
Morpholino Antisense Oligonucleotides-Zebrafish Catalog Number(s): PZF1245 Product Description Morpholino antisense oligonucleotides are shipped as prequantitated, sterile, lyophilized white powder. They are provided as a quantity of 50 nanoMoles. Storage The Morpholino antisense oligonucleotides are shipped individually at ambient temperature. They can be stored at room temperature in the lyophilized and the resuspended form. Preparation for Use To resuspend the 50nanoMole quantity provided, add an appropriate volume of sterile water and vortex briefly. Table 1 lists effective concentrations of Morpholino antisense oligonucleotides in various test systems and methodologies. Table 1: Effective concentrations of Morpholinos in various applications Test System or Methodology Morpholino Concentration Diluent Cell-free translation system1 100 nM to 1000 nM Lysate Microinjection into oocytes Inject 1 to 10 nl of 1 mM Sterile water or buffer oligo into 1µl oocyte giving final concentration of 1 to 10 µM in oocyte Scrape loading cells2 1 µM to 20 µM Media Special delivery to cells3 1µM Delivery solution Morpholino Information Phone: 1-888-412-2225 FAX: 1-256-704-4849 [email protected] V11003 For Research Use Only Detailed information for individual Morpholino antisense oligonucleotides is found in the Open Biosystems clone query (http://www.openbiosystems.com/query) ‘Details’ section. To view the ‘Details’ information for a particular Morpholino perform the following simple steps: 1. Enter the Genbank Accession number into the search list box, choose the corresponding search option in step 2, and click “Go” (Figure 1). Examples of search criteria: Genbank Accession Number: AF004521 Figure 1: Open Biosystems Clone Query 2. On the query results page, click the link entitled “Details” (Figure 2) to view detailed information about the clone (Figure 3). Figure 2: Open Biosystems Clone Query Results Phone: 1-888-412-2225 FAX: 1-256-704-4849 [email protected] V11003 For Research Use Only Figure 3: Open Biosystems Clone Query Details Page Appendix 1 contains information regarding the determination of the concentration of the Morpholino in solution. Overview The Morpholino antisense oligonucleotide collection consists of oligonucleotides corresponding to a non-redundant collection of Zebrafish (Danio rerio) genes. Morpholino oligonucleotides are composed of morpholine (1-oxa-4- azacyclohexane) subunits joined by phosphorodiamidate interlinkages. Each Morpholino subunit contains one of the four genetic bases (Adenine, Cytosine, Guanine, or Thymine). James Summerton developed Morpholino oligonucleotides in 1985. The Phone: 1-888-412-2225 FAX: 1-256-704-4849 [email protected] V11003 For Research Use Only Morpholino structural type was developed using a non-traditional backbone comprised of ribonucleosides (Figure 4). The linkage between the subunits is accomplished by a ribose-to-morpholine transformation, thus eliminating the complex hydroxyl coupling reactions associated with deoxyribose linkages (See Figure 5). Figure 4: Ribonucleoside to Morpholino transformation Diagram courtesy of Gene Tools, LLC (http://www.gene-tools.com) Figure 5: Morpholino oligonucleotide assembly Diagram courtesy of Gene Tools, LLC (http://www.gene-tools.com) The key benefit to this alternate backbone structure is its resistance to nucleases, increased water solubility, increased binding affinity, and increased efficacy in both cell-free and cellular systems as compared to synthetic DNA (S- DNA) and Peptide Nucleic Acid (PNA) antisense oligonucleotides4. Useful websites Phone: 1-888-412-2225 FAX: 1-256-704-4849 [email protected] V11003 For Research Use Only Open Biosystems Clone Query http://www.openbiosystems.com/query Gene Tools: Morpholino Antisense Oligos http://www.morpholino.com References 1 Summerton, J., et al. Morpholino and phosphorothioate antisense oligomers compared in cell-free and in-cell systems. Antisense Nucleic Acid Drug Dev. 7:63-70 (1997). 2 Partridge, M., et. al. A simple method for delivering Morpholino antisense oligos into the cytoplasm of cells. Antisense Nucleic Acid Drug Dev. 6:169- 175 (1996). 3 Morcos, P. A. Achieving efficient delivery of Morpholino oligos in cultured cells. Genesis. 30:94-102 (2001). 4 Summerton, J. and Weller, D. Morpholino antisense oligomers: Design, preparation, and properties. Antisense Res. Dev. 7:187-195 (1997). Phone: 1-888-412-2225 FAX: 1-256-704-4849 [email protected] V11003 For Research Use Only Appendix 1 Open Biosystems provides Morpholinos at a quantity of 50 nanoMoles. If desired, the following equation can be used to determine the concentration of the Morpholino in solution. Determining the Concentration of the Morpholino in Solution Note: This procedure assumes use of a spectrophotometer with a 1cm path length (the most common type). 1. Blank the spectrophotometer with 995 µl of 0.1 N HCL in a quartz cuvette. 2. Add 5 µl of the Morpholino to the 995 µl of 0.1 N HCL. Mix 3. Read the absorbance of this solution at 265 nm on a spectrophotometer. 4. Multiply the absorbance by 200 (to account for the dilution). This = A. 5. Using the Open Biosystems Clone Query, find the molar absorbance of the Morpholino (Figures 1, 2, and 3). This would be the absorbance if the Morpholino were in a 1M solution. This number = ε. 6. The concentration (C) of the Morpholino = A/ε in M. The concentration will most likely be in the range of 0.000001 M = 1 microMolar (µM) to 0.001M = 1milliMolar (mM) Example using Standard Control: Sequence: 5’CCTCTTACCTCAGTTACAATTTATA3’ Molar Absorbance: 259160.00 Molecular Weight: 8341 Phone: 1-888-412-2225 FAX: 1-256-704-4849 [email protected] V11003 For Research Use Only Absorbance of 5 µl Morpholino in 995 µl 0.1 N HCL = 0.645 A= 0.645 x 200 (dilution factor) = 129 ε = 259160 C = A/ε = 129/259160 = 0.000497 M = 497 microMolar (µM) Phone: 1-888-412-2225 FAX: 1-256-704-4849 [email protected] V11003 For Research Use Only .
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages7 Page
-
File Size-