The Involvement of the Kynurenine Pathway in Parkinson’S Disease in Vitro Models

Home , Formamidase, Kynureninase, Mitochondrial DNA, Traxoprodil, Tryptophan hydroxylase

THE INVOLVEMENT OF THE KYNURENINE PATHWAY IN PARKINSON’S DISEASE IN VITRO MODELS

A thesis submitted in fulfilment of the requirements for the degree of Doctor of Philosophy

March 2012

The Neuroinflammation group School of Medical Sciences The University of New South Wales

i Abstract

Parkinson’s disease (PD) is caused by a progressive loss of dopaminergic neurons in the Substantia Nigra (SN) in patients. The kynurenine pathway (KP) of tryptophan (TRP) metabolism is a key regulatory mechanism of the immune response. The KP is activated in several neuroinflammatory diseases and is likely to be involved in PD pathogenesis. Activation of the KP can lead to production of the excitotoxin quinolinic acid (QUIN) or neuroprotective metabolites such as picolinic acid (PIC) or kynurenic acid (KYNA). The first rate-limiting inducible enzyme of the KP is indoleamine 2,3-dioxygenase (IDO). We hypothesise that the KP in human dopaminergic neurons may lead to the production of neuroprotective KP metabolites and that these neurons will be very sensitive to QUIN excitotoxicity produced by microglia. The main findings of this project are: 1) establishment of an in vitro model of human dopaminergic neurons differentiated from human neuroblastoma cell lines, 2) a primary human in vitro model for dopaminergic neurons established by optimisation of an isolation procedure and culture conditions of neurons derived from human foetal SN, 3) full characterisation of KP in these models by HPLC, GC/MS and quantitative RT-PCR, 4) the KP is highly activated in dopaminergic neurons in inflammatory conditions and is shifted toward production of neuroprotective metabolites, 5) QUIN is neurotoxic for dopaminergic neurons, causing neuronal loss and denervation. In conclusion, this study provides new in vitro models for human dopaminergic models and strong evidence for the involvement of KP in PD pathogenesis and that this is associated with inflammation. This study provides important tools to investigate mechanisms of dopaminergic neuronal death and may suggest various neuroprotective strategies for future development based on KP modulation.

ii Declaration relating to disposition of project thesis/dissertation

I hereby grant to the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or in part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all property rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation.

I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstracts International (this is applicable to doctoral theses only).

Signed ……………………………………………......

Date ……………………………………………......

Witness …………………………………………………...

iii ORIGINALITY STATEMENT

‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.’

Signed ……………………………………………......

Date ……………………………………………......

iv Acknowledgements First, I would like to express my gratitude to my supervisor, A/Prof. Gilles Guillemin, for giving me the opportunity to undertake this PhD project. I appreciate your supervision, continuous support, deep expertise, and critical comments throughout my candidature. Your great enthusiasm, humour and positive attitude made my experience rewarding and enjoyable. I would like to believe that my thinking and writing are clearer, all as a result of your guidance. I would like to thank Prof Kay Double, my co-supervisor, for her support and valuable advises. I gratefully thank our collaborators from Spain, Prof Herrero and Prof Barcia for generously sharing your great knowledge on Parkinson’s disease and your recourses. You have provided us with results of valuable experiments, which put a base to this study. Lots of thanks to my colleges at Neuroinflammation unit, you shared with me your knowledge, time and experience. Thank you Dr Edwin Lim, Ms Seray Adams and Ms Priyanka Anand for the help with HPLC and GC/MS experiments. I have made many friends along the way: Ms Gayathri Sundaram, Dr Nady Braidy, Ms Jon-Min Lee, Ms Seray Adams and Ms Gloria Castellano, thank you all for day-to-day consults, valuable comments and good laugh. A special thank you for Ms Sonia Bustamante (BMSF, UNSW)) and Dr Alexandrer Macmillan (BMIF, UNSW) for their great patience and assistance with the experiments. This thesis would not have been possible without everyone’s supports. The PhD journey was very challenging for me and as a result left me with so many people I would love to thank. I would like to thank my colleges from Diabetes Transplant Unit: Dr Catalina Palma, Dr Methichit Chayosumrit, Dr Kerstin Brand and Dr Estella Sanchez. Your friendship, support and encouragement helped me a lot. My deepest gratitude goes to my family including my daughters Dana and Keren, my mum and dad, my grandmother Feiga and many more relatives who have always believed in me and supported me through these times. I would like to thank to my husband, Slav, not only for providing his editing and programming skills but also for the encouragement, great support and love. I recognize that this research would not have been possible without the financial assistance of Parkinson’s NSW. Thank you for your support and the hope that you give to those suffering with this devastating disease. Finally, I would like to consider this study to be the start of a promising future research, rather than only a dissertation.

v Publications

Zinger A, Barcia C, Hererro MT, Guillemin GJ. “The involvement of Neuroinflammation and Kynurenine Pathway in Parkinson’s disease”, Parkinson’s Disease, 2011. Article ID 716859

Zinger A, Barcia C, Hererro MT, Guillemin GJ. “Characterization of Kynurenine pathway in human dopaminergic neurons” (in preparation).

vi Awards Postgraduate Research Student Scholarship Travel Grant

International Conference on Alzheimer's and Parkinson's Diseases, 2011

School of Medical Sciences Research Travel Award Australian Neuroscience Society (ANS) 2011

Seed grant Parkinson's NSW Research grant program, 2010.

School of Medical Sciences Research Travel Award 5th AH&MR Congress, 2010

UNSW Commercialisation Training Scheme Research Scholarship, 2010-2011.

Australian Postgraduate Award, 2008-2011

Rising star dean’s award, 2008-2011

vii List of abbreviations

3HAA 3-Hydroxyanthranilic acid 3HAAO 3-Hydroxyanthranilic acid oxygenase 3HK 3-Hydroxykynurenine 5HT 5-Hydroxytryptamine 5HIIA 5-Hydroxyindoleacetic acid

ACMS Aminocarboxymuconate semialdehyde ACMSD Aminocarboxymuconate semialdehyde decarboxylase ACTB Actin beta AC Adenylyl cyclase AFMID Arylformamidase AraC Arabinofuranosyl Cytidine

BBB Blood-brain barrier BSA Bovine serum albumin BCA Bicinchoninic acid BDNF Brain-derived neurotrophic factor B2M Beta-2 microglobulin cDNA complementary DNA CNS Central nervous system CSF Cerebrospinal fluid COX Cyclo oxygenase

DAPI 4’,6-Diamidino-2-phenylindole Db-cAMP Dibutyryladenosine 3':5' cyclic monophosphate DNA Deoxyribonucleic acid DNase I Deoxyribonuclease I dNTPs Deoxynucleotide triphosphates DAT Dopamine transporter EDTA Ethylenediaminetetraacetic acid

1 FBS Fetal bovine serum

GABA γ-Aminobutyric acid GAPDH Glyceraldehyde phosphate dehydrogenase GAD Glutamic acid decarboxylase GCH1 GTP cyclohydroxilase 1 GC/MS Gas chromatography/mass spectrometry GOT2 Glutamic-oxaloacetic transaminase 2 GPi Internal paladial segment GPe External paladial GPR G-protein coupled receptor

HAAO 3-Hydroxyanthranilate 3,4-dioxygenase HPRT Hypoxanthine-guanine phosphoribosyltransferase HPLC High performance liquid chromatography

IDO Indoleamine, 2-3 dioxygenase IFN- Interferon

KAT Kynurenine aminotransferase KMO Kynurenine 3-monooxygenase KP Kynurenine pathway KYN Kynurenine KYNA Kynurenic acid

KYNU L-Kynurenine hydrolase LDH Lactate dehydrogenase LB Lewy body LPS Lipopolysaccharide

MAO Monoamine oxidase MAP2 Microtubule-associated protein 2 MHC Major histocompatibility complex MPTP 1-Methyl-4-phenyl-1,2,3,6-tetra-pyridine MPP+ 1-Methyl-4-phenylpyridinium

2 mRNA Messenger RNA

NADPH Nicotinamide adenine dinucleotide phosphate NAD+ Nicotinamide adenine dinucleotide NGF Neuronal growth factor NeuN Neuronal Nuclei NO Nitric oxide NOS Nitric oxide synthase NMDA N-methyl-D-aspartate NMDAR N-methyl-D-aspartate receptor NSAID Nonsteroidal anti-inflammatory drugs PD Parkinson’s disease PIC Picolinic acid PS Penicillin/streptomycin QPRT Quinolinate phosphoribosyltransferase QUIN Quinolinic acid ROS Reactive oxygen species RNA Ribonucleic acid RNS Repetitive nerve stimulation RT-PCR Reverse transcriptase-polymerase chain reaction SN Substantia nigra SNpc Substantia nigra pars compacta SNpr Substantia nigra pars reticulata SYN Alpha synuclein STN Subthalamic nucleus

TDO Tryptophan 2-3 dioxygenase TH Tyrosine hydroxylase TPH Tryptophan hydroxylase

TRP L-Tryptophan

UPDRS Unified Parkinson's Disease Rating Scale

VTA Ventral tegmental area

TABLE OF CONTENTS

Abstract ...... ii

Declaration relating to disposition of project thesis/dissertation...... iii

ORIGINALITY STATEMENT ...... iv

Acknowledgements ...... v

Publications ...... vi

Awards ...... vii

List of abbreviations ...... 1

List of figures ...... 12

List of tables ...... 17

CHAPTER 1 : INTRODUCTION ...... 18

1.1 Introduction ...... 19

1.2 Research approach ...... 21

CHAPTER 2 : LITERATURE REVIEW...... 22

2.1 Parkinson’s disease ...... 23 2.1.1 Loss of dopaminergic neurons: ...... 23 2.1.2 Lewy bodies:...... 25 2.1.3 Basal ganglia motor circuit and Nigrostriatal pathway ...... 26

2.2 Underlying causes of Parkinson’s disease: ...... 28 2.2.1 Toxins: ...... 29 2.2.2 Genes: ...... 29 2.2.3 Mitochondria dysfunction and oxidative stress: ...... 31 2.2.4 Discovery of MPTP: ...... 32 2.2.5 Microglia and microgliosis:...... 33 2.2.6 Role of neuroinflammation in the pathogenesis of PD: ...... 36 2.2.6.1 In vitro/in vivo: ...... 36

2.2.6.2 Human studies ...... 37 2.2.7 Role of NMDA receptor:...... 40 2.2.8 Excitotoxicity ...... 42 2.2.9 Current and potential treatments in Parkinson’s disease: ...... 44 2.2.9.1 Dopamine replacement strategy ...... 45

2.2.9.2 Adenosine A2A antagonists...... 46 2.2.9.3 Monoamine oxidase B inhibitors ...... 47 2.2.9.4 Dopamine agonists ...... 48 2.2.9.5 NMDA receptor antagonists ...... 49 2.2.9.6 Anti-inflammatory drugs ...... 50 2.2.9.7 Antioxidants ...... 51 2.2.9.8 Non-pharmacological treatments ...... 52 2.2.9.9 Future perspectives ...... 54

2.3 The Kynurenine pathway...... 56 ...... 58 2.3.1 Neuroactive kynurenine metabolites ...... 58 2.3.1.1 3-hydroxyanthranilic acid (3HAA) and 3-hydroxykynurenine (3-HK)...... 58 2.3.1.2 Quinolinic acid ...... 59 2.3.1.3 Kynurenic acid ...... 60 2.3.1.4 Picolinic acid ...... 60

2.4 Evidence for the involvement of the KP in PD...... 62 2.4.1 Recent KP inhibitors for the Treatment of PD ...... 63 2.4.1.1 Enzyme inhibitors ...... 64 2.4.1.2 Analogues of KP metabolites ...... 64 2.4.1.3 Pro-drugs ...... 65 2.4.2 Conclusion ...... 65

CHAPTER 3 : MATERIALS AND METHODS ...... 67

3.1 Overview of the methods used in the study ...... 68 3.1.1 Culture and differentiation of human neuroblastoma cell lines ...... 68 3.1.2 Culture of human macrophages cell line ...... 68 3.1.3 Isolation and culture of primary dopaminergic neurons ...... 68 3.1.4 Real-time quantitative polymerase chain reaction (RT-qPCR) ...... 68 3.1.4.1 Materials...... 68 3.1.4.2 Total RNA extraction ...... 69 3.1.4.3 cDNA synthesis...... 69

3.1.4.4 Quantitative PCR ...... 70 3.1.5 Design and validation of oligonucleotides for PCR amplification ...... 70 3.1.6 Immunocytochemistry analysis ...... 71 3.1.6.1 Materials...... 71 3.1.6.2 Immunocytochemistry procedure ...... 71 3.1.7 Gas chromatography/mass spectrometry (GC/MS)...... 72 3.1.7.1 Materials...... 72 3.1.7.2 GC/MS method ...... 73 3.1.8 High performance liquid chromatography (HPLC) ...... 73 3.1.8.1 Materials...... 73 3.1.8.2 HPLC method ...... 74 3.1.8.3 Ammonium acetate buffer preparation ...... 75 3.1.9 Statistical analysis ...... 75

CHAPTER 4 : VALIDATION OF A RELIABLE SET OF PRIMERS FOR MEASURING EXPRESSION OF KYNURENINE PATHWAY GENES BY REAL-TIME QUANTITATIVE RT-PCR IN HUMAN CELLS ...... 76

4.1 Introduction ...... 77 4.1.1 Kynurenine pathway enzymes ...... 78 4.1.1.1 Indoleamine 2,3-dioxygenase 1 and 2 (IDO1 and IDO2) ...... 78 4.1.1.2 Arylformamidase (AFMID) ...... 79 4.1.1.3 Tryptophan 2,3-dioxygenase (TDO2) ...... 79 4.1.1.4 Tryptophan hydroxylase 1 and 2 (TPH1)...... 79 4.1.1.5 Monoamine oxidase A and monoamine oxidase B (MAOA and MAOB) ...... 80 4.1.1.6 Kynurenine aminotransferase 1, 2 and 3 (KAT1, KAT2, KAT3) ...... 80 4.1.1.7 Glutamic-oxaloacetic transaminase 2 (GOT2) ...... 81 4.1.1.8 Kynurenine 3-monooxygenase (KMO)...... 81 4.1.1.9 Kynureninase or L-kynurenine hydrolase (KYNU) ...... 81 4.1.1.10 3-Hydroxyanthranilate 3,4-dioxygenase (3HAAO) ...... 82 4.1.1.11 Quinolinate phosphoribosyltransferase (QPRT) ...... 82 4.1.1.12 Aminocarboxymuconate semialdehyde decarboxylase (ACMSD) ...... 82 4.1.2 Aims ...... 83 4.1.3 Rationale ...... 83 4.1.4 Study step-wise approach ...... 83

4.2 Materials and methods ...... 85 4.2.1 Cell cultures and tissue isolation ...... 85

4.2.1.1 Materials...... 85 4.2.1.2 Tissue culture of U973 macrophages-derived cell line ...... 85 4.2.1.3 Tissue isolation...... 86 4.2.2 Real-time quantitative polymerase chain reaction (RT-qPCR) ...... 86 4.2.2.1 Materials...... 86 4.2.2.2 Tissue homogenizing ...... 87 4.2.2.3 Total RNA extraction ...... 87 4.2.2.4 RNA integrity number (RIN) ...... 87 4.2.2.5 cDNA synthesis...... 87 4.2.2.6 Design of primers and test of amplification efficiency ...... 87 4.2.2.7 Quantitative PCR ...... 88

4.3 Results ...... 89 4.3.1 Primers design ...... 89 4.3.1.1 Basic Local Alignment Search Tool ( BLAST) ...... 92 4.3.1.2 NetPrimer ...... 93 4.3.1.3 Amplify 3x ...... 95 4.3.1.4 Primer-check ...... 96 4.3.2 RNA quality...... 97 4.3.3 Primer concentration ...... 99 4.3.4 Finding appropriate type of cells/tissue ...... 100 4.3.5 Single amplicon and quality of amplification ...... 101 4.3.6 PCR efficiency ...... 102

4.4 Discussion ...... 109 4.4.1 Routine use of primers...... 109

CHAPTER 5 : DEVELOPMENT OF IN VITRO MODEL FOR DOPAMINERGIC HUMAN NEURONS DERIVED FROM A NEUROBLASTOMA CELL LINE AND CHARACTERIZATION OF THE KP THEREIN ...... 110

5.1 Introduction ...... 111 5.1.1 Neuroblastoma cell lines as an in vitro model of dopaminergic neurons ...... 111 5.1.2 Characterization of the kynurenine pathway in dopaminergic neurons ...... 112 5.1.3 Aims ...... 112 5.1.4 Rationale ...... 112 5.1.5 Hypothesis...... 113

5.2 Materials and methods: ...... 114

5.2.1 Cell cultures ...... 114 5.2.1.1 Materials...... 114 5.2.1.2 Routine culture of cell lines ...... 114 5.2.1.3 Cryopreservation of SH-SY5Y and SK-N-SH cells ...... 115 5.2.1.4 Thawing cryopreserved SH-SY5Y and SK-N-SH cells ...... 115 5.2.1.5 Differentiation protocol number 1 ...... 115 5.2.1.6 Differentiation protocol number 2 ...... 116 5.2.1.7 Differentiation protocol number 3 ...... 116 5.2.2 Real time quantitative reverse transcriptase polymerase chain reaction (RT-qPCR) ...... 116 5.2.2.1 Controls ...... 116 5.2.2.2 RNA extraction and cDNA preparation ...... 116 5.2.2.3 RT-qPCR reaction ...... 116 5.2.3 Immunocytochemistry ...... 116 5.2.4 HPLC ...... 117 5.2.5 GCMS ...... 117

5.3 Results ...... 118 5.3.1 Establishment of dopaminergic in vitro model for KP research ...... 118 5.3.1.1 Differentiation protocols selection ...... 118 5.3.1.2 Morphology of undifferentiated neuroblastoma cell lines ...... 119 5.3.1.3 Morphology of differentiated neuroblastoma cell lines ...... 121 5.3.1.4 Expression of neuronal markers in differentiated neuroblastoma cell lines ...... 124 5.3.1.5 Further optimization of differentiation protocols ...... 126 5.3.1.6 Choosing the optimal protocol to study KP expression ...... 131 5.3.2 Validation of the chosen differentiation protocol for KP investigation ...... 132 5.3.2.1 Expression of NMDAR subunit genes ...... 132 5.3.2.2 Expression of the KP enzyme genes in undifferentiated versus differentiated SH-SY5Y cells ...... 133 5.3.3 KP characterization in differentiated SH-SY5Y cells ...... 136 5.3.3.1 KP induction ...... 136 5.3.3.2 Gene expression of KP enzymes ...... 137 5.3.3.3 Quantification of KP metabolites ...... 142

5.4 Discussion ...... 147 5.4.1 Development of human dopaminergic neurons in vitro model ...... 147 5.4.2 Characterization of KP in human dopaminergic neurons in vitro model ...... 150

CHAPTER 6 : ISOLATION OF HUMAN FOETAL PRIMARY DOPAMINERGIC NEURONS AND CHARACTERIZATION OF THE KP THEREIN...... 155

6.1 Introduction ...... 156 6.1.1 Primary dopaminergic neurons in culture...... 156 6.1.2 Aims ...... 156 6.1.3 Rationale for the characterisation of the KP in primary foetal human dopaminergic neurons ...... 157 6.1.4 Hypothesis...... 157

6.2 Materials and methods ...... 158 6.2.1 Isolation and culture of human foetal primary dopaminergic neurons ...... 158 6.2.1.1 Materials...... 158 6.2.1.2 Culture plate coating ...... 158 6.2.1.3 Tissue isolation...... 159 6.2.1.4 Isolation of human foetal dopaminergic neurons ...... 159 6.2.1.5 Further changes to the protocol ...... 160 6.2.1.6 Culture of primary dopaminergic neurons ...... 160 6.2.2 Real-time RT-qPCR ...... 161 6.2.2.1 Controls ...... 161 6.2.2.2 RNA isolation and cDNA preparation ...... 161 6.2.2.3 RT-qPCR reaction ...... 161 6.2.3 Immunocytochemistry ...... 161 6.2.4 HPLC ...... 161 6.2.5 GCMS ...... 161

6.3 Results ...... 162 6.3.1 Establishment of primary dopaminergic in vitro model for KP research ...... 162 6.3.1.1 Protocol selection ...... 162 6.3.1.2 Elimination of non-neuronal cells from dopaminergic culture ...... 162 6.3.1.3 Expression of neuronal markers in isolated human foetal dopaminergic neurons ...... 164 6.3.1.4 NMDAR subunit expression ...... 167 6.3.2 KP characterisation in primary dopaminergic in vitro model ...... 169 6.3.2.1 Gene expression of KP enzymes in dopaminergic neurons ...... 169 6.3.2.2 Quantification of KP metabolites ...... 172

6.4 Discussion ...... 177 6.4.1 Primary in vitro model of human dopaminergic neurons derived from foetal brain ...... 177 6.4.2 Characterization of KP in primary in vitro model of human foetal dopaminergic neurons.... 180

CHAPTER 7 : QUINOLINIC ACID TOXICITY ...... 183

7.1 Introduction ...... 184 7.1.1 QUIN toxicity in human neurons ...... 184 7.1.2 Aims ...... 184 7.1.3 Rationale ...... 185 7.1.4 Hypothesis...... 185

7.2 Materials and methods ...... 186 7.2.1 Isolation and culture of human foetal primary dopaminergic neurons ...... 186 7.2.1.1 Materials...... 186 7.2.1.2 Cell cultures ...... 187 7.2.1.3 QUIN toxicity induction ...... 187 7.2.1.4 Extracellular LDH activity as a measurement of cytotoxicity ...... 187 7.2.1.5 BCA Protein Assay for the Quantification of Total Protein ...... 187 7.2.1.6 Live cells real-time imaging...... 188 7.2.1.7 ...... 189

7.3 Results ...... 190 7.3.1 QUIN toxicity in dopaminergic in vitro model derived from neuroblastoma cell line ...... 190 7.3.2 Neurodegeneration assessment by neurite extension analysis ...... 191

7.4 Discussion ...... 194

CHAPTER 8 : CONCLUSIONS AND FUTURE STUDIES ...... 197

8.1 Conclusions ...... 198

8.2 Limitations and future study ...... 204 8.2.1 Human foetal dopaminergic neurons primary cultures ...... 204 8.2.2 Ex vivo study limitation ...... 204 8.2.3 Toxicity studies ...... 204 8.2.4 Co-culture of dopaminergic neurons with microglia cells and KP inhibitors ...... 204 8.2.5 Characterization of KP in mice, macaque and human brain samples and CSF ...... 205 8.2.6 Correlation of PD severity with KP expression in mouse and macaque PD models – potential biomarker for early PD ...... 205 8.2.7 Tranilast and 1-MT trial in mouse and macaque PD models ...... 205 8.2.8 Further validation of in vitro models ...... 206

APPENDIX FOR CHAPTER 4 ...... 207

APPENDIX FOR CHAPTER 5 ...... 218

REFERENCES ...... 223

List of figures Figure 1-1 Outline of experiments in chapters 4-7...... 21 Figure 2-1: Nigrostriatal pathway...... 24 Figure 2-2 Depigmentation of SN in the brain of advanced PD patient versus the same region in normal brain...... 25 Figure 2-3 Tissue from patients with dementia with Lewy bodies immunostained for α-synuclein ...... 26 Figure 2-4: Model of basal ganglia changes under normal (a) and PD condition (b). 27 Figure 2-5: The MPTP model of Parkinson's disease...... 33 Figure 2-6: Schematic and fluorescent microscope image of resting versus activated microglia...... 34 Figure 2-7: MRI imaging with PK1195 binding, selective marker of activated microglia...... 38 Figure 2-8 Schematic structure of NMDA receptor...... 41 Figure 2-9: Cycle of mitochondrial dysfunction and excitotoxicity...... 44 Figure 2-10: Overview of tryptophan metabolism in CNS...... 56 Figure 2-11: Schematic view of tryptophan metabolism along kynurenine pathway. 58 Figure 2-12: Model for Kynurenine pathway interactions between astrocytes, neurons, and microglia during brain inflammation...... 63 Figure 2-13 The possible role of Kynurenine pathway involvement in dopaminergic neurodegenerative process through microglia activation: ...... 66 Figure 4-1 Schematic summary of the major KP metabolites and enzymes...... 78 Figure 4-2: Schematic approach to primers’ optimisation study ...... 84 Figure 4-3: Cultured macrophages at low and high confluence. ATCC ...... 85 Figure 4-4: Example of BLAST output for IDO1 primer pair. Red frame highlightes 100% coverage with accession number of IDO1...... 92 Figure 4-5: Example of NetPrimer output...... 94 Figure 4-6: Example of Amplify 3X output...... 95 Figure 4-7: Difference between primers spanning and flanking intron/exon junctions...... 96 Figure 4-8: Example of Primer-check output...... 97 Figure 4-9: Bioanalyzer application environment...... 98 Figure 4-10: Electropherogram summary for human foetal brain RNA sample...... 99

Figure 4-11: ACMSD levels, presented by Ct values in different types of tissue. ... 100 Figure 4-12: Quantification of ACMSD variants in human organs...... 101 Figure 4-13: Dissociation curves...... 102 Figure 4-14: Illustration of Ct value generation...... 103 Figure 4-15: Standard curves of valid KP primers. Eff. represents efficiency in precents and RSq number linearity of the plot...... 105 Figure 4-16 : Standard curves of valid KP primers...... 106 Figure 5-1: SH-SY5Y and SK-N-SH neuroblastoma cell lines at full confluence. .. 119 Figure 5-2: SH-SY5Y and SK-N-SH cells at day 2 after passaging at 1 × 103 viable cells/cm2 . N, S and I-type cells are presented in different proportions in both cultures...... 120 Figure 5-3: S, I and N-type cells in human neuroblastoma cell line. (Potenza, Papa et al. 2009) ...... 120 Figure 5-5: Morphology of SH-SY5Y and SK-N-SH cells differentiated by protocols 2 and 3...... 124 Figure 5-6: Relative expression of TH in SK-N-SH and SH-SY5Y cells differentiated by protocols 1, 2 and 3, compared to SK-N-SH control cells...... 125 Figure 5-7 : Relative expression of TH in SK-N-SH and SH-SY5Y cells differentiated by protocol 2 and 3, compared with SK-N-SH control...... 126 Figure 5-8: Relative expression of TH in SH-SY5Y cells differentiated with original protocols 1, 2 and 3 and protocols 2 and 3 with lowered serum content, compared with control untreated cells...... 127 Figure 5-9: Relative expression of MAP2 in SH-SY5Y cells differentiated by protocol 1, 2 and 3, high and low serum, compared to SH-SY5Y control...... 128 Figure 5-10: Relative expression of DAT in SH-SY5Y cells differentiated by protocol 1, 2 and 3, high and low serum, compared to SH-SY5Y control...... 129 Figure 5-11: SH-SY5Y cells differentiated with protocols 2 and 3 with low serum content (3%) ...... 130 Figure 5-12: Immunodetection of dopaminergic (TH) and neuronal (MAP2) markers in differentiated and control SH-SY5Y cells...... 131 Figure 5-13: Relative expression of NMDAR subunits in SH-SY5Y cells differentiated with modified protocol number 3 compared to undifferentiated control cells...... 133 Figure 5-14: Relative expression of KP enzymes converting tryptophan to kynurenine in the SH-SY5Y cells...... 135

Figure 5-15 : Relative expression of KP enzymes converting kynurenine to kynurenic acid in the SH-SY5Y cells...... 136 Figure 5-16 : Relative expression of KP enzymes converting kynurenine to QUIN and nicotinamide in the SH-SY5Y cells...... 136 Figure 5-17: Relative expression of IDO1, IDO2, TDO2 and AFMID in dSH-SY5Y cells, stimulated or not with INF-γ, at 24, 48 and 72 hours...... 138 Figure 5-18: Amplification curve for IDO1 at 24 hours in SH-SY5Y, stimulated or not with INF-γ...... 139 Figure 5-19: Relative expression of KAT1, KAT2, KAT3 and GOT2 in dSH-SY5Y cells, stimulated or not with INF-γ, at 24, 48 and 72 hours...... 140 Figure 5-20: Relative expression of KMO, KYNU and 3HAAO in dSH-SY5Y cells, stimulated or not with INF-γ, at 24, 48 and 72 hours...... 140 Figure 5-21: Relative expression of ACMSD and QPRT in dSH-SY5Y cells, stimulated or not with INF-γ, at 24, 48 and 72 hours...... 141 Figure 5-22: Relative expression of TPH1, TPH2, MAOA and MAOB in dSH-SY5Y cells, stimulated or not with INF-γ, at 24, 48 and 72 hours...... 141 Figure 5-23: TRP catabolism in dSH-SY5Y cells, stimulated or not with INF-γ, at 24, 48 and 72 hours...... 142 Figure 5-24: KYN metabolism in dSH-SY5Y cells, stimulated or not with INF-γ, at 24, 48 and 72 hours...... 143 Figure 5-25: KP activation in INF-γ induced and control dSH-SY5Y cells...... 144 Figure 5-26: KYNA metabolism in dSH-SY5Y cells, stimulated or not with INF-γ, at 24, 48 and 72 hours...... 144 Figure 5-27: PIC in dSH-SY5Y cells, stimulated or not with INF-γ, at 24, 48 and 72 hours. PIC concentrations measured by GC/MS in medium samples derived from growing cells...... 145 Figure 5-28: QUIN in dSH-SY5Y cells, stimulated or not with INF-γ, at 24, 48 and 72 hours...... 146 Figure 5-29: QA in dSH-SY5Y cells, stimulated or not with INF-γ, at 24, 48 and 72 hours...... 146 Figure 5-30: A possible KP switch in dSH-SY5Y cell line in the presence of INF-γ...... 154 Figure 6-1: Mid-brain isolation procedure...... 160

Figure 6-2: Isolated neurons grown in B27 supplemented DMEM or Neurobasal media with or without ARAC...... 163 Figure 6-3: Contamination of primary dopaminergic neuronal culture with other CNS cell types...... 164 Figure 6-4: Isolated neurons from SN stained positively for TH and MAP2, but not microglial marker CD68...... 164 Figure 6-5: Relative expression of dopaminergic markers in isolated neurons and SN primary tissue...... 165 Figure 6-6: Dopaminergic neurons isolated from SN are stained positively for β- tubulin III...... 166 Figure 6-7: DA neurons isolated from SN stained positively for MAP2, NeuN and TH...... 166 Figure 6-8: Comparison in TH expression between neurons isolated from SN or cortex...... 167 Figure 6-9: Relative expression of NMDAR subunits in DA neurons isolated from SN compared with differentiated and undifferentiated SH-SY5Y cells...... 168 Figure 6-10: Relative expression of IDO1, IDO2, TDO2 and AFMID in DA isolated neurons stimulated or not with INF-γ, at 24, 48 and 72 hours...... 169 Figure 6-11: Relative expression of KAT1, KAT2, KAT3 and GOT2 in DA isolated neurons stimulated or not with INF-γ, at 24, 48 and 72 hours...... 170 Figure 6-12: Relative expression of KMO, KYNU and 3HAAO in DA isolated neurons stimulated or not with INF-γ, at 24, 48 and 72 hours...... 171 Figure 6-13: Relative expression of ACMSD and QPRT in DA isolated neurons stimulated or not with INF-γ, at 24, 48 and 72 hours...... 171 Figure 6-14: Relative expression of TPH1, TPH2, MAOA and MAOB in DA isolated neurons stimulated or not with INF-γ, at 24, 48 and 72 ...... 172 Figure 6-15: TRP catabolism in DA isolated neurons stimulated or not with INF-γ, at 24, 48 and 72 hours...... 173 Figure 6-16: KYN metabolism in DA isolated neurons stimulated or not with INF-γ, at 24, 48 and 72 hours...... 173 Figure 6-17: KP activation in DA isolated neurons stimulated (red) or non-stimulated (blue) with INF-γ, at 24, 48 and 72 hours...... 174 Figure 6-18: KYNA metabolism in DA isolated neurons stimulated or not with INF-γ, at 24, 48 and 72 hours...... 174

Figure 6-19: PIC in DA isolated neurons stimulated or not with INF-γ, at 24, 48 and 72 hours...... 175 Figure 6-20: QUIN in DA isolated neurons stimulated or not with INF-γ, at 24, 48 and 72 hours...... 176 Figure 6-21: QA in DA isolated neurons stimulated or not with INF-γ, at 24, 48 and 72 hours...... 176 Figure 6-22: Morphology of dopaminergic primary neurons isolated from human foetal brain...... 177 Figure 6-23: Approximate location of VTA and SN in the human foetal brain...... 178 Figure 6-24: Schematic diagram of KP activation induced by INF-γ in human dopaminergic cells isolated from foetal SN...... 182 Figure 7-1: Process of neurites quantification by ImageJ. dSH-SY5Y cells ...... 189 Figure 7-2: Neurotoxicity of QUIN on dSH-SY5Y cells at 24 and 48 hours...... 190 Figure 7-3: Neurotoxicity of QUIN on dSH-SY5Y cells at 72 hours...... 191 Figure 7-4: Live imaging of dopaminergic neurons derived from neuroblastoma cell line in the presence of QUIN...... 192 Figure 7-5: Live imaging of dopaminergic neurons isolated from human foetal brain in presence of QUIN...... 192 Figure 7-6: Live imaging of dopaminergic neurons isolated from human foetal brain in the presence of QUIN...... 193 Figure 7-7: Model for Kynurenine pathway interactions between astrocytes, neurons and microglia during brain inflammation...... 196 Figure 8-1: Relative expression of TH in dSH-SY5Y cells, isolated dopaminergic neurons and SN from human foetal brain...... 199 Figure 8-2 KP switch in dSH-SY5Y neuron-like cells and SN isolated neurons in inflammatory conditions...... 200 Figure 8-3: Immunoreactivity in rat midbrain and striatum after dopaminergic neurotoxin and QUIN administration...... 201 Figure 8-4: Evidence of inflammation and KP activation in the SN of PD macaques’ brain...... 202 Figure 8-5: The possible role of Kynurenine pathway involvement in dopaminergic neurodegenerative process through microglia activation...... 203

List of tables

Table 2-1: Possible mechanisms in the pathogenesis of Parkinson’s disease...... 28 Table 2-2 List of genes linked to Parkinson's disease. Evidence for involvement in mitochondrial dysfunction and oxidative stress...... 31 Table 2-3: Involvment of microglia in PD patients and PD models...... 35 Table 2-4: Evidence of inflammation in PD data from the patients...... 40 Table 3-1: Primers sequences used for RT-qPCR analysis...... 70 Table 3-2 List of primary and secondary antibodies used in immunocytochemistry analysis ...... 72 Table 4-1: Example of primer selection criteria for the GOT2 gene, among 4 candidate pairs...... 91 Table 4-2: Summary of RNA integrity number results...... 98 Table 4-3 : Valid and optimized set of 17 Kynurenine pathway genes...... 108 Table 5-1 Protocols selected for neuroblastoma differentiation: all cultures contained antibiotics as described in methods...... 119 Table 5-2: Expression levels (Ct values) of NMDAR subunits and reference gene in SH-SY5Y control cells and cells differentiated with modified protocol number 3 (n=3). ... 134 Table 6-1: Expression levels (Ct values) of NMDAR subunits and reference gene in dopaminergic neurons isolated from SN...... 168

17 Chapter 1: Introduction

Chapter 1 : Introduction

18 Chapter 1: Introduction

1.1 Introduction Parkinson's disease (PD) is a pathological condition that has been known for centuries through early Greek scientific descriptions, traditional Indian texts and ancient Chinese sources. However, it was first medically described as a neurological syndrome in 1817 when James Parkinson published a detailed medical essay on the shaking palsy (Parkinson, 2002). The most complete pathologic analysis of Parkinson’s disease and the clear description of the brain lesions were performed in 1953 by Greenﬁeld and Bosanquet when low dopamine presence were identified in the brains of PD patients. Today, the PD movement disorder is the most frequent neurodegenerative condition of the aging brain just behind Alzheimer’s disease. According to the 2005 report from the World Health Organization, the number of PD cases worldwide was expected to rise dramatically due to the increase of life expectancy. In the 1960s, the drug Levodopa was first introduced to treat the symptoms and has since become the "gold standard" in medication. Since then, research on PD has been focused on finding efficient symptomatic treatments using patient-based research. Discovery of 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP), a neurotoxin which causes permanent PD symptoms, led to intense research and discoveries of the mechanisms responsible for dopaminergic neuron vulnerability and allowed to experiment with neuroprotective strategies (Langston et al., 1983). Over the last two decades, many studies have demonstrated that the kynurenine pathway (KP) is involved in several major neurodegenerative diseases such as Alzheimer’s disease, Huntington’s disease, and amyotrophic lateral sclerosis. More recently, the key roles played by the KP in the regulation of the brain and peripheral immune systems have strongly boosted the interest of researchers in this metabolic pathway. The various neuroactive metabolites produced through the KP are involved in both neurodegeneration and neuroprotection, primarily in relation to excitotoxicity and oxidative stress, which both are strongly associated with PD pathogenesis. Several drugs targeting specific KP enzymes are already available on the market and some are even undergoing clinical studies as promising neuroprotective candidates. However, there is only limited or indirect evidence linking KP with PD. Investigating the mechanisms of the KP involvement in the early neuropathogenesis of PD may lead to novel strategies able to delay or even prevent the onset of this devastating disease.

19 Chapter 1: Introduction

Based on the hypothesis that KP plays a role in the development and severity of PD, the main goal of this study is to create an in vitro model of human dopaminergic neurons as a platform for PD therapy development.

20 Chapter 1: Introduction

1.2 Research approach To achieve the principal aim of this study, the following chapters are outlined: Chapter 2 first provides the literature review on PD, the KP and the multiple evidences and theories that link between the two and led to the conception of this project. Chapter 3 describes the general materials and methods employed during the PhD project. Chapter 4 describes the development and validation of the main biological tools used to characterise the KP in human cells: full sets of KP primers for real-time quantitative PCR analysis. Chapter 5 describes establishment and validation of the human cell lines in vitro model for dopaminergic neurons and characterization of the KP. Chapter 6 describes the establishment and validation of a primary human in vitro model of dopaminergic neurons, derived from human foetal brain and then characterization of the KP Chapter 7 examines two in vitro models for toxicity / neuroprotection associated with the KP and PD The final chapter summaries the information from the 4 results chapters as a general discussion of conclusions, in relation to the study’s limitations and future research.

Figure 1-1 Outline of experiments in chapters 4-7

21 Chapter 2: Literature review Chapter 2 : Literature review

22 Chapter 2: Literature review

2.1 Parkinson’s disease Parkinson’s disease (PD) is the most common movement disorder and is the second most common chronic progressive neurodegenerative disorder after Alzheimer’s disease. Parkinsonism is characterised by a collection of signs that constitute a syndrome with multiple etiologies. Most commonly this syndrome is idiopathic (Nutt et al., 1992). Clinically Parkinsonism is defined by movement–related signs in early disease stages: these include shaking, rigidity, and slowness of movement, postural instability and gait. Later, cognitive and behavioural problems may arise, with dementia commonly occurring in the advanced stages of the disease. Other symptoms include sensory, sleep and emotional problems (Nutt et al., 1992). PD is a sporadic, age dependent disease in 90% of cases and affects more than 1% of the population over the age of 65 (Tanner, 1992).

2.1.1 Loss of dopaminergic neurons: Neurons are classified chemically based on the neurotransmitters they use for chemical transmission or neuromodulation: glutamate, gamma-aminobutyric acid (GABA), acetylcholine, dopamine, adenosine or peptide transmitters and neuromodulators. Dopaminergic neurons correspond to approximately 3–5% of total neurons in the substantia nigra. The number of midbrain dopaminergic cell bodies in human brain in their fourth decade of life is 590,000 but this drops to an average of about 350,000 during the sixth decade of life (Bogerts et al., 1983). Midbrain dopaminergic neurons are the main source of dopamine in the mammalian central nervous system. Although their numbers are few, these dopaminergic neurons play an important role in the control of multiple brain functions including voluntary movement and a broad array of behavioural processes such as mood, reward, addiction, and stress (Chinta and Andersen, 2005). Parkinsonism is caused by a dysfunction of dopaminergic neurotransmission in the nigrostriatal pathway, the pathway that connects the Substantia Nigra (SN) with the Striatum (Figure 2-1). It is one of the four major dopamine pathways in the brain, and is particularly involved in the production of movement, as part of a system called the basal ganglia motor circuit. Dopaminergic neurons are found in all brain areas, but the largest amount of dopaminergic neurons is concentrated in the midbrain and located in three specific areas: Substantia Nigra pars compacta (SNpc), ventral tegmental area (VTA), and the retrobulbar area (Prensa et al., 2000).

23 Chapter 2: Literature review

Figure 2-1: Nigrostriatal pathway. Signals that control body movements travel along dopaminergic neurons that project from the substantia nigra to the caudate nucleus and putamen (collectively called the striatum). (© 2001 Terese Winslow, Lydia Kibiuk).

PD is diagnosed pathologically by the loss of midbrain pigmented dopaminergic neurons in the SNpc, which provide dopaminergic input to the striatum and other basal ganglia nuclei under normal conditions (Gelb et al., 1999). It is estimated that at the onset of first PD symptoms there is a depletion of up to 50% of dopaminergic neurons in SN, with a consequent depletion of 80% of striatal dopamine (Braak et al., 2003). Post-mortem examinations can record more than a 90% depletion of dopaminergic neurons in PD brains (Bezard et al., 2001). In advanced PD, loss of pigmented neurons results in gross depigmentation of the SN (Figure 2-2).

24 Chapter 2: Literature review

Figure 2-2 Depigmentation of SN in the brain of advanced PD patient versus the same region in normal brain. PD is characterized by a progressive degeneration of dopaminergic neurons in the substantia nigra The axons of these neurons form the nigrostraital pathway, which is involved in the production of movement. Loss of dopamine negatively affects the nerves and muscles controlling movement and coordination, resulting in the major symptoms characteristic of Parkinson's disease. http://pennstatehershey.adam.com/content.aspx?productId=10&pid=10 &gid=000051.

2.1.2 Lewy bodies: Another pathological hallmark of the disease is the presence of protein inclusions called Lewy bodies (LBs) (Spillantini et al., 1998). LBs are intracytoplasmic inclusion bodies composed mainly of neurofilament-like structures that also stain positively for ubiquitin and α-synuclein (SYN) (Figure 2-3). LBs are not restricted to SN and can be found in other brain areas (Takahashi and Wakabayashi, 2001). Neurons containing LBs undergo neurodegenerative processes, subsequently leading to their death. Ubiqutin is a protein involved in the degradation of cytoplasmic proteins, by tagging them and participating in a signalling pathway toward their destruction. The normal function of SYN is not completely understood. SYN is suggested to play a maintenance role in a mechanism that compensates the dopamine loss in early Parkinson’s neurodegeneration (Norris et al., 2004).

25 Chapter 2: Literature review

Figure 2-3 Tissue from patients with dementia with Lewy bodies immunostained for α-synuclein a). Normal SNpc region from human brain with pigmented dopaminergic neurons. b) same location - loss of pigmented neurons. c) Lewy body in dopaminergic neuron. D.P. Agamano, http://neuropathology- web.org/chapter9/chapter9dPD.html

2.1.3 Basal ganglia motor circuit and Nigrostriatal pathway The basal ganglia include the neostriatum, the ventral striatum, the external and internal paladial segment (GPe and GPi), the subthalamic nucleus (STN) and the SN pars reticulate (SNpr) and SNpc. One of the four major dopamine pathways in the brain, the nigrostriatal pathway is a neural pathway that connects the SN with the striatum. The output from the striatum is thought to be important for dyskinesia induction (Wichmann and DeLong, 2003). The striatum and STN are the main entry points for cortical and thalamic inputs into the basal ganglia. From there information is transferred through multiple pathways to the principal basal ganglia output nuclei, GPi and SN. The connections between the striatum and output nuclei of basal ganglia are organized into two distinct pathways, the so- called direct and indirect pathways. Dopaminergic loss in SN leads to irreversible degeneration of the nigrostriatal pathway, causing imbalance in the activity of the direct and indirect pathways (Crossman, 2000). Further striatal dopaminergic denervation causes pathological changes in neurotransmission of basal ganglia motor circuit and results in characteristic Parkinsonian symptoms (Wichmann and DeLong, 2003). Normally dopamine secretion provides inhibitory control of indirect pathway the (Figure 2-4). Following dopaminergic loss, activity in the indirect pathway increases and neuronal projection from GPe to STN becomes underactive. It causes over-activation of STN glutamateric neurons, leading to increased activity of inhibitory GABAergic neurons in the GPi that project to the thalamus (Figure 2-4). While dopamine has an excitatory effect on the direct pathway, loss of dopaminergic input decreases its activity, thus contributing to the increased activity of the GABAergic neurons that project to the thalamus. Changes in the direct and indirect pathways

26 Chapter 2: Literature review following dopamine depletion result in decreased thalamic neuronal firing and alter the input to the motor cortex, thus reducing voluntary movement (Jenner, 2008). A dramatic reduction in dopamine metabolism before the symptoms appear indicates a remarkable ability of the system to compensate. Studies suggest several compensatory mechanisms: two major classes are working either through reduction of indirect pathway signalling via non-dopamine mechanisms, or by enhancing the effect or remaining striatal dopamine levels (Brotchie and Fitzer-Attas, 2009). Both mechanisms involve structural and functional brain changes and are able to prevent the clinical manifestation of the disease until the system is unable to compensate any further. Novel “disease-modifying” approaches are targeting to enhance compensatory mechanisms that naturally exist in human brain, in aim to delay or reverse disease progression (Hitzeman and Rafii, 2009, Sulzer, 2007).

Figure 2-4: Model of basal ganglia changes under normal (a) and PD condition (b). The internal segment, or GPi, receives signals from the striatum via two pathways, called "direct" and "indirect". Loss of dopaminergic input from SN leads to overactivity of indirect pathway [2] and overactivity of direct pathway [3], diminishing voluntary movements (Jenner 2008).

27 Chapter 2: Literature review

2.2 Underlying causes of Parkinson’s disease: Potential pathogenetic mechanisms of neurodegeneration associated with PD can be divided into genetic and environmental hypothesises (Table2-1) (Nutt et al., 1992). About 85% of parkinsonism cases are idiopathic. The proportion of inherited Parkinson's cases is not yet clear. Approximately 5-10% of patients inherit a familial form of Parkinsonism, and several large multi-case families have been carefully studied (Wood, 1998). They account for 2-3% of the late-onset cases and about 50% of early-onset forms (Schiesling et al., 2008, Farrer, 2006). Regardless of the percentage of inherited cases, genes research responsible for familial Parkinsonism is seen as a major contributor for understanding the underlying mechanisms of the disease. Some toxins and viruses can cause Parkinson's-like disorders. Population studies suggest that the environment may play a role in the development of some cases of PD (Table 2-1). Ongoing research supports the interaction theory, which says that SN vulnerability to different genetic, environmental and cellular factors independently or concomitantly contributes to the onset of the disease (Schapira, 2009) (Sulzer, 2007). However, the major and certain risk factor of PD is the aging process. Age-related changes within the basal ganglia primarily affect the dopaminergic nigrostriatal pathway and related pigmented nuclei. While some changes are similar to the pathologic degeneration in PD, the disease is not a result of normal aging process. Dopamine depletion in PD patients’ brains is not as marked or uniquely selective in the normal aged brain (Hubble, 1998). Hypothesis Mechanism References Genetic Mendelian inheritance: (Gasser et al., 2011, Autosomal dominant or Bekris et al., 2010, Muqit recessive et al., 2006) Multiple genes . defect in mitochondrial genome

Environmental Viral (Elizan and Casals, 1983, Toxins Jang et al., 2009) (Liu and Industrial Yang, 2005, Feng, 2006, Agricultural Ayala et al., 2007) Natural toxins in food Interaction of genetic and Defective detoxification on (Ross and Smith, 2007) environmental environmental toxins Increased generation of free radicals’ defective removal

Table 2-1: Possible mechanisms in the pathogenesis of Parkinson’s disease.

28 Chapter 2: Literature review

2.2.1 Toxins: Epidemiological studies have suggested the association between PD and exposure of pesticides such as rotenone and paraquat (Richardson et al., 2009, Betarbet et al., 2000) (Brooks et al., 1999). Rotenone is a potent and high-affinity specific inhibitor of mitochondrial complex I. In rodents, continuous infusion of these toxic agents induced death of dopaminergic neurons and LB– like inclusions (Betarbet et al., 2000). Paraquat, a free radical generator with a chemical structure similar to a neurotoxin 1-methyl-4- phenylpyridinium (MPP+), is one of the most commonly used pesticides. It causes loss of dopaminergic neurons and motor defects in rodents and leads to oxidative stress by increased formation of free radicals in mitochondria (Berry et al.). Epidemiologic studies implicate the association between exposure to this toxin and the development of PD. Exposure to a combination of paraquat and maneb, which is also widely used as an agricultural pesticide, potentiates the effect of each chemical, increasing the incidence of PD especially in younger humans (Costello et al., 2009). Under the given conditions, exposure to a combination of several toxins could lead to greater risk of developing PD than a single toxin.

2.2.2 Genes: Over the last decade, more than 25 genetic factors contributing to the pathogenesis of PD have been identified. These studies revealed that PD- associated genes play important roles in molecular cell function, such as mitochondrial function, the ubiqutin-proteasomal system, autophagy-lysosomal pathway and membrane trafficking (Hatano et al., 2009). Investigation of these genes in familial PD cases has shed a light on key proteins involved in pathogenesis, which has a significant role in the sporadic forms of the disease (Table 2-2). Important role is given to mitochondrial dysfunction and oxidative stress (Henchcliffe and Beal, 2008).

Gene Function of Observations References gene product Wild-type protein: (Martin et al., 2006, Reduces mitochondrial function, increases Parihar et al., 2008, oxidative stress. Song et al., 2004, Ko α- Overexpression plus MPTP administration et al., 2000, synuclein Not known leads to abnormal mitochondria. Ostrerova-Golts et al., (SNCA or Overexpression leads to association with 2000, Perry et al., PARK1) mitochondrial membrane and cytochrome c 2008, Paxinou et al., release or increased free radicals 2001)

29 Chapter 2: Literature review

Knockout mutant: Increased resistance to MPTP (mice)

Mutation: Abnormal mitochondria, damage to mitochondrial DNA (mice) Increased cytochrome c release Association with mitochondrial membrane increased markers of oxidative stress Partially associated with the mitochondrial (Kuroda et al., 2006, outer membrane Greene et al., 2003, Localized to mitochondria in proliferating Pesah et al., 2004, cells Palacino et al., 2004, Interacts with PINK1 to promote Muftuoglu et al., mitochondrial fission 2004, Poole et al., Mutation: 2008, Clark et al., Parkin Ubiquitin Abnormal mitochondria, increased sensitivity 2006, West et al., (PARK2) E3 ligase to oxidative stress (in Drosophila 2005, Darios et al., melanogaster) 2003, Park et al., Decreased complex I and IV (in mice and 2006) humans); increased oxidative stress (in mice) Wild–type protein: Involved in mitochondrial biogenesis and mitochondrial DNA replication; rescues PINK1 mutant phenotype Mitochondrial membrane localization (Silvestri et al., 2005, Targeting by small interfering RNA: Clark et al., 2006, Increased sensitivity to 1-methyl-4- Yang et al., 2008, phenylpyridinium and rotenone Petit et al., 2005, Park Mutation: et al., 2006, Gandhi et Abnormal mitochondria, increased sensitivity al., 2006) Serine– PINK1 to oxidative stress (in D. melanogaster) threonine (PARK6) reduced complex I activity and increased kinase oxidative damage. Wild–type protein: Reduces mitochondrial cytochrome c release, reduces apoptosis (in cell cultures); overexpression promotes mitochondrial fission Oxidative stress causes relocalization to (Bonifati et al., 2003, mitochondria Yokota et al., 2003, It is oxidized in the brains of patients with PD Zhang et al., 2005a, Protects against oxidative stress Meulener et al., Oxidative Targeting by small interfering RNA increased 2005a, Park et al., DJ-1 stress sensitivity to oxidative stress (in D. 2005, Yang et al., (PARK7) sensor, melanogaster) 2005, Shendelman et chaperone Mutation: al., 2004, Meulener et increased sensitivity to rotenone, paraquat, al., 2005b, Taira et al., and hydrogen peroxide (in D. melanogaster) 2004, Choi et al., increased sensitivity to oxidative stress (in 2006, Menzies et al.,

30 Chapter 2: Literature review

mice) 2005) Serine– Around 10% are located in outer (West et al., 2005) LRRK2 threonine mitochondrial membrane (PARK8) kinase Kinase activity affects mitochondrial function Localized to mitochondria, released during (Martins et al., 2004, mitochondrial membrane permeabilization in Strauss et al., 2005) HTRA2 Serine programmed cell death (PARK13) protease Mutation: Mitochondrial swelling, reduced membrane potential, reduced neuroprotection

Table 2-2 List of genes linked to Parkinson's disease. Evidence for involvement in mitochondrial dysfunction and oxidative stress. (Henchcliffe and Beal, 2008) .

2.2.3 Mitochondria dysfunction and oxidative stress: Although the aetiology of PD is relatively unknown, it is largely associated with mitochondrial dysfunction, making nigral neurons highly vulnerable to neurotoxicity due to glutamate and reactive oxygen species (ROS) (Dauer and Przedborski, 2003, Przedborski et al., 2003). Mitochondria have a key role in electron transport and oxidative phosphorylation, and are the main cellular source of free radicals and one of the regulators of the apoptotic cell death pathway (Green and Kroemer, 2004). The most direct evidence for disturbed mitochondrial metabolism has come from autopsy pathological studies and in vitro cell cultures derived from PD patients’ brain (Schapira et al., 1990, Parker et al., 2008), though mitochondrial dysfunction is not detected in all PD patients. Impaired mitochondrial function increases oxidative stress. Oxidative stress is caused by an imbalance between the generation of ROS and their enzymatic or non-enzymatic detoxification rate. Oxidative stress plays an important role in brain aging, neurodegenerative diseases and has long been associated with the death of dopaminergic neurons, due to production of toxic species through autoxidation and formation of neuromelanin (Graham, 1979). The iron and copper levels in SN are high and it contributes to autoxidation of dopamine and its metabolites, leading to production of ROS (Olney et al., 1990). Oxidative damage of lipids, proteins and DNA as well as decreased level of an important antioxidant, reduced glutathione, have been detected PD patients’ autopsy brain (Dexter et al., 1989, Zhang et al., 1999, Perry and Yong, 1986). Oxidative damage induces SYN aggregation and impairs proteosomal ubiquitination and degradation of proteins, inducing LBs formation, one of PD’s characteristic hallmarks (Jenner, 2003b). Mitochondrial activity can also be affected by environmental factors that possibly contribute

31 Chapter 2: Literature review to PD pathogenesis, as discussed in Toxins: 2.2.1. The ability of the ROS generator, paraquat, to cause specific dopaminergic lesions strongly suggests involvement of oxidative stress in PD (McCormack et al., 2002). Oxidative stress in PD is not restricted to the brain area alone: a variety of oxidative damage markers, in the serum and CSF of PD patients, suggest a systemic DNA/RNA oxidation (Kikuchi et al., 2002). Oxidative stress in the central nervous system (CNS) comes not only from mitochondria-generated ROS, but also from microglia. Classic microglial activation is a source of intracellular and extracellular ROS, which can induce neuronal damage. Nicotinamide adenine dinucleotide phosphate (NADPH) oxidase is a membrane bound enzyme complex that catalyses the production of superoxide from oxygen, and is implicated as both the primary source of microglial-derived extracellular ROS and a mechanism of proinflammatory signalling in microglia (Babior, 2000). NADPH-oxidase is upregulated in the SN of PD patients (Wu et al., 2003).

2.2.4 Discovery of MPTP: Langston et al. discovered that MPTP intravenous injections cause parkinsonian symptoms in humans (Langston and Ballard, 1983). Furthermore, the patients responded to Levodopa treatment similarly to patients with idiopathic PD. Tomography studies showed that patients exposed to MPTP had progressive dopaminergic lesions that persisted for years after the exposure (Vingerhoets et al., 1994). Neuropathological findings of 3 human patients demonstrated moderate to severe dopaminergic neuronal degeneration, without LBs in the SN, and continuing microgliosis (Langston et al., 1999). MPTP is a by-product of the chemical synthesis of a narcotic meperidine analogue. This chemical agent is highly lypophilic, therefore it quickly crosses the blood-brain barrier (BBB) and converts to MPP+. Protoxin MPTP is metabolised to the active toxic compound MPP+, via monoamine oxidase B and spontaneous oxidation, inside non-dopaminergic cells. MPP+ is transported into dopamine neurons by the dopamine transporter, and therefore exhibits highly selective toxicity to dopaminergic neurons. Furthermore, MPP+ accumulates in mitochondria, where it inhibits the mitochondrial electron transport chain component complex I (Figure 2-5) (Vila and Przedborski, 2003). In SN of sporadic PD subjects, decreased activity and protein levels of complex I also have been reported (Schapira et al., 1989). The fact that biochemical changes in dopaminergic neuronal degeneration in sporadic PD were essentially similar to those in MPTP-exposed patients allowed scientists to reproduce same brain lesions and symptoms in animal models. Discovery of MPTP

32 Chapter 2: Literature review stimulated a new wave of Parkinson research which uses animal MPTP model, aiming for better understanding of PD-related mechanisms and, even more importantly, providing a tool for drug tests (Jenner, 2003a). However, the MPTP-induced Parkinsonism is not progressive, does not represent LB formation and does not expand its pathology beyond SN.

Figure 2-5: The MPTP model of Parkinson's disease. After systemic administration, MPTP crosses the blood-brain barrier. Once in the brain, MPTP is converted to MPP+ by MAO-B within glial cells and released. Thereafter, MPP+ is selectively concentrated into dopaminergic neurons via the dopamine transporter (DAT). Inside neurons, MPP+ can bind to the vesicular monoamine transporter (VMAT), which translocates MPP+ into synaptosomal vesicles or it can be concentrated within the mitochondria, blocking complex I, thus enhancing production of reactive oxygen species. (Vila and Przedborski 2003). 2.2.5 Microglia and microgliosis: Microglia are the prime cells of central nervous system (CNS) immune defence and are the main producers of neuroreactive molecules involved in oxidative stress, excitotoxicity, and neuroinflammation. The SN contains the highest concentration of microglia compared to other brain areas (McGeer et al., 1988). Microglia can respond to a wide range of immunologic stimuli or CNS injuries, and initiate protective neuroinflammatory processes (Kreutzberg, 1996). Resting microglia have a characteristic ramified morphology; the small cell body remains stationary, while the long branches are constantly moving and are very sensitive to small physiological changes (Nimmerjahn et al., 2005, Liu and Hong, 2003). At the site of inflammation, activated microglia change their morphology and act similarly to macrophages: they undergo phagocytosis, express increased levels of major

33 Chapter 2: Literature review histocompatibility complex (MHC) antigens, and secrete cytotoxins, which ultimately activate more microglia to remove harmful stimuli and initiate the healing processes (Figure 2-6) (Gehrmann et al., 1995, Hayes et al., 1988).

Figure 2-6: Schematic and fluorescent microscope image of resting versus activated microglia. Neurotoxic or other inflammatory stimuli lead to activation of microglial cells. Activated microglia (stained green) take on an irregular shape and approach neurons (stained red). Adapted from http://alsn.mda.org/article/examining-role-microglia-als and http://www.biology.uiowa.edu/daileylab/projects.html

The total number of MHC class II microglia has been shown to significantly increase not only in SN and putamen but also in the hippocampus, transentorhinal cortex, cingulate cortex and temporal cortex in PD brains (Imamura et al., 2003, Hickey and Kimura, 1988). It suggests that microglia act as antigen presenting cells and therefore generate an immune response to the neuropathological change associated with damaged neurons.

34 Chapter 2: Literature review

Nature of Reported evidence Studies Parkinsonism Parkinson’s Significantly higher numbers of activated (McGeer et al., 1988) disease microglia in the SN of PD patients compared to controls. Monkey model Loss of dopaminergic neurons in SN was (Scheller et al., 2005) associated with microglia activation despite lack of gross histopathological lesions. α-synuclein Microglia activation enhanced (Zhang et al., 2005b) neurodegeneration induced by aggregated α- synuclein. 6-OHDA model In animal models neurons were rescued (Croisier et al., 2005) from 6-OHDA toxicity by microglia inhibition. MPTP model Microglia, and not astroglia, increased the (Gao et al., 2003) toxicity of MPTP. (Croisier et al., 2005) Microglial inhibition improved neuronal (Delgado and Ganea, survival in animal models of MPTP. 2003) MPTP administration increased the amount (Barcia et al., 2004) of activated microglia. Activated microglia were seen in SN of animals 1 year after last exposure to MTPT. Paraquat model Microglia activation coupled with the (McCormack et al., 2002) neurotoxicity of paraquat. (Miller et al., 2007) Paraquat induces generation of reactive oxygen species in microglia. Rotenone model Neuro-glia co-culture amplified the toxicity (Gao et al., 2002a) of rotenone compared to neuron only (Casarejos et al., 2006) culture. Addition microglia increased the toxicity of rotenone to neurons in culture and inhibition of microglia prevented the loss of neurons. LPS Inhibition of microglia rescued neurons (Li et al., 2005) from inflammation-induced neurodegeneration.

Table 2-3: Involvment of microglia in PD patients and PD models. Adapted from (Miller et al., 2009).

The microglial reaction is a very tightly regulated process which is essential for precise immune response; excessive microglial activation may lead to the release of inflammatory mediators such as cytokines, chemokines, reactive free radicals and proteases (Block et al., 2007). This process is referred to as “reactive microgliosis” and involves the proliferation, recruitment and activation of microglia, followed by further neuronal damage (Streit et al., 1999), all of which are secondary to actual neuronal injury, taking this process

35 Chapter 2: Literature review from a neuroprotective to pathologically active state. Thus, initial acute damage from microgliosis may provoke a continuous circle of events that proceed to the chronic, progressive neurodegeneration, which is a common characteristic of PD (Gao and Hong, 2008). Presence of microgliosis, like dopaminergic denervation and LBs presence, is another hallmark of PD. Table 2-3 Table 2-3 demonstrates involvement of microglia, recorded in PD patients and PD models (Miller et al., 2009). MPTP-treated monkeys’ and patients’ brain exhibit activated microglia many years after the exposure, suggesting that, once initiated, microglia remain in an active microgliosis state for a long period of time, contributing to progressive neuronal loss (Barcia et al., 2004, McGeer et al., 2003). Postmortem studies reveal changes in a range of inflammatory cytokines both in SN and in the cerebrospinal fluid (CSF) of PD patients (Hirsch and Hunot, 2000, Hunot and Hirsch, 2003).

2.2.6 Role of neuroinflammation in the pathogenesis of PD: Glial cells, such as astrocytes or microglia, play important role in CNS homeostasis, mediating immune responses and reducing oxidative stress (Dringen et al., 2000, Park et al., 2001). When CNS regional homeostasis is disturbed, glial cells release cytokines to re- establish the balance and repair damaged cells. Such a response is natural and beneficial for neurons, however repeated microglia and astrocyte activation evoke chronic inflammatory stress, leading to increased production of ROS and severe neuronal damage (Aloisi, 2001, Banati et al., 1993). Several cell, animal and human studies indicate involvement of neuroinflammation in the pathogenesis of PD:

2.2.6.1 In vitro/in vivo: To demonstrate the delayed and progressive nature of neuroinflammation observed in PD, lipopolysaccharide (LPS) was administered in rodents in a single or chronic infusion (Castano et al., 1998). While LPS has no direct effect on neurons, it is capable of initiating a chronic inflammatory progress and a delayed, progressive degeneration of dopaminergic neurons in SN (Gao et al., 2002b, Castano et al., 1998). An in vitro study by the same group showed that MPTP initiated direct neuronal injury in neuron-glia cultures, followed by the induction of reactive microgliosis (Gao et al., 2003). Further, in microglia-free, neuron- astrocyte co-culture, MPTP induced only acute, non-progressive neurotoxicity (Gao and Hong, 2008). MPTP is selectively toxic to dopaminergic neurons, and is often used to induce

36 Chapter 2: Literature review

PD in animal models (Gerlach et al., 1991). Moreover, inhibition of microglia activation resulted in a neuroprotective effect in MPTP-mouse and LPS- rat models (Wu et al., 2002, Liu et al., 2000).

2.2.6.2 Human studies A large epidemiological study on nearly 150,000 men and women reported that the use of nonsteroidal anti-inflammatory drugs (NSAIDs) prevent or delay the onset of PD (Chen et al., 2003). Chen, H. et al have shown a similar effect in chronic users of ibuprofen, a NSAID which acts through inhibiting cyclo-oxygenase (COX) (Chen et al., 2005). Interestingly, a correlation has been shown between high plasma concentrations of interleukin-6, a proinflammatory cytokine, and an increased risk of developing PD (Chen et al., 2008). Moreover, in vivo imaging studies on patients in the early stages of idiopathic PD have shown increased neuroinflammation in basal ganglia, striatum and frontal and temporal cortical regions compared with age matched healthy controls (Figure 2-7) (Gerhard et al., 2006). This suggests that activation of microglia occurs at an earlier disease stage, before (or in parallel to) the massive loss of dopaminergic neurons. In post-mortem examinations, activated microglia have been detected around impaired dopaminergic neurons in the SN of patients with PD, suggesting the involvement of inflammation in the degenerative disease (McGeer and McGeer, 2008). As previously discussed, MPTP causes Parkinsonism in humans and primates, leaving them with the continuous presence of activated microglia around dopaminergic neurons in SN even 10 years post-exposure (McGeer et al., 2003, Langston et al., 1999).

37 Chapter 2: Literature review

Figure 2-7: MRI imaging with PK1195 binding, selective marker of activated microglia. In the PD patient (A and B) there is an increased number of activated microglia (bright yellow-red regions) in basal ganglia and frontal regions, whereas the control person (C and D) shows only constitutive binding in the thalamus and pons. (Gerhard et al., 2006)

Substantial evidence of microglial activation associated with dopaminergic neuronal damage suggests that degenerating neurons have the capacity to initiate microgliosis and further neuronal loss. Therefore, suppressing inflammation can potentially slow or even terminate this cycle of continuous neuronal damage mediated by excessive microglial activation, even if microglial activation presents as an initiator or a secondary responder in this disease process. However, the initial stimulus, driving excessive inflammation is still unknown. Several compounds released by damaged neurons can induce microgliosis and induce ROS production: Matrix metalloproteinase 3 is released by damaged dopaminergic neurons and induces superoxide production in microglia, which contributes to neuronal death (Kim et al., 2007b). Neuromelanin, a neuronal pigment, is released in PD by dying neurons to activate microglia (Zecca et al., 2003). SYN, a component of LB neurons, typically found in PD, is toxic to neurons only in the presence of microglia. Microglia activated by aggregated SYN have been shown, in turn, to be toxic to dopaminergic neurons isolated from embryonic

38 Chapter 2: Literature review mouse brains. Importantly, its toxicity was dependant on the presence of NADPH- oxidase following ROS formation (Zhang et al., 2005b). Another study showed that neuroinflammation was accompanied by dopaminergic loss and aggregation of oxidized SYN in the cytoplasm of SN neurons only in the presence of human SYN in the brain (Gao et al., 2008) .These studies suggest that there is a mechanistic link between protein aggregation and the production of ROS by activated microglia. Over-production of ROS by microglia has been directly linked to neuronal toxicity and death via nitric oxide (NO) production (Kim and Joh, 2006, Chao et al., 1992). NO induces oxidative stress, a major cause of neuronal injury, which is strongly linked to the pathogenesis of PD and physiological aging (Jenner, 2003b, Koutsilieri et al., 2002). For example, NO can react with dopamine to generate quinone products, which are known to have damaging effect on brain mitochondria (Jana et al., 2007). The basal level of lipid peroxidation is increased in the SN of PD patients, suggesting a higher sensitivity of this area to free radicals and ROS (Dexter et al., 1989). Aging also contributes to microglial “priming”: activated microglia in healthy aged brains release excessive quantities of proinflammatory cytokines compared to younger individuals (Dilger and Johnson, 2008, Huang et al., 2008). Furthermore, there is an increased probability of developing a neurodegenerative disorder after 60 years of age, due to age related increases in oxidative, metabolic or inflammatory activation (von Bernhardi et al., 2009). Inflammatory cytokines (IL-1β, TNF-α, IL-6 and INF-γ), also released by activated microglia, amplify the inflammatory response. Excessive production of these cytokines has been reported in the SN of PD patients (Merrill and Benveniste, 1996, Nagatsu et al., 2000), as well as in cerebrospinal fluid (CSF) and blood (Mogi et al., 1994b, Stypula et al., 1996). Genetic studies show increased risk of PD associated with polymorphism in inflammatory genes, including tumour necrosis factor α (TNF-α) and interleukin-1β (IL-1β), and high plasma concentrations of interleukin-6 (IL-6) (Wahner et al., 2007, Hakansson et al., 2005). Cytokines stimulate inactivated microglia and also directly bind to receptors on the cellular surface of dopaminergic neurons, promoting apoptotic cell death and subsequent phagocytosis of dopaminergic neurons (Hirsch, 2000). Neurons in the midbrain, unlike in the hippocampus or cortex, exhibit a greater sensitivity to proinflammatory cytokines. Moreover, this sensitivity has been directly related to a high degree of oxidative processes (Block et al., 2007). In contrast to proinflammatory cytokines, activated microglia also produce anti- inflammatory cytokines, such as TGF-β1, IL-10 and IL-1, which play a role in inflammatory

39 Chapter 2: Literature review

response inhibition. The imbalance between pro- and anti-inflammatory cytokine production is impaired during neuroinflammation (Nagatsu and Sawada, 2005). Table 2-4 summarises a

collection of evidence for involvement of inflammation in human PD. Evidence from PD patients Study Up-regulation of MHC molecules in brains (McGeer et al., 1988) Increased level TNF-α, in the striatum and CSF (Mogi et al., 1994b) (Mogi et al., 1994a) Increased levels of β2-microglobulin, the light chain of (Mogi et al., 1995) MHC, in striata Increased levels of IL-1β and IL-6 in the CSF (Blum-Degen et al., 1995) Presence of antibody reactivity to quinone-modified (Rowe et al., 1998) proteins Presence of gliosis and clustering of microglia around (Langston et al., 1999) nerve cells in MPTP-induced parkinsonism in humans Absence of reactive astrocytosis in the inflammatory (Mirza et al., 2000) process in PD autopsies. Up-regulation of nitric oxide synthase and (Knott et al., 2000) cyclooxygenase-1- and -2 in amoeboid microglia, but not in control SN. Up-regulation of glial neurotrophins (BDNF, NT-3) in (Knott et al., 2002) response to signals released from failing nigral neurons. Association of interleukin-1 beta polymorphisms with (McGeer et al., 2002) idiopathic PD The number of activated microglia is higher not only in the (Imamura et al., 2003) SN and putamen but also in the hippocampus, transentorhinal cortex, cingulate cortex and temporal cortex in PD. Parallel changes in microglial activation and (Ouchi et al., 2005) corresponding dopaminergic terminal loss in the affected nigrostriatal pathway in early PD. Increased expression of PAR-1 in astrocytes in SNpc of (Ishida et al., 2006) PD brain.

Table 2-4: Evidence of inflammation in PD data from the patients. Adapted from (Esposito et al., 2007)

2.2.7 Role of NMDA receptor: Glutamate, an excitatory neurotransmitter, plays a critical role in glutamatergic transmission in basal ganglia (Ravenscroft and Brotchie, 2000). The action of glutamate on target neurons is mediated by ionotropic and metabotropic glutamate receptors. The N-methyl D-aspartate receptor (NMDAR) is a specific type of ionotropic glutamate receptor. NMDA is water-soluble synthetic excitotoxin that acts as a selective agonist that binds to NMDAR, mimicking the action of glutamate, but has no effect on other glutamate receptors. Activation

40 Chapter 2: Literature review of NMDA receptors results in the opening of an ion channel that is nonselective to cations. A unique property of the NMDA receptor is its voltage-dependent activation, a result of ion channel block by extracellular Mg2+ ions. This allows the flow of Na+ and small amounts of Ca2+ ions into the cell, and K+ out of the cell to be voltage-dependent. Calcium flux through NMDARs is playing a critical role in synaptic plasticity and cellular mechanisms for learning and memory. The NMDA receptor is distinct in two ways: First, it is both ligand-gated and voltage-dependent; second, it requires co-activation by two ligands - glutamate and glycine (Figure 2-8). The NMDAR consist of tetrameric, heteromeric subunits, forming a receptor by a combination of two NR1 and two NR2 subunits. Several different combinations of glutamate receptor subunits can form receptors with different physiological and pharmacological properties, which are differently distributed in the CNS (Danysz and Parsons, 1998). Scientists are just beginning to understand how subunit composition differs among brain areas and controls receptor characteristics.

Figure 2-8 Schematic structure of NMDA receptor. The NMDA receptor requires both glutamate and the co-agonist glycine for the efficient opening of the ion channel. NMDA receptor is a structurally complex, with separate binding sites for glutamate, glycine, magnesium ions (Mg+2), zinc ions (Zn+2). There is also an antagonist binding site for PCP and MK-801. (Smith 2002)

Ionotropic NMDA receptors are known to mediate excitotoxicity caused by high levels of glutamate and can be found on dopaminergic neurons (Waxman and Lynch, 2005). Activation of NMDA receptors located on these neurons has been found to produce neurotoxic effects both in vitro and in vivo (Kikuchi and Kim, 1993, Connop et al., 1995). The functional organisation of basal ganglia also plays a role in the genesis of symptoms

41 Chapter 2: Literature review observed in movement disorder. The striatum, the input nucleus of the basal ganglia circuit, is the main recipient of dopaminergic fibres from the SN. The reduction in dopaminergic innervations of the striatum and changes in the activity of basal ganglia induces complex changes in the structure and function of basal ganglia NMDA receptor (Hallett and Standaert, 2004). Glutamatergic excitation is increased and neurons become uninhibited under PD conditions (Schmidt et al., 1992). It was shown that activated microglia neurotoxicity is primarily mediated by glutamate released through NMDA receptor signalling (Takeuchi et al., 2005). Neuritic beading, focal bead-like swelling in dendrites and axons, is a neuropathological sign in PD (Mattila et al., 1999) and can be also induced by microglia activated through NMDAR (Takeuchi et al., 2005). NMDA receptors have been linked to disturbed energy metabolism and glutamate transmission in neuronal death, and have thus been investigated as an important therapeutic target in pharmacological PD research (Ikonomidou and Turski, 1996). Accordingly, reducing glutamateric transmission could induce anti-PD activity. It is possible to speculate that some NMDA receptor antagonists could provide some degree of neuroprotection for PD brain. Indeed, injections of the NMDA antagonist, MK-801, reverses parkinsonian symptoms in MPTP-treated monkeys (Greenamyre and O'Brien, 1991). Several studies using rodent PD models have shown that glutamate antagonists may have both symptomatic and neuroprotective effects in PD (Hallett and Standaert, 2004). PD patients treated with memantine, another NMDA receptor antagonist, have been shown recently to produce moderate but genuine improvements in cognitive symptoms (Aarsland et al., 2009). The use of amantadine as an adjuvant to Levodopa has demonstrated beneficial effects on motor response complications (Verhagen Metman et al., 1998). Additional evidence has been reviewed and demonstrates the potential of NMDA receptor blockade to reverse parkinsonian symptoms (Hallett and Standaert, 2004).

2.2.8 Excitotoxicity Excitotoxicity is the pathological process by which nerve cells are damaged and killed by excessive release of normal excitatory neurotransmitters such as glutamate, the most prevalent excitatory transmitter in the CNS (Lucas and Newhouse, 1957). Under pathological conditions glutamate from both vascular and metabolic pools may be released into the extracellular space and evoke NMDA receptor over-activation. When glutamate interacts with the NMDA receptor, this can cause excitotoxicity by allowing high levels of

42 Chapter 2: Literature review calcium ions (Ca2+) to flow into the signal-receiving neuron. Calcium influx generated through the NMDA receptor is an important signal in neuronal development and powerful regulator of neuronal function, including death pathways. Prolonged activation of the NMDA receptor can lead to high intracellular cytosolic calcium accumulation and lead to neuronal death by apoptosis or necrosis (Choi, 1995, Pang and Geddes, 1997). Dopaminergic neurons of SN are rich in NMDA receptors; they receive extensive glutamate innervation from the cortex and STN and exhibit burst firing pattern in response to glutamate administration (Johnson et al., 1992). Turski et al. demonstrated in rats that MPP+ neurotoxicity in the SN could be blocked with both competitive and non-competitive NMDA agonists (Turski et al., 1991). Similar findings were shown with MPTP treatment in primates (Greenamyre et al., 1994). Nitric oxide synthase (NOS) inhibitors protect against MPTP toxicity in mice and primates (Schulz et al., 1995) (Hantraye et al., 1996). SN neurons of mice lacking the neuronal NOS gene are resistant to MPP+-induced toxicity (Matthews et al., 1997). A form of “weak excitotoxicity” has been proposed as a potential mechanism in late- onset neurodegenerative diseases (Albin and Greenamyre, 1992). At normal resting potential, calcium influx through NMDA receptor channels is blocked by magnesium. Resting potential is maintained by mitochondria energy metabolism. Mitochondrial defects may therefore lead to reduction in the membrane potential resulting in calcium influx due to loss of the voltage- dependent magnesium blockade of NMDA receptor channels. Calcium influx through these channels may then reach a sufficient concentration to induce mitochondrial generation of free radicals (Dykens, 1994). Increased intracellular calcium also activates NOS (Garthwaite, 1995) . This results in increased production of free radicals and oxidative damage to proteins, lipids, or DNA (Ciccone, 1998). Thus, excitotoxicity can lead to an increase in oxidative stress and mitochondrial damage. Mitochondrial dysfunction, in turn, can result in an increased vulnerability to excitotoxicity. Figure 2-9 demonstrates a cycle of mitochondrial damage resulting in impaired energy metabolism, which causes increased vulnerability to excitotoxicity, which then induces further mitochondrial damage.

43 Chapter 2: Literature review

Figure 2-9: Cycle of mitochondrial dysfunction and excitotoxicity. Defects in energy metabolism may lead to reduction in the membrane potential resulting in calcium influx due to loss of the voltage-dependent magnesium blockade of NMDA receptor channels. Calcium influx through these channels may then reach a sufficient concentration to induce mitochondrial generation of free radicals. Increased intracellular calcium also activates nitric oxide synthase (NOS). Factor SA, Weiner WJ, editors. Parkinson's Disease: Diagnosis and Clinical Management. New York: Demos Medical Publishing; 2002.

There is evidence that dopaminergic neurodegeneration of SN in PD involves excitotoxicity (Blandini and Greenamyre, 1998, Greenamyre et al., 1988, Sattler et al., 1999). This implicates excitotoxic processes in other neurodegenerative disorders and suggesting its effect on progressive PD nature.

2.2.9 Current and potential treatments in Parkinson’s disease: While there is no cure available to treat PD, the available treatment for PD remains focused primarily on motor symptoms, as well as on non-motor. Since the introduction of L- Dopa in 1968 (Cotzias et al., 1969), both it and dopaminergic agonists represent the current, most effective symptomatic treatment for PD. This therapy is mainly aimed at replacing dopamine in the striatum and does not have any slowing effect on neurodegenerative processes. Moreover, long term use is associated with serious side effects such as dyskinesia and motor fluctuations in a large fraction of patients (Montastruc et al., 1993) and the effectiveness of treatment thus diminishes. Other drugs are available, but do not work as well as Levodopa in reducing Parkinson's symptoms and all have side effects. There is a large demand for novel therapeutic strategies and technologies, specifically an unmet need to slow or stop the progression of the disease. Increasing knowledge of non-dopaminergic mechanisms contributing to PD progression is giving rise to investigation and development of

44 Chapter 2: Literature review drugs to modify these abnormalities and thus alter the course of PD, either by slowing down cell death rate or by restoring function to damaged neurons.

2.2.9.1 Dopamine replacement strategy Current Levodopa therapy for PD corrects the dopamine levels in basal ganglia that are required for its normal function. In healthy brains, dopaminergic neurons fire at a relatively constant rate, maintaining striatal dopamine concentrations at the same levels and continuously stimulating dopamine receptors in SN (Venton et al., 2003). With a progressive loss of dopaminergic neurons through the course of the disease, striatal dopamine levels become very dependent on the unremitting availability of peripherally administered Levodopa (Olanow et al., 2006). Pulsatile stimulation of dopaminergic receptors by Levodopa bears a non-physiologic character, with a Levodopa half-life of 1-3h (LeWitt, 2008). This pulsatile stimulation normalises dopamine levels in the basal ganglia for only a short period of time, causing fluctuations in dopamine levels thus disturbing the unstable striatum even more. It is suggested that Levodopa or other short-acting dopaminergic drugs induce molecular changes and altered neuronal firing patterns in basal ganglia neurons, leading to motor complications. It was shown that continuous infusion of Levodopa reduces pulsative stimulation pattern and dyskinesias in MPTP monkeys and PD patients (Olanow and Obeso, 2000). The concept of continuous dopaminergic administration leads to the need to develop a long-acting oral formulation of Levodopa that will provide same clinical benefits without motor complications. While Levodopa still remains the most effective treatment for the symptoms of PD it doesn’t restore the brain to normality, moreover it contributes to the appearance of Levodopa-induced dyskinesias. Motor complications occur in about 50% of patients treated with Levodopa for more than 5 years, and in 80% of patients, treated for over 10 years (Fahn, 2000). Estimated life expectancy of PD patients after diagnosis varies from 5 to 21 years, diagnosed at age 40-64 and 65+ respectively, while a greater proportion of early diagnosed patients eventually becomes significantly disabled and prone to medical complications (Ishihara et al., 2007). It is possible to adjust the effects of Levodopa by changing the dosage or adding catechol-O-methyltransferase or monoamine oxidase (MAO) B inhibitors, which extend the response to Levodopa by slowing its degradation in the blood and brain. Additional clinical therapies are under development to stabilize continuous levels of the drug in the basal ganglia. These include slow-release polymers, drug pumps, patches, slow acting Levodopa formulations and other controlled release strategies. There are

45 Chapter 2: Literature review difficulties associated with drug delivery systems, safety and continuous need to modify the treatment according to the altered drug response, due to continuous dopaminergic loss (Hickey and Stacy).

2.2.9.2 Adenosine A2A antagonists

A2A receptors are one of the four subtypes of adenosine receptor and functionally oppose the actions of dopamine D2 receptors on GABAergic striatal neurons (Fuxe et al.,

2001). A2A receptors are particularly densely localised in the basal ganglia on the GABAergic neurons of the indirect pathway that projects from the striatum to the globus pallidus (Ferre et al., 1993).

Blockade of the adenosine A2A receptors in striatopallidal neurons reduces its overactivity, thus helping to increase inhibitory output from the striatum to the globus pallidus. This serves to restore the balance between basal ganglia output pathways, that were disturbed by striatal dopamine depletion and reducing the motor deficits of PD (Ferre et al., 1997).

Newly developed A2A receptor selective antagonists have a positive influence on motor functions, with an anti-Parkinsonian effect in both rat and primate models (Rose et al.,

2007, Lundblad et al., 2003) . The ability of A2A selective antagonists to successfully reverse motor PD symptoms in animal models, led to clinical trials in PD patients. These studies demonstrated symptomatic improvement in patients treated with Levodopa at advanced PD stages, which already have developed dyskenesia. A Phase I study showed that pairing A2A antagonists with low–dose Levodopa induces symptomatic relief with less dyskinesia, compared to the full dose Levodopa administration (Bara-Jimenez et al., 2003). Large Phase II studies demonstrated significant reduction in the patients “off” state, which is the period when medication effectiveness is greatly reduced or absent, causing dyskinesia, rigidity and slowness (LeWitt et al., 2008). These results were confirmed in a large Phase III trial (Hauser et al., 2008), but not replicated by another trial (Guttman, 2006). There are several differently formulated A2A antagonists under Phase I and II clinical trials in both early and advanced PD patients (Hickey and Stacy).

A2A receptor antagonists also provide an even more exciting novel therapeutic potential as a neuroprotection strategy for Parkinson’s disease. High intake of caffeine, a nonselective adenosine antagonist, has a protective effect and lowers the risk of PD in diverse populations (Ascherio et al., 2001). A2A antagonists were shown to have similar

46 Chapter 2: Literature review

neuroprotective properties by demonstrating reductions in neuronal loss in mouse and

primate PD models (Ikeda et al., 2002, Pierri et al., 2005). Protective actions of A2A antagonists have been reported in ischemia and excitotoxic brain injury models (Sweeney, 1997). The nature of the neuroprotective effect is not well understood and is not restricted to dopaminergic neurons but extends to other types of neurons in basal ganglia (Schwarzschild

et al., 2006). A2A receptors on microglia are also reported to facilitate neuroinflammation,

which might explain the neuroprotective effect of A2A antagonists (Fiebich et al., 1996).

2.2.9.3 Monoamine oxidase B inhibitors MAO-B is a subtype of the MAO enzymes that are primarily found in the brain and is predominant in human brain, where it accounts for 70 to 80% of the total (Fowler and Tipton, 1984). Monoamines, such as dopamine, are important neurotransmitters and are catabolised by MAO on the mitochondrial membrane (Rajput et al., 2007). Inhibition of MAO-B will prolong the action of dopamine at the synapse, thus slowing down the turnover of striatal dopamine in PD patients’ brain, reducing the “off” time. Selegiline and Resagiline are both irreversible inhibitors of MAO-B, with a short turnover time (Rajput et al., 2007). MAO-B inhibitors are effective for symptomatic treatment both in early and advanced PD, since in early PD MAO-B inhibitors are primarily acting on endogenous dopamine levels, whereas in advanced PD, when patients are using combination therapies, MAO-B inhibitors are extending the effect of exogenous Levodopa (Robottom, 2011). A neuroprotective effect of Resagiline was shown in rodent and primate models and led to renewed popularity of MAO-B inhibitors (Blandini et al., 2004) (Kupsch et al., 2001). Selegiline and Resagiline also were shown to specifically protect dopaminergic neurons in culture from neurotoxin (Ebadi et al., 2002, Blandini, 2005). The neuroprotective effect of MAO-B inhibitors is unlikely to arise from the inhibitory action. Selegiline and Resagiline prevent neuronal death through apoptosis suppression, up-regulation of nerve growth factors, neurotrophic factors and glutathione levels. Furthermore, they induce activity of antioxidative enzymes, such as superoxide dismutase and catalase, in the brain regions containing dopamine neurons, preventing oxidative stress. These observations suggest that both Selegiline and Resagiline can act on various antioxidant systems, inhibiting the apoptotic cascade initiated in mitochondria (Takahata et al., 2006, Maruyama et al., 2002). The potential disease-modifying effect of Resagiline initiated a 12-months early PD patient study with a randomised delayed-start unique design. This study demonstrated less disease progression for patients who started immediate treatment compared with 6-months

47 Chapter 2: Literature review delayed treatment (Siderowf and Parkinson Study, 2004). Based on these results a larger, double-blind, placebo controlled, delayed-start 72 week trial was designed for testing the first putative disease-modifying agent for PD (Rascol et al., 2009). The ADGIO study results suggested a disease-modifying effect for the lower dose of Resagiline, but a definitive conclusion could not be drawn. In addition, the mechanisms underlying this effect still remain unclear. A highly selective, reversible inhibitor of MAO-B, Safinamide, is currently in Phase III clinical trial development (Stocchi et al., 2011). Safinamide reduces reuptake and degradation of dopamine, blocks calcium and sodium channels, and inhibits glutamate release. These actions may suggest not only symptomatic relief, but also a neuroprotective effect (Schapira, 2010). However, MAO-B inhibitors are not yet considered as a monotherapy for initiation of early PD treatment. A disease-modifying effect of MAO-B inhibitors still remains a controversial topic. Even though there is a favourable safety profile for MAO-B inhibitors, there are theoretical risks of life-threatening hypertensive crisis, serotonin syndrome and other minor side effects (Robottom, 2011).

2.2.9.4 Dopamine agonists Dopamine agonists directly stimulate dopamine receptors and there symptomatic effect does not depend on the presence of dopaminergic neurons. While Levodopa is converted in the brain into dopamine, dopamine agonists actually mimic the effects of dopamine without having to be converted and have a slightly longer action then Levodopa. They are not as effective as Levodopa in controlling tremor and other symptoms, and they tend to have more side effects such as hallucinations, edema, sudden sleep attacks and impulse control disorder. However, dyskinesia is a less common side effect (Stacy and Galbreath, 2008). In an effort to delay the development of motor fluctuations associated with prolonged Levodopa use, dopamine agonists are often the first medication prescribed to treat early PD for 2 or 3 years (Mandel et al., 2003). Pramipexole, the most studied dopamine agonist, was shown to decrease apoptotic cell death in cultures exposed to MPP+ and rotenone (Kitamura et al., 1998). A similar effect was demonstrated in primates, when pre-treatment with Pramipexole saved a significantly greater number of neurons upon the induction of PD with MPTP (Iravani et al., 2006). In vitro and animal studies of different dopamine agonists suggested that the proposed neuroprotection mechanisms are similar to ones described for MAO-B inhibitors: protection

48 Chapter 2: Literature review against apoptosis, against ROS and free radicals and neurotoxins, as well as inducing high levels of glutathione and neurotrophic factors (Cassarino et al., 1998, Gu et al., 2004, Finotti et al., 2000, Le et al., 2000, Ohta et al., 2003). Also similar to the MAO-B inhibitors, the neuroprotective mechanism of dopamine agonists doesn’t depend on their action on dopamine receptors (Le et al., 2000). Although several mechanisms of neuroprotection have been demonstrated in in vivo and in vitro studies, there is no reliable evidence for neuroprotection from dopamine agonists in PD patients. A 4-years clinical trial of Pramipexole versus Levodopa treatment in PD patients suggested a neuroprotective effect. Regular brain imaging demonstrated significant reduction in dopamine transporter loss in a Pramipexole-treated group (Marek et al., 2002). Similar results were seen in a Ropinirole as Early Therapy trial (Whone et al., 2003). The dopamine agonist group developed fewer motor complications and Unified Parkinson Disease Rating Scale (UPDRS) scores were more improved then in a Levodopa group (Holloway et al., 2000). However, ten-year follow-up of patients from this trial found that UPDRS scores were not significantly different in patients who had initially been treated with Ropinirole or Levodopa (Hauser et al., 2007). Subsequent analyses proposed that the initial ability of the dopamine agonists to delay motor complications might be related to the delayed levodopa administration and its symptomatic effects. An additional limiting factor in dopamine agonists’ use is an increased risk to develop impulse control disorders (ICD) such as pathologic gambling, compulsive buying, eating or sexual behaviour (Evans et al., 2009).

2.2.9.5 NMDA receptor antagonists Glutamate is a major excitatory neurotransmitter in the striatum and SN, thus antagonists of glutamate receptor NMDA could reduce degeneration through the indirect pathway, decreasing glutamatergic excitation and reducing STN activity. It makes NMDA antagonists an obvious target as a PD drug candidate. N-methyl-D-aspartate (NMDA) receptor antagonists, such as amantadine and memantine have been used to provide improvement in PD symptoms since 1969 (Parkes et al., 1970, Fischer et al., 1977). The non- competitive antagonist MK-801 demonstrated an antiparkinsonian effect after direct infusion into several rodent basal ganglia nuclei, suggesting that inhibition of NMDA activity in the striatum contributes to the effect through indirect pathway inhibition (Kaur et al., 1997). Furthermore, some NMDA receptor antagonists contribute to antiparkinsonian effect of

49 Chapter 2: Literature review

Levodopa and even reduce dyskinesia, associated with prolonged Levodopa use, in both rat and primate PD models (Blanchet et al., 1999, Engber et al., 1994, Marin et al., 1996). NMDA antagonists also appear to have a neuroprotective effect, as they can protect neurons from hypoxia and excitotoxicity induced by NMDA and glutamate in vitro and in vivo (Erdo and Schafer, 1991, Lustig et al., 1992, Seif el Nasr et al., 1990). A partial protective effect was demonstrated in a PD rat model (Rojas et al., 1992). NMDA receptor is widely expressed in human brain and has diverse physiological roles, thus using NMDAR antagonists has a potential to affect normal basal ganglia function. The NMDAR inhibition could cause severe adverse effects such as psychosis, impaired learning and disruption of normal motor functions (Paoletti and Neyton, 2007). In this context, specific targeting of NMDA receptor subunits represents a new therapeutic potential. The NR2B subunit is highly expressed in the SN neurons, but has a relatively low expression on other types of neurons, suggesting selective inhibition of receptors containing this subunit may have more specific effect (Hallett and Standaert, 2004). There are several NMDA receptor blockers that are selective for the NR2B subunit. Traxoprodil and ifenprodil, for example, decrease parkinsonian motor symptoms in MPTP-lesioned monkeys and primates (Steece-Collier et al., 2000, Nash et al., 2000). To date, the only antiglutamatergic therapy used in humans is amantadine, which has been shown to non-competitively block NMDA receptors and reduce dyskinesias in people receiving Levodopa (Crosby et al., 2003). A retrospective study identified an increased survival in patients who received amantadine versus those who did not (Uitti et al., 1996). In addition, amantadine therapy is associated with delayed dementia in humans with PD, suggesting another potential benefit for PD management (Inzelberg et al., 2006). In recent studies, other selective NMDAR antagonists, such as MK-801, HA-966 and ifenprodile, did not provide any benefits or relieve dyskinesia (Paquette et al., 2008, Montastruc et al., 1992). More prospective studies are needed to explore possible disease-modifying effects of amantadine, and perhaps other more selective NMDA blockers.

2.2.9.6 Anti-inflammatory drugs Inflammatory process plays a role in PD pathogenesis, though it is still unclear whether this is a primary or a secondary underlying mechanism. After McGeer et al. demonstrated the presence of inflammation in the SN and striatum of PD patients (McGeer et al., 1988), many research groups have focused on the inflammatory nature of the disease. An increasing number of scientific observations suggest that inhibition of inflammatory process could slow down degeneration of dopaminergic neurons in SN. A protective effect of

50 Chapter 2: Literature review nonsteroidal anti-inflammatory drugs (NSAIDs) has been demonstrated in PD animal models (Aubin et al., 1998, Teismann and Ferger, 2001). NSAIDs inhibit the enzyme cyclooxygenase (COX), which catalyses the formation of prostaglandins. They also have an inhibitory effect on the synthesis of nitric oxide radical (NO) and on inflammation-related transcription factors, and are able to directly scavenge ROS and reactive nitrogen species (RNS) (Asanuma and Miyazaki, 2006, Esposito et al., 2007). Meloxicam has been shown to prevent dopaminergic cell loss in MPTP-treated mice (Teismann and Ferger, 2001). NSAIDs are commonly used for their anti-inflammatory properties; currently, selective COX-2 inhibitors are used more frequently, because of fewer side effects. Large scale epidemiological studies with non-aspirin NSAIDs have demonstrated 35 to 45% lower prevalence of PD in user groups compared to non-users (Chen et al., 2005). The use of aspirin, though, was not associated with lower disease risk. Another large study reported a surprising finding: non-aspirin NSAIDs reduce PD risk in men, but not in women (Hernan et al., 2006). The same investigators reported a correlation between pre-existing immune- mediated conditions and the later development of PD in same patients. Taken together with evidence from other clinical studies (Table 2-4), these findings support the rationale of anti- inflammatory agents to modify the course of PD. However, recent clinical studies of a few COX-2 inhibitors showed increased risk of cardiovascular events and resulted in suspensions of the studies and withdrawal of some drugs from the market (Couzin, 2004).

2.2.9.7 Antioxidants Oxidative stress is strongly associated with PD and supported by post-mortem analysis showing that SN cell degeneration can be induced by oxidative stress (Jenner, 2003c). Increased ROS production is substantiated by dysfunction of the mitochondrial complex I, a major hallmark of PD (Winklhofer and Haass, 2010). Elevated iron levels are reported in PD patients’ midbrain and it has been shown that iron chelation is effective in delaying progress of PD in vivo (Kaur et al., 2003). Use of free radical scavengers, such as vitamin A, C and E, would be able to neutralize excess free radicals and thereby prevent oxidative stress (Contestabile, 2001). The first clinical trial of neuroprotection in PD was on the most active form of vitamin E, α-tocopherol (Shoulson et al., 1993). This study failed to show any beneficial effect of the vitamin E supplement, but later meta-analysis suggested a protective effect of vitamin E-rich diets (Etminan et al., 2005). Furthermore, a combination of vitamin E and C did showed some beneficial effect in patients with early PD, whereas vitamin E alone did not (Shoulson et al., 1993). Based on this trial it is recommended to use

51 Chapter 2: Literature review

antioxidant supplements for three population groups: people with high PD risk, early PD stage patients, and patients who are treated by Levodopa alone or in combination with MAO- B inhibitors (Prasad et al., 1999).

Ubiquinol, a reduced form of coenzyme Q10, acts as antioxidant, preventing lipid peroxidation and also protecting the mitochondrial membrane from ROS-induced oxidative damage (Ernster and Dallner, 1995). Coenzyme Q10 administration improves clinical symptoms in patients with mitochondrial encephalomyopathies (Chen et al., 1997). A coenzyme Q10 study in PD patients showed “slowing of the worsening as measured by UPDRS scores” (Shults et al., 2002). A larger and later study was terminated prematurely as it was unlikely to demonstrate efficacy of the treatment over placebo (Lew, 2011).

2.2.9.8 Non-pharmacological treatments Molecular genetic studies of familial forms of the disease could identify impaired key genes supporting normal mitochondrial function (Table 2-2). The proteins encoded by these genes are also important in the sporadic form of the disease. These studies triggered the development of several transgenic mouse models, but they all failed to demonstrate degeneration of the nigrostriatal system (Manning-Bog and Langston, 2007). No perfect animal model yet exists, however different genetic mouse models have demonstrated molecular mechanisms that are most likely to occur before actual cell loss (Bogaerts et al., 2008). One of the main targets in gene-based therapy research is reducing the expression level of SNCA, encoding SYN (Gonzalez-Alegre, 2007). A vaccination approach was also tested: immunization of human SNCA transgenic mice with recombinant human SNCA led to decreased α-synuclein accumulation in neurons and reduced neurodegeneration (Masliah et al., 2005). The Michael J. Fox Foundation (MJFF) has recently awarded $1.5 million for a clinical study of AFFITOPE PD01, a first-of-its-kind PD vaccine (Riedmann, 2011). PD01 vaccine targets the SYN protein aggregations in neurons, preventing LBs formation. Preclinical studies, firstly designed for Alzheimer disease, showed that the PD01 vaccine stimulates the body’s immune system to produce antibodies that target SYN protein, clearing it from the brain and slowing disease progression (Schneeberger et al., 2009). Another goal of gene therapy is to restore the ability of the brain to deliver dopamine to the striatum. The strategy is to deliver genes on viral vectors to the brain with the aim of increasing dopamine production by neurons or efficiency of exogenously administered Levodopa into dopamine (Hickey and Stacy). Delivering genes such as tyrosine hydroxylase (TH), L-amino acid decarboxylase (AADC) and GTP cyclohydroxylase 1 (GCH1) have been demonstrating

52 Chapter 2: Literature review positive results in rat and monkey PD models (Shen et al., 2000, Muramatsu et al., 2002); (Jarraya et al., 2009). These encouraging results led to Phase I/II clinical trials in humans that were well tolerated and demonstrated significant improvement for a 2 year period (Palfi et al., 2011). Another trial that used an inhibitory approach by transferring the glutamic acid decarboxylase (GAD) gene that induces GABA synthesis, also demonstrated significant improvement in UPDRS scores for a 12 month period (Kaplitt et al., 2007). Additional approach is to deliver glial-derived neurotrophic factor or its analogs to the patient brain, as it was shown to have a protective effect on survival of dopaminergic neurons (Lin et al., 1993). Two Phase I clinical trials resulted in significant improvement of motor performance, however a similar randomized placebo-controlled, parallel-group study failed to confirm these results (Patel et al., 2005, Marks et al., 2008, Lang et al., 2006). A surgical approach to PD has been used since 1950, since Cooper demonstrated the dramatic effect of thalamotomy on tremor improvement (Scott et al., 1970). With the introduction of Levodopa, these procedures were abandoned. Surgical techniques have continue to evolve, including introduction of sophisticated imaging systems, and led to the development of deep brain stimulation (DBS). DBS involves implantation of electrodes into STN or GPi and patients are implanted with an external stimulator that is connected to the electrodes. Indications for the surgery are intractable tremor and Levodopa-induced dyskinesias (Chang and Chou, 2006). DBS provides major improvement to PD patients’ motor symptoms and it was documented by numerous studies (Deuschl et al., 2006). DBS in some cases can cause non-motor side effects such as worsened depression, verbal fluency or some other cognitive changes that occur in almost 50% of cases , but become “relevant” in about 10% of treated individuals (Smith et al., 2012). There is a growing interest around a potential neuroprotective role of DBS, based on experimental results in rat and primate PD models (Maesawa et al., 2004, Wallace et al., 2007). Altering STN activity by DBS may inhibit the source of glutamatergic input, thus decreasing glutamate excitotoxicity and protecting the remaining dopaminergic neurons. A clinical study has been initiated to evaluate the potential of DBS in the early stages of PD (Charles et al., 2011). Another promising approach for treatment of PD is transplantation of dopamine- producing cells into the striatum. Currently this is the only approach offering to restore dopaminergic depletion to its full capacity. Experimental work on animal models showed promising results, though it has demonstrated little benefit and significant adverse effects in humans, raising safety questions. Grafts derived from human foetal mesencephalic cells induce dyskinesia and involuntary movements with unknown etiology (Olanow et al., 2003).

53 Chapter 2: Literature review

It was suggested that grafts may cause renewed innervations, graft rejection followed by inflammation. 10-16 years after the therapy, SYN aggregates were found in transplanted cells in patients brain (Kordower et al., 2008). 90% of embryonic mesencephalic dopaminergic neurons transplanted into striatum die during 4 post-transplantation weeks (Sortwell et al., 2000). Another limitation is restricted availability of foetal tissues and its failure to supply adequate quantities of material. Stem cells could provide an unlimited source of material and there is a growing focus on various stem cell types, as lineage-specific stem cells, pluripotent stem cells and reprogrammed somatic cells (Smith et al., 2012). Safety of these treatments remains an issue, since unwanted proliferation or differentiation of stem cells might cause brain tumours and maintenance of the dopaminergic phenotype for a prolonged time is difficult.

2.2.9.9 Future perspectives Despite many safety and efficacy limitations, cell-based and gene therapeutic approaches still holding exciting potential for future treatments. The biggest challenge in PD research is the introduction of novel neuroprotective therapy, able to modify the course of the devastating disease. At the same time there is growing demand for reliable markers for PD progression. Present clinical PD research is focused on early diagnostic approaches and accurate identification of at-risk individuals. There is evidence that loss of olfaction can predict the onset of motor symptoms by 4 years and can be used as a screening tool (Ross et al., 2008). This correlation can be explained by the fact that PD patients are reported to have increased numbers of dopaminergic cells in the olfactory bulb (Morley and Duda, 2010). There are three imaging methods that are considered tools for early PD diagnosis, which include positron emission tomography (PET), single-photon emission computed tomography (SPECT) and magnetic resonance imaging (MRI). PET and SPECT are able to map changes in number and function of dopaminergic terminals in the striatum and currently represent the most sensitive method for PD identification (Piccini and Whone, 2004). Other approaches are investigated as well, such as identification by multiple genes or use of proteomics as a highly sensitive tool to identify changes in gene expression, protein or metabolite levels in biological specimens (Smith et al., 2012).

54 Chapter 2: Literature review

Current lack of reliable markers may be one of the major reasons for the failure of studies aimed to demonstrate neuroprotection. PD-risk prediction, followed by neuroprevention, is a major challenge for the scientific community for the next decades.

55 Chapter 2: Literature review

2.3 The Kynurenine pathway The kynurenine pathway (KP) represents the main catabolic pathway of the essential amino acid tryptophan (TRP) and ultimately leads to the production of the central metabolic co-factor, nicotinamide adenine dinucleotide (NAD+). TRP is the largest amino acid and is the only one that significantly binds to serum albumin. Once TRP is absorbed to the body, 90% of it will be transported around the periphery in a bound form that is unable to cross BBB (McMenamy, 1965). Only the free form of TRP is transported through the BBB by a competitive L-type amino acid transporter (Pardridge, 1979). In the CNS TRP is freely available for the uptake by cells and acts as a precursor for several metabolic pathways, such as synthesis of proteins, serotonin, tryptamine and kynurenine metabolism (Figure 2-10) (Ruddick et al., 2006).

Figure 2-10: Overview of tryptophan metabolism in CNS. Only the free form of TRP can cross the BBB and act as precursor for protein, serotonin, tryptamine, and kynurenine and kynuramine synthesis. The kynurenine pathway is a major pathway for TRP catabolism. (Ruddick et al., 2006)

56 Chapter 2: Literature review

The KP is one of the major regulatory mechanisms of the immune response (Moffett and Namboodiri, 2003). Two non-mutually exclusive theories have been proposed: 1) that TRP degradation suppresses T-cell proliferation by dramatically depleting the supply of this critical amino acid; and 2) that various downstream KP metabolites suppress certain immune cells (Moffett and Namboodiri, 2003). Induction of the KP by the rate-limiting enzyme indoleamine 2,3 dioxygenase (IDO) in dendritic cells completely inhibits clonal expansion of T cells (Mellor et al., 2003). TRP depletion and IDO/KP activation have been implicated in the facilitation of immune tolerance associated with pregnancy and tumor persistence (Munn et al., 2004). The cellular expression of the KP in the brain is only partially understood. It is complete in cells of monocytic lineage, including macrophages and microglia (Guillemin et al., 2003b), but only partially present in human astrocytes (Guillemin et al., 2001d), neurons (Guillemin et al., 2007a) and endothelial cells (Owe-Young et al., 2008). The various KP metabolites can have either neurotoxic or neuroprotective effects and occasionally both, depending on the concentration (Figure 2-11). The neurotoxicity of several KP metabolites has been investigated in relation to oxidative stress generation and neuronal death in vitro and in vivo in animal models of neurodegenerative disorders (Wu et al., 2000a, Chiarugi et al., 2001, Schwarcz and Pellicciari, 2002, Smith et al., 2007).

57 Chapter 2: Literature review

Figure 2-11: Schematic view of tryptophan metabolism along kynurenine pathway. (Stone and Darlington, 2002a)

2.3.1 Neuroactive kynurenine metabolites

2.3.1.1 3-hydroxyanthranilic acid (3HAA) and 3-hydroxykynurenine (3-HK) 3HAA is one of the neurotoxic KP metabolites, derived either from the hydrolysis of 3-hydroxykyurenine or the oxidation of anthranilic acid (Figure 2-11). 3HAA plays a role in immunoregulation by inducing apoptosis, immunosuppression and toxicity (Morita et al., 2001, Fallarino et al., 1995, Lopez et al., 2008). 3HAA has a synergistic toxic effect when administered together with QUIN (Jhamandas et al., 1990). Notably, 3-hydroxykynurenine

58 Chapter 2: Literature review

(3-HK) and 3HAA are superoxide and hydrogen peroxide generators (Goldstein et al., 2000). Furthermore, 3-HK, 3HAA and 5-hydroxyanthranilic acid (5HAA) are known to induce cell death in cultures of rat neurons (Smith et al., 2009). 3-HK is toxic to stratial neuron cultures, mainly due to its ability to generate ROS and initiate apoptosis (Okuda et al., 1998). In contrast, 3-HK and 3HAA were demonstrated to significantly reduce index of lipid peroxidation and oxidative stress in rat brain, as well as to prevent GSH spontaneous oxidation and scavenging peroxyl radicals (Leipnitz et al., 2007). The most likely explanation for the dual effect of 3HAA and 3-HK is a concentration-dependent action. The optimal concentration of 3HAA for apoptosis induction in T cells was 300-500 μM (Hiramatsu et al., 2008), and antioxidant properties of 3HAA and 3-HK were demonstrated while concentrations veried from 0 to 100 μM (Leipnitz et al., 2007).

2.3.1.2 Quinolinic acid QUIN is likely to be the most important metabolite in terms of biological activity (Guillemin, 2012). QUIN can selectively activate NMDA receptors, producing excitation and causing selective neuronal lesions in the rat brain (Stone and Perkins, 1981, Schwarcz et al., 1983). QUIN can lead acutely to human neuronal death and chronically to dysfunction by at least five separate mechanisms (Guillemin and Brew, 2002a, Guillemin et al., 2005c). In pathophysiological concentrations, it can activate NMDA receptors (Schurr et al., 1991). QUIN also increases glutamate release in neurons and inhibits glutamate uptake in astrocytes. QUIN can potentiate its own toxicity and that of other excitotoxins, like NMDA and glutamate, producing progressive mitochondrial dysfunction (Bordelon et al., 1997). Finally, QUIN can increase free radical generation by inducing NOS production in astrocytes and neurons, leading to oxidative stress (Baran et al., 2001, Braidy et al., 2009a) . Within the brain, QUIN is only produced by activated microglia and infiltrating macrophages (Guillemin et al., 2003b), not by neurons and astrocytes (Guillemin et al., 2005b, Guillemin et al., 2007b). Recent findings have demonstrated that QUIN excitotoxicity in human astrocytes and neurons is mediated through activation of an NMDA-like receptor (Braidy et al., 2009a). In addition, QUIN-induced damage can be increased in the presence of 3-HK, ROS and 6- hydroxydopamine, which is specifically toxic for dopaminergic neurons (Guidetti and Schwarcz, 1999, Behan and Stone, 2002, Ghorayeb et al., 2001). Human glial cells, such as astrocytes and microglia, produce most components of the KP (Espey et al., 1997). The KP components are also presented in macrophages that are able to penetrate BBB in the presence

59 Chapter 2: Literature review of brain damage or infection (Heyes et al., 1992). Thus, up-regulation of QUIN production alone or together with additional neurotoxic factors during inflammation could easily lead to over-activation of the NMDA receptor followed by oxidative stress, which can occur in early PD development.

2.3.1.3 Kynurenic acid In contrast to the neurotoxic activity of QUIN, kynurenic acid (KYNA) is a neuroprotective metabolite, antagonising all ionotropic glutamate receptors (including NMDA) and thus can potentially block some of the neurotoxic effects of QUIN and other excitotoxins. KYNA is produced from kynurenine by the kynurenine aminotranferases (KAT) I, KAT II, and KAT III, in astrocytes (Guillemin et al., 2001c). Endogenous generation of KYNA in rat brain was shown to be more effective than KYNA applied exogenously, suggesting the importance of localised KYNA concentration and physical proximity to NMDA receptors (Scharfman et al., 1999). Increase in endogenous KYNA levels has been demonstrated to prevent the SN dopaminergic loss caused by focal infusion of QUIN or NMDA (Miranda et al., 1997). Nanomolar concentrations of KYNA significantly reduced glutamate output from striatal neurons in rat brain, similar to kynurenine hydroxylase (KMO) inhibitors (Carpenedo et al., 2001). Both KYNA and QUIN have been found to be produced locally in SN (Roberts et al., 1994, Schwarcz et al., 1992). Relying on the results from earlier studies, it can be hypothesised that, under normal conditions, local concentrations of KYNA and QUIN are sufficient to regulate NMDA receptor function. It is noteworthy that in disease states where excess QUIN is produced, it is thought that there is insufficient KYNA concentration to block QUIN (Foster et al., 1984).

2.3.1.4 Picolinic acid Picolinic acid (PIC), is another endogenous neuroprotective compound within the brain (Jhamandas et al., 1990) and is produced in micro-molar concentrations by human primary neurons (Guillemin et al., 2007a). PIC is also a natural metal chelating molecule of iron and zinc (Testa et al., 1985). Protein aggregation and oxidative stress are associated with the involvement of metal ions and have been described in PD’s pathology (Molina-Holgado et al., 2007). A chelation therapy approach was also suggested to be relevant to PD (Hider et al., 2011) . In physiological conditions, the KP leads to balanced production of all KP intermediates, including NAD+. Under pathologic conditions the KP is shifted toward production of kynurenine (KYN) and KYNA in astrocytes (Guillemin et al., 2001a), PIC in

60 Chapter 2: Literature review neurons (Guillemin et al., 2007b) and QUIN in activated microglia (Guillemin et al., 2005b). It is important to note that PIC is able to block the neurotoxic effect of QUIN (Beninger et al., 1994), but not the neuroexcitatory component (Jhamandas et al., 1990, Beninger et al., 1994). However, secretion of excess KYN can lead to further toxicity through synthesis of QUIN by microglia, suggesting that the constitutive synthesis of QUIN will negate the neuroprotective effects of PIC produced by other types of cells (Owe-Young et al., 2008).

61 Chapter 2: Literature review

2.4 Evidence for the involvement of the KP in PD Impaired KP metabolism and altered KYNA levels have been previously reported in the brain of PD patients, where the KYNA/TRP ratios in serum and cerebrospinal fluid (CSF) are significantly increased, along with a significant increase in levels of 3-HK, a neurotoxic compound contributing to oxidative damage, in the putamen and SNpc (Ogawa et al., 1992, Beal et al., 1992). These finding suggest that endogenous KYNA concentrations are unable to effectively block NMDA receptors and prevent excitotoxicity induced by 3-HK. Kynurenine aminotransferase-1 (KAT1) expression, the KP enzyme which leads to KYNA formation, is decreased in the SNpc of MPTP-treated mice (Knyihar-Csillik et al., 2004). KAT-I immunoreactivity in dopaminergic neurons and surrounding microglia has been linked to increased vulnerability of SN neurons to toxicity (Knyihar-Csillik et al., 2004). Lowered KYNA concentrations also have been found in frontal cortex, putamen and SNpc of PD patients (Ogawa et al., 1992). KYNA, but not highly selective NMDA antagonist 7- chlorokynurenic acid, exhibited partial protection against MPP+ toxin on dopaminergic terminals of rat striatum (Merino et al., 1999). However, increased activity of KAT2 activity, which is an enzyme responsible for 75% of the KYNA synthesis in the brain, has been found in peripheral red blood cells of PD patients, but not in the plasma (Hartai et al., 2005). This was associated with higher blood KYNA concentrations, and could be caused by 3-HK released from the CNS. As KYNA has limited abilities to cross the BBB, it has been suggested that peripheral KYNA is likely to be transported into the brain by the large neutral amino acid carrier and have neuroprotective effects (Fukui et al., 1991). A recent study showed that KYNA is involved in leukocyte recruitment and it was hypothesised that KYNA might have an anti-inflammatory action (Barth et al., 2009). Relying on preclinical and clinical data, KYNA or its analogues are considered to have neuroprotective effects in PD through binding as antagonists to the NMDA receptor, causing slow neuronal excitotoxic damage (Nemeth et al., 2006). Unpublished data from Prof. Herrero (University of Murcia, Spain) indicate increased in the production of INF-γ in the SN of MPTP-treated macaques’ brain. This is of particular significance, since INF-γ is also a potent inducer of the KP (Fujigaki et al., 2001). Same study in SN of MPTP-treated macaques, demonstrated that QUIN is produced and accumulated by activated microglia, which surrounded by dopaminergic neurons (Figure 8- 4). Several other studies have shown extensive evidence of activated microglial cells and NMDAR+ dopaminergic neurons in the SNpc, suggesting that the NMDA receptor is likely to

62 Chapter 2: Literature review

be activated by endogenous QUIN released by microglia, followed closely by glutamate (Figure 2-12) (Stone and Darlington, 2002a, McNally et al., 2008).

Figure 2-12: Model for Kynurenine pathway interactions between astrocytes, neurons, and microglia during brain inflammation.

2.4.1 Recent KP inhibitors for the Treatment of PD Specific drugs’ targeting of KP could be approached by two strategies: a) to develop and administer analogues of neuroprotective metabolites, b) to inhibit the synthesis of neurotoxic compounds or c) use prodrugs to deliver KYNA or its analogues through BBB directly to the brain. Several drugs that block the KP are currently under therapeutic investigation by our laboratory and other investigators. Pharmacological modulation of KP could potentially treat numerous disorders like AIDS-dementia and many other neurodegenerative diseases, diabetes, depression, infections, tumour development, glaucoma, and cataract formation (Stone and Darlington, 2002a, Stone et al., 2012) .

63 Chapter 2: Literature review

2.4.1.1 Enzyme inhibitors IDO1 is a rate-limiting KP enzyme and its suppression would lead to reduced QUIN production and toxicity. Evidence exists of a link between IDO activity, depression and dementia. Notably, depressive symptoms affect up to 50% of Alzheimer patients, 41% of Huntington patients, and 40% of Parkinson patients. IDO1 selective inhibition by 1-MT or hydroxyamidine small molecule inhibitors represents attractive therapy for cancer or infectious processes associated with inflammation (Ibana et al., 2011, Liu et al., 2010). The ratio between toxic QUIN and neuroprotective KYNA is largely regulated by KMO activity. Alanine derivates are able to inhibit KMO, thus increasing brain concentration of neuroprotective KYNA (Pellicciari et al., 1994). Furthermore, positive neurological changes were greater when the inhibitor was administered together with kynurenine and organic acid transporter inhibitor, which limits efflux of KYNA out of the brain (Moroni et al., 1991). Ro 61–8048 and nMBA have been demonstrated to elevate KYNA levels and reduce ischemic brain damage along with reducing neuronal loss (Cozzi et al., 1999).

2.4.1.2 Analogues of KP metabolites The most obvious way to exert neuroprotective therapy through KP is to mimic the glutamate blocking activity of KYNA, since over activation of glutamate receptors is one of the key reasons for neurodegeneration and brain damage. A synthetic derivate of KYNA, 4- chlorokynurenine, crosses the BBB and blocks QUIN toxicity at the glycine site on NMDA receptors in rat brain in vivo (Wu et al., 2000b). Kynurenic acid analogues are currently about to enter clinical trials for the treatment of epilepsy, stroke and possibly PD as potential neuroprotective agents (Stone, 2000). Two KP analogues are currently in phase III clinical trial: Teriflunomide (Sanofi-Aventis) and Laquinimod (Teva Neuroscience) (Platten et al., 2006). Recently, one KP analogue reached the Japanese market as a potent immunomodulatory drug for the treatment of arthritis, asthma and dermatitis (Platten et al., 2006): Tranilast/Rizaben® (Kissei Pharmaceutics) is an anthranilic acid derivative and it has been suggested as a treatment for autoimmune diseases such as Multiple Sclerosis (Platten et al., 2005). Finally, 8-OH quinolinine metal attenuating compounds - Clioquinol and PBT2® (Prana) - rapidly decrease soluble brain amyloid-beta and improve cognitive performance (Ritchie et al., 2004). Elevated iron levels in striatum promote oxidative stress and contribute to pathogenesis of PD (Wolozin and Golts, 2002). Quinolinine metal chelators bind selectively to zinc and copper ions and easily cross the BBB. Recent research supports the

64 Chapter 2: Literature review ability of the chelators to protect dopaminergic neurons from degeneration and to target the aging-associated protein CLK-1 (Wang et al., 2009, Kaur et al., 2009) . It is proposed to relieve age-dependent diseases, such as Alzheimer, Parkinson, and Huntington. Interestingly, Clioquinol and PBT2® share close structural similarity and similar biochemical properties with KYNA and QUIN.

2.4.1.3 Pro-drugs An alternative approach to target KP metabolites for PD is to use pro-drugs to deliver protective compounds directly to the brain. This can be used along with KYNA or its analogues. Esterified analogues penetrate the BBB faster than KYNA itself and are converted into KYNA as soon as they reach the brain (Hokari et al., 1996). Conjugates of KYNA analogues with D-glucose or D-galactose increase its ability to cross the BBB and prevent excitotoxicity and seizures in animal models (Moffett et al., 1997). Kynurenine 3-hydroxylase inhibitors significantly reduce the severity of dystonia in hamsters, suggesting it as a candidate for managing dyskinesia associated with striatal dysfunction (Hamann et al., 2008).

2.4.2 Conclusion PD seems to be associated with an imbalance between the two main branches of the KP within the brain. KYNA synthesis by astrocytes and neurons is decreased whereas QUIN production by microglia is increased (Figure 2-13). There are many therapeutic opportunities for intervention and modification of impaired KP, that potentially could stop the progression of neurodegenerative disorders such as PD. Using specific KP enzyme inhibitors, it might be possible to reinstate a physiologically normal, neuroprotective balance of the KP. This neuroprotective state might also be synergistically improved by concomitantly blocking the NMDA receptor using its antagonists, such as memantine or MK801. Another way to achieve neuroprotection is to design KYNA analogues able to penetrate the BBB, so as to deliver neuroprotective compounds to brain pools and reduce hyperactivation of glutamatergic receptors.

65 Chapter 2: Literature review

Figure 2-13 The possible role of Kynurenine pathway involvement in dopaminergic neurodegenerative process through microglia activation: Parkinson’s disease is associated with chronic activation of microglia, which also can be induced by LPS or Rotenone treatments. Classic microglia activation releases neurotoxic substances including ROS and proinflammatory cytokines such as INF-γ, potent activator of KP. KP in activated microglia leads to up regulation of 3HK and QUIN. 3HK is toxic primarily as a result of conversion to ROS. The combined effects of ROS and NMDA receptor mediated excitotoxicity by QUIN contribute to the dysfunction of neurons and their death. However, PIC produced through KP activation in neurons has the ability to protect neurons against QUIN- induced neurotoxicity, being an NMDA agonist. Microglia can become over activated by pro-inflammatory mediators and stimuli from dying neurons and cause a perpetuating cycle of further microglia activation- microgliosis. Excessive microgliosis will cause neurotoxicity to neighbouring neurons and result in neuronal death, contributing to progression of Parkinson’s disease.

66 Chapter 3: Materials and methods

Chapter 3 : Materials and methods

67 Chapter 3: Materials and methods

3.1 Overview of the methods used in the study x Culture and differentiation of human neuroblastoma cell lines (section 5.2.1 ) x Culture of human macrophages cell line (section 4.2.1.2 ) x Isolation and culture of primary dopaminergic neurons (section 6.2.1 ) x Real-time reverse transcriptase quantitative polymerase chain reaction (Real-time RT-qPCR) (section 3.1.4 and 4.2.2 ) x Design and validation of oligonucleotides for PCR amplification (section 4.2.2.6 4.3.1 ) x Immunocytochemistry (section 3.1.6 ) x Gas chromatography/mass spectrometry (GC/MS) (section 3.1.7 ) x High performance liquid chromatography (HPLC) (section 3.1.8 ) x Lactate dehydrogenase test (LDH) (section 7.2.1.4 ) x Bicinchoninic acid brotein assays (BCA) (section 7.2.1.5 ) x Real-time imaging of neurons (section 7.2.1.6 )

3.1.1 Culture and differentiation of human neuroblastoma cell lines As described in section 5.2.1

3.1.2 Culture of human macrophages cell line As described in section 4.2.1.2

3.1.3 Isolation and culture of primary dopaminergic neurons As described in section 6.2.1

3.1.4 Real-time quantitative polymerase chain reaction (RT-qPCR)

3.1.4.1 Materials Oligonucleotide primers. Brilliant III Ultra-Fast SYBR® Green QPCR Master Mix (Agilent technologies) SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen). Ethanol (Sigma-Aldrich) Absolutely RNA Miniprep Kit (Stratagene) SuperScript® VILO™ cDNA Synthesis Kit (Invitrogen)

68 Chapter 3: Materials and methods

BioPhotometer plus UV/Vis photometer, 230 V/50–60 Hz (Eppendorf) Mastercycler® gradient PCR machine (Eppendorf) Agilent 2100 bioanalyzer (Agilent Technologies) Mx3500P Real-Time PCR platform (Stratagene, NSW, Australia) Optical tube and cap strips (Applied Biosystems).

3.1.4.2 Total RNA extraction Total RNA from cells and tissue was prepared from RNeasy mini kits (Absolutely RNA Miniprep Kit) according to manufacturer’s instructions. Samples were lysed and homogenized with the lysis buffer with added β-mercaptoethanol, which immediately inactivates RNases and denatures unwanted proteins. The samples were then transferred into an RNA miniprep column where the total RNA binds to the membrane and contaminants were washed away through a series of washes and centrifugations. Ethanol was added according to manufacturer instructions to provide appropriate binding conditions. DNA contamination was removed by treating the RNA sample with on-column RNase-free DNaseI included in the kit. High-quality RNA was then eluted in 30 μL of RNase-free water. RNA was quantified using a UV spectrophotometer (BioPhotometer plus, Eppendorf) with the absorbance of 1 unit at 260 nm corresponding to 40 μg of RNA per mL. RNA was then stored at -80˚C.

3.1.4.3 cDNA synthesis cDNA was prepared by using 1 μg of RNA per reaction. Standard reverse transcription (RT) was performed using SuperScript® VILO™ cDNA Synthesis Kit according to the manufacturer’s instructions (Invitrogen). Briefly, RNA, 10 mM VILO reaction mix, SuperScript enzyme mix and water were mixed, incubated at 25˚C for 10 min to remove any nucleic acid secondary structures and subsequently placed in the Mastercycler® gradient PCR machine (Eppendorf). cDNA synthesis was performed by incubation for 60 min at 42˚C followed by terminating the reaction for 5 min at 85˚C. cDNA was then stored at -20˚C until further use.

69 Chapter 3: Materials and methods

3.1.4.4 Quantitative PCR Quantitative PCR (qPCR) analysis was carried out on the Mx3500P Real-Time PCR system (Stratagene, NSW, Australia) using Brilliant III Ultra-Fast SYBR® Green QPCR Master Mix (Agilent technologies). One PCR reaction consisted of 10 μL of SYBR Green QPCR Master Mix, 1.2 μL of 100 μM forward and reverse primers, 3.8 μL of nuclease-free water, and 5 μL of template cDNA in a total volume of 20 μL. Final concentration of primers was 300nM and concentrations of cDNA varied from 80 to 5*10−6 μM per reaction. Initial enzyme activation was performed at 95˚C for 5 min, followed by 40 cycles of denaturation at 95˚C for 5 sec, and primer annealing/extension at 60˚C for 20 sec. Melting curve analysis was performed at 95˚C for 1 min, 60˚C for 30 sec and 95˚C for 30 sec at the end of each run to confirm a single PCR product in each reaction. The relative expression of each gene was normalized against the house-keeping genes beta-2 microglobulin (B2M), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), hypoxanthine phosphoribosyltransferase (HPRT) or beta-actin (ACTB) (Table 3-1). After normalization, each sample was plotted relative to the chosen control. Primer sequences used for qPCR are shown in Table 3-1.

Gene Accession Sequence Source number GAPDH NM_002046.3 FW 5’- TCACCAGGGCTGCTTTTAAC -3’ Dr. Alban Millonig RV 5’- GACAAGCTTCCCGTTCTCAG -3’ HPRT NM_000194.2 FW 5’- TGAGGATTTGGAAAGGGTGT-3’ designed RV-5’- GAGCACACAGAGGGCTACAA-3’ ACTB NC_000007.13 Not available geNormTM B2M NM_004048.2 Not available Housekeeping Gene Selection Kit TH NM_000360.3 FW 5’-GGTGTTTGAGACGTTTGAA-3’ Dr. Fabrice RV 5’-ACAAGTGTCATCACCTGG-3’ Magnino MAP2 NM_001044.4 FW 5’-AACCGAGGAAGCATTGATTG-3’ Dr. Danie Lie RV 5’-TTCGTTGTGTCGTGTTCTCA-3’ DAT NM_001039538.1 FW 5’-CACCTGCTGCCGAGTACTTT-3’ designed RV 5’-CAGGCAGGCTGTGAGCTG-3’ Table 3-1: Primers sequences used for RT-qPCR analysis.

3.1.5 Design and validation of oligonucleotides for PCR amplification As described in chapter 4.2.2.6 4.3.1

70 Chapter 3: Materials and methods

3.1.6 Immunocytochemistry analysis

3.1.6.1 Materials ProLong® Gold reagent with 4´,6-diamidino-2-phenylindole (DAPI) (Invitrogen) Acetone (Sigma-Aldrich) Methanol (Sigma-Aldrich) Normal goat’s serum (NGS) (Sigma-Aldrich) PBS (Gibco, Invitrogen) Primary antibodies Table 3-2 Secondary antibodies Table 3-2 TritonX-100 (Sigma-Aldrich) DakoCytomation pen (Dako; Hovedstaden, DK) Fluoromount-G (Southern Biotech; AL, US) Glass cover-slip (Menzel; Lower Saxony, DE) Olympus microscope BX600 (Olympus; Middlesex, UK) Slide flask (Nunc; NY, US)

3.1.6.2 Immunocytochemistry procedure For immunocytochemistry analysis primary neurons or neuroblastoma cells were grown in slide flasks. Before the staining, the media was removed and the cells were washed twice with PBS for fixation. The cells were fixed with methanol-acetone (1:1) at -20qC for 10 min followed by two washings with cold PBS and stored at 4°C if needed. Cell membranes were permeabilized using 0.1% (v/v) Triton-X in PBS for 10 min at room temperature. Cells were washed again with PBS and incubated in 5% (v/v) normal goat serum (NGS) in PBS for at least 30 min at 37qC. Following that, the cells were washed again, dried and a Dakocytomation pen was then used to enclose the cells in separate staining wells. The primary antibodies were then diluted in 5% (v/v) NGS in PBS and applied to the cells for 1 hr in the incubator in humid conditions at 37qC (Table 3-2). Then the cells were washed extensively with PBS, the secondary antibodies (1:500) in 5% (v/v) NGS were applied and slides were placed in the incubator in dark humid conditions at 37qC (Table 3-2). After the incubation, the cells were again washed extensively, followed by nuclear staining with

71 Chapter 3: Materials and methods

ProLong® Gold reagent that contains DAPI, and coverslipped. This is a liquid mountant solution that was applied directly to fluorescently labelled cell.

Antibody Source Manufacturer TH rabbit Chemicon, Millipore TH mouse Chemicon, Millipore MAP2 mouse Chemicon, Millipore MAP2 rabbit Chemicon, Millipore Beta-tubulin III mouse Chemicon, Millipore NeuN mouse Chemicon, Millipore AlexaFlour IgG 488 anti-mouse goat Molecular probes, Invitrogen AlexaFlour IgG 488 anti-rabbit goat Molecular probes, Invitrogen AlexaFlour IgG 594 anti-mouse goat Molecular probes, Invitrogen AlexaFlour IgG 594 anti-rabbit goat Molecular probes, Invitrogen

Table 3-2 List of primary and secondary antibodies used in immunocytochemistry analysis

3.1.7 Gas chromatography/mass spectrometry (GC/MS)

3.1.7.1 Materials Picolinic acid conjugated with deuterium D4-PIC (Medical Isotopes, Inc.) Quinolinic acid conjugated with deuterium D3-QUIN (Medical Isotopes, Inc.) Quinaldic acid conjugated with deuterium D6-QA (Medical Isotopes, Inc.) 1,1,1,3,3,3-hexafluoro-2-propanol (HFP) (Sigma-Aldrich) Picolinic acid (Sigma-Aldrich) Quinolinic acid (Sigma-Aldrich) Quinaldic acid (Sigma-Aldrich) Trifluoroactic anhydride (TFAA) (Sigma-Aldrich) Trichloroacetic acid TCA (Sigma-Aldrich) Reagent-grade organic solvents 2 ml glass vial (Agilent) Autosampler Agilent 7683 (Agilent Technologies) Gas chromatography Agilent 6890 (Agilent Technologies) Glass tissue culture vials (Biolab) Mass selective detector (Agilent 5973) (Agilent Technologies) Savant SpeedVac, DNA 120 (GMI)

72 Chapter 3: Materials and methods

3.1.7.2 GC/MS method The GC/MS method used in this study was optimized by Mrs Sonia Bastamante (BMSF, UNSW). The GC/MS method used for the analysis of PIC, QUIN and QA levels in the supernatant of growing cells as described previously (Guillemin et al., 2007b, Smythe et al., 2002). Briefly, the internal standards used were PIC, QUIN and QA, conjugated with deuterium. Fresh standard solutions of PIC, QUIN and QA were prepared in distilled water. For blood plasma, protein was precipitated by the addition of an equal volume of 10% (v/v) TCA and centrifuged at 1000 rpm for 5 min. Samples (100 μl) and standards were then transferred to glass tissue culture vials (100 x 10 mm) with the addition of 50 μl of internal standard and then evaporated to dryness. 60 μl TFAA and 60 μl HFP were then added to the tubes. The glass vials were then capped and heated at 60qC for 30 min to produce the hexafluoroisopropyl ester of the respective acid. The ester products were then dissolved in 880 μl toluene and transferred to autosampler vials where 1 μl of each sample was injected into a gas chromatography interfaced to a mass selective detector via an autosampler. Experiments were done in triplicates and final concentration in cells’ supernatant were calculated based on standard curves of PIC, QUIN and QA generated during the same experiment.

3.1.8 High performance liquid chromatography (HPLC)

3.1.8.1 Materials 3-nitro-L-tyrosine (Sigma-Aldrich) Ammonium acetate (Sigma-Aldrich) Bovine serum albumin (BSA) (Sigma-Aldrich) Kynurenine (Sigma-Aldrich) Potassium phosphate monobasic (Sigma-Aldrich) Potassium phosphate dibasic (Sigma-Aldrich) Trichloroacetic acid (TCA) (Sigma-Aldrich) Tryptophan (Sigma-Aldrich) 0.45 Pm, 4 mm, PTFE filters (Waters) 2 ml glass vial (Agilent Technologies) 250 Pl limited volume inserts (Agilent Technologies)

73 Chapter 3: Materials and methods

HPLC machine, Agilent series 1100 (Agilent Technologies)

3.1.8.2 HPLC method The HPLC method used in this study was optimised by Dr. Chai Lim (Neuroinflammation unit, SOMS, UNSW) The HPLC method was developed and optimized from the TRP and KYN quantification method, described before (Schrocksnadel et al., 2006). For analysis, 50 Pl of 0.05 M potassium phosphate buffer (pH 6.0) was added to 50 Pl of sample, together with 100 Pl of 50 PM nitrotyrosine, as an internal standard, and 250 Pl of 0.2 PM TCA, for protein precipitation. The mixture was then mixed by vortex and centrifuged at 13,000 g for 10 min in 4°C. Then, supernatant was filtered through a 0.45 Pm, 4 mm, PTFE filter, and a 100 Pl aliquot was transferred into a 250 Pl glass insert and placed into a 2 ml vial. The vial was capped and set onto a HPLC autosampling device. The external standards were prepared using stock solutions of TRP and KYN (1 M in MilliQ water) made up to 1 ml with BSA solution (70 g/L). Aliquots of the external standards were then treated in the same manner as the unknown samples. The HPLC analysis was controlled using ChemStation software. For each sample, 30 Pl was injected into the machine and the analysis was carried out using a C18 column at a flow rate of 1 ml/min, at 22qC, with 0.1 M ammonium acetate buffer (pH 4.65) as the mobile phase. TRP was monitored by a fluorescence detector at an excitation wavelength of 285 nm, an emission wavelength of 365 nm and a retention time of 17.5 min. KYN was monitored in the samples prepared by same method using an ultraviolet-detector, set at 360 nm wavelength, with a retention time of 8.7 min. The concentration of KYNA was quantified by HPLC with fluorescence detection along with the mobile phase consisting of zinc ions (Zn2+). Since the endogenous concentration of KYNA is very low, ions of zinc can enhance fluorescence of KYNA thus increasing the signal (Shibata, 1988, Mitsuhashi et al., 2007). The fluorescence excitation wavelength was 344 nm and emission wavelength was 388 nm. Final concentrations in supernatants were calculated based on standard curves of TRP, KYN and KYNA generated during the same experiment.

74 Chapter 3: Materials and methods

3.1.8.3 Ammonium acetate buffer preparation In 800 ml of MilliQ, dissolve 7.71 g of ammonium acetate (Sigma-Aldrich) and pH to 4.65 with glacial acetic acid (Sigma-Aldrich). Make up to 1 L with MilliQ water and filter through a 0.45 Pm cellulose membrane (Agilent Technologies).

3.1.9 Statistical analysis Results obtained are presented as means ± the standard error of mean (SEM). Significant differences between results were verified using the two-tailed independent- measures t-test with equal variance. The results were considered significant when P-values were less than 0.05. All results are obtained from 3 experimental repetitions, unless otherwise stated.

75 Chapter 4: KP primers’ validation

Chapter 4 : Validation of a reliable set of primers for measuring expression of Kynurenine Pathway genes by real-time quantitative RT-PCR in human cells

76 Chapter 4: KP primers’ validation

4.1 Introduction Quantification of gene expression using real-time quantitative reverse transcriptase polymerase chain reaction (RT-qPCR) is a reliable method to characterize expression of Kynurenine pathway related enzymes (Figure 4-1). The main objective of this study was to validate a set of human primer pairs that can be routinely used to monitor expression of genes encoding KP enzymes in a variety of cells. The KP has been characterised in human macrophages (Guillemin et al., 2001b), motor neurons (Guillemin et al., 2007b), glial cells (Guillemin et al., 2003b) and astrocytes (Guillemin et al., 2003a) using reverse transcript PCR (RT-PCR) and incomplete set of primers. Importantly, the KP enzyme profile varies in different type of cells (Guillemin et al., 2005b). Validation of 18 primer pairs will represent an important and accurate tool in KP investigation. Extensive KP profiling for each cell type will enable researchers to track even minor changes in enzyme expression level, occurring during pathological processes. This chapter describes the steps used to optimize and validate 18 human primer pairs for RT-qPCR assays using SYBR Green detection.

77 Chapter 4: KP primers’ validation

Figure 4-1 Schematic summary of the major KP metabolites and enzymes. 4.1.1 Kynurenine pathway enzymes

4.1.1.1 Indoleamine 2,3-dioxygenase 1 and 2 (IDO1 and IDO2) Both IDO1 and IDO2 catabolise tryptophan to kynurenine. The IDO1 and IDO2 proteins share about 43% identity at the amino acid level expression in a variety of antigen- presenting cell types (Ball et al., 2009). The immune regulatory role of IDO1 was first demonstrated when an IDO inhibitor, 1-methyl-Trp (1MT), was shown to activate maternal T cell tolerance towards the allogeneic foetus in mice, initiating a lethal immune response (Mellor and Munn, 2001). IDO1 is constitutively expressed in several tissues including lung, small intestine, placenta, spleen and central nervous system (Dai and Zhu, 2010, Stone et al., 2003) , and is up-regulated in numerous cell types in response to interferon-γ (IFN-γ) and other pro-inﬂammatory cytokines (Macchiarulo et al., 2009). Biochemical studies indicate that both enzymes have similar catabolic activity, although the expression pattern is dependent on cell type and physiological conditions (Ball et al., 2007). For example, IDO1 is

78 Chapter 4: KP primers’ validation strongly induced by IFN-γ, but it is less clear whether this is the case for IDO2. Additionally, whereas IDO1 is induced in endothelial cells during malaria infection in mice, IDO2 is induced in kidney, down regulated in liver and, unlike IDO1 is independent of the presence of IFN-γ. Taken together, this information suggests that IDO1 and IDO2 respond to distinct signalling pathways and have distinct functions in immunomodulation, proposing possible selective targeting of these enzymes (Meininger et al., 2011).

4.1.1.2 Arylformamidase (AFMID) AFMID, known also as kynurenine formamidase, catalyses the hydrolysis of N- formyl-L-kynurenine to L-kynurenine, the second step in the conversion of tryptophan to nicotinic acid, NAD and NADP. The initial step of the degradation, opening the indole ring, is activated by INF-γ in the cells of the immune system and others (Wirleitner et al., 2003). The most significant function of AFMID in the KP may be in eliminating toxic metabolites and, to a lesser extent, in providing intermediates for other processes (Dobrovolsky et al., 2005a).

4.1.1.3 Tryptophan 2,3-dioxygenase (TDO2) TDO2, also known as TDO, is a ferrous heme enzyme that catalyses the first and rate- limiting step in the KP. It incorporates oxygen into the indole moiety of tryptophan. It has a broad specificity towards tryptamine and derivatives including D- and L-tryptophan, 5- hydroxytryptophan and serotonin, but is highly specific for L- tryptophan (Leeds et al., 1993). Despite catalysing the same biochemical reaction as IDO and sharing relatively conserved active site regions, the two enzymes share an overall amino acid sequence identity of not more than 10% (Forouhar et al., 2007). While IDO is inducible by inﬂammatory stimuli, TDO is induced by tryptophan, glucocorticoids, and kynurenine (Sono et al., 1996). TDO is suggested to be a key molecule involved in regulating adult hippocampal neurogenesis (Kanai et al., 2009).

4.1.1.4 Tryptophan hydroxylase 1 and 2 (TPH1) TPH catalyzes the rate limiting step in neurotransmitter serotonin (5-HT) synthesis (Zhang et al., 2004). Serotonin dysfunction has been implicated in different psychiatric disorders such as major depression, schizophrenia, autism, and attention-deﬁcit/hyperactivity disorder (Lucki, 1998). Until recent identification of a new TPH isoform (TPH2), only one TPH gene was described for vertebrates, now called TPH1. Human TPH1 and TPH2 share 71% amino-acid homology (Walther and Bader, 2003). Human TPH1 and TPH2 are equally

79 Chapter 4: KP primers’ validation expressed in several brain regions, with a predominant expression of TPH2 in the brain stem, the major locus of the serotonin-producing neurons, but not in peripheral tissues like TPH1 (Zill et al., 2004).

4.1.1.5 Monoamine oxidase A and monoamine oxidase B (MAOA and MAOB) MAO-A and MAO-B catalyse the oxidative deamination of biogenic and dietary amines. MAO substrates include the neurotransmitters serotonin, norepinephrine and dopamine, and the neuromodulator phenylethylamine (Shih and Thompson, 1999). The rapid degradation of bioactive monoamines by MAO enzymes is essential for appropriate synaptic neurotransmission, and monoamine signalling affects motor, perceptual, cognitive and emotional brain functions (Bortolato et al., 2008). Both enzymes exist on the outer membrane of the mitochondria of various types of cells in various tissues including the brain (Erwin and Hellerma.L, 1967). In humans, MAO-A is abundant in the brain and liver, whereas the liver, lungs and intestine are rich in MAO-B (Saura et al., 1992). In the human brain, MAO-A exists in catecholaminergic neurons, but MAO-B is found in serotonergic neurons and glial cells. Patients affected with MAO gene microdeletion suffer from severe mental retardation, epilepsy and stereotypic movements (Whibley et al., 2010). MAO-A and MAO-B were suggested to play a role in neuropsychiatric disorders such as depression and PD (Hotamisligil et al., 1994).

4.1.1.6 Kynurenine aminotransferase 1, 2 and 3 (KAT1, KAT2, KAT3) KAT is an enzyme responsible for the synthesis of neuroprotective kynurenic acid (KYNA), a NMDA receptor antagonist, implicated in the pathophysiology of schizophrenia, Huntington's disease and other neurological disorders (Schwarcz, 2004). KAT 1, also known as glutamine transaminase K (GTK) or cysteine conjugate beta-lyase (CCBL), is present in several organs, including in the brain astrocytes and neurons (Carninci and Hayashizaki, 1999). KAT 2 is also known as alpha-aminoadipate aminotransferase (AADAT) and KAT3 as CCBL2 Among the three human KATs, KAT 1 and KAT 2 share the highest sequence identity (51.7%). All three KATs show activity with kynurenine, phenylalanine, tyrosine, and tryptophan, and with the sulfur-containing amino acid, methionine. KATs 1 and 3 display very similar amino acid substrate profiles. Both KAT1 and 3 show high activity with glutamine and no detectable activity to glutamate, which contrasts with KAT 2 which shows high activity with glutamate and extremely low or undetectable activity to glutamine. KAT II is unique in having AADAT activity to transfer nitrogenous groups (Han et al., 2010).

80 Chapter 4: KP primers’ validation

4.1.1.7 Glutamic-oxaloacetic transaminase 2 (GOT2) GOT2, also known as KAT4 or mitochondrial aspartate aminotransferase (ASAT) has been reported in mouse, rat, and human brains. GOT2 normally exists in liver and heart cells in cytoplasmic and inner-membrane mitochondrial forms. GOT2 catalyses the reversible transfer of an amine group from glutamic acid to oxaloacetic acid, forming alpha-ketoglutaric acid and aspartic acid. The enzyme has a number of specific roles in astrocytes and neurons in the brain (McKenna et al., 2000). a) GOT2 has a role in the entry of glutamate into the tricarboxylic acid cycle, and in resynthesis of intramitochondrial glutamate from tricarboxylic acid cycle intermediates (McKenna et al., 1996). b) GOT2 has a key role in the synthesis of neurotransmitter glutamate in brains (Palaiologos et al., 1989); c) it is an essential component of the malate–aspartate shuttle, which is considered the most important mechanism for transferring reducing equivalents from the cytosol into mitochondria in brain (McKenna et al., 2006). GOT2 expression is raised in conditions that affect the heart and liver such as viral hepatitis and myocardial infarction. Following damage to these cells, the enzyme is released into the blood where the level can be measured. Patients with Parkinsonism showed elevated GOT2 level in their CSF (Steen and Thomas, 1962).

4.1.1.8 Kynurenine 3-monooxygenase (KMO) KMO is a rate-limiting enzyme at the branching point of the KP, converting kynurenine (KYN) to 3-hydroxykynurenine (3-HK). The KMO enzyme is located at the outer membrane of the mitochondria (Okamoto et al., 1967). Formation of kynurenic acid (KYNA) directly depends on the activity of kynurenine 3-monooxygenase (KMO) (Moroni, 1999). Based on this, pharmacologic inhibition of KMO will shunt the metabolism of KYN to KYNA. Genetic analysis of a few families affected with Schizoaffective disorder revealed linkage to the KMO encoding region on the chromosome (Hamshere et al., 2005). There is genetic and pharmacological evidence that inhibition of KMO activity protects against neurodegeneration associated with Huntington's disease in an animal model (Zwilling et al., 2011, Campesan et al., 2011).

4.1.1.9 Kynureninase or L-kynurenine hydrolase (KYNU) KYNU is a member of a large family of catalytically diverse but structurally homologous pyridoxal 5'-phosphate (PLP)-dependent enzymes known as the alpha-family. KYNU, as a PLP-dependent enzyme, is in a subgroup of the aminotransferases, which suggests that KYNU has an aminotransferase fold. Branched chain aminotransferases are

81 Chapter 4: KP primers’ validation involved in excitatory neurotransmitter glutamate synthesis in the CNS and recently have been recognized as targets of the neuroactive drug gabapentin (Hutson, 2001). Kynurenine is first hydroxylated to 3-hydroxykynurenine, which is the preferred substrate of KYNU in those organisms, resulting in 3-hydroxyanthranilate and L-alanine. (Phillips, 2011). KYNU is one of the enzymes involved in the biosynthesis of NAD cofactors from tryptophan through the KP.

4.1.1.10 3-Hydroxyanthranilate 3,4-dioxygenase (3HAAO) 3HAAO is an enzyme responsible for the conversion of 3-hydroxyanthranilic acid (3- HAA) to QUIN. It acts in the final stage of the kynurenine pathway, where it catalyses the ring opening of 3-HAA with the incorporation of both atoms of molecular oxygen, giving rise to the unstable intermediate 2-amino-3-carboxymuconic acid semialdehyde (ACS). The ACS can be converted non-enzymatically to QUIN or can be converted to PIC enzymatically (Stone and Darlington, 2002a).

4.1.1.11 Quinolinate phosphoribosyltransferase (QPRT) QPRT is a key de novo NAD-biosynthetic enzyme which catalyses the transfer of quinolinic acid (QUIN) to 5-phosphoribosyl-1-pyrophosphate, yielding nicotinic acid mononucleotide. Homo sapiens QPRT has a hexameric structure (Liu et al., 2007). A possible mechanism for a pathological accumulation of QUIN can be a deficiency in its degradation by QPRT. Elevation of QUIN levels in the brain has been linked to the pathogenesis of neurodegenerative disorders (Feldblum et al., 1988). QPRT activity measured in normal human brain appeared to be highest in the caudate nucleus and SN (Foster et al., 1985), proposing a potential explanation for the specific vulnerability of dopaminergic neurons in SN. It was also demonstrated that QPRT-depleted cells had an increased intracellular active-caspase-3 activity and were highly sensitive to spontaneous cell death (Ishidoh et al., 2010).

4.1.1.12 Aminocarboxymuconate semialdehyde decarboxylase (ACMSD) The enzyme ACMSD is a zinc-dependent amidohydrolase that participates in PIIC, QUIN and NAD homeostasis. This enzyme stands at a branch point of the tryptophan to NAD pathway, and ultimately controls whether tryptophan will be transformed into PA by completing oxidation through the citric acid cycle, or converted into NAD through QUIN synthesis (Pucci et al., 2007a). Serum and tissue QUIN and PIC levels are highly influenced by ACMSD activity (Shin et al., 2006). Both PA and QUIN are involved in a number of

82 Chapter 4: KP primers’ validation physiological and pathological conditions, mainly affecting the central nervous system. Thus modulation of ACMSD activity proposed to be a promising prospect for the treatment of neurological disorders, including Parkinson’s.

4.1.2 Aims The aims of this study are: 1) To design oligonucleotide primers’ pairs. 2) To optimize primers’ concentration and PCR efficiency choosing the appropriate type of human cells or tissues. 3) To provide a valid tool for KP investigation in human samples by using RT-qPCR.

4.1.3 Rationale KP characterization has been done before in other CNS cell types (Guillemin et al., 2007a, Guillemin et al., 2003b). However, only some of the known KP enzymes were screened and reverse transcription polymerase chain reaction (RT-PCR) method was used. RT-qPCR offers many technical advantages over RT-PCR technique, including reduced probabilities of variability and contamination, higher sensitivity, as well as online monitoring and the convenience and accuracy of final results, expressed in numbers. To increase our understanding of KP involvement in molecular mechanisms it is essential to develop accurate and reliable assays for KP gene expression quantification. To date, qPCR is the gold standard for gene expression analysis and widely applied technique (D'Haene et al., 2010, Jozefczuk and Adjaye, 2011).

4.1.4 Study step-wise approach Every primer pair validation was performed using organised methodology (Figure 4- 2). Each primer was designed accordingly to a set of defined criteria for quantitative PCR reaction. Selected primers underwent an optimization process followed by a demonstration of a single, specific PCR product and its efficiency. After this, RT-qPCR assays for KP enzymes were ready for routine use.

83 Chapter 4: KP primers’ validation

Figure 4-2: Schematic approach to primers’ optimisation study

84 Chapter 4: KP primers’ validation

4.2 Materials and methods

4.2.1 Cell cultures and tissue isolation

4.2.1.1 Materials Foetal bovine serum (FBS) (Gibco, Invitrogen) Dulbecco’s modified eagle medium 11995 (DMEM) (Gibco, Invitrogen) Glutamax (Gibco, Invitrogen) penicillin/streptomycin (PS) (Gibco, Invitrogen) 5% trypsin EDTA 10X (Gibco Invitrogen) Phosphate-Buffered Saline (PBS) without calcium, magnesium and phenol-red (Gibco, Invitrogen) Modified Eagle’s medium nonessential amino acids (NEAA) (Sigma-Aldrich) Tissue culture plates (BD Biosciences) Tissue culture flask (BD Biosciences) Eppendorf 1.5ml conical microcentrifuge tubes (BD Biosciences) Interferon gamma, human (IFN-γ) (Invitrogen)

4.2.1.2 Tissue culture of U973 macrophages-derived cell line The U937 cell line was derived by Sundstrom and Nilsson in 1974 from malignant cells obtained from the pleural effusion of a patient with histiocytic lymphoma (Sundstrom and Nilsson, 1976) (Figure 4-3) . The human monocytic cell line U937 (ATCC CRL 1593; American Type Culture Collection, Rockville, Md.) was grown in Figure 4-3: Cultured macrophages at low and high confluence. RPMI 1640 containing 2mM ATCC glutamine, penicillin/streptomycin (50IU/ml/50g/ml) and 10% (v/v) fetal calf serum (FCS). U937 cells were cultured at 0.5*106 cells/ml in the T75 tissue culture flask. Cells were incubated at 37ºC, in 5% CO2 for 4 days to 6 days until confluent, then IFN-γ (100 U/ml) was

85 Chapter 4: KP primers’ validation added to the cell culture for 48 h. IFN-γ stimulates IDO-1 enzyme expression in macrophages, thus up regulating KP expression (Alberati-Giani et al., 1996). Thus stimulated cells are expected to express KP enzymes at higher levels. After treatment, the cells were washed with PBS (pH 7.4), harvested by scraping with a rubber policeman in 1ml of lysis buffer from RNA extraction kit (Absolutely RNA Miniprep Kit; Stratagene ), and stored as pellets at —80°C until further RNA extraction.

4.2.1.3 Tissue isolation Brain, liver or kidney were isolated from human foetus (gestation week 15-18). Organs were removed into sterile PBS and cleaned from blood vessels and attached membranes. The organs were cut into several fragments, removed from PBS by fine forceps and placed in 1.5ml eppendorf tube. The tube was immediately deepen in a metal bucket with liquid nitrogen for 30-60 minutes to allow “snap freezing”. “Snap freezing” is the process by which samples are lowered to temperatures below -70°C very rapidly, achieving the same endpoint as slow rate-controlled freezing, but at an approximate rate of -10-1000°C/min, compared to -1°C/min. The frozen sample is removed to a liquid nitrogen tank for prolonged storage if needed. This method allows preservation of specimen integrity and reliable results in future tissue analysis, including RNA extraction. Only intact liver and kidney organs were used.

4.2.2 Real-time quantitative polymerase chain reaction (RT-qPCR)

4.2.2.1 Materials Oligonucleotide primers. Brilliant III Ultra-Fast SYBR® Green QPCR Master Mix (Agilent technologies) SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen). Ethanol (Sigma-Aldrich; MO, US) Absolutely RNA Miniprep Kit (Stratagene) SuperScript® VILO™ cDNA Synthesis Kit (Invitrogen) BioPhotometer plus UV/Vis photometer, 230 V/50–60 Hz (Eppendorf) Mastercycler® gradient PCR machine (Eppendorf) Agilent 2100 bioanalyzer (Agilent Technologies) Mx3500P Real-Time PCR platform (Stratagene, NSW, Australia) Optical tube and cap strips (Applied Biosystems)

86 Chapter 4: KP primers’ validation

4.2.2.2 Tissue homogenizing Small piece of frozen tissue was weighed immediately upon removal from liquid nitrogen tank. 40 to 60 milligram of tissue was used for one RNA extraction. Using cold glass tissue grinder the sample was broken down while still frozen. Then cold lysis buffer from RNA extraction kit was added and the syringe-needle method was used to achieve complete homogenization. The homogenized sample should be of even consistency with no visible chunks and smoothly glide through an insulin syringe needle. Using the syringe the sample was transferred to the RNA kit extraction column.

4.2.2.3 Total RNA extraction As described in section 3.1.4.2

4.2.2.4 RNA integrity number (RIN) To determine the RNA quality, total RNA samples obtained from human fetal brain, liver, kidney and U-937 cell line were analysed on the Agilent 2100 bioanalyzer (Agilent Technologies). The bioanalyzer software automatically generates the electropherogram, detailing the regions that are indicative of RNA quality and assign it to an RIN class by numbers. For classification of RNA ten integrity categories were defined from 1 (totally degraded) to 10 (fully intact RNA). The analysis was performed at the Ramaciotti Centre (UNSW, Australia)

4.2.2.5 cDNA synthesis As described in section 3.1.4.3

4.2.2.6 Design of primers and test of amplification efficiency Primers were obtained from several sources: designed by Dr. Fabrice Magnino (PCR/qPCR specialist Integrated Sciences Pty Limited), a gift from collaborating researchers, Primer Bank (http://pga.mgh.harvard.edu/primerbank/) or designed by using Primer BLAST (web-based NCBI primer designing tool: http://www.ncbi.nlm.nih.gov/tools/primer-blast/) or Primer3 designing programme (http://primer3.sourceforge.net/). All obtained sequences were run through “Amplify 3x” (http://engels.genetics.wisc.edu/amplify/) and “NetPrimer”

87 Chapter 4: KP primers’ validation

(http://www.premierbiosoft.com/index.html )software and blasted with Primer BLAST for determination of exon/intron boundaries and evaluating the best potential outcome based on relative scores and secondary structures. The following parameters were used during the design: melting temperatures 58-61°C, primer lengths 20-24bp and amplicon lengths 80-200 bp. 3 to 5 primer pairs were directed to locate on different exons or directly spanning exon- exon junction of each cDNA. For each primer pair, reaction efficiency estimates were derived from a standard curve generated from a serial dilution of selected cDNA. Target reporter fluorescence is determined from the fractional cycle at which a threshold amount of amplicon CT DNA is reached: R CT = R0 * (1+ Eexp )* . R n value is a normalized reporter value, where the fluorescent signal from SYBR Green normalized to the signal of the passive reference dye for a given reaction; Eexp is an amplification efficiency of the primers and CT is cycle (-1/s) threshold. Eexp = (10 -1)*100% , where s represents the slope of linear regression of CT values versus the logarithm of the cDNA dilution factor (Ginzinger, 2002).

4.2.2.7 Quantitative PCR As described in section 3.1.4.4

88 Chapter 4: KP primers’ validation

4.3 Results

4.3.1 Primers design The oligonucleotide sequences obtained from different sources were checked for various parameters, adequate for a typical PCR reaction (Dieffenbach et al., 1993) (Strachan

and Read, 1999). 1) Primer length: It is generally accepted that the optimal length of PCR primers is 18-22 bp. This is long enough for adequate specificity and short enough for

primers to bind easily to the template at the annealing temperature. 2) Primer melting

temperature (Tm) and annealing temperature (Ta): is the temperature at which one half of the DNA duplex will dissociate to become single stranded and indicates the duplex stability. o Primers with melting temperatures in the range of 52-58 C generally produce the best results. Primers with melting temperatures above 65oC have a tendency for secondary annealing. Ta is that temperature at which the single stranded primer will specifically bind to the template sequence. It therefore has to be lower than the melting temperature, so that the primer will anneal with template DNA. Brilliant III Ultra-Fast SYBR® Green QPCR Master Mix (Agilent Technologies) has to be used at 60˚C according to manufacturer instructions.

Thus, primers considered for a future optimization are preferably to cover a Ta range between

57-62˚C and have Tm above 60˚C. The GC content of the sequence gives a fair indication of

the primer Tm. 3) GC Content: The GC content (the number of G's and C's in the primer as a

percentage of the total bases) of primer should be 40-60% for optimal Tm. Tm is calculated using the nearest neighbour thermodynamic theory, which is accepted as the most recent and best available (Peyret et al., 1999). 4) GC Clamp: The presence of G or C bases within the last five bases from the 3' end of primers (GC clamp) helps promote specific binding at the 3' end due to the stronger bonding of G and C bases. More than 3 G's or C's should be avoided

in the last 5 bases at the 3' end of the primer. 5) Primer Secondary Structures: Presence of the primer secondary structures produced by inter- or intra-molecular interactions can lead to poor or no yield of the product. They affect primer template annealing and thus the amplification and reduce the availability of primers for the reaction. Hairpins are formed by intramolecular interaction within one strand of primer. Self-dimers are formed by intermolecular interactions between two same sense primers, when the primer contains homologous regions. Primer cross dimers are formed by intermolecular interaction between sense and antisense primers, where they are homologous.

89 Chapter 4: KP primers’ validation

All available sequences were screened using NCBI Primer Blast, NetPrimer, Amplify

3x and PrimerCheck web-based softwares to predict or calculate Tm, GC content, primer length, presence of secondary structures, number of PCR products and other relevant scores discussed further. Table 4-1 represents set of primers’ pairs for GOT2 amplification, which are candidates for future consideration. Full list of primers and its criteria can be found in the Appendix for this chapter. Only primer sets marked with blue were chosen for further optimisation. The eliminating criteria for inadequate sets of primers are marked with green. Some of eliminating criteria are: inappropriate Tm, large product size, few predicted PCR products instead of one specific, secondary structures or lower score compared with other candidates. Table 4-1 also demonstrates other possible matches between forward and reverse primers from different pairs, if they are available.

90 Chapter 4: KP primers’ validation

Primer length Melting Temp GC% Product size (bp) NCBI blast total score Query coverage "Amplify 3X"

screening results score other matches serial number Designed RT-PCR

Accession primer sequences for Source Sequence

number

KP (human)

Homo sapiens 60.3 4 105+19 46. 100 Fwd 5'- gagtcactgaagcctttaagagg 23 glutamic-oxaloacetic 0 8 50 1 % transaminase 2, mitochondrial PrimerBank (aspartate NM_0020 ID × aminotransferase 2) 8.2 62.5 5 42. 100 4504069a1 1 Rev 5'- ggacgctaggcagaacgtaag 21 (GOT2), nuclear gene 0 7 1 % encoding mitochondrial protein, mRNA 60.3 4 44. 100 PrimerBank Fwd 5'- atttggacaaggaatacctgcc 22 101 NM_0020 0 5 1 % GOT2 ID 1 2 8.2 61.0 5 40. 100 4504069a2 Rev 5'- gccactcttcaagacttcgc 20 0 5 1 % 62.2 5 105+12 38. 100 PrimerBank Fwd 5'- agagtggccggtttgtcac 19 NM_0020 0 8 95 2 % GOT2 ID × 3 8.2 60.3 4 44. 100 4504069a3 Rev 5'- gaaagacatctcggctgaactt 22 0 5 1 % 72.0 5 48. 100 Integrated Fwd 5'- gacctcctccctttgttgaatgtg 24 162 NM_0020 0 0 1 % GOT2 Sciences Dr. OK 4 8.2 catggttagagcagatggtggtt 72.0 5 48. 100 Magnino Rev 5'- 24 c 0 0 1 %

Table 4-1: Example of primer selection criteria for the GOT2 gene, among 4 candidate pairs. Full table presented in Appendix for chapter 4.

91 Chapter 4: KP primers’ validation

4.3.1.1 Basic Local Alignment Search Tool ( BLAST) BLAST finds homologous sequences, using a heuristic method, by locating short matches between the two sequences and after this first match BLAST begins to make local alignments (Altschul et al., 1990). Nucleotide-nucleotide BLAST (blastn) was used to identify DNA query (the primer of interest). Blastn returns the most similar DNA sequences from the DNA database that the user specifies. When performing a BLAST on NCBI, the results are given in a graphical format showing the hits found between the primer of interest and gene databases. A table below shows sequence identifiers for the hits with scoring related data, as well as alignments for the sequence of interest and the hits received with corresponding BLAST scores for these (Figure 4-4).

Figure 4-4: Example of BLAST output for IDO1 primer pair. Red frame highlightes 100% coverage with accession number of IDO1.

92 Chapter 4: KP primers’ validation

The rationale behind BLAST is that there are often high-scoring segment pairs (HSP) contained in a statistically significant alignment. BLAST searches for HSP between the query sequence and sequences in the database using a 50 times faster heuristic approach that approximates the more accurate Smith-Waterman algorithm. The exhaustive Smith- Waterman approach is too slow for searching large genomic databases such the GeneBank (Bandyopadhyay and Mitra, 2009). The speed and relatively good accuracy of BLAST are among the key technical innovations of the BLAST programs. However, since it is in principle a local similarity search program, its output often contains many redundant HSPs. Usually this is because of the existence of homologues, pseudogenes or some repeated fragments in the genome (Zhang, 2003). The purpose of this screening was to confirm that each primer aligns with the gene of interest. Another purpose is to compare scores between different primers pairs as a parameter to predict pair performance (Table 4-1).

"Total Scores" is the sum of the score of all HSPs with the given sequence from the database. Sorting by this figure helps separate the HSPs from intron-less pseudo-gene matches away from true exon matches since the true exon matches are often of higher quality and cover more of the query mRNA.

"Query Coverage" is the length coverage of the input query sequence by different HSPs from the same database sequence. Sorting by this figure has a similar effect to sorting by "Total Score".

"Maximal Identity" is the highest percent identity of the HSPs from the same database sequence. In most cases, sorting by this figure helps bring to the top the HSPs with higher percent identity to the query and makes them more visible. “E-value” reported for each match represents that number of alternate alignments, with the same or better total score, that could be expected to occur within the database purely by chance. Thus, the lower the E-value is, the better the match between the primers and the gene of interest.

4.3.1.2 NetPrimer NetPrimer is a web-based program for primer screening. Primers are analysed for primer properties as: Tm, molecular weight, GC%, optical activity (both in nmol/A260 & μg/A260), both ends stability factors. Primers are also analysed for all primer secondary structures including hairpins, self-dimers, and cross-dimers in primer pairs. The program

93 Chapter 4: KP primers’ validation

quantifies molecular weight and optical activity of primers to provide information on the stability of the secondary structures. Figure 4-5 is an example output of IDO1 primer screening: Ideally secondary structures should be avoided, but in most cases some will exist. Delta G value is an indicator for secondary structure stability in a PCR reaction. Delta G values for hairpins and dimers should be more positive than -9 kcal/mole. Essentially, the more negative the Delta G value of a secondary structure, the more likely it is that these structures interfere with the PCR reaction (Breslauer et al., 1986). The primers chosen for the next step had none or a minimal number of hairpins or dimers, and the most positive delta G number.

Figure 4-5: Example of NetPrimer output. Different colours mark secondary structures predicted: blue- hairpins, red- self dimers, green- cross dimers.

94 Chapter 4: KP primers’ validation

4.3.1.3 Amplify 3x Amplify 3x is a program to simulate the polymerase chain reaction. It allows the user to specify a target sequence and primers, and to predict the amplification result. Amplify 3x draws a diagram of the predicted results showing all expected primer matches and amplified fragments. All candidate primers were checked for the potential to form more than one PCR product and the size of amplicons (Figure 4-6). Ideally, the amplicon should always be between 100bp and 150bp to ensure the qPCR reaction efficiency is as close to 100% as possible. Good qPCR efficiency promotes assay reproducibility and sensitivity. The potential ability of sense and anti-sense primers from different pairs to amplify a target gene was screened too. The results are indicated in Table 4-1, in ”product size” and “other matches” columns.

Figure 4-6: Example of Amplify 3X output. Screening of GOT2 primers: thick black line indicates formation of target amplicon, thin black line shows potential formation of another amplicon and its size.

95 Chapter 4: KP primers’ validation

4.3.1.4 Primer-check PrimerCheck displays splice variants and the target location of PCR primers. Mature mRNA is a union of exons, while introns have been removed from the pre-mRNA sequence that has just been transcribed from the genomic DNA (Reed, 2003). To avoid amplification of contaminating genomic DNA, primers for RT-PCR should be designed so that one half of the primer hybridizes to the 3' end of one exon and the other half to the 5' end of the adjacent exon (Figure 4-7). Such primers will anneal to cDNA synthesized from spliced mRNAs, but not to genomic DNA.

Figure 4-7: Difference between primers spanning and flanking intron/exon junctions. Amplicons from cDNA, without intron, obtained with spanning primers will be smaller, than amplicons from genomic DNA that contain introns, and obtained with flanking primers. www.qiagen.com/literature/render.aspx?id=23579

However, some mRNA sequences have no deletion of introns, some are direct copies of the DNA coding sequence with no genomic DNA sequence eliminations and some are eukaryotic pseudo genes. Figure 4-8 demonstrates that there may not be adequate sequences at the exon-intron junction. In these cases high quality mRNA that was treated to remove genomic DNA contamination by DNase I enzyme becomes extremely important (Vanecko and Laskowski, 1961).

96 Chapter 4: KP primers’ validation

Figure 4-8: Example of Primer-check output. Both HAAO primers are located on exons, while one primer from CCLB2 pair is located on exon/intron junction and represent the optimal primer location.

4.3.2 RNA quality RNA is a thermodynamically stable molecule; however it is easily digested by omnipresent RNase enzymes. As a result, short fragments rapidly occur in the sample, which can potentially affect the result of future analysis (Auer et al., 2003). It is important to evaluate the degree of degradation, to ensure RNA standardization and quality control of downstream applications. A automated and reliable tool was developed and introduced in 1999 and has since become a mainstream technique for assessing the quality of RNA samples (Fleige and Pfaffl, 2006). The bioanalyzer is an automated device that provides electrophoretic separation of tiny RNA amounts, using microfluidics technology (Figure 4-9) (Mueller et al., 2000). Data are produced in a digital format: amount of measured fluorescence correlates with the amount of RNA of particular size. The gradual degradation of RNA is reflected by a continuous shift of peaks (18S and 28S ribosomal fragments) toward shorter fragment sizes on the left side of the diagram.

97 Chapter 4: KP primers’ validation

Figure 4-9: Bioanalyzer application environment. 1. Role of RNA in gene expression and protein production, 2. Extracted RNA molecules and analysis by Agilent 2100 bioanalyzer, 3. Assignment of integrity categories, where RIN 10 is given to intact RNA and RIN1 to fully degraded. (Schroeder, Mueller et al. 2006)

The data obtained for 4 samples of RNA isolated for future primer optimisation is given in Table 4-3 and an example of electropherogram summary is presented in Figure 4-10. The RNA sample from a cell line gained the highest RIN criteria. Cells collected for RNA extraction require less processing and homogenizing, unlike tissue samples that contain debris and connecting membranes. Thus, these samples undergo more degradation by RNase enzymes and also contain more contaminants from tissue residues. Nevertheless, samples from human tissue with RIN number higher than five can still be used to perform gene expression analysis (Opitz et al., 2010). Therefore all derived samples, having RIN number around 8.50 and higher can be safely used for future qPCR analysis to produce reliable results.

RNA rRNA ratio Sample RNA area concentration RIN number (28s/18s) (ng/μl) U-937 cells 240.9 204 1.7 9.60 stimulated with INF-γ Human foetal brain 72 61 1.8 8.90 Human foetal liver 287.6 244 1.4 8.40 Human foetal kidney 52.4 44 1.4 8.50 Table 4-2: Summary of RNA integrity number results.

98 Chapter 4: KP primers’ validation

Figure 4-10: Electropherogram summary for human foetal brain RNA sample. The electropherogram on top shows good-quality RNA with a 28S/18S rRNA ratio of 1.7 and an RNA Integrity Number of 8.9 (max is 10.0). The rRNA peaks are distinct, with 28S higher than the 18S, and there are only a few smaller peaks that indicate RNA degradation.

4.3.3 Primer concentration Primer concentration in a common qPCR reaction is about 100-500 nM per primer. Increasing primer concentrations too much may inhibit the reaction and cause formation of unwanted secondary structures. From previous experience on the Mx3500P Real-Time PCR platform, using the same reagents and tissue types, a concentration of 300 nM was chosen for initial trial use. 300 nM of the forward and reverse primers were used to target two reference genes (GAPDH and ACTB) and few representative genes from KP. The product generated by each primer pair yielded single product and acceptable Ct value (between 16 to 25), in a range that allows future series of dilutions. A concentration of 300 nM was used for the remaining sets of primers.

99 Chapter 4: KP primers’ validation

4.3.4 Finding appropriate type of cells/tissue All primers were initially optimized using the U937 human macrophage cell line, stimulated with INF-γ to enhance KP expression (Alberati-Giani et al., 1996). Each pair of primers was run against No Amplification Controls (NAC) and No Template Controls (NTC). NAC is a mock reverse transcription containing all the RT-PCR reagents, except the reverse transcriptase, assuming that if the cDNA sample was properly cleaned from genomic DNA contaminants NAC will not produce any reaction. NTC includes all of the RT-PCR reagents except the RNA template and is also expected to be negative, assuming that primers do not form secondary structures. It is also necessary to confirm that there are no fluorescence contaminants in the sample. No product should be synthesized in the NTC or NAC (Figure 4-11).

Figure 4-11: ACMSD levels, presented by Ct values in different types of tissue. Highest ACMSD levels are in kidney, No RT represents NTC control and is negative, except in sample presumably containing genomic DNA (sample with no DNase treatment). NTC is negative or dramatically low.

ll sets of primers, except ACMSD, generated a single peak with acceptably low Ct value, for future series of dilutions. Human ACMSD transcript coding for the active enzyme has been examined in kidney, liver and brain by Raffaelli et al. (Pucci et al., 2007b). The

100 Chapter 4: KP primers’ validation highest expression has been observed in kidney, suggesting that the KP might not be the preferred route of tryptophan catabolism in this organ (Figure 4-12). In fact, in kidney the KP is mostly used to convert tryptophan catabolites, including kynurenine and hydroxykinurenine taken up from the blood, to a series of metabolites which are then excreted, presumably preserving high levels of ACMSD (Pawlak et al., 2003). ACMSD set of primers were optimized using human foetal kidney sample, to allow serial dilutions for primer efficiency access.

Figure 4-12: Quantification of ACMSD variants in human organs. Human kidney expresses both ACMSD variants 150,000-times higher than brain tissue. (Pucci et al., 2007a)

4.3.5 Single amplicon and quality of amplification The specificity of amplicons generated by each candidate primer pair was confirmed by the presence of single peak on the melting curve. Melting curve analysis allows examination of the dissociation-characteristics of double-stranded DNA during heating

(Rasmussen et al., 1996). The Tm of the amplicon starts at the point of inflection of the melting curve profile. For the example set of primers the inflection point occurs at 75°C (Figure 4-13A) It is apparent that Tm of the amplicon occurs at 82.5°C. A single sharp peak at the same Tm indicates that no contaminating products are present in this reaction. The area under the overall melting peaks is related to the total amount of amplification products. Contaminating DNA or primer dimers show up as a series of peaks separate from the desired

101 Chapter 4: KP primers’ validation amplicon peak (Figure 4-13B). It indicates that there is not enough discrimination between specific and non-specific reaction products. Non-specific amplification products tend to melt at much lower, and over a broader range of, temperatures. The information gathered from melting curve analysis can be used to detect the formation of secondary structures in PCR reactions.

Figure 4-13: Dissociation curves. A) Single pick indicates a single PCR product, B) Irregular single pick or several picks indicate that PCR product is accompanied by secondary structures.

4.3.6 PCR efficiency During qPCR, the amount of targeted DNA product is amplified and quantified simultaneously. The more target DNA present in a sample, the more quickly the PCR product is generated. A positive reaction is detected when the amount of fluorescence produced rises above the threshold level (Ct) (Figure 4-14). Most of the difficulties arise because only a very small number of the cycles in a PCR reaction contain useful information. The amplification plot has two phases, an exponential phase which is followed by a nonexponential plateau phase. When early cycles have undetectable amounts of the DNA product, late cycles may appear during the plateau phase and be as uninformative. During the exponential phase, the amount of PCR product approximately doubles in each cycle. The quantitative information in a PCR reaction usually comes only from few cycles where the amount of DNA grows

102 Chapter 4: KP primers’ validation

logarithmically from barely above background to the plateau. Often only 4 or 5 cycles out of 40 will fall in this “log-linear” portion of the curve (Rasmussen et al., 1996). Standard curves were generated for each primer pair to assess reaction optimization. Reaction efficiency coefficient was derived from a standard curve generated from 4 to 6

serial dilutions of cDNA of appropriate cell/tissue type. Mean Ct values of each dilution point were plotted against the logarithm of the cDNA dilution factor. Each dilution was assayed in duplicate. An estimate of PCR efficiency was derived from the expression [10(1/-S)- 1] × 100%, where S represents the slope of the linear regression (Ginzinger, 2002) (Figures 4-15 and 4-16). The R2 value of a standard curve represents how well the experimental data

fit the regression line. A significant variability in observed CT values between replicates will lower the R2 value. All primer efficiencies are between 90 and 110%, except IDO2. IDO2 was usually expressed at a very low level compared, for example, with IDO1. Thus, serial dilutions have to be done at less than 10 fold between each other. When using the serial dilution method to determine amplification efficiency, the presence of inhibitor can also result in an apparent increase in efficiency. This is because samples with the highest concentration of template also have the highest level of inhibitors, which cause a delayed Ct, whereas samples with lower template concentrations have lower levels of inhibitors, so the Ct is minimally delayed. As a result, the absolute value of the slope decreases and the efficiency appears to be higher (Opel et al., 2010).

Figure 4-14: Illustration of Ct value generation. Sample A contains 250 times more target DNA than Sample B, so it reaches the threshold level at a lower cycle number (20) than Sample B (28). Samples containing no target DNA never reach the threshold level. http://www.langfordvets.co.uk/lab_pcr_ct_values.htm

The calculated amplification efficiency and R2 values are presented in (Table 4-1). Some of the genes have few pairs of valid primers: primers marked with colour were chosen

103 Chapter 4: KP primers’ validation as the most effective in terms of efficiency, level of detection and variability. However, different sets may be chosen for future experiments with different cell types or different reference genes.

104 Chapter 4: KP primers’ validation

Figure 4-15: Standard curves of valid KP primers. Eff. represents efficiency in precents and RSq number linearity of the plot. 105 Chapter 4: KP primers’ validation

Figure 4-16 : Standard curves of valid KP primers. Eff. represents efficiency in precents and RSq number linearity of the plot.

106 Chapter 4: KP primers’ validation Efficiency % for standard curve number of points concentration detectable Ct value at lowest concentration Ct value at highest

Gene Tm Sequence

Fwd 5'- gactacaagaatggcacacgctatg IDO1 _1 99.5 5 30 (0.0008 ng) 17 (80 ng) 79.8 Rev 5'- ccagactctatgagatcaggcagatg Fwd 5'- ggctttgctctgccaaatcc IDO1 _2 96 5 30 (0.008 ng) 16.5 (80 ng) 79.5 Rev 5'- ttctcaactctttctcgaagctg Fwd 5'- tcatctcacagaccacaagtca IDO1 _3 99 6 31 (0.008ng) 17 (80 ng) 82.6 Rev 5'- gcaagaccttacggacatctcc Fwd 5'- aagatagaggatgctgacaata IDO2 115 5 36 (0.026 ng) 27.5 (80ng) 77 Rev 5'- tccgttcccatatcattaact Fwd 5'- cggtggttcctcaggctatcac TDO2_1 104 5 29 (0.008ng) 19.5 (80 ng) 79.3 Rev 5'- tggttgggttcatcttcggtatcc Fwd 5'- attcataaggattcaggctaaag TDO2_2 97 5 33 (0.026 ng) 22 (80ng) 78.5 Rev 5'- tttctcatcaaataaggacagtag Fwd 5'- atataccatacaagccactga TPH1 97 5 36 (0.026 ng) 26 (80 ng) 77.5 Rev 5'- aatactcctcaagttattctaagc Fwd 5'- tgatgcctggaactatgttgttgc TPH2 92 5 32 (0.4 ng) 24 (102ng) 80.5 Rev 5'- tagccaagccatgacacagaagg Fwd 5'- aaacttggggtgttgtattccg TPH2_2 108 6 32 (0.1 ng) 23.5 (102ng) 80 Rev 5'- agccacagtatttagtcagcaga Fwd 5'- atgttggtggagcttatgtgg MAOA 109 4 31 (0.08 ng) 21.5 (80 ng) 80.6 Rev 5'- atattgaacgagacgctcactg Fwd 5'- tatggctttgtgcttgttcttcctc MAOB 110 5 30 (0.4 ng) 23 (102ng) 80.6 Rev 5'- cagtggcttattgtggctcttagg Fwd 5'- cgacagtcctgggagttttaccaga AFMID_1 109 5 31 (0.008 ng) 24 (80 ng) 84.2 Rev 5'- ggctctcctgggtgctgggg Fwd 5'- caagtcaatgctcagagatg AFMID_2 96 4 39 (0.005 ng) 28 (50ng) 79 Rev 5'- cctgggtgacagagtaag Fwd 5'- caccactgacgaagatcctgg KAT1_1 110 6 32 (0.1 ng) 23.5 (102ng) 81 Rev 5'- ctgagcgggtctatctcctga Fwd 5'- gatagacccgctcaggaatgt KAT_2 100 5 30 (0.4 ng) 23 (102ng) 84.6 Rev 5'- atgacctcgtctccttcgtcc Fwd 5'- ggctggtggcttaccaaatc KAT2 102 6 33 (0.1 )ng 24 (102ng) 78.9 Rev 5'- actcggagaatactgaagtgctc Fwd 5'- cgctgatgtgtctttgctagatcc KAT3_1 102 5 32 (0.008 ng) 19.5 (80ng) 78.3 Rev 5'- cagaatgctgaaacggggatgg Fwd 5'- ctgcaagtaattgctgacctttg KAT3_2 87 4 31 (0.08 ng) 20 (80ng) 81.5 Rev 5'- cccacatacctggaaaagtagc Fwd 5'- gacctcctccctttgttgaatgtg GOT2 94 4 29 (0.08 ng) 18 (80ng) 84.4 Rev 5'- catggttagagcagatggtggttc Fwd 5'- tgttcagtggggtgcattttt KYNA 106 4 31 (0.4 ng) 24 (102ng) 82.6 Rev 5'- aactccgatctcgcaggttta Fwd 5'- gcgaaggcggctggagac 3HAAO_1 99 5 30 (0.008 ng) 18 (80ng) 85.4 Rev 5'- tcagagctgaagaactcctggatg Fwd 5'- acatcgaagagggtgaag 3HAAO_2 90 5 31 (0.026 ng) 22 (80ng) 86.7 Rev 5'- gtgttggcaaacctctgt Fwd 5'- gcatctactaggtgacagccactg KMO 106 4 32 (0.08 ng) 23 (80ng) 76.8 Rev 5'- aactctgccaggaagagccttatc Fwd 5'- tgaacccgaagaaatacct ACMSD 108 4 37 (0.1 ng) 29 (102ng) 80 Rev 5'- cagctcacctagtggaaa Fwd 5'- atttacccaactcaactgccaagtc QPRT_1 89 4 32 (1.6 ng) 22.5 (102ng) 91 Rev 5'- ctgccacgtgcccagtccag

107 Chapter 4: KP primers’ validation Efficiency % for standard curve number of points concentration detectable Ct value at lowest concentration Ct value at highest

Gene Tm Sequence

Fwd 5'- ttcacctctgctcatctc QPRT_2 96 5 27 (0.026 ng) 28 (80ng) 79 Rev 5'- cctcactatgtgctcattatc

Table 4-3 : Valid and optimized set of 17 Kynurenine pathway genes. Efficiency presented in percents; Ct value at lowest detectable concentration represents the level of primer sensitivity for low cDNA concentration; Ct value at highest cDNA concentration represents the Ct value beyond which results are not reliable, because of inhibiting factors; Tm is a melting temperature on dissociation curve where the peak for specific PCR product appears. Some genes can be assessed with more than one set of valid primers.

108 Chapter 4: KP primers’ validation

4.4 Discussion Gene analysis plays an important role in understanding signalling and metabolic pathways in different organisms. RT-qPCR represents a suitable technology platform for this type of research, providing a sensitive, specific and highly dynamic range of assays (Walker, 2002). This study describes the approach used to optimize and validate a reliable set of 17 primers pairs for RT-qPCR analysis of KP in human cells, using the fluorogenic binding dye SYBR-Green as a detection method (Table 4-3). The SYBR-Green detection method is widely used and represents a reliable and accurate quantification of changes in gene expression (Arya et al., 2005, Schefe et al., 2006) . This method represents mathematical model that calculates a relative fold change in gene expression between experimental samples. Using the SYBR-Green method allows detection of the PCR product without fluorescent probe synthesis for individual templates and reducing costs associated with it. The accuracy of gene expression relies on the linear formation of product and its efficiency during the amplification step of the reaction. A normalization step is essential to avoid experimental errors. PCR efficiency was assessed using standard curves generated with a primer pair specific to the gene and linearly increasing amounts of cDNA from macrophages stimulated with a pro-inflammatory agent. Because of poor results for the ACMSD gene, a different tissue type was chosen, based on the literature.

4.4.1 Routine use of primers Comparative method for gene expression quantification can only be used in conjunction with one, or a few reference genes. Such genes are expressed at constant levels in the same type of cells or tissues and are not affected by experimental or environmental conditions (Radonic et al., 2004). To achieve complete normalization of KP assay for a particular experimental environment, stable reference genes must be chosen prior to study (Gutierrez et al., 2008). It is also advised to select reference genes with amplification kinetics (Ct values) approximately similar to the gene of interest (Livak and Schmittgen, 2001). A number of reference genes was also optimized in this study: actin-β (ACTB), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), β2-microglobulin (β2M) and hypoxanthinephophoribosyltransferase (HPRT) (see Appendix chapter 4). Selection of primers for reference genes and, in some cases, for one of the KP genes, will allow the choice of optimal conditions for assessing reliable data from future experiments. However, investigators must adhere to the conditions validated in this study, such as type of instrument, thermal profile and type of fluorescent dye used.

109 Chapter 5: KP in in vitro model derived from neuroblastoma

Chapter 5 : Development of in vitro model for dopaminergic human neurons derived from a neuroblastoma cell line and characterization of the KP therein

110 Chapter 5: KP in in vitro model derived from neuroblastoma

5.1 Introduction

5.1.1 Neuroblastoma cell lines as an in vitro model of dopaminergic neurons To understand the pathophysiology of PD it is important to develop relevant models of the disease. In vitro models provide an important tool for molecular and biochemical research. Cell models are usually easy to maintain and manipulate. Immortal cell lines usually keep consistency between preparations and are often used for early toxicity and drug screening studies. However, there is only limited number of cell lines that accurately model neuronal cells, especially CNS neurons. Normal mature human neurons normally do not divide and present a challenge for creating accurate in vitro models based on proliferating cell lines. Alternative substitute cell types that express neuronal properties, such as cell lines derived from tumour cells, have been previously used to study neuronal changes in neurodegenerative diseases. Such cell lines are proliferating and do not always express markers typical for mature neurons. For example, Ntera2, a human teratocarcinoma cell line requires a very long differentiation process and has an irregular karyotype (Schwartz et al., 2005, Andrews et al., 1984). Another example, the human neuroblastoma cell line SH-SY5Y offers an alternative of closer karyotype to that of normal human neurons (Ross et al., 1983) and has commonly been chosen to study the pathogenesis of neurodegenerative diseases (Egea et al., 2010, Xie et al., 2011, Park et al., 2009). SH-SY5Y was reported to have a dopamine-β-hydroxylase activity, converting glutamate to GABA (Biedler et al., 1978). Based on this information, undifferentiated SH-SY5Y cells have been extensively used in vitro as a model for dopaminergic neurons (Prather et al., 1994, Doo et al., 2010, Kim et al., 2011a). SH-SY5Y differentiation induced by all-trans-retinoic acid (RA) results in a more neuronal-like phenotype of the cells: morphological cell body changes and neurite outgrowth (Pahlman et al., 1984). Due to the shortness of the procedure, most differentiation protocols for SH-SY5Y cells employ RA as a single agent. However, to yield more mature and homogenous populations, more complex and time-consuming differentiation protocols have been established (Rebhan et al., 1994, Encinas et al., 2000a, Edsjo et al., 2003). SK-N-SH is a parent cell line of the SH-SY5Y sub clone, derived from the bone marrow of the same neuroblastoma patient (Biedler et al., 1973). This cell line contains cells from three different phenotypes: neuronal, Schwannian and intermediary, while the SH-SY5Y cell line has a comparatively homogenous neuronal like phenotype (Joshi et al., 2006). Yet, the SK-N-SH cell line is widely used as an in vitro neuronal model in neurodegenerative research (Gao et al., 2009, Ezoulin et al., 2008, Li et al., 2011) . As mentioned before, neuroblastoma cell lines

111 Chapter 5: KP in in vitro model derived from neuroblastoma still have genetic and physiological differences compared to primary neuronal cells. Primary cell cultures represent more accurately normal neurons, but their source is extremely limited and batches can be inconsistent per sample.

5.1.2 Characterization of the kynurenine pathway in dopaminergic neurons Many potential mechanisms of KP involvement in PD pathogenesis have been extensively discussed in section 2.4 (Ogawa et al., 1992, Zadori et al., 2012, Zinger et al., 2011). Our group has characterized the KP in various CNS cells, such as microglia cells, macrophages, astrocytes, and motor neurons (Guillemin et al., 2007a, Guillemin et al., 2003b, Guillemin et al., 2005c), in relation to various neurodegenerative conditions. However, KP enzymes and metabolites have never been characterized in dopaminergic neurons.

5.1.3 Aims The aims of this study are to: 1) Establish an in vitro model of human dopaminergic neurons derived from a neuroblastoma cell line 2) Characterize the cell line model using dopaminergic neuronal markers 3) Characterize the expression of KP enzymes occurring in normal versus inflammatory conditions in an established cell line model for dopaminergic neurons 4) Quantify KP metabolites in normal versus inflammatory conditions in the same cell lines.

5.1.4 Rationale There are several direct and indirect lines of evidence for various KP metabolites and enzymes being implicated in PD models, patients and mechanisms, strongly associated with PD pathogenesis (see section 2.4 ). Pathologically, PD is characterized by progressive loss of dopaminergic neurons (Gelb et al., 1999). Both SH-SY5Y and SK-N-SH neuroblastoma cell lines (derived from the same patient) possess many characteristics of dopaminergic neurons and are normally used for toxicity studies (Kheradpezhouh et al., 2003, Xie et al., 2010, Baratchi et al., 2011). Based on prior literature studies, the SH-SY5Y cell line is more dopaminergic neuronal-like. Our laboratory has experience with the SK-N-SH cell line, which already has been used for the characterization of KP in normal CNS neurons (Guillemin et al., 2007a). Thus both cell lines will be employed for establishment of an in vitro model for human dopaminergic neurons.

112 Chapter 5: KP in in vitro model derived from neuroblastoma

It has been demonstrated that the KP is presented differently in different CNS cell types: fully presented in macrophages and microglia cells (Guillemin et al., 2003b) and only partially in astrocytes and neurons (Guillemin et al., 1999, Guillemin et al., 2007a). Thus, it is essential to characterise KP in dopaminergic neurons to gain a better understanding of its involvement in the pathogenesis of PD.

5.1.5 Hypothesis We hypothesise that the differentiated SH-SY5Y cell line is likely to be the most suitable in vitro cell model for dopaminergic neurons to study neurotoxicity in PD. We will also use this model to characterize the KP. Treatment with INF-γ of the differentiated dopaminergic cells will induce KP metabolism. Neuronal differentiation will also likely result in NMDA receptor maturation and expression leading to higher sensitivity to excitotoxins deriving from the KP (e.g. quinolinic acid). Finally, we hypothesize that in inflammatory conditions KP in human dopaminergic neurons will be switched towards production of neuroprotective metabolites.

113 Chapter 5: KP in in vitro model derived from neuroblastoma

5.2 Materials and methods:

5.2.1 Cell cultures

5.2.1.1 Materials Brain derived neurotrophic factor (Sigma-Aldrich) DNAse I (Sigma-Aldrich) Foetal bovine serum (FBS) (Gibco, Invitrogen) Dulbecco’s modified eagle medium 11995 (DMEM) (Gibco, Invitrogen) Glutamax (Gibco, Invitrogen) Penicillin/streptomycin (PS) (Gibco, Invitrogen) 5% trypsin EDTA 10X (Gibco, Invitrogen) Modified Eagle’s medium nonessential amino acids (NEAA) (Sigma-Aldrich) BDNF (Alomone Laboratories) cAMP (Invitrogen) HEPES (Gibco, Invitrogen) PBS (Gibco, Invitrogen) DMSO (Sigma-Aldrich)

Heraeus HERAcell CO2 incubator (Fisher) Heraeus Multifuge 1S (Thermo Scientific) Slide flask (Nunc) Tissue culture plates (BD Biosciences) Tissue culture flask (BD Biosciences)

5.2.1.2 Routine culture of cell lines The SH-SY5Y cell line is a thrice-cloned sub-line of bone marrow biopsy-derived SK-N-SH (Biedler et al., 1978). SH-SY5Y cells at early passage number (assigned as number 2 in our lab), were a gift from Prof. Kay Double (Neuroscience Research Australia, Sydney, Australia). Human SK-N-SH neuroblastoma cells were obtained from American Type Culture Collection (Manassas, VA) (HTB11). SH-SY5Y and SK-N-SH cells were maintained in DMEM supplemented with 10% FBS, 1% PS and 1% Glutamax (v/v) (Chang et al., 2002). The medium was changed every 2-3 days. Every 7 to 10 days cells were passaged into another dish: cells cultured in a T75 flask were washed with 10 mL pre-warmed

114 Chapter 5: KP in in vitro model derived from neuroblastoma

2+ 2+ PBS without Ca and Mg (Invitrogen Corporation) twice before being trypsinized with 4 mL of 0.25% trypsin (w/v) for 2 min by vigorous shaking. The trypsin was neutralized by 6 mL pre- warmed supplemented DMEM. The cell suspension was then centrifuged at 210 g (1000 rpm, 186 mm rotation radius, Heraeus Multifuge) for 5 min. Once the supernatant was discarded, the cells pellet was resuspended in fresh supplemented DMEM and transferred into three T75 flasks. Cells from passage number 4 to 6 were used for future differentiation, seeded at 1 × 103 viable cells/cm2. Cultures were kept at 37°C at 5% CO2 in a humidified atmosphere. The loss of dopaminergic characteristics has been described with increasing passage numbers for SH-SY5Y cells (Balasooriya and Wimalasena, 2007). Therefore, it is recommended to verify specific characteristics such as neuronal markers routinely or use cells from the same passage number for all experiments. Before starting differentiation experiments both cell lines were expanded and 20 vials of P3 and P4 were frozen.

5.2.1.3 Cryopreservation of SH-SY5Y and SK-N-SH cells SH-SY5Y or SK-N-SH cells in a T75 flask were harvested as in section 1.2.1.2. The cell pellet was resuspended with 4 mL of cryopreservation solution (supplemented DMEM with 10% DMSO (v/v)). The cell suspension at 1 mL/cryovial was then transferred to a 5100 Cryo 1ºC Freezing Container (Nalgene Labware, Rochester) at -80ºC overnight. The cryogenic vials (Nalgene Labware) were then stored in liquid nitrogen the following day.

5.2.1.4 Thawing cryopreserved SH-SY5Y and SK-N-SH cells Frozen SH-SY5Y or SK-N-SH vials from liquid nitrogen were submerged in a 37ºC water bath. After thawing (1-2 min), the cell suspension was removed from the cryogenic vial, resuspended in 8 mL of supplemented DMEM and centrifuged at 210 g for 5 min. The supernatant was discarded, cells were resuspended in 20 mL supplemented DMEM (containing 20% FCS (v/v)), then transferred into a T75 flask for culturing at 37ºC and 5 %

CO2. The medium was changed the next day.

5.2.1.5 Differentiation protocol number 1 This protocol was adapted from the study of Chang et al. study (Cheung et al., 2009). Cells were seeded at an initial density of 1 × 103 viable cells/cm2 in 6 well plates. 48 hour after seeding, serum levels of the medium were reduced to 3% and RA (10 μM) was added, for the 7 day differentiation process. Cells were grown on non-coated culture plates.

115 Chapter 5: KP in in vitro model derived from neuroblastoma

5.2.1.6 Differentiation protocol number 2 The protocol was described by Ecinas et al. and was adapted for this study (Encinas et al., 2000b). Cells were seeded at an initial density of 1 × 103 viable cells/cm2 in 6 well plates (Corning, Corning, NY, U.S.A.). All-trans-RA was added 48 hours after seeding at a ﬁnal concentration of 10 μM in DMEM with 5 or 15% FCS (v/v), supplemented with antibiotics and glutamine. After 5 days in the presence of RA, cells were washed twice with DMEM and incubated with 50 ng/ml BDNF (Alomone Laboratories, Jerusalem, Israel) in DMEM (without serum) for 4 to 6 days. Cells were grown on non-coated culture plates.

5.2.1.7 Differentiation protocol number 3 The cells were differentiated by using a procedure based on that described by Gimenez-Cassina et al., with some modiﬁcations (Gimenez-Cassina et al., 2006). Brieﬂy, 1-2 × 103 viable cells/cm2 were seeded onto 6 well non-coated culture dishes and were allowed to attach and expand for 48 hours. The FBS content of the culture medium was then reduced to 2, 3 or 5%, and the cells were exposed to 10 μM RA. The cells were kept under these conditions for 5 days, changing the medium every 2 days. Subsequently, the cells were cultured in Neurobasal medium supplemented with B-27, 2 mM Glutamax, 2 mM dibutyryl- cyclic AMP (db-cAMP), 20 mM KCl, 50 ng/ml hBDNF, and antibiotics, in which they were maintained for an additional 5 days.

5.2.2 Real time quantitative reverse transcriptase polymerase chain reaction (RT- qPCR) As described in section 3.1.4

5.2.2.1 Controls Human foetal brain and INF-γ induced macrophages cell line as described in section 4.2.1.2 and 4.2.1.3

5.2.2.2 RNA extraction and cDNA preparation As described in section 3.1.4.2 and 3.1.4.3

5.2.2.3 RT-qPCR reaction As described in section 3.1.4.4

5.2.3 Immunocytochemistry As described in section 3.1.6

116 Chapter 5: KP in in vitro model derived from neuroblastoma

5.2.4 HPLC As described in section 3.1.8

5.2.5 GCMS As described in section 3.1.7

117 Chapter 5: KP in in vitro model derived from neuroblastoma

5.3 Results

5.3.1 Establishment of dopaminergic in vitro model for KP research

5.3.1.1 Differentiation protocols selection Undifferentiated and differentiated neuroblastoma cell lines have been widely used as a PD cell model. However, undifferentiated models have several disadvantages. Unsworth et al. demonstrated that naive SH-SY5Y cells show a degree of spontaneous differentiation, with only 43% showing differentiation-like neurite growth (Unsworth et al., 2007). When continuously using undifferentiated cells, the portion of proliferating cells increases during the course of the experiment, making it difficult to understand the nature of the effect. Numerous differentiation methods applied to the SH-SY5Y cell line have resulted in a functional mature neuronal phenotype. Differentiation stabilized the population and induced neuritis outgrow together with morphological changes (Fagerstrom et al., 1996). The dopaminergic phenotype can be induced using RA treatment, which is a naturally occurring morphogen (Wagner et al., 1990). However, many reports indicate no difference in tyrosine hydroxylase (TH) and dopamine transporter (DAT) expression levels between differentiated and undifferentiated cells (Cheung et al., 2009, Presgraves et al., 2004). Yet, differentiation by RA treatment represents a short, economical and simple protocol, which is still widely used as a PD model. For this reason, RA differentiation was chosen as differentiation protocol number one for this study (Table 5-1). Neurotrophic factors have been shown to modulate survival, differentiation and neuronal activity of cells. Neuronal growth factor (NGF) and brain-derived growth factor (BDNF) contribute to terminally differentiated culture with mature neuronal morphology (Jensen et al., 1992, Kaplan et al., 1993b). It was shown that RA pre-treatment causes the up regulation of the neurotrophin receptors on targeted cells, making them more responsive to neurotrophins (Cernaianu et al., 2008a). Differentiation protocol number 2 is a sequential treatment with RA and BDNF, which is expected to up regulate expression of general neuronal markers, including TH and DAT activity (Table 5-1) (Mastroeni et al., 2009b). Cyclic AMP (cAMP) has been observed to have a cooperative effect together with neurotrophins on neuronal survival. cAMP is a second messenger and has been implicated as mediating some of the actions of nerve growth factor (NGF) (Levi et al., 1988, Friedman et al., 1992). This effect is achieved through modulation of the genomic response of targeted cells to neurotrophins, particularly in dopaminergic neurons (Franke et al., 2000a).

118 Chapter 5: KP in in vitro model derived from neuroblastoma

Differentiation protocol number three, adapted from a Gimenez-Cassina et al. study, incorporated RA treatment with subsequent BDNF and cAMP treatment (Table 5-1) (Gimenez-Cassina et al., 2006).

Protocol 1 Protocol 2 Protocol 3 Adapted (Gimenez-Cassina (Cheung et al., 2009) (Encinas et al., 2000a) from study et al., 2006) 3% FCS DMEM 15% FCS DMEM 5% FCS DMEM Days 0-4 +10 μM RA + 10 μM RA +10 μM RA No serum DMEM No serum DMEM 50 ng/ml hBDNF Days 5-10 - 50 ng/ml hBDNF B27, Glutamax, cAMP, KCl Table 5-1 Protocols selected for neuroblastoma differentiation: all cultures contained antibiotics as described in methods. 5.3.1.2 Morphology of undifferentiated neuroblastoma cell lines Naive SH-SY5Y neuroblastoma cultures have a slightly flattened morphology with numerous small neuritic extensions (Figure 5-1). When SH-SY5Y cells reach their confluence, after 1 week in culture, the morphology is similar to SK-N-SH mature cells: a continuous monolayer with epithelial-like morphology (Figure 5-1).

Figure 5-1: SH-SY5Y and SK-N-SH neuroblastoma cell lines at full confluence.

119 Chapter 5: KP in in vitro model derived from neuroblastoma

However, there is a clear phenotypic difference between these cell lines on first/second days after passage. SK- N-SH do not resemble the neuron- like morphology of young SH-SY5Y cells. The majority of SK-N-SH cells are narrow and of flattened and elongated shape with occasional

short processes on the edge of cells, Figure 5-3: S, I and N-type cells in human neuroblastoma cell line. (Potenza, Papa et al. 2009) resembling non-neuronal substrate– adherent cells from S-type or intermediate I-type (Figure 5-3) (Dimitroulakos et al., 1994). A recent Liu et al. study confirmed that SK-N-SH cultures consist of three types of cells, characterised by their morphology: 1) neuroblastic, neuronal-like cells (N-type), 2) Schwannian or stromal-like cells, non-tumorigenic (S-type) and 3) cells with both characteristics that can exclusively differentiate to S or N-type of cells (I-type) (Figure 5-2) (Liu et al., 2011).

Figure 5-2: SH-SY5Y and SK-N-SH cells at day 2 after passaging at 1 × 103 viable cells/cm2 . N, S and I-type cells are presented in different proportions in both cultures.

A small proportion of SK-N-SH cells at day 1 have short neuritis processes (Figure 5- 3). I-type cells appear more symmetrical then S and N-types and usually have the beginnings of thick neurite processes, yet are hard to differentiate from two other types due to shared morphology. Nevertheless, I-type cells have strong potential to stably differentiate into N- type cells (Walton et al., 2004). Furthermore, S-type cell population is unstable, since it readily able to trans-differentiate to N-type cells (Ross et al., 2003, Dimitroulakos et al.,

120 Chapter 5: KP in in vitro model derived from neuroblastoma

1994). However, young SH-SY5Y still have more frequent and longer neuritic processes and smaller rounded bodies, representing mostly neuronal N-type cells, which dominates with time (Liu et al., 2011, Kim et al., 2004).

5.3.1.3 Morphology of differentiated neuroblastoma cell lines SK-N-SH cells differentiated by the first protocol (Table 5-1) demonstrated little change from undifferentiated culture or compared to cells differentiated with other protocols (Figure 5-4). There was a larger number of small body rounded cells from N-type and thick elongated neurite-like extensions are abundant, suggesting trans-differentiation of S-type cells into I-type cells. Other studies have observed similar results: when exposed to RA, SK- N-SH stop proliferating, N-type cells differentiate into neuronal phenotype, however cultures still appear enriched with RA-resistant S-cells (Wainwright et al., 2001, Gaitonde et al., 2001) . In the same neuroblastoma cell line differentiated with protocol number 2 (Table 5-1), which involves subsequent RA and BDNF differentiation, the amount of small, round neuron-like cells with neuritis was enlarged. Unlike with protocol 1, these neurites exhibited branching (Figure 5-4). Other type of cells is still present; however, it appears even more elongated with a symmetrical, spindle-shaped body, suggesting I-type cells. Surprisingly, the third protocol that incorporates additional factors such as cAMP together with BDNF, yielded cultures very similar in morphology to cells differentiated with the first protocol. Compared with cells differentiated with protocol number 2, there are less neurite-like extensions, no branching and the proportion of elongated S and I-type cells is greater (Figure 5-4). SH-SY5Y cells differentiated by protocol number 1 appeared less confluent than undifferentiated cells, clearly demonstrating mitotic arrest by RA (Figure 5-4). Mitotic cell arrest, DNA synthesis and growth inhibition, following RA treatment in tumorigenic cells, have been described numerous times in the literature (Melino et al., 1997). A large proportion of cells had a fusiform, multipolar shape, and the rest of the cells possessed small, round, N- type bodies. There are also noticeably more neurite branching, compared with undifferentiated and SK-N-SH differentiated cells. Differentiation of SH-SY5Y with protocol number 2 resulted in even more neurite extensions and branching compared to the first protocol. The proportion of rounded N-type cells got higher as well (Figure 5-4).

121 Chapter 5: KP in in vitro model derived from neuroblastoma

Unlike with SK-N-SH cells, the vast majority of SH-SY5Y cells differentiated with protocol number 3 clearly exhibited neuronal morphological characteristics (Figures 5-4, 5-5 and high-resolution images in Appendix chapter 5). They have more rounded cell bodies with multiple branching neurites and no visible S-type cells in culture (Figure 5-5).

122 Chapter 5: KP in in vitro model derived from neuroblastoma

Figure 5-4: Morphology of SH-SY5Y and SK-N-SH cells differentiated by protocols 1, 2 and 3. (×10 magnification) For high-resolution images, refer to chapter 5 appendix.

123 Chapter 5: KP in in vitro model derived from neuroblastoma

Furthermore, initiation of neuronal cluster aggregation was noticeable in SH-SY5Y cells treated with protocols 2 and 3 (Figure 5-5), resembling newly developed neurons in the human foetal brain that typically migrate to reach their final position (Revishchin et al., 2001, Sidman and Rakic, 1973).

Figure 5-5: Morphology of SH-SY5Y and SK-N-SH cells differentiated by protocols 2 and 3. (×20 magnification).

5.3.1.4 Expression of neuronal markers in differentiated neuroblastoma cell lines Differentiation efficiencies were also compared by examining the gene expression of dopaminergic markers. TH catalyses the rate-limiting step in the synthesis of dopamine, converting tyrosine to dihydroxyphenylalanine. Numerous studies, which identify dopaminergic neurons in the human and primate striatum, have previously demonstrated reliability of TH and DAT markers to distinct dopaminergic neurons from other neuronal populations (Huot et al., 2007). Firstly, SK-N-SH cells differentiated with the three protocols were compared to undifferentiated control cells from the same cell line (Figure 5-6). Despite morphological observations that suggested a better response to protocol 2, cells differentiated with protocol 3 expressed TH at a significantly higher level than those subjected to protocols 2 and 1.

124 Chapter 5: KP in in vitro model derived from neuroblastoma

Indeed protocols 2 and 1, did not affect TH expression, compared to SK-N-SH undifferentiated cells. Secondly, TH expression in differentiated SH-SY5Y cells was compared with it’s expression in SK-N-SH undifferentiated control cells (Figure 5-6). Protocol 3 yielded the highest amount of dopaminergic neurons, based on TH expression and morphological observation. TH expression in cells differentiated by the third protocol was significantly higher than in cells differentiated with the second protocol (p<0.05). Moreover, the second protocol also resulted in significantly higher TH expression when compared with protocol 1 or untreated cells (p<0.05). However, the first protocol, despite the appearance of noticeable branching neurites, did not raise the expression of TH, compared to control cells. Thirdly, TH expression in SH-SY5Y undifferentiated cells was initially about 20 times higher than in undifferentiated SK-N-SH. Furthermore, it was significantly higher than TH expression generated by any of the differentiation protocols in the SK-N-SH cell line (Figure 5-6).

Figure 5-6: Relative expression of TH in SK-N-SH and SH-SY5Y cells differentiated by protocols 1, 2 and 3, compared to SK-N-SH control cells. * - SK-N-SH protocol 3 compared with SK-N-SH control (p<0.001); ** - SH-SY5Y protocol 3 compared with SH-SY5Y protocol 2 (P<0.05); # - SH-SY5Y protocol 2 compared with SH-SY5Y protocol 1 (p<0.05); § - SH-SY5Y protocol 2 compared with SH-SY5Y control (p<0.05).

Based on the initial results protocol 1 was abandoned and the following experiments involved comparison and subsequent optimization of protocols 2 and 3 only. Figure 5-7 shows the comparison between control and cell differentiated with protocol 2 and 3 for both neuroblastoma cell lines. The results confirm that SH-SY5Y expresses TH at significantly higher levels than SK-N-SH in both the differentiated and undifferentiated states. TH levels in undifferentiated SH-SY5Y are significantly higher compared to control, protocol 2 and

125 Chapter 5: KP in in vitro model derived from neuroblastoma

protocol 3 samples of SH-SK-SN (p<0.05). SH-SY5Y cells differentiated by protocol 2 express 4 times higher TH than control samples from the same cell line (p<0.05). Finally, the highest TH levels are observed in SH-SY5Y cells differentiated with the third protocol, demonstrating 17 fold up regulation of TH expression compared with undifferentiated SH- SY5Y and about 4 fold up regulation, compared to same cells differentiated by protocol 2.

Figure 5-7 : Relative expression of TH in SK-N-SH and SH-SY5Y cells differentiated by protocol 2 and 3, compared with SK-N-SH control. * - SH-SY5Y protocol 3 compared with SH-SY5Y protocol 2 (p<0.05); # - SH-SY5Y protocol 2 compared with SH-SY5Y control (p<0.001); $ - SH-SY5Y protocol 2 compared with SK-N-SH protocol 2 (p<0.001); & - SH-SY5Y control compared with SK-N-SH protocol 2 (p<0.05); % - SH-SY5Y control compared with SK-N-SH control (p<0.05).

5.3.1.5 Further optimization of differentiation protocols From morphological observations in both neuroblastoma cell lines following differentiation, it is clear that SH-SY5Y respond better than SK-N-SH to all protocols (Figure 5-5). TH expression levels confirmed these observations (Figure 5-6). Therefore, the SH- SY5Y cell line was chosen as a candidate for protocol modification to perfect the existing results. Cultured cells are usually grown in the presence of serum, which contains peptide growth factors, which in turn facilitate survival and proliferation of cells. Serum starvation was shown to induce differentiation in various neuroblastoma cell lines (Seidman et al., 1996, Monard et al., 1977). Serum-free medium induced differentiation and outgrow of neurites in

126 Chapter 5: KP in in vitro model derived from neuroblastoma the SH-SY5Y cell line, without addition of any differentiating agents (Buttiglione et al., 2007). The protocols tested in this study contain different amounts of serum (Table 5-1), while the lowest (3%) content was present in protocol 1, which produced the worse outcome. Relying on previous scientific evidence it was decided to lower the serum content to 3% during the first RA differentiation step in protocols 2 and 3 for SH-SY5Y cells. TH expression of SH-SY5Y cells cultured with modified versus initial protocols and control is shown in Figure 5-8. Serum reduction in protocol number 2 resulted in elevated TH expression; however, the up regulation was not significant (p=0.067). Nevertheless, serum reduction in protocol number 3 yielded the significant increase in TH levels compared with cells differentiated with the equivalent non-modified protocol and modified protocol number 2.

Figure 5-8: Relative expression of TH in SH-SY5Y cells differentiated with original protocols 1, 2 and 3 and protocols 2 and 3 with lowered serum content, compared with control untreated cells. # - SH-SY5Y low serum protocol 3 compared with SH-SY5Y high serum protocol 3 (p<0.05); $ - SH-SY5Y low serum protocol 3 compared with SH-SY5Y low serum protocol 2 (p<0.05).

Expression levels of neuronal markers DAT and microtubule-associated protein 2 (MAP2) were also analysed in SH-SY5Y cells differentiated with both original and modified protocols (Figures 5-9 and 5-10). Serum reduction resulted in slightly higher DAT expression in cells differentiated by protocol number 3, however the expression levels was not significantly different between protocol 2 and 3 (p=0.079). Protocol 3 yielded significantly higher DAT levels compared

127 Chapter 5: KP in in vitro model derived from neuroblastoma with all unmodified protocols and control cells (P<0.05). Modified protocol number 2 resulted in significantly higher DAT expression, compared with the second original protocol. Unmodified protocol 3 was still demonstrating best outcomes by significantly higher DAT expression compared with cells treated by original protocol number 1, 2 and control cells (p<0.05). The expression of MAP2 is consistent through modified and original protocols 2 and 3, but significantly higher than in undifferentiated cells and cells differentiated by protocol 1 (p<0.05). Differentiation by protocol 1 resulted in the lowest MAP2 expression, even compared to control cells.

Figure 5-9: Relative expression of MAP2 in SH-SY5Y cells differentiated by protocol 1, 2 and 3, high and low serum, compared to SH-SY5Y control. # - SH-SY5Y low serum protocol 3 compared with SH-SY5Y protocol 1 (p<0.001); ¢ - SH-SY5Y low serum protocol 3 compared with SH-SY5Y control (p<0.05); $ - SH-SY5Y high serum protocol 3 compared with SH-SY5Y protocol 1 (p<0.05); § - SH-SY5Y high serum protocol 3 compared with SH-SY5Y control (p<0.05); * - SH-SY5Y low serum protocol 2 compared with SH-SY5Y protocol 1 (p<0.05); & - SH-SY5Y low serum protocol 2 compared with SH-SY5Y control (p<0.05); β - SH-SY5Y high serum protocol 2 compared with SH-SY5Y control (p<0.001): ^ - SH-SY5Y high serum protocol 2 compared with SH-SY5Y protocol 1 (p<0.001); ~ - SH-SY5Y control compared with SH-SY5Y protocol 1 (p<0.05)

128 Chapter 5: KP in in vitro model derived from neuroblastoma

Figure 5-10: Relative expression of DAT in SH-SY5Y cells differentiated by protocol 1, 2 and 3, high and low serum, compared to SH-SY5Y control. # - SH-SY5Y low serum protocol 3 compared with SH-SY5Y high serum protocol 3 (p<0.05); $ - SH-SY5Y low serum protocol 3 compared with SH-SY5Y high serum protocol 2 (p<0.05); & - SH-SY5Y low serum protocol 3 compared with SH-SY5Y protocol 1 (p<0.05); ~ - SH-SY5Y low serum protocol 3 compared with SH-SY5Y control (p<0.05); * - SH-SY5Y high serum protocol 3 compared with SH-SY5Y high serum protocol 2 (p<0.05); § - SH-SY5Y high serum protocol 3 compared with SH-SY5Y control (p<0.05); ¢ - SH-SY5Y low serum protocol 2 compared with SH-SY5Y control (p<0.05).

Morphological observation confirmed these results: both protocols 2 and 3 with low serum content of 3% resulted in long and branching neurites extended by neuron-like cells (Figure 5-11). Cells differentiated with modified protocol number 2 exhibited particularly large morphological change toward neuron-like cultures, compared with SH-SY5Y cells differentiated with high serum protocol 2 (Figure 5-5). However, this differentiated culture still contained a noticeable proportion of I-type cells and some S-type cells. SH-SY5Y treated with low serum protocol 3 contained neuron-like cells that extensively branched to form clusters, typical for primary neuronal cultures.

129 Chapter 5: KP in in vitro model derived from neuroblastoma

Figure 5-11: SH-SY5Y cells differentiated with protocols 2 and 3 with low serum content (3%) Modified protocol 3 resulted in pure population of neuron-like cells with long neuritis. 10 and 20 times magnification.

Immunocytochemical staining confirmed positive expression of neuronal markers TH and MAP2 in differentiated cells, but control cells expressed MAP2 only (Figure 5-12).

130 Chapter 5: KP in in vitro model derived from neuroblastoma

Figure 5-12: Immunodetection of dopaminergic (TH) and neuronal (MAP2) markers in differentiated and control SH-SY5Y cells. Dopaminergic cells are present in SH-SY5Y differentiated with modified protocol 3, but not in control cells.

5.3.1.6 Choosing the optimal protocol to study KP expression TH enzyme activity, which is solely expressed in dopaminergic neurons, and the levels of DAT expression, a transporter that mediates dopamine uptake, are well-established measures in studies of dopaminergic neuron dysfunction (Cossette et al., 2005). Based upon morphological observations and TH expression levels the SH-N-SK cell line was eliminated as a potential candidate for an in vitro dopaminergic cell model. Every differentiation protocol applied to the SH-N-SK neuroblastoma cell line resulted in dramatically lower TH expression. Furthermore, the morphology of differentiated SH-N-SK proved that only a fraction of cells was fully differentiated into N-type cells. Though some studies still employ SH-N-SK cell line as a dopaminergic model (Ajjimaporn et al., 2008, Baratchi et al., 2011), characterization of differentiated cells is still questionable. Differentiation of SH-SY5Y cells by protocol number 3 yielded a homogenous population of N-type cells, extensive neurites and branching, as well as the highest levels of TH expression. Modification of the protocol by serum reduction improved the results.

131 Chapter 5: KP in in vitro model derived from neuroblastoma

Expression levels of DAT were moderately higher in cells differentiated by both modified and original protocols. The MAP2 marker, which indicates that cells are from neuronal origin was up regulated compared to undifferentiated cells. All these finding together make SH- SY5Y neuroblastoma cell line differentiated by protocol number 3 with low serum concentration (3%) the best candidate for a dopaminergic in vitro model for KP investigation.

5.3.2 Validation of the chosen differentiation protocol for KP investigation

5.3.2.1 Expression of NMDAR subunit genes NMDA receptors (NMDAR) are heteromeric ligand-gated ion channels composed of two obligatory NR1 subunits, and two regulatory subunits (NR2A-D or NR3 A-B) (Villmann and Becker, 2007). The functional difference and similarity between NMDA receptor variants depends on the subunit combination. Expression of the regulatory subunits is developmentally and spatially regulated, and altered during differentiation processes, embryonic development or even in adult brain (Villmann and Becker, 2007). Figure 5-13 demonstrates a significant up regulation (p<0.001) in the transcripts of all NMDAR subunits, in the SH-SY5Y cell line differentiated with modified protocol number 3 compared with undifferentiated cells. The highest up regulation, 5-times, was achieved in NR2C, compared with 2-times up regulation for the NR2A and NR3A subunits, 3-times for the NR2B subunit and 4-times for the NR2D subunit: all compared with expression of the same subunit in undifferentiated cells.

132 Chapter 5: KP in in vitro model derived from neuroblastoma

Figure 5-13: Relative expression of NMDAR subunits in SH-SY5Y cells differentiated with modified protocol number 3 compared to undifferentiated control cells. * - expression of every subunit was significantly higher in dSH-SY5Y than in control cells (p<0.001)

Generally, the degree of expression of different subunits cannot be compared with each other; however, initial amount of target cDNA in the same sample can be estimated by analysing Ct values. The lower the Ct values for a sample the greater the starting amount of cDNA in the sample. Ct values for 5 analysed NMDAR subunits in undifferentiated cells showed that NR2C subunit cDNA appeared to be present in the highest amount, being first detected at cycle 19 (p<0.001) (Table 5-2). The DNA concentration of the NR2B subunit was the lowest, when then NR2D subunit was present in moderately high concentration, firstly detected at cycle 25. The same ratio was maintained in differentiated cells. The relative expression of single subunits was calculated using endogenous control reference gene expression, which normalizes target gene expression with input amounts of cDNA.

5.3.2.2 Expression of the KP enzyme genes in undifferentiated versus differentiated SH-SY5Y cells To validate the chosen model for KP investigation the expression of several key enzymes was analysed in control and differentiated cells, treated with INF-γ versus control at 3 time points. INF-γ was used to induce IDO-1, one of the rate limiting KP enzyme (Alberati-Giani et al., 1996, Takikawa et al., 1999, Taylor and Feng, 1991). Primer pairs were designed to identify mRNA of human KP enzymes as described in Chapter 4.

133 Chapter 5: KP in in vitro model derived from neuroblastoma

Subunit Reference NR2A NR3A NR2B NR2C NR2D type gene Ct value SH-SY5Y 31.97±1.08 30.01±0.39 34.31±0.91 19.97±0.2 25.78±0.18 31.24±0.62 cells Ct value dSH- 33.17±0.71 30.45±0.21 35.04±0.73 19.83±0.01 25.80±0.03 32.61+0.46 SY5Y cells

Table 5-2: Expression levels (Ct values) of NMDAR subunits and reference gene in SH-SY5Y control cells and cells differentiated with modified protocol number 3 (n=3). Initial amount of target cDNA in the same sample can be estimated based on Ct values. The lower the Ct values for a sample the greater the starting amount of target cDNA in the sample. For example, cDNA concentration of NR2C subunit’s was the highest in both differentiated and undifferentiated cells.

The enzymes are present in three different groups: 1) enzymes that convert tryptophan into kynurenine, 2) enzymes that convert kynurenine into kynurenic acid and 3) enzymes that convert kynurenine along the path leading to quinolinic acid formation. All enzymes had different expression pattern in differentiated and undifferentiated cells (Figures 5-14, 5-15 and 5-16). Among the enzymes that convert tryptophan into kynurenine IDO1 is the most important one, being a rate limiting KP enzyme of tryptophan metabolism and also strongly involved in immunoregulating processes (Prendergast, 2008). IDO1 was 50-times up regulated in differentiated, but not in control, cells after 24 hours, presenting a massive activation of KP (Figure 5-14). TDO2, which catalyse the same step of KP together with IDO1, was up regulated in differentiated cells compared to undifferentiated at 48 hour, but not at 24 hours. IDO2 and AFMID expression levels along different treatments and time line was not considerably different. However, IDO2 expression in differentiated SH-SY5Y was lower than in control cells, but only about 2-fold (Figure 5-14). Second group enzymes: KAT1 and GOT2 demonstrated analogous expression pattern, being slightly higher in control cells, similar to IDO2. KAT2 was up regulated at 24 and 48 hours in differentiated cells compared with control cells, while KAT3 was strongly up regulated in differentiated cells after 24 hours (Figure 5-15). Expression of 3HAAO and QPRT enzymes was present at the relatively steady level in stimulated and unstimulated cells over the 48 hours’ time line, regardless of the differentiation process. KMO, another enzyme leading to QUIN production, was expressed at a consistent, clearly higher level in undifferentiated cells compared to differentiated ones, whether stimulated or not (Figure 5-16).

134 Chapter 5: KP in in vitro model derived from neuroblastoma

Figure 5-14: Relative expression of KP enzymes converting tryptophan to kynurenine in the SH-SY5Y cells. The expression examined in differentiated and control cells at 24 and 48 h, stimulated and unstimulated with INF-γ and compared to unstimulated control at 24 h (n=1).

135 Chapter 5: KP in in vitro model derived from neuroblastoma

Figure 5-15 : Relative expression of KP enzymes converting kynurenine to kynurenic acid in the SH-SY5Y cells. The expression examined in differentiated and control cells at 24 and 48 h, stimulated and unstimulated with INF-γ and compared to unstimulated control at 24 h.

Figure 5-16 : Relative expression of KP enzymes converting kynurenine to QUIN and nicotinamide in the SH-SY5Y cells. The expression examined in differentiated and control cells at 24 and 48 h, stimulated and unstimulated with INF-γ and compared to unstimulated control at 24 h.

5.3.3 KP characterization in differentiated SH-SY5Y cells

5.3.3.1 KP induction Differentiated cells were treated with INF-γ for 24, 48 and 72 hours to mimic inflammation conditions and activate pathways associated with, including KP. KP enzyme expression and metabolite concentrations were measured in INF-γ induced and control SH-

136 Chapter 5: KP in in vitro model derived from neuroblastoma

SY5Y cells differentiated by protocol number 3 at 24, 48 and 72 hours, to examine the dynamics of KP activation.

5.3.3.2 Gene expression of KP enzymes Profound IDO1 expression was detected in SH-SY5Y differentiated cells, 24h after INF-γ stimulation (Figure 5-17). IDO1 up regulation was the most powerful among all KP enzymes, reaching 400-times up regulation at 24 hours , up to 1000-times up regulation after 72 hours of INF-γ stimulation, compared with non-stimulated cells (p<0.001). The expression patterns of 3 other enzymes that convert tryptophan into kynurenine, were similar to that of IDO1; AFMID, IDO2 and TDO2 were very alike, achieving strong 140 to 250-times up regulation only after 72 hours of INF-γ stimulation. The next group of enzymes convert kynurenine into the protective metabolite kynurenic acid: KAT1, KAT2, KAT3 and GOT2/KAT4. At 24 hours of INF-γ stimulation, only KAT3 demonstrated slight up regulation. At 48 hours , KAT2, KAT2 and GOT2 showed higher expression in stimulated cells, compared with stimulated at 24 hours and unstimulated cells. KAT1, 2 and 3 up regulation significantly increased in stimulated cells at 72 hours, compared with unstimulated, but was not significant for GOT2 (Figure 5-19). 24 hours INF-γ stimulation evoked slightly up regulated expression of KMO, KYNU and 3HAAO, enzymes that catabolise kynurenine into 3-HK, 3-HAA and ACMS respectively (Figure 5-20). Unstimulated cells at 48 hours demonstrated high KYNU expression, but not stimulated cells. However, at 72 hours KYNU expression was dramatically increased in stimulated cells, demonstrating 780-times up regulation compared to unstimulated cells at 24 hours (p<0.001). The 3HAOO expression pattern was similar to KYNU, with less profound, but still powerful, up regulation at 72 hours. INF-γ induced steady and significant up regulation of KMO at 48 and 72 hours, compared with control cells (p<0.05). Both INF-γ stimulated and unstimulated cells expressed QPRT enzyme in the same low levels at 24 and 48 hours, however at 72 hours its expression was significantly up regulated in unstimulated cells, but not in stimulated (Figure 5-21). ACMSD was significantly 2-times up regulated (p<0.05) in stimulated cells at 24 hours, reaching a massive 37-times rise at 72 hours (p<0.001) (Figure 5-21). Figure 5-22 demonstrates the expression of KP side branch enzymes that convert tryptophan into serotonin and 5-HIAA. TPH1 and TPH2 showed a similar expression pattern, with strong up regulation achieved only after 72h of INF-γ stimulation, compared to other treatments and times. MAOA was expressed at relatively the same low level at 24 and 48

137 Chapter 5: KP in in vitro model derived from neuroblastoma

hours, with significant up regulation at 72 hours in non-stimulated cells (p<0.05). MAOB expression was constantly higher in stimulated cells, compared with control cells (p<0.01), 48 and 72 hours expression is similarly 20-times higher in INF-γ induced cells, compared to 24h control (p<0.01).

Figure 5-17: Relative expression of IDO1, IDO2, TDO2 and AFMID in dSH-SY5Y cells, stimulated or not with INF-γ, at 24, 48 and 72 hours. IDO1 and IDO2 were significantly up regulated in INF-γ-induced cells, indicating a massive KP activation.

138 Chapter 5: KP in in vitro model derived from neuroblastoma

Figure 5-18: Amplification curve for IDO1 at 24 hours in SH-SY5Y, stimulated or not with INF-γ. The plot of cycle numbers versus fluorescence signal which correlates with the initial amount of target nucleic acid during the exponential phase of PCR. The higher the starting copy number of the cDNA target, the sooner a significant increase in fluorescence is observed. cDNA from dSH-SY5Y stimulated with INF-γ amplified at cycle 23, compared with control cDNA amplified at cycle 30. Each PCR cycle theoretically doubles the amount of targeted sequence in the reaction, giving approximately 130-times greater amount of target cDNA in INF-γ stimulated cells.

139 Chapter 5: KP in in vitro model derived from neuroblastoma

Figure 5-19: Relative expression of KAT1, KAT2, KAT3 and GOT2 in dSH-SY5Y cells, stimulated or not with INF-γ, at 24, 48 and 72 hours.

Figure 5-20: Relative expression of KMO, KYNU and 3HAAO in dSH-SY5Y cells, stimulated or not with INF-γ, at 24, 48 and 72 hours.

140 Chapter 5: KP in in vitro model derived from neuroblastoma

Figure 5-21: Relative expression of ACMSD and QPRT in dSH-SY5Y cells, stimulated or not with INF-γ, at 24, 48 and 72 hours.

Figure 5-22: Relative expression of TPH1, TPH2, MAOA and MAOB in dSH-SY5Y cells, stimulated or not with INF-γ, at 24, 48 and 72 hours.

141 Chapter 5: KP in in vitro model derived from neuroblastoma

5.3.3.3 Quantification of KP metabolites Concentrations of KYN and TRP were measured in the growth medium of INF-γ stimulated and non-stimulated differentiated SH-SY5Y cells at 24, 48 and 72 hours (section 3.1.8 The concentration of TRP in supplemented Neurobasal growth medium was 52.64±4.55 μM, and the concentration of KYN was 3.29±0.32 μM. Changes in TRP concentrations were calculated as following: TRP concentration in sample supernatant – TRP concentration initially presented in the supplemented media. TRP was catabolised from the growth medium by cells stimulated with INF-γ, but not by control cells. Non-stimulated cells secreted small amounts of TRP into the growth medium, increasing its initial concentration by 15.9±3.20, 13.02±4.59 and 5.61±0.32 μM at 24, 48 and 72 hours, respectively. TRP catabolism by INF-γ- induced cells at 24, 48 and 72 hours dramatically increased, compared to control cells, resulting in decreases of TRP concentrations in growth medium of 18.86±0.61, 52.61±3.37 and 57.93±0.66 μM, respectively (p<0.01) (Figure 5-23). Final concentrations of KYN in the media derived from cells growing in different conditions were calculated in a similar manner as TRP concentrations. Non-stimulated cells produced non-detectable to low concentrations of KYN: 0, 1.16±0.34 and 2.25±0.65 μM at 24, 48 and 72 hours respectively. KYN concentrations in the supernatant of stimulated cells increased dramatically (p<0.001), compared to unstimulated cells: 23.16±0.26, 46.38±0.88 and 55.45±0.36 μM at 24, 48 and 72 hours respectively (Figure 5-24).

Figure 5-23: TRP catabolism in dSH-SY5Y cells, stimulated or not with INF-γ, at 24, 48 and 72 hours. TRP concentrations measured by HPLC in medium samples derived from growing cells. * - INF-γ stimulated dSH-SY5Y 72h compared with INF-γ stimulated dSH-SY5Y 24h (p<0.001). # - INF-γ stimulated dSH-SY5Y 48h compared with INF-γ stimulated dSH-SY5Y 24h (p<0.001).

142 Chapter 5: KP in in vitro model derived from neuroblastoma

Figure 5-24: KYN metabolism in dSH-SY5Y cells, stimulated or not with INF-γ, at 24, 48 and 72 hours. KYN concentrations measured by HPLC in medium samples derived from growing cells. $ - INF-γ stimulated dSH-SY5Y 72h compared with INF-γ stimulated dSH-SY5Y 48h (p<0.01). & - INF-γ stimulated dSH-SY5Y 72h compared with INF-γ stimulated dSH-SY5Y 24h (p<0.001). # - INF-γ stimulated dSH-SY5Y 48h compared with INF-γ stimulated dSH-SY5Y 24h (p<0.001).

The ratio of KYN metabolism and TRP catabolism represents the degree of KP activation. The KP activation is measured as the ratio between KYN concentration / TRP concentration in the sample’s supernatant (not corrected with the concentrations of metabolites initially presented in the growth medium). In non-stimulated differentiated cells, KP activation was at relatively the same level at 24, 48 and 72 hours. INF-γ stimulation induced massive KP activation at 24 hours, having KYN/TRP ratio of 1188±594. At 72 hours, the ratio reaches 69529±1998, showing massive 60-times higher KP activation compared with 24 hours (Figure 5-24). INF-γ also stimulated a higher production of neuroprotective KYNA at 24, 48 and 72 hours, compared with unstimulated cells (Figure 5-26). KYNA was produced at nanomolar concentrations compared with KYN, which was produced in micromolar concentrations. Non-stimulated cells produced not-detectable to 20 nM KYNA concentrations, while INF-γ induced cells to secrete 109.23±1.73, 205.42±8.43 and 523.51±84.65 μM at 24, 48 and 72 hours respectively.

143 Chapter 5: KP in in vitro model derived from neuroblastoma

Figure 5-25: KP activation in INF-γ induced and control dSH-SY5Y cells. High KYN/TRP ratio indicates enhanced TRP degradation and greater capacity of KP to produce KYN from TRP. The ratio provides an estimate on IDO1 activation, a first rate-limiting KP enzyme. * - dSH-SY5Y (INF-γ , 72h) compared with dSH-SY5Y (INF-γ , 48h); p<0.05. $ - dSH-SY5Y (INF-γ , 72h) compared with dSH-SY5Y (INF-γ , 24h); p<0.001. # - dSH-SY5Y (INF-γ , 48h) compared with dSH-SY5Y (INF-γ , 24h); p<0.05.

Figure 5-26: KYNA metabolism in dSH-SY5Y cells, stimulated or not with INF-γ, at 24, 48 and 72 hours. KYNA concentrations measured by HPLC in media samples derived from growing cells. $ - INF-γ stimulated dSH-SY5Y 72h compared with INF-γ stimulated dSH-SY5Y 48h (p<0.05). # - INF-γ stimulated dSH-SY5Y 72h compared with INF-γ stimulated dSH-SY5Y 24h (p<0.01). & - INF-γ stimulated dSH-SY5Y 48h compared with INF-γ stimulated dSH-SY5Y 24h (p<0.05). * - INF-γ stimulated dSH-SY5Y 24h compared with non- stimulated dSH-SY5Y 24h (p<0.05).

Concentrations of three additional KP metabolites secreted by cells were measured in culture media by GC/MS analysis. Initial concentrations in the growing media were as follows: PIC concentration was 47.49±5.40 nM, the concentration of QUIN was 269.70±50.03 nM, and 3.75±0.50 nM for quinaldic acid (QA). Only INF-γ stimulated cells (24 and 48 hours) produced PIC, while PIC concentration at 24h in the media was significantly higher than at 48 hours, being 115.77±20 and 51.07±6 nM, respectively (p<0.05) (Figure 5-27). Non-stimulated cells and stimulated cells at 72

144 Chapter 5: KP in in vitro model derived from neuroblastoma hours, consumed PIC from growth medium in small amounts ranging from 0.56±0.31 to 19.97±1.20 nM. Both non-stimulated and stimulated cells degraded QUIN from the growth medium. The levels of catabolised QUIN were similar for unstimulated cells at 24, 48 and 72 hours (Figure 5-28). INF-γ-stimulated cells catabolised QUIN at lower levels, consuming 68.87±37.77 (24 hours), 75.98±50.45 (48 hours) and 249.37±10.64 (72 hours) nM. There was no difference found in QUIN amounts catabolised by stimulated and non-stimulated cells at 72 hours. INF-γ-stimulated cells produced very small concentrations of QA into growing media, which were decreasing with time: 18.82 ±3.84 (24 hours), 10.56± 0.98 (48 hours) and 7.67± 1.96 (72 hours) nM (Figure 5-29). Non-stimulated cells at 24 hours also secreted small amount 6.01±3.84 nM of PIC into the medium, however non-stimulated cells at 48 and 72 hours catabolised 1.49±0.97 and 2.4±1.96 nM QUIN into the medium, respectively.

Figure 5-27: PIC in dSH-SY5Y cells, stimulated or not with INF-γ, at 24, 48 and 72 hours. PIC concentrations measured by GC/MS in medium samples derived from growing cells. * - INF-γ stimulated dSH-SY5Y 24h compared with non-stimulated dSH-SY5Y 24 h (p<0.05)

145 Chapter 5: KP in in vitro model derived from neuroblastoma

Figure 5-28: QUIN in dSH-SY5Y cells, stimulated or not with INF-γ, at 24, 48 and 72 hours. QUIN concentrations measured by GC/MS in medium samples derived from growing cells. # - non- stimulated dSH-SY5Y 24h compared with INF-γ stimulated dSH-SY5Y 24 h (p<0.01). & - non- stimulated dSH-SY5Y 48h compared with INF-γ stimulated dSH-SY5Y 48 h (p<0.05).

Figure 5-29: QA in dSH-SY5Y cells, stimulated or not with INF-γ, at 24, 48 and 72 hours. QA concentrations measured by GC/MS in medium samples derived from growing cells. & - INF-γ stimulated dSH-SY5Y 24h compared with non- stimulated dSH-SY5Y 24h (p<0.05). * - INF-γ stimulated dSH-SY5Y 48h compared with non- stimulated dSH-SY5Y 48h (p<0.01). # - INF-γ stimulated dSH-SY5Y 72h compared with non- stimulated dSH-SY5Y 72h (p<0.05).

146 Chapter 5: KP in in vitro model derived from neuroblastoma

5.4 Discussion

5.4.1 Development of human dopaminergic neurons in vitro model The effects of RA, a naturally occurring morphogen (Wagner et al., 1990), on human neuroblastoma cell lines, includes promotion of morphological differentiation and growth inhibition (Pahlman et al., 1995). A number of different methods for differentiation of SK-N- SH and SH-SY5Y have been reported (Pahlman et al., 1984, Jensen, 1987, Kaplan et al., 1993a). It is well documented that one of the neuroblastoma cell lines characteristics is transdifferentiation between N-type and S-type cells (Jensen, 1987, Matsushima and Bogenmann, 1992), including the SH-SY5Y cell line, which is considered as neuroblastic (Ross et al., 1983). This phenomenon is related to the multipotent nature of neural crest cells, from which the SH-SY5Y cell line was derived. S-type cells are reported to be resistant to some RA effects and contribute to rapid proliferation of the cell line. RA treatment of the SK-N-SH cell line did not arrest proliferation and was reported to transform the culture into fibroblastic or epithelial–like cells (Sidell et al., 1983). Both cell lines did not differentiate morphologically to full neuronal capacity in response to RA treatment alone (Figure 5-4). Similar results were reported by Lovat et al. (Lovat et al., 1993). However, the same study, and others, reported neurite extension occurring in SK-N-SH and SH-SY5Y cell lines in response to db-cAMP (Perez-Polo et al., 1979, Lovat et al., 1993). Indeed, both SH-SY5Y and SK-N-SH neuroblastoma cell lines treated with protocol number 3, that includes db- cAMP, responded in neurite extensions, however SK-N-SH response was limited (Figure 5- 5). Limited neurite extension in response to db-cAMP or to NGF in SK-N-SH has also been observed before (Reynolds and Perez-Polo, 1989). The documented heterogeneity of the SK- N-SH line was supported again in a Sidell et al. study, showing distinct responses to RA treatment of two SK-N-SH variants, making these cells incompatible with RA differentiation (Sidell et al., 1986). This study demonstrates that both selected protocols that involve sequential RA/BDNF (protocols 2 and 3)-induced differentiation promote the most neuronal phenotype, but cannot fully overcome the appearance of S-type cells (Figures 5-5 and 5-11). RA treatment causes the up regulation of neurotrophin receptors, making SH-SY5Y cells responsive to neurotrophins (Cernaianu et al., 2008b). It was previously reported that RA together with neurotrophin treatments lead to a significant increase in a number of generated mature neurons from stem cell culture or pluripotent neural crest cells (Takahashi et al., 1999, Sieber-Blum, 1991). Numerous observations suggest RA involvement in promotion of

147 Chapter 5: KP in in vitro model derived from neuroblastoma differentiation along the neuronal lineage and neurotrophic factors support the fully developed mature neuronal phenotype (Encinas et al., 2000a). The aim of the study was to develop and select a differentiation protocol that induces dopaminergic neuronal phenotype and avoids trans-differentiation, leading to increased amount of non-neuronal S-type cells in the culture. BDNF addition into cell culture was reported to reduce the amount of S-type cells in RA-treated SH-SY5Y cultures, to yield a homogenous neuronal-like culture and induce expression of some specific dopaminergic neuron characteristics (Encinas et al., 2000a, Mastroeni et al., 2009a, Xie et al., 2010). BDNF was also reported numerous times to promote survival of midbrain dopaminergic neurons in primary cultures (Alderson et al., 1990, Hyman et al., 1991). Low serum conditions have been shown to induce neurogenesis in various neuroblastoma cell lines, including SH-SY5Y, even without addition of specific differentiation agents (Alleaume et al., 2004, Heraud et al., 2004, Buttiglione et al., 2007). Sequential use of RA and BDNF under low serum conditions (modified protocol number 3) in Neurobasal medium, which is widely used for many types of primary neuronal cell culture, commits SH-SY5Y cells to a neuronal phenotype without the presence of non- neuronal cell types, suggesting that this treatment might mimic some developmental signals leading to maturation of dopaminergic neurons. Protocol number 3 also incorporates treatment with db-cAMP, which has been reported to increase TH expression during SH- SY5Y differentiation (Kume et al., 2008) and 50mM of KCl, which induces membrane depolarization. It was shown that membrane depolarization causes transmembrane ion influxes that are involved in neuronal differentiation processes and promote neuronal survival, also in SH-SY5Y cell line (Gallo et al., 1987, Seo et al., 2006). Similar to BDNF treatment, db-cAMP and depolarizing concentrations of K+ treatment also demonstrated to promote survival of TH-positive neurons in mesencephalic primary rat cultures (Murer et al., 1999). The positive effect of db-cAMP was most likely associated with increased levels of intracellular cAMP, which enables neurotrophins to promote dopaminergic neuron survival through activation of adenylate cyclase or inhibition of phosphodiesterase (Franke et al., 2000b, Rupniak et al., 1984). Indeed, SH-SY5Y cells developed by protocol number 3 were a reproducible homogenous cell population with the morphology of cultured primary neurons, and developed a healthy and well-established network of neurites (Figure 5-5). Protocol number 3 with lower serum content was chosen as an optimal in vitro model for dopaminergic neurons, relying not on morphological observations alone, but also due to expression of specific dopaminergic markers. There is controversial evidence regarding TH

148 Chapter 5: KP in in vitro model derived from neuroblastoma

expression in undifferentiated SH-SY5Y cells (Mastroeni et al., 2009b, Gomez-Santos et al., 2002, McMillan et al., 2007), as well as DAT and MAP2 expression (Ross et al., 1983, Biedler et al., 1978, Willets et al., 1995). Despite expressing all these markers, SH-SY5Y cells are still considered as immature neuroblasts in the process of neuronal differentiation and have been demonstrated to carry some characteristics of stem cells (Biedler et al., 1973, Ross et al., 1983). TH is a rate-limiting enzyme in catecholamine biosynthesis and routinely used to identify dopaminergic neurons (Margolis et al., 2010). The current study demonstrates low TH expression by qPCR and negative TH immunolabelling in undifferentiated cells, together with strong up regulation of TH expression in cells differentiated by various protocols, especially in the SH-SY5Y cell line (Figures 5-5, 5-6 and 5-12). Significantly, higher TH up regulation was achieved with protocol number 3, with lowered serum content. DAT, sodium-dependent dopamine reuptake carrier, is another dopaminergic marker, exclusively expressed by dopaminergic neurons and has higher expression levels in SNpc (Storch et al., 2004). MAP2 is an abundant neuronal cytoskeletal phosphoprotein that binds to tubulin to stabilize microtubules and is essential for the development and maintenance of neuronal morphology (Binder et al., 1985). Both these markers were expressed at significantly higher levels in SH-SY5Y cells differentiated with protocols that involved subsequent RA/BDNF treatment, with slightly higher expression in culture treated with modified protocol number 3. The presence of functional NMDA receptors in non-differentiated SH-SY5Y cell has been reported, based on the evidence that exposure of the cells to NMDA or glutamate induced an increase in free intracellular calcium concentration (Naarala et al., 1993). SH- SY5Y and SK-N-SH cells express obligatory NR1 subunit and functional NMDARs composited of NR1/NR2B (de Arriba et al., 2006, Pizzi et al., 2002). Differentiated SH- SY5Y cells expressed all functional NMDAR subunits in significantly higher levels, than undifferentiated cells, suggesting increased vulnerability of the model to glutamate exposure (Pizzi et al., 2002). NMDARs are involved in excitotoxic mechanisms in the brain, which are triggered by glutamate and strongly associated with PD (section 2.2.7 ). Enhanced activation of the NR1/NR2B receptor has been shown to generate Parkinsonian symptoms together with SN dopamine depletion (Nash et al., 1999, Nash et al., 2000). Moreover, it has been suggested that expression of NMDA receptors can serve as an indicator of neuronal differentiation of cells and as a marker of the efficiency of neuronal differentiation protocol (Kulikov et al., 2007).

149 Chapter 5: KP in in vitro model derived from neuroblastoma

In conclusion, the model presented herein features many dopaminergic neuron characteristics, and is a convenient system for PD in vitro studies. This protocol has several advantages over other existing protocols; firstly, despite differentiation taking a relatively long time (10 days) it allows non-differentiated cells to be eliminated from the culture, compared with protocols utilizing a 4-6 day differentiation process. Secondly, cells differentiated by the current protocol are systematically characterised on both the morphological and molecular levels. Finally, cells derived by the chosen protocol have more mature NMDA receptor, suggesting higher cells vulnerability to oxidative stress, resembling primary dopaminergic neurons (Ebadi et al., 1996). Moreover, this model offers a suitable tool for KP investigation, by demonstrating sensitivity to inflammation induction in response of massive IDO1 up regulation, when compared with non-differentiated cells (Figure 5-14). Being so sensitive to the inflammatory process, this model will also allow investigation of the impact of inflammation on dopaminergic neuron degeneration in PD.

5.4.2 Characterization of KP in human dopaminergic neurons in vitro model The KP is fully presented in microglia, macrophages and neurons, but only partially in astrocytes (Guillemin et al., 2001c, Guillemin et al., 2003b, Guillemin et al., 2007b). Numerous studies have demonstrated different expression patterns of KP enzymes in different species and cell types (Heyes et al., 1997a, Heyes et al., 1997b). It is important to characterize KP expression in every type of cell or in vitro model. The current in vitro model of dopaminergic neurons derived from SH-SY5Y neuroblastoma cell line expressed all KP enzymes at 24, 48 or 72 hours following inflammatory induction by INF-γ. Stimulation of cells by INF-γ led to massive IDO1 up regulation, as was seen before with rodent and human neurons and neuronal cell lines (Figure 5-17) (Chen et al., 2011, Roy et al., 2005, Guillemin et al., 2007b). The Roy et al. study described particularly strong expression of IDO1 in neurons of the hippocampus and dentate gyrus areas, which are highly sensitive to excitotoxins such as QUIN, that act on NMDA receptors (Roy et al., 2005). TRP depletion from the growth medium by INF-γ-stimulated cells increased during 72 hours’ time course, demonstrating the same pattern of up regulated expression, as IDO1, the enzyme that converts TRP to KYN (Figure 5-23). IDO2 and TDO2 belong to the same group of enzymes, as IDO1. IDO2 is predominantly expressed in the kidney and liver (Ball et al., 2007) and was suggested to be activated by different signalling mechanisms than IDO1, despite close similarity in biological

150 Chapter 5: KP in in vitro model derived from neuroblastoma

function and structure of both enzymes (Ball et al., 2009). TDO2 is predominant in hepatic tissue, but is still expressed in neurons and found to be up regulated in the frontal cortex of schizophrenia patients, unlike IDO1 (Guillemin et al., 2007b, Miller et al., 2004). Expression of AFMID, an enzyme that degrades TRP, together with TDO2 and IDO2 concomitantly rose in the presence of INF-γ at 72 hours, but to a lower extent then IDO1. Similar results were reported by Chen et al. in mouse neuronal culture at 24 hours (Chen et al., 2011). However, an inverse relationship between IDO1 and TDO2 was found in an INF-γ treated neuroblastoma cell line and human neurons at 24 hours (Guillemin et al., 2007b). This Guillemin et al. finding correlates with the current results at 24 and 48 hours, when TDO2 expression was decreased, as well as IDO2 and AFMID, when IDO1 was profoundly activated by INF-γ. Interestingly, AFMID, similar to IDO2 and TDO2, is normally expressed in kidney (Dobrovolsky et al., 2005b). This fact might be a reason for a similar expression pattern of these enzymes in neurons, but significantly different to IDO1, which is continuously expressed in the CNS (Dai and Zhu, 2010). The enzyme KAT1, KAT2, KAT3 and GOT2/KAT4 are responsible for synthesising one of the neuroprotective KP metabolites, KYNA (Okuno et al., 1991). MPTP treatment was reported to decrease KAT1 expression in correlation with dopaminergic loss from mouse SN (Knyihar-Csillik et al., 2004). Compared with the first group of enzymes, up regulation of enzyme expression was much lower (Figures 5-17 and 5-19). Expression of KAT2, KAT3 and GOT2 became significantly higher in the presence of INF-γ at 48 h, reaching even higher up regulation at 72 hours. The most powerful increase in expression was detected for KAT3. KAT3 was detected in the human retina and optic nerve, inside corpora amylacea accumulations, a hallmark of aging and neurodegeneration (Rejdak et al., 2011). This finding indicates that KYNA synthesis might be involved in the mechanisms of retina neurodegeneration. KYNA is a natural endogenous antagonist of NMDA and the neuronal cholinergic α7 nicotine receptors and had a neuroprotective effect (Moroni et al., 2012). The KYNA concentration results correlated well with the increasing expression of KAT family enzymes (Figure 5-26). Briefly, KYNA concentration increased paralleled by the rising expression of IDO1 in INF-γ-stimulated cells during a time course of 24, 48 and 72 hours. It has shown before that KYNA is synthesised by human and rat neurons in low micromolar concentrations, similar to the present results (Guillemin et al., 2007b, Rzeski et al., 2005). Among the enzymes participating in the conversion of KYN into ACMS, a significantly up regulated expression of KMO was detected at 48 hours in INF-γ-triggered cells. KMO activation leads to the production of neurotoxic compound 3-HK, a generator of highly

151 Chapter 5: KP in in vitro model derived from neuroblastoma

reactive free radicals. 3-HK also potentiates QUIN toxicity and is a significant hazard in situations of excitotoxic injury (Guidetti and Schwarcz, 1999). KYNU and 3HAAO expression is very low in stimulated and non-stimulated cells, supporting the previous finding that these enzymes are significantly expressed only in monocytic cells, such as human microglia or macrophages (Guillemin et al., 2003b). However, a further study from this group characterizing the KP in the SK-N-SH neuroblastoma cell line has demonstrated that this system represents the only neuron-like cells able to produce QUIN (Guillemin et al., 2007b). The present study indicates no QUIN production by dopaminergic neurons in the in vitro model, but, rather, consumption of nanomolar QUIN concentrations from the growth medium. It correlates with a Guillemin et al. study of primary neurons (Guillemin et al., 2007b). QUIN uptake by the NCS-34 mouse motor neuron-neuroblastoma cell was gradually increased, suggesting that it was not rapidly metabolized by QPRT and accumulated over time (Chen et al., 2011). Under normal circumstances, the uptake of small amounts of QUIN may be beneﬁcial if converted quickly by QPRT to NAD+ (Braidy et al., 2009a). It explains why unstimulated cells still catabolise QUIN from growth medium in nanomolar concentrations. QPRT showed steady low expression through the 48 hours’ time course in stimulated and unstimulated cells, suggesting that there is no significant difference in the amount of QUIN accumulated within the cells (Figure 5-21). ACMSD is a rate limiting enzyme in PIC production, and also regulates QUIN and NAD generation through the KP (Tanabe et al., 2002, Ikeda et al., 1965). ASMSD is predominantly a hepatic enzyme and is expressed in the brain in low levels (Pucci et al., 2007a, Fukuoka et al., 2002). An inverse relationship was recorded between ACMSD activity and QUIN production (Guillemin et al., 2007b). PIC is an endogenous neuroprotective compound within the brain, suggested to act via metal chelation and attenuation of calcium-dependent glutamate release (Jhamandas et al., 1998, Jhamandas et al., 1990). Differentiated SH-SY5Y cells express ACMSD at low levels, similar to human neurons and in contrast with SK-N-SH neuron-like cells (Guillemin et al., 2007b). INF-γ-treated cells expressed a significantly increased ACMSD level compared with unstimulated cells at 24 hours (Figure 5-21). Furthermore, ACMSD up regulation was associated with PIC production (68±20 nM) over 24 hours from INF-γ application, but not in control cells (Figure 5-27). In nanomolar concentrations, PIC protects against QUIN-induced neurotoxicity (Vrooman et al., 1993). Unlike neuroprotective KYNA and other NMDAR antagonists, PIC can attenuate QUIN neurotoxicity without affecting its excitatory effect, though the mechanism is still unclear (Beninger et al., 1994, Cockhill et al., 1992). PIC also has a strong

152 Chapter 5: KP in in vitro model derived from neuroblastoma influence on the immune system by regulating chemokine release and stimulating anti- inflammatory mechanisms (Grant et al., 2009). These findings support the hypothesis of this study that PIC produced through KP activation in neurons has the ability to protect neurons against QUIN-induced neurotoxicity (Figures 2-12 and 2-13). Quinoline-2-carboxylic acid (QA) is another potent chelator of divalent metal ions and similar to PIC, is formed by the dehydroxylation of KYNA (Epand, 1982, Kaihara et al., 1956). QA has not been investigated in relation to neurodegeneration. QA derivatives exhibited good levels of anti-inflammatory and analgesic activities by in vivo screening; furthermore, some of them were indicated to have anti-HIV activities (Mazzoni et al., 2010, Luo et al., 2009). Our model showed a small rise in QA concentration in stimulated cells along 72 hours time course, compared with control. QA was secreted by cells at very low nanomolar concentrations. However, some QA analogues were shown to be extremely potent, with IC50 as low as 0.11nM, antagonizing endothelin receptor type A, a human G-protein coupled receptor (Patel et al., 2010). Another fact that may suggest that QA is neuroprotective in PD is that several QA derivatives are potent antagonists of the 5HT(1B) receptor, another type of human GPCR (Horchler et al., 2007). This receptor acts as an auto- receptor in human striatum and basal ganglia, inhibiting serotonin release (Pytliak et al., 2011). Thus elevated QA concentrations may lead to 5HT(1B) inhibition, leading to excessive serotonin formation. A side branch of the KP that converts TRP to serotonin and then to 5HAA is strongly associated with PD. The striatum and the SN and GPm receive a dense serotonergic input, suggesting a potential role for serotonin in PD (Lavoie and Parent, 1990). Post mortem and live imaging studies indicated depletion of serotonin in PD patients’ brain (Shannak et al., 1994, Guttman et al., 2007). Moreover, MAOB inhibitors are widely used in PD and some of them even represent a novel neuroprotective PD therapy (section 2.2.9.3 . No significant differences in TPH1 and TPH2 expression were found up to 48 hours in stimulated, when compared to non-stimulated, cells. However, MAOB expression was significantly up regulated at 24, 48 and 72 hours in INF-γ-treated cells, suggesting high rate of serotonin depletion toward 5HIAA synthesis. These findings taken together with previously mentioned facts, suggest that differentiated INF-γ-stimulated SH-SY5Y cells to be a dopaminergic neuron in vitro model, mimicking INF-γ-mediated inflammation associated with PD (Mount et al., 2007). Figure 5-30 shows the diagram of possible KP switch in the presence of INF-γ in the proposed in vitro model of dopaminergic neurons. The KP is massively activated through

153 Chapter 5: KP in in vitro model derived from neuroblastoma

IDO1, which is indicated by the ratio of TRP catabolism and KYN synthesis, leading the pathway towards production of neuroprotective KYNA and PIC (Figure 5-25). QUIN intake by the cells suggests a neurotoxic environment created not only by INF-γ application but also by the presence of QUIN in the growth medium. Neurobasal culture media has been reported to induce excitotoxicity and NMDAR activation (Hogins et al., 2011). It is Important to mention that all KP enzymes are over expressed at 72 hours in the presence of INF-γ. The possible explanation is that prolonged INF-γ-induced inflammation may switch on a different signalling mechanism, as INF-γ was also described as a potent inducer of apoptotic genes (Maher et al., 2007).

Figure 5-30: A possible KP switch in dSH-SY5Y cell line in the presence of INF-γ. KP is highly activated in dSH-SY5Y following INF-γ-induced inflammation, the rate-limiting enzyme IDO1 is highly upregulated and it leads to the production of neuroprotective KP metabolites KYNA, PIC and QA, but not toxic QUIN. Red colour indicates changes occurring under INF-γ stimulation. Based on results at 24 or 48 h.

154 Chapter 6: KP in primary dopaminergic neurons

Chapter 6 : Isolation of human foetal primary dopaminergic neurons and characterization of the KP therein

155 Chapter 6: KP in primary dopaminergic neurons

6.1 Introduction

6.1.1 Primary dopaminergic neurons in culture Because normal mature neurons do not generally divide and are thus not readily available for in vitro culturing, human neurons represent great challenges for the development of adequate in vitro model systems to study the pathomechanisms of neurodegeneration. These difficulties have led to the use of substitute cell types such as tumour cells, which express neuronal properties. Examples of such cell lines include PC12 cells, which were derived from a pheochromocytoma (Greene and Tischler, 1976), and SH- SY5Y cells, which were generated from a human neuroblastoma (Biedler et al., 1973). Ntera2 is a human teratocarcinoma cell line, which is easy to maintain and can be differentiated into a dopaminergic neuronal phenotype (Schwartz et al., 2005). Nevertheless, these cell types have genetic differences from normal cells, and physiologically differ from normal neurons in various respects, including the inability to generate synapses. Use of foetal midbrain neural precursor cells for the generation of dopaminergic cells has its limitations. Key problems include the increasing number of glial cells, and decreasing number of dopaminergic neurons over a short period of time in culture (Anderson et al., 2007, Chung et al., 2006, Kim et al., 2007a). Primary cell cultures derived from live brain, more accurately represent normal neurons, but can be inconsistent from batch to batch due to different age and medical history. Primary cultures of human neurons, and particularly human neurons with specific phenotypes such as dopaminergic neurons, are difficult to obtain. Yet, a significant amount of key PD- related findings and proof-of-principle clinical data were accumulated using primary tissue derived from the human foetal midbrain (Svendsen, 2008, Mendez et al., 2002). Most neurological studies are performed using primary human or animal neurons derived from brain or spinal cord. Primary cultures of nigral tissue are used for toxicity studies, transplantation and dopaminergic differentiation.

6.1.2 Aims The aims of this study are four-fold: 1) establish a reliable and reproducible procedure for isolation of human fetal dopaminergic neurons; 2) characterize a primary in vitro model using dopaminergic neuronal markers; 3) characterize KP enzyme expression occurring in normal versus inflammatory conditions in isolated primary human dopaminergic neurons; 4) quantify KP metabolites in normal versus inflammatory conditions in vitro.

156 Chapter 6: KP in primary dopaminergic neurons

6.1.3 Rationale for the characterisation of the KP in primary foetal human dopaminergic neurons It has been demonstrated several times that KP expression varies between different species and cell types (Heyes et al., 1997a, Heyes et al., 1997b). The KP is fully presented in CNS cells in microglia, macrophages and neurons, but only partially in astrocytes (Guillemin et al., 2001c, Guillemin et al., 2003b, Guillemin et al., 2007b). The results described for an in vitro dopaminergic model derived from a neuroblastoma cell line differ from similar results in the neuronal cell line, SK-N-SH (section 5.3.1 ) (Guillemin et al., 2007b). Furthermore, Guillemin et al. showed that KP is differentially expressed between a neuronal cell line and primary human foetal neurons (Guillemin et al., 2007b). Thus, it is important to characterize KP expression in every in vitro model. The link between the KP and PD pathogenesis is well established (section 2.4 ). PD is pathologically characterized by the loss of dopaminergic neurons (Gelb et al., 1999). Our laboratory has access to human foetal tissues and extensive experience in isolating different types of CNS cells, but not neurons with a specific dopaminergic phenotype. To our knowledge, KP enzymes and metabolites have never been characterized in primary human dopaminergic neurons.

6.1.4 Hypothesis We hypothesise that: 1) Primary foetal dopaminergic neurons can be isolated from human foetal brain reproducibly and be maintained in culture for further experiments. 2) Isolated cells will represent a very close and relevant model of dopaminergic neurons. 3) Treatment with INF-γ will activate KP metabolism in dopaminergic neurons.

157 Chapter 6: KP in primary dopaminergic neurons

6.2 Materials and methods

6.2.1 Isolation and culture of human foetal primary dopaminergic neurons

6.2.1.1 Materials DNAse I (Sigma-Aldrich) Foetal bovine serum (FBS) (Gibco, Invitrogen) Dulbecco’s modified eagle medium 11995 (DMEM) (Gibco Invitrogen) Glutamax (Gibco,Invitrogen) Penicillin/streptomycin (PS) (Gibco, Invitrogen) 5% trypsin EDTA 10X (Gibco, Invitrogen) Modified Eagle’s medium nonessential amino acids (NEAA) (Sigma-Aldrich) HEPES (Gibco, Invitrogen) PBS (Gibco, Invitrogen) Poly-D -Lysine (Sigma-Aldrich; MO, US) Trypsin inhibitor (Gibco, Invitrogen) Heraeus Multifuge 1 S (Thermo scientific)

6.2.1.2 Culture plate coating Poly-D-lysine was prepared at 50 μg/ml final concentration in sterile tissue culture grade H2O. The solution was well mixed. The culture plate surface was covered with poly-D- lysine solution and incubated at room temperature for 2 to 6 hours. After incubation, the solution was aspirated and the plate surface washed with sterile tissue culture grade H2O and

158 Chapter 6: KP in primary dopaminergic neurons dried in sterile conditions. Culture plates were stored at -4°C for up to 2 months. Before use the plates were warmed to 37°C inside the incubator.

6.2.1.3 Tissue isolation Human foetal brains were obtained from 16 to 19-week-old foetuses collected following therapeutic termination with informed consent. Only intact brains were used for isolation of the mid-brain region to allow accurate identification of the SN. All experiments and actions were approved by the institutional ethic committee (Approval number HREC 03187).

6.2.1.4 Isolation of human foetal dopaminergic neurons This procedure was adapted from another protocol for the isolation of rat primary foetal dopaminergic neurons with some modifications (Radad et al., 2004, Radad et al., 2008). The intact scalp was carefully dissected so as not to break the brain hemispheres. An intact hemisphere was placed in a Petri dish containing phosphate buffered saline (pH 7.2) for future manipulations. The mid-brain region was carefully removed and mechanically cut into small pieces in 1-2 ml of PBS (pH 7.2) using surgical disposable blades (Figure 6-1 a, b and c). Then dissected pieces were transferred by pipette into a sterile test tube containing 5 ml of 0.1 % trypsin (w/v) and 3 ml 0.03 % DNase I (v/v) in DPBS (Figure 6-1 d). The tube was incubated in a water bath at 37 °C for 7 min, shaken every minute. Then, 5 ml of trypsin inhibitor (0.125 mg/ml in DPBS) were added, the tissue was centrifuged at 52 g (Heraeus Multifuge 1 S) for 5 min and the supernatant was aspirated. The tissue pellet was triturated with a ﬁre-polished Pasteur pipette in 5 ml of DMEM containing 0.02 % (v/v) DNase I. Afterwards, the cells were passed through a 22μm cell strainer. Additional syringe dissociation was applied to the remaining tissue pieces before the strainer. Dissociated cells were collected in supplemented DMEM with HEPES buơer (25 mM), glucose (30 mM), glutamine (2 mM), penicillin–streptomycin (10 U/ml and 0.1 mg/ml, respectively) and heat inactivated foetal calf serum (FCS, 10% (v/v)). The cell suspension was plated into 6, 12 or 24 well culture dishes pre-coated with poly-D-lysine. Cultures were placed at 37 °C in an

atmosphere of 5% CO2 and 100% relative humidity. The medium was exchanged on the 1st day in vitro (DIV) and on the 3rd DIV. On the 5th DIV half of the medium was replaced with serum-free DMEM containing 0.02 ml B-27/ml and antibiotics. Serum-free supplemented DMEM was used for feeding from the 6th DIV and subsequently replaced every 2nd day.

159 Chapter 6: KP in primary dopaminergic neurons

6.2.1.5 Further changes to the protocol During the course of thestudy the protocol was modified for better performance. On the 2nd day in vitro (DIV), cells were treated with cytosine arabinoside (Ara C) at the final concentration of 1μM for 48 hours DMEM supplemented with B27 was changed to Neurobasal medium supplemented with the same amount of B27 (0.02 ml per 1ml of the medium), containing penicillin–streptomycin (10 U/ml and 0.1 mg/ml, respectively).

Figure 6-1: Mid-brain isolation procedure. a) Location of basal ganglia in the brain, b) region of dissection in human foetal brain, c) isolated basal ganglia pieces, d) mechanically dissected tissue in enzymatic solution (image of brain from Joel Jacobs Ph.D).

6.2.1.6 Culture of primary dopaminergic neurons The medium of isolated neurons was carefully exchanged on 1st and 3rd DIV, to remove debris. Between medium exchanges, the culture was carefully washed once with DMEM. On the 5th DIV half of the medium was replaced with serum-free DMEM medium containing 0.02 ml B-27/ml. Serum-free B-27 supplemented DMEM media was used for feeding from the 7th DIV and subsequently replaced every 2nd day. Cells were maintained in culture for up to 4 weeks.

160 Chapter 6: KP in primary dopaminergic neurons

6.2.2 Real-time RT-qPCR

6.2.2.1 Controls Human fetal brain and INF-γ induced macrophage cell line as described in sections 4.2.1.2 and 4.2.1.3

6.2.2.2 RNA isolation and cDNA preparation As described in section 3.1.4.2 3.1.4.3

6.2.2.3 RT-qPCR reaction As described in section 3.1.4.4

6.2.3 Immunocytochemistry As described in section 3.1.6

6.2.4 HPLC As described in section 3.1.8

6.2.5 GCMS As described in section 3.1.7

161 Chapter 6: KP in primary dopaminergic neurons

6.3 Results

6.3.1 Establishment of primary dopaminergic in vitro model for KP research

6.3.1.1 Protocol selection This culture system was chosen because it was demonstrated to successfully isolate foetal rat primary dopaminergic neurons on several occasions (Radad et al., 2010, Radad et al., 2004, Radad et al., 2006, Radad et al., 2008). Of the few studies implementing isolation of foetal dopaminergic neurons, many have taken a very complex experimental approach. Examples are cultures of neurons on an astrocyte monolayer, glial cell-conditioned media or a prolonged isolation process (Kaech et al., 2012, Fasano et al., 2008, Studer, 2001). As well as the simplicity of the procedure and suitability of the cultures for planned experiments, available equipment was also taken into account. Radad et al. have modified this system through several years to achieve better dissociation process and homogenous culture. The chosen protocol also employed Poly-D-Lysine coating, which enhances cell adhesion and protein absorption by altering surface charges on the culture substrate (Kim et al., 2011b). Both L- and D-isomers can be used for cell attachment, but the D-isomer is not degraded by proteases released by cells. This protocol was adapted for use in human neurons with some further modifications.

6.3.1.2 Elimination of non-neuronal cells from dopaminergic culture To support neuronal culture conditioned media is often used, however it contains specific growth factors and serum that may promote proliferation of non-neuronal dividing cells (Delree et al., 1989, Polazzi and Contestabile, 2003). Cytosine arabinoside (ARA C) is an antimitotic agent that eliminates dividing cells and is often used to eliminate non-neuronal cells for neuronal culture purification. Published experimental protocols suggest adding 5 to 20 μM of ARA C to the neuronal culture in every other medium exchange. (Delivopoulos and Murray, 2011, Watanabe et al., 2005) However, this antimitotic agent may be toxic to neurons by causing NGF deprivation, followed by neuronal death (Martin et al., 1990). In the procedure of dopaminergic neuron isolation, cultures were treated with ARA C at a concentration of 10 μM, 48 h after plating. It was described before that less, or no, toxic effect was observed when 10 μM of ARA C was added at 24 or 48 hours after plating, respectively (Leeds et al., 2005).

162 Chapter 6: KP in primary dopaminergic neurons

Neurobasal medium has been developed and optimised for survival of embryonic rat hippocampal neurons (Brewer et al., 1993). Later it was shown to support the growth of neurons from other regions of the brain (Brewer, 1995). The dopaminergic phenotype of cells derived from rat embryonic SN neurons was maintained over 2 weeks. Neurobasal medium does not contain glutamate, to avoid excitotoxicity and meets the standards for culturing embryonic neuronal cells (Brewer, 1994). It was shown to reduce glial growth to 0.5% of cultured cells, resulting in a nearly pure neuronal population (Brewer et al., 1993).

Figure 6-2: Isolated neurons grown in B27 supplemented DMEM or Neurobasal media with or without ARAC. Change of the growth medium from DMEM to Neurobasal enhanced the proportion of neuronal population in the culture. Near-pure neuronal cultures developed after ARA C treatment.

Figure 6-2 demonstrates isolated neurons grown in presence of different media or treatments. A variety of cells was clearly seen in cultures grown with B-27 supplemented DMEM: astrocytes were eliminated from culture over the time, however endothelial cells and fibroblasts was still present (Figure 6-3). Fibroblasts and endothelial cells were present when cultures grown with DMEM medium. However, the change to Neurobasal medium supplemented with ARA C allowed achieving pure neuronal culture. Microglia cells do not survive for a prolonged time in Neurobasal medium accompanied by low serum conditions (Saura, 2007, Brewer et al., 1993). This fact was confirmed by negative immunolabeling for

CD68, an antibody that is widely used as microglia’s marker (Figure 6-4) (Slepko and Levi, 1996). It is important to note that neuronal culture purity depends on sample quality but, for ethical reasons, it is impossible to associate the culture with the medical history of each patient.

163 Chapter 6: KP in primary dopaminergic neurons

Figure 6-3: Contamination of primary dopaminergic neuronal culture with other CNS cell types. CNS cell types are astrocytes, microglia, endothelial cells or fibroblast.

Figure 6-4: Isolated neurons from SN stained positively for TH and MAP2, but not microglial marker CD68.

6.3.1.3 Expression of neuronal markers in isolated human foetal dopaminergic neurons Isolated neurons cultured for 2 to 3 weeks were checked for dopaminergic neuronal markers, similarly to the in vitro model derived from neuroblastoma cell line (Figure 6-5). There was no significant difference in expression of DAT, however TH expression was significantly higher, when compared to a tissue sample from foetal SN. Expression of MAP2 was massively 6000-times up regulated in isolated neurons during the 2-3 week culturing period.

164 Chapter 6: KP in primary dopaminergic neurons

Figure 6-5: Relative expression of dopaminergic markers in isolated neurons and SN primary tissue. * - DA isolated neurons compared with SN tissue. MAP2 (p<0.001). TH (p<0.05).

Isolated neurons also labelled for dopaminergic markers by immunocytochemistry (Figure 6-6). All cells expressed MAP2 and β-tubulin class III, markers widely used as sensitive and specific markers for neural differentiation (Figure 6-7 and 6-8) (Matus et al., 1981). The majority or all neurons expressed TH protein, depending on the sample. However, only a small proportion of cells stained positively for NeuN.

165 Chapter 6: KP in primary dopaminergic neurons

Figure 6-6: Dopaminergic neurons isolated from SN are stained positively for β-tubulin III. The class III beta-tubulin is widely regarded as a neuronal marker during the development. Tubulin is the major building block of microtubules, thus may indicate active neurite extension. Day 15.

Figure 6-7: DA neurons isolated from SN stained positively for MAP2, NeuN and TH. Neuronal nuclear marker NeuN was expressed only in small proportion of dopaminergic neurons, unlike MAP2 or specific marker of dopaminergic neurons TH. Day 15.

166 Chapter 6: KP in primary dopaminergic neurons

Importantly, when neurons were isolated by the method practiced for general neurons isolation from random brain region, such as cortex, TH labelling was negative (Figure 6-8) (Braidy et al., 2009b). The growing pattern also appeared to be different, with dopaminergic neurons grouped together in clusters and the neurites connecting between cell bodies, forming a network (Figures 6-2, 6-5 and 6-6). While neuronal cultures derived from cortex, more resembled a monolayer growth (Figure 6-8).

Figure 6-8: Comparison in TH expression between neurons isolated from SN or cortex. Cell isolated from the cortex of human foetal brain, do not express dopaminergic specific marker TH, as neurons isolated directly from SN region.

6.3.1.4 NMDAR subunit expression NMDA receptor is one of the major types of glutamate receptors. The function of NMDAR depends on their subunit composition: a functional NMDA channel in vivo is known to be composed of a compulsory NR1 subunit together with either NR2 or NR3 subunits (Buller et al., 1994). The expression pattern of NMDAR subunits was reported to vary among different groups of neurons in different areas of rat basal ganglia (Standaert et al., 1994, Standaert et al., 1999). The relative expression of NMDAR subunits in dopaminergic neurons were assessed similar as in differentiated SH-SY5Y cells (Figure 6-9). Subunit expression levels in neurons

167 Chapter 6: KP in primary dopaminergic neurons and differentiated SH-SY5Y cells were compared to the expression of the same subunit in undifferentiated SH-SY5Y cells, which expressed all subunits at a steady low level (Figure 5- 2). Only NR2A and NR2B subunit expression was significantly higher in SN-isolated neurons than in undifferentiated SH-SY5Y control cells (p<0.001). Dopaminergic neurons expressed significantly lower levels of subunit NR3A, NR2C and NR2D transcripts (7 to 8- times lower), when compared with undifferentiated SH-SY5Y cells (p<0.005). Table 6-1 shows Ct values, which represent the amount of targeted cDNA in the sample, thus allowing a comparison of the starting amount of specific cDNA in the sample. Relative expression is based on the steady expression of a reference gene in the sample. There is an inverse relationship between Ct value and the amount of target cDNA, thus lower Ct values represent higher cDNA concentrations, which is true for the NR2A and NR2C subunits. It is important to note that Figure 6-9 represent relative expression and NR2C subunit expression appears to be low, because SH-SY5Y cells express it at even higher levels (the opposite correlation applies to the NR2B subunit).

Figure 6-9: Relative expression of NMDAR subunits in DA neurons isolated from SN compared with differentiated and undifferentiated SH-SY5Y cells. * - subunit expression in control SH-SY5Y is significantly higher than DA neurons (p<0.05). # - subunit expression in DA neurons is significantly than in control SH-SY5Y (p<0.005)

Subunit Reference NR2A NR3A NR2B NR2C NR2D type gene Neurons isolated 22.92±0.11 28.43±0.14 25.88±0.19 19.97±0.16 25.54±0.05 26.85±0.03 from SN Table 6-1: Expression levels (Ct values) of NMDAR subunits and reference gene in dopaminergic neurons isolated from SN.

168 Chapter 6: KP in primary dopaminergic neurons

6.3.2 KP characterisation in primary dopaminergic in vitro model

6.3.2.1 Gene expression of KP enzymes in dopaminergic neurons Neurons isolated from SN and grown in culture for 15 to 22 days were treated with INF-γ for 24, 48 and 72 hours to mimic inflammation conditions and activate KP. The expression of KP enzymes was measured in INF-γ-stimulated and non-stimulated cells to examine the dynamics of KP activation. IDO1 and IDO2 expression in INF-γ stimulated neurons was significantly up regulated at 24, 48 and 72 hours (Figure 6-10) (p<0.001). Notably, IDO1 expression in stimulated cells increased about 3200-times, while IDO2 expression 8-times, compared to control neurons at 24h. Expression levels of TDO2 and AFMID did not vary significantly at any time between INF-γ-stimulated and non-stimulated neurons.

Figure 6-10: Relative expression of IDO1, IDO2, TDO2 and AFMID in DA isolated neurons stimulated or not with INF-γ, at 24, 48 and 72 hours. IDO1 and IDO2 were significantly up regulated in INF-γ-induced cells, indicating a massive KP activation.

Among the group of enzymes responsible for KYNA synthesis only KAT3 was significantly up regulated at 24 and 48 hours in stimulated neurons, however the degree of up regulation very low (Figure 6-11). Expression levels of GOT2/KAT4 were not affected by treatments and time course. KAT2 and KAT3 enzyme expression was slightly, but not

169 Chapter 6: KP in primary dopaminergic neurons significantly, down regulated. KAT2 expression at 48 hours reached a low, but significant, degree of up regulation.

Figure 6-11: Relative expression of KAT1, KAT2, KAT3 and GOT2 in DA isolated neurons stimulated or not with INF-γ, at 24, 48 and 72 hours.

INF-γ simulation induce elevated expression of all 3 enzymes that eventually lead to NAD production, however only KMO at 24 h and KYNU at 24 and 72 hours were significantly higher than non-stimulated cells at the same time (p<0.005) (Figure 6-12). KYNU expression in control cells at 24 hours was significantly higher than at 48 h (p<0.05). HAAO expression did not change with time or INF-γ treatment.

170 Chapter 6: KP in primary dopaminergic neurons

Figure 6-12: Relative expression of KMO, KYNU and 3HAAO in DA isolated neurons stimulated or not with INF-γ, at 24, 48 and 72 hours.

ACMSD, the enzyme synthesising neuroprotective PIC, was significantly down regulated at 24 and 48 hours in INF-γ-treated cell, compared to non-stimulated cells (p<0.05). ACMSD expression in stimulated neurons did not change over 72 hours (Figure 6-13). The expression of QPRT in the presence of INF-γ did not vary compared to control neurons, however its expression in both control and stimulated neurons was significantly higher at 72 hours than in 48 hours (p<0.05) (Figure 6-13).

Figure 6-13: Relative expression of ACMSD and QPRT in DA isolated neurons stimulated or not with INF- γ, at 24, 48 and 72 hours.

When examining the expression of enzymes regulating serotonin production, TPH1 and TPH2 expression remained at the same levels in neurons induced with INF-γ during the 72 hours course. TPH1 expression in stimulated cells was significantly higher than in control cells at 48 h (p<0.05), but rose significantly at 72 hours in control cells (p<0.05) (Figure 6- 14). TPH2 expression in control cells was also significantly up regulated in control, compared with INF-γ treated neurons (p<0.05) (Figure 6-14). MAOA and MAOB expression was generally down regulated in stimulated neurons, compared with control, demonstrating a

171 Chapter 6: KP in primary dopaminergic neurons rising expression pattern along the 72 hours’ time course for non-stimulated cells and decreased for INF-γ-stimulated cells (Figure 6-14).

Figure 6-14: Relative expression of TPH1, TPH2, MAOA and MAOB in DA isolated neurons stimulated or not with INF-γ, at 24, 48 and 72 .

6.3.2.2 Quantification of KP metabolites TRP, KYN and KYNA concentrations were measured by HPLC (section 3.1.8 ). Amounts of TRP and KYN in the growth medium were 73.4±3.83 μM and 1.62±0.14 μM respectively. Both INF-γ-stimulated and non-stimulated cells catabolised TRP from the growth medium, while amounts consumed by stimulated neurons were significantly higher than in control cells (Figure 6-15). TRP was consumed by stimulated neurons at the same rate during 72 hours’ time course: 20.36±4.47 (24 h), 20.4±2.03 (48 h) and 23.19±3.70 μM (72 h). At the same time, neurons catabolising TRP secrete KYN into the medium. Both stimulated and non-stimulated cells release KYN into the growth medium; however, INF-γ-

172 Chapter 6: KP in primary dopaminergic neurons stimulated neurons significantly elevated KYN concentrations in the media, by 10.35±1.41, 25.21±2.43 and 35.7±4.79 μM at 24, 48 and 72 hours respectively (Figure 6-16). Figure 6-17 shows the degree of KP activation in terms of the KYN/TRP ratio: while KP in non-stimulated neurons was always at the same low level, the INF-γ resulted in a substantial 10-times KP activation at 24 hours, which increases every 24 hours and was significantly higher than in control neurons (p<0.01). The KP activation is calculated as the ratio between KYN concentration / TRP concentration in the sample’s supernatant (not corrected with the concentrations of metabolites initially presented in the growth medium).

Figure 6-15: TRP catabolism in DA isolated neurons stimulated or not with INF-γ, at 24, 48 and 72 hours. *- INF-γ stimulated neurons compared with control at 24, 48 and 72 h (p<0.05)

Figure 6-16: KYN metabolism in DA isolated neurons stimulated or not with INF-γ, at 24, 48 and 72 hours. *- INF-γ stimulated neurons compared with control at 24, 48 and 72 h (p<0.01)

173 Chapter 6: KP in primary dopaminergic neurons

Figure 6-17: KP activation in DA isolated neurons stimulated (red) or non-stimulated (blue) with INF-γ, at 24, 48 and 72 hours. High KYN/TRP ratio indicates enhanced TRP degradation and greater capacity of KP to produce KYN from TRP. The ratio provides an estimate on IDO1 activation, a first rate-limiting KP enzyme. *- INF-γ stimulated neurons 24 h compared with control at 24 (p<0.05). #- INF-γ stimulated neurons 72 h compared with control at 24 (p<0.05). &- INF-γ stimulated neurons 72 h compared with control at 48 (p<0.05)

Production of neuroprotective metabolite KYNA was stimulated in the presence of INF-γ. In stimulated neurons KYNA concentrations in the growth medium achieving 5.75±1.24, 63.51±9.26 and 71.67±11.44 nM, compared with 0, 5.38±2.17 and 2.94±0.72 nM at 24, 48 and 72 hours respectively (Figure 6-18). KYNA concentration in the growth medium itself was not detectable.

Figure 6-18: KYNA metabolism in DA isolated neurons stimulated or not with INF-γ, at 24, 48 and 72 hours. *- INF-γ stimulated neurons compared with control at 24 h (p<0.05). # - INF-γ stimulated neurons compared with control at 48, 72 h (p<0.01). &- INF-γ stimulated neurons 48 h compared with INF-γ stimulated neurons at 24 h (p<0.01).

174 Chapter 6: KP in primary dopaminergic neurons

PIC, QUIN and QA were quantified in culture media of growing neurons by GC/MS. Concentrations of PIC and QUIN in the media were 25.84±3.65 and 237.39±42 nM respectively, QA concentration was not detectable. All neurons produced neuroprotective PIC into the media, while INF-γ-stimulated cells produced slightly higher amounts at 24 and 72 hours, and significantly higher at 48 hours (p<0.05), when compared with unstimulated neurons. INF-γ-stimulation increased PIC concentrations by 25.24±5.82, 33.52±2.38 and 35.38±30 nM, compared with control neurons 14.54±5.49, 7.29±2.50 and 31.18±1.48 nM, at 24, 48 and 72 hours respectively (Figure 6-19). Neurons at all times and treatments consumed QUIN from the growth medium, with except stimulated neurons at 72 hours, which secreted a small and highly variable amount of QUIN into the medium: 29.31±33 nM. Notably, utilization rate of QUIN by INF-γ-stimulated neurons from the medium decreased over 72 hours, but remained the same in non-stimulated cells (Figure 6-20). At 48 and 72 hours, INF-γ-stimulated neurons produced significantly higher amounts of QA into the growth medium: 47.45±10.10 and 12.31±0.72, compared with 0.42±0.99 and 6.7±0.88, respectively. QA concentrations secreted by neurons at 24 h did not vary between treatments (Figure 6-21).

Figure 6-19: PIC in DA isolated neurons stimulated or not with INF-γ, at 24, 48 and 72 hours. *- INF-γ stimulated neurons compared with control at 48 h (p<0.05).

175 Chapter 6: KP in primary dopaminergic neurons

Figure 6-20: QUIN in DA isolated neurons stimulated or not with INF-γ, at 24, 48 and 72 hours. *- INF-γ stimulated neurons 24 h compared with INF-γ stimulated neurons at 48 h (p<0.05). # - control neurons compared with INF-γ stimulated neurons at 48 h (p<0.05).

Figure 6-21: QA in DA isolated neurons stimulated or not with INF-γ, at 24, 48 and 72 hours. *- INF-γ stimulated neurons compared with control at 48 h (p<0.01). # - INF-γ stimulated neurons compared with control at 72 h (p<0.05).

176 Chapter 6: KP in primary dopaminergic neurons

6.4 Discussion

6.4.1 Primary in vitro model of human dopaminergic neurons derived from foetal brain Neurons are highly varied in characteristics depending on their age, location, and function in the brain, but commonly do not proliferate, making cell culture quite difficult. Several protocols for isolation of rat dopaminergic neurons have been established to produce consistent, pure, active neuronal cultures (Pruszak et al., 2009, Michel et al., 1992, Imamura et al., 2007). Neurons are usually isolated from embryonic or early postnatal animals. Difficulties in the isolation process include: 1) low neuronal yield, since most neurons perish during the procedure; 2) removal of non-neuronal cells to prevent overgrowth by glial cells. In an earlier study, Radad et al. used an isolation protocol that had been established for several years for use in toxicology studies, however it was designed for rat neurons (Radad et al., 2004, Radad et al., 2008, Radad et al., 2010, Radad et al., 2007). By slight modification to this protocol, we could isolate dopaminergic primary neurons from human foetal brain and maintain them up to 4 weeks in culture exhibiting all neuronal morphological properties (Figure 6-22). Long–term culture of primary isolated neurons for one year has been described before (Potter and DeMarse, 2001). Our procedure involves minimal manipulations with neurons and lasts about 30 to 40 min, compared with other more sophisticated protocols (Studer, 2001, Fasano et al., 2008).

Figure 6-22: Morphology of dopaminergic primary neurons isolated from human foetal brain. Almost pure dopaminergic neuronal culture can be obtained from human foetal brain SN. Neurons are maintained in culture for up to 4 weeks, which is sufficient for most in vitro experiments. Neurons on the image are 20 days in culture.

Dopaminergic neurons are compartmentalized into anatomically and functionally distinct groups in the CNS and SN dopaminergic neurons are implicated in playing a major role in PD (Prakash and Wurst, 2006). Ventral tegmental area (VTA) dopaminergic neurons

177 Chapter 6: KP in primary dopaminergic neurons are much less affected in PD, however are suggested to play a role in neuroprotection (Dawson et al., 2002). Figure 6-23 demonstrates that the region isolated by the current protocol is very likely to include isolation of VTA dopaminergic neurons, which makes our model even more suitable for studying the neuroprotective effect of the KP on PD pathogenesis (Greene, 2006).

Figure 6-23: Approximate location of VTA and SN in the human foetal brain. Schematic brain image from(Psarros et al., 2003).

Isolated neurons express dopaminergic markers MAP2 and TH in very high levels compared with tissue sample from SN. Profound MAP2 expression correlates well with morphological observation of intense neurite extension. With time in culture, cells adhere to the surface and elongate their neuritis. High MAP2 and TH expression in total RNA from SN- isolated neurons, but not in SN tissue sample, indicates that the culture mainly consists of dopaminergic neurons. MAP2 and β-tubulin class III, cytoskeletal proteins, have been associated before with neuronal differentiation and used as its indicators (Qian and Yang, 2009, Paganoni and Ferreira, 2005, Ida et al., 2004). TH and DAT are specific markers for dopaminergic neurons, however DAT expression was not up regulated as expected after isolation. Several studies suggest postnatal development of DAT in rats, while the majority of transporter sites appear after postnatal day 15 (Coulter et al., 1997, Coulter et al., 1995). DAT has a different expression pattern in different brain areas during brain development (Coulter et al., 1995). However, based on previous studies with human PD cases, the number and implication of DAT positive neurons appears to be largely overestimated (Porritt et al., 2000). Isolated neurons stained positively for NeuN, but a number of TH positive neurons had very faint, or no, NeuN expression. These results perfectly correlate with similar findings in the

178 Chapter 6: KP in primary dopaminergic neurons rat, where NeuN was described as non-reliable neuronal marker for identification of dopamine neurons in SN (Cannon and Greenamyre, 2009). NMDA expression in the basal ganglia is an important step for neuronal maturation and closely tied with its function (Chen et al., 1999, Lau et al., 2003). However, expression of NMDA subunits specifically by dopaminergic neurons of SN is less known. The NR1 subunit is ubiquitously expressed in the CNS, it has a glycine binding site and is essential for NMDAR function. It was described to be expressed in higher levels in monkey SN than in other areas and to be the most abundant subunit in human SN (Paquet et al., 1997) (Mueller et al., 2004). NR2 subunits determine the biophysiological properties of the ion channel, and during embryonic development specific CNS regions have a different expression pattern of NMDAR subunits (Monyer et al., 1994). The NR2B subunit was over expressed in isolated human dopaminergic primary neurons compared to neuroblastoma cell line (Figure 6-9). Neonatal dopaminergic neurons isolated from rat brain also expressed NR2B, however NMDAR was not functional in the culture (Lui et al., 2003). NR2B and NR2D subunits were found prenatally in the rat brain (Sheng et al., 1994). A number of studies have shown that NR1/NR2B receptors are involved in excitotoxic mechanisms triggered by glutamate in the brain (Menniti et al., 1997, Reyes et al., 1998). We showed that transcripts of all NR2 and NR3 subunits are expressed in human embryonic neurons isolated from SN. NR2A and NR2C transcripts are present in higher concentrations than others, and these two subunits were reported to be first detected around birth in rats (Table 6-1) (Sheng et al., 1994). The xpression level of NR3A in isolated neurons suggests it is the last abundant among the subunits (Table 6-1). Its expression was reported to drop dramatically two weeks after birth in rat brain. Our data, taken together with findings from rat prenatal and neonatal brain, suggest that embryonic human dopaminergic neurons mature faster than rat ones. However, while all subunit transcripts for functional NMDAR are present, its functionality still needs to be proved by ion permeability, for instance. In contrast to our results, it was reported that NR2A and NR2B subunits are expressed in low levels in human adult brain (Counihan et al., 1998). Additional studies on NMDAR maturation in human neurons, in particular dopaminergic, will reveal if neurons isolated from human foetal brain could become a good model for mature dopaminergic neurons, as ones affected in PD pathogenesis.

179 Chapter 6: KP in primary dopaminergic neurons

6.4.2 Characterization of KP in primary in vitro model of human foetal dopaminergic neurons As previously described by Guillemin et al. primary neurons express the KP differently to a neuroblastoma cell line (Guillemin et al., 2007b). Here, we characterised the KP in human primary dopaminergic neurons isolated from foetal SN. All KP enzymes were expressed at some level in dopaminergic foetal neurons, stimulated or not by INF-γ. The presence of inflammatory conditions induced by INF-γ, the expression of IDO1 and IDO2 significantly rose (Figure 6-10). IDO1 induction by INF-γ was described in human neurons before, but not that of IDO2 (Guillemin et al., 2007b). Moreover, IDO2 was shown not to be influenced by INF-γ in human stromal cells (Maiwald et al., 2011). Levels of TRP required for IDO2 induction in vitro were reported to be too high to match physiologically relevant levels (Ball et al., 2009). However, TRP level measured in the Neuroblastoma growth medium was 73 μM, while TRP physiological level in human plasma are estimated to be 40-90 μM (Werner et al., 1988, Forrest et al., 2006). Our study shows that the KP is activated by induction of both IDO1 and IDO2 enzymes, while expression levels of TDO2 and AFMID do not change (Figure 6-17). Along with activation of the KP and TRP catabolised by neurons from the media, KYN concentration are shown to increase with INF-γ treatment and time course compared with untreated neurons (Figures 6-15 and 6-16). Expression of KAT enzymes, which activate the neuroprotective branch of KP, did not vary dramatically. Only KAT3 expression was significantly up regulated in INF-γ- stimulated cells at 24 and 48 hours, while KAT2 expression was down regulated at 48 hours (Figure 6-11). It previously was reported that KAT1, KAT2 and KAT 4 are down regulated during neuronal differentiation in human hippocampal progenitor cells (Asp et al., 2011). When the KAT family was characterized in human neurons, INF-γ did not have any significant effect on its expression (Guillemin et al., 2007b). In contrast, production of neuroprotective KYNA was greatly increased following INF-γ, similarly to the observations of Guillemin et al. (Figure 6-18) (Guillemin et al., 2007b). KAT2 was reported to be responsible for most of the rapid KYNA formation in rat brain (Amori et al., 2009). However, little is known about specific biochemical activity of KAT3, moreover it may vary between different species (Han et al., 2009, Guidetti et al., 2007) . Enzymes acting along the neurotoxic branch of KP were up regulated in the presence of INF-γ, while 3HAAO induction was not significantly higher than in control cells (Figure 6-12). KMO and KYNU expression significantly rose either at 24 or 48 hours, similar to human hippocampal progenitor cells, but in contrast with previous observations in human

180 Chapter 6: KP in primary dopaminergic neurons neurons (Guillemin et al., 2007b, Asp et al., 2011). Despite inflammatory activation of this branch of the KP, it did not lead to neurotoxic QUIN accumulation or up regulation QPRT, an enzyme that catabolise QUIN towards NAD production (Figures 6-13 and 6-20). QUIN consumption by neurons decreased during the time course and, at 72 hours, occasional low (highly variable) QUIN production was detected (Figure 6-20). This observation argues the concept that human neurons unable to produce QUIN (Guillemin et al., 2007b). However, QUIN could be produced by occasional microglial contamination of the neuronal culture, thus explaining the highly variable nature of this outcome (Guillemin and Brew, 2004). ACMSD expression was down-regulated following INF-γ treatment at 24 and 48 hours, as described in human neurons (Guillemin et al., 2007b). However, neuroprotective PIC production by this enzyme, under the same conditions, was increased at 48 hours, compared to control (Figure 6-19). MAOA and MAOB enzymes participating in serotonin catabolism are down regulated in the presence of INF-γ, while TPH1 expression is increased, suggesting serotonin accumulation in inflammatory conditions (Figure 6-14). Furthermore, increased production of QA at 48 h by stimulated dopaminergic neurons may suggest a neuroprotective mechanism through excessive serotonin formation (Figure 6-21) (section 5.4.2 ). A KP activation scheme in primary dopaminergic neurons isolated from foetal SN is presented in Figure 6-24. Despite increased activation of KMO and KYNU leading to production of toxic 3-HK and 3-HAAO, neuroprotective branches are activated as well, leading to the production of KYNA and PIC. Very little is known about QA synthesis and mechanism of action, nevertheless - relying on little evidence and given the fact that QA is KYNA derivative - we speculate that QA is involved in neuronal self-protection initiated in inflammatory conditions, as in PD (section 2.4.2 and 5.4.2 ).

181 Chapter 6: KP in primary dopaminergic neurons

Figure 6-24: Schematic diagram of KP activation induced by INF-γ in human dopaminergic cells isolated from foetal SN. KP is highly activated in dopaminergic neurons isolated from human foetal SN following INF-γ-induced inflammation. The rate-limiting enzyme IDO1 is highly upregulated and it leads to the production of neuroprotective KP metabolites KYNA, PIC and QA, but not toxic QUIN. KP activation also causes serotonin depletion. Red colour indicates changes occurring in the presence of INF-γ. Results are based on 24 and 48 hours culture observations.

182 Chapter 7: Quinolinic acid toxicity.

Chapter 7 : Quinolinic acid toxicity

183 Chapter 7: Quinolinic acid toxicity.

7.1 Introduction

7.1.1 QUIN toxicity in human neurons Quinolinic acid (QUIN) is an NMDA receptor agonist that is commonly used to model excitotoxicity in neurodegenerative diseases (Piani et al., 1992, Chao et al., 1995). The mechanisms of QUIN toxicity are widely described in the literature, and associated with AIDS dementia complex, Huntington disease, autism, Alzheimer’s disease, PD and others (section 2.3.1.2 ) (Guillemin and Brew, 2002a, Guillemin et al., 2005a, Estrada Sanchez et al., 2008, Muller et al., 2009, Guillemin, 2012). The main source of QUIN in human brain is reactive microglia and infiltrating macrophages, which are highly activated in PD and considered to be the activator the dopaminergic neuron degeneration process (Figure 2-12) (Gelb et al., 1999, Lee et al., 2010, Zadori et al., 2012). Several mechanisms of QUIN’s toxic effect in human neurons have been described (Guillemin, 2012). Intrastriatal administration of QUIN in rats produced significant behavioural changes (Kalonia et al., 2009). QUIN has been suggested to play a major cytotoxic role in the pathogenesis of neuronal damage, as a contributor to neuroinflammation (Vamos et al., 2009). QUIN induces not only cell death, but also damage to axons and dendrites (Kells et al., 2008, Kerr et al., 1998). The cytoskeleton plays a key role in maintaining the neuronal cell shape and is essential for its normal functions, such as neurite outgrowth, synapse formation, and internal transport of various molecules. Several neurodegenerative diseases, including PD, are characterized by abnormal cytoskeletal assembly and, as a consequence, impairment of neurotransmission (Benitez-King et al., 2004). Decreased expression of cytoskeletal proteins was found, particularly in, SN of PD patients (Simunovic et al., 2009) and may be related to QUIN.

7.1.2 Aims The aims of this study are two-fold: 1) Examine QUIN toxicity on human dopaminergic neurons; 2) Compare the vulnerability to QUIN toxicity of the two in vitro models of dopaminergic neurons.

184 Chapter 7: Quinolinic acid toxicity.

7.1.3 Rationale Cytotoxicity of QUIN has been examined previously in a mouse motor neuron cell line, and human foetal neurons and astrocytes (Braidy et al., 2009a, Chen et al., 2009). However, KP expression varies in different species and cell types (Heyes et al., 1997a, Heyes et al., 1997b). Thus, the self-protective response of different types of neurons to QUIN may also be different. This study will provide the final step in the assessment of two established in vitro models of dopaminergic neurons. Live imaging studies in the presence of QUIN will demonstrate that dopaminergic neurons are vulnerable to QUIN toxicity.

7.1.4 Hypothesis The hypotheses are that: 1) Dopaminergic neurons are highly sensitive to QUIN excitotoxicity. 2) QUIN not only causes death in dopaminergic neurons, but also affects neurite outgrowth.

185 Chapter 7: Quinolinic acid toxicity.

7.2 Materials and methods

7.2.1 Isolation and culture of human foetal primary dopaminergic neurons

7.2.1.1 Materials DNAse I (Sigma-Aldrich) Foetal bovine serum (FBS) (Gibco, Ivitrogen) Dulbecco’s modified eagle medium 11995 (DMEM) (Gibco, Ivitrogen) Glutamax (Gibco, Ivitrogen) penicillin/streptomycin (PS) (Gibco, Ivitrogen) 5% trypsin EDTA 10X (Gibco, Ivitrogen) Modified Eagle’s medium nonessential amino acids (NEAA) (Sigma-Aldrich) HEPES (Gibco, Ivitrogen) PBS (Gibco, Ivitrogen) Poly-D -Lysine (Sigma-Aldrich) Trypsin inhibitor (Gibco, Ivitrogen)

Heraeus HERAcell CO2 incubator (Fisher) Tissue culture plates (BD Biosciences) Tissue culture flask (BD Biosciences) Dissection tools: small and medium-size scissors, Iris tissue forceps and Dumont no.5 forceps. 19 G needles attached to 5/10ml syringe 10/20 cm tissue culture dishes (Falcon) 22 μm cell strainer (Falcon) 15/50 ml conical-bottom tubes (Falcon) 96 well plates for Microplate reader Microplate reader (Bio-Rad)) Radioimmune precipitation assay (RIPA) buffer (Sigma-Aldrich) Lactate dehydrogenase (LDH) assay kit (Promega) Bicinchoninic acid (BCA) protein assay kit (Piercenet) Glass bottom tissue culture dishes (FluoroDish) Nikon Eclipse Ti-E14 (Nikon Inc.)

186 Chapter 7: Quinolinic acid toxicity.

7.2.1.2 Cell cultures SH-SY5Y cells were differentiated and cultured as described in section 5.2.1.7 . Primary dopaminergic neurons were isolated and cultured as described in section 6.2.1.4 .

7.2.1.3 QUIN toxicity induction For LDH assay, SH-SY5Y cells were differentiated with modified protocol number 3 (section 5.2.1.7 ) in 24-well plates. Afterwards, cells were treated with 0.1 - 2 μM of QUIN in the growth medium for 24, 48 and 72 hours. For live cell imaging SH-SY5Y cells were differentiated in FluoroDish. Primary human dopaminergic foetal neurons were isolated and plated in FluoroDish dishes coated with Poly-D-Lysine (section 6.2.1.2 ). Cell homogenates and culture supernatants were collected after 24, 48 and 72 hours. Experiments were performed in triplicate.

7.2.1.4 Extracellular LDH activity as a measurement of cytotoxicity The release of lactate dehydrogenase (LDH) into culture supernatant correlates with the amount of cell death and membrane damage, providing an accurate measure of cellular toxicity. LDH activity was assayed using a standard spectrophotometric technique as described before (Koh and Choi, 1987). The rate of absorbance reduction was measured using the Microplate reader (Bio-Rad).

7.2.1.5 BCA Protein Assay for the Quantification of Total Protein The protein amounts in each well were determined by bicinchoninic acid protein (BCA, Piercenet) assay according to the manufacturer’s protocol using bovine serum albumin as a standard (Smith et al., 1985). Radioimmune precipitation assay (RIPA) buffer was used for lysis and protein extraction from the cells, as recommended for mammalian cells (by the manufacturer). The tissue samples were homogenized in RIPA buffer (Sigma) for correlation of QUIN toxicity results. RIPA buffer enables efficient cell lysis and protein solubilisation while avoiding protein degradation and interference with immunoreactivity. This buffer was supplemented with a protease inhibitor cocktail (Sigma) containing 104 mM 4-(2- Aminoethyl) benzenesulfonyl fluoride hydrochloride (AEBSF). After 15 min incubation on ice, the extracts were clarified by centrifugation at 15,000 g for 15 min at 4°C and stored at - 20°C.

187 Chapter 7: Quinolinic acid toxicity.

The protein levels were determined by measuring the absorbance at 562 nm using the Microplate reader (Bio-Rad). Protein concentrations were calculated using internal albumin standards supplied with a kit. The amount of LDH produced was then calculated as a ratio of the amount of protein in the well.

7.2.1.6 Live cells real-time imaging An inverted microscope was used for live cell imaging in bright field (Nikon Eclipse Ti-E14, Nikon Inc., Japan). The cells are kept alive during visualization incubated within a

chamber heated to 37°C and 5 % CO2. Focal drift is prevented by the Perfect Focus System. Cells growing in two culture dishes were filmed at the same time. 6 to 8 images were taken at two randomly chosen areas every 5 min during a 10-12 hours period (n=1). Then images were tiled together by Nikon NIS Elements interface system to create a large field, high resolution series of images. Lower limit light intensity of mercury lamp was used in a dark room, to prevent bright light cell damage. It causes the images to be darkn, but allows prolong experiments. For quantification of neurite extension, the NeuroJ plug-in for the public access software ImageJ was used (NIH, Bethesda, MD, USA). By using an Intensity-tracing algorithm, the NeuroJ plug-in is able to recognize and accurately trace the neurite, when the programme’s user have only to identify the beginning and the end of the neurite (Figure 7-1) (Meijering et al., 2004). It allows rapid quantification neurite length in pixels.

188 Chapter 7: Quinolinic acid toxicity.

7.2.1.7

Figure 7-1: Process of neurites quantification by ImageJ. dSH-SY5Y cells The image shows neurons (pink) by a semi-automatic neurite tracing technique (NeuroJ plug-in). The user has to identify the beginning (point 1) and the end (point 2) of the neurite, then the program is able accurately to identify and measure its length.

189 Chapter 7: Quinolinic acid toxicity.

7.3 Results

7.3.1 QUIN toxicity in dopaminergic in vitro model derived from neuroblastoma cell line SH-SY5Y cells differentiated by modified protocol number 3, as described in section 5.2.1.7 , were incubated with varying concentrations of QUIN for 24, 48 and 72 hours (Figures 7-2 and 7-3). The QUIN concentration range was determined based on numerous evidence from the literature about its’ toxic effect on neurons (Guillemin, 2012, Guillemin and Brew, 2002b). For example, QUIN concentration, as low as 60nM, caused death of SN dopaminergic dopaminergic neurons within 24 hours (Miranda et al., 1999). Abnormally high QUINS concentrations (>150 nM) were shown to cause neuronal inflammation and further nitric oxide-stimulated oxidative stress (Braidy et al., 2009a). Concentration range 1-4 μM had a maximal toxic effect on motor neurons in culture (Chen et al., 2011). QUIN concentrations of 2 to 4 μM caused cell death, dependant on incubation time of 24 and 48 hours (Figure 7-2). Cell death caused by toxicity at 72 hours, was linearly dependent on the QUIN concentration (Figure 7-4).

Figure 7-2: Neurotoxicity of QUIN on dSH-SY5Y cells at 24 and 48 hours. *- LDH release at cells treated with 2 μM QUIN was significantly higher than in control cells (0 μM QUIN) 24h (p<0.05). #- LDH release at cells treated with 2 μM QUIN was significantly higher than in control cells (0 μM QUIN) 48h (p<0.05). %- LDH release at cells treated with 4 μM QUIN was significantly higher than in cells treated with 2 μM QUIN 48 h (p<0.01). #- LDH release at cells treated with 4 μM QUIN 48 h was significantly higher than in cells treated with 4 μM QUIN 24 h (p<0.05).

190 Chapter 7: Quinolinic acid toxicity.

Figure 7-3: Neurotoxicity of QUIN on dSH-SY5Y cells at 72 hours. LDH release at cells treated with all QUIN concentrations at 72 h was significantly higher than in cells treated with QUIN at 24 and 48 h (p<0.001).

7.3.2 Neurodegeneration assessment by neurite extension analysis Dopaminergic neurons from both in vitro models were real-time imaged for 12 hours with or without 2 μM QUIN. QUIN was administered 3 hours before the start of the experiment. Dopaminergic neurons derived from human foetal SN had a greater number of neurites at the beginning of the experiment than did the neuroblastoma cell line derived model (Figures 7-4 and 7-5). Control differentiated SH-SY5Y cells developed more extensions than QUIN-treated cells (Figure 7-4). However, the average extension length stayed at the similar levels throughout the experiment in control and QUIN-treated cells. Moreover, the average length of the extensions in neuroblastoma derived dopaminergic neurons increased at 10-11 hours. Based on morphological observations in both in vitro models, neurons affected by QUIN toxicity stoped developing new short neurites, cell bodies shrank, but long neurites already developed thinned and gradually broke, but remained in culture for a longer time than new extensions (Figure 7-6). Yet, control neurons differentiated from SH-SY5Y developed new short neurites during all experiments that prolonged, keeping the average length about the same. Dopaminergic neurons isolated from foetal SN not treated with QUIN have a greater number of existing and newly formed extensions while, increasing the average length (Figure 7-5). QUIN-treated primary neurons prolonged neurites during the first 3 hours of the experiment, then maintaining its number and length, without creating new

191 Chapter 7: Quinolinic acid toxicity. ones (Figure 7-5). At the end of the experiment, the number of extensions and average lengths decreased in all types of neurons and treatments. This occurs due to cell damage caused by worsening conditions and bright light exposure during imaging.

Figure 7-4: Live imaging of dopaminergic neurons derived from neuroblastoma cell line in the presence of QUIN. 2 μM of QUIN was administered 3 h prior to the imaging. Number and length of the extensions were measured (n=1).

Figure 7-5: Live imaging of dopaminergic neurons isolated from human foetal brain in presence of QUIN. 2 μM of QUIN was administered 3 h prior to the imaging. Number and length of the extensions were measured (n=1).

192 Chapter 7: Quinolinic acid toxicity.

Figure 7-6: Live imaging of dopaminergic neurons isolated from human foetal brain in the presence of QUIN. Neurons cell bodies shrank with time, the number of extensions decrease, long neurites remained in the culture despite the damage caused.

193 Chapter 7: Quinolinic acid toxicity.

7.4 Discussion QUIN is an endogenous brain excitotoxin and NMDA agonist, and probably the most extensively studied metabolite of the KP (Guillemin, 2012). In the brain large amounts of QUIN are produced and secreted by activated microglia (Guillemin et al., 2003b). Activated microglia cells were detected in the SN of PD patients and the QUIN amount correlated with the severity of motor symptoms (Ouchi et al., 2005). Human neurons do not produce QUIN, as was demonstrated in a study by Guillemin et al. and confirmed here with dopaminergic neurons (sections 5.3.3.3 and 6.3.2.2 ) (Guillemin et al., 2007b). In normal gerbils’ brain QUIN levels were 110 nM and 130 pmol/g , accessed via the extracellular fluid and tissue homogenate, respectively . During CNS inflammation QUIN levels increases in brain homogenate (246-fold) and ECF (66-fold), mostly due the increase in local QUIN’s synthesis rate (Beagles et al., 1998). Human neurons in pathophysiological conditions can catabolise high micromolar concentrations of QUIN from the environment and accumulate it in

vacuoles due to the low catabolic activity of the degrading enzyme QPRT (Guillemin et al., 2005b, Guillemin, 2012). QPRT activity begins to be saturated at QUIN concentrations higher than 300 nM (Rahman et al., 2009b). Both dopaminergic in vitro models can catabolise some of the QUIN from the media and express low levels of QPRT enzyme in inflammatory conditions (sections 5.3.3.2 6.3.2.1 ), confirming the lower activity of the metabolising enzyme. Increasing QUIN concentrations induced neuronal cell death (Figures 7-2 and 7-3). Due to limited availability of foetal tissue, only results for the in vitro model derived from the neuroblastoma cell line are shown. Similar results in human primary foetal neurons were previously reported (Braidy et al., 2009b). QUIN can lead to neuronal dysfunction by several mechanisms (Guillemin, 2012): 1) QUIN activates NMDA receptor through glutamate site, increasing glutamate release and causing receptor over activation (Guillemin and Brew, 2004). 2) QUIN also can increase glutamate release and inhibit its reuptake by astrocytes, thus increasing its concentration in the microenvironments, causing neurotoxicity (Tavares et al., 2000, Tavares et al., 2002). 3) Two recent studies demonstrated that QUIN toxicity could lead to destabilization of the cytoskeleton, phosphorylating structural proteins (Rahman et al., 2009a, Pierozan et al., 2010). This correlates with the results obtained from real time imaging of neurons in the presence of QUIN, demonstrating that neurons fail to maintain a healthy structure of long neurites, and to prolong existing neurites (Figure 7-6). Moreover, the shorter neurite length of foetal dopaminergic neurons in the presence of QUIN suggests that primary

194 Chapter 7: Quinolinic acid toxicity. cells are more vulnerable to QUIN’s neurotoxic effect that cell line derived neurons (Figure 7-5). Other studies have linked the oxidative neuron injury with disruption of the neuritic network in rat brain, and excitotoxicity with axonal degeneration in mice (Vaz et al., 2011, Uribe et al., 2012). Normal neuronal function depends on its ability to maintain a healthy axon and dendrites, known as neurites that extend for great distances from the cell body, propagating electrochemical signals and forming a network of synaptic connections. Synaptic pathology is one of the key players in pathophysiological mechanisms underlying neurodegenerative diseases (Wishart et al., 2006). Figure 7-7 represents a model of interaction between CNS cells during brain inflammation, typical for PD and the effect of KP activation in astrocytes and microglia on neurons. The KP, under normal physiological conditions is well balanced and produces all KP intermediates leading ultimately to NAD+ production. However, under pathologic conditions, IDO1 is activated and astrocytes produce KYN and KYNA (Guillemin et al., 2001a), neurons produce PIC (Guillemin et al., 2007b) and activated microglia / infiltrating macrophages produce QUIN (Guillemin et al., 2005b). It is important to note that PIC and KYNA can partly antagonise the neurotoxic effects of QUIN (Beninger et al., 1994). However, astroglial secretion of large quantities of KYN can lead to further synthesis of QUIN by microglia (active microgliosis), suggesting that the cerebral synthesis of QUIN largely overtakes the neuroprotective effects of PIC and KYNA (Owe-Young et al., 2008). Several studies have shown extensive evidence of activated microglial cells and NMDAR+ dopaminergic neurons in the SNpc (Stone and Darlington, 2002b, McNally et al., 2008). This suggests that the NMDA receptor is likely to be activated by endogenous QUIN released by microglia, followed closely by glutamate excitotoxicity.

195 Chapter 7: Quinolinic acid toxicity.

Figure 7-7: Model for Kynurenine pathway interactions between astrocytes, neurons and microglia during brain inflammation. INF-γ-induced inflammation causes KP activation through up regulation of IDO in microglia and astrocytes, which followed by release of neurotoxic QUIN. It can induce excitotoxicity, oxidative stress, apoptosis, mitochondrial dysfunction and the inflammatory cascade, all putatively thought to contribute to PD pathogenesis and progression.

196 Chapter 8: Conclusions and future studies.

Chapter 8 : Conclusions and future studies

197 Chapter 8: Conclusions and future studies.

8.1 Conclusions Since the introduction of symptomatic Levodopa therapy for PD, many novel theraputic approaches have been introduced. However, two main issues still remain unsolved: 1) the motor and non-motor complications of Levodopa treatment and 2) the lack of neuroprotective or disease-modifying therapy. The exact mechanism responsible for PD pathogenesis is unknown, but its main pathological hallmark is a progressive loss of dopaminergic neurons in the SN. Although dopaminergic neurons represent less than 1% of the total number of brain neurons, they are believed to be specifically vulnerable to oxidative stress. Post-mortem, in vivo and genetic studies have provided evidence that mitochondrial impairment leading to oxidative stress, glutamate excitotoxicity and neuroinflammation are key components of the degeneration of nigral neurons (section 2.2 . Altered TRP metabolism via the KP has been demonstrated in PD (section 2.4 ). Probably the most studied KP end product, QUIN, plays a role in numerous neurodegenerative diseases as a neurotoxin. Yet, the KP intermediates KYNA and PIC are putative intrinsic neuroprotective compounds. The implication of the KP in neurodegenerative diseases has led to development of therapeutic strategies for restoration of altered TRP metabolism. To assess the drug efficacy of targeting the KP in CNS cells, in particular dopaminergic neurons, adequate in vitro model systems are needed. In vitro models provide an important tool to study toxicity, neuroprotection and biochemical or molecular mechanisms. As shown in Chapter 5 and Chapter 6, we have established 2 in vitro models of dopaminergic neurons. The two protocols developed allow us to 1) differentiate human neuroblastoma cells and 2) to isolate primary dopaminergic neurons from human foetal brain. We demonstrated that both models express the phenotype and other molecular characteristics of dopaminergic neurons. Both differentiated SH-SY5Y cells and isolated neurons highly express the dopaminergic marker TH, and TH levels in the model derived from the neuroblastoma cell line are higher than in primary neurons (Figure 8-1). It has been previously described that SH-SY5Y cells with high TH expression have an increased resistance to oxidative insult, suggesting that an in vitro model derived from foetal SN is more suitable for toxicity studies (McMillan et al., 2007). High expression of MAP2 in primary neurons suggests an extensive neurite outgrowth, which correlates with observations obtained from real-time imaging that primary neurons have more extensions then differentiated SH-SY5Y neuron-like cells (Figure 6-5).

198 Chapter 8: Conclusions and future studies.

Figure 8-1: Relative expression of TH in dSH-SY5Y cells, isolated dopaminergic neurons and SN from human foetal brain. #- dSH-SY5Y compared with isolated neurons (p<0.05). *- Isolated neurons compared with SN tissue (p<0.01).

The characterization of the KP in our in vitro models has led to the conclusion that in inflammatory conditions neuronal KP is strongly activated with IDO1 or/and IDO2 up regulated and the KP shifts towards a neuroprotective state. The differences in KP activation between the two dopaminergic in vitro models are summarised in the diagram (Figure 8-2). Following INF-γ stimulation a switch toward production of neuroprotective KYNA, PIC and QA was observed (Figure 8-2). The neuroprotective effect of KYNA and PIC on neurons was described in sections 2.3.1.3 and 2.3.1.4 , however it was reported that micromolar PIC concentrations, synergistically with INF-γ, might activate macrophage effector functions and induce macrophage inflammatory responses in mice (Rapisarda et al., 2002, Melillo et al., 1993). Nanomolar concentrations of KYNA reduced glutamate release through glycine site activation on glutamate receptor (Moroni et al., 2012). Moreover micromolar KYNA concentrations activate G-protein coupled receptor GPR35, thus reducing the release of excitatory inflammatory mediators from both glia and macrophages (Moroni et al., 2012). Furthermore, KYNA-induced activation of aryl hydrocarbon receptor (AhR) has been reported to be involved in suppression of the cellular immune response, but also may stimulate carcinogenesis (Moroni et al., 2012, Stevens et al., 2009). There is not much known about QA’s mechanisms of action, however it and its derivates were suggested to have anti- inflammatory activities and linked to excessive serotonin formation through 5HT(1B)

199 Chapter 8: Conclusions and future studies. receptor inhibition, thus replenishing depleted serotonin pools, associated with PD (section 5.3.3.3 ).

Figure 8-2 KP switch in dSH-SY5Y neuron-like cells and SN isolated neurons in inflammatory conditions. KP is presented very similarly in in vitro models of human dopaminergic neurons. Following INF-γ-induced inflammation neurons absorb toxic QUIN and the KP switches toward production of neuroprotective KYNA, PIC and QA. KP in dSH-SY5Y cells shown in red, in isolated dopaminergic neurons in green.

As shown previously in cortical neurons, dopaminergic neurons do not produce QUIN but take it up from the microenvironment (Guillemin et al., 2005b, Guillemin et al., 2007b). Only 75 nM of QUIN following dopaminergic neurotoxin administration causes further excitotoxic lesions in rat brain (Figure 8-3) (Kollensperger et al., 2007). Uptake of QUIN by neurons is likely to be part of a scavenging mechanism, when activated microglia release high concentrations of QUIN (> 1 μM) into the neuronal environment (Guillemin et al.,

2007b, Guillemin et al., 2005b, Rahman et al., 2009b) . In both in vitro models, the QUIN uptake from the culture medium was observed (Figure 2). QUIN acts on NMDAR through the NR1+NR2A and NR1+NR2B subunit combinations (Priestley et al., 1995). We showed that both NR2A and NR2B subunits are present in both in vitro models of dopaminergic

200 Chapter 8: Conclusions and future studies. neurons, while being expressed in much higher concentrations in primary neurons, suggesting higher vulnerability to QUIN toxicity (sections 5.3.2.1 and 6.3.1.4 ).

Figure 8-3: Immunoreactivity in rat midbrain and striatum after dopaminergic neurotoxin and QUIN administration. Image A shows specific loss of dopaminergic neurons in SN after administration of specific dopaminergic toxin. Image B shows distinct excitotoxic lesion after 75 nM QUIN administration. (Kollensperger, Stefanova et al. 2007)

Microglial activation correlated with the dopaminergic terminal loss demonstrated in the early stages of PD (Ouchi et al., 2005, Imamura et al., 2003). Furthermore, our Spanish collaborators, Prof. Herrero and her group from University of Murcia (Spain), have obtained a great body of evidence on the involvement of inflammation and KP activation in the SN of MPTP-treated macaques (Figure 8-4). Firstly, they have shown increased number of activated microglia in the SN (Figure 8-4 a). Secondly, using immunocytochemistry they demonstrated that QUIN accumulates in the SN of MPTP-treated macaques and co-localises with activated microglia producing QUIN and TH neurons (Figure 8-4 b). Finally, it was found that the number of QUIN-immunoreactive microglial cells was 4 times higher in MPTP-treated macaques than in control animals (Figure 8-4 c). These results together with previous observations and KP characterisation support the hypothesis that an intrinsic immune response of microglia accompanied by QUIN release significantly contributes to the dopaminergic degeneration processes and further inflammatory response and excitotoxicity through NMDAR activation (Figure 8-5). To conclude, two in vitro models established in this study present a valid model for dopaminergic neurons that can be used to study neurotoxicity and inflammation in PD and other neurodegenerative disorders. The models demonstrate great similarities in KP response to INF-γ-induced inflammatory events. The key advantage of a neuroblastoma derived in vitro model over a primary model is that it is readily available and provides controlled environment for the experiments. The neuroblastoma derived in vitro model may become a simple, easily accessible tool for toxicity studies and evaluation of potential therapeutic intervention, particularly KP modulation.

201 Chapter 8: Conclusions and future studies.

Figure 8-4: Evidence of inflammation and KP activation in the SN of PD macaques’ brain. A shows co-localization of microglia marker Iba-1 and inflammatory cytokine INF-γ, suggesting inflammation induced by activated microglia in PD macaques’ SN. B shows QUIN’s presence, co-localized with microglia, around dopaminergic neurons (TH) in SN of MPTP-treated macaques. C shows greater amount of QUIN positive cells in MPTP-treated animals (black) compared with control (white).

202 Chapter 8: Conclusions and future studies.

Figure 8-5: The possible role of Kynurenine pathway involvement in dopaminergic neurodegenerative process through microglia activation. Parkinson’s disease is associated with chronic activation of microglia, which also can be induced by LPS or Rotenone treatment. Classic microglia activation releases neurotoxic substances including ROS and proinflammatory cytokines such as INFγ, a potent activator of the KP. Activation of the KP in activated microglia leads to up regulation of 3HK and QUIN. The 3HK is toxic, primarily as a result of conversion to ROS. The combined effects of ROS and NMDA receptor-mediated excitotoxicity by QUIN contribute to the dysfunction of neurons and their death. However, PIC, an NMDA agonist, produced through KP activation in neurons has the ability to protect neurons against QUIN-induced neurotoxicity. Microglia can become over activated by proinflammatory mediators and stimuli from dying neurons, and cause a perpetuating cycle of further microglia activation-microgliosis. Excessive microgliosis will cause neurotoxicity to neighbouring neurons and result in neuronal death, contributing to progression of Parkinson’s disease.

203 Chapter 8: Conclusions and future studies.

8.2 Limitations and future study

Both in vitro models of dopaminergic neurons described in this thesis are suitable for future investigations on the KP and toxicity studies for PD. However, there were a few limitations as well as future proposed studies.

8.2.1 Human foetal dopaminergic neurons primary cultures Dopaminergic neurons isolated from the SN of foetal human brain represent an outstanding model for investigations on PD. Our Neuroinflammation group has regular access to human foetal tissue, however we have been able to use only a few intact samples for dopaminergic neuron isolation. These difficulties influenced the course of the study and not all experiments could be performed in both dopaminergic neuron models at the same experimental conditions.

8.2.2 Ex vivo study limitation We initially planned to obtain human brain samples, serum and CSF from PD patients from Australian brain banks to characterise the KP ex vivo and correlate the results with those obtained from the in vitro models. This would have allowed in vitro model validation. We have applied to two Australian-based and one UK-based brain banks, but unfortunately we never managed to get access to the samples. The spplication processes have been time consuming and it was decided to complete the current study without ex vivo validation, with the approval of the postgraduate committee (3rd year assessment).

8.2.3 Toxicity studies To assess the toxic effect of QUIN on dopaminergic neurons, both in vitro models will be exposed to different concentrations of QUIN in culture (this work was partially done in chapter 7). QUIN’s toxic effect can be evaluated based on LDH assay, caspase activation or neurites quality and lengths. These results will also contribute to further validation of the neuroblastoma derived cell model, compared with primary dopaminergic cells.

8.2.4 Co-culture of dopaminergic neurons with microglia cells and KP inhibitors PD seems to be associated with activated microglia and increased QUIN production as well as with an imbalance between the two main branches of the KP within the brain (Figure 8-2). To assess the neurotoxic effects of QUIN released by microglia in an

204 Chapter 8: Conclusions and future studies. environment resembling pathophysiological conditions, neurons could have been co-cultured together with endogenous activated microglia cells pre-triggered by INF-γ. There are many therapeutic opportunities for intervention and modification of an impaired KP that may possibly alter the progression of neurodegeneration. It may be possible to reinstate a physiologically normal KP, which is basically neuroprotective, using specific KP enzyme inhibitors. This neuroprotective state might also be synergistically improved by concomitantly blocking the NMDA receptor using its antagonists (PIC, KYNA, MK801, APV, Memantine or their combination) as was shown in a mouse neuronal cell line (Chen et al., 2011).

8.2.5 Characterization of KP in mice, macaque and human brain samples and CSF Characterization of KP enzymes and metabolites in brain samples obtained from MPTP-treated mice and macaques and PD patients will allow further validation of in vitro models from this study. Concentration of KP metabolites in CSF (or blood, serum and plasma if available) from MPTP-treated macaques and PD patients could help to identify a potential biomarker of the disease. Such biomarkers would allow objective PD patient diagnosis, to track the disease progression and to assess treatment’s efficacy.

8.2.6 Correlation of PD severity with KP expression in mouse and macaque PD models – potential biomarker for early PD Animal models allow us to monitor disease progression and collect numerous samples at different disease stages. Mice and macaques samples can be collected throughout the experiment, starting from MPTP administration until the end of the experiment. KP examination in these samples will allow correlating enzymes expression and metabolites amount with the severity of the disease. One of KP metabolites can be a candidate biomarker for detecting PD at its earliest stages. Such a biomarker would allow currently available treatments to begin earlier and potentially accelerate the development of new PD treatments.

8.2.7 Tranilast and 1-MT trial in mouse and macaque PD models Neuroprotection of dopaminergic neurons in PD may be achieved not only by use of KP inhibitors, but also by KYNA analogues that are able to penetrate the BBB and deliver neuroprotective compounds to brain pools thus reducing hyper activation of glutamatergic receptors. We hypothesize that treatment with the IDO1 inhibitor 1-methyl-Tryptophan (1- MT) or kynurenines’ analogue Tranilast would result in decreased microglial activation and dopaminergic neuron loss, leading to delay in disease onset and progression in PD mice

205 Chapter 8: Conclusions and future studies. and/or macaques model. Results from such a study could demonstrate if Tranilast or 1-MT prolong survival of MPTP treated animals, and delay the onset of the disease. Prof Herrero, who has provided us the results obtained from macaques’ PD models, has a great expertise in PD investigation using mice and macaques models. It has been suggested, that based on the present Thesis, a trial with Tranilast and 1-MT could be initiated in Prof Herrero’s laboratory.

8.2.8 Further validation of in vitro models Additional validation of in vitro models of dopaminergic neurons should be provided by a comparison of data available from in vitro studies with in vivo and ex vivo observations. These findings will reveal if in vitro models established in this study are fully relevant in experimental PD research.

206 Chapter 4 Appendix. Appendix for chapter 4

207 Chapter 4 Appendix. Primer length Melting Temp GC% Product size (bp) NCBI blast total score Query coverage "Amplify 3X"

screening results other matches serial number score

Designed RT-PCR primer Accession

Source Sequence sequences for KP (human) number

Homo sapiens indoleamine PrimerBank ID Fwd 5'- ggctttgctctgccaaatcc 20 61.90 55 119 40.1 100% 2,3-dioxygenase 1 (IDO1), NM_002164.4 1 4504577a1 Rev 5'- ttctcaactctttctcgaagctg 23 60.20 50 46.1 100% mRNA PrimerBank ID Fwd 5'- tcatctcacagaccacaagtca 22 60.70 45 107 44.1 100% IDO1 NM_002164.4 2 4504577a2 Rev 5'- gcaagaccttacggacatctcc 22 62.40 55 44.1 100% PrimerBank ID Fwd 5'- gatgtccgtaaggtcttgcca 21 61.80 50 187 42.1 100% IDO1 NM_002164.4 × 4504577a3 Rev 5'- tgcagtctccatcacgaaatg 21 60.40 50 42.1 100% Integrated Fwd 5'- gactacaagaatggcacacgctatg 25 74.00 48 50.1 100% IDO1 Sciences Dr. NM_002164.4 × 168+ 181 Rev 5'- ccagactctatgagatcaggcagatg 26 78.00 50 52 100% Magnino Homo sapiens indoleamine Dr. Helen Ball, Fwd 5'- cccacagaccgaatgtgaagac 22 60.00 66 133 44.1 100% 2,3-dioxygenase 2 (IDO2), University of NM_194294.2 1 Rev 5'- gcaatttccatccaaggcctat 22 60.00 45 44.1 100% mRNA Sydney Dr. Helen Ball, Fwd 5'- catccggatctttctctctgggt 23 60.00 52 200 42 91% IDO2 University of NM_194294.2 × Rev 5'- gaaggaggcatgtaatccctcattct 26 60.00 46 52 100% Sydney Integrated Fwd 5'- tcatactgagcactgcctccaag 23 70.00 52 92+787+ 46.1 100% IDO2 Sciences NM_194294.2 × Rev 5'- cctgccaccaactcaacacattc 23 70.00 52 292 46.1 100% DRFabrice M. 1 Fwd 5'- ggttcctcaggctatcactacc 22 61.30 55 101 44.1 100% Homo sapiens tryptophan PrimerBank ID 2,3-dioxygenase (TDO2), NM_005651.2 × 1+4=128 5032165a1 2 Rev 5'- cgacctgggttcaattccta 20 61.00 50 38.2 100% mRNA

Integrated NM_005651.2 3 Fwd 5'- cggtggttcctcaggctatcac 22 70.00 59 128 44.1 100% TDO2 Sciences Dr. OK 4 Rev 5'- tggttgggttcatcttcggtatcc 24 72.00 50 44.1 100% Magnino

208 Chapter 4 Appendix. Primer length Melting Temp GC% Product size (bp) NCBI blast total score Query coverage "Amplify 3X"

screening results other matches serial number score

Designed RT-PCR primer Accession

Source Sequence sequences for KP (human) number

Homo sapiens tryptophan PrimerBank ID 1 Fwd 5'- ccattgtgccaacagagttct 21 60.50 48 42.1 100% hydroxylase 1 (TPH1), NM_004179.1 × 1+4=218 101+378 4759248a1 mRNA 2 Rev 5'- cagcgccatctctgtgataa 20 60.00 50 44.1 100% PrimerBank ID 3 Fwd 5'- cgtcgaaagtattttgcggact 22 61.20 45 136 44.1 100% TPH1 NM_004179.1 1 4759248a2 4 Rev 5'- catgggttgggtagagtttgtt 22 60.20 45 44.1 100% PrimerBank ID 5 Fwd 5'- tggctgaacctagttttgccc 21 62.60 52 151 42.1 100% TPH1 NM_004179.1 2 4759248a3 6 Rev 5'- ccaaagactcttagctgtccatc 23 60.40 48 46.1 100% TPH1 NM_004179.1 7 Fwd 5'- tcagcaggaagccgagtatctaac 24 72.00 50 no 46.1 95% Integrated product Homo sapiens toll-like Sciences Dr. × or NM_016562.3 8 Rev 5'- caggatcaggtgttcaaggaaagc 24 72.00 50 32.4 70% receptor 7 (TLR7), mRNA Magnino multiple dimers Homo sapiens tryptophan PrimerBank ID 1 Fwd 5'- aaacttggggtgttgtattccg 22 60.80 45 102 44.1 100% hydroxylase 2 (TPH2), NM_173353.3 1 31795563a1 2 Rev 5'- agccacagtatttagtcagcaga 23 61.10 43 46.1 100% mRNA PrimerBank ID 3 Fwd 5'- gtggctacagagaggacaatgt 22 61.40 50 108 44.1 100% TPH2 NM_173353.3 × 31795563a2 4 Rev 5'- ctcgtgggctcaggtatcca 22 62.90 60 40.1 100% PrimerBank ID 5 Fwd 5'- atacctgagcccacgagactt 21 62.40 52 131 42.1 100% TPH2 NM_173353.3 2 31795563a3 6 Rev 5'- catgtcccaagagttcatggc 21 61.00 52 42.1 100% 7 Fwd 5'- tgatgcctggaactatgttgttgc 24 70.00 46 48.1 100%

Integrated 1+4=208 TPH2 Sciences Dr. NM_173353.3 OK 1+6=318 8 Rev 5'- tagccaagccatgacacagaagg 23 70.00 52 46.1 100% Magnino

209 Chapter 4 Appendix. Primer length Melting Temp GC% Product size (bp) NCBI blast total score Query coverage "Amplify 3X"

screening results other matches serial number score

Designed RT-PCR primer Accession

Source Sequence sequences for KP (human) number

Homo sapiens monoamine 1 Fwd 5'- gaatcaagagaaggcgagtatcg 23 60.50 48 106 46.1 100% oxidase A (MAOA), PrimerBank ID nuclear gene encoding NM_00240.2 × 1+4=295 4557735a1 2 Rev 5'- aacgccatattcagtcaagagtt 23 60.00 39 46.1 100% mitochondrial protein, mRNA PrimerBank ID 3 Fwd 5'- atgttggtggagcttatgtgg 21 60.00 48 110 42.1 100% MAOA NM_00240.2 1 4557735a2 4 Rev 5'- atattgaacgagacgctcactg 22 60.20 45 44.1 100% PrimerBank ID NM_00240.2 5 Fwd 5'- tgagcgtctcgttcaatatgtc 22 60.20 45 143 44.1 100% MAOA × 4557735a3 6 Rev 5'- catcagttggaatctccttccc 22 60.10 50 44.1 100% Integrated 7 Fwd 5'- ccctgttaaggcatccacttcac 23 70.00 52 105 46.1 100% MAOA Sciences Dr. NM_00240.2 OK 8 Rev 5'- aggcaccaagttcacaatcacac 23 68.00 48 46.1 100% Magnino Homo sapiens monoamine Fwd 5'- ggcggcatctcaggtatgg 19 62.30 63 195 38.2 100% oxidase B (MAOB), nuclear PrimerBank ID gene encoding NM_000898.4 1 31543137a1 Rev 5'- tcctagctccttggctaatctc 22 60.40 50 44.1 100% mitochondrial protein, mRNA PrimerBank ID Fwd 5'- gttgagcgtctgatccaccat 21 62.10 52 121 42.1 100% MAOB NM_000898.4 2 31543137a2 Rev 5'- tgtcatccattgtcctccaaaag 23 60.50 43 46.1 100% PrimerBank ID Fwd 5'- atgacatggggcgagagattc 21 61.70 52 128 42.1 100% MAOB NM_000898.4 3 31543137a3 Rev 5'- ggcaagctgctttgcagatt 20 61.90 50 40.1 100% Fwd 5'- tatggctttgtgcttgttcttcctc 25 72.00 44 50.1 100% Integrated MAOB Sciences Dr. NM_000898.4 OK Rev 5'- cagtggcttattgtggctcttagg 24 72.00 50 48.1 100% Magnino

210 Chapter 4 Appendix. Primer length Melting Temp GC% Product size (bp) NCBI blast total score Query coverage "Amplify 3X"

screening results other matches serial number score

Designed RT-PCR primer Accession

Source Sequence sequences for KP (human) number

Homo sapiens cysteine Fwd 5'- agccgcccttcttcatcttagag 70.00 52 46.1 100% conjugate-beta lyase, NM_0011226 cytoplasmic (CCBL1), × no 71.1 transcript variant 3, mRNA Integrated Rev 5'- gcacctagagctgcatcaaag 62.00 62 product 38.2 90% (KAT1) Sciences Dr. or Homo sapiens cysteine Magnino multiple conjugate-beta lyase, NM_0011226 dimers cytoplasmic (CCBL1), 72.1 transcript variant 2, mRNA Homo sapiens cysteine conjugate-beta lyase, NM_004059.4 cytoplasmic (CCBL1), transcript variant 1, mRNA NM_0011226 PrimerBank ID 1 Fwd 5'- caccactgacgaagatcctgg 21 62.10 57 67 42.1 100% KAT1 71.1 1 4757928a1 NM_004059.4 2 Rev 5'- ctgagcgggtctatctcctga 21 62.20 57 42.1 100% NM_0011226 PrimerBank ID 3 Fwd 5'- gatagacccgctcaggaatgt 21 61.10 52 96 42.1 100% KAT1 71.1 2 1+4=148 4757928a2 NM_004059.4 4 Rev 5'- atgacctcgtctccttcgtcc 21 63.00 57 42.1 100% NM_0011226 5 Fwd 5'- cagtagccgagagctttgaac 21 60.70 52 131 42.1 100% 71.1 PrimerBank ID NM_0011226 KAT1 3 4757928a3 72.1 NM_004059.4 6 Rev 5'- cttcaggcccactgactgta 20 60.90 55 40.1 100% Homo sapiens aminoadipate PrimerBank ID no NM_016228.3 × 1 Fwd 5'- aattacgcacggttcatcacg 21 61.30 48 42.1 100% aminotransferase 21410576a1 product

211 Chapter 4 Appendix. Primer length Melting Temp GC% Product size (bp) NCBI blast total score Query coverage "Amplify 3X"

screening results other matches serial number score

Designed RT-PCR primer Accession

Source Sequence sequences for KP (human) number

(AADAT), transcript or PrimerBank ID variant 1, mRNA (KAT2) 2 Rev 5'- tctacagtgattacggcagtctt 23 60.80 43 multiple 46.1 100% 21410576a2 dimers

Homo sapiens aminoadipate Fwd 5'- aminotransferase PrimerBank ID NM_182662.1 1 1+3=228 (AADAT), transcript 21410576a3 3 Rev 5'- actcggagaatactgaagtgctc 23 61.40 48 46.1 100% variant 2, mRNA (KAT2) PrimerBank ID 4 Fwd 5'- ttgagcagaggaccaaaatcg 21 60.30 48 92 42.1 100% KAT2 × 33469970a1 5 Rev 5'- tctacagtgattacggcagtctt 23 60.80 42 46.1 100% PrimerBank ID 6 Fwd 5'- ggctggtggcttaccaaatc 20 61.00 55 124 40.1 100% KAT2 NM_182662.1 2 33469970a2 7 Rev 5'- actcggagaatactgaagtgctc 23 61.40 48 46.1 100% no 8 Fwd 5'- aagactgccgtaatcactgtaga 23 60.80 43 46.1 100% product PrimerBank ID KAT2 × or 33469970a3 9 Rev 5'- actcggagaatactgaagtgctc 23 61.40 48 multiple x dimers Integrated NM_016228.3 10 Fwd 5'- gctccctggaaatgctttctacg 23 70.00 52 112 46.1 100% KAT2 Sciences Dr. OK NM_182662.1 11 Rev 5'- tgctaatacctggaaggccacatc 24 72.00 50 48.1 100% Magnino Homo sapiens cysteine conjugate-beta lyase 2 NM_0010086 1 Fwd 5'- atgtttttggcccagaggagcc 22 57.00 55 no 44.1 100% (CCBL2), transcript variant 61.1 Yu P. Gene 365 product 1, mRNA (KAT3) (2006), 111- or Homo sapiens cysteine 118 multiple conjugate-beta lyase 2 NM_0010086 2+9=244 2 Rev 5'- tcaagacttctgtacactccatg 23 53.00 43 dimers 46.1 100% (CCBL2), transcript variant 62.1 (only R) 2, mRNA

212 Chapter 4 Appendix. Primer length Melting Temp GC% Product size (bp) NCBI blast total score Query coverage "Amplify 3X"

screening results other matches serial number score

Designed RT-PCR primer Accession

Source Sequence sequences for KP (human) number

NM_0010086 3 Fwd 5'- ggctggagcaacacctgttt 20 63.00 55 201 40.1 100% PrimerBank ID 61.1 KAT3 × 12654031a1 NM_0010086 4 Rev 5'- aggtcagcaattacttgcagttc 23 61.00 43 46.1 100% 62.1 NM_0010086 5 Fwd 5'- ctgcaagtaattgctgacctttg 23 60.30 43 124 46.1 100% PrimerBank ID 61.1 KAT3 1 12654031a1 NM_0010086 6 Rev 5'- cccacatacctggaaaagtagc 22 60.40 50 44.1 100% 62.1 NM_0010086 5+7=275 7 Fwd 5'- acttttccaggtatgtgggaga 22 60.40 45 170 44.1 100% PrimerBank ID 61.1 KAT3 12654031a1 NM_0010086 8 Rev 5'- gcttcctgtaaaggagttgcac 22 61.40 50 44.1 100% 62.1 NM_0010086 Integrated 9 Fwd 5'- cgctgatgtgtctttgctagatcc 24 72.00 50 88 48.1 100% 61.1 KAT3 Sciences Dr. OK NM_0010086 Magnino 10 Rev 5'- cagaatgctgaaacggggatgg 22 68.00 55 44.1 100% 62.1 Homo sapiens kynurenine Fwd 5'- tgtcaactcaagctggttcatt 22 60.10 41 194 44.1 100% 3-monooxygenase PrimerBank ID NM_003679.3 × (kynurenine 3-hydroxylase) 4504891a1 Rev 5'- tggctatcagtgatcccaagaaa 23 61.10 43 46.1 100% (KMO), mRNA Integrated Fwd 5'- gcatctactaggtgacagccactg 24 74.00 54 48.1 100% KMO Sciences Dr. NM_003679.3 OK Rev 5'- aactctgccaggaagagccttatc 24 72.00 50 48.1 100% Magnino PrimerBank ID x Fwd 5'- tagccctttctcatagaggacg 22 60.40 50 84 44.1 100% KMO NM_003679.3 13529017a1 Rev 5'- ctctcatgggaataccttggga 22 60.60 50 44.1 100% PrimerBank ID Fwd 5'- tagccctttctcatagaggacg 22 60.40 50 201 44.1 100% KMO NM_003679.3 x 13529017a2 Rev 5'- cagcagcagtcaatagatccttg 23 61.00 48 44.1 100%

213 Chapter 4 Appendix. Primer length Melting Temp GC% Product size (bp) NCBI blast total score Query coverage "Amplify 3X"

screening results other matches serial number score

Designed RT-PCR primer Accession

Source Sequence sequences for KP (human) number

Fwd 5'- tcccaaggtattcccatgagag 22 60.60 50 141 44.1 100%

PrimerBank ID KMO NM_003679.3 x 13529017a3 Rev 5'- ctcagcagcagtcaatagatcc 22 60.20 50 44.1 100%

Homo sapiens kynureninase Fwd 5'- ttgcagtgatcctgttcagtg 21 60.20 48 269 42.1 100% (L-kynurenine hydrolase) NM_0010329 1 (KYNU), transcript variant PrimerBank ID 98.1 × 2+7=127 44.1 100% 2, mRNA 12654129a1 Homo sapiens kynureninase NM_003937.2 2+5=273 2 Rev 5'- ctccgatctcgcaggtttaatc 22 60.60 50 100% (L-kynurenine hydrolase) (Fwd only) (KYNU), transcript variant PrimerBank ID NM_0010329 3 Fwd 5'- gggtgcatttttacactggaca 22 61.00 45 248 44.1 100% 1, mRNA 12654129a2 98.1 NM_0010329 5 Fwd 5'- tgttcagtggggtgcattttt 21 60.70 43 259 42.1 100% PrimerBank ID 98.1 KUNY 1 12654129a3 NM_003937.2 6 Rev 5'- aactccgatctcgcaggttta 21 60.90 48 42.1 100% (Fwd only) NM_0010329 no 7 Fwd 5'- acatgactggggagttgattttgc 24 70.00 46 48.1 100% Integrated 98.1 product KUNY Sciences Dr. × or Magnino NM_003937.2 8 Rev 5'- cgcaggtttaatcgtggcatg 21 72.00 52 multiple 28.2 66%

dimers Homo sapiens quinolinate PrimerBank ID Fwd 5'- tgttgaaggataaccatgtggtg 23 60.50 43 106 40.1 86% phosphoribosyltransferase NM_014298 1 7657488a1 Rev 5'- ctgctgcattccacttcca 19 60.00 53 38.2 100% (QPRT), mRNA Integrated QPRT NM_014298 × Fwd 5'- atttacccaactcaactgccaagtc 25 72.00 44 50.1 100% Sciences Dr.

214 Chapter 4 Appendix. Primer length Melting Temp GC% Product size (bp) NCBI blast total score Query coverage "Amplify 3X"

screening results other matches serial number score

Designed RT-PCR primer Accession

Source Sequence sequences for KP (human) number

Magnino Rev 5'- ccaccaggagcccatacttctc 22 70.00 59 275 44.1 100% Homo sapiens glutamic- 105+195 Fwd 5'- gagtcactgaagcctttaagagg 23 60.30 48 46.1 100% oxaloacetic transaminase 2, 0 mitochondrial (aspartate PrimerBank ID aminotransferase 2) NM_00208.2 × 4504069a1 (GOT2), nuclear gene Rev 5'- ggacgctaggcagaacgtaag 21 62.50 57 42.1 100% encoding mitochondrial protein, mRNA PrimerBank ID Fwd 5'- atttggacaaggaatacctgcc 22 60.30 45 101 44.1 100% GOT2 NM_00208.2 1 4504069a2 Rev 5'- gccactcttcaagacttcgc 20 61.00 55 40.1 100% 105+129 PrimerBank ID Fwd 5'- agagtggccggtttgtcac 19 62.20 58 38.2 100% GOT2 NM_00208.2 × 5 4504069a3 Rev 5'- gaaagacatctcggctgaactt 22 60.30 45 44.1 100% Integrated Fwd 5'- gacctcctccctttgttgaatgtg 24 72.00 50 162 48.1 100% GOT2 Sciences Dr. NM_00208.2 OK Rev 5'- catggttagagcagatggtggttc 24 72.00 50 48.1 100% Magnino Homo sapiens aminocarboxymuconate 3+5=189 1 Fwd 5'- taccccaggaggttcgtgg 19 62.60 63 121 38.2 100% PrimerBank ID semialdehyde NM_138326.2 1 21264328a1 decarboxylase (ACMSD), 1+4=171 2 Rev 5'- cgtgggtgccaatttggac 19 61.60 58 38.2 100% mRNA PrimerBank ID 1+5=173 3 Fwd 5'- cagcaccgttgtgagctac 19 62.60 58 187 38.2 100% ACMSD NM_138326.2 2 21264328a2 2+3=137 4 Rev 5'- tgccgcatagacaggaaagag 21 62.60 52 42.1 100% PrimerBank ID no ACMSD NM_138326.2 Fwd 5'- 21264328a3 product

215 Chapter 4 Appendix. Primer length Melting Temp GC% Product size (bp) NCBI blast total score Query coverage "Amplify 3X"

screening results other matches serial number score

Designed RT-PCR primer Accession

Source Sequence sequences for KP (human) number

or 5 Rev 5'- gctgccgcatagacaggaaa 20 62.60 55 multiple 40.1 100%

dimers Integrated 6 Fwd 5'- gccagcagagaccaccatagc 21 68.00 62 42.1 100% ACMSD Sciences Dr. NM_138326.2 OK 7 Rev 5'- gggttgtcctgggcacacag 20 66.00 65 171 40.1 100% Magnino Homo sapiens 3- 1 Fwd 5'- accaggaaggactatcacatcg 22 61.00 50 107 44.1 100% hydroxyanthranilate 3,4- PrimerBank ID NM_012205.2 × dioxygenase (HAAO), 6912406a1 2 Rev 5'- atgaccacatcccggtgtttc 21 62.40 52 42.1 100% mRNA PrimerBank ID 3 Fwd 5'- acaccgggatgtggtcaatc 20 61.90 55 145+577 34.2 85% HAAO NM_012205.2 × 6912406a2 4 Rev 5'- atagtacctgagcccatctagc 22 60.20 50 44.1 100% PrimerBank ID 6+7=298 5 Fwd 5'- gaaagcccatccctgaccag 20 62.30 60 143 40.1 100% HAAO NM_012205.2 1 6912406a3 6 Rev 5'- cccaaacaggctgagtggtg 20 63.00 60 40.1 100% Integrated 7 Fwd 5'- gcgaaggcggctggagac 18 62.00 72 141 36.2 100% HAAO Sciences Dr. NM_012205.2 OK 8 Rev 5'- tcagagctgaagaactcctggatg 24 72.00 50 48.1 100% Magnino Homo sapiens NM_0010109 arylformamidase (AFMID), × 1 Fwd 5'- cgacagtcctgggagttttaccaga 25 57.96 52 193+280 48.1 100% Blast - primer 82.3 transcript variant 1, mRNA design tool NM_0011455 Homo sapiens 8+2=280 2 Rev 5'- gggatgcacgtggaccaggc 20 60.04 70 40.1 100% 26.1 arylformamidase (AFMID), Blast - primer NM_0010109 transcript variant 2, mRNA 1 Fwd 5'- cgacagtcctgggagttttaccaga 270 design tool 82.3 NM_0011455 AFMID 3 Rev 5'- aggctctcctgggtgctggg 20 59.89 70 40.1 100% 26.1 Blast - primer NM_0010109 AFMID × Fwd 5'- cgacagtcctgggagttttaccaga 291+373 design tool 82.3

216 Chapter 4 Appendix. Primer length Melting Temp GC% Product size (bp) NCBI blast total score Query coverage "Amplify 3X"

screening results other matches serial number score

Designed RT-PCR primer Accession

Source Sequence sequences for KP (human) number

NM_0011455 4 Rev 5'- gccgggcagacagacacagc 20 60.32 70 40.1 100% 26.1 NM_0010109 2 Fwd 5'- cgacagtcctgggagttttaccaga 267 Blast - primer 82.3 AFMID design tool NM_0011455 5 Rev 5'- ctctcctgggtgctggggga 20 59.24 70 40.1 100% 26.1 NM_0010109 × Fwd 5'- cgacagtcctgggagttttaccaga 268+320 Blast - primer 82.3 AFMID design tool NM_0011455 6 Rev 5'- gctctcctgggtgctggggg 20 60.89 75 40.1 100% 26.1 NM_0010109 3 Fwd 5'- cgacagtcctgggagttttaccaga 269 Blast - primer 82.3 AFMID design tool NM_0011455 7 Rev 5'- ggctctcctgggtgctgggg 20 60.89 75 40.1 100% 26.1 NM_0010109 Integrated × 8 Fwd 5'- ccgcaagtcaatgctcagagatg 23 70.00 52 170+115 46.1 100% 82.3 AFMID Sciences Dr. NM_0011455 Magnino 9 Rev 5'- cagcctgggtgacagagtaagac 23 72.00 57 46.1 100% 26.1

217 References

Appendix for chapter 5

218 References

Figure1: SH-SY5Y (above) and SK-N-SH (below) cells ,day 0, 10 times magnification.

219 References

Figure2: SH-SY5Y (above) and SK-N-SH (below) cells differentiated by protocol 1 (DMEM with 3% FCS +10 μM RA, 7 days), day 7, 10 times magnification.

220 References

Figure3: SH-SY5Y (above) and SK-N-SH (below) cells differentiated by protocol 2 (DMEM with 15% FCS +10 μM RA, followed by serum free DMEM and50 ng/ml hBDNF 10 days),day 9, 10 times magnification.

221 References

Figure4: SH-SY5Y (above) and SK-N-SH (below)cells differentiated by protocol 3 DMEM with 5% FCS DMEM+10 μM RA, followed by serum free DMEM and50 ng/ml hBDNF, B27, Glutamax, cAMP, KCl ,10 days) day 9, 10 times magnification.

222 References

References

223 References

References AARSLAND, D., BALLARD, C., WALKER, Z., BOSTROM, F., ALVES, G., KOSSAKOWSKI, K., LEROI, I., POZO-RODRIGUEZ, F., MINTHON, L. & LONDOS, E. 2009. Memantine in patients with Parkinson's disease dementia or dementia with Lewy bodies: a double-blind, placebo- controlled, multicentre trial. Lancet Neurol, 8, 613-8. AJJIMAPORN, A., SHAVALI, S., EBADI, M. & GOVITRAPONG, P. 2008. Zinc rescues dopaminergic SK-N- SH cell lines from methamphetamine-induced toxicity. Brain Res Bull, 77, 361-6. ALBERATI-GIANI, D., RICCIARDI-CASTAGNOLI, P., KOHLER, C. & CESURA, A. M. 1996. Regulation of the kynurenine metabolic pathway by interferon-gamma in murine cloned macrophages and microglial cells. J Neurochem, 66, 996-1004. ALBIN, R. L. & GREENAMYRE, J. T. 1992. Alternative Excitotoxic Hypotheses. Neurology, 42, 733-738. ALDERSON, R. F., ALTERMAN, A. L., BARDE, Y. A. & LINDSAY, R. M. 1990. Brain-derived neurotrophic factor increases survival and differentiated functions of rat septal cholinergic neurons in culture. Neuron, 5, 297-306. ALLEAUME, C., EYCHENE, A., HARNOIS, T., BOURMEYSTER, N., CONSTANTIN, B., CAIGNEAUX, E., MULLER, J. M. & PHILIPPE, M. 2004. Vasoactive intestinal peptide-induced neurite remodeling in human neuroblastoma SH-SY5Y cells implicates the Cdc42 GTPase and is independent of Ras-ERK pathway. Exp Cell Res, 299, 511-24. ALOISI, F. 2001. Immune function of microglia. Glia, 36, 165-79. ALTSCHUL, S. F., GISH, W., MILLER, W., MYERS, E. W. & LIPMAN, D. J. 1990. Basic local alignment search tool. J Mol Biol, 215, 403-10. AMORI, L., GUIDETTI, P., PELLICCIARI, R., KAJII, Y. & SCHWARCZ, R. 2009. On the relationship between the two branches of the kynurenine pathway in the rat brain in vivo. J Neurochem, 109, 316-25. ANDERSON, L., BURNSTEIN, R. M., HE, X., LUCE, R., FURLONG, R., FOLTYNIE, T., SYKACEK, P., MENON, D. K. & CALDWELL, M. A. 2007. Gene expression changes in long term expanded human neural progenitor cells passaged by chopping lead to loss of neurogenic potential in vivo. Exp Neurol, 204, 512-24. ANDREWS, P. W., DAMJANOV, I., SIMON, D., BANTING, G. S., CARLIN, C., DRACOPOLI, N. C. & FOGH, J. 1984. Pluripotent embryonal carcinoma clones derived from the human teratocarcinoma cell line Tera-2. Differentiation in vivo and in vitro. Lab Invest, 50, 147-62. ARYA, M., SHERGILL, I. S., WILLIAMSON, M., GOMMERSALL, L., ARYA, N. & PATEL, H. R. 2005. Basic principles of real-time quantitative PCR. Expert Rev Mol Diagn, 5, 209-19. ASANUMA, M. & MIYAZAKI, I. 2006. Nonsteroidal anti-inflammatory drugs in Parkinson's disease: possible involvement of quinone formation. Expert Rev Neurother, 6, 1313-25. ASCHERIO, A., ZHANG, S. M., HERNAN, M. A., KAWACHI, I., COLDITZ, G. A., SPEIZER, F. E. & WILLETT, W. C. 2001. Prospective study of caffeine consumption and risk of Parkinson's disease in men and women. Ann Neurol, 50, 56-63. ASP, L., JOHANSSON, A. S., MANN, A., OWE-LARSSON, B., URBANSKA, E. M., KOCKI, T., KEGEL, M., ENGBERG, G., LUNDKVIST, G. B. & KARLSSON, H. 2011. Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts. J Inflamm (Lond), 8, 25. AUBIN, N., CURET, O., DEFFOIS, A. & CARTER, C. 1998. Aspirin and salicylate protect against MPTP- induced dopamine depletion in mice. J Neurochem, 71, 1635-42. AUER, H., LYIANARACHCHI, S., NEWSOM, D., KLISOVIC, M. I., MARCUCCI, G. & KORNACKER, K. 2003. Chipping away at the chip bias: RNA degradation in microarray analysis. Nat Genet, 35, 292- 3. AYALA, A., VENERO, J. L., CANO, J. & MACHADO, A. 2007. Mitochondrial toxins and neurodegenerative diseases. Front Biosci, 12, 986-1007. BABIOR, B. M. 2000. Phagocytes and oxidative stress. Am J Med, 109, 33-44.

224 References

BALASOORIYA, I. S. & WIMALASENA, K. 2007. Are SH-SY5Y and MN9D cell lines truly dopaminergic? Faseb Journal, 21, A1274-A1274. BALL, H. J., SANCHEZ-PEREZ, A., WEISER, S., AUSTIN, C. J. D., ASTELBAUER, F., MIU, J., MCQUILLAN, J. A., STOCKER, R., JERMIIN, L. S. & HUNT, N. H. 2007. Characterization of an indoleamine 2,3- dioxygenase-like protein found in humans and mice. Gene, 396, 203-213. BALL, H. J., YUASA, H. J., AUSTIN, C. J., WEISER, S. & HUNT, N. H. 2009. Indoleamine 2,3-dioxygenase- 2; a new enzyme in the kynurenine pathway. Int J Biochem Cell Biol, 41, 467-71. BANATI, R. B., GEHRMANN, J., CZECH, C., MONNING, U., JONES, L. L., KONIG, G., BEYREUTHER, K. & KREUTZBERG, G. W. 1993. Early and rapid de novo synthesis of Alzheimer beta A4-amyloid precursor protein (APP) in activated microglia. Glia, 9, 199-210. BANDYOPADHYAY, S. & MITRA, R. 2009. A parallel pairwise local sequence alignment algorithm. IEEE Trans Nanobioscience, 8, 139-46. BARA-JIMENEZ, W., SHERZAI, A., DIMITROVA, T., FAVIT, A., BIBBIANI, F., GILLESPIE, M., MORRIS, M. J., MOURADIAN, M. M. & CHASE, T. N. 2003. Adenosine A(2A) receptor antagonist treatment of Parkinson's disease. Neurology, 61, 293-6. BARAN, H., KEPPLINGER, B., HERRERA-MARSCHITZ, M., STOLZE, K., LUBEC, G. & NOHL, H. 2001. Increased kynurenic acid in the brain after neonatal asphyxia. Life Sci, 69, 1249-56. BARATCHI, S., KANWAR, R. K. & KANWAR, J. R. 2011. Survivin mutant protects differentiated dopaminergic SK-N-SH cells against oxidative stress. PLoS One, 6, e15865. BARCIA, C., SANCHEZ BAHILLO, A., FERNANDEZ-VILLALBA, E., BAUTISTA, V., POZA, Y. P. M., FERNANDEZ-BARREIRO, A., HIRSCH, E. C. & HERRERO, M. T. 2004. Evidence of active microglia in substantia nigra pars compacta of parkinsonian monkeys 1 year after MPTP exposure. Glia, 46, 402-9. BARTH, M. C., AHLUWALIA, N., ANDERSON, T. J., HARDY, G. J., SINHA, S., ALVAREZ-CARDONA, J. A., PRUITT, I. E., RHEE, E. P., COLVIN, R. A. & GERSZTEN, R. E. 2009. Kynurenic acid triggers firm arrest of leukocytes to vascular endothelium under flow conditions. J Biol Chem, 284, 19189- 95. BEAGLES, K. E., MORRISON, P. F. & HEYES, M. P. 1998. Quinolinic acid in vivo synthesis rates, extracellular concentrations, and intercompartmental distributions in normal and immune- activated brain as determined by multiple-isotope microdialysis. J Neurochem, 70, 281-91. BEAL, M. F., MATSON, W. R., STOREY, E., MILBURY, P., RYAN, E. A., OGAWA, T. & BIRD, E. D. 1992. Kynurenic Acid Concentrations Are Reduced in Huntingtons-Disease Cerebral-Cortex. Journal of the Neurological Sciences, 108, 80-87. BEHAN, W. M. & STONE, T. W. 2002. Enhanced neuronal damage by co-administration of quinolinic acid and free radicals, and protection by adenosine A2A receptor antagonists. Br J Pharmacol, 135, 1435-42. BEKRIS, L. M., MATA, I. F. & ZABETIAN, C. P. 2010. The genetics of Parkinson disease. J Geriatr Psychiatry Neurol, 23, 228-42. BENINGER, R. J., COLTON, A. M., INGLES, J. L., JHAMANDAS, K. & BOEGMAN, R. J. 1994. Picolinic acid blocks the neurotoxic but not the neuroexcitant properties of quinolinic acid in the rat brain: evidence from turning behaviour and tyrosine hydroxylase immunohistochemistry. Neuroscience, 61, 603-12. BENITEZ-KING, G., RAMIREZ-RODRIGUEZ, G., ORTIZ, L. & MEZA, I. 2004. The neuronal cytoskeleton as a potential therapeutical target in neurodegenerative diseases and schizophrenia. Curr Drug Targets CNS Neurol Disord, 3, 515-33. BERRY, C., LA VECCHIA, C. & NICOTERA, P. Paraquat and Parkinson's disease. Cell Death Differ, 17, 1115-25. BETARBET, R., SHERER, T. B., MACKENZIE, G., GARCIA-OSUNA, M., PANOV, A. V. & GREENAMYRE, J. T. 2000. Chronic systemic pesticide exposure reproduces features of Parkinson's disease. Nat Neurosci, 3, 1301-6.

225 References

BEZARD, E., DOVERO, S., PRUNIER, C., RAVENSCROFT, P., CHALON, S., GUILLOTEAU, D., CROSSMAN, A. R., BIOULAC, B., BROTCHIE, J. M. & GROSS, C. E. 2001. Relationship between the appearance of symptoms and the level of nigrostriatal degeneration in a progressive 1- methyl-4-phenyl-1,2,3,6-tetrahydropyridine-lesioned macaque model of Parkinson's disease. J Neurosci, 21, 6853-61. BIEDLER, J. L., HELSON, L. & SPENGLER, B. A. 1973. Morphology and growth, tumorigenicity, and cytogenetics of human neuroblastoma cells in continuous culture. Cancer Res, 33, 2643-52. BIEDLER, J. L., ROFFLER-TARLOV, S., SCHACHNER, M. & FREEDMAN, L. S. 1978. Multiple neurotransmitter synthesis by human neuroblastoma cell lines and clones. Cancer Res, 38, 3751-7. BINDER, L. I., FRANKFURTER, A. & REBHUN, L. I. 1985. The distribution of tau in the mammalian central nervous system. J Cell Biol, 101, 1371-8. BLANCHET, P. J., KONITSIOTIS, S., WHITTEMORE, E. R., ZHOU, Z. L., WOODWARD, R. M. & CHASE, T. N. 1999. Differing effects of N-methyl-D-aspartate receptor subtype selective antagonists on dyskinesias in levodopa-treated 1-methyl-4-phenyl-tetrahydropyridine monkeys. J Pharmacol Exp Ther, 290, 1034-40. BLANDINI, F. 2005. Neuroprotection by rasagiline: a new therapeutic approach to Parkinson's disease? CNS Drug Rev, 11, 183-94. BLANDINI, F., ARMENTERO, M. T., FANCELLU, R., BLAUGRUND, E. & NAPPI, G. 2004. Neuroprotective effect of rasagiline in a rodent model of Parkinson's disease. Exp Neurol, 187, 455-9. BLANDINI, F. & GREENAMYRE, J. T. 1998. Prospects of glutamate antagonists in the therapy of Parkinson's disease. Fundamental & Clinical Pharmacology, 12, 4-12. BLOCK, M. L., ZECCA, L. & HONG, J. S. 2007. Microglia-mediated neurotoxicity: uncovering the molecular mechanisms. Nat Rev Neurosci, 8, 57-69. BLUM-DEGEN, D., MULLER, T., KUHN, W., GERLACH, M., PRZUNTEK, H. & RIEDERER, P. 1995. Interleukin-1 beta and interleukin-6 are elevated in the cerebrospinal fluid of Alzheimer's and de novo Parkinson's disease patients. Neurosci Lett, 202, 17-20. BOGAERTS, V., THEUNS, J. & VAN BROECKHOVEN, C. 2008. Genetic findings in Parkinson's disease and translation into treatment: a leading role for mitochondria? Genes Brain Behav, 7, 129- 51. BOGERTS, B., HANTSCH, J. & HERZER, M. 1983. A morphometric study of the dopamine-containing cell groups in the mesencephalon of normals, Parkinson patients, and schizophrenics. Biol Psychiatry, 18, 951-69. BONIFATI, V., RIZZU, P., VAN BAREN, M. J., SCHAAP, O., BREEDVELD, G. J., KRIEGER, E., DEKKER, M. C., SQUITIERI, F., IBANEZ, P., JOOSSE, M., VAN DONGEN, J. W., VANACORE, N., VAN SWIETEN, J. C., BRICE, A., MECO, G., VAN DUIJN, C. M., OOSTRA, B. A. & HEUTINK, P. 2003. Mutations in the DJ-1 gene associated with autosomal recessive early-onset parkinsonism. Science, 299, 256-9. BORDELON, Y. M., CHESSELET, M. F., NELSON, D., WELSH, F. & ERECINSKA, M. 1997. Energetic dysfunction in quinolinic acid-lesioned rat striatum. J Neurochem, 69, 1629-39. BORTOLATO, M., CHEN, K. & SHIH, J. C. 2008. Monoamine oxidase inactivation: From pathophysiology to therapeutics. Advanced Drug Delivery Reviews, 60, 1527-1533. BRAAK, H., DEL TREDICI, K., RUB, U., DE VOS, R. A., JANSEN STEUR, E. N. & BRAAK, E. 2003. Staging of brain pathology related to sporadic Parkinson's disease. Neurobiol Aging, 24, 197-211. BRAIDY, N., GRANT, R., ADAMS, S., BREW, B. J. & GUILLEMIN, G. J. 2009a. Mechanism for quinolinic Acid cytotoxicity in human astrocytes and neurons. Neurotox Res, 16, 77-86. BRAIDY, N., GRANT, R., ADAMS, S., BREW, B. J. & GUILLEMIN, G. J. 2009b. Mechanism for Quinolinic Acid Cytotoxicity in Human Astrocytes and Neurons. Neurotoxicity Research, 1-10. BRESLAUER, K. J., FRANK, R., BLOCKER, H. & MARKY, L. A. 1986. Predicting DNA duplex stability from the base sequence. Proc Natl Acad Sci U S A, 83, 3746-50.

226 References

BREWER, G. J. 1995. Serum-free B27/neurobasal medium supports differentiated growth of neurons from the striatum, substantia nigra, septum, cerebral cortex, cerebellum, and dentate gyrus. J Neurosci Res, 42, 674-83. BREWER, G. J., TORRICELLI, J. R., EVEGE, E. K. & PRICE, P. J. 1993. Optimized survival of hippocampal neurons in B27-supplemented Neurobasal, a new serum-free medium combination. J Neurosci Res, 35, 567-76. BREWER, G. J., TORRICELLI, J.R., EVEGE, E.K. AND PRICE, P.J. 1994. Neurobasal™ Medium/B27 supplement: a new serum-free medium combination for survival of neurons. Focus, 16, 6-9. BROOKS, A. I., CHADWICK, C. A., GELBARD, H. A., CORY-SLECHTA, D. A. & FEDEROFF, H. J. 1999. Paraquat elicited neurobehavioral syndrome caused by dopaminergic neuron loss. Brain Res, 823, 1-10. BROTCHIE, J. & FITZER-ATTAS, C. 2009. Mechanisms compensating for dopamine loss in early Parkinson disease. Neurology, 72, S32-8. BULLER, A. L., LARSON, H. C., SCHNEIDER, B. E., BEATON, J. A., MORRISETT, R. A. & MONAGHAN, D. T. 1994. The Molecular-Basis of Nmda Receptor Subtypes - Native Receptor Diversity Is Predicted by Subunit Composition. Journal of Neuroscience, 14, 5471-5484. BUTTIGLIONE, M., VITIELLO, F., SARDELLA, E., PETRONE, L., NARDULLI, M., FAVIA, P., D'AGOSTINO, R. & GRISTINA, R. 2007. Behaviour of SH-SY5Y neuroblastoma cell line grown in different media and on different chemically modified substrates. Biomaterials, 28, 2932-45. CAMPESAN, S., GREEN, E. W., BREDA, C., SATHYASAIKUMAR, K. V., MUCHOWSKI, P. J., SCHWARCZ, R., KYRIACOU, C. P. & GIORGINI, F. 2011. The Kynurenine Pathway Modulates Neurodegeneration in a Drosophila Model of Huntington's Disease. Current Biology, 21, 961- 966. CANNON, J. R. & GREENAMYRE, J. T. 2009. NeuN is not a reliable marker of dopamine neurons in rat substantia nigra. Neurosci Lett, 464, 14-7. CARNINCI, P. & HAYASHIZAKI, Y. 1999. High-efficiency full-length cDNA cloning. Cdna Preparation and Characterization, 303, 19-44. CARPENEDO, R., PITTALUGA, A., COZZI, A., ATTUCCI, S., GALLI, A., RAITERI, M. & MORONI, F. 2001. Presynaptic kynurenate-sensitive receptors inhibit glutamate release. Eur J Neurosci, 13, 2141-7. CASAREJOS, M. J., MENENDEZ, J., SOLANO, R. M., RODRIGUEZ-NAVARRO, J. A., GARCIA DE YEBENES, J. & MENA, M. A. 2006. Susceptibility to rotenone is increased in neurons from parkin null mice and is reduced by minocycline. J Neurochem, 97, 934-46. CASSARINO, D. S., FALL, C. P., SMITH, T. S. & BENNETT, J. P., JR. 1998. Pramipexole reduces reactive oxygen species production in vivo and in vitro and inhibits the mitochondrial permeability transition produced by the parkinsonian neurotoxin methylpyridinium ion. J Neurochem, 71, 295-301. CASTANO, A., HERRERA, A. J., CANO, J. & MACHADO, A. 1998. Lipopolysaccharide intranigral injection induces inflammatory reaction and damage in nigrostriatal dopaminergic system. J Neurochem, 70, 1584-92. CERNAIANU, G., BRANDMAIER, P., SCHOLZ, G., ACKERMANN, O. P., ALT, R., ROTHE, K., CROSS, M., WITZIGMANN, H. & TROBS, R. B. 2008a. All-trans retinoic acid arrests neuroblastoma cells in a dormant state. Subsequent nerve growth factor/brain-derived neurotrophic factor treatment adds modest benefit. Journal of Pediatric Surgery, 43, 1284-1294. CERNAIANU, G., BRANDMAIER, P., SCHOLZ, G., ACKERMANN, O. P., ALT, R., ROTHE, K., CROSS, M., WITZIGMANN, H. & TROBS, R. B. 2008b. All-trans retinoic acid arrests neuroblastoma cells in a dormant state. Subsequent nerve growth factor/brain-derived neurotrophic factor treatment adds modest benefit. J Pediatr Surg, 43, 1284-94. CHANG, R. C. C., SUEN, K. C., MA, C. H., ELYAMAN, W., NG, H. K. & HUGON, J. 2002. Involvement of double-stranded RNA-dependent protein kinase and phosphorylation of eukaryotic initiation factor-2 alpha in neuronal degeneration. Journal of Neurochemistry, 83, 1215-1225.

227 References

CHANG, V. C. & CHOU, K. L. 2006. Deep brain stimulation for Parkinson's disease: patient selection and motor outcomes. Med Health R I, 89, 142-4. CHAO, C. C., HU, S., EHRLICH, L. & PETERSON, P. K. 1995. Interleukin-1 and tumor necrosis factor- alpha synergistically mediate neurotoxicity: involvement of nitric oxide and of N-methyl-D- aspartate receptors. Brain Behav Immun, 9, 355-65. CHAO, C. C., HU, S., MOLITOR, T. W., SHASKAN, E. G. & PETERSON, P. K. 1992. Activated microglia mediate neuronal cell injury via a nitric oxide mechanism. J Immunol, 149, 2736-41. CHARLES, P. D., DOLHUN, R. M., GILL, C. E., DAVIS, T. L., BLITON, M. J., TRAMONTANA, M. G., SALOMON, R. M., WANG, L., HEDERA, P., PHIBBS, F. T., NEIMAT, J. S. & KONRAD, P. E. 2011. Deep brain stimulation in early Parkinson's disease: Enrollment experience from a pilot trial. Parkinsonism Relat Disord. CHEN, H., JACOBS, E., SCHWARZSCHILD, M. A., MCCULLOUGH, M. L., CALLE, E. E., THUN, M. J. & ASCHERIO, A. 2005. Nonsteroidal antiinflammatory drug use and the risk for Parkinson's disease. Ann Neurol, 58, 963-7. CHEN, H., O'REILLY, E. J., SCHWARZSCHILD, M. A. & ASCHERIO, A. 2008. Peripheral inflammatory biomarkers and risk of Parkinson's disease. Am J Epidemiol, 167, 90-5. CHEN, H., ZHANG, S. M., HERNAN, M. A., SCHWARZSCHILD, M. A., WILLETT, W. C., COLDITZ, G. A., SPEIZER, F. E. & ASCHERIO, A. 2003. Nonsteroidal anti-inflammatory drugs and the risk of Parkinson disease. Arch Neurol, 60, 1059-64. CHEN, Q., SURMEIER, D. J. & REINER, A. 1999. NMDA and non-NMDA receptor-mediated excitotoxicity are potentiated in cultured striatal neurons by prior chronic depolarization. Exp Neurol, 159, 283-96. CHEN, R. S., HUANG, C. C. & CHU, N. S. 1997. Coenzyme Q(10) treatment in mitochondrial encephalomyopathies - Short-term double-blind, crossover study. European Neurology, 37, 212-218. CHEN, Y., BREW, B. J. & GUILLEMIN, G. J. 2011. Characterization of the kynurenine pathway in NSC- 34 cell line: implications for amyotrophic lateral sclerosis. J Neurochem, 118, 816-25. CHEN, Y., STANKOVIC, R., CULLEN, K. M., MEININGER, V., GARNER, B., COGGAN, S., GRANT, R., BREW, B. J. & GUILLEMIN, G. J. 2009. The Kynurenine Pathway and Inflammation in Amyotrophic Lateral Sclerosis. Neurotox Res. CHEUNG, Y. T., LAU, W. K. W., YU, M. S., LAI, C. S. W., YEUNG, S. C., SO, K. F. & CHANG, R. C. C. 2009. Effects of all-trans-retinoic acid on human SH-SY5Y neuroblastoma as in vitro model in neurotoxicity research. Neurotoxicology, 30, 127-135. CHIARUGI, A., MELI, E. & MORONI, F. 2001. Similarities and differences in the neuronal death processes activated by 3OH-kynurenine and quinolinic acid. J Neurochem, 77, 1310-8. CHINTA, S. J. & ANDERSEN, J. K. 2005. Dopaminergic neurons. Int J Biochem Cell Biol, 37, 942-6. CHOI, D. W. 1995. Calcium: still center-stage in hypoxic-ischemic neuronal death. Trends Neurosci, 18, 58-60. CHOI, J., SULLARDS, M. C., OLZMANN, J. A., REES, H. D., WEINTRAUB, S. T., BOSTWICK, D. E., GEARING, M., LEVEY, A. I., CHIN, L. S. & LI, L. 2006. Oxidative damage of DJ-1 is linked to sporadic Parkinson and Alzheimer diseases. J Biol Chem, 281, 10816-24. CHUNG, S., SHIN, B. S., HWANG, M., LARDARO, T., KANG, U. J., ISACSON, O. & KIM, K. S. 2006. Neural precursors derived from embryonic stem cells, but not those from fetal ventral mesencephalon, maintain the potential to differentiate into dopaminergic neurons after expansion in vitro. Stem Cells, 24, 1583-93. CICCONE, C. D. 1998. Free-radical toxicity and antioxidant medications in Parkinson's disease. Physical Therapy, 78, 313-319. CLARK, I. E., DODSON, M. W., JIANG, C., CAO, J. H., HUH, J. R., SEOL, J. H., YOO, S. J., HAY, B. A. & GUO, M. 2006. Drosophila pink1 is required for mitochondrial function and interacts genetically with parkin. Nature, 441, 1162-6.

228 References

COCKHILL, J., JHAMANDAS, K., BOEGMAN, R. J. & BENINGER, R. J. 1992. Action of picolinic acid and structurally related pyridine carboxylic acids on quinolinic acid-induced cortical cholinergic damage. Brain Res, 599, 57-63. CONNOP, B. P., BOEGMAN, R. J., JHAMANDAS, K. & BENINGER, R. J. 1995. Excitotoxic action of NMDA agonists on nigrostriatal dopaminergic neurons: modulation by inhibition of nitric oxide synthesis. Brain Res, 676, 124-32. CONTESTABILE, A. 2001. Antioxidant strategies for neurodegenerative diseases. Expert Opinion on Therapeutic Patents, 11, 573-585. COSSETTE, M., LEVESQUE, D. & PARENT, A. 2005. Neurochemical characterization of dopaminergic neurons in human striatum. Parkinsonism Relat Disord, 11, 277-86. COSTELLO, S., COCKBURN, M., BRONSTEIN, J., ZHANG, X. & RITZ, B. 2009. Parkinson's disease and residential exposure to maneb and paraquat from agricultural applications in the central valley of California. Am J Epidemiol, 169, 919-26. COTZIAS, G. C., PAPAVASI.PS & GELLENE, R. 1969. Modification of Parkinsonism - Chronic Treatment with L-Dopa. New England Journal of Medicine, 280, 337-&. COULTER, C. L., HAPPE, H. K., BERGMAN, D. A. & MURRIN, L. C. 1995. Localization and quantification of the dopamine transporter: comparison of [3H]WIN 35,428 and [125I]RTI-55. Brain Res, 690, 217-24. COULTER, C. L., HAPPE, H. K. & MURRIN, L. C. 1997. Dopamine transporter development in postnatal rat striatum: an autoradiographic study with [3H]WIN 35,428. Brain Res Dev Brain Res, 104, 55-62. COUNIHAN, T. J., LANDWEHRMEYER, G. B., STANDAERT, D. G., KOSINSKI, C. M., SCHERZER, C. R., DAGGETT, L. P., VELICELEBI, G., YOUNG, A. B. & PENNEY, J. B., JR. 1998. Expression of N- methyl-D-aspartate receptor subunit mRNA in the human brain: mesencephalic dopaminergic neurons. J Comp Neurol, 390, 91-101. COUZIN, J. 2004. Clinical trials. Halt of Celebrex study threatens drug's future, other trials. Science, 306, 2170. COZZI, A., CARPENEDO, R. & MORONI, F. 1999. Kynurenine hydroxylase inhibitors reduce ischemic brain damage: studies with (m-nitrobenzoyl)-alanine (mNBA) and 3,4-dimethoxy-[-N-4- (nitrophenyl)thiazol-2yl]-benzenesulfonamide (Ro 61-8048) in models of focal or global brain ischemia. J Cereb Blood Flow Metab, 19, 771-7. CROISIER, E., MORAN, L. B., DEXTER, D. T., PEARCE, R. K. & GRAEBER, M. B. 2005. Microglial inflammation in the parkinsonian substantia nigra: relationship to alpha-synuclein deposition. J Neuroinflammation, 2, 14. CROSBY, N., DEANE, K. H. & CLARKE, C. E. 2003. Amantadine in Parkinson's disease. Cochrane Database Syst Rev, CD003468. CROSSMAN, A. R. 2000. Functional anatomy of movement disorders. J Anat, 196 ( Pt 4), 519-25. D'HAENE, B., VANDESOMPELE, J. & HELLEMANS, J. 2010. Accurate and objective copy number profiling using real-time quantitative PCR. Methods, 50, 262-70. DAI, X. C. & ZHU, B. T. 2010. Indoleamine 2,3-Dioxygenase Tissue Distribution and Cellular Localization in Mice: Implications for Its Biological Functions. Journal of Histochemistry & Cytochemistry, 58, 17-28. DANYSZ, W. & PARSONS, C. G. 1998. Glycine and N-methyl-D-aspartate receptors: Physiological significance and possible therapeutic applications. Pharmacological Reviews, 50, 597-664. DARIOS, F., CORTI, O., LUCKING, C. B., HAMPE, C., MURIEL, M. P., ABBAS, N., GU, W. J., HIRSCH, E. C., ROONEY, T., RUBERG, M. & BRICE, A. 2003. Parkin prevents mitochondrial swelling and cytochrome c release in mitochondria-dependent cell death. Hum Mol Genet, 12, 517-26. DAUER, W. & PRZEDBORSKI, S. 2003. Parkinson's disease: mechanisms and models. Neuron, 39, 889- 909. DAWSON, T., MANDIR, A. & LEE, M. 2002. Animal models of PD: pieces of the same puzzle? Neuron, 35, 219-22.

229 References

DE ARRIBA, S. G., KRUGEL, U., REGENTHAL, R., VISSIENNON, Z., VERDAGUER, E., LEWERENZ, A., GARCIA-JORDA, E., PALLAS, M., CAMINS, A., MUNCH, G., NIEBER, K. & ALLGAIER, C. 2006. Carbonyl stress and NMDA receptor activation contribute to methylglyoxal neurotoxicity. Free Radic Biol Med, 40, 779-90. DELGADO, M. & GANEA, D. 2003. Neuroprotective effect of vasoactive intestinal peptide (VIP) in a mouse model of Parkinson's disease by blocking microglial activation. FASEB J, 17, 944-6. DELIVOPOULOS, E. & MURRAY, A. F. 2011. Controlled adhesion and growth of long term glial and neuronal cultures on Parylene-C. PLoS One, 6, e25411. DELREE, P., LEPRINCE, P., SCHOENEN, J. & MOONEN, G. 1989. Purification and culture of adult rat dorsal root ganglia neurons. J Neurosci Res, 23, 198-206. DEUSCHL, G., SCHADE-BRITTINGER, C., KRACK, P., VOLKMANN, J., SCHAFER, H., BOTZEL, K., DANIELS, C., DEUTSCHLANDER, A., DILLMANN, U., EISNER, W., GRUBER, D., HAMEL, W., HERZOG, J., HILKER, R., KLEBE, S., KLOSS, M., KOY, J., KRAUSE, M., KUPSCH, A., LORENZ, D., LORENZL, S., MEHDORN, H. M., MORINGLANE, J. R., OERTEL, W., PINSKER, M. O., REICHMANN, H., REUSS, A., SCHNEIDER, G. H., SCHNITZLER, A., STEUDE, U., STURM, V., TIMMERMANN, L., TRONNIER, V., TROTTENBERG, T., WOJTECKI, L., WOLF, E., POEWE, W. & VOGES, J. 2006. A randomized trial of deep-brain stimulation for Parkinson's disease. N Engl J Med, 355, 896-908. DEXTER, D. T., CARTER, C. J., WELLS, F. R., JAVOY-AGID, F., AGID, Y., LEES, A., JENNER, P. & MARSDEN, C. D. 1989. Basal lipid peroxidation in substantia nigra is increased in Parkinson's disease. J Neurochem, 52, 381-9. DIEFFENBACH, C. W., LOWE, T. M. & DVEKSLER, G. S. 1993. General concepts for PCR primer design. PCR Methods Appl, 3, S30-7. DILGER, R. N. & JOHNSON, R. W. 2008. Aging, microglial cell priming, and the discordant central inflammatory response to signals from the peripheral immune system. J Leukoc Biol, 84, 932- 9. DIMITROULAKOS, J., SQUIRE, J., PAWLIN, G. & YEGER, H. 1994. NUB-7: a stable I-type human neuroblastoma cell line inducible along N- and S-type cell lineages. Cell Growth & Differentiation, 5, 373-84. DOBROVOLSKY, V. N., BOWYER, J. F., PABARCUS, M. K., HEFLICH, R. H., WILLIAMS, L. D., DOERGE, D. R., ARVIDSSON, B., BERGQUIST, J. & CASIDA, J. E. 2005a. Effect of arylformamidase (kynurenine formamidase) gene inactivation in mice on enzymatic activity, kynurenine pathway metabolites and phenotype. Biochimica Et Biophysica Acta-General Subjects, 1724, 163-172. DOBROVOLSKY, V. N., BOWYER, J. F., PABARCUS, M. K., HEFLICH, R. H., WILLIAMS, L. D., DOERGE, D. R., ARVIDSSON, B., BERGQUIST, J. & CASIDA, J. E. 2005b. Effect of arylformamidase (kynurenine formamidase) gene inactivation in mice on enzymatic activity, kynurenine pathway metabolites and phenotype. Biochim Biophys Acta, 1724, 163-72. DOO, A. R., KIM, S. N., PARK, J. Y., CHO, K. H., HONG, J., EUN-KYUNG, K., MOON, S. K., JUNG, W. S., LEE, H., JUNG, J. H. & PARK, H. J. 2010. Neuroprotective effects of an herbal medicine, Yi-Gan San on MPP+/MPTP-induced cytotoxicity in vitro and in vivo. J Ethnopharmacol, 131, 433-42. DRINGEN, R., GUTTERER, J. M. & HIRRLINGER, J. 2000. Glutathione metabolism in brain metabolic interaction between astrocytes and neurons in the defense against reactive oxygen species. Eur J Biochem, 267, 4912-6. DYKENS, J. A. 1994. Isolated Cerebral and Cerebellar Mitochondria Produce Free-Radicals When Exposed to Elevated Ca2+ and Na+ - Implications for Neurodegeneration. Journal of Neurochemistry, 63, 584-591. EBADI, M., SHARMA, S., SHAVALI, S., SANGCHOT, P. & BREKKE, L. 2002. The multiple actions of selegiline. Proc West Pharmacol Soc, 45, 39-41. EBADI, M., SRINIVASAN, S. K. & BAXI, M. D. 1996. Oxidative stress and antioxidant therapy in Parkinson's disease. Prog Neurobiol, 48, 1-19.

230 References

EDSJO, A., LAVENIUS, E., NILSSON, H., HOEHNER, J. C., SIMONSSON, P., CULP, L. A., MARTINSSON, T., LARSSON, C. & PAHLMAN, S. 2003. Expression of trkB in human neuroblastoma in relation to MYCN expression and retinoic acid treatment. Lab Invest, 83, 813-23. EGEA, J., GARCIA, A. G., VERGES, J., MONTELL, E. & LOPEZ, M. G. 2010. Antioxidant, antiinflammatory and neuroprotective actions of chondroitin sulfate and proteoglycans. Osteoarthritis Cartilage, 18 Suppl 1, S24-7. ELIZAN, T. S. & CASALS, J. 1983. The viral hypothesis in parkinsonism. J Neural Transm Suppl, 19, 75- 88. ENCINAS, M., IGLESIAS, M., LIU, Y., WANG, H., MUHAISEN, A., CENA, V., GALLEGO, C. & COMELLA, J. X. 2000a. Sequential treatment of SH-SY5Y cells with retinoic acid and brain-derived neurotrophic factor gives rise to fully differentiated, neurotrophic factor-dependent, human neuron-like cells. J Neurochem, 75, 991-1003. ENCINAS, M., IGLESIAS, M., LIU, Y. H., WANG, H. Y., MUHAISEN, A., CENA, V., GALLEGO, C. & COMELLA, J. X. 2000b. Sequential treatment of SH-SY5Y cells with retinoic acid and brain- derived neurotrophic factor gives rise to fully differentiated, neurotrophic factor-dependent, human neuron-like cells. Journal of Neurochemistry, 75, 991-1003. ENGBER, T. M., PAPA, S. M., BOLDRY, R. C. & CHASE, T. N. 1994. NMDA receptor blockade reverses motor response alterations induced by levodopa. Neuroreport, 5, 2586-8. EPAND, R. M. 1982. The role of dietary ergothioneine in the development of diabetes mellitus. Med Hypotheses, 9, 207-13. ERDO, S. L. & SCHAFER, M. 1991. Memantine is highly potent in protecting cortical cultures against excitotoxic cell death evoked by glutamate and N-methyl-D-aspartate. Eur J Pharmacol, 198, 215-7. ERNSTER, L. & DALLNER, G. 1995. Biochemical, Physiological and Medical Aspects of Ubiquinone Function. Biochimica Et Biophysica Acta-Molecular Basis of Disease, 1271, 195-204. ERWIN, V. G. & HELLERMA.L 1967. Mitochondrial Monoamine Oxidase . Characterization of Bovine Kidney Enzyme. Federation Proceedings, 26, 843-&. ESPEY, M. G., CHERNYSHEV, O. N., REINHARD, J. F., JR., NAMBOODIRI, M. A. & COLTON, C. A. 1997. Activated human microglia produce the excitotoxin quinolinic acid. Neuroreport, 8, 431-4. ESPOSITO, E., DI MATTEO, V., BENIGNO, A., PIERUCCI, M., CRESCIMANNO, G. & DI GIOVANNI, G. 2007. Non-steroidal anti-inflammatory drugs in Parkinson's disease. Exp Neurol, 205, 295- 312. ESTRADA SANCHEZ, A. M., MEJIA-TOIBER, J. & MASSIEU, L. 2008. Excitotoxic neuronal death and the pathogenesis of Huntington's disease. Arch Med Res, 39, 265-76. ETMINAN, M., GILL, S. S. & SAMII, A. 2005. Intake of vitamin E, vitamin C, and carotenoids and the risk of Parkinson's disease: a meta-analysis. Lancet Neurology, 4, 362-365. EVANS, A. H., STRAFELLA, A. P., WEINTRAUB, D. & STACY, M. 2009. Impulsive and compulsive behaviors in Parkinson's disease. Mov Disord, 24, 1561-70. EZOULIN, M. J., OMBETTA, J. E., DUTERTRE-CATELLA, H., WARNET, J. M. & MASSICOT, F. 2008. Antioxidative properties of galantamine on neuronal damage induced by hydrogen peroxide in SK-N-SH cells. Neurotoxicology, 29, 270-7. FAGERSTROM, S., PAHLMAN, S., GESTBLOM, C. & NANBERG, E. 1996. Protein kinase C-epsilon is implicated in neurite outgrowth in differentiating human neuroblastoma cells. Cell Growth & Differentiation, 7, 775-785. FAHN, S. 2000. The spectrum of levodopa-induced dyskinesias. Annals of Neurology, 47, S2-S11. FALLARINO, F., GENAZZANI, A. A., SILLA, S., L'EPISCOPO, M. R., CAMICI, O., CORAZZI, L., NICOLETTI, F. & FIORETTI, M. C. 1995. [3H]aniracetam binds to specific recognition sites in brain membranes. J Neurochem, 65, 912-8. FARRER, M. J. 2006. Genetics of Parkinson disease: paradigm shifts and future prospects. Nat Rev Genet, 7, 306-18.

231 References

FASANO, C., THIBAULT, D. & TRUDEAU, L. E. 2008. Culture of postnatal mesencephalic dopamine neurons on an astrocyte monolayer. Curr Protoc Neurosci, Chapter 3, Unit 3 21. FELDBLUM, S., ROUGIER, A., LOISEAU, H., LOISEAU, P., COHADON, F., MORSELLI, P. L. & LLOYD, K. G. 1988. Quinolinic Phosphoribosyl Transferase-Activity Is Decreased in Epileptic Human-Brain Tissue. Epilepsia, 29, 523-529. FENG, J. 2006. Microtubule: a common target for parkin and Parkinson's disease toxins. Neuroscientist, 12, 469-76. FERRE, S., FREDHOLM, B. B., MORELLI, M., POPOLI, P. & FUXE, K. 1997. Adenosine-dopamine receptor-receptor interactions as an integrative mechanism in the basal ganglia. Trends Neurosci, 20, 482-7. FERRE, S., O'CONNOR, W. T., FUXE, K. & UNGERSTEDT, U. 1993. The striopallidal neuron: a main locus for adenosine-dopamine interactions in the brain. J Neurosci, 13, 5402-6. FIEBICH, B. L., BIBER, K., LIEB, K., VAN CALKER, D., BERGER, M., BAUER, J. & GEBICKE-HAERTER, P. J. 1996. Cyclooxygenase-2 expression in rat microglia is induced by adenosine A2a-receptors. Glia, 18, 152-60. FINOTTI, N., CASTAGNA, L., MORETTI, A. & MARZATICO, F. 2000. Reduction of lipid peroxidation in different rat brain areas after cabergoline treatment. Pharmacol Res, 42, 287-91. FISCHER, P. A., JACOBI, P., SCHNEIDER, E. & SCHONBERGER, B. 1977. [Effects of intravenous administration of memantine in parkinsonian patients (author's transl)]. Arzneimittelforschung, 27, 1487-9. FLEIGE, S. & PFAFFL, M. W. 2006. RNA integrity and the effect on the real-time qRT-PCR performance. Mol Aspects Med, 27, 126-39. FOROUHAR, F., ANDERSON, J. L., MOWAT, C. G., VOROBIEV, S. M., HUSSAIN, A., ABASHIDZE, M., BRUCKMANN, C., THACKRAY, S. J., SEETHARAMAN, J., TUCKER, T., XIAO, R., MA, L. C., ZHAO, L., ACTON, T. B., MONTELIONE, G. T., CHAPMAN, S. K. & TONG, L. 2007. Molecular insights into substrate recognition and catalysis by tryptophan 2,3-dioxygenase. Proc Natl Acad Sci U S A, 104, 473-8. FORREST, C. M., MACKAY, G. M., OXFORD, L., STOY, N., STONE, T. W. & DARLINGTON, L. G. 2006. Kynurenine pathway metabolism in patients with osteoporosis after 2 years of drug treatment. Clin Exp Pharmacol Physiol, 33, 1078-87. FOSTER, A. C., VEZZANI, A., FRENCH, E. D. & SCHWARCZ, R. 1984. Kynurenic acid blocks neurotoxicity and seizures induced in rats by the related brain metabolite quinolinic acid. Neurosci Lett, 48, 273-8. FOSTER, A. C., WHETSELL, W. O., BIRD, E. D. & SCHWARCZ, R. 1985. Quinolinic Acid Phosphoribosyltransferase in Human and Rat-Brain - Activity in Huntingtons-Disease and in Quinolinate-Lesioned Rat Striatum. Brain Research, 336, 207-214. FOWLER, C. J. & TIPTON, K. F. 1984. On the substrate specificities of the two forms of monoamine oxidase. J Pharm Pharmacol, 36, 111-5. FRANKE, B., BAYATTI, N. & ENGELE, J. 2000a. Neurotrophins require distinct extracellular signals to promote the survival of CNS neurons in vitro. Experimental Neurology, 165, 125-135. FRANKE, B., BAYATTI, N. & ENGELE, J. 2000b. Neurotrophins require distinct extracellular signals to promote the survival of CNS neurons in vitro. Exp Neurol, 165, 125-35. FRIEDMAN, W. J., ALTIOK, N., FREDHOLM, B. B. & PERSSON, H. 1992. Mechanisms of nerve growth factor mRNA regulation by interleukin-1 beta in hippocampal cultures: role of second messengers. J Neurosci Res, 33, 37-46. FUJIGAKI, S., SAITO, K., SEKIKAWA, K., TONE, S., TAKIKAWA, O., FUJII, H., WADA, H., NOMA, A. & SEISHIMA, M. 2001. Lipopolysaccharide induction of indoleamine 2,3-dioxygenase is mediated dominantly by an IFN-gamma-independent mechanism. Eur J Immunol, 31, 2313- 8.

232 References

FUKUI, S., SCHWARCZ, R., RAPOPORT, S. I., TAKADA, Y. & SMITH, Q. R. 1991. Blood-brain barrier transport of kynurenines: implications for brain synthesis and metabolism. J Neurochem, 56, 2007-17. FUKUOKA, S., ISHIGURO, K., YANAGIHARA, K., TANABE, A., EGASHIRA, Y., SANADA, H. & SHIBATA, K. 2002. Identification and expression of a cDNA encoding human alpha-amino-beta- carboxymuconate-epsilon-semialdehyde decarboxylase (ACMSD). A key enzyme for the tryptophan-niacine pathway and "quinolinate hypothesis". J Biol Chem, 277, 35162-7. FUXE, K., STROMBERG, I., POPOLI, P., RIMONDINI-GIORGINI, R., TORVINEN, M., OGREN, S. O., FRANCO, R., AGNATI, L. F. & FERRE, S. 2001. Adenosine receptors and Parkinson's disease. Relevance of antagonistic adenosine and dopamine receptor interactions in the striatum. Adv Neurol, 86, 345-53. GAITONDE, S. V., QI, W., FALSEY, R. R., SIDELL, N. & MARTINEZ, J. D. 2001. Morphologic conversion of a neuroblastoma-derived cell line by E6-mediated p53 degradation. Cell Growth & Differentiation, 12, 19-27. GALLO, V., KINGSBURY, A., BALAZS, R. & JORGENSEN, O. S. 1987. The role of depolarization in the survival and differentiation of cerebellar granule cells in culture. J Neurosci, 7, 2203-13. GANDHI, S., MUQIT, M. M., STANYER, L., HEALY, D. G., ABOU-SLEIMAN, P. M., HARGREAVES, I., HEALES, S., GANGULY, M., PARSONS, L., LEES, A. J., LATCHMAN, D. S., HOLTON, J. L., WOOD, N. W. & REVESZ, T. 2006. PINK1 protein in normal human brain and Parkinson's disease. Brain, 129, 1720-31. GAO, H. M. & HONG, J. S. 2008. Why neurodegenerative diseases are progressive: uncontrolled inflammation drives disease progression. Trends Immunol, 29, 357-65. GAO, H. M., HONG, J. S., ZHANG, W. & LIU, B. 2002a. Distinct role for microglia in rotenone-induced degeneration of dopaminergic neurons. J Neurosci, 22, 782-90. GAO, H. M., JIANG, J., WILSON, B., ZHANG, W., HONG, J. S. & LIU, B. 2002b. Microglial activation- mediated delayed and progressive degeneration of rat nigral dopaminergic neurons: relevance to Parkinson's disease. J Neurochem, 81, 1285-97. GAO, H. M., KOTZBAUER, P. T., URYU, K., LEIGHT, S., TROJANOWSKI, J. Q. & LEE, V. M. 2008. Neuroinflammation and oxidation/nitration of alpha-synuclein linked to dopaminergic neurodegeneration. J Neurosci, 28, 7687-98. GAO, H. M., LIU, B., ZHANG, W. & HONG, J. S. 2003. Critical role of microglial NADPH oxidase-derived free radicals in the in vitro MPTP model of Parkinson's disease. FASEB J, 17, 1954-6. GAO, Q. G., CHEN, W. F., XIE, J. X. & WONG, M. S. 2009. Ginsenoside Rg1 protects against 6-OHDA- induced neurotoxicity in neuroblastoma SK-N-SH cells via IGF-I receptor and estrogen receptor pathways. J Neurochem, 109, 1338-47. GARTHWAITE, J. 1995. Neural Nitric-Oxide Signaling. Trends in Neurosciences, 18, 51-52. GASSER, T., HARDY, J. & MIZUNO, Y. 2011. Milestones in PD genetics. Mov Disord, 26, 1042-8. GEHRMANN, J., MATSUMOTO, Y. & KREUTZBERG, G. W. 1995. Microglia: intrinsic immuneffector cell of the brain. Brain Res Brain Res Rev, 20, 269-87. GELB, D. J., OLIVER, E. & GILMAN, S. 1999. Diagnostic criteria for Parkinson disease. Arch Neurol, 56, 33-9. GERHARD, A., PAVESE, N., HOTTON, G., TURKHEIMER, F., ES, M., HAMMERS, A., EGGERT, K., OERTEL, W., BANATI, R. B. & BROOKS, D. J. 2006. In vivo imaging of microglial activation with [11C](R)-PK11195 PET in idiopathic Parkinson's disease. Neurobiol Dis, 21, 404-12. GERLACH, M., RIEDERER, P., PRZUNTEK, H. & YOUDIM, M. B. 1991. MPTP mechanisms of neurotoxicity and their implications for Parkinson's disease. Eur J Pharmacol, 208, 273-86. GHORAYEB, I., PUSCHBAN, Z., FERNAGUT, P. O., SCHERFLER, C., ROULAND, R., WENNING, G. K. & TISON, F. 2001. Simultaneous intrastriatal 6-hydroxydopamine and quinolinic acid injection: a model of early-stage striatonigral degeneration. Exp Neurol, 167, 133-47.

233 References

GIMENEZ-CASSINA, A., LIM, F. & DIAZ-NIDO, J. 2006. Differentiation of a human neuroblastoma into neuron-like cells increases their susceptibility to transduction by herpesviral vectors. Journal of Neuroscience Research, 84, 755-767. GINZINGER, D. G. 2002. Gene quantification using real-time quantitative PCR: an emerging technology hits the mainstream. Exp Hematol, 30, 503-12. GOLDSTEIN, L. E., LEOPOLD, M. C., HUANG, X., ATWOOD, C. S., SAUNDERS, A. J., HARTSHORN, M., LIM, J. T., FAGET, K. Y., MUFFAT, J. A., SCARPA, R. C., CHYLACK, L. T., JR., BOWDEN, E. F., TANZI, R. E. & BUSH, A. I. 2000. 3-Hydroxykynurenine and 3-hydroxyanthranilic acid generate hydrogen peroxide and promote alpha-crystallin cross-linking by metal ion reduction. Biochemistry, 39, 7266-75. GOMEZ-SANTOS, C., AMBROSIO, S., VENTURA, F., FERRER, I. & REIRIZ, J. 2002. TGF-beta1 increases tyrosine hydroxylase expression by a mechanism blocked by BMP-2 in human neuroblastoma SH-SY5Y cells. Brain Res, 958, 152-60. GONZALEZ-ALEGRE, P. 2007. Therapeutic RNA interference for neurodegenerative diseases: From promise to progress. Pharmacol Ther, 114, 34-55. GRAHAM, D. G. 1979. On the origin and significance of neuromelanin. Arch Pathol Lab Med, 103, 359-62. GRANT, R. S., COGGAN, S. E. & SMYTHE, G. A. 2009. The physiological action of picolinic Acid in the human brain. Int J Tryptophan Res, 2, 71-9. GREEN, D. R. & KROEMER, G. 2004. The pathophysiology of mitochondrial cell death. Science, 305, 626-9. GREENAMYRE, J. T., ELLER, R. V., ZHANG, Z. M., OVADIA, A., KURLAN, R. & GASH, D. M. 1994. Antiparkinsonian Effects of Remacemide Hydrochloride, a Glutamate Antagonist, in Rodent and Primate Models of Parkinsons-Disease. Annals of Neurology, 35, 655-661. GREENAMYRE, J. T., MARAGOS, W. F., ALBIN, R. L., PENNEY, J. B. & YOUNG, A. B. 1988. Glutamate Transmission and Toxicity in Alzheimers-Disease. Progress in Neuro-Psychopharmacology & Biological Psychiatry, 12, 421-430. GREENAMYRE, J. T. & O'BRIEN, C. F. 1991. N-methyl-D-aspartate antagonists in the treatment of Parkinson's disease. Arch Neurol, 48, 977-81. GREENE, J. C., WHITWORTH, A. J., KUO, I., ANDREWS, L. A., FEANY, M. B. & PALLANCK, L. J. 2003. Mitochondrial pathology and apoptotic muscle degeneration in Drosophila parkin mutants. Proc Natl Acad Sci U S A, 100, 4078-83. GREENE, J. G. 2006. Gene expression profiles of brain dopamine neurons and relevance to neuropsychiatric disease. J Physiol, 575, 411-6. GREENE, L. A. & TISCHLER, A. S. 1976. Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proc Natl Acad Sci U S A, 73, 2424-8. GU, M., IRAVANI, M. M., COOPER, J. M., KING, D., JENNER, P. & SCHAPIRA, A. H. 2004. Pramipexole protects against apoptotic cell death by non-dopaminergic mechanisms. J Neurochem, 91, 1075-81. GUIDETTI, P., AMORI, L., SAPKO, M. T., OKUNO, E. & SCHWARCZ, R. 2007. Mitochondrial aspartate aminotransferase: a third kynurenate-producing enzyme in the mammalian brain. J Neurochem, 102, 103-11. GUIDETTI, P. & SCHWARCZ, R. 1999. 3-Hydroxykynurenine potentiates quinolinate but not NMDA toxicity in the rat striatum. Eur J Neurosci, 11, 3857-63. GUILLEMIN, G. J. 2012. Quinolinic acid, the inescapable neurotoxin. FEBS J. GUILLEMIN, G. J. & BREW, B. J. 2002a. Implications of the kynurenine pathway and quinolinic acid in Alzheimer's disease. Redox Rep, 7, 199-206. GUILLEMIN, G. J. & BREW, B. J. 2002b. Implications of the kynurenine pathway and quinolinic acid in Alzheimer's disease. Redox Report, 7, 199-206.

234 References

GUILLEMIN, G. J. & BREW, B. J. 2004. Microglia, macrophages, perivascular macrophages, and pericytes: A review of function and identification. Journal of Leukocyte Biology, 75, 388-397. GUILLEMIN, G. J., CROITORU-LAMOURY, J., DORMONT, D., ARMATI, P. J. & BREW, B. J. 2003a. Quinolinic acid upregulates chemokine production and chemokine receptor expression in astrocytes. GLIA, 41, 371-381. GUILLEMIN, G. J., CULLEN, K. M., LIM, C. K., SMYTHE, G. A., GARNER, B., KAPOOR, V., TAKIKAWA, O. & BREW, B. J. 2007a. Characterization of the kynurenine pathway in human neurons. J Neurosci, 27, 12884-92. GUILLEMIN, G. J., CULLEN, K. M., LIM, C. K., SMYTHE, G. A., GARNER, B., KAPOOR, V., TAKIKAWA, O. & BREW, B. J. 2007b. Characterization of the kynurenine pathway in human neurons. Journal of Neuroscience, 27, 12884-12892. GUILLEMIN, G. J., KERR, S. J. & BREW, B. J. 2005a. Involvement of quinolinic acid in AIDS dementia complex. Neurotox Res, 7, 103-23. GUILLEMIN, G. J., KERR, S. J., PEMBERTON, L. A., SMITH, D. G., SMYTHE, G. A., ARMATI, P. J. & BREW, B. J. 2001a. IFN-beta1b induces kynurenine pathway metabolism in human macrophages: potential implications for multiple sclerosis treatment. J Interferon Cytokine Res, 21, 1097- 101. GUILLEMIN, G. J., KERR, S. J., PEMBERTON, L. A., SMITH, D. G., SMYTHE, G. A., ARMATI, P. J. & BREW, B. J. 2001b. IFN-β 1b induces kynurenine pathway metabolism in human macrophages: Potential implications for multiple sclerosis treatment. Journal of Interferon and Cytokine Research, 21, 1097-1101. GUILLEMIN, G. J., KERR, S. J., SMYTHE, G. A., ARMATI, P. J. & BREW, B. J. 1999. Kynurenine pathway metabolism in human astrocytes. Adv Exp Med Biol, 467, 125-31. GUILLEMIN, G. J., KERR, S. J., SMYTHE, G. A., SMITH, D. G., KAPOOR, V., ARMATI, P. J., CROITORU, J. & BREW, B. J. 2001c. Kynurenine pathway metabolism in human astrocytes: A paradox for neuronal protection. Journal of Neurochemistry, 78, 842-853. GUILLEMIN, G. J., KERR, S. J., SMYTHE, G. A., SMITH, D. G., KAPOOR, V., ARMATI, P. J., CROITORU, J. & BREW, B. J. 2001d. Kynurenine pathway metabolism in human astrocytes: a paradox for neuronal protection. J Neurochem, 78, 842-53. GUILLEMIN, G. J., SMITH, D. G., SMYTHE, G. A., ARMATI, P. J. & BREW, B. J. 2003b. Expression of the kynurenine pathway enzymes in human microglia and macrophages. Adv Exp Med Biol, 527, 105-12. GUILLEMIN, G. J., SMYTHE, G., TAKIKAWA, O. & BREW, B. J. 2005b. Expression of indoleamine 2,3- dioxygenase and production of quinolinic acid by human microglia, astrocytes, and neurons. Glia, 49, 15-23. GUILLEMIN, G. J., WANG, L. & BREW, B. J. 2005c. Quinolinic acid selectively induces apoptosis of human astrocytes: potential role in AIDS dementia complex. J Neuroinflammation, 2, 16. GUTIERREZ, L., MAURIAT, M., PELLOUX, J., BELLINI, C. & VAN WUYTSWINKEL, O. 2008. Towards a systematic validation of references in real-time rt-PCR. Plant Cell, 20, 1734-5. GUTTMAN, M. 2006. Efficacy of istradefylline in Parkinson's disease patients treated with levodopa with motor response complications: results of the KW-6002US-018 study. Movement Disorders, 21, S585-S585. GUTTMAN, M., BOILEAU, I., WARSH, J., SAINT-CYR, J. A., GINOVART, N., MCCLUSKEY, T., HOULE, S., WILSON, A., MUNDO, E., RUSJAN, P., MEYER, J. & KISH, S. J. 2007. Brain serotonin transporter binding in non-depressed patients with Parkinson's disease. Eur J Neurol, 14, 523-8. HAKANSSON, A., WESTBERG, L., NILSSON, S., BUERVENICH, S., CARMINE, A., HOLMBERG, B., SYDOW, O., OLSON, L., JOHNELS, B., ERIKSSON, E. & NISSBRANDT, H. 2005. Interaction of polymorphisms in the genes encoding interleukin-6 and estrogen receptor beta on the susceptibility to Parkinson's disease. Am J Med Genet B Neuropsychiatr Genet, 133B, 88-92.

235 References

HALLETT, P. J. & STANDAERT, D. G. 2004. Rationale for and use of NMDA receptor antagonists in Parkinson's disease. Pharmacol Ther, 102, 155-74. HAMANN, M., SANDER, S. E. & RICHTER, A. 2008. Effects of the kynurenine 3-hydroxylase inhibitor Ro 61-8048 after intrastriatal injections on the severity of dystonia in the dt sz mutant. Eur J Pharmacol, 586, 156-9. HAMSHERE, M. L., BENNETT, P., WILLIAMS, N., SEGURADO, R., CARDNO, A., NORTON, N., LAMBERT, D., WILLIAMS, H., KIROV, G., CORVIN, A., HOLMANS, P., JONES, I., GILL, M., O'DONOVAN, M. C., OWEN, M. J. & CRADDOCK, N. 2005. Genomewide linkage scan in Schizoaffective disorder - Significant evidence for linkage at 1q42 close to DISC1, and suggestive evidence at 22q11 and 19p13. Archives of General Psychiatry, 62, 1081-1088. HAN, Q., CAI, T., TAGLE, D. A. & LI, J. Y. 2010. Structure, expression, and function of kynurenine aminotransferases in human and rodent brains. Cellular and Molecular Life Sciences, 67, 353-368. HAN, Q., ROBINSON, H., CAI, T., TAGLE, D. A. & LI, J. 2009. Biochemical and structural properties of mouse kynurenine aminotransferase III. Mol Cell Biol, 29, 784-93. HANTRAYE, P., BROUILLET, E., FERRANTE, R., PALFI, S., DOLAN, R., MATTHEWS, R. T. & BEAL, M. F. 1996. Inhibition of neuronal nitric oxide synthase prevents MPTP-induced parkinsonism in baboons. Nature Medicine, 2, 1017-1021. HARTAI, Z., KLIVENYI, P., JANAKY, T., PENKE, B., DUX, L. & VECSEI, L. 2005. Kynurenine metabolism in plasma and in red blood cells in Parkinson's disease. J Neurol Sci, 239, 31-5. HATANO, T., KUBO, S., SATO, S. & HATTORI, N. 2009. Pathogenesis of familial Parkinson's disease: new insights based on monogenic forms of Parkinson's disease. J Neurochem, 111, 1075-93. HAUSER, R. A., RASCOL, O., KORCZYN, A. D., JON STOESSL, A., WATTS, R. L., POEWE, W., DE DEYN, P. P. & LANG, A. E. 2007. Ten-year follow-up of Parkinson's disease patients randomized to initial therapy with ropinirole or levodopa. Mov Disord, 22, 2409-17. HAUSER, R. A., SHULMAN, L. M., TRUGMAN, J. M., ROBERTS, J. W., MORI, A., BALLERINI, R. & SUSSMAN, N. M. 2008. Study of istradefylline in patients with Parkinson's disease on levodopa with motor fluctuations. Mov Disord, 23, 2177-85. HAYES, G. M., WOODROOFE, M. N. & CUZNER, M. L. 1988. Microglia express MHC class II in normal and demyelinating human white matter. Ann N Y Acad Sci, 540, 501-3. HENCHCLIFFE, C. & BEAL, M. F. 2008. Mitochondrial biology and oxidative stress in Parkinson disease pathogenesis. Nat Clin Pract Neurol, 4, 600-9. HERAUD, C., HILAIRET, S., MULLER, J. M., LETERRIER, J. F. & CHADENEAU, C. 2004. Neuritogenesis induced by vasoactive intestinal peptide, pituitary adenylate cyclase-activating polypeptide, and peptide histidine methionine in SH-SY5y cells is associated with regulated expression of cytoskeleton mRNAs and proteins. J Neurosci Res, 75, 320-9. HERNAN, M. A., LOGROSCINO, G. & GARCIA RODRIGUEZ, L. A. 2006. Nonsteroidal anti-inflammatory drugs and the incidence of Parkinson disease. Neurology, 66, 1097-9. HEYES, M. P., CHEN, C. Y., MAJOR, E. O. & SAITO, K. 1997a. Different kynurenine pathway enzymes limit quinolinic acid formation by various human cell types. Biochem J, 326 ( Pt 2), 351-6. HEYES, M. P., SAITO, K., CHEN, C. Y., PROESCHOLDT, M. G., NOWAK, T. S., JR., LI, J., BEAGLES, K. E., PROESCHOLDT, M. A., ZITO, M. A., KAWAI, K. & MARKEY, S. P. 1997b. Species heterogeneity between gerbils and rats: quinolinate production by microglia and astrocytes and accumulations in response to ischemic brain injury and systemic immune activation. J Neurochem, 69, 1519-29. HEYES, M. P., SAITO, K. & MARKEY, S. P. 1992. Human macrophages convert L-tryptophan into the neurotoxin quinolinic acid. Biochem J, 283 ( Pt 3), 633-5. HICKEY, P. & STACY, M. Available and emerging treatments for Parkinson's disease: a review. Drug Des Devel Ther, 5, 241-54. HICKEY, W. F. & KIMURA, H. 1988. Perivascular microglial cells of the CNS are bone marrow-derived and present antigen in vivo. Science, 239, 290-2.

236 References

HIDER, R. C., ROY, S., MA, Y. M., LE KONG, X. & PRESTON, J. 2011. The potential application of iron chelators for the treatment of neurodegenerative diseases. Metallomics, 3, 239-49. HIRAMATSU, R., HARA, T., AKIMOTO, H., TAKIKAWA, O., KAWABE, T., ISOBE, K. & NAGASE, F. 2008. Cinnabarinic acid generated from 3-hydroxyanthranilic acid strongly induces apoptosis in thymocytes through the generation of reactive oxygen species and the induction of caspase. J Cell Biochem, 103, 42-53. HIRSCH, E. C. 2000. Glial cells and Parkinson's disease. J Neurol, 247 Suppl 2, II58-62. HIRSCH, E. C. & HUNOT, S. 2000. Nitric oxide, glial cells and neuronal degeneration in parkinsonism. Trends Pharmacol Sci, 21, 163-5. HITZEMAN, N. & RAFII, F. 2009. Dopamine agonists for early Parkinson disease. Am Fam Physician, 80, 28-30. HOGINS, J., CRAWFORD, D. C., ZORUMSKI, C. F. & MENNERICK, S. 2011. Excitotoxicity triggered by Neurobasal culture medium. PLoS One, 6, e25633. HOKARI, M., WU, H. Q., SCHWARCZ, R. & SMITH, Q. R. 1996. Facilitated brain uptake of 4- chlorokynurenine and conversion to 7-chlorokynurenic acid. Neuroreport, 8, 15-8. HOLLOWAY, R., SHOULSON, I., KIEBURTZ, K., MCDERMOTT, M., TARIOT, P., KAMP, C., DAY, D., SHINAMAN, A., FAHN, S., LANG, A., MAREK, K., SEIBYL, J., WEINER, W., WELSH, M., PAHWA, R., COE, S., BARCLAY, L., SUTHERLAND, L., HILDEBRAND, K., HUBBLE, J., WEEKS, C., LEWITT, P., MIYASAKI, J., DUFF, J., SIME, E., SUCHOWERSKY, O., STACY, M., KURTH, M., BREWER, M., HARRIGAN, M., RUSSELL, D. S., FUSSELL, B., FORD, B., DILLON, S., HAMMERSTAD, J., STONE, C., RILEY, D., RAINEY, P., STANDAERT, D., TENNIS, M., WOOTEN, F., ROST-RUFFNER, E., FACTOR, S., BROWN, D., JANKOVIC, J., ATASSI, F., KURLAN, R., GARDINER, I., PANISSET, M., AMYOT, D., HALL, J., RAJPUT, A., SHIRLEY, T., RODNITZKY, R., DOBSON, J., SHULTS, C., FONTAINE, D., WATERS, C., WELSH, M., SCHUMAN, S., PFEIFFER, R., RAST, S., PFEIFFER, B., BROCHT, A., CASACELI, C., DAIGNEAULT, S., HODGEMAN, K., HONSINGER, K., O'CONNELL, C., WATTS, A. & GRP, P. S. 2000. Pramipexole vs levodopa as initial treatment for Parkinson disease - A randomized controlled trial. Jama-Journal of the American Medical Association, 284, 1931-1938. HORCHLER, C. L., MCCAULEY, J. P., HALL, J. E., SNYDER, D. H., MOORE, W. C., HUDZIK, T. J. & CHAPDELAINE, M. J. 2007. Synthesis of novel quinolone and quinoline-2-carboxylic acid (4- morpholin-4-yl-phenyl)amides: A late-stage diversification approach to potent 5HT(1B) antagonists. Bioorganic & Medicinal Chemistry, 15, 939-950. HOTAMISLIGIL, G. S., GIRMEN, A. S., FINK, J. S., TIVOL, E., SHALISH, C., TROFATTER, J., BAENZIGER, J., DIAMOND, S., MARKHAM, C., SULLIVAN, J., GROWDON, J. & BREAKEFIELD, X. O. 1994. Hereditary Variations in Monoamine-Oxidase as a Risk Factor for Parkinsons-Disease. Movement Disorders, 9, 305-310. HUANG, Y., HENRY, C. J., DANTZER, R., JOHNSON, R. W. & GODBOUT, J. P. 2008. Exaggerated sickness behavior and brain proinflammatory cytokine expression in aged mice in response to intracerebroventricular lipopolysaccharide. Neurobiol Aging, 29, 1744-53. HUBBLE, J. P. 1998. Aging and the basal ganglia. Neurol Clin, 16, 649-57. HUNOT, S. & HIRSCH, E. C. 2003. Neuroinflammatory processes in Parkinson's disease. Ann Neurol, 53 Suppl 3, S49-58; discussion S58-60. HUOT, P., LEVESQUE, M. & PARENT, A. 2007. The fate of striatal dopaminergic neurons in Parkinson's disease and Huntington's chorea. Brain, 130, 222-32. HUTSON, S. 2001. Structure and function of branched chain aminotransferases. Prog Nucleic Acid Res Mol Biol, 70, 175-206. HYMAN, C., HOFER, M., BARDE, Y. A., JUHASZ, M., YANCOPOULOS, G. D., SQUINTO, S. P. & LINDSAY, R. M. 1991. BDNF is a neurotrophic factor for dopaminergic neurons of the substantia nigra. Nature, 350, 230-2. IBANA, J. A., BELLAND, R. J., ZEA, A. H., SCHUST, D. J., NAGAMATSU, T., ABDELRAHMAN, Y. M., TATE, D. J., BEATTY, W. L., AIYAR, A. A. & QUAYLE, A. J. 2011. Inhibition of indoleamine 2,3-

237 References

dioxygenase activity by levo-1-methyl tryptophan blocks gamma interferon-induced Chlamydia trachomatis persistence in human epithelial cells. Infect Immun, 79, 4425-37. IDA, M., SUZUKI, H., MORI, N., TAKETANI, S. & ARAKI, M. 2004. Neuro-p24 plays an essential role in neurite extension: antisense oligonucleotide inhibition of neurite extension in cultured DRG neurons and neuroblastoma cells. Neurosci Res, 50, 199-208. IKEDA, K., KUROKAWA, M., AOYAMA, S. & KUWANA, Y. 2002. Neuroprotection by adenosine A2A receptor blockade in experimental models of Parkinson's disease. J Neurochem, 80, 262-70. IKEDA, M., TSUJI, H., NAKAMURA, S., ICHIYAMA, A., NISHIZUKA, Y. & HAYAISHI, O. 1965. Studies on the Biosynthesis of Nicotinamide Adenine Dinucleotide. Ii. A Role of Picolinic Carboxylase in the Biosynthesis of Nicotinamide Adenine Dinucleotide from Tryptophan in Mammals. J Biol Chem, 240, 1395-401. IKONOMIDOU, C. & TURSKI, L. 1996. Neurodegenerative disorders: clues from glutamate and energy metabolism. Crit Rev Neurobiol, 10, 239-63. IMAMURA, K., HISHIKAWA, N., SAWADA, M., NAGATSU, T., YOSHIDA, M. & HASHIZUME, Y. 2003. Distribution of major histocompatibility complex class II-positive microglia and cytokine profile of Parkinson's disease brains. Acta Neuropathol, 106, 518-26. IMAMURA, K., TAKESHIMA, T., NAKASO, K. & NAKASHIMA, K. 2007. Homocysteine is toxic for dopaminergic neurons in primary mesencephalic culture. Neuroreport, 18, 1319-22. INZELBERG, R., BONUCCELLI, U., SCHECHTMAN, E., MINIOWICH, A., STRUGATSKY, R., CERAVOLO, R., LOGI, C., ROSSI, C., KLEIN, C. & RABEY, J. M. 2006. Association between amantadine and the onset of dementia in Parkinson's disease. Movement Disorders, 21, 1375-1379. IRAVANI, M. M., HADDON, C. O., COOPER, J. M., JENNER, P. & SCHAPIRA, A. H. 2006. Pramipexole protects against MPTP toxicity in non-human primates. J Neurochem, 96, 1315-21. ISHIDA, Y., NAGAI, A., KOBAYASHI, S. & KIM, S. U. 2006. Upregulation of protease-activated receptor- 1 in astrocytes in Parkinson disease: astrocyte-mediated neuroprotection through increased levels of glutathione peroxidase. J Neuropathol Exp Neurol, 65, 66-77. ISHIDOH, K., KAMEMURA, N., IMAGAWA, T., ODA, M., SAKURAI, J. & KATUNUMA, N. 2010. Quinolinate phosphoribosyl transferase, a key enzyme in de novo NAD(+) synthesis, suppresses spontaneous cell death by inhibiting overproduction of active-caspase-3. Biochimica Et Biophysica Acta-Molecular Cell Research, 1803, 527-533. ISHIHARA, L. S., CHEESBROUGH, A., BRAYNE, C. & SCHRAG, A. 2007. Estimated life expectancy of Parkinson's patients compared with the UK population. Journal of Neurology Neurosurgery and Psychiatry, 78, 1304-1309. JANA, S., MAITI, A. K., BAGH, M. B., BANERJEE, K., DAS, A., ROY, A. & CHAKRABARTI, S. 2007. Dopamine but not 3,4-dihydroxy phenylacetic acid (DOPAC) inhibits brain respiratory chain activity by autoxidation and mitochondria catalyzed oxidation to quinone products: implications in Parkinson's disease. Brain Res, 1139, 195-200. JANG, H., BOLTZ, D. A., WEBSTER, R. G. & SMEYNE, R. J. 2009. Viral parkinsonism. Biochim Biophys Acta, 1792, 714-21. JARRAYA, B., BOULET, S., RALPH, G. S., JAN, C., BONVENTO, G., AZZOUZ, M., MISKIN, J. E., SHIN, M., DELZESCAUX, T., DROUOT, X., HERARD, A. S., DAY, D. M., BROUILLET, E., KINGSMAN, S. M., HANTRAYE, P., MITROPHANOUS, K. A., MAZARAKIS, N. D. & PALFI, S. 2009. Dopamine gene therapy for Parkinson's disease in a nonhuman primate without associated dyskinesia. Sci Transl Med, 1, 2ra4. JENNER, P. 2003a. The contribution of the MPTP-treated primate model to the development of new treatment strategies for Parkinson's disease. Parkinsonism Relat Disord, 9, 131-7. JENNER, P. 2003b. Oxidative stress in Parkinson's disease. Ann Neurol, 53 Suppl 3, S26-36; discussion S36-8. JENNER, P. 2003c. Oxidative stress in Parkinson's disease. Annals of Neurology, 53, S26-S36. JENNER, P. 2008. Molecular mechanisms of L-DOPA-induced dyskinesia. Nat Rev Neurosci, 9, 665-77.

238 References

JENSEN, L. M. 1987. Phenotypic differentiation of aphidicolin-selected human neuroblastoma cultures after long-term exposure to nerve growth factor. Dev Biol, 120, 56-64. JENSEN, L. M., ZHANG, Y. & SHOOTER, E. M. 1992. Steady-State Polypeptide Modulations Associated with Nerve Growth-Factor (Ngf)-Induced Terminal Differentiation and Ngf Deprivation- Induced Apoptosis in Human Neuroblastoma-Cells. Journal of Biological Chemistry, 267, 19325-19333. JHAMANDAS, K., BOEGMAN, R. J., BENINGER, R. J. & BIALIK, M. 1990. Quinolinate-induced cortical cholinergic damage: modulation by tryptophan metabolites. Brain Res, 529, 185-91. JHAMANDAS, K. H., BOEGMAN, R. J., BENINGER, R. J. & FLESHER, S. 1998. Role of zinc in blockade of excitotoxic action of quinolinic acid by picolinic acid. Amino Acids, 14, 257-61. JOHNSON, S. W., SEUTIN, V. & NORTH, R. A. 1992. Burst firing in dopamine neurons induced by N- methyl-D-aspartate: role of electrogenic sodium pump. Science, 258, 665-7. JOSHI, S., GULERIA, R., PAN, J., DIPETTE, D. & SINGH, U. S. 2006. Retinoic acid receptors and tissue- transglutaminase mediate short-term effect of retinoic acid on migration and invasion of neuroblastoma SH-SY5Y cells. Oncogene, 25, 240-7. JOZEFCZUK, J. & ADJAYE, J. 2011. Quantitative real-time PCR-based analysis of gene expression. Methods Enzymol, 500, 99-109. KAECH, S., HUANG, C. F. & BANKER, G. 2012. Short-term high-resolution imaging of developing hippocampal neurons in culture. Cold Spring Harb Protoc, 2012. KAIHARA, M., PRICE, J. M. & TAKAHASHI, H. 1956. The conversion of kynurenic acid to quinaldic acid by humans and rats. J Biol Chem, 223, 705-8. KALONIA, H., KUMAR, P., NEHRU, B. & KUMAR, A. 2009. Neuroprotective effect of MK-801 against intra-striatal quinolinic acid induced behavioral, oxidative stress and cellular alterations in rats. Indian J Exp Biol, 47, 880-92. KANAI, M., NAKAMURA, T. & FUNAKOSHI, H. 2009. Implication of tryptophan 2,3-dioxygease and its novel variants in the hippocampus and cerebellum during development. Neuroscience Research, 65, S56-S56. KAPLAN, A., CROMIE, M. A., VOORHEES, J. J. & ELDER, J. T. 1993a. Induction of Crabp-Ii Messenger- Rna by Retinol, Retinal, and Synthetic Retinoids in Human Dermal Fibroblasts. Journal of Investigative Dermatology, 100, 490-490. KAPLAN, D. R., MATSUMOTO, K., LUCARELLI, E. & THIELE, C. J. 1993b. Induction of Trkb by Retinoic Acid Mediates Biologic Responsiveness to Bdnf and Differentiation of Human Neuroblastoma-Cells. Neuron, 11, 321-331. KAPLITT, M. G., FEIGIN, A., TANG, C., FITZSIMONS, H. L., MATTIS, P., LAWLOR, P. A., BLAND, R. J., YOUNG, D., STRYBING, K., EIDELBERG, D. & DURING, M. J. 2007. Safety and tolerability of gene therapy with an adeno-associated virus (AAV) borne GAD gene for Parkinson's disease: an open label, phase I trial. Lancet, 369, 2097-105. KAUR, D., RAJAGOPALAN, S. & ANDERSEN, J. K. 2009. Chronic expression of H-ferritin in dopaminergic midbrain neurons results in an age-related expansion of the labile iron pool and subsequent neurodegeneration: implications for Parkinson's disease. Brain Res, 1297, 17-22. KAUR, D., YANTIRI, F., RAJAGOPALAN, S., KUMAR, J., MO, J. O., BOONPLUEANG, R., VISWANATH, V., JACOBS, R., YANG, L., BEAL, M. F., DIMONTE, D., VOLITASKIS, I., ELLERBY, L., CHERNY, R. A., BUSH, A. I. & ANDERSEN, J. K. 2003. Genetic or pharmacological iron chelation prevents MPTP-induced neurotoxicity in vivo: A novel therapy for Parkinson's disease. Neuron, 37, 899-909. KAUR, S., OZER, H. & STARR, M. 1997. MK 801 reverses haloperidol-induced catalepsy from both striatal and extrastriatal sites in the rat brain. Eur J Pharmacol, 332, 153-60. KELLS, A. P., HENRY, R. A. & CONNOR, B. 2008. AAV-BDNF mediated attenuation of quinolinic acid- induced neuropathology and motor function impairment. Gene Ther, 15, 966-77.

239 References

KERR, S. J., ARMATI, P. J., GUILLEMIN, G. J. & BREW, B. J. 1998. Chronic exposure of human neurons to quinolinic acid results in neuronal changes consistent with AIDS dementia complex. AIDS, 12, 355-63. KHERADPEZHOUH, M., SHAVALI, S. & EBADI, M. 2003. Salsolinol causing parkinsonism activates endoplasmic reticulum-stress signaling pathways in human dopaminergic SK-N-SH cells. Neurosignals, 12, 315-24. KIKUCHI, A., TAKEDA, A., ONODERA, H., KIMPARA, T., HISANAGA, K., SATO, N., NUNOMURA, A., CASTELLANI, R. J., PERRY, G., SMITH, M. A. & ITOYAMA, Y. 2002. Systemic increase of oxidative nucleic acid damage in Parkinson's disease and multiple system atrophy. Neurobiol Dis, 9, 244-8. KIKUCHI, S. & KIM, S. U. 1993. Glutamate neurotoxicity in mesencephalic dopaminergic neurons in culture. J Neurosci Res, 36, 558-69. KIM, B., VAN GOLEN, C. M. & FELDMAN, E. L. 2004. Insulin-like growth factor-I signaling in human neuroblastoma cells. Oncogene, 23, 130-41. KIM, H. J., SUGIMORI, M., NAKAFUKU, M. & SVENDSEN, C. N. 2007a. Control of neurogenesis and tyrosine hydroxylase expression in neural progenitor cells through bHLH proteins and Nurr1. Exp Neurol, 203, 394-405. KIM, I. S., KO, H. M., KOPPULA, S., KIM, B. W. & CHOI, D. K. 2011a. Protective effect of Chrysanthemum indicum Linne against 1-methyl-4-phenylpridinium ion and lipopolysaccharide-induced cytotoxicity in cellular model of Parkinson's disease. Food Chem Toxicol, 49, 963-73. KIM, Y. H., BAEK, N. S., HAN, Y. H., CHUNG, M. A. & JUNG, S. D. 2011b. Enhancement of neuronal cell adhesion by covalent binding of poly-D-lysine. J Neurosci Methods, 202, 38-44. KIM, Y. S., CHOI, D. H., BLOCK, M. L., LORENZL, S., YANG, L., KIM, Y. J., SUGAMA, S., CHO, B. P., HWANG, O., BROWNE, S. E., KIM, S. Y., HONG, J. S., BEAL, M. F. & JOH, T. H. 2007b. A pivotal role of matrix metalloproteinase-3 activity in dopaminergic neuronal degeneration via microglial activation. FASEB J, 21, 179-87. KIM, Y. S. & JOH, T. H. 2006. Microglia, major player in the brain inflammation: their roles in the pathogenesis of Parkinson's disease. Exp Mol Med, 38, 333-47. KITAMURA, Y., KOSAKA, T., KAKIMURA, J. I., MATSUOKA, Y., KOHNO, Y., NOMURA, Y. & TANIGUCHI, T. 1998. Protective effects of the antiparkinsonian drugs talipexole and pramipexole against 1-methyl-4-phenylpyridinium-induced apoptotic death in human neuroblastoma SH-SY5Y cells. Mol Pharmacol, 54, 1046-54. KNOTT, C., STERN, G., KINGSBURY, A., WELCHER, A. A. & WILKIN, G. P. 2002. Elevated glial brain- derived neurotrophic factor in Parkinson's diseased nigra. Parkinsonism Relat Disord, 8, 329- 41. KNOTT, C., STERN, G. & WILKIN, G. P. 2000. Inflammatory regulators in Parkinson's disease: iNOS, lipocortin-1, and cyclooxygenases-1 and -2. Mol Cell Neurosci, 16, 724-39. KNYIHAR-CSILLIK, E., CSILLIK, B., PAKASKI, M., KRISZTIN-PEVA, B., DOBO, E., OKUNO, E. & VECSEI, L. 2004. Decreased expression of kynurenine aminotransferase-I (KAT-I) in the substantia nigra of mice after 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) treatment. Neuroscience, 126, 899-914. KO, L., MEHTA, N. D., FARRER, M., EASSON, C., HUSSEY, J., YEN, S., HARDY, J. & YEN, S. H. 2000. Sensitization of neuronal cells to oxidative stress with mutated human alpha-synuclein. J Neurochem, 75, 2546-54. KOH, J. Y. & CHOI, D. W. 1987. Quantitative determination of glutamate mediated cortical neuronal injury in cell culture by lactate dehydrogenase efflux assay. J Neurosci Methods, 20, 83-90. KOLLENSPERGER, M., STEFANOVA, N., REINDL, M., POEWE, W. & WENNING, G. K. 2007. Loss of dopaminergic responsiveness in a double lesion rat model of the Parkinson variant of multiple system atrophy. Mov Disord, 22, 353-8.

240 References

KORDOWER, J. H., CHU, Y., HAUSER, R. A., FREEMAN, T. B. & OLANOW, C. W. 2008. Lewy body-like pathology in long-term embryonic nigral transplants in Parkinson's disease. Nat Med, 14, 504-6. KOUTSILIERI, E., SCHELLER, C., GRUNBLATT, E., NARA, K., LI, J. & RIEDERER, P. 2002. Free radicals in Parkinson's disease. J Neurol, 249 Suppl 2, II1-5. KREUTZBERG, G. W. 1996. Microglia: a sensor for pathological events in the CNS. Trends Neurosci, 19, 312-8. KULIKOV, A. V., RZHANINOVA, A. A., GOLDSHTEIN, D. V. & BOLDYREV, A. A. 2007. Expression of NMDA receptors in multipotent stromal cells of human adipose tissue under conditions of retinoic acid-induced differentiation. Bull Exp Biol Med, 144, 626-9. KUME, T., KAWATO, Y., OSAKADA, F., IZUMI, Y., KATSUKI, H., NAKAGAWA, T., KANEKO, S., NIIDOME, T., TAKADA-TAKATORI, Y. & AKAIKE, A. 2008. Dibutyryl cyclic AMP induces differentiation of human neuroblastoma SH-SY5Y cells into a noradrenergic phenotype. Neurosci Lett, 443, 199-203. KUPSCH, A., SAUTTER, J., GOTZ, M. E., BREITHAUPT, W., SCHWARZ, J., YOUDIM, M. B., RIEDERER, P., GERLACH, M. & OERTEL, W. H. 2001. Monoamine oxidase-inhibition and MPTP-induced neurotoxicity in the non-human primate: comparison of rasagiline (TVP 1012) with selegiline. J Neural Transm, 108, 985-1009. KURODA, Y., MITSUI, T., KUNISHIGE, M., SHONO, M., AKAIKE, M., AZUMA, H. & MATSUMOTO, T. 2006. Parkin enhances mitochondrial biogenesis in proliferating cells. Hum Mol Genet, 15, 883-95. LANG, A. E., GILL, S., PATEL, N. K., LOZANO, A., NUTT, J. G., PENN, R., BROOKS, D. J., HOTTON, G., MORO, E., HEYWOOD, P., BRODSKY, M. A., BURCHIEL, K., KELLY, P., DALVI, A., SCOTT, B., STACY, M., TURNER, D., WOOTEN, V. G., ELIAS, W. J., LAWS, E. R., DHAWAN, V., STOESSL, A. J., MATCHAM, J., COFFEY, R. J. & TRAUB, M. 2006. Randomized controlled trial of intraputamenal glial cell line-derived neurotrophic factor infusion in Parkinson disease. Ann Neurol, 59, 459-66. LANGSTON, J. W., BALLARD, P., TETRUD, J. W. & IRWIN, I. 1983. Chronic Parkinsonism in humans due to a product of meperidine-analog synthesis. Science, 219, 979-80. LANGSTON, J. W. & BALLARD, P. A., JR. 1983. Parkinson's disease in a chemist working with 1- methyl-4-phenyl-1,2,5,6-tetrahydropyridine. N Engl J Med, 309, 310. LANGSTON, J. W., FORNO, L. S., TETRUD, J., REEVES, A. G., KAPLAN, J. A. & KARLUK, D. 1999. Evidence of active nerve cell degeneration in the substantia nigra of humans years after 1- methyl-4-phenyl-1,2,3,6-tetrahydropyridine exposure. Ann Neurol, 46, 598-605. LAU, W. K., LUI, P. W., WONG, C. K., CHAN, Y. S. & YUNG, K. K. 2003. Differential expression of N- methyl-D-aspartate receptor subunit messenger ribonucleic acids and immunoreactivity in the rat neostriatum during postnatal development. Neurochem Int, 43, 47-65. LAVOIE, B. & PARENT, A. 1990. Immunohistochemical study of the serotoninergic innervation of the basal ganglia in the squirrel monkey. J Comp Neurol, 299, 1-16. LE, W. D., JANKOVIC, J., XIE, W. & APPEL, S. H. 2000. Antioxidant property of pramipexole independent of dopamine receptor activation in neuroprotection. J Neural Transm, 107, 1165-73. LEE, M. C., TING, K. K., ADAMS, S., BREW, B. J., CHUNG, R. & GUILLEMIN, G. J. 2010. Characterisation of the expression of NMDA receptors in human astrocytes. PLoS One, 5, e14123. LEEDS, J. M., BROWN, P. J., MCGEEHAN, G. M., BROWN, F. K. & WISEMAN, J. S. 1993. Isotope effects and alternative substrate reactivities for tryptophan 2,3-dioxygenase. J Biol Chem, 268, 17781-6. LEEDS, P., LENG, Y., CHALECKA-FRANASZEK, E. & CHUANG, D. M. 2005. Neurotrophins protect against cytosine arabinoside-induced apoptosis of immature rat cerebellar neurons. Neurochem Int, 46, 61-72.

241 References

LEIPNITZ, G., SCHUMACHER, C., DALCIN, K. B., SCUSSIATO, K., SOLANO, A., FUNCHAL, C., DUTRA- FILHO, C. S., WYSE, A. T., WANNMACHER, C. M., LATINI, A. & WAJNER, M. 2007. In vitro evidence for an antioxidant role of 3-hydroxykynurenine and 3-hydroxyanthranilic acid in the brain. Neurochem Int, 50, 83-94. LEVI, A., BIOCCA, S., CATTANEO, A. & CALISSANO, P. 1988. The mode of action of nerve growth factor in PC12 cells. Mol Neurobiol, 2, 201-26. LEW, M. F. 2011. The evidence for disease modification in Parkinson's disease. Int J Neurosci, 121 Suppl 2, 18-26. LEWITT, P. A. 2008. Levodopa for the Treatment of Parkinson's Disease. New England Journal of Medicine, 359, 2468-2476. LEWITT, P. A., GUTTMAN, M., TETRUD, J. W., TUITE, P. J., MORI, A., CHAIKIN, P. & SUSSMAN, N. M. 2008. Adenosine A2A receptor antagonist istradefylline (KW-6002) reduces "off" time in Parkinson's disease: a double-blind, randomized, multicenter clinical trial (6002-US-005). Ann Neurol, 63, 295-302. LI, G., CUI, G., TZENG, N. S., WEI, S. J., WANG, T., BLOCK, M. L. & HONG, J. S. 2005. Femtomolar concentrations of dextromethorphan protect mesencephalic dopaminergic neurons from inflammatory damage. FASEB J, 19, 489-96. LI, J., YANG, J., ZHAO, P., LI, S., ZHANG, R., ZHANG, X., LIU, D. & ZHANG, B. 2011. Neuromelanin enhances the toxicity of alpha-synuclein in SK-N-SH cells. J Neural Transm. LIN, L. F., DOHERTY, D. H., LILE, J. D., BEKTESH, S. & COLLINS, F. 1993. GDNF: a glial cell line-derived neurotrophic factor for midbrain dopaminergic neurons. Science, 260, 1130-2. LIU, B., DU, L. & HONG, J. S. 2000. Naloxone protects rat dopaminergic neurons against inflammatory damage through inhibition of microglia activation and superoxide generation. J Pharmacol Exp Ther, 293, 607-17. LIU, B. & HONG, J. S. 2003. Role of microglia in inflammation-mediated neurodegenerative diseases: mechanisms and strategies for therapeutic intervention. J Pharmacol Exp Ther, 304, 1-7. LIU, H., WOZNICA, K., CATTON, G., CRAWFORD, A., BOTTING, N. & NAISMITH, J. H. 2007. Structural and kinetic characterization of quinolinate phosphoribosyltransferase (hQPRTase) from homo sapiens. J Mol Biol, 373, 755-63. LIU, X., SHIN, N., KOBLISH, H. K., YANG, G., WANG, Q., WANG, K., LEFFET, L., HANSBURY, M. J., THOMAS, B., RUPAR, M., WAELTZ, P., BOWMAN, K. J., POLAM, P., SPARKS, R. B., YUE, E. W., LI, Y., WYNN, R., FRIDMAN, J. S., BURN, T. C., COMBS, A. P., NEWTON, R. C. & SCHERLE, P. A. 2010. Selective inhibition of IDO1 effectively regulates mediators of antitumor immunity. Blood, 115, 3520-30. LIU, X., YANG, X., ZHANG, B., ZHANG, X., LU, H., ZHANG, J. & ZHANG, Y. 2011. High-resolution morphological identification and characterization of living neuroblastoma SK-N-SH cells by hopping probe ion conductance microscopy. Brain Res, 1386, 35-40. LIU, Y. & YANG, H. 2005. Environmental toxins and alpha-synuclein in Parkinson's disease. Mol Neurobiol, 31, 273-82. LIVAK, K. J. & SCHMITTGEN, T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 25, 402-8. LOPEZ, A. S., ALEGRE, E., DIAZ-LAGARES, A., GARCIA-GIRON, C., COMA, M. J. & GONZALEZ, A. 2008. Effect of 3-hydroxyanthranilic acid in the immunosuppressive molecules indoleamine dioxygenase and HLA-G in macrophages. Immunol Lett, 117, 91-5. LOVAT, P. E., PEARSON, A. D., MALCOLM, A. & REDFERN, C. P. 1993. Retinoic acid receptor expression during the in vitro differentiation of human neuroblastoma. Neurosci Lett, 162, 109-13. LUCAS, D. R. & NEWHOUSE, J. P. 1957. The toxic effect of sodium L-glutamate on the inner layers of the retina. AMA Arch Ophthalmol, 58, 193-201. LUCKI, I. 1998. The spectrum of behaviors influenced by serotonin. Biological Psychiatry, 44, 151- 162.

242 References

LUI, P. W., SUEN, K. C., CHAN, Y. S., YUNG, W. H. & YUNG, K. K. 2003. Striatal neurons but not nigral dopaminergic neurons in neonatal primary cell culture express endogenous functional N- methyl-D-aspartate receptors. Brain Res Mol Brain Res, 120, 9-21. LUNDBLAD, M., VAUDANO, E. & CENCI, M. A. 2003. Cellular and behavioural effects of the adenosine A2a receptor antagonist KW-6002 in a rat model of l-DOPA-induced dyskinesia. J Neurochem, 84, 1398-410. LUO, Z. G., ZENG, C. C., YANG, L. F., HE, H. Q., WANG, C. X. & HU, L. M. 2009. Synthesis of 6- sulfamoyl-4-oxoquinoline-3-carboxylic acid derivatives as integrase antagonists with anti-HIV activity. Chinese Chemical Letters, 20, 789-792. LUSTIG, H. S., AHERN, K. V. & GREENBERG, D. A. 1992. Antiparkinsonian drugs and in vitro excitotoxicity. Brain Res, 597, 148-50. MACCHIARULO, A., CAMAIONI, E., NUTI, R. & PELLICCIARI, R. 2009. Highlights at the gate of tryptophan catabolism: a review on the mechanisms of activation and regulation of indoleamine 2,3-dioxygenase (IDO), a novel target in cancer disease. Amino Acids, 37, 219- 229. MAESAWA, S., KANEOKE, Y., KAJITA, Y., USUI, N., MISAWA, N., NAKAYAMA, A. & YOSHIDA, J. 2004. Long-term stimulation of the subthalamic nucleus in hemiparkinsonian rats: neuroprotection of dopaminergic neurons. J Neurosurg, 100, 679-87. MAHER, S. G., ROMERO-WEAVER, A. L., SCARZELLO, A. J. & GAMERO, A. M. 2007. Interferon: cellular executioner or white knight? Curr Med Chem, 14, 1279-89. MAIWALD, S., WEHNER, R., SCHMITZ, M., BORNHAUSER, M., LOEB, S. & WASSMUTH, R. 2011. IDO1 and IDO2 gene expression analysis by quantitative polymerase chain reaction. Tissue Antigens, 77, 136-42. MANDEL, S., GRUNBLATT, E., RIEDERER, P., GERLACH, M., LEVITES, Y. & YOUDIM, M. B. 2003. Neuroprotective strategies in Parkinson's disease : an update on progress. CNS Drugs, 17, 729-62. MANNING-BOG, A. B. & LANGSTON, J. W. 2007. Model fusion, the next phase in developing animal models for Parkinson's disease. Neurotox Res, 11, 219-40. MAREK, K., SEIBYL, J., SHOULSON, I., HOLLOWAY, R., KIEBURTZ, K., MCDERMOTT, M., KAMP, C., SHINAMAN, A., FAHN, S., LANG, A., WEINER, W., WELSH, M. & PARKINSON STUDY, G. 2002. Dopamine transporter brain imaging to assess the effects of pramipexole vs levodopa on Parkinson disease progression. Jama-Journal of the American Medical Association, 287, 1653-1661. MARGOLIS, E. B., COKER, A. R., DRISCOLL, J. R., LEMAITRE, A. I. & FIELDS, H. L. 2010. Reliability in the identification of midbrain dopamine neurons. PLoS One, 5, e15222. MARIN, C., PAPA, S., ENGBER, T. M., BONASTRE, M., TOLOSA, E. & CHASE, T. N. 1996. MK-801 prevents levodopa-induced motor response alterations in parkinsonian rats. Brain Res, 736, 202-5. MARKS, W. J., JR., OSTREM, J. L., VERHAGEN, L., STARR, P. A., LARSON, P. S., BAKAY, R. A., TAYLOR, R., CAHN-WEINER, D. A., STOESSL, A. J., OLANOW, C. W. & BARTUS, R. T. 2008. Safety and tolerability of intraputaminal delivery of CERE-120 (adeno-associated virus serotype 2- neurturin) to patients with idiopathic Parkinson's disease: an open-label, phase I trial. Lancet Neurol, 7, 400-8. MARTIN, D. P., WALLACE, T. L. & JOHNSON, E. M., JR. 1990. Cytosine arabinoside kills postmitotic neurons in a fashion resembling trophic factor deprivation: evidence that a deoxycytidine- dependent process may be required for nerve growth factor signal transduction. J Neurosci, 10, 184-93. MARTIN, L. J., PAN, Y., PRICE, A. C., STERLING, W., COPELAND, N. G., JENKINS, N. A., PRICE, D. L. & LEE, M. K. 2006. Parkinson's disease alpha-synuclein transgenic mice develop neuronal mitochondrial degeneration and cell death. J Neurosci, 26, 41-50.

243 References

MARTINS, L. M., MORRISON, A., KLUPSCH, K., FEDELE, V., MOISOI, N., TEISMANN, P., ABUIN, A., GRAU, E., GEPPERT, M., LIVI, G. P., CREASY, C. L., MARTIN, A., HARGREAVES, I., HEALES, S. J., OKADA, H., BRANDNER, S., SCHULZ, J. B., MAK, T. & DOWNWARD, J. 2004. Neuroprotective role of the Reaper-related serine protease HtrA2/Omi revealed by targeted deletion in mice. Mol Cell Biol, 24, 9848-62. MARUYAMA, W., AKAO, Y., CARRILLO, M. C., KITANI, K., YOUDIUM, M. B. & NAOI, M. 2002. Neuroprotection by propargylamines in Parkinson's disease: suppression of apoptosis and induction of prosurvival genes. Neurotoxicol Teratol, 24, 675-82. MASLIAH, E., ROCKENSTEIN, E., ADAME, A., ALFORD, M., CREWS, L., HASHIMOTO, M., SEUBERT, P., LEE, M., GOLDSTEIN, J., CHILCOTE, T., GAMES, D. & SCHENK, D. 2005. Effects of alpha- synuclein immunization in a mouse model of Parkinson's disease. Neuron, 46, 857-68. MASTROENI, D., GROVER, A., LEONARD, B., JOYCE, J. N., COLEMAN, P. D., KOZIK, B., BELLINGER, D. L. & ROGERS, J. 2009a. Microglial responses to dopamine in a cell culture model of Parkinson's disease. Neurobiol Aging, 30, 1805-17. MASTROENI, D., GROVER, A., LEONARD, B., JOYCE, J. N., COLEMAN, P. D., KOZIK, B., BELLINGER, D. L. & ROGERS, J. 2009b. Microglial responses to dopamine in a cell culture model of Parkinson's disease. Neurobiology of Aging, 30, 1805-1817. MATSUSHIMA, H. & BOGENMANN, E. 1992. Bi-modal differentiation pattern in a new human neuroblastoma cell line in vitro. Int J Cancer, 51, 250-8. MATTHEWS, R. T., BEAL, M. F., FALLON, J., FEDORCHAK, K., HUANG, P. L., FISHMAN, M. C. & HYMAN, B. T. 1997. MPP+ induced substantia nigra degeneration is attenuated in nNOS knockout mice. Neurobiology of Disease, 4, 114-121. MATTILA, P. M., RINNE, J. O., HELENIUS, H. & ROYTTA, M. 1999. Neuritic degeneration in the hippocampus and amygdala in Parkinson's disease in relation to Alzheimer pathology. Acta Neuropathol, 98, 157-64. MATUS, A., BERNHARDT, R. & HUGH-JONES, T. 1981. High molecular weight microtubule-associated proteins are preferentially associated with dendritic microtubules in brain. Proc Natl Acad Sci U S A, 78, 3010-4. MAZZONI, O., ESPOSITO, G., DIURNO, M. V., BRANCACCIO, D., CAROTENUTO, A., GRIECO, P., NOVELLINO, E. & FILIPPELLI, W. 2010. Synthesis and Pharmacological Evaluation of Some 4- Oxo-quinoline-2-carboxylic Acid Derivatives as Anti-inflammatory and Analgesic Agents. Archiv Der Pharmazie, 343, 561-569. MCCORMACK, A. L., THIRUCHELVAM, M., MANNING-BOG, A. B., THIFFAULT, C., LANGSTON, J. W., CORY-SLECHTA, D. A. & DI MONTE, D. A. 2002. Environmental risk factors and Parkinson's disease: selective degeneration of nigral dopaminergic neurons caused by the herbicide paraquat. Neurobiol Dis, 10, 119-27. MCGEER, P. L., ITAGAKI, S., BOYES, B. E. & MCGEER, E. G. 1988. Reactive microglia are positive for HLA-DR in the substantia nigra of Parkinson's and Alzheimer's disease brains. Neurology, 38, 1285-91. MCGEER, P. L. & MCGEER, E. G. 2008. Glial reactions in Parkinson's disease. Mov Disord, 23, 474-83. MCGEER, P. L., SCHWAB, C., PARENT, A. & DOUDET, D. 2003. Presence of reactive microglia in monkey substantia nigra years after 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine administration. Ann Neurol, 54, 599-604. MCGEER, P. L., YASOJIMA, K. & MCGEER, E. G. 2002. Association of interleukin-1 beta polymorphisms with idiopathic Parkinson's disease. Neurosci Lett, 326, 67-9. MCKENNA, M. C., STEVENSON, J. H., HUANG, X. L. & HOPKINS, I. B. 2000. Differential distribution of the enzymes glutamate dehydrogenase and aspartate aminotransferase in cortical synaptic mitochondria contributes to metabolic compartmentation in cortical synaptic terminals. Neurochemistry International, 37, 229-241.

244 References

MCKENNA, M. C., TILDON, J. T., STEVENSON, J. H. & HUANG, X. L. 1996. New insights into the compartmentation of glutamate and glutamine in cultured rat brain astrocytes. Developmental Neuroscience, 18, 380-390. MCKENNA, M. C., WAAGEPETERSEN, H. S., SCHOUSBOE, A. & SONNEWALD, U. 2006. Neuronal and astrocytic shuttle mechanisms for cytosolic-mitochondrial transfer of reducing equivalents: Current evidence and pharmacological tools. Biochemical Pharmacology, 71, 399-407. MCMENAMY, R. H. 1965. Binding of indole analogues to human serum albumin. Effects of fatty acids. J Biol Chem, 240, 4235-43. MCMILLAN, C. R., SHARMA, R., OTTENHOF, T. & NILES, L. P. 2007. Modulation of tyrosine hydroxylase expression by melatonin in human SH-SY5Y neuroblastoma cells. Neurosci Lett, 419, 202-6. MCNALLY, L., BHAGWAGAR, Z. & HANNESTAD, J. 2008. Inflammation, glutamate, and glia in depression: a literature review. CNS Spectr, 13, 501-10. MEIJERING, E., JACOB, M., SARRIA, J. C., STEINER, P., HIRLING, H. & UNSER, M. 2004. Design and validation of a tool for neurite tracing and analysis in fluorescence microscopy images. Cytometry A, 58, 167-76. MEININGER, D., ZALAMEDA, L., LIU, Y., STEPAN, L. P., BORGES, L., MCCARTER, J. D. & SUTHERLAND, C. L. 2011. Purification and kinetic characterization of human indoleamine 2,3-dioxygenases 1 and 2 (IDO1 and IDO2) and discovery of selective IDO1 inhibitors. Biochim Biophys Acta, 1814, 1947-54. MELILLO, G., COX, G. W., RADZIOCH, D. & VARESIO, L. 1993. Picolinic acid, a catabolite of L- tryptophan, is a costimulus for the induction of reactive nitrogen intermediate production in murine macrophages. J Immunol, 150, 4031-40. MELINO, G., THIELE, C. J., KNIGHT, R. A. & PIACENTINI, M. 1997. Retinoids and the control of growth/death decisions in human neuroblastoma cell lines. J Neurooncol, 31, 65-83. MELLOR, A. L., BABAN, B., CHANDLER, P., MARSHALL, B., JHAVER, K., HANSEN, A., KONI, P. A., IWASHIMA, M. & MUNN, D. H. 2003. Cutting edge: induced indoleamine 2,3 dioxygenase expression in dendritic cell subsets suppresses T cell clonal expansion. J Immunol, 171, 1652- 5. MELLOR, A. L. & MUNN, D. H. 2001. Tryptophan catabolism prevents maternal T cells from activating lethal anti-fetal immune responses. Journal of Reproductive Immunology, 52, 5-13. MENDEZ, I., DAGHER, A., HONG, M., GAUDET, P., WEERASINGHE, S., MCALISTER, V., KING, D., DESROSIERS, J., DARVESH, S., ACORN, T. & ROBERTSON, H. 2002. Simultaneous intrastriatal and intranigral fetal dopaminergic grafts in patients with Parkinson disease: a pilot study. Report of three cases. J Neurosurg, 96, 589-96. MENNITI, F., CHENARD, B., COLLINS, M., DUCAT, M., SHALABY, I. & WHITE, F. 1997. CP-101,606, a potent neuroprotectant selective for forebrain neurons. Eur J Pharmacol, 331, 117-26. MENZIES, F. M., YENISETTI, S. C. & MIN, K. T. 2005. Roles of Drosophila DJ-1 in survival of dopaminergic neurons and oxidative stress. Curr Biol, 15, 1578-82. MERINO, M., VIZUETE, M. L., CANO, J. & MACHADO, A. 1999. The non-NMDA glutamate receptor antagonists 6-cyano-7-nitroquinoxaline-2,3-dione and 2,3-dihydroxy-6-nitro-7- sulfamoylbenzo(f)quinoxaline, but not NMDA antagonists, block the intrastriatal neurotoxic effect of MPP+. J Neurochem, 73, 750-7. MERRILL, J. E. & BENVENISTE, E. N. 1996. Cytokines in inflammatory brain lesions: helpful and harmful. Trends Neurosci, 19, 331-8. MEULENER, M., WHITWORTH, A. J., ARMSTRONG-GOLD, C. E., RIZZU, P., HEUTINK, P., WES, P. D., PALLANCK, L. J. & BONINI, N. M. 2005a. Drosophila DJ-1 mutants are selectively sensitive to environmental toxins associated with Parkinson's disease. Curr Biol, 15, 1572-7. MEULENER, M. C., GRAVES, C. L., SAMPATHU, D. M., ARMSTRONG-GOLD, C. E., BONINI, N. M. & GIASSON, B. I. 2005b. DJ-1 is present in a large molecular complex in human brain tissue and interacts with alpha-synuclein. J Neurochem, 93, 1524-32.

245 References

MICHEL, P. P., VYAS, S. & AGID, Y. 1992. Toxic effects of iron for cultured mesencephalic dopaminergic neurons derived from rat embryonic brains. J Neurochem, 59, 118-27. MILLER, C. L., LLENOS, I. C., DULAY, J. R., BARILLO, M. M., YOLKEN, R. H. & WEIS, S. 2004. Expression of the kynurenine pathway enzyme tryptophan 2,3-dioxygenase is increased in the frontal cortex of individuals with schizophrenia. Neurobiol Dis, 15, 618-29. MILLER, R. L., JAMES-KRACKE, M., SUN, G. Y. & SUN, A. Y. 2009. Oxidative and inflammatory pathways in Parkinson's disease. Neurochem Res, 34, 55-65. MILLER, R. L., SUN, G. Y. & SUN, A. Y. 2007. Cytotoxicity of paraquat in microglial cells: Involvement of PKCdelta- and ERK1/2-dependent NADPH oxidase. Brain Res, 1167, 129-39. MIRANDA, A. F., BOEGMAN, R. J., BENINGER, R. J. & JHAMANDAS, K. 1997. Protection against quinolinic acid-mediated excitotoxicity in nigrostriatal dopaminergic neurons by endogenous kynurenic acid. Neuroscience, 78, 967-75. MIRANDA, A. F., SUTTON, M. A., BENINGER, R. J., JHAMANDAS, K. & BOEGMAN, R. J. 1999. Quinolinic acid lesion of the nigrostriatal pathway: effect on turning behaviour and protection by elevation of endogenous kynurenic acid in Rattus norvegicus. Neurosci Lett, 262, 81-4. MIRZA, B., HADBERG, H., THOMSEN, P. & MOOS, T. 2000. The absence of reactive astrocytosis is indicative of a unique inflammatory process in Parkinson's disease. Neuroscience, 95, 425- 32. MITSUHASHI, S., FUKUSHIMA, T., ARAI, K., TOMIYA, M., SANTA, T., IMAI, K. & TOYO'OKA, T. 2007. Development of a column-switching high-performance liquid chromatography for kynurenine enantiomers and its application to a pharmacokinetic study in rat plasma. Anal Chim Acta, 587, 60-6. MOFFETT, J. R., ELS, T., ESPEY, M. G., WALTER, S. A., STREIT, W. J. & NAMBOODIRI, M. A. 1997. Quinolinate immunoreactivity in experimental rat brain tumors is present in macrophages but not in astrocytes. Exp Neurol, 144, 287-301. MOFFETT, J. R. & NAMBOODIRI, M. A. 2003. Tryptophan and the immune response. Immunol Cell Biol, 81, 247-65. MOGI, M., HARADA, M., KONDO, T., RIEDERER, P., INAGAKI, H., MINAMI, M. & NAGATSU, T. 1994a. Interleukin-1 beta, interleukin-6, epidermal growth factor and transforming growth factor- alpha are elevated in the brain from parkinsonian patients. Neurosci Lett, 180, 147-50. MOGI, M., HARADA, M., KONDO, T., RIEDERER, P. & NAGATSU, T. 1995. Brain beta 2-microglobulin levels are elevated in the striatum in Parkinson's disease. J Neural Transm Park Dis Dement Sect, 9, 87-92. MOGI, M., HARADA, M., RIEDERER, P., NARABAYASHI, H., FUJITA, K. & NAGATSU, T. 1994b. Tumor necrosis factor-alpha (TNF-alpha) increases both in the brain and in the cerebrospinal fluid from parkinsonian patients. Neurosci Lett, 165, 208-10. MOLINA-HOLGADO, F., HIDER, R. C., GAETA, A., WILLIAMS, R. & FRANCIS, P. 2007. Metals ions and neurodegeneration. Biometals, 20, 639-54. MONARD, D., RENTSCH, M., SCHUERCH-RATHGEB, Y. & LINDSAY, R. M. 1977. Morphological differentiation of neuroblastoma cells in medium supplemented with delipidated serum. Proc Natl Acad Sci U S A, 74, 3893-7. MONTASTRUC, J. L., RASCOL, O. & SENARD, J. M. 1993. Current Status of Dopamine Agonists in Parkinsons-Disease Management. Drugs, 46, 384-393. MONTASTRUC, J. L., RASCOL, O., SENARD, J. M. & RASCOL, A. 1992. A Pilot-Study of N-Methyl-D- Aspartate (Nmda) Antagonist in Parkinsons-Disease. Journal of Neurology Neurosurgery and Psychiatry, 55, 630-631. MONYER, H., BURNASHEV, N., LAURIE, D. J., SAKMANN, B. & SEEBURG, P. H. 1994. Developmental and regional expression in the rat brain and functional properties of four NMDA receptors. Neuron, 12, 529-40. MORITA, T., SAITO, K., TAKEMURA, M., MAEKAWA, N., FUJIGAKI, S., FUJII, H., WADA, H., TAKEUCHI, S., NOMA, A. & SEISHIMA, M. 2001. 3-Hydroxyanthranilic acid, an L-tryptophan metabolite,

246 References

induces apoptosis in monocyte-derived cells stimulated by interferon-gamma. Ann Clin Biochem, 38, 242-51. MORLEY, J. F. & DUDA, J. E. 2010. Olfaction as a biomarker in Parkinson's disease. Biomark Med, 4, 661-70. MORONI, F. 1999. Tryptophan metabolism and brain function: focus on kynurenine and other indole metabolites. European Journal of Pharmacology, 375, 87-100. MORONI, F., COZZI, A., SILI, M. & MANNAIONI, G. 2012. Kynurenic acid: a metabolite with multiple actions and multiple targets in brain and periphery. J Neural Transm, 119, 133-9. MORONI, F., RUSSI, P., GALLO-MEZO, M. A., MONETI, G. & PELLICCIARI, R. 1991. Modulation of quinolinic and kynurenic acid content in the rat brain: effects of endotoxins and nicotinylalanine. J Neurochem, 57, 1630-5. MOUNT, M. P., LIRA, A., GRIMES, D., SMITH, P. D., FAUCHER, S., SLACK, R., ANISMAN, H., HAYLEY, S. & PARK, D. S. 2007. Involvement of interferon-gamma in microglial-mediated loss of dopaminergic neurons. J Neurosci, 27, 3328-37. MUELLER, H. T., HAROUTUNIAN, V., DAVIS, K. L. & MEADOR-WOODRUFF, J. H. 2004. Expression of the ionotropic glutamate receptor subunits and NMDA receptor-associated intracellular proteins in the substantia nigra in schizophrenia. Brain Res Mol Brain Res, 121, 60-9. MUELLER, O., HAHNENBERGER, K., DITTMANN, M., YEE, H., DUBROW, R., NAGLE, R. & ILSLEY, D. 2000. A microfluidic system for high-speed reproducible DNA sizing and quantitation. Electrophoresis, 21, 128-34. MUFTUOGLU, M., ELIBOL, B., DALMIZRAK, O., ERCAN, A., KULAKSIZ, G., OGUS, H., DALKARA, T. & OZER, N. 2004. Mitochondrial complex I and IV activities in leukocytes from patients with parkin mutations. Mov Disord, 19, 544-8. MULLER, N., MYINT, A. M. & SCHWARZ, M. J. 2009. The impact of neuroimmune dysregulation on neuroprotection and neurotoxicity in psychiatric disorders--relation to drug treatment. Dialogues Clin Neurosci, 11, 319-32. MUNN, D. H., SHARMA, M. D., HOU, D., BABAN, B., LEE, J. R., ANTONIA, S. J., MESSINA, J. L., CHANDLER, P., KONI, P. A. & MELLOR, A. L. 2004. Expression of indoleamine 2,3-dioxygenase by plasmacytoid dendritic cells in tumor-draining lymph nodes. J Clin Invest, 114, 280-90. MUQIT, M. M., GANDHI, S. & WOOD, N. W. 2006. Mitochondria in Parkinson disease: back in fashion with a little help from genetics. Arch Neurol, 63, 649-54. MURAMATSU, S., FUJIMOTO, K., IKEGUCHI, K., SHIZUMA, N., KAWASAKI, K., ONO, F., SHEN, Y., WANG, L., MIZUKAMI, H., KUME, A., MATSUMURA, M., NAGATSU, I., URANO, F., ICHINOSE, H., NAGATSU, T., TERAO, K., NAKANO, I. & OZAWA, K. 2002. Behavioral recovery in a primate model of Parkinson's disease by triple transduction of striatal cells with adeno-associated viral vectors expressing dopamine-synthesizing enzymes. Hum Gene Ther, 13, 345-54. MURER, M. G., RAISMAN-VOZARI, R., YAN, Q., RUBERG, M., AGID, Y. & MICHEL, P. P. 1999. Survival factors promote BDNF protein expression in mesencephalic dopaminergic neurons. Neuroreport, 10, 801-5. NAARALA, J., NYKVIST, P., TUOMALA, M. & SAVOLAINEN, K. 1993. Excitatory amino acid-induced slow biphasic responses of free intracellular calcium in human neuroblastoma cells. FEBS Lett, 330, 222-6. NAGATSU, T., MOGI, M., ICHINOSE, H. & TOGARI, A. 2000. Cytokines in Parkinson's disease. J Neural Transm Suppl, 143-51. NAGATSU, T. & SAWADA, M. 2005. Inflammatory process in Parkinson's disease: role for cytokines. Curr Pharm Des, 11, 999-1016. NASH, J. E., FOX, S. H., HENRY, B., HILL, M. P., PEGGS, D., MCGUIRE, S., MANEUF, Y., HILLE, C., BROTCHIE, J. M. & CROSSMAN, A. R. 2000. Antiparkinsonian actions of ifenprodil in the MPTP-lesioned marmoset model of Parkinson's disease. Exp Neurol, 165, 136-42. NASH, J. E., HILL, M. P. & BROTCHIE, J. M. 1999. Antiparkinsonian actions of blockade of NR2B- containing NMDA receptors in the reserpine-treated rat. Exp Neurol, 155, 42-8.

247 References

NEMETH, H., TOLDI, J. & VECSEI, L. 2006. Kynurenines, Parkinson's disease and other neurodegenerative disorders: preclinical and clinical studies. J Neural Transm Suppl, 285- 304. NIMMERJAHN, A., KIRCHHOFF, F. & HELMCHEN, F. 2005. Resting microglial cells are highly dynamic surveillants of brain parenchyma in vivo. Science, 308, 1314-8. NORRIS, E. H., GIASSON, B. I. & LEE, V. M. 2004. Alpha-synuclein: normal function and role in neurodegenerative diseases. Curr Top Dev Biol, 60, 17-54. NUTT, J. G., HAMMERSTAD, J. P. & GANCHER, S. T. 1992. Parkinson's disease: 100 maxims, B.I. Publications. OGAWA, T., MATSON, W. R., BEAL, M. F., MYERS, R. H., BIRD, E. D., MILBURY, P. & SASO, S. 1992. Kynurenine pathway abnormalities in Parkinson's disease. Neurology, 42, 1702-6. OHTA, K., KUNO, S., MIZUTA, I., FUJINAMI, A., MATSUI, H. & OHTA, M. 2003. Effects of dopamine agonists bromocriptine, pergolide, cabergoline, and SKF-38393 on GDNF, NGF, and BDNF synthesis in cultured mouse astrocytes. Life Sci, 73, 617-26. OKAMOTO, H., YAMAMOTO, S., NOZAKI, M. & HAYAISHI, O. 1967. On Submitochondrial Localization of L-Kynurenine-3-Hydroxylase. Biochemical and Biophysical Research Communications, 26, 309-&. OKUDA, S., NISHIYAMA, N., SAITO, H. & KATSUKI, H. 1998. 3-Hydroxykynurenine, an endogenous oxidative stress generator, causes neuronal cell death with apoptotic features and region selectivity. J Neurochem, 70, 299-307. OKUNO, E., NAKAMURA, M. & SCHWARCZ, R. 1991. Two kynurenine aminotransferases in human brain. Brain Res, 542, 307-12. OLANOW, C. W., GOETZ, C. G., KORDOWER, J. H., STOESSL, A. J., SOSSI, V., BRIN, M. F., SHANNON, K. M., NAUERT, G. M., PERL, D. P., GODBOLD, J. & FREEMAN, T. B. 2003. A double-blind controlled trial of bilateral fetal nigral transplantation in Parkinson's disease. Ann Neurol, 54, 403-14. OLANOW, C. W. & OBESO, J. A. 2000. Preventing levodopa-induced dyskinesias. Annals of Neurology, 47, S167-S178. OLANOW, C. W., OBESO, J. A. & STOCCHI, F. 2006. Continuous dopamine-receptor treatment of Parkinson's disease: scientific rationale and clinical implications. Lancet Neurology, 5, 677- 687. OLNEY, J. W., ZORUMSKI, C. F., STEWART, G. R., PRICE, M. T., WANG, G. J. & LABRUYERE, J. 1990. Excitotoxicity of L-dopa and 6-OH-dopa: implications for Parkinson's and Huntington's diseases. Exp Neurol, 108, 269-72. OPEL, K. L., CHUNG, D. & MCCORD, B. R. 2010. A Study of PCR Inhibition Mechanisms Using Real Time PCR. Journal of Forensic Sciences, 55, 25-33. OPITZ, L., SALINAS-RIESTER, G., GRADE, M., JUNG, K., JO, P., EMONS, G., GHADIMI, B. M., BEISSBARTH, T. & GAEDCKE, J. 2010. Impact of RNA degradation on gene expression profiling. BMC Med Genomics, 3, 36. OSTREROVA-GOLTS, N., PETRUCELLI, L., HARDY, J., LEE, J. M., FARER, M. & WOLOZIN, B. 2000. The A53T alpha-synuclein mutation increases iron-dependent aggregation and toxicity. J Neurosci, 20, 6048-54. OUCHI, Y., YOSHIKAWA, E., SEKINE, Y., FUTATSUBASHI, M., KANNO, T., OGUSU, T. & TORIZUKA, T. 2005. Microglial activation and dopamine terminal loss in early Parkinson's disease. Ann Neurol, 57, 168-75. OWE-YOUNG, R., WEBSTER, N. L., MUKHTAR, M., POMERANTZ, R. J., SMYTHE, G., WALKER, D., ARMATI, P. J., CROWE, S. M. & BREW, B. J. 2008. Kynurenine pathway metabolism in human blood-brain-barrier cells: implications for immune tolerance and neurotoxicity. J Neurochem, 105, 1346-57. PAGANONI, S. & FERREIRA, A. 2005. Neurite extension in central neurons: a novel role for the receptor tyrosine kinases Ror1 and Ror2. J Cell Sci, 118, 433-46.

248 References

PAHLMAN, S., HOEHNER, J. C., NANBERG, E., HEDBORG, F., FAGERSTROM, S., GESTBLOM, C., JOHANSSON, I., LARSSON, U., LAVENIUS, E., ORTOFT, E. & ET AL. 1995. Differentiation and survival influences of growth factors in human neuroblastoma. Eur J Cancer, 31A, 453-8. PAHLMAN, S., RUUSALA, A. I., ABRAHAMSSON, L., MATTSSON, M. E. & ESSCHER, T. 1984. Retinoic acid-induced differentiation of cultured human neuroblastoma cells: a comparison with phorbolester-induced differentiation. Cell Differ, 14, 135-44. PALACINO, J. J., SAGI, D., GOLDBERG, M. S., KRAUSS, S., MOTZ, C., WACKER, M., KLOSE, J. & SHEN, J. 2004. Mitochondrial dysfunction and oxidative damage in parkin-deficient mice. J Biol Chem, 279, 18614-22. PALAIOLOGOS, G., HERTZ, L. & SCHOUSBOE, A. 1989. Role of Aspartate-Aminotransferase and Mitochondrial Dicarboxylate Transport for Release of Endogenously and Exogenously Supplied Neurotransmitter in Glutamatergic Neurons. Neurochemical Research, 14, 359-366. PALFI, S., GURRUCHAGA, J. M., SCORER, S., RALPH, S., LEPETIT, H., JARRAYA, B., MISKIN, J., IWAMURO, H., LAVISSE, S., RAMELLI, A. L., TANI, N., DOLPHIN, P., ABHAY, K., GABRIEL, I., FENELON, G., BRUGIERE, P., KINGSMAN, S., PRICE, G., NAYLOR, S., HANTRAYE, P., REMY, P. & MITROPHANOUS, K. 2011. ProSavin (R) a Gene Therapy Approach for the Treatment of Parkinson's Disease: Phase I Clinical Trial Update. Human Gene Therapy, 22, A20-A20. PANG, Z. & GEDDES, J. W. 1997. Mechanisms of cell death induced by the mitochondrial toxin 3- nitropropionic acid: acute excitotoxic necrosis and delayed apoptosis. J Neurosci, 17, 3064- 73. PAOLETTI, P. & NEYTON, J. 2007. NMDA receptor subunits: function and pharmacology. Curr Opin Pharmacol, 7, 39-47. PAQUET, M., TREMBLAY, M., SOGHOMONIAN, J. J. & SMITH, Y. 1997. AMPA and NMDA glutamate receptor subunits in midbrain dopaminergic neurons in the squirrel monkey: an immunohistochemical and in situ hybridization study. J Neurosci, 17, 1377-96. PAQUETTE, M. A., BRUDNEY, E. G., PUTTERMAN, D. B., MESHUL, C. K., JOHNSON, S. W. & BERGER, S. P. 2008. Sigma ligands, but not N-methyl-D-aspartate antagonists, reduce levodopa-induced dyskinesias. Neuroreport, 19, 111-115. PARDRIDGE, W. M. 1979. The role of blood-brain barrier transport of tryptophan and other neutral amino acids in the regulation of substrate-limited pathways of brain amino acid metabolism. J Neural Transm Suppl, 43-54. PARIHAR, M. S., PARIHAR, A., FUJITA, M., HASHIMOTO, M. & GHAFOURIFAR, P. 2008. Mitochondrial association of alpha-synuclein causes oxidative stress. Cell Mol Life Sci, 65, 1272-84. PARK, J., KIM, S. Y., CHA, G. H., LEE, S. B., KIM, S. & CHUNG, J. 2005. Drosophila DJ-1 mutants show oxidative stress-sensitive locomotive dysfunction. Gene, 361, 133-9. PARK, J., LEE, S. B., LEE, S., KIM, Y., SONG, S., KIM, S., BAE, E., KIM, J., SHONG, M., KIM, J. M. & CHUNG, J. 2006. Mitochondrial dysfunction in Drosophila PINK1 mutants is complemented by parkin. Nature, 441, 1157-61. PARK, L. C., ZHANG, H. & GIBSON, G. E. 2001. Co-culture with astrocytes or microglia protects metabolically impaired neurons. Mech Ageing Dev, 123, 21-7. PARK, Y. J., JANG, Y. M. & KWON, Y. H. 2009. Isoflavones prevent endoplasmic reticulum stress- mediated neuronal degeneration by inhibiting tau hyperphosphorylation in SH-SY5Y cells. J Med Food, 12, 528-35. PARKER, W. D., JR., PARKS, J. K. & SWERDLOW, R. H. 2008. Complex I deficiency in Parkinson's disease frontal cortex. Brain Res, 1189, 215-8. PARKES, J. D., CALVER, D. M., ZILKHA, K. J. & KNILL-JONES, R. P. 1970. Controlled trial of amantadine hydrochloride in Parkinson's disease. Lancet, 1, 259-62. PARKINSON, J. 2002. An essay on the shaking palsy. 1817. J Neuropsychiatry Clin Neurosci, 14, 223- 36; discussion 222.

249 References

PATEL, H. J., OLGUN, N., LENGYEL, I., REZNIK, S. & STEPHANI, R. A. 2010. Synthesis and pharmacological activity of 1,3,6-trisubstituted-4-oxo-1,4-dihydroquinoline-2-carboxylic acids as selective ET(A) antagonists. Bioorg Med Chem Lett, 20, 6840-4. PATEL, N. K., BUNNAGE, M., PLAHA, P., SVENDSEN, C. N., HEYWOOD, P. & GILL, S. S. 2005. Intraputamenal infusion of glial cell line-derived neurotrophic factor in PD: a two-year outcome study. Ann Neurol, 57, 298-302. PAWLAK, D., TANKIEWICZ, A., MATYS, T. & BUCZKO, W. 2003. Peripheral distribution of kynurenine metabolites and activity of kynurenine pathway enzymes in renal failure. J Physiol Pharmacol, 54, 175-89. PAXINOU, E., CHEN, Q., WEISSE, M., GIASSON, B. I., NORRIS, E. H., RUETER, S. M., TROJANOWSKI, J. Q., LEE, V. M. & ISCHIROPOULOS, H. 2001. Induction of alpha-synuclein aggregation by intracellular nitrative insult. J Neurosci, 21, 8053-61. PELLICCIARI, R., NATALINI, B., COSTANTINO, G., MAHMOUD, M. R., MATTOLI, L., SADEGHPOUR, B. M., MORONI, F., CHIARUGI, A. & CARPENEDO, R. 1994. Modulation of the kynurenine pathway in search for new neuroprotective agents. Synthesis and preliminary evaluation of (m-nitrobenzoyl)alanine, a potent inhibitor of kynurenine-3-hydroxylase. J Med Chem, 37, 647-55. PEREZ-POLO, J. R., WERBACH-PEREZ, K. & TIFFANY-CASTIGLIONI, E. 1979. A human clonal cell line model of differentiating neurons. Dev Biol, 71, 341-55. PERRY, G., ZHU, X., BABAR, A. K., SIEDLAK, S. L., YANG, Q., ITO, G., IWATSUBO, T., SMITH, M. A. & CHEN, S. G. 2008. Leucine-rich repeat kinase 2 colocalizes with alpha-synuclein in Parkinson's disease, but not tau-containing deposits in tauopathies. Neurodegener Dis, 5, 222-4. PERRY, T. L. & YONG, V. W. 1986. Idiopathic Parkinson's disease, progressive supranuclear palsy and glutathione metabolism in the substantia nigra of patients. Neurosci Lett, 67, 269-74. PESAH, Y., PHAM, T., BURGESS, H., MIDDLEBROOKS, B., VERSTREKEN, P., ZHOU, Y., HARDING, M., BELLEN, H. & MARDON, G. 2004. Drosophila parkin mutants have decreased mass and cell size and increased sensitivity to oxygen radical stress. Development, 131, 2183-94. PETIT, A., KAWARAI, T., PAITEL, E., SANJO, N., MAJ, M., SCHEID, M., CHEN, F., GU, Y., HASEGAWA, H., SALEHI-RAD, S., WANG, L., ROGAEVA, E., FRASER, P., ROBINSON, B., ST GEORGE-HYSLOP, P. & TANDON, A. 2005. Wild-type PINK1 prevents basal and induced neuronal apoptosis, a protective effect abrogated by Parkinson disease-related mutations. J Biol Chem, 280, 34025-32. PEYRET, N., SENEVIRATNE, P. A., ALLAWI, H. T. & SANTALUCIA, J., JR. 1999. Nearest-neighbor thermodynamics and NMR of DNA sequences with internal A.A, C.C, G.G, and T.T mismatches. Biochemistry, 38, 3468-77. PHILLIPS, R. S. 2011. Structure, mechanism, and substrate specificity of kynureninase. Biochim Biophys Acta, 1814, 1481-8. PIANI, D., SPRANGER, M., FREI, K., SCHAFFNER, A. & FONTANA, A. 1992. Macrophage-induced cytotoxicity of N-methyl-D-aspartate receptor positive neurons involves excitatory amino acids rather than reactive oxygen intermediates and cytokines. Eur J Immunol, 22, 2429-36. PICCINI, P. & WHONE, A. 2004. Functional brain imaging in the differential diagnosis of Parkinson's disease. Lancet Neurol, 3, 284-90. PIEROZAN, P., ZAMONER, A., SOSKA, A. K., SILVESTRIN, R. B., LOUREIRO, S. O., HEIMFARTH, L., MELLO E SOUZA, T., WAJNER, M. & PESSOA-PUREUR, R. 2010. Acute intrastriatal administration of quinolinic acid provokes hyperphosphorylation of cytoskeletal intermediate filament proteins in astrocytes and neurons of rats. Exp Neurol, 224, 188-96. PIERRI, M., VAUDANO, E., SAGER, T. & ENGLUND, U. 2005. KW-6002 protects from MPTP induced dopaminergic toxicity in the mouse. Neuropharmacology, 48, 517-24. PIZZI, M., BORONI, F., BIANCHETTI, A., MORAITIS, C., SARNICO, I., BENARESE, M., GOFFI, F., VALERIO, A. & SPANO, P. 2002. Expression of functional NR1/NR2B-type NMDA receptors in neuronally differentiated SK-N-SH human cell line. Eur J Neurosci, 16, 2342-50.

250 References

PLATTEN, M., HO, P. P. & STEINMAN, L. 2006. Anti-inflammatory strategies for the treatment of multiple sclerosis â€“ tryptophan catabolites may hold the key. Drug Discovery Today: Therapeutic Strategies, 3, 401-408. PLATTEN, M., HO, P. P., YOUSSEF, S., FONTOURA, P., GARREN, H., HUR, E. M., GUPTA, R., LEE, L. Y., KIDD, B. A., ROBINSON, W. H., SOBEL, R. A., SELLEY, M. L. & STEINMAN, L. 2005. Treatment of autoimmune neuroinflammation with a synthetic tryptophan metabolite. Science, 310, 850-5. POLAZZI, E. & CONTESTABILE, A. 2003. Neuron-conditioned media differentially affect the survival of activated or unstimulated microglia: evidence for neuronal control on apoptotic elimination of activated microglia. J Neuropathol Exp Neurol, 62, 351-62. POOLE, A. C., THOMAS, R. E., ANDREWS, L. A., MCBRIDE, H. M., WHITWORTH, A. J. & PALLANCK, L. J. 2008. The PINK1/Parkin pathway regulates mitochondrial morphology. Proc Natl Acad Sci U S A, 105, 1638-43. PORRITT, M. J., BATCHELOR, P. E., HUGHES, A. J., KALNINS, R., DONNAN, G. A. & HOWELLS, D. W. 2000. New dopaminergic neurons in Parkinson's disease striatum. Lancet, 356, 44-5. POTTER, S. M. & DEMARSE, T. B. 2001. A new approach to neural cell culture for long-term studies. J Neurosci Methods, 110, 17-24. PRAKASH, N. & WURST, W. 2006. Development of dopaminergic neurons in the mammalian brain. Cell Mol Life Sci, 63, 187-206. PRASAD, K. N., COLE, W. C., HOVLAND, A. R., PRASAD, K. C., NAHREINI, P., KUMAR, B., EDWARDS- PRASAD, J. & ANDREATTA, C. P. 1999. Multiple antioxidants in the prevention and treatment of neurodegenerative disease: analysis of biologic rationale. Current Opinion in Neurology, 12, 761-770. PRATHER, P. L., TSAI, A. W. & LAW, P. Y. 1994. Mu and delta opioid receptor desensitization in undifferentiated human neuroblastoma SHSY5Y cells. J Pharmacol Exp Ther, 270, 177-84. PRENDERGAST, G. C. 2008. Immune escape as a fundamental trait of cancer: focus on IDO. Oncogene, 27, 3889-900. PRENSA, L., COSSETTE, M. & PARENT, A. 2000. Dopaminergic innervation of human basal ganglia. J Chem Neuroanat, 20, 207-13. PRESGRAVES, S. P., BORWEGE, S., MILLAN, M. J. & JOYCE, J. N. 2004. Involvement of dopamine D- 2/D-3 receptors and BDNF in the neuroprotective effects of S32504 and pramipexole against 1-methyl-4-phenylpyridinium in terminally differentiated SH-SY5Y cells. Experimental Neurology, 190, 157-170. PRIESTLEY, T., LAUGHTON, P., MYERS, J., LE BOURDELLES, B., KERBY, J. & WHITING, P. J. 1995. Pharmacological properties of recombinant human N-methyl-D-aspartate receptors comprising NR1a/NR2A and NR1a/NR2B subunit assemblies expressed in permanently transfected mouse fibroblast cells. Mol Pharmacol, 48, 841-8. PRUSZAK, J., JUST, L., ISACSON, O. & NIKKHAH, G. 2009. Isolation and culture of ventral mesencephalic precursor cells and dopaminergic neurons from rodent brains. Curr Protoc Stem Cell Biol, Chapter 2, Unit 2D 5. PRZEDBORSKI, S., JACKSON-LEWIS, V., VILA, M., WU, D. C., TEISMANN, P., TIEU, K., CHOI, D. K. & COHEN, O. 2003. Free radical and nitric oxide toxicity in Parkinson's disease. Adv Neurol, 91, 83-94. PSARROS, T., ZOUROS, A. & COIMBRA, C. 2003. Bromocriptine-responsive akinetic mutism following endoscopy for ventricular neurocysticercosis. Case report and review of the literature. J Neurosurg, 99, 397-401. PUCCI, L., PEROZZI, S., CIMADAMORE, F., ORSOMANDO, G. & RAFFAELLI, N. 2007a. Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism. Febs Journal, 274, 827-840.

251 References

PUCCI, L., PEROZZI, S., CIMADAMORE, F., ORSOMANDO, G. & RAFFAELLI, N. 2007b. Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism. FEBS J, 274, 827-40. PYTLIAK, M., VARGOVA, V., MECHIROVA, V. & FELSOCI, M. 2011. Serotonin Receptors - From Molecular Biology to Clinical Applications. Physiological Research, 60, 15-25. QIAN, H. R. & YANG, Y. 2009. Neuron differentiation and neuritogenesis stimulated by N- acetylcysteine (NAC). Acta Pharmacol Sin, 30, 907-12. RADAD, K., GILLE, G., MOLDZIO, R., SAITO, H., ISHIGE, K. & RAUSCH, W. D. 2004. Ginsenosides Rb1 and Rg1 effects on survival and neurite growth of MPP+-affected mesencephalic dopaminergic cells. J Neural Transm, 111, 37-45. RADAD, K., GILLE, G. & RAUSCH, W. D. 2008. Dopaminergic neurons are preferentially sensitive to long-term rotenone toxicity in primary cell culture. Toxicol In Vitro, 22, 68-74. RADAD, K., GILLE, G., XIAOJING, J., DURANY, N. & RAUSCH, W. D. 2007. CDP-choline reduces dopaminergic cell loss induced by MPP(+) and glutamate in primary mesencephalic cell culture. Int J Neurosci, 117, 985-98. RADAD, K., MOLDZIO, R. & RAUSCH, W. D. 2010. Minocycline protects dopaminergic neurons against long-term rotenone toxicity. Can J Neurol Sci, 37, 81-5. RADAD, K., RAUSCH, W. D. & GILLE, G. 2006. Rotenone induces cell death in primary dopaminergic culture by increasing ROS production and inhibiting mitochondrial respiration. Neurochem Int, 49, 379-86. RADONIC, A., THULKE, S., MACKAY, I. M., LANDT, O., SIEGERT, W. & NITSCHE, A. 2004. Guideline to reference gene selection for quantitative real-time PCR. Biochem Biophys Res Commun, 313, 856-62. RAHMAN, A., TING, K., CULLEN, K. M., BRAIDY, N., BREW, B. J. & GUILLEMIN, G. J. 2009a. The excitotoxin quinolinic acid induces tau phosphorylation in human neurons. PLoS One, 4, e6344. RAHMAN, A., TING, K., CULLEN, K. M., BRAIDY, N., BREW, B. J. & GUILLEMIN, G. J. 2009b. The excitotoxin quinolinic acid induces tau phosphorylation in human neurons. PLoS ONE, 4. RAJPUT, A., ZESIEWICZ, T. A. & HAUSER, R. A. 2007. Monoamine Oxidase Inhibitors. Handbook of Parkinson's Disease. RAPISARDA, A., PASTORINO, S., MASSAZZA, S., VARESIO, L. & BOSCO, M. C. 2002. Antagonistic effect of picolinic acid and interferon-gamma on macrophage inflammatory protein-1alpha/beta production. Cell Immunol, 220, 70-80. RASCOL, O., OLANOW, C. W. & INVESTIGATORS, A. 2009. Rasagiline in early Parkinson's disease (PD): results from the ADAGIO study. European Journal of Neurology, 16, 655-655. RASMUSSEN, R., MORISSON, T., HERRMANN, M. & WITTWER, C. 1996. Quantitative PCR by Continuous Fluorescence Monitoring of a Double Strand DNA Specific Binding Dye. Biochemica, 2, 8-11. RAVENSCROFT, P. & BROTCHIE, J. 2000. NMDA receptors in the basal ganglia. J Anat, 196 ( Pt 4), 577- 85. REBHAN, M., VACUN, G., BAYREUTHER, K. & ROSNER, H. 1994. Altered ganglioside expression by SH- SY5Y cells upon retinoic acid-induced neuronal differentiation. Neuroreport, 5, 941-4. REED, R. 2003. Coupling transcription, splicing and mRNA export. Curr Opin Cell Biol, 15, 326-31. REJDAK, R., RUMMELT, C., ZRENNER, E., GRIEB, P., REJDAK, K., OKUNO, E., THALER, S., NOWOMIEJSKA, K., KRUSE, F., TURSKI, W. & JUNEMANN, A. G. 2011. Presence of L- kynurenine aminotransferase III in retinal ganglion cells and corpora amylacea in the human retina and optic nerve. Folia Neuropathol, 49, 132-7. REVISHCHIN, A. V., POLTAVTSEVA, R. A., MAREI, M. V., ALEKSANDROVA, M. A., VIKTOROV, I. V., KOROCHKIN, L. I. & SUKHIKH, G. T. 2001. Structure of cell clusters formed in cultures of dissociated human embryonic brain. Bull Exp Biol Med, 132, 856-60.

252 References

REYES, M., REYES, A., OPITZ, T., KAPIN, M. A. & STANTON, P. K. 1998. Eliprodil, a non-competitive, NR2B-selective NMDA antagonist, protects pyramidal neurons in hippocampal slices from hypoxic/ischemic damage. Brain Res, 782, 212-8. REYNOLDS, C. P. & PEREZ-POLO, J. R. 1989. Nerve growth factor induces neurite outgrowth in a clone derived from an NGF-insensitive human neuroblastoma cell line. Int J Dev Neurosci, 7, 125- 32. RICHARDSON, J. R., SHALAT, S. L., BUCKLEY, B., WINNIK, B., O'SUILLEABHAIN, P., DIAZ-ARRASTIA, R., REISCH, J. & GERMAN, D. C. 2009. Elevated serum pesticide levels and risk of Parkinson disease. Arch Neurol, 66, 870-5. RIEDMANN, E. M. 2011. News. Hum Vaccin, 7, 1246-9. RITCHIE, C. W., BUSH, A. I. & MASTERS, C. L. 2004. Metal-protein attenuating compounds and Alzheimer's disease. Expert Opin Investig Drugs, 13, 1585-92. ROBERTS, R. C., MCCARTHY, K. E., DU, F., OKUNO, E. & SCHWARCZ, R. 1994. Immunocytochemical localization of the quinolinic acid synthesizing enzyme, 3-hydroxyanthranilic acid oxygenase, in the rat substantia nigra. Brain Res, 650, 229-38. ROBOTTOM, B. J. 2011. Efficacy, safety, and patient preference of monoamine oxidase B inhibitors in the treatment of Parkinson's disease. Patient Prefer Adherence, 5, 57-64. ROJAS, P., ALTAGRACIA, M., KRAVSOV, J. & RIOS, C. 1992. Partially protective effect of amantadine in the MPTP model of Parkinson's disease. Proc West Pharmacol Soc, 35, 33-5. ROSE, S., RAMSAY CROFT, N. & JENNER, P. 2007. The novel adenosine A2a antagonist ST1535 potentiates the effects of a threshold dose of l-dopa in unilaterally 6-OHDA-lesioned rats. Brain Res, 1133, 110-4. ROSS, C. A. & SMITH, W. W. 2007. Gene-environment interactions in Parkinson's disease. Parkinsonism Relat Disord, 13 Suppl 3, S309-15. ROSS, G. W., PETROVITCH, H., ABBOTT, R. D., TANNER, C. M., POPPER, J., MASAKI, K., LAUNER, L. & WHITE, L. R. 2008. Association of olfactory dysfunction with risk for future Parkinson's disease. Ann Neurol, 63, 167-73. ROSS, R. A., BIEDLER, J. L. & SPENGLER, B. A. 2003. A role for distinct cell types in determining malignancy in human neuroblastoma cell lines and tumors. Cancer Lett, 197, 35-9. ROSS, R. A., SPENGLER, B. A. & BIEDLER, J. L. 1983. Coordinate morphological and biochemical interconversion of human neuroblastoma cells. J Natl Cancer Inst, 71, 741-7. ROWE, D. B., LE, W., SMITH, R. G. & APPEL, S. H. 1998. Antibodies from patients with Parkinson's disease react with protein modified by dopamine oxidation. J Neurosci Res, 53, 551-8. ROY, E. J., TAKIKAWA, O., KRANZ, D. M., BROWN, A. R. & THOMAS, D. L. 2005. Neuronal localization of indoleamine 2,3-dioxygenase in mice. Neurosci Lett, 387, 95-9. RUDDICK, J. P., EVANS, A. K., NUTT, D. J., LIGHTMAN, S. L., ROOK, G. A. & LOWRY, C. A. 2006. Tryptophan metabolism in the central nervous system: medical implications. Expert Rev Mol Med, 8, 1-27. RUPNIAK, H. T., REIN, G., POWELL, J. F., RYDER, T. A., CARSON, S., POVEY, S. & HILL, B. T. 1984. Characteristics of a new human neuroblastoma cell line which differentiates in response to cyclic adenosine 3':5'-monophosphate. Cancer Res, 44, 2600-7. RZESKI, W., KOCKI, T., DYBEL, A., WEJKSZA, K., ZDZISINSKA, B., KANDEFER-SZERSZEN, M., TURSKI, W. A., OKUNO, E. & ALBRECHT, J. 2005. Demonstration of kynurenine aminotransferases I and II and characterization of kynurenic acid synthesis in cultured cerebral cortical neurons. J Neurosci Res, 80, 677-82. SATTLER, R., XIANG, Z. G., LU, W. Y., HAFNER, M., MACDONALD, J. F. & TYMIANSKI, M. 1999. Specific coupling of NMDA receptor activation to nitric oxide neurotoxicity by PSD-95 protein. Science, 284, 1845-1848. SAURA, J. 2007. Microglial cells in astroglial cultures: a cautionary note. J Neuroinflammation, 4, 26. SAURA, J., KETTLER, R., DAPRADA, M. & RICHARDS, J. G. 1992. Quantitative Enzyme Autoradiography with H-3 Ro 41-1049 and H-3 Ro 19-6327 Invitro - Localization and Abundance of Mao-a and

253 References

Mao-B in Rat Cns, Peripheral Organs, and Human Brain. Journal of Neuroscience, 12, 1977- 1999. SCHAPIRA, A. H. 2009. Etiology and pathogenesis of Parkinson disease. Neurol Clin, 27, 583-603, v. SCHAPIRA, A. H. 2010. Safinamide in the treatment of Parkinson's disease. Expert Opin Pharmacother, 11, 2261-8. SCHAPIRA, A. H., COOPER, J. M., DEXTER, D., CLARK, J. B., JENNER, P. & MARSDEN, C. D. 1990. Mitochondrial complex I deficiency in Parkinson's disease. J Neurochem, 54, 823-7. SCHAPIRA, A. H., COOPER, J. M., DEXTER, D., JENNER, P., CLARK, J. B. & MARSDEN, C. D. 1989. Mitochondrial complex I deficiency in Parkinson's disease. Lancet, 1, 1269. SCHARFMAN, H. E., HODGKINS, P. S., LEE, S. C. & SCHWARCZ, R. 1999. Quantitative differences in the effects of de novo produced and exogenous kynurenic acid in rat brain slices. Neurosci Lett, 274, 111-4. SCHEFE, J. H., LEHMANN, K. E., BUSCHMANN, I. R., UNGER, T. & FUNKE-KAISER, H. 2006. Quantitative real-time RT-PCR data analysis: current concepts and the novel "gene expression's CT difference" formula. J Mol Med (Berl), 84, 901-10. SCHELLER, C., SOPPER, S., JENUWEIN, M., NEUEN-JACOB, E., TATSCHNER, T., GRUNBLATT, E., TER MEULEN, V., RIEDERER, P. & KOUTSILIERI, E. 2005. Early impairment in dopaminergic neurotransmission in brains of SIV-infected rhesus monkeys due to microglia activation. J Neurochem, 95, 377-87. SCHIESLING, C., KIEPER, N., SEIDEL, K. & KRUGER, R. 2008. Review: Familial Parkinson's disease-- genetics, clinical phenotype and neuropathology in relation to the common sporadic form of the disease. Neuropathol Appl Neurobiol, 34, 255-71. SCHMIDT, W. J., BUBSER, M. & HAUBER, W. 1992. Behavioural pharmacology of glutamate in the basal ganglia. J Neural Transm Suppl, 38, 65-89. SCHNEEBERGER, A., MANDLER, M., OTAWA, O., ZAUNER, W., MATTNER, F. & SCHMIDT, W. 2009. Development of AFFITOPE vaccines for Alzheimer's disease (AD)--from concept to clinical testing. J Nutr Health Aging, 13, 264-7. SCHROCKSNADEL, K., WIRLEITNER, B., WINKLER, C. & FUCHS, D. 2006. Monitoring tryptophan metabolism in chronic immune activation. Clin Chim Acta, 364, 82-90. SCHULZ, J. B., MATTHEWS, R. T., MUQIT, M. M. K., BROWNE, S. E. & BEAL, M. F. 1995. Inhibition of Neuronal Nitric-Oxide Synthase by 7-Nitroindazole Protects against Mptp-Induced Neurotoxicity in Mice. Journal of Neurochemistry, 64, 936-939. SCHURR, A., WEST, C. A. & RIGOR, B. M. 1991. Neurotoxicity of quinolinic acid and its derivatives in hypoxic rat hippocampal slices. Brain Res, 568, 199-204. SCHWARCZ, R. 2004. The kynurenine pathway of tryptophan degradation as a drug target. Current Opinion in Pharmacology, 4, 12-17. SCHWARCZ, R., DU, F., SCHMIDT, W., TURSKI, W. A., GRAMSBERGEN, J. B., OKUNO, E. & ROBERTS, R. C. 1992. Kynurenic acid: a potential pathogen in brain disorders. Ann N Y Acad Sci, 648, 140- 53. SCHWARCZ, R. & PELLICCIARI, R. 2002. Manipulation of brain kynurenines: glial targets, neuronal effects, and clinical opportunities. J Pharmacol Exp Ther, 303, 1-10. SCHWARCZ, R., WHETSELL, W. O., JR. & MANGANO, R. M. 1983. Quinolinic acid: an endogenous metabolite that produces axon-sparing lesions in rat brain. Science, 219, 316-8. SCHWARTZ, C. M., SPIVAK, C. E., BAKER, S. C., MCDANIEL, T. K., LORING, J. F., NGUYEN, C., CHREST, F. J., WERSTO, R., ARENAS, E., ZENG, X., FREED, W. J. & RAO, M. S. 2005. NTera2: a model system to study dopaminergic differentiation of human embryonic stem cells. Stem Cells Dev, 14, 517-34. SCHWARZSCHILD, M. A., AGNATI, L., FUXE, K., CHEN, J. F. & MORELLI, M. 2006. Targeting adenosine A2A receptors in Parkinson's disease. Trends Neurosci, 29, 647-54. SCOTT, R. M., BRODY, J. A. & COOPER, I. S. 1970. The effect of thalamotomy on the progress of unilateral Parkinson's disease. J Neurosurg, 32, 286-8.

254 References

SEIDMAN, K. J., BARSUK, J. H., JOHNSON, R. F. & WEYHENMEYER, J. A. 1996. Differentiation of NG108-15 neuroblastoma cells by serum starvation or dimethyl sulfoxide results in marked differences in angiotensin II receptor subtype expression. J Neurochem, 66, 1011-8. SEIF EL NASR, M., PERUCHE, B., ROSSBERG, C., MENNEL, H. D. & KRIEGLSTEIN, J. 1990. Neuroprotective effect of memantine demonstrated in vivo and in vitro. Eur J Pharmacol, 185, 19-24. SEO, M., KIM, Y., LEE, Y. I., KIM, S. Y., AHN, Y. M., KANG, U. G., ROH, M. S., KIM, Y. S. & JUHNN, Y. S. 2006. Membrane depolarization stimulates the proliferation of SH-SY5Y human neuroblastoma cells by increasing retinoblastoma protein (RB) phosphorylation through the activation of cyclin-dependent kinase 2 (Cdk2). Neurosci Lett, 404, 87-92. SHANNAK, K., RAJPUT, A., ROZDILSKY, B., KISH, S., GILBERT, J. & HORNYKIEWICZ, O. 1994. Noradrenaline, dopamine and serotonin levels and metabolism in the human hypothalamus: observations in Parkinson's disease and normal subjects. Brain Res, 639, 33-41. SHEN, Y., MURAMATSU, S. I., IKEGUCHI, K., FUJIMOTO, K. I., FAN, D. S., OGAWA, M., MIZUKAMI, H., URABE, M., KUME, A., NAGATSU, I., URANO, F., SUZUKI, T., ICHINOSE, H., NAGATSU, T., MONAHAN, J., NAKANO, I. & OZAWA, K. 2000. Triple transduction with adeno-associated virus vectors expressing tyrosine hydroxylase, aromatic-L-amino-acid decarboxylase, and GTP cyclohydrolase I for gene therapy of Parkinson's disease. Hum Gene Ther, 11, 1509-19. SHENDELMAN, S., JONASON, A., MARTINAT, C., LEETE, T. & ABELIOVICH, A. 2004. DJ-1 is a redox- dependent molecular chaperone that inhibits alpha-synuclein aggregate formation. PLoS Biol, 2, e362. SHENG, M., CUMMINGS, J., ROLDAN, L. A., JAN, Y. N. & JAN, L. Y. 1994. Changing subunit composition of heteromeric NMDA receptors during development of rat cortex. Nature, 368, 144-7. SHIBATA, K. 1988. Fluorimetric micro-determination of kynurenic acid, an endogenous blocker of neurotoxicity, by high-performance liquid chromatography. J Chromatogr, 430, 376-80. SHIH, J. C. & THOMPSON, R. F. 1999. Monoamine oxidase in neuropsychiatry and behavior. American Journal of Human Genetics, 65, 593-598. SHIN, M., KIM, I., INOUE, Y., KIMURA, S. & GONZALEZ, F. J. 2006. Regulation of mouse hepatic alpha- amino-beta-carboxymuconate-epsilon-semialdehyde decarboxylase, a key enzyme in the tryptophan-nicotinamide adenine dinucleotide pathway, by hepatocyte nuclear factor 4 alpha and peroxisome proliferator-activated receptor alpha. Molecular Pharmacology, 70, 1281-1290. SHOULSON, I., FAHN, S., OAKES, D., KIEBURTZ, K., LANG, A., LANGSTON, J. W., LEWITT, P., OLANOW, C. W., PENNEY, J. B., TANNER, C., RUDOLPH, A. & PELUSIO, R. M. 1993. Effects of Tocopherol and Deprenyl on the Progression of Disability in Early Parkinsons-Disease. New England Journal of Medicine, 328, 176-183. SHULTS, C. W., OAKES, D., KIEBURTZ, K., BEAL, M. F., HAAS, R., PLUMB, S., JUNCOS, B. L., NUTT, J., SHOULSON, I., CARTER, J., KOMPOLITI, K., PERLMUTTER, J. S., REICH, S., STERN, M., WATTS, R. L., KURLAN, R., MOLHO, E., HARRISON, M., LEW, M. & PARKINSON STUDY, G. 2002. Effects of coenzyme Q(10) in early Parkinson disease - Evidence of slowing of the functional decline. Archives of Neurology, 59, 1541-1550. SIDELL, N., ALTMAN, A., HAUSSLER, M. R. & SEEGER, R. C. 1983. Effects of retinoic acid (RA) on the growth and phenotypic expression of several human neuroblastoma cell lines. Exp Cell Res, 148, 21-30. SIDELL, N., SARAFIAN, T., KELLY, M., TSUCHIDA, T. & HAUSSLER, M. 1986. Retinoic acid-induced differentiation of human neuroblastoma: a cell variant system showing two distinct responses. Exp Cell Biol, 54, 287-300. SIDEROWF, A. & PARKINSON STUDY, G. 2004. A controlled, randomized, delayed-start study of rasagiline in early Parkinson disease. Archives of Neurology, 61, 561-566.

255 References

SIDMAN, R. L. & RAKIC, P. 1973. Neuronal migration, with special reference to developing human brain: a review. Brain Res, 62, 1-35. SIEBER-BLUM, M. 1991. Role of the neurotrophic factors BDNF and NGF in the commitment of pluripotent neural crest cells. Neuron, 6, 949-55. SILVESTRI, L., CAPUTO, V., BELLACCHIO, E., ATORINO, L., DALLAPICCOLA, B., VALENTE, E. M. & CASARI, G. 2005. Mitochondrial import and enzymatic activity of PINK1 mutants associated to recessive parkinsonism. Hum Mol Genet, 14, 3477-92. SIMUNOVIC, F., YI, M., WANG, Y., MACEY, L., BROWN, L. T., KRICHEVSKY, A. M., ANDERSEN, S. L., STEPHENS, R. M., BENES, F. M. & SONNTAG, K. C. 2009. Gene expression profiling of substantia nigra dopamine neurons: further insights into Parkinson's disease pathology. Brain, 132, 1795-809. SLEPKO, N. & LEVI, G. 1996. Progressive activation of adult microglial cells in vitro. Glia, 16, 241-46. SMITH, A. J., SMITH, R. A. & STONE, T. W. 2009. 5-Hydroxyanthranilic acid, a tryptophan metabolite, generates oxidative stress and neuronal death via p38 activation in cultured cerebellar granule neurones. Neurotox Res, 15, 303-10. SMITH, A. J., STONE, T. W. & SMITH, R. A. 2007. Neurotoxicity of tryptophan metabolites. Biochem Soc Trans, 35, 1287-9. SMITH, P. K., KROHN, R. I., HERMANSON, G. T., MALLIA, A. K., GARTNER, F. H., PROVENZANO, M. D., FUJIMOTO, E. K., GOEKE, N. M., OLSON, B. J. & KLENK, D. C. 1985. Measurement of protein using bicinchoninic acid. Anal Biochem, 150, 76-85. SMITH, Y., WICHMANN, T., FACTOR, S. A. & DELONG, M. R. 2012. Parkinson's disease therapeutics: new developments and challenges since the introduction of levodopa. Neuropsychopharmacology, 37, 213-46. SMYTHE, G. A., BRAGA, O., BREW, B. J., GRANT, R. S., GUILLEMIN, G. J., KERR, S. J. & WALKER, D. W. 2002. Concurrent quantification of quinolinic, picolinic, and nicotinic acids using electron- capture negative-ion gas chromatography-mass spectrometry. Anal Biochem, 301, 21-6. SONG, D. D., SHULTS, C. W., SISK, A., ROCKENSTEIN, E. & MASLIAH, E. 2004. Enhanced substantia nigra mitochondrial pathology in human alpha-synuclein transgenic mice after treatment with MPTP. Exp Neurol, 186, 158-72. SONO, M., ROACH, M. P., COULTER, E. D. & DAWSON, J. H. 1996. Heme-Containing Oxygenases. Chem Rev, 96, 2841-2888. SORTWELL, C. E., PITZER, M. R. & COLLIER, T. J. 2000. Time course of apoptotic cell death within mesencephalic cell suspension grafts: implications for improving grafted dopamine neuron survival. Exp Neurol, 165, 268-77. SPILLANTINI, M. G., CROWTHER, R. A., JAKES, R., HASEGAWA, M. & GOEDERT, M. 1998. alpha- Synuclein in filamentous inclusions of Lewy bodies from Parkinson's disease and dementia with lewy bodies. Proc Natl Acad Sci U S A, 95, 6469-73. STACY, M. & GALBREATH, A. 2008. Optimizing long-term therapy for Parkinson disease: levodopa, dopamine agonists, and treatment-associated dyskinesia. Clin Neuropharmacol, 31, 51-6. STANDAERT, D. G., FRIBERG, I. K., LANDWEHRMEYER, G. B., YOUNG, A. B. & PENNEY, J. B. 1999. Expression of NMDA glutamate receptor subunit mRNAs in neurochemically identified projection and interneurons in the striatum of the rat. Molecular Brain Research, 64, 11-23. STANDAERT, D. G., TESTA, C. M., YOUNG, A. B. & PENNEY, J. B. 1994. Organization of N-Methyl-D- Aspartate Glutamate-Receptor Gene-Expression in the Basal Ganglia of the Rat. Journal of Comparative Neurology, 343, 1-16. STEECE-COLLIER, K., CHAMBERS, L. K., JAW-TSAI, S. S., MENNITI, F. S. & GREENAMYRE, J. T. 2000. Antiparkinsonian actions of CP-101,606, an antagonist of NR2B subunit-containing N-methyl- d-aspartate receptors. Exp Neurol, 163, 239-43. STEEN, S. N. & THOMAS, J. S. 1962. Glutamic Oxaloacetic Transaminase in Serum and Cerebrospinal Fluid in Parkinsonism. Jama-Journal of the American Medical Association, 180, 836-&.

256 References

STEVENS, E. A., MEZRICH, J. D. & BRADFIELD, C. A. 2009. The aryl hydrocarbon receptor: a perspective on potential roles in the immune system. Immunology, 127, 299-311. STOCCHI, F., BORGOHAIN, R., ONOFRJ, M., SCHAPIRA, A. H., BHATT, M., LUCINI, V., GIULIANI, R. & ANAND, R. 2011. A randomized, double-blind, placebo-controlled trial of safinamide as add- on therapy in early Parkinson's disease patients. Mov Disord. STONE, T. W. 2000. Development and therapeutic potential of kynurenic acid and kynurenine derivatives for neuroprotection. Trends Pharmacol Sci, 21, 149-54. STONE, T. W. & DARLINGTON, L. G. 2002a. Endogenous kynurenines as targets for drug discovery and development. Nature Reviews Drug Discovery, 1, 609-620. STONE, T. W. & DARLINGTON, L. G. 2002b. Endogenous kynurenines as targets for drug discovery and development. Nat Rev Drug Discov, 1, 609-20. STONE, T. W., FORREST, C. M. & DARLINGTON, L. G. 2012. Kynurenine pathway inhibition as a therapeutic strategy for neuroprotection. FEBS J. STONE, T. W., MACKAY, G. M., FORREST, C. M., CLARK, C. J. & DARLINGTON, L. G. 2003. Tryptophan metabolites and brain disorders. Clin Chem Lab Med, 41, 852-9. STONE, T. W. & PERKINS, M. N. 1981. Quinolinic acid: a potent endogenous excitant at amino acid receptors in CNS. Eur J Pharmacol, 72, 411-2. STORCH, A., LUDOLPH, A. C. & SCHWARZ, J. 2004. Dopamine transporter: involvement in selective dopaminergic neurotoxicity and degeneration. J Neural Transm, 111, 1267-86. STRACHAN, T. & READ, A. P. 1999. Human molecular genetics, Oxford, BIOS Scientific. STRAUSS, K. M., MARTINS, L. M., PLUN-FAVREAU, H., MARX, F. P., KAUTZMANN, S., BERG, D., GASSER, T., WSZOLEK, Z., MULLER, T., BORNEMANN, A., WOLBURG, H., DOWNWARD, J., RIESS, O., SCHULZ, J. B. & KRUGER, R. 2005. Loss of function mutations in the gene encoding Omi/HtrA2 in Parkinson's disease. Hum Mol Genet, 14, 2099-111. STREIT, W. J., WALTER, S. A. & PENNELL, N. A. 1999. Reactive microgliosis. Prog Neurobiol, 57, 563- 81. STUDER, L. 2001. Culture of substantia nigra neurons. Curr Protoc Neurosci, Chapter 3, Unit 3 3. STYPULA, G., KUNERT-RADEK, J., STEPIEN, H., ZYLINSKA, K. & PAWLIKOWSKI, M. 1996. Evaluation of interleukins, ACTH, cortisol and prolactin concentrations in the blood of patients with parkinson's disease. Neuroimmunomodulation, 3, 131-4. SULZER, D. 2007. Multiple hit hypotheses for dopamine neuron loss in Parkinson's disease. Trends Neurosci, 30, 244-50. SUNDSTROM, C. & NILSSON, K. 1976. Establishment and characterization of a human histiocytic lymphoma cell line (U-937). Int J Cancer, 17, 565-77. SVENDSEN, C. 2008. Stem cells and Parkinson's disease: toward a treatment, not a cure. Cell Stem Cell, 2, 412-3. SWEENEY, M. I. 1997. Neuroprotective effects of adenosine in cerebral ischemia: window of opportunity. Neurosci Biobehav Rev, 21, 207-17. TAIRA, T., SAITO, Y., NIKI, T., IGUCHI-ARIGA, S. M., TAKAHASHI, K. & ARIGA, H. 2004. DJ-1 has a role in antioxidative stress to prevent cell death. EMBO Rep, 5, 213-8. TAKAHASHI, H. & WAKABAYASHI, K. 2001. The cellular pathology of Parkinson's disease. Neuropathology, 21, 315-22. TAKAHASHI, J., PALMER, T. D. & GAGE, F. H. 1999. Retinoic acid and neurotrophins collaborate to regulate neurogenesis in adult-derived neural stem cell cultures. J Neurobiol, 38, 65-81. TAKAHATA, K., SHIMAZU, S., KATSUKI, H., YONEDA, F. & AKAIKE, A. 2006. Effects of selegiline on antioxidant systems in the nigrostriatum in rat. J Neural Transm, 113, 151-8. TAKEUCHI, H., MIZUNO, T., ZHANG, G., WANG, J., KAWANOKUCHI, J., KUNO, R. & SUZUMURA, A. 2005. Neuritic beading induced by activated microglia is an early feature of neuronal dysfunction toward neuronal death by inhibition of mitochondrial respiration and axonal transport. J Biol Chem, 280, 10444-54.

257 References

TAKIKAWA, O., TAGAWA, Y., IWAKURA, Y., YOSHIDA, R. & TRUSCOTT, R. J. 1999. Interferon-gamma- dependent/independent expression of indoleamine 2,3-dioxygenase. Studies with interferon-gamma-knockout mice. Adv Exp Med Biol, 467, 553-7. TANABE, A., EGASHIRA, Y., FUKUOKA, S., SHIBATA, K. & SANADA, H. 2002. Expression of rat hepatic 2-amino-3-carboxymuconate-6-semialdehyde decarboxylase is affected by a high protein diet and by streptozotocin-induced diabetes. J Nutr, 132, 1153-9. TANNER, C. M. 1992. Epidemiology of Parkinson's disease. Neurol Clin, 10, 317-29. TAVARES, R. G., TASCA, C. I., SANTOS, C. E., ALVES, L. B., PORCIUNCULA, L. O., EMANUELLI, T. & SOUZA, D. O. 2002. Quinolinic acid stimulates synaptosomal glutamate release and inhibits glutamate uptake into astrocytes. Neurochem Int, 40, 621-7. TAVARES, R. G., TASCA, C. I., SANTOS, C. E., WAJNER, M., SOUZA, D. O. & DUTRA-FILHO, C. S. 2000. Quinolinic acid inhibits glutamate uptake into synaptic vesicles from rat brain. Neuroreport, 11, 249-53. TAYLOR, M. W. & FENG, G. S. 1991. Relationship between interferon-gamma, indoleamine 2,3- dioxygenase, and tryptophan catabolism. FASEB J, 5, 2516-22. TEISMANN, P. & FERGER, B. 2001. Inhibition of the cyclooxygenase isoenzymes COX-1 and COX-2 provide neuroprotection in the MPTP-mouse model of Parkinson's disease. Synapse, 39, 167-74. TESTA, U., LOUACHE, F., TITEUX, M., THOMOPOULOS, P. & ROCHANT, H. 1985. The iron-chelating agent picolinic acid enhances transferrin receptors expression in human erythroleukaemic cell lines. Br J Haematol, 60, 491-502. TURSKI, L., BRESSLER, K., RETTIG, K. J., LOSCHMANN, P. A. & WACHTEL, H. 1991. Protection of substantia nigra from MPP+ neurotoxicity by N-methyl-D-aspartate antagonists. Nature, 349, 414-8. UITTI, R. J., RAJPUT, A. H., AHLSKOG, J. E., OFFORD, K. P., SCHROEDER, D. R., HO, M. M., PRASAD, M., RAJPUT, A. & BASRAN, P. 1996. Amantadine treatment is an independent predictor of improved survival in Parkinson's disease. Neurology, 46, 1551-6. UNSWORTH, H. C., AASEN, T., MCELWAINE, S. & KELSELL, D. P. 2007. Tissue-specific effects of wild- type and mutant connexin 31: a role in neurite outgrowth. Human Molecular Genetics, 16, 165-172. URIBE, V., WONG, B. K., GRAHAM, R. K., CUSACK, C. L., SKOTTE, N. H., POULADI, M. A., XIE, Y., FEINBERG, K., OU, Y., OUYANG, Y., DENG, Y., FRANCIOSI, S., BISSADA, N., SPREEUW, A., ZHANG, W., EHRNHOEFER, D. E., VAID, K., MILLER, F. D., DESHMUKH, M., HOWLAND, D. & HAYDEN, M. R. 2012. Rescue from excitotoxicity and axonal degeneration accompanied by age-dependent behavioral and neuroanatomical alterations in caspase-6-deficient mice. Hum Mol Genet. VAMOS, E., PARDUTZ, A., KLIVENYI, P., TOLDI, J. & VECSEI, L. 2009. The role of kynurenines in disorders of the central nervous system: possibilities for neuroprotection. J Neurol Sci, 283, 21-7. VANECKO, S. & LASKOWSKI, M., SR. 1961. Studies of the specificity of deoxyribonuclease I. II. Hydrolysis of oligonucleotides carrying a monoesterified phosphate on carbon 3'. J Biol Chem, 236, 1135-40. VAZ, A. R., SILVA, S. L., BARATEIRO, A., FALCAO, A. S., FERNANDES, A., BRITO, M. A. & BRITES, D. 2011. Selective vulnerability of rat brain regions to unconjugated bilirubin. Mol Cell Neurosci, 48, 82-93. VENTON, B. J., ZHANG, H., GARRIS, P. A., PHILLIPS, P. E. M., SULZER, D. & WIGHTMAN, R. M. 2003. Real-time decoding of dopamine concentration changes in the caudate-putamen during tonic and phasic firing. Journal of Neurochemistry, 87, 1284-1295. VERHAGEN METMAN, L., DEL DOTTO, P., VAN DEN MUNCKHOF, P., FANG, J., MOURADIAN, M. M. & CHASE, T. N. 1998. Amantadine as treatment for dyskinesias and motor fluctuations in Parkinson's disease. Neurology, 50, 1323-6.

258 References

VILA, M. & PRZEDBORSKI, S. 2003. Targeting programmed cell death in neurodegenerative diseases. Nat Rev Neurosci, 4, 365-75. VILLMANN, C. & BECKER, C. M. 2007. On the hypes and falls in neuroprotection: targeting the NMDA receptor. Neuroscientist, 13, 594-615. VINGERHOETS, F. J., SNOW, B. J., TETRUD, J. W., LANGSTON, J. W., SCHULZER, M. & CALNE, D. B. 1994. Positron emission tomographic evidence for progression of human MPTP-induced dopaminergic lesions. Ann Neurol, 36, 765-70. VON BERNHARDI, R., TICHAUER, J. E. & EUGENIN, J. 2009. Aging-dependent changes of microglial cells and their relevance for neurodegenerative disorders. J Neurochem, 112, 1099-114. VROOMAN, L., JHAMANDAS, K., BOEGMAN, R. J. & BENINGER, R. J. 1993. Picolinic acid modulates kainic acid-evoked glutamate release from the striatum in vitro. Brain Res, 627, 193-8. WAGNER, M., THALLER, C., JESSELL, T. & EICHELE, G. 1990. Polarizing Activity and Retinoid Synthesis in the Floor Plate of the Neural-Tube. Nature, 345, 819-822. WAHNER, A. D., SINSHEIMER, J. S., BRONSTEIN, J. M. & RITZ, B. 2007. Inflammatory cytokine gene polymorphisms and increased risk of Parkinson disease. Arch Neurol, 64, 836-40. WAINWRIGHT, L. J., LASORELLA, A. & IAVARONE, A. 2001. Distinct mechanisms of cell cycle arrest control the decision between differentiation and senescence in human neuroblastoma cells. Proc Natl Acad Sci U S A, 98, 9396-400. WALKER, N. J. 2002. Tech.Sight. A technique whose time has come. Science, 296, 557-9. WALLACE, B. A., ASHKAN, K., HEISE, C. E., FOOTE, K. D., TORRES, N., MITROFANIS, J. & BENABID, A. L. 2007. Survival of midbrain dopaminergic cells after lesion or deep brain stimulation of the subthalamic nucleus in MPTP-treated monkeys. Brain, 130, 2129-45. WALTHER, D. J. & BADER, M. 2003. A unique central tryptophan hydroxylase isoform. Biochemical Pharmacology, 66, 1673-1680. WALTON, J. D., KATTAN, D. R., THOMAS, S. K., SPENGLER, B. A., GUO, H. F., BIEDLER, J. L., CHEUNG, N. K. & ROSS, R. A. 2004. Characteristics of stem cells from human neuroblastoma cell lines and in tumors. Neoplasia, 6, 838-45. WANG, Y., BRANICKY, R., STEPANYAN, Z., CARROLL, M., GUIMOND, M. P., HIHI, A., HAYES, S., MCBRIDE, K. & HEKIMI, S. 2009. The anti-neurodegeneration drug clioquinol inhibits the aging-associated protein CLK-1. J Biol Chem, 284, 314-23. WATANABE, Y., MATSUMOTO, N., DEZAWA, M., ITOKAZU, Y., YOSHIHARA, T. & IDE, C. 2005. Conditioned medium of the primary culture of rat choroid plexus epithelial (modified ependymal) cells enhances neurite outgrowth and survival of hippocampal neurons. Neurosci Lett, 379, 158-63. WAXMAN, E. A. & LYNCH, D. R. 2005. N-methyl-D-aspartate receptor subtype mediated bidirectional control of p38 mitogen-activated protein kinase. J Biol Chem, 280, 29322-33. WERNER, E. R., FUCHS, D., HAUSEN, A., JAEGER, H., REIBNEGGER, G., WERNER-FELMAYER, G., DIERICH, M. P. & WACHTER, H. 1988. Tryptophan degradation in patients infected by human immunodeficiency virus. Biol Chem Hoppe Seyler, 369, 337-40. WEST, A. B., MOORE, D. J., BISKUP, S., BUGAYENKO, A., SMITH, W. W., ROSS, C. A., DAWSON, V. L. & DAWSON, T. M. 2005. Parkinson's disease-associated mutations in leucine-rich repeat kinase 2 augment kinase activity. Proc Natl Acad Sci U S A, 102, 16842-7. WHIBLEY, A., URQUHART, J., DORE, J., WILLATT, L., PARKIN, G., GAUNT, L., BLACK, G., DONNAI, D. & RAYMOND, F. L. 2010. Deletion of MAOA and MAOB in a male patient causes severe developmental delay, intermittent hypotonia and stereotypical hand movements. European Journal of Human Genetics, 18, 1095-1099. WHONE, A. L., WATTS, R. L., STOESSL, A. J., DAVIS, M., RESKE, S., NAHMIAS, C., LANG, A. E., RASCOL, O., RIBEIRO, M. J., REMY, P., POEWE, W. H., HAUSER, R. A. & BROOKS, D. J. 2003. Slower progression of Parkinson's disease with ropinirole versus levodopa: The REAL-PET study. Ann Neurol, 54, 93-101.

259 References

WICHMANN, T. & DELONG, M. R. 2003. Functional neuroanatomy of the basal ganglia in Parkinson's disease. Adv Neurol, 91, 9-18. WILLETS, J. M., LAMBERT, D. G., LUNEC, J. & GRIFFITHS, H. R. 1995. Studies on the neurotoxicity of 6,7-dihydroxy-1-methyl-1,2,3,4-tetrahydroisoquinoline (salsolinol) in SH-SY5Y cells. Eur J Pharmacol, 293, 319-26. WINKLHOFER, K. F. & HAASS, C. 2010. Mitochondrial dysfunction in Parkinson's disease. Biochimica Et Biophysica Acta-Molecular Basis of Disease, 1802, 29-44. WIRLEITNER, B., NEURAUTER, G., SCHROCKSNADEL, K., FRICK, B. & FUCHS, D. 2003. Interferon- gamma-induced conversion of tryptophan: Immunologic and neuropsychiatric aspects. Current Medicinal Chemistry, 10, 1581-1591. WISHART, T. M., PARSON, S. H. & GILLINGWATER, T. H. 2006. Synaptic vulnerability in neurodegenerative disease. J Neuropathol Exp Neurol, 65, 733-9. WOLOZIN, B. & GOLTS, N. 2002. Iron and Parkinson's disease. Neuroscientist, 8, 22-32. WOOD, N. W. 1998. Genetic risk factors in Parkinson's disease. Ann Neurol, 44, S58-62. WU, D. C., JACKSON-LEWIS, V., VILA, M., TIEU, K., TEISMANN, P., VADSETH, C., CHOI, D. K., ISCHIROPOULOS, H. & PRZEDBORSKI, S. 2002. Blockade of microglial activation is neuroprotective in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine mouse model of Parkinson disease. J Neurosci, 22, 1763-71. WU, D. C., TEISMANN, P., TIEU, K., VILA, M., JACKSON-LEWIS, V., ISCHIROPOULOS, H. & PRZEDBORSKI, S. 2003. NADPH oxidase mediates oxidative stress in the 1-methyl-4-phenyl- 1,2,3,6-tetrahydropyridine model of Parkinson's disease. Proc Natl Acad Sci U S A, 100, 6145- 50. WU, H. Q., GUIDETTI, P., GOODMAN, J. H., VARASI, M., CERESOLI-BORRONI, G., SPECIALE, C., SCHARFMAN, H. E. & SCHWARCZ, R. 2000a. Kynurenergic manipulations influence excitatory synaptic function and excitotoxic vulnerability in the rat hippocampus in vivo. Neuroscience, 97, 243-51. WU, H. Q., LEE, S. C. & SCHWARCZ, R. 2000b. Systemic administration of 4-chlorokynurenine prevents quinolinate neurotoxicity in the rat hippocampus. Eur J Pharmacol, 390, 267-74. XIE, H., CHANG, M., HU, X., WANG, D., TIAN, M., LI, G., JIANG, H., WANG, Y., DONG, Z., ZHANG, Y. & HU, L. 2011. Proteomics analysis of MPP+-induced apoptosis in SH-SY5Y cells. Neurol Sci, 32, 221-8. XIE, H. R., HU, L. S. & LI, G. Y. 2010. SH-SY5Y human neuroblastoma cell line: in vitro cell model of dopaminergic neurons in Parkinson's disease. Chin Med J (Engl), 123, 1086-92. YANG, Y., GEHRKE, S., HAQUE, M. E., IMAI, Y., KOSEK, J., YANG, L., BEAL, M. F., NISHIMURA, I., WAKAMATSU, K., ITO, S., TAKAHASHI, R. & LU, B. 2005. Inactivation of Drosophila DJ-1 leads to impairments of oxidative stress response and phosphatidylinositol 3-kinase/Akt signaling. Proc Natl Acad Sci U S A, 102, 13670-5. YANG, Y., OUYANG, Y., YANG, L., BEAL, M. F., MCQUIBBAN, A., VOGEL, H. & LU, B. 2008. Pink1 regulates mitochondrial dynamics through interaction with the fission/fusion machinery. Proc Natl Acad Sci U S A, 105, 7070-5. YOKOTA, T., SUGAWARA, K., ITO, K., TAKAHASHI, R., ARIGA, H. & MIZUSAWA, H. 2003. Down regulation of DJ-1 enhances cell death by oxidative stress, ER stress, and proteasome inhibition. Biochem Biophys Res Commun, 312, 1342-8. ZADORI, D., KLIVENYI, P., TOLDI, J., FULOP, F. & VECSEI, L. 2012. Kynurenines in Parkinson's disease: therapeutic perspectives. J Neural Transm, 119, 275-83. ZECCA, L., ZUCCA, F. A., WILMS, H. & SULZER, D. 2003. Neuromelanin of the substantia nigra: a neuronal black hole with protective and toxic characteristics. Trends Neurosci, 26, 578-80. ZHANG, H. 2003. Alignment of BLAST high-scoring segment pairs based on the longest increasing subsequence algorithm. Bioinformatics, 19, 1391-6.

260 References

ZHANG, J., PERRY, G., SMITH, M. A., ROBERTSON, D., OLSON, S. J., GRAHAM, D. G. & MONTINE, T. J. 1999. Parkinson's disease is associated with oxidative damage to cytoplasmic DNA and RNA in substantia nigra neurons. Am J Pathol, 154, 1423-9. ZHANG, L., SHIMOJI, M., THOMAS, B., MOORE, D. J., YU, S. W., MARUPUDI, N. I., TORP, R., TORGNER, I. A., OTTERSEN, O. P., DAWSON, T. M. & DAWSON, V. L. 2005a. Mitochondrial localization of the Parkinson's disease related protein DJ-1: implications for pathogenesis. Hum Mol Genet, 14, 2063-73. ZHANG, W., WANG, T., PEI, Z., MILLER, D. S., WU, X., BLOCK, M. L., WILSON, B., ZHOU, Y., HONG, J. S. & ZHANG, J. 2005b. Aggregated alpha-synuclein activates microglia: a process leading to disease progression in Parkinson's disease. FASEB J, 19, 533-42. ZHANG, X. D., BEAULIEU, J. M., SOTNIKOVA, T. D., GAINETDINOV, R. R. & CARON, M. G. 2004. Tryptophan hydroxylase-2 controls brain serotonin synthesis. Science, 305, 217-217. ZILL, P., BUTTNER, A., EISENMENGER, W., BONDY, B. & ACKENHEIL, M. 2004. Regional mRNA expression of a second tryptophan hydroxylase isoform in postmortem tissue samples of two human brains. European Neuropsychopharmacology, 14, 282-284. ZINGER, A., BARCIA, C., HERRERO, M. T. & GUILLEMIN, G. J. 2011. The involvement of neuroinflammation and kynurenine pathway in Parkinson's disease. Parkinsons Dis, 2011, 716859. ZWILLING, D., HUANG, S. Y., SATHYASAIKUMAR, K. V., NOTARANGELO, F. M., GUIDETTI, P., WU, H. Q., LEE, J., TRUONG, J., ANDREWS-ZWILLING, Y., HSIEH, E. W., LOUIE, J. Y., WU, T., SCEARCE- LEVIE, K., PATRICK, C., ADAME, A., GIORGINI, F., MOUSSAOUI, S., LAUE, G., RASSOULPOUR, A., FLIK, G., HUANG, Y. D., MUCHOWSKI, J. M., MASLIAH, E., SCHWARCZ, R. & MUCHOWSKI, P. J. 2011. Kynurenine 3-Monooxygenase Inhibition in Blood Ameliorates Neurodegeneration. Cell, 145, 863-874.

261