Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
1 Characterization of an Abiraterone Ultraresponsive Phenotype in Castration-Resistant
2 Prostate Cancer Patient-Derived Xenografts
3
4 Hung-Ming Lam1,2*, Ryan McMullin3*†, Holly M. Nguyen1, Ilsa Coleman4, Michael Gormley5,
5 Roman Gulati4, Lisha G. Brown1, Sarah K. Holt1, Weimin Li5, Deborah S. Ricci6, Karin
6 Verstraeten7, Shibu Thomas5, Elahe A. Mostaghel4, 8, Peter S. Nelson4, 8, Robert L. Vessella1,
7 9, and Eva Corey1
8
9 Affiliation of authors: 1Department of Urology, University of Washington School of
10 Medicine, Seattle, Washington; 2State Key Laboratory of Quality Research in Chinese
11 Medicine, Macau Institute for Applied Research in Medicine and Health, Macau University of
12 Science and Technology, Macau (SAR), China; 3LabConnect, Seattle, Washington; 4Fred
13 Hutchinson Cancer Research Center, Seattle, Washington; 5Janssen Research &
14 Development, Spring House, Pennsylvania; 6Janssen Research & Development, Raritan,
15 New Jersey; 7Janssen Research & Development, Beerse, Belgium; 8Department of
16 Medicine, University of Washington, Seattle, Washington; 9Department of Veterans Affairs
17 Medical Center, Seattle, Washington
18
19 *Co-primary lead authors
20 †Current affiliation: Janssen Research & Development, Spring House, Pennsylvania 21 22
23 Running title (60 characters max): Abiraterone Response and Resistance
24
25 Keywords: abiraterone acetate, prostate cancer, xenografts, biomarkers, androgen
26 receptor, glucocorticoid receptor, castration resistance
27
28 Grant/funding support: The work was supported by The Richard M. Lucas Foundation, the
29 Prostate Cancer Foundation, SU2C, a NIH PO1 CA085859, and the PNW Prostate Cancer
1
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
30 SPORE NIH P50 CA097186. HML is a recipient of the Young Investigator Award from the
31 Prostate Cancer Foundation, an Idea Development Award from the Department of Defense
32 (W81XWH-14-1-0271), and a FHCRC/UW Cancer Consortium New Investigator Grant of
33 NIH P30 CA015704. Janssen Research & Development provided funding support for some
34 of the molecular analyses reported herein.
35
36
37 Corresponding author:
38 Eva Corey, PhD 39 Department of Urology 40 Mailstop 356510 41 University of Washington 42 Seattle, WA 98195 43 Phone: +1 206 543 1461 44 Fax: +1 206 543 1146 45 Email: [email protected] 46
47 Conflict of interest:
48 Peter S. Nelson has served on advisory boards for Janssen and received compensation.
49 Ryan McMullin, Michael Gormley, Weimin Li, Deborah S. Ricci, Karin Verstraeten, and
50 Shibu Thomas are employees of Janssen Research & Development and own stock in
51 Johnson & Johnson.
52
53
54 Word count
55 Text (excluding references, tables/figures): 4328
56 Figures: 5
57
2
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
58 Translational Relevance 59 60 Abiraterone acetate (AA) improves survival in patients with metastatic castration-resistant
61 prostate cancer (mCRPC); however, not all tumors respond and responding tumors
62 eventually develop resistance. Currently there is no information available regarding how to
63 stratify patients for durable AA therapy, and the mechanisms underlying AA resistance are
64 diverse. We used patient-derived xenograft models that recapitulated the diverse clinical
65 response of CRPC to AA and identified a molecular signature of secreted proteins
66 associated with the AA ultraresponsive phenotype. The signature will provide the much
67 needed information on noninvasive biomarker development to select AA-responsive
68 patients. Upon resistance, our results suggested reduced androgen receptor (AR) signaling
69 and sustainably low nuclear glucocorticoid receptor (nGR) localization in the AA
70 ultraresponders. In contrast, sustained AR signaling and increased nGR localization was
71 observed in the intermediate and minimal responders. Further inhibition along the AR/GR
72 signaling axis may be effective in AA-resistant patients who are intermediate or minimal
73 responders.
74
75
76
3
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
77 Abstract
78 Purpose: To identify the molecular signature associated with abiraterone acetate (AA)
79 response and mechanisms underlying AA resistance in castration-resistant prostate cancer
80 patient-derived xenografts (PDXs).
81 Experimental Design: SCID mice bearing LuCaP 136CR, 77CR, 96CR, and 35CR PDXs
82 were treated with AA. Tumor volume and prostate-specific antigen were monitored, and
83 tumors were harvested 7 days post-treatment or at end of study for gene expression and
84 immunohistochemical studies.
85 Results: Three phenotypic groups were observed based on AA response. An
86 ultraresponsive phenotype was identified in LuCaP 136CR with significant inhibition of tumor
87 progression and increased survival, intermediate responders LuCaP 77CR and LuCaP
88 96CR with a modest tumor inhibition and survival benefit, and LuCaP 35CR with minimal
89 tumor inhibition and no survival benefit upon AA treatment. We identified a molecular
90 signature of secreted proteins associated with the AA ultraresponsive phenotype. Upon
91 resistance, AA ultraresponder LuCaP 136CR displayed reduced androgen receptor (AR)
92 signaling and sustainably low nuclear glucocorticoid receptor (nGR) localization,
93 accompanied by steroid metabolism alteration and epithelial-mesenchymal transition
94 phenotype enrichment with increased expression of NF-κB-regulated genes; intermediate
95 and minimal responders maintained sustained AR signaling and increased tumoral nGR
96 localization.
97 Conclusions: We identified a molecular signature of secreted proteins associated with AA
98 ultraresponsiveness and sustained AR/GR signaling upon AA resistance in intermediate or
99 minimal responders. These data will inform development of noninvasive biomarkers
100 predicting AA response, and suggest further inhibition along the AR/GR signaling axis may
101 be effective only in AA-resistant patients who are intermediate or minimal responders. These
102 findings require verification in prospective clinical trials.
4
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
103 Introduction
104 Androgen-deprivation therapy (ADT) has been the mainstay therapy for patients with
105 advanced prostate cancer (1). Abiraterone acetate (AA), the prodrug of abiraterone, is a
106 specific CYP17A1 inhibitor that blocks androgen biosynthesis, resulting in effective reduction
107 of serum and intratumoral androgens (2-4). AA was the first second-generation ADT shown
108 to improve survival in metastatic castration-resistant prostate cancer (mCRPC) patients (5-
109 9). While dramatic decline in prostate specific antigen (PSA) was achieved in some patients,
110 others exhibited a subtle PSA response or de novo resistance, and disease progression is
111 universal (1, 5, 9).
112 Predictive biomarkers that distinguish ultraresponders from intermediate or minimal
113 responders to AA are critically needed. Early attempts using circulating tumor cells (CTCs)
114 showed that TMPRSS2-ERG fusion did not predict the response to AA in CRPC patients
115 (10). However, Antonarakis et al. recently showed that CRPC patients with positive
116 androgen receptor transcript variant (ARv7) in their pretreatment CTC did not demonstrate
117 PSA decline and 68% of a small cohort of patients with negative ARv7 demonstrated > 50%
118 PSA decline after receiving AA (11), suggesting that the detection of positive ARv7 in CTCs
119 may predict AA sensitivity.
120 De novo and acquired resistance to AA is emerging clinically, and there are
121 preclinical and clinical efforts to investigate the mechanisms of resistance. In preclinical
122 studies, resistance to AA was associated with an induction of full-length AR , ARv7, and
123 CYP17A1 (12). In clinical studies, the presence of ARv7 in CTCs was associated with
124 resistance to AA and shorter overall survival (11). In addition, acquired resistance to AA has
125 been associated with the emergence of AR mutations that have been reported in up to 20%
126 of patients who progressed (13-15). Recently, upregulation of glucocorticoid receptor (GR)
127 has been shown to be a possible bypass mechanism to ADT, and CRPC patients with
128 positive GR in their bone marrow biopsies were less likely to have a durable response to
129 enzalutamide, another second-generation ADT (16).
5
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
130 Currently, there is little information about biomarkers to identify patients who will
131 durably respond to AA, and the mechanisms of resistance are diverse. In the present study
132 we evaluated the AA response in a panel of LuCaP CRPC patient-derived xenografts
133 (PDXs) that displayed differential responsiveness to AA and identified a molecular signature
134 associated with AA ultraresponsiveness. We also provided evidence to support diverse
135 resistance mechanisms upon AA treatment. This study highlights potential noninvasive
136 biomarkers that may be used to select patients for durable AA therapy, and potential
137 targeting of the epithelial-mesenchymal transition (EMT)/nuclear factor κB (NF-κB) pathway
138 in AA ultraresponsive or AR/GR pathways in AA intermediate- or minimally responsive
139 CRPC.
140
141 Materials and Methods
142 Prostate cancer PDX models
143 Animal procedures were carried out in accordance with National Institutes of Health
144 guidelines and upon University of Washington Institutional Animal Care and Use Committee
145 approval. Four different LuCaP human CRPC PDXs (LuCaP 136CR, LuCaP 77CR, LuCaP
146 96CR, and LuCaP 35CR) were used. All four PDXs express wild-type AR but exhibit
147 differential expression of PSA, PTEN, and ERG (corresponding patient information is
148 summarized in Supplementary Table S1). Two additional PDX models (LuCaP 70CR and
149 LuCaP 86.2CR) were used for survival analysis upon AA treatment and assessment of gene
150 signature.
151 Intact male CB-17 SCID mice (aged ~6 weeks; Charles River Laboratories, San
152 Diego, CA) were implanted subcutaneously with tumor bits of LuCaP 136 or LuCaP 77. Mice
153 were castrated when tumor volume was ≥100 mm3. When tumor regrew to 1.5-fold the
154 original volume, tumors were referred to as LuCaP 136CR or LuCaP 77CR (Fig. 1). LuCaP
155 96CR and LuCaP 35CR are castration-resistant PDXs that are propagated in castrated male
156 mice. Castrated male CB-17 SCID mice were implanted subcutaneously with LuCaP 96CR
157 or LuCaP 35CR tumor bits, and enrolled when tumor volume reached ≥100 mm3 (Fig. 1).
6
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
158 Upon enrollment, mice were randomized to vehicle (20% HPbCD/0.37N HCl/PBS) or AA
159 treatment groups (0.5 mmol/kg; Janssen Pharmaceutical Companies, Beerse, Belgium).
160 Animals were treated by oral gavage on a weekly schedule of 5 days on, 2 days off. Tumor
161 volume and body weight were measured twice weekly, and blood samples were drawn
162 weekly for PSA measurements using AxSym Total PSA Assay (Abbott Laboratories, Abbott
163 Park, IL). Five animals in each group were sacrificed 7 days after the initiation of treatment
164 (D7) and the remaining animals were followed and sacrificed when tumors exceeded 1,000
165 mm3 (end of study, EOS) or sacrificed if animals became compromised. At sacrifice (D7 or
166 EOS), half of the tumor was harvested for paraffin embedding and half was frozen for
167 subsequent analyses. Treatment schemes for LuCaP 70CR and LuCaP 86.2CR are
168 illustrated in Supplementary Fig. S1.
169
170 Intratumoral androgen measurement
171 Intratumoral androgen levels were measured using mass spectrometry as described
172 previously (17, 18). Vehicle-treated tumors and AA-resistant tumors harvested at EOS were
173 used for these analyses.
174
175 Immunohistochemistry
176 Hematoxylin and eosin staining of paraffin-embedded tissues was used to identify
177 viable tumor cells in the tissues. Two cores (5–8 tumors per group) were punched and
178 placed in tissue microarrays. The tissue microarray slides were stained for AR (F39.4.1,
179 1:100, BioGenex, Fremont, CA), GR (D6H2L, 1:100, Cell Signaling, Danvers, MA),
180 chromogranin A (DAK-A3, 1:100, DAKO, Carpinteria, CA), and synaptophysin (D-4, 1:200,
181 Santa Cruz Biotechnology, Dallas, TX) using standard procedures as described previously
182 (19-21). All evaluations were performed in a blinded fashion and a quasi-continuous
183 immunohistochemical (IHC) score was calculated by multiplying each intensity level (0 for no
184 stain, 1 for faint stain, and 2 for intense stain) by the corresponding percentage of cells (0–
7
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
185 100%) at the corresponding intensity and totaling the results. IHC scores ranged from 0 (no
186 staining in any cell) to 200 (intense staining in 100% of the cells).
187
188 RNA extraction
189 Frozen pieces of tumor were embedded in Optimal Cutting Temperature Compound
190 and 5-µm sections were stained with hematoxylin and eosin. Areas of viable tumor cells
191 were identified and macro-dissected for RNA extraction using a standard procedure with
192 RNA STAT 60 (Tel-Test, Friendswood, TX). RNA was then purified using RNeasy Mini kit
193 utilizing the optional DNase digestion in solution prior to purification (Qiagen, Hilden,
194 Germany) for subsequent gene expression analyses. RNA integrity number was determined
195 using the Agilent Bioanalyzer system (Agilent, Santa Clara, CA).
196
197 Gene expression analyses
198 For Affymetrix microarray analyses, biotin-labeled, amplified RNA (aRNA) was
199 synthesized from 200 ng total RNA using the 3ʹ IVT Express Kit (Affymetrix, Santa Clara,
200 CA). The aRNA was purified using Agencourt RNAClean XP beads (Beckman Coulter Inc.,
201 Brea, CA) on the BioMek FX Workstation (Beckman Coulter Inc.). Biotin-labeled aRNA was
202 fragmented using the 3ʹ IVT Express Kit. A total of 4.5 µg fragmented biotin-labeled aRNA
203 was hybridized on an HT Human Genome (HG)-U219 96-array plate. The plate was
204 washed, stained, and scanned with the GeneTitan Instrument. All reagents were from
205 Affymetrix. Gene expression microarray data were normalized to minimize systematic
206 technical variation using robust multichip average (22) and represented in the log2 scale.
207 Data were filtered to remove probes with mean signal intensities below the 25th percentile of
208 signal intensities for all probes. The Significance Analysis of Microarrays (SAM) program
209 (http://www-stat.stanford.edu/~tibs/SAM/) (23) was used to analyze expression differences
210 between groups using unpaired, two-sample t tests and controlled for multiple testing by
211 estimating q-values using the false discovery rate method. Gene family was manually
212 curated from Gene Ontology and Uniprot databases. The AR score was determined by the
8
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
213 expression of a 21-gene signature and calculated as described previously (24). Microarray
214 data are deposited in the Gene Expression Omnibus database under the accession number
215 GSE85672.
216
217 Ingenuity pathway analysis
218 The differentially expressed genes between vehicle-treated and AA-resistant tumors
219 at the EOS from each of the four LuCaP models were imported into Ingenuity Pathway
220 Analysis (Ingenuity Systems; https://www.ingenuity.com) to identify molecular and cellular
221 functions and regulator effect network involved in AA resistance as previously described (25,
222 26).
223
224 Gene set enrichment analysis
225 Gene set enrichment analysis (GSEA) (27) was conducted to evaluate enrichment of
226 differential expression patterns in canonical signaling pathways (Reactome) (28) or
227 predefined gene signatures of prostate cancer core gene expression modules representing
228 distinct biological programs (Compendia Bioscience, Ann Arbor, MI) and annotated
229 signatures associated with EMT, AR activity, GR activity, and AA response.
230
231 Quantitative real-time polymerase chain reaction
232 Total RNA was reverse-transcribed to cDNA, and real-time polymerase chain
233 reaction (PCR) was carried out as described previously (29). Species-specific primer
234 sequences are presented in Supplementary Table S2. PCR reactions with SYBR GreenER
235 PCR Master-Mix (Invitrogen, Carlsbad, CA) were monitored with the 7900HT Fast Real-time
236 PCR System (Applied Biosystems, Foster City, CA). Individual mRNA levels were
237 normalized to human RPL13a.
238
239 AR sequencing
9
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
240 Genomic DNA was extracted using DNeasy Blood and Tissue Kit (Qiagen) and PCR
241 amplified using primer AR_exon8_c1-589_F: ATTGCGAGAGAGCTGCATCA and
242 AR_exon8_c1-589_R: TGCTTGTTTTTGTTTTGATTTCC. Sanger Sequencing was
243 performed using BigDye Terminator v3.1 Cycle Sequencing Kit (# 4337454, Life
244 Technologies, Carlsbad, CA) according to manufacturer’s recommendations. Sequences
245 were aligned to human AR genomic sequence NC_000023.11 and mRNA RefSeq NM_0044
246 using Sequencher Software (version 5.1, Gene Codes, Ann Arbor, MI). Mutations were
247 verified using The Androgen Receptor Gene Mutations Database (McGill University).
248
249 Statistical analyses
250 Survival was determined using Kaplan-Meier estimation of time from start of
251 treatment (vehicle or AA) to sacrifice and compared by log-rank (Mantel-Cox) test. Statistical
252 analyses of tumor volume and PSA responses were performed as described previously (19).
253 Briefly, longitudinal tumor measurements and PSA serum levels were log-transformed and
254 modeled using linear mixed models conditional on the treatment group with random effects
255 for each animal. Following standard diagnostic assessment of model fit, we simulated 1,000
256 datasets from each fitted model, calculated the empirical mean and 95% confidence limits at
257 each time point, and refitted the models to these datasets. The final results represented
258 means and 95% confidence limits of 1,000 bootstrap replicates. In addition, the rate of
259 change in serum PSA and tumor volume upon AA treatment was tested using estimated
260 fixed effects for each LuCaP line. Student’s t test and Pearson correlation coefficients were
261 used for statistical comparisons between the groups in the intratumoral androgen
262 measurements, gene expression analysis, and IHC analyses. For GSEA, a gene set that
263 displayed false discovery rate <25% is considered significantly enriched.
264 265 Results
266 Heterogeneous AA responses and identification of an AA ultraresponder in LuCaP
267 PDX models
10
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
268 CRPC was developed using four different models of LuCaP PDXs (Fig. 1). AA
269 treatment improved survival and inhibited tumor progression in three of the four models. In
270 mice bearing LuCaP 136CR tumors, survival was substantially improved in AA-treated
271 compared with vehicle-treated mice (P < 0.001) and the median survival improved from 6.8
272 weeks (vehicle) to 21.8 weeks (AA; denoted as AA ultraresponder; 220% gain in survival;
273 Fig. 2A). AA treatment resulted in statistically significant but modest improvement in survival
274 in mice bearing LuCaP 77CR (P = 0.05) and LuCaP 96CR (P = 0.02) — both denoted as
275 intermediate responders (36–74% gain in survival; Fig. 2A). AA did not significantly extend
276 survival in mice bearing LuCaP 35CR (12% gain in survival; P = 0.52; denoted as minimal
277 responder; Fig. 2A).
278 Both the AA ultraresponder LuCaP 136CR and intermediate responders LuCaP
279 77CR and LuCaP 96CR, but not the minimal responder LuCaP 35CR, demonstrated
280 significantly delayed tumor and PSA progression (except for LuCaP 136CR, which has
281 undetectable levels of serum PSA; Fig. 2, panels B and C), followed by both tumor and PSA
282 recurrence. These results suggested the PDX models recapitulated clinical AA response
283 phenotypes comprising ultraresponders with inhibition of tumor progression and a significant
284 extension of survival followed by tumor recurrence, and intermediate and minimal
285 responders with brief or limited AA effect on tumor growth inhibition followed by disease
286 progression.
287
288 Gene expression associated with LuCaP 136CR ultraresponsiveness to AA
289 To identify the gene expression profiles associated with AA ultraresponsiveness, we
290 conducted global transcriptome analyses of the PDX lines. We identified 531 differentially
291 expressed genes between the AA ultraresponder LuCaP 136CR versus the intermediate
292 responder LuCaP 96CR and minimal responder LuCaP 35CR at D7 (P < 0.0001, fold
293 change ≥3; Fig. 3A). LuCaP 77CR D7 tumors were not included in the global analysis
294 because the specimens were not available, but their EOS tumors were included in the gene
295 expression validation. Of the 156 genes that were successfully mapped into known gene
11
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
296 families, 68 (44%) were secreted proteins (Supplementary Fig. S2A). We observed that the
297 differential expression of these 68 secretory proteins in LuCaP 136CR were consistent
298 between early time point (D7; Supplementary Fig. S2B) and EOS (Supplementary Fig. S2C),
299 suggesting the expression of these markers was not dependent on age of mice or tumor
300 size. We then selected the top 10 upregulated and downregulated genes of secreted
301 proteins (total 20 genes) in the AA ultraresponder LuCaP 136CR compared with the
302 intermediate and minimal responders for qPCR validation (Fig. 3B and Supplementary Fig.
303 S3). Primers for 18 genes were available, and qPCR confirmed all of the eight upregulated
304 genes (CEL, ARMCX1, TNC, BMP7, IER3, FSTL5, SNTB1, and FBN2; Fig. 3C) and 10
305 downregulated genes (IL17RB, GDF15, ST6GAL1, SPOCK1, MSMB, INHBB, MINPP1,
306 GALS3BP, C15orf48, and PLA2G2A; Supplementary Fig. S4). However, the downregulated
307 genes showed more variable expression in the intermediate (LuCaP 77CR, LuCaP 96CR)
308 and minimal (LuCaP 35CR) responders and therefore were not included in the development
309 of a stringent gene signature for AA ultraresponsiveness.
310 We next validated the highly consistent eight-gene signature that was upregulated in
311 the AA ultraresponder LuCaP 136CR in an independent cohort of six LuCaP models that
312 displayed different responses to AA. As expected, the signature positively correlated with the
313 percentage gained survival on AA (R = 0.95, P = 0.0002; Fig. 3D and E), supporting the
314 potential of this eight-gene signature in predicting AA ultraresponsiveness.
315
316 Mechanisms associated with the acquired resistance of individual AA-responsive
317 phenotypes
318 To identify response and resistance mechanisms specific to different AA response
319 phenotypes, we conducted global transcriptome analyses on the AA-treated (D7) and AA-
320 resistant (EOS) tumors. Interestingly, upon AA resistance, a distinct set of genes was
321 differentially expressed in each of the four models (vehicle vs. AA, P < 0.01, fold change ≥2),
322 and there was virtually no overlap of genes between ultraresponders and
323 intermediate/minimal responders or within the intermediate and minimal responders (Fig. 4A
12
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
324 and Supplementary Table S5), suggesting that the AA-induced resistance mechanisms are
325 largely diverse. Next, we conducted Ingenuity Pathway Analysis to identify molecular and
326 cellular function involved in the AA resistance in individual models. For both ultraresponder
327 LuCaP 136CR and the intermediate responder LuCaP 77CR, cell growth and proliferation
328 represented 40% to 45% of genes that were associated with AA resistance. In LuCaP 96CR,
329 a majority of AA differentially expressed genes were related to cell morphology (30%),
330 whereas in the minimal responder, AA differentially expressed genes were principally
331 mapped to cell-to-cell signaling (20%) or cellular death and survival (20%) (Fig. 4B).
332 GSEA analysis showed that AA treatment of LuCaP 77CR was negatively associated
333 with signatures of cell growth and androgen-regulated genes upon resistance at EOS
334 (Supplementary Fig. S5). Similarly, AA treatment of LuCaP 96CR was negatively associated
335 with a cell cycle–associated signature that was previously reported to be decreased in a cell
336 line–derived xenograft model of AA resistance (Supplementary Fig. S4) (30). Interestingly, in
337 the AA ultraresponder LuCaP 136CR, we identified steroid metabolism as the top altered
338 regulator effect network upon AA resistance (Fig. 4C), which, together with the high basal
339 expression of the cholesterol esterase CEL, implies that alterations in the steroid availability
340 and usage may contribute to the development of AA resistance in this model. Importantly,
341 GSEA analysis showed that AA treatment of LuCaP 136CR was initially negatively
342 associated with signatures of proliferation, cell growth, and a selected AR transcriptional
343 program at D7, and this negative proliferation signature persisted but with fewer genes
344 represented at the leading edge at EOS (Supplementary Fig. S5). Despite the negative
345 association with the specific proliferation markers, LuCaP 136CR acquired AA resistance
346 that was enriched with genes associated with NF-κB transcriptional activity, EMT,
347 extracellular matrix, and prostate basal cells (Supplementary Fig. S5). These results suggest
348 the diversity of resistance mechanisms to AA and specifically indicate potential mechanisms
349 that drive AR-independent resistance in the AA ultraresponsive phenotype.
350
13
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
351 Low basal AR signaling and a further reduction of androgen signaling upon
352 resistance in the AA ultraresponder LuCaP 136CR
353 We examined the AR signaling axis to gain insight into its role in AA resistance and
354 tumor progression. Previous reports showed that AA treatment elevated serum levels of
355 progesterone and other upstream steroids that activated mutant AR (e.g., L701H and
356 T878A) leading to AA resistance (31-34). To elucidate whether AR mutation was involved in
357 the differential AA responsiveness observed in our models, we sequenced the ligand-binding
358 domain of AR and detected no mutation in the AA-treated LuCaP PDXs (data not shown),
359 suggesting that the differential AA responsiveness was not due to AR mutation.
360 We next conducted targeted analysis on intratumoral androgens and androgen
361 signaling pathways in AA-resistant tumors. We used a sensitive liquid chromatography–
362 mass spectrometry method to detect intratumoral androgens that are sensitive to AA
363 inhibition. In the ultraresponder LuCaP 136CR, AA treatment significantly reduced
364 intratumoral levels of testosterone (P = 0.009), dihydrotestosterone (P = 0.04),
365 androstenedione (P = 0.03; Fig. 5A), and androsterone (P = 0.04; Supplementary Fig. S6).
366 Interestingly, LuCaP 136CR demonstrated the lowest basal AR signaling among the LuCaP
367 lines tested, depicted by a low AR activity score (Fig. 5B) and a low AR signature score (Fig.
368 5C). Upon AA resistance, the decrease in intratumoral androgens was accompanied by a
369 general downregulation of steroidogenic enzymes, including LDLR (P = 0.004), STARD4 (P
370 = 0.005), and DUSP1 (P = 0.01) (Supplementary Table S3) (12), a further downregulation of
371 AR activity (Fig. 5B), and a reduced AR signature score (Fig. 5C). These results suggested
372 reduced AR signaling in the AA ultraresponder LuCaP 136CR upon resistance.
373 In contrast, despite decreasing testosterone in the intermediate responders LuCaP
374 77CR (P = 0.03) and LuCaP 96CR (P = 0.02) upon AA treatment, high variability in
375 dihydrotestosterone levels was observed in LuCaP 77CR and a statistically insignificant
376 reduction was observed in LuCaP 96CR (P = 0.11) (Fig. 5A). Upstream steroids, including
377 pregnenolone (P = 0.02) and dehydroepiandrosterone (DHEA; P = 0.056), were increased in
378 the intermediate responder LuCaP 77CR upon AA resistance (Supplementary Fig. S5),
14
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
379 whereas progesterone was decreased in the intermediate responder LuCaP 96CR (P =
380 0.02; Supplementary Fig. S6). Consistent with the sustained level of intratumoral androgens,
381 no reduction in the enrichment in AR-responsive genes (Fig. 5B) and AR signature (Fig. 5C)
382 was detected upon AA resistance in the intermediate responders LuCaP 77CR and LuCaP
383 96CR. Similarly, in the AA minimal responder LuCaP 35CR, AA treatment showed an initial
384 negative association with GSEA signatures of AR- and GR-regulated genes at D7
385 (Supplementary Fig. S5) and a reduction in our selected AR signature (Fig. 5C). However,
386 the negative association was not observed upon AA resistance at EOS (Supplementary Fig.
387 S5), and the AA-resistant tumor demonstrated a persistent expression of steroidogenic
388 enzymes (Supplementary Table S3), AR-responsive genes (Fig. 5B), and AR signature (Fig.
389 5C). Due to the limited number of LuCaP 35CR AA-resistant tumors available, statistically
390 significant change in the intratumoral androgens was not observed in these tumors upon AA
391 resistance (Fig. 5A). Collectively, these results pointed to sustained AR signaling in the AA
392 intermediate and minimal responders upon resistance. In all models, we also tested whether
393 the AA-resistant tumors acquired a neuroendocrine phenotype. Our results showed that both
394 neuroendocrine markers (chromogranin A and synaptophysin) were absent or minimally
395 expressed (<0.1% in LuCaP 77CR) in the vehicle-treated tumors and the expression did not
396 change upon AA resistance (data not shown).
397 Finally, we questioned whether AR and GR levels in the tumor may contribute to the
398 downregulation of AR signaling in the AA-resistant tumors in the ultraresponder LuCaP
399 136CR and the sustained AR signaling in the intermediate or minimal responders. In the
400 ultraresponder LuCaP 136CR, the gene expression of AR and ARv7 was increased upon
401 castration (Supplementary Table S4) but remained unchanged upon further androgen
402 ablation by AA (Fig. 5D), and the nuclear AR and GR localization was not altered upon AA
403 resistance (Fig. 5, panels E and F). The nuclear GR level remained low even upon AA
404 resistance in the ultraresponder LuCaP 136CR (Fig. 5F). In the intermediate and minimal
405 responders, increased expression of AR and its variants was observed upon castration in
406 LuCaP 77CR (Supplementary Table S4), but the expression of AR and ARv7 generally
15
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
407 remained unchanged upon AA resistance except for LuCaP 96CR (Fig. 5D). Nuclear
408 localization of AR remained high (i.e., H-score > 100) in the intermediate and minimal
409 responders although a slight decrease in nuclear AR localization for LuCaP 77CR was
410 observed upon AA resistance (Fig. 5, panels D and F). Collectively, these findings
411 suggested active AR signaling in these AA-resistant tumors. Importantly, we observed a high
412 basal level of nuclear GR in the AA minimal responder LuCaP 35CR (Fig. 5F) and a
413 consistent upregulation of both GR gene expression (NR3C1, except for LuCaP 35CR) and
414 nuclear localization for all intermediate and minimal responders (Fig. 5, panels D and F).
415 These GR results may suggest that high basal nuclear GR localization is associated with AA
416 minimal responsiveness, and that an increase in nuclear GR upon AA treatment is
417 associated with rapid, acquired resistance. In summary, upon AA resistance, the
418 ultraresponder LuCaP 136CR displayed lower intratumoral androgens and AR signaling
419 accompanied by sustainably low nuclear GR localization. In contrast, the intermediate and
420 minimal responders demonstrated a slight decrease in intratumoral androgens and
421 sustained AR signaling associated with an increase in nuclear GR localization.
422
423 Discussion
424 AA is effective in a subset of patients, but responding tumors eventually develop
425 resistance. We used PDX models that recapitulated the diverse clinical responses of CRPC
426 to AA and identified heterogeneous response phenotypes, including ultraresponsive,
427 intermediate, and minimal. The ultraresponsive phenotype represents not only AA sensitivity
428 but also durability. We report for the first time that the AA ultraresponsive phenotype is
429 represented by a molecular signature of secreted proteins and biochemical features,
430 including low basal AR signaling and a low basal nuclear GR level, which is insensitive to
431 AA-induced upregulation.
432 Mechanisms underlying acquired resistance to AA are diverse and have not yet been
433 fully identified. GR was shown to compensate for reduced AR activity through activation of
434 overlapping target genes (35). High GR expression was associated with enzalutamide
16
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
435 insensitivity (16), and preliminary results of the COU-AA-203 study demonstrated that high
436 GR may predict low AA sensitivity (36). Our results provided novel information to highlight
437 the role of GR in response to AA: (a) a low level of nuclear GR, and sustainably low GR on
438 AA therapy, was predictive of durable AA inhibition; (b) low to intermediate levels of GR,
439 despite initial response, and increase in nuclear GR was associated with rapid, acquired
440 resistance to AA; and (c) a high basal level of GR was associated with de novo
441 resistance/minimal responsiveness. Notably, while we observed a concordant increase in
442 both GR transcript and protein expression levels in some models, discordance was present
443 in others. This result indicates that GR transcripts may not ideally reflect the protein level,
444 especially the nuclear protein level indicative of active GR signaling. Retrospective clinical
445 studies investigating response and resistance patterns have suggested cross-
446 response/resistance between enzalutamide and AA (37-44). However, whether a
447 sustainably low level of GR will lead to a durable response to either AA or enzalutamide in
448 patients, and whether an increase in GR is attributable to rapid AA resistance, requires
449 clinical confirmation.
450 Copy number gain of AR and CYP17A1 has been shown to predict shorter
451 progression-free survival with AA treatment (45). Our results supported, at a gene
452 expression level, that the intermediate responders LuCaP 77CR/LuCaP 96CR and the
453 minimal responder LuCaP 35CR demonstrated a higher AR level and enhanced androgen
454 signaling when compared with the ultraresponder LuCaP 136CR. On the other hand, other
455 preliminary studies on gene expression using pretreatment primary prostate cancer samples
456 reported a significant association between proliferation-associated genes, androgen-
457 regulated genes, and CYP17 cofactors with longer radiographic progression-free survival of
458 patients receiving AA (46).
459 In our studies, the ultraresponsive phenotype demonstrated reduced AR signaling
460 upon AA resistance, indicating an emergence of an AR-independent pathway to sustain
461 survival. Upon AA resistance, the ultraresponders presented an enrichment of genes
462 associated with EMT, prostate basal-type cells, and NF-κB activity. This is consistent with a
17
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
463 previous report showing an association between EMT induction and the emergence of
464 prostate cancer stem-like cells (CSC)-like phenotype following androgen deprivation (47).
465 Additionally, activation of the NF-κB pathway is involved in the induction and maintenance of
466 EMT (48, 49) and CSC-like characteristics in prostate cancer (50-52). These characteristics
467 are concordant with the results of a preclinical study identifying a progenitor-like cell
468 population with increased NF-κB activity upon resistance to androgen depletion (53) and
469 reduced AR signaling upon increased NF-κB activity in prostate cancer (54). A recent report
470 on NF-κB as a potential resistance mechanism for enzalutamide independent of ARv7 may
471 provide another cross-resistance mechanism for AA (55).
472 In view of the heterogeneity of patients’ responses to AA therapy, identification of
473 biomarkers of responses has important implications for treatment selection in the context of
474 precision oncology. The preclinical eight-gene molecular signature of secreted proteins
475 associated with AA durable response that we identified can potentially be developed into a
476 fast, noninvasive test to predict AA response. However, our results at this point are limited to
477 the preclinical setting and by the number of PDX models representing each response
478 phenotype. Validation in prospective clinical studies is needed to support translational value
479 of this signature.
480 Collectively, the diverse resistant phenotypes associated with differential AA
481 responses highlighted the need for a tailored next line of therapy. The resistance in the AA
482 ultraresponsive phenotype was represented by low intratumoral androgens and AR signaling
483 accompanied by a sustainably low nuclear GR localization, and alteration in gene
484 expression associated with NF-κB activity and a EMT/basal cell phenotype. In contrast,
485 resistance in the intermediate and minimally responding phenotypes demonstrated
486 sustained AR signaling and increased nuclear GR localization. Novel treatments may be
487 explored to target NF-κB activity with a rationale to prevent or revert an EMT basal cell
488 phenotype in the ultraresponders and to target sustained AR/GR signaling in the
489 intermediate or minimal responders upon AA resistance.
490
18
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
491 Acknowledgments 492 493 Editorial assistance was provided by Ira Mills, PhD, of PAREXEL and funded by Janssen
494 Global Services, LLC. We thank Bryce Lakely and Daniel Sondheim for their excellent
495 technical assistance.
19
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
496 References 497 498 1. Crawford ED. Understanding the epidemiology, natural history, and key pathways
499 involved in prostate cancer. Urology 2009;73:S4-10.
500 2. Attard G, Belldegrun AS, de Bono JS. Selective blockade of androgenic steroid
501 synthesis by novel lyase inhibitors as a therapeutic strategy for treating metastatic
502 prostate cancer. BJU Int 2005;96:1241-6.
503 3. Barrie SE, Potter GA, Goddard PM, Haynes BP, Dowsett M, Jarman M. Pharmacology
504 of novel steroidal inhibitors of cytochrome P450(17) alpha (17 alpha-hydroxylase/C17-
505 20 lyase). J Steroid Biochem Mol Biol 1994;50:267-73.
506 4. O'Donnell A, Judson I, Dowsett M, Raynaud F, Dearnaley D, Mason M, et al. Hormonal
507 impact of the 17alpha-hydroxylase/C(17,20)-lyase inhibitor abiraterone acetate
508 (CB7630) in patients with prostate cancer. Br J Cancer 2004;90:2317-25.
509 5. de Bono JS, Logothetis CJ, Molina A, Fizazi K, North S, Chu L, et al. Abiraterone and
510 increased survival in metastatic prostate cancer. N Engl J Med 2011;364:1995-2005.
511 6. Fizazi K, Scher HI, Molina A, Logothetis CJ, Chi KN, Jones RJ, et al. Abiraterone
512 acetate for treatment of metastatic castration-resistant prostate cancer: final overall
513 survival analysis of the COU-AA-301 randomised, double-blind, placebo-controlled
514 phase 3 study. Lancet Oncol 2012;13:983-92.
515 7. Ryan CJ, Smith MR, de Bono JS, Molina A, Logothetis CJ, de Souza P, et al.
516 Abiraterone in metastatic prostate cancer without previous chemotherapy. N Engl J
517 Med 2013;368:138-48.
518 8. Rathkopf DE, Smith MR, de Bono JS, Logothetis CJ, Shore ND, de SP, et al. Updated
519 interim efficacy analysis and long-term safety of abiraterone acetate in metastatic
20
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
520 castration-resistant prostate cancer patients without prior chemotherapy (COU-AA-
521 302). Eur Urol 2014;66:815-25.
522 9. Ryan CJ, Smith MR, Fizazi K, Saad F, Mulders PF, Sternberg CN, et al. Abiraterone
523 acetate plus prednisone versus placebo plus prednisone in chemotherapy-naive men
524 with metastatic castration-resistant prostate cancer (COU-AA-302): final overall
525 survival analysis of a randomised, double-blind, placebo-controlled phase 3 study.
526 Lancet Oncol 2015;16:152-60.
527 10. Danila DC, Anand A, Sung CC, Heller G, Leversha MA, Cao L, et al. TMPRSS2-ERG
528 status in circulating tumor cells as a predictive biomarker of sensitivity in castration-
529 resistant prostate cancer patients treated with abiraterone acetate. Eur Urol
530 2011;60:897-904.
531 11. Antonarakis ES, Lu C, Wang H, Luber B, Nakazawa M, Roeser JC, et al. AR-V7 and
532 resistance to enzalutamide and abiraterone in prostate cancer. N Engl J Med
533 2014;371:1028-38.
534 12. Mostaghel EA, Marck BT, Plymate SR, Vessella RL, Balk S, Matsumoto AM, et al.
535 Resistance to CYP17A1 inhibition with abiraterone in castration-resistant prostate
536 cancer: induction of steroidogenesis and androgen receptor splice variants. Clin
537 Cancer Res 2011;17:5913-25.
538 13. Carreira S, Romanel A, Goodall J, Grist E, Ferraldeschi R, Miranda S, et al. Tumor
539 clone dynamics in lethal prostate cancer. Sci Transl Med 2014;6:254ra125.
540 14. Chen EJ, Sowalsky AG, Gao S, Cai C, Voznesensky O, Schaefer R, et al. Abiraterone
541 treatment in castration-resistant prostate cancer selects for progesterone responsive
542 mutant androgen receptors. Clin Cancer Res 2015;21:1273-80.
21
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
543 15. Romanel A, Gasi TD, Conteduca V, Jayaram A, Casiraghi N, Wetterskog D, et al.
544 Plasma AR and abiraterone-resistant prostate cancer. Sci Transl Med 2015;7:312re10.
545 16. Arora VK, Schenkein E, Murali R, Subudhi SK, Wongvipat J, Balbas MD, et al.
546 Glucocorticoid receptor confers resistance to antiandrogens by bypassing androgen
547 receptor blockade. Cell 2013;155:1309-22.
548 17. Montgomery B, Nelson PS, Vessella R, Kalhorn T, Hess D, Corey E. Estradiol
549 suppresses tissue androgens and prostate cancer growth in castration resistant
550 prostate cancer. BMC Cancer 2010;10:244.
551 18. Montgomery RB, Mostaghel EA, Vessella R, Hess DL, Kalhorn TF, Higano CS, et al.
552 Maintenance of intratumoral androgens in metastatic prostate cancer: a mechanism for
553 castration-resistant tumor growth. Cancer Res 2008;68:4447-54.
554 19. Nguyen HM, Ruppender N, Zhang X, Brown LG, Gross TS, Morrissey C, et al.
555 Cabozantinib inhibits growth of androgen-sensitive and castration-resistant prostate
556 cancer and affects bone remodeling. PLoS One 2013;8:e78881.
557 20. Morrissey C, Brown LG, Pitts TE, Vessella RL, Corey E. Bone morphogenetic protein 7
558 is expressed in prostate cancer metastases and its effects on prostate tumor cells
559 depend on cell phenotype and the tumor microenvironment. Neoplasia 2010;12:192-
560 205.
561 21. Pfitzenmaier J, Quinn JE, Odman AM, Zhang J, Keller ET, Vessella RL, et al.
562 Characterization of C4-2 prostate cancer bone metastases and their response to
563 castration. J Bone Miner Res 2003;18:1882-8.
564 22. Irizarry RA, Hobbs B, Collin F, Beazer-Barclay YD, Antonellis KJ, Scherf U, et al.
565 Exploration, normalization, and summaries of high density oligonucleotide array probe
566 level data. Biostatistics 2003;4:249-64.
22
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
567 23. Tusher VG, Tibshirani R, Chu G. Significance analysis of microarrays applied to the
568 ionizing radiation response. Proc Natl Acad Sci U S A 2001;98:5116-21.
569 24. Hieronymus H, Lamb J, Ross KN, Peng XP, Clement C, Rodina A, et al. Gene
570 expression signature-based chemical genomic prediction identifies a novel class of
571 HSP90 pathway modulators. Cancer Cell 2006;10:321-30.
572 25. Lam HM, Ho SM, Chen J, Medvedovic M, Tam NN. Bisphenol A disrupts HNF4alpha-
573 regulated gene networks linking to prostate preneoplasia and immune disruption in
574 noble rats. Endocrinology 2016;157:207-19.
575 26. Ruppender N, Larson S, Lakely B, Kollath L, Brown L, Coleman I, et al. Cellular
576 adhesion promotes prostate cancer cells escape from dormancy. PLoS One
577 2015;10:e0130565.
578 27. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, et al.
579 Gene set enrichment analysis: a knowledge-based approach for interpreting genome-
580 wide expression profiles. Proc Natl Acad Sci U S A 2005;102:15545-50.
581 28. Kanehisa M, Goto S. KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids
582 Res 2000;28:27-30.
583 29. Chan QK, Lam HM, Ng CF, Lee AY, Chan ES, Ng HK, et al. Activation of GPR30
584 inhibits the growth of prostate cancer cells through sustained activation of Erk1/2, c-
585 jun/c-fos-dependent upregulation of p21, and induction of G(2) cell-cycle arrest. Cell
586 Death Differ 2010;17:1511-23.
587 30. Yu Z, Chen S, Sowalsky AG, Voznesensky OS, Mostaghel EA, Nelson PS, et al. Rapid
588 induction of androgen receptor splice variants by androgen deprivation in prostate
589 cancer. Clin Cancer Res 2014;20:1590-600.
23
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
590 31. Cai C, Balk SP. Intratumoral androgen biosynthesis in prostate cancer pathogenesis
591 and response to therapy. Endocr Relat Cancer 2011;18:R175-R182.
592 32. Zhao XY, Malloy PJ, Krishnan AV, Swami S, Navone NM, Peehl DM, et al.
593 Glucocorticoids can promote androgen-independent growth of prostate cancer cells
594 through a mutated androgen receptor. Nat Med 2000;6:703-6.
595 33. Chen EJ, Sowalsky AG, Gao S, Cai C, Voznesensky O, Schaefer R, et al. Abiraterone
596 treatment in castration-resistant prostate cancer selects for progesterone responsive
597 mutant androgen receptors. Clin Cancer Res 2015;21:1273-80.
598 34. Cai C, Chen S, Ng P, Bubley GJ, Nelson PS, Mostaghel EA, et al. Intratumoral de
599 novo steroid synthesis activates androgen receptor in castration-resistant prostate
600 cancer and is upregulated by treatment with CYP17A1 inhibitors. Cancer Res
601 2011;71:6503-13.
602 35. Sahu B, Laakso M, Pihlajamaa P, Ovaska K, Sinielnikov I, Hautaniemi S, et al. FoxA1
603 specifies unique androgen and glucocorticoid receptor binding events in prostate
604 cancer cells. Cancer Res 2013;73:1570-80.
605 36. Efstathiou E, Li W, Gormley M, McMullin R, Ricci DS, Davis JW, et al. Biological
606 heterogeneity in localized high-risk prostate cancer (LHRPC) from a study of
607 neoadjuvant abiraterone acetate plus leuprolide acetate (LHRHa) versus LHRHa. J
608 Clin Oncol 2015;33:(supp: abstract 5005)
609 37. Loriot Y, Bianchini D, Ileana E, Sandhu S, Patrikidou A, Pezaro C, et al. Antitumour
610 activity of abiraterone acetate against metastatic castration-resistant prostate cancer
611 progressing after docetaxel and enzalutamide (MDV3100). Ann Oncol 2013;24:1807-
612 12.
24
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
613 38. Noonan KL, North S, Bitting RL, Armstrong AJ, Ellard SL, Chi KN. Clinical activity of
614 abiraterone acetate in patients with metastatic castration-resistant prostate cancer
615 progressing after enzalutamide. Ann Oncol 2013;24:1802-7.
616 39. Schrader AJ, Boegemann M, Ohlmann CH, Schnoeller TJ, Krabbe LM, Hajili T, et al.
617 Enzalutamide in castration-resistant prostate cancer patients progressing after
618 docetaxel and abiraterone. Eur Urol 2014;65:30-6.
619 40. Badrising S, van dN, V, van Oort IM, van den Berg HP, Los M, Hamberg P, et al.
620 Clinical activity and tolerability of enzalutamide (MDV3100) in patients with metastatic,
621 castration-resistant prostate cancer who progress after docetaxel and abiraterone
622 treatment. Cancer 2014;120:968-75.
623 41. Schmid SC, Geith A, Boker A, Tauber R, Seitz AK, Kuczyk M, et al. Enzalutamide after
624 docetaxel and abiraterone therapy in metastatic castration-resistant prostate cancer.
625 Adv Ther 2014;31:234-41.
626 42. Brasso K, Thomsen FB, Schrader AJ, Schmid SC, Lorente D, Retz M, et al.
627 Enzalutamide antitumour activity against metastatic castration-resistant prostate
628 cancer previously treated with docetaxel and abiraterone: a multicentre analysis. Eur
629 Urol 2015;68:317-24.
630 43. Suzman DL, Luber B, Schweizer MT, Nadal R, Antonarakis ES. Clinical activity of
631 enzalutamide versus docetaxel in men with castration-resistant prostate cancer
632 progressing after abiraterone. Prostate 2014;74:1278-85.
633 44. Bianchini D, Lorente D, Rodriguez-Vida A, Omlin A, Pezaro C, Ferraldeschi R, et al.
634 Antitumour activity of enzalutamide (MDV3100) in patients with metastatic castration-
635 resistant prostate cancer (CRPC) pre-treated with docetaxel and abiraterone. Eur J
636 Cancer 2014;50:78-84.
25
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
637 45. Salvi S, Casadio V, Conteduca V, Burgio SL, Menna C, Bianchi E, et al. Circulating
638 cell-free AR and CYP17A1 copy number variations may associate with outcome of
639 metastatic castration-resistant prostate cancer patients treated with abiraterone. Br J
640 Cancer 2015;112:1717-24.
641 46. Ricci DS, Li W, Griffin TW, Gromley M, Henitz E, Ryan CJ, et al. Predicting response
642 to abiraterone acetate (AA): mRNA biomarker analysis of study COU-AA-302. J Clin
643 Oncol 2014;32(5s):(abstract 5058)
644 47. Sun Y, Wang BE, Leong KG, Yue P, Li L, Jhunjhunwala S, et al. Androgen deprivation
645 causes epithelial-mesenchymal transition in the prostate: implications for androgen-
646 deprivation therapy. Cancer Res 2012;72:527-36.
647 48. Huber MA, Azoitei N, Baumann B, Grunert S, Sommer A, Pehamberger H, et al. NF-
648 kappaB is essential for epithelial-mesenchymal transition and metastasis in a model of
649 breast cancer progression. J Clin Invest 2004;114:569-81.
650 49. Wang X, Belguise K, Kersual N, Kirsch KH, Mineva ND, Galtier F, et al. Oestrogen
651 signalling inhibits invasive phenotype by repressing RelB and its target BCL2. Nat Cell
652 Biol 2007;9:470-8.
653 50. Odero-Marah VA, Wang R, Chu G, Zayzafoon M, Xu J, Shi C, et al. Receptor activator
654 of NF-kappaB Ligand (RANKL) expression is associated with epithelial to
655 mesenchymal transition in human prostate cancer cells. Cell Res 2008;18:858-70.
656 51. Birnie R, Bryce SD, Roome C, Dussupt V, Droop A, Lang SH, et al. Gene expression
657 profiling of human prostate cancer stem cells reveals a pro-inflammatory phenotype
658 and the importance of extracellular matrix interactions. Genome Biol 2008;9:R83.
26
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
659 52. Kong D, Wang Z, Sarkar SH, Li Y, Banerjee S, Saliganan A, et al. Platelet-derived
660 growth factor-D overexpression contributes to epithelial-mesenchymal transition of
661 PC3 prostate cancer cells. Stem Cells 2008;26:1425-35.
662 53. Rajasekhar VK, Studer L, Gerald W, Socci ND, Scher HI. Tumour-initiating stem-like
663 cells in human prostate cancer exhibit increased NF-kappaB signalling. Nat Commun
664 2011;2:162.
665 54. Campa VM, Baltziskueta E, Bengoa-Vergniory N, Gorrono-Etxebarria I, Wesolowski R,
666 Waxman J, et al. A screen for transcription factor targets of glycogen synthase kinase-
667 3 highlights an inverse correlation of NFkappaB and androgen receptor signaling in
668 prostate cancer. Oncotarget 2014;5:8173-87.
669 55. Jeganathan S, Zoubeidi A, Gleave M, Wouters BG, Joshua AM. Using functional and
670 chemical genomics to identify mechanisms of Enzalutamide resistance in prostate
671 cancer. Cancer Res 2015;75(15):(supp: abstract 732)
672
673
27
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
674 Legends
675 Figure 1.
676 Treatment scheme for AA on CRPC PDXs. Castration-resistant tumors were developed and
677 mice were treated orally with either vehicle or AA (0.5 mmol/kg/day). Mice were sacrificed
678 and tumors were harvested on D7 or when tumors reached 1,000 mm3 (EOS).
679 Figure 2.
680 Ultraresponsiveness to AA in LuCaP 136CR PDX models. A, Kaplan-Meier curves showing
681 survival benefits of AA treatment in different LuCaP PDX models. B, Linear model analyses
682 of tumor volume. C, Serum PSA upon AA treatment. n = 9–14 per group.
683 Figure 3.
684 Gene expression associated with LuCaP 136CR ultraresponsiveness. A, Supervised
685 clustering analyses showing 531 differentially expressed genes between LuCaP 136CR and
686 LuCaP 35CR and LuCaP 96CR on D7. Yellow: high gene expression; blue: low gene
687 expression. B, Schematic diagram on gene shaving to identify an eight-gene signature
688 associated with the LuCaP 136CR AA ultraresponsive phenotype. C, qPCR confirmation on
689 the eight-gene signature associated with LuCaP 136CR AA ultraresponsive phenotype (D7
690 and EOS). D, Heat map showing the microarray gene expression of the eight-gene signature
691 in multiple LuCaP models. E, Correlation between the enrichment of the eight-gene
692 signature associated with AA ultraresponsive phenotype and percentage gained in survival
693 upon AA treatment. Percentage survival gained was calculated based on median survival in
694 AA-treated versus vehicle-treated mice in each xenograft model. Each data point or column
695 represented an individual animal. P < 0.05 was considered statistically significant.
696 Figure 4.
697 Biological mechanisms underlying the acquired resistance to AA. A. Venn diagrams showing
698 distinct gene alternations by AA upon treatment resistance at EOS among different LuCaP
699 PDXs. B. Ingenuity Pathway Analysis identified the molecular and cellular functions
700 associated with AA resistance in different LuCaP PDXs. C, Top regulator effect network in
701 AA-resistant tumors in the AA ultraresponder LuCaP 136CR PDXs.
28
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
702 Figure 5.
703 Reduction of androgen signaling upon treatment resistance in the AA ultraresponsive
704 phenotype. A, Levels of intratumoral androgens in control and AA-resistant CRPC PDXs
705 measured by mass spectrometry. n = 2–6 per group. B, Heat map showing the low AR
706 activity (top row, pink squares) and low expression of genes involved in androgen signaling
707 in LuCaP 136CR (n = 4–6 per group), and C, their respective AR signature score in LuCaP
708 PDXs (n = 4–6 per group). D, qPCR analysis in vehicle versus AA-resistant tumors at EOS
709 (n = 4–6 per group). E, Representative IHC pictures of AR and GR, and F, their respective
710 H-score in control and AA-resistant PDXs (n = 6–12 per group). Scale bar: 50 μm.
711 Magnification: 200×. Each data point or column (heat map) represented an individual animal.
712 P < 0.05 was considered statistically significant.
29
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Figure 1
LuCaP 136CR and LuCaP 77CR
Castrate 3 Androgen- Tumor ≥100 mm sensitive tumor bits implanted Start treatment Tumor ≥1.5× volume D7 EOS Vehicle or sacrifice sacrifice AA 0.5 mmol/kg/day
LuCaP 96CR and LuCaP 35CR
CR tumor bits implanted Castrate Start treatment 3 2 weeks Tumor ≥100 mm D7 EOS Downloaded from clincancerres.aacrjournals.orgVehicle or sacrifice on September 23, 2021. © 2016 Americansacrifice Association for Cancer AA 0.5 mmol/kg/day Research. Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Figure 2
A Treatment CX AA LuCaP 136CR LuCaP 77CR LuCaP 96CR LuCaP 35CR HR (95% CI), 18.40 (4.79–70.62) HR (95% CI), 4.11 (1.22–13.78) HR (95%CI), 1.88 (0.63–5.60) HR (95% CI), 0.90 (0.27–2.97) P = 0.0001 P = 0.05 P = 0.02 P = 0.52 100 100 100 100 80 80 80 80 60 21.8 wks 60 9.5 wks 60 10 wks 60 9.5 wks 40 40 40 40 6.8 7.0 wks 5.75 wks 8.5 wks 20 20 20 20 Survival (%) Survival (%) Survival (%) wks Survival (%) 0 0 0 0 0 20 40 60 0 5 10 15 0 5 10 15 0 5 10 15 Time Time Time Time (weeks post enrollment) (weeks post enrollment) (weeks post enrollment) (weeks post enrollment)
B Treatment CX AA LuCaP 136CR LuCaP 77CR LuCaP 96CR LuCaP 35CR P = 0.0003 P = 0.013 P = 0.032 P = 0.22 1,500 1,500 1,500 1,500 ) ) ) ) 3 1,000 3 1,000 3 1,000 3 1,000
500 500 500 500 TV (mm TV (mm TV (mm TV (mm
0 0 0 0 0 20 40 60 0 4 8 12 16 0 10 20 30 40 0 5 10 15 20 Time Time Time Time (weeks post enrollment) (weeks post enrollment) (weeks post enrollment) (weeks post enrollment)
C Treatment CX AA LuCaP 77CR LuCaP 96CR LuCaP 35CR P = 0.001 P = 0.051 P = NS 1,500 1,500 1,500
1,000 1,000 1,000
500 500 500 PSA (ng/mL) PSA (ng/mL) PSA (ng/mL) 0 0 0 0 1 2 3 0 20 40 60 0 5 10 15 20 25 Time Time Time (weeks post enrollment) (weeks post enrollment) (weeks post enrollment)
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. A B -1 -2 -3 3 2 1 0 (8 upregulated and10downregulated) Heatmap 136CRvs 35CRand96CR Downloaded from P <0.0001,fold change≥3 Author ManuscriptPublishedOnlineFirstonDecember19,2016;DOI:10.1158/1078-0432.CCR-16-2054 Author manuscriptshavebeenpeerreviewedandacceptedforpublicationbutnotyetedited. 531 genes PDX lines 18 genes 20 genes 68 genes 8 genes 136CR qPCR conrmed forOptimal primers qPCR down-regulated genes Top and 10mostup- Secreted family: Gene Validation 35CR clincancerres.aacrjournals.org 96CR C D E Relative mRNA expresssion Relative mRNA expresssion Relative mRNA expresssion 0 1 2 3 4 0 1 2 3 0 1 2 3 136CR 136CR 136CR
Enrichment score (0–8) responder 0 2 4 6 8 Ultra- 50 0 P <0.0001 P <0.0001 P <0.0001 77CR 77CR 77CR on September 23, 2021. © 2016American Association for Cancer (w-ald 0.0032 0.9537 P (two-tailed) 95% CI Pearson r SNTB1 BMP7 Research. CEL 6R 35CR 96CR 6R 35CR 96CR 6R 35CR 96CR % Survival gaineduponAAtreatment % Survival Intermediate responders 0 150 100 0.62.91–0.9951 0.0 0.5 1.0 1.5 2.0 2.5 0.0 0.5 1.0 1.5 2.0 2.5 0 1 2 3 4 5 136CR 136CR 136CR P <0.0001 P <0.0001 P <0.0001 77CR 77CR 77CR ARMCX1 FBN2 IER3 6R 35CR 96CR 6R 35CR 96CR 35CR 96CR 0 250 200 responders Minimal 0.0 0.5 1.0 1.5 2.0 2.5 0 1 2 3 4 5 136CR 136CR P <0.0001 P <0.0001 77CR 77CR FSTL5 TNC 6R 35CR 96CR 6R 35CR 96CR Figure 3 Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Figure 4
A B 136CR 96CR 35CR 136CR 77CR P = 1.92 -4 to 1.13 -21 P = 4.46-2 to 1.81-4 Cellular growth and proliferation Cell morphology P = 1.90 -4 to 2.25 -20 P = 4.92-2 to 5.98-4 Cellular development Small molecular biochemistry P = 2.02 -4 to 1.26 -19 P = 4.68-2 to 5.98-4 315 714 59 212 Cellular death and survival Cellular function and maintenance P = 1.70 -4 to 6.02 -19 P = 4.90-2 to 1.36-3 Cellular movement Molecular transport
-4 -16 -3 9 0 P = 2.02 to 1.78 P = 1.59 2 Cell cycle Antigen presentation 0 10 20 30 40 50 0 10 20 30 40 42 % Genes % Genes
77CR 35CR
P = 1.23-2 to 1.26-10 P = 6.58-3 to 8.24-4 Cellular growth and proliferation Cell-to-cell signaling and interaction 96CR P = 1.23-2 to 1.26-10 P = 1.96-2 to 8.24-4 Cellular movement Cell death and survival P = 1.23-2 to 3.56-6 P = 4.28-2 to 8.24-4 Cellular development Cell morphology P = 1.23-2 to 6.15-5 P = 1.15-2 to 8.24-4 Cellular function and maintenance Cellular assembly and organization P = 1.23-2 to 6.15-5 P = 6.58-3 to 8.24-4 Cellular assembly and organization Cellular function and maintenance
0 10 20 30 40 50 0 5 10 15 20 25 % Genes % Genes
C
Prediction Legend
more extreme less Upregulated Downregulated
more con dence less Predicted activation Predicted inhibition
Predicted Relationships Leads to activation Leads to inhibition Findings inconsistent with state of downstream molecule Eect not predicted
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research. GR AR E D A Testosterone ua 3C LCP7C LCP9C LuCaP 35CR LuCaP 96CR LuCaP 77CR LuCaP 136CR LuCaP 35CR LuCaP 96CR LuCaP 77CR LuCaP 136CR NR3C1 V567 O ua 3C ua 7RLCP9C LuCaP35CR LuCaP96CR LuCaP77CR LuCaP136CR EOS AR V7 DHT AED Downloaded from
change pg/mg
Fold pg/mg .408 .001 .405 .90.10 2.59 0.52 1.14 0.12 1.20 0.83 1.04 .408 .60.65 0.86 0.87 0.94 .50.10 3.65 pg/mg DN DN .6N .70.54 1.77 ND 2.66 ND ND ND ND Author ManuscriptPublishedOnlineFirstonDecember19,2016;DOI:10.1158/1078-0432.CCR-16-2054 Author manuscriptshavebeenpeerreviewedandacceptedforpublicationbutnotyetedited. 0.0 2.5 0.5 1.0 1.5 2.0 0.00 0.08 0.02 0.04 0.06 15 10 0 5 P =0.0381 P =0.009 136CR LuCaP 136CR LuCaP P =0.0333 136CR LuCaP P change P =0.0317 Fold .500 .10.02 2.41 0.03 1.45 LuCaP clincancerres.aacrjournals.org LuCaP 77CR 77CR LuCaP 77CR P =NS CX P =NS P =0.0159 P =0.111 P LuCaP LuCaP 96CR 96CR LuCaP 96CR P =NS AA change Fold .50.00 4.45 LuCaP LuCaP 35CR 35CR P =NS LuCaP P =NS P =NS 35CR P change Fold .60.22 1.66 0.80 on September 23, 2021. © 2016American Association for Cancer Research. 0.40 P C B nGR IHC nAR IHC F
IHC score100 150 200 IHC score100 150 200 50 50 0 0 LuCaP 136CR LuCaP 136CR control
XAA CX AA CX AR signature EOS P =0.5664 P =0.1998 CX sum Z-score 136CR – D7 –15 –10 10 15 20 25 –5 20
Control 0 5 EOS AA P
D7 =NS D7
100 150 200 100 150 200 AA Control 50 50 control 0 0 EOS CX LuCaP 77CR LuCaP 77CR P 77CR =NS XAA CX XAA CX D7
P =0.0302 P =0.0013 D7 AA Control EOS P AA =0.004 EOS ControlD7 AA control EOS 100 150 200 100 150 200 50 50 P 96CR 0 0 EOS AA EOS Control =0.02 LuCaP 96CR LuCaP 96CR XAA CX AA CX EOS P =0.0007 P =0.7669 AA
EOS AA P
EOS Control =NS control EOS 35CR P 200 200 100 150 100 150 EOS AA =NS
50 50 EOS Control EOS AA 0 0 LuCaP 35CR LuCaP 35CR XAA CX AA CX P =0.0132 P =0.8467
EOS AA P =NS 35CR 77CR 96CR 136CR Figure 5 Author Manuscript Published OnlineFirst on December 19, 2016; DOI: 10.1158/1078-0432.CCR-16-2054 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Characterization of an abiraterone ultraresponsive phenotype in castration-resistant prostate cancer patient-derived xenografts
Hung-Ming Lam, Ryan McMullin, Holly Nguyen, et al.
Clin Cancer Res Published OnlineFirst December 19, 2016.
Updated version Access the most recent version of this article at: doi:10.1158/1078-0432.CCR-16-2054
Supplementary Access the most recent supplemental material at: Material http://clincancerres.aacrjournals.org/content/suppl/2016/12/17/1078-0432.CCR-16-2054.DC1
Author Author manuscripts have been peer reviewed and accepted for publication but have not yet been Manuscript edited.
E-mail alerts Sign up to receive free email-alerts related to this article or journal.
Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].
Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/early/2016/12/17/1078-0432.CCR-16-2054. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.
Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2016 American Association for Cancer Research.