Morpholino antisense oligomers: Design, preparation, and properties. Antisense Res. Dev. 7:187-195 (1997). Phone: 1-888-412-2225 FAX: 1-256-704-4849 [email protected] V11003 For Research Use Only Appendix 1 Open Biosystems provides Morpholinos at a quantity of 50 nanoMoles. If desired, the following equation can be used to determine the concentration of the Morpholino in solution. Determining the Concentration of the Morpholino in Solution Note: This procedure assumes use of a spectrophotometer with a 1cm path length (the most common type). 1. Blank the spectrophotometer with 995 µl of 0.1 N HCL in a quartz cuvette. 2. Add 5 µl of the Morpholino to the 995 µl of 0.1 N HCL. Mix 3. Read the absorbance of this solution at 265 nm on a spectrophotometer. 4. Multiply the absorbance by 200 (to account for the dilution). This = A. 5. Using the Open Biosystems Clone Query, find the molar absorbance of the Morpholino (Figures 1, 2, and 3). This would be the absorbance if the Morpholino were in a 1M solution. This number = ε. 6. The concentration (C) of the Morpholino = A/ε in M. The concentration will most likely be in the range of 0.000001 M = 1 microMolar (µM) to 0.001M = 1milliMolar (mM) Example using Standard Control: Sequence: 5’CCTCTTACCTCAGTTACAATTTATA3’ Molar Absorbance: 259160.00 Molecular Weight: 8341 Phone: 1-888-412-2225 FAX: 1-256-704-4849 [email protected] V11003 For Research Use Only Absorbance of 5 µl Morpholino in 995 µl 0.1 N HCL = 0.645 A= 0.645 x 200 (dilution factor) = 129 ε = 259160 C = A/ε = 129/259160 = 0.000497 M = 497 microMolar (µM) Phone: 1-888-412-2225 FAX: 1-256-704-4849 [email protected] V11003 For Research Use Only .
Load more

Recommended publications
  • Chapter 23 Nucleic Acids
    7-9/99 Neuman Chapter 23 Chapter 23 Nucleic Acids from Organic Chemistry by Robert C. Neuman, Jr. Professor of Chemistry, emeritus University of California, Riverside [email protected] <http://web.chem.ucsb.edu/~neuman/orgchembyneuman/> Chapter Outline of the Book ************************************************************************************** I. Foundations 1. Organic Molecules and Chemical Bonding 2. Alkanes and Cycloalkanes 3. Haloalkanes, Alcohols, Ethers, and Amines 4. Stereochemistry 5. Organic Spectrometry II. Reactions, Mechanisms, Multiple Bonds 6. Organic Reactions *(Not yet Posted) 7. Reactions of Haloalkanes, Alcohols, and Amines. Nucleophilic Substitution 8. Alkenes and Alkynes 9. Formation of Alkenes and Alkynes. Elimination Reactions 10. Alkenes and Alkynes. Addition Reactions 11. Free Radical Addition and Substitution Reactions III. Conjugation, Electronic Effects, Carbonyl Groups 12. Conjugated and Aromatic Molecules 13. Carbonyl Compounds. Ketones, Aldehydes, and Carboxylic Acids 14. Substituent Effects 15. Carbonyl Compounds. Esters, Amides, and Related Molecules IV. Carbonyl and Pericyclic Reactions and Mechanisms 16. Carbonyl Compounds. Addition and Substitution Reactions 17. Oxidation and Reduction Reactions 18. Reactions of Enolate Ions and Enols 19. Cyclization and Pericyclic Reactions *(Not yet Posted) V. Bioorganic Compounds 20. Carbohydrates 21. Lipids 22. Peptides, Proteins, and α−Amino Acids 23. Nucleic Acids **************************************************************************************
    [Show full text]
  • Alternative Biochemistries for Alien Life: Basic Concepts and Requirements for the Design of a Robust Biocontainment System in Genetic Isolation
    G C A T T A C G G C A T genes Review Alternative Biochemistries for Alien Life: Basic Concepts and Requirements for the Design of a Robust Biocontainment System in Genetic Isolation Christian Diwo 1 and Nediljko Budisa 1,2,* 1 Institut für Chemie, Technische Universität Berlin Müller-Breslau-Straße 10, 10623 Berlin, Germany; [email protected] 2 Department of Chemistry, University of Manitoba, 144 Dysart Rd, 360 Parker Building, Winnipeg, MB R3T 2N2, Canada * Correspondence: [email protected] or [email protected]; Tel.: +49-30-314-28821 or +1-204-474-9178 Received: 27 November 2018; Accepted: 21 December 2018; Published: 28 December 2018 Abstract: The universal genetic code, which is the foundation of cellular organization for almost all organisms, has fostered the exchange of genetic information from very different paths of evolution. The result of this communication network of potentially beneficial traits can be observed as modern biodiversity. Today, the genetic modification techniques of synthetic biology allow for the design of specialized organisms and their employment as tools, creating an artificial biodiversity based on the same universal genetic code. As there is no natural barrier towards the proliferation of genetic information which confers an advantage for a certain species, the naturally evolved genetic pool could be irreversibly altered if modified genetic information is exchanged. We argue that an alien genetic code which is incompatible with nature is likely to assure the inhibition of all mechanisms of genetic information transfer in an open environment. The two conceivable routes to synthetic life are either de novo cellular design or the successive alienation of a complex biological organism through laboratory evolution.
    [Show full text]
  • Expanding the Genetic Code Lei Wang and Peter G
    Reviews P. G. Schultz and L. Wang Protein Science Expanding the Genetic Code Lei Wang and Peter G. Schultz* Keywords: amino acids · genetic code · protein chemistry Angewandte Chemie 34 2005 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim DOI: 10.1002/anie.200460627 Angew. Chem. Int. Ed. 2005, 44,34–66 Angewandte Protein Science Chemie Although chemists can synthesize virtually any small organic molecule, our From the Contents ability to rationally manipulate the structures of proteins is quite limited, despite their involvement in virtually every life process. For most proteins, 1. Introduction 35 modifications are largely restricted to substitutions among the common 20 2. Chemical Approaches 35 amino acids. Herein we describe recent advances that make it possible to add new building blocks to the genetic codes of both prokaryotic and 3. In Vitro Biosynthetic eukaryotic organisms. Over 30 novel amino acids have been genetically Approaches to Protein encoded in response to unique triplet and quadruplet codons including Mutagenesis 39 fluorescent, photoreactive, and redox-active amino acids, glycosylated 4. In Vivo Protein amino acids, and amino acids with keto, azido, acetylenic, and heavy-atom- Mutagenesis 43 containing side chains. By removing the limitations imposed by the existing 20 amino acid code, it should be possible to generate proteins and perhaps 5. An Expanded Code 46 entire organisms with new or enhanced properties. 6. Outlook 61 1. Introduction The genetic codes of all known organisms specify the same functional roles to amino acid residues in proteins. Selectivity 20 amino acid building blocks. These building blocks contain a depends on the number and reactivity (dependent on both limited number of functional groups including carboxylic steric and electronic factors) of a particular amino acid side acids and amides, a thiol and thiol ether, alcohols, basic chain.
    [Show full text]
  • Biosynthesis of Ribosylthymine in the Transfer RNA of Streptococcus
    Proc. Nat. Acad. Sci. USA Vol. 72, No. 2, pp. 528-530, February 1975 Biosynthesis of Ribosylthymine in the Transfer RNA of Streptococcus faecalis: A Folate-Dependent Methylation Not Involving S-Adenosylmethionine (thymine/tRNA modification/formate/[methyl-'4Clmethionine/GlT'C-loop) ANN S. DELK AND JESSE C. RABINOWITZ Department of Biochemistry, University of California, Berkeley, Calif. 94720 Communicated by Bruce Ames, November 18, 1974 ABSTRACT Ribosylthymine is not present in tRNA of to produce thymidine 5'-monophosphate, which is sub- Streptococcus faecalis grown in the absence of folic acid, sequently used in DNA synthesis. Because of the folate although this methylated residue does occur in the tRNA of this organism when it is grown in the presence of folate. requirement for T formation in S. faecalis, it appeared possible We have found that, unlike other methylated residues in that methylation of RNA in this organism, particularly in RNA of S. faecalis and other organisms, the methyl moiety the biosynthesis of T, involves a folate derivative and not of ribosylthymine of the tRNA of folate-sufficient S. S-adenosylmethionine. faecalis is not derived from S-adenosylmethionine. Pre- liminary evidence suggests that a folate derivative serves MATERIALS AND METHODS as the methyl donor in this methylation. Unless stated otherwise, S. faecalis (ATCC 8043) and Esche- When grown in the presence of folic acid, Streptococcus richia coli (MRE 600) were grown for several generations in faecalis, like other prokaryotes, initiates protein synthesis
    [Show full text]
  • Replication and Kinetic Trapping of Nucleic Acids in Alternative Environments
    REPLICATION AND KINETIC TRAPPING OF NUCLEIC ACIDS IN ALTERNATIVE ENVIRONMENTS A Dissertation Presented to The Academic Faculty by Adriana Lozoya Colinas In Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the School of Chemistry and Biochemistry Georgia Institute of Technology December 2020 COPYRIGHT © 2020 BY ADRIANA LOZOYA COLINAS REPLICATION AND KINETIC TRAPPING OF NUCLEIC ACIDS IN ALTERNATIVE ENVIRONMENTS Approved by: Dr. Nicholas V. Hud, Advisor Dr. Amanda Stockton School of Chemistry and Biochemistry School of Chemistry and Biochemistry Georgia Institute of Technology Georgia Institute of Technology Dr. Martha A. Grover Dr. Adegboyega (Yomi) Oyelere School of Chemical & Biomolecular School of Chemistry and Biochemistry Engineering Georgia Institute of Technology Georgia Institute of Technology Dr. Loren Williams School of Chemistry and Biochemistry Georgia Institute of Technology Date Approved: October 16, 2020 ACKNOWLEDGEMENTS I would like to thank my mom and dad for all their support and setting up an example for me to follow. I really appreciate everything you have done to encourage me to succeed and follow my dreams. I want to thank Mario for always supporting me. I know it hasn’t always been easy being far away, thank you for being patient and supportive with me. Thank you for the time and adventures we lived together. To all my Latino family at Georgia Tech, thank you for making me feel closer to home. We spent a lot of time together, learned a lot from each other and shared our culture, all of which have made my PhD experience more enjoyable. I would also like to acknowledge my advisor, Nick Hud, for being supportive and sharing his passion for science with me.
    [Show full text]
  • Guide for Morpholino Users: Toward Therapeutics
    Open Access Journal of Drug Discovery, Development and Delivery Special Article - Antisense Drug Research and Development Guide for Morpholino Users: Toward Therapeutics Moulton JD* Gene Tools, LLC, USA Abstract *Corresponding author: Moulton JD, Gene Tools, Morpholino oligos are uncharged molecules for blocking sites on RNA. They LLC, 1001 Summerton Way, Philomath, Oregon 97370, are specific, soluble, non-toxic, stable, and effective antisense reagents suitable USA for development as therapeutics and currently in clinical trials. They are very versatile, targeting a wide range of RNA targets for outcomes such as blocking Received: January 28, 2016; Accepted: April 29, 2016; translation, modifying splicing of pre-mRNA, inhibiting miRNA maturation and Published: May 03, 2016 activity, as well as less common biological targets and diagnostic applications. Solutions have been developed for delivery into a range of cultured cells, embryos and adult animals; with development of a non-toxic and effective system for systemic delivery, Morpholinos have potential for broad therapeutic development targeting pathogens and genetic disorders. Keywords: Splicing; Duchenne muscular dystrophy; Phosphorodiamidate morpholino oligos; Internal ribosome entry site; Nonsense-mediated decay Morpholinos: Research Applications, the transcript from miRNA regulation; Therapeutic Promise • Block regulatory proteins from binding to RNA, shifting Morpholino oligos bind to complementary sequences of RNA alternative splicing; and get in the way of processes. Morpholino oligos are commonly • Block association of RNAs with cytoskeletal motor protein used to prevent a particular protein from being made in an organism complexes, preventing RNA translocation; or cell culture. Morpholinos are not the only tool used for this: a protein’s synthesis can be inhibited by altering DNA to make a null • Inhibit poly-A tailing of pre-mRNA; mutant (called a gene knockout) or by interrupting processes on RNA • Trigger frame shifts at slippery sequences; (called a gene knockdown).
    [Show full text]
  • An Expanded Genetic Code in Mammalian Cells with a Functional Quadruplet Codon Wei Niu University of Nebraska-Lincoln, [email protected]
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by UNL | Libraries University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Faculty Publications -- Chemistry Department Published Research - Department of Chemistry 2013 An Expanded Genetic Code In Mammalian Cells With A Functional Quadruplet Codon Wei Niu University of Nebraska-Lincoln, [email protected] Peter G. Schultz The Scripps Research Institute Jiantao Guo University of Nebraska-Lincoln, [email protected] Follow this and additional works at: http://digitalcommons.unl.edu/chemfacpub Part of the Analytical Chemistry Commons, Medicinal-Pharmaceutical Chemistry Commons, and the Other Chemistry Commons Niu, Wei; Schultz, Peter G.; and Guo, Jiantao, "An Expanded Genetic Code In Mammalian Cells With A Functional Quadruplet Codon" (2013). Faculty Publications -- Chemistry Department. 101. http://digitalcommons.unl.edu/chemfacpub/101 This Article is brought to you for free and open access by the Published Research - Department of Chemistry at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Faculty Publications -- Chemistry Department by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. HHS Public Access Author manuscript Author Manuscript Author ManuscriptACS Chem Author Manuscript Biol. Author Author Manuscript manuscript; available in PMC 2015 July 14. Published in final edited form as: ACS Chem Biol. 2013 July 19; 8(7): 1640–1645. doi:10.1021/cb4001662. An Expanded
    [Show full text]
  • RNA Pull-Down Procedure to Identify RNA Targets of a Long Non-Coding
    RNA Pull-down Procedure to Identify RNA Targets of a Long Non-coding RNA Manon Torres, Denis Becquet, Séverine Guillen, Bénédicte Boyer, Mathias Moreno, Marie-Pierre Blanchard, Jean-Louis Franc, Anne-Marie François-Bellan To cite this version: Manon Torres, Denis Becquet, Séverine Guillen, Bénédicte Boyer, Mathias Moreno, et al.. RNA Pull-down Procedure to Identify RNA Targets of a Long Non-coding RNA. Journal of visualized experiments : JoVE, JoVE, 2018, 10.3791/57379. hal-02093065 HAL Id: hal-02093065 https://hal-amu.archives-ouvertes.fr/hal-02093065 Submitted on 20 Dec 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution - NonCommercial - NoDerivatives| 4.0 International License Journal of Visualized Experiments www.jove.com Video Article RNA Pull-down Procedure to Identify RNA Targets of a Long Non-coding RNA Manon Torres1, Denis Becquet1, Séverine Guillen1, Bénédicte Boyer1, Mathias Moreno1, Marie-Pierre Blanchard2, Jean-Louis Franc1, Anne- Marie François-Bellan1 1 CNRS, CRN2M-UMR7286, Faculté
    [Show full text]
  • Long Non-Coding Rnas Are Largely Dispensable for Zebrafish Embryogenesis, Viability and Fertility
    bioRxiv preprint doi: https://doi.org/10.1101/374702; this version posted July 23, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Long non-coding RNAs are largely dispensable for zebrafish embryogenesis, viability and fertility Mehdi Goudarzi1, Kathryn Berg1, Lindsey M. Pieper1, and Alexander F. Schier1,2,3,4,5 1Department oF Molecular and Cellular Biology, Harvard University, Cambridge, Massachusetts, USA. 2Center For Brain Science, Harvard University, Cambridge, MA 02138, USA., 3FAS Center For Systems Biology, Harvard University, Cambridge, MA 02138, USA., 4Allen Discovery Center For Cell Lineage Tracing, University oF Washington, Seattle, 5 WA 98195, USA., Biozentrum, University oF Basel, Switzerland. Correspondence should be addressed to M.G. ([email protected]) or A.F.S. ([email protected]). Hundreds oF long non-coding RNAs (lncRNAs) have been identiFied as potential regulators oF gene expression, but their Functions remain largely unknown. To study the role oF lncRNAs during vertebrate development, we selected 25 zebraFish lncRNAs based on their conservation, expression proFile or proximity to developmental regulators, and used CRISPR-Cas9 to generate 32 deletion alleles. We observed altered transcription oF neighboring genes in some mutants, but none oF the lncRNAs were required For embryogenesis, viability or Fertility. Even RNAs with previously proposed non-coding Functions (cyrano and squint) and other conserved lncRNAs (gas5 and lnc-setd1ba) were dispensable. In one case (lnc-phox2bb), absence oF putative DNA regulatory-elements, but not of the lncRNA transcript itselF, resulted in abnormal development.
    [Show full text]
  • A Standard Reference Frame for the Description of Nucleic Acid Base-Pair Geometry Wilma K
    doi:10.1006/jmbi.2001.4987 available online at http://www.idealibrary.com on J. Mol. Biol. (2001) 313, 229±237 NOMENCLATURE A Standard Reference Frame for the Description of Nucleic Acid Base-pair Geometry Wilma K. Olson, Manju Bansal, Stephen K. Burley Richard E. Dickerson, Mark Gerstein, Stephen C. Harvey Udo Heinemann, Xiang-Jun Lu, Stephen Neidle, Zippora Shakked Heinz Sklenar, Masashi Suzuki, Chang-Shung Tung, Eric Westhof Cynthia Wolberger and Helen M. Berman # 2001 Academic Press Keywords: nucleic acid conformation; base-pair geometry; standard reference frame A common point of reference is needed to N1-C10 ÁÁÁC10 virtual angles consistent with values describe the three-dimensional arrangements of observed in the crystal structures of relevant small bases and base-pairs in nucleic acid structures. The molecules. Conformational analyses performed in different standards used in computer programs this reference frame lead to interpretations of local created for this purpose give rise to con¯icting helical structure that are essentially independent of interpretations of the same structure.1 For example, computational scheme. A compilation of base-pair parts of a structure that appear ``normal'' accord- parameters from representative A-DNA, B-DNA, ing to one computational scheme may be highly and protein-bound DNA structures from the unusual according to another and vice versa.Itis Nucleic Acid Database (NDB)4 provides useful thus dif®cult to carry out comprehensive compari- guidelines for understanding other nucleic acid sons of nucleic acid structures and to pinpoint structures. unique conformational features in individual struc- tures. In order to resolve these issues, a group of Base coordinates researchers who create and use the different soft- ware packages have proposed the standard base Models of the ®ve common bases (A, C, G, T reference frames outlined below for nucleic acid and U) were generated from searches of the crystal conformational analysis.
    [Show full text]
  • Targeting Protein Translation, RNA Splicing, and Degradation by Morpholino-Based Conjugates in Plasmodium Falciparum
    Targeting protein translation, RNA splicing, and degradation by morpholino-based conjugates in Plasmodium falciparum Aprajita Garga, Donna Wesolowskib, Dulce Alonsob,1, Kirk W. Deitschc, Choukri Ben Mamouna, and Sidney Altmanb,2 aDepartment of Internal Medicine, Yale University School of Medicine, New Haven, CT 06520; bDepartment of Molecular, Cellular and Developmental Biology, Yale University, New Haven, CT 06520; and cDepartment of Microbiology and Immunology, Weill Medical College of Cornell University, New York, NY 10065 Contributed by Sidney Altman, August 11, 2015 (sent for review May 27, 2015; reviewed by Ron Dzikowski and Rima Mcleod) Identification and genetic validation of new targets from available same targets, MO conjugates have also been used to inhibit RNA genome sequences are critical steps toward the development of splicing and initiation of protein translation (9, 17, 18). new potent and selective antimalarials. However, no methods are To enhance cellular uptake of morpholino oligomers and other currently available for large-scale functional analysis of the Plasmo- drug-like molecules, arginine-rich peptides and polyguanidino dium falciparum genome. Here we present evidence for successful dendrimers have been used (19–23). For morpholino-based anti- use of morpholino oligomers (MO) to mediate degradation of target microbial activity, two types of conjugates have been developed, mRNAs or to inhibit RNA splicing or translation of several genes of PPMOs and vivo morpholino oligomers (VMOs, octa-guanidinium P. falciparum involved in chloroquine transport, apicoplast biogen- dendrimer-conjugated MOs; Materials and Methods). PPMOs are esis, and phospholipid biosynthesis. Consistent with their role in the produced following conjugation of a specific MO to a cell-pen- parasite life cycle, down-regulation of these essential genes resulted etrating, arginine-rich peptide, whereas VMOs are synthesized in inhibition of parasite development.
    [Show full text]
  • Advances in Oligonucleotide Drug Delivery
    REVIEWS Advances in oligonucleotide drug delivery Thomas C. Roberts 1,2 ✉ , Robert Langer 3 and Matthew J. A. Wood 1,2 ✉ Abstract | Oligonucleotides can be used to modulate gene expression via a range of processes including RNAi, target degradation by RNase H-mediated cleavage, splicing modulation, non-coding RNA inhibition, gene activation and programmed gene editing. As such, these molecules have potential therapeutic applications for myriad indications, with several oligonucleotide drugs recently gaining approval. However, despite recent technological advances, achieving efficient oligonucleotide delivery, particularly to extrahepatic tissues, remains a major translational limitation. Here, we provide an overview of oligonucleotide-based drug platforms, focusing on key approaches — including chemical modification, bioconjugation and the use of nanocarriers — which aim to address the delivery challenge. Oligonucleotides are nucleic acid polymers with the In addition to their ability to recognize specific tar- potential to treat or manage a wide range of diseases. get sequences via complementary base pairing, nucleic Although the majority of oligonucleotide therapeutics acids can also interact with proteins through the for- have focused on gene silencing, other strategies are being mation of three-dimensional secondary structures — a pursued, including splice modulation and gene activa- property that is also being exploited therapeutically. For tion, expanding the range of possible targets beyond example, nucleic acid aptamers are structured
    [Show full text]