DOCSLIB.ORG

(HRQOL): a Genome-Wide Study Approach

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

cancers Article Genetic Variations and Health-Related Quality of Life (HRQOL): A Genome-Wide Study Approach Araba A. Adjei 1, Camden L. Lopez 2 , Daniel J. Schaid 2, Jeff A. Sloan 2, Jennifer G. Le-Rademacher 2 , Charles L. Loprinzi 1, Aaron D. Norman 2, Janet E. Olson 2, Fergus J. Couch 3, Andreas S. Beutler 1, Celine M. Vachon 2 and Kathryn J. Ruddy 1,* 1 Department of Oncology, Mayo Clinic, Rochester, MN 55905, USA; [email protected] (A.A.A.); [email protected] (C.L.L.); [email protected] (A.S.B.) 2 Department of Health Sciences Research, Mayo Clinic, Rochester, MN 55905, USA; [email protected] (C.L.L.); [email protected] (D.J.S.); [email protected] (J.A.S.); [email protected] (J.G.L.-R.); [email protected] (A.D.N.); [email protected] (J.E.O.); [email protected] (C.M.V.) 3 Department of Laboratory Medicine and Pathology, Rochester, MN 55905, USA; [email protected] * Correspondence: [email protected] Simple Summary: Health-related quality of life (HRQOL) is associated with cancer prognosis as well as with age, sex, race, and lifestyle factors, including diet and physical activity. To investigate the hypothesis that HRQOL has genetic underpinnings in patients with cancer, we performed a genome-wide association study to evaluate genetic variants (single nucleotide polymorphisms, SNPs) associated with mental and physical QOL as measured by the PROMIS assessment tool in breast Citation: Adjei, A.A.; Lopez, C.L.; cancer survivors participating in a longitudinal cohort study, the Mayo Clinic Breast Disease Registry Schaid, D.J.; Sloan, J.A.; (MCBDR). Age and financial concerns were associated with worse physical and mental health, and Le-Rademacher, J.G.; Loprinzi, C.L.; previous receipt of chemotherapy was associated with worse mental health. SNPs in SCN10A, Norman, A.D.; Olson, J.E.; Couch, F.J.; LMX1B, SGCD, PARP12, and SEMA5A were associated with physical and mental QOL, but none at Beutler, A.S.; et al. Genetic Variations the genome-wide significance thresholds of p < 5 × 10−8. and Health-Related Quality of Life (HRQOL): A Genome-Wide Study Abstract: Health-related quality of life (HRQOL) is an important prognostic patient-reported outcome Approach. Cancers 2021, 13, 716. https://doi.org/10.3390/cancers in oncology. Because prior studies suggest that HRQOL is, in part, heritable, we performed a GWAS 13040716 to elucidate genetic factors associated with HRQOL in breast cancer survivors. Physical and mental HRQOL were measured via paper surveys that included the PROMIS-10 physical and mental Academic Editors: Marieke J.H. health domain scales in 1442 breast cancer survivors participating in the Mayo Clinic Breast Disease Coenen and Daniel L. Hertz Registry (MCBDR). In multivariable regression analyses, age and financial concerns were significantly Received: 31 December 2020 associated with global physical health (age: p = 1.6 × 10−23; financial concerns: p = 4.8 × 10−40) and Accepted: 4 February 2021 mental health (age: p = 3.5 × 10−7; financial concerns: p = 2.0 × 10−69). Chemotherapy was associated Published: 10 February 2021 with worse global mental health (p = 0.01). In the GWAS, none of the SNPs reached the genome-wide association significance threshold of 5 × 10−8 for associations with either global physical or global Publisher’s Note: MDPI stays neutral mental health, however, a cluster of SNPs in SCN10A, particularly rs112718371, appeared to be linked with regard to jurisdictional claims in to worse global physical health (p = 5.21 × 10−8). Additionally, SNPs in LMX1B, SGCD, PARP12 published maps and institutional affil- and SEMA5A were also moderately associated with worse physical and mental health (p < 10−6). iations. These biologically plausible candidate SNPs warrant further study as possible predictors of HRQOL. Keywords: health-related quality of life; genome-wide association study; global physical and men- tal health Copyright: © 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and 1. Introduction conditions of the Creative Commons Attribution (CC BY) license (https:// Health-related quality of life (HRQOL) is a multifactorial concept of a person’s self- creativecommons.org/licenses/by/ perception of physical, psychological, and social functioning, often subdivided into sev- 4.0/). eral domains, including physical health, emotional health, cognitive functioning, fatigue, Cancers 2021, 13, 716. https://doi.org/10.3390/cancers13040716 https://www.mdpi.com/journal/cancers Cancers 2021, 13, 716 2 of 15 and pain [1,2] HRQOL correlates with survival in patients with cancer, and is influenced by demographic characteristics, such as age, sex, and race. Lifestyle factors, including diet and physical activity, are also associated with HRQOL [3–6]. Quality of life in cancer patients is dynamic and is influenced not only by symptoms of the disease and adverse effects of the treatment but by psychological, social, and spiritual factors as well [7]. Additionally, cancer-related financial hardship has been associated with poor HRQOL [8,9]. Multiple biological pathways play a role in HRQOL [2], including via an impact of the dopaminergic pathway on emotional functioning and via an impact of the inflammation pathway on multiple domains of HRQOL. Specifically, links between the inflammatory pathway and both fatigue and pain are well-established [2–6,10]. Genetic variation may underlie individual differences in HRQOL, which are substan- tial even for patients receiving identical medical care for very similar health problems. There have been reports regarding the relationship between genetic polymorphisms and pain [11–14], and family and twin studies have identified 30–50% heritability for sub- jective well-being, depression, and anxiety, and 22–42% heritability for HRQOL [15–17]. Genetic underpinnings of inflammatory pathways may be important, with a number of single nucleotide polymorphisms (SNPs) in cytokine genes and the glutathione metabolic pathway found to be associated with QOL in different populations [2,18–20]. Although the exact mechanisms by which genetic variants in inflammatory genes contribute to individual variation in QOL are yet to be elucidated, inflammation may increase the severity of symp- toms experienced in diseases, such as cancer, impacting functional status and QOL [2,21]. Genetic variants in inflammatory, dopaminergic, serotonergic, and neurotrophic signaling, as well as neuroactive ligand-receptor interaction pathways, have been associated with overall HRQOL, and oxytocin-related genes and genes involved in the serotonergic and dopaminergic pathways appear to play a role in social functioning [1,2,15,18–20]. Candidate gene studies in lung cancer have reported that some SNPs in interleukin genes IL1b, IL1RN, and IL10 are associated with fatigue (a common driver of impaired HRQOL in patients with cancer) [2,18]. Other SNPs in inflammation pathway genes, such as PTGS2 and LTA, have also been associated with pain and QOL [22–25]. In addition, SNPs rs3858300, rs10741191, and rs3852507 in MGMT (a DNA repair pathway gene) have been associated with overall QOL in patients with lung cancer, and SNPs rs2756109 in ABCC2 and rs9524885 in ABCC4 (glutathione metabolic pathway) have been associated with pain [20]. An SNP in p38 MAPK signaling pathway gene, MEF2B rs2040562, has also been reported as a genetic determinant of HRQOL in patients with lung cancer [26]. Building on the findings of these candidate gene studies, a genome-wide study in 5142 Swedish women [17] did not find any SNPs significantly associated with QOL (Bonferroni- corrected significance threshold 2.86 × 10−7) but observed SNPs with moderate association, including rs17599095 in FSTL5 with social functioning and rs813299 in TRPM1 with global health/QOL. In this current study, we aimed to perform a comprehensive GWAS to explore the relationship between genetic variations and HRQOL domains in a large cohort of breast cancer survivors. 2. Results 2.1. Patient Characteristics The characteristics of the participants in this HRQOL study are shown in Table1. At the time of this study, 8317 patients had consented to the Mayo Clinic Breast Disease Registry (MCBDR), as depicted in Figure1. After exclusion of subjects without available genotyping data (n = 4901), those who did not return a follow-up questionnaire (n = 1129), and those who had prior cancer diagnosis (n = 352), a DCIS diagnosis (n = 329) or a metastatic disease diagnosis (n = 38), a total of 1568 patients remained. Nine had not responded to questions inquiring about financial concerns, and 117 had not completed the PROMIS-10 instrument, therefore, 126 additional patients were excluded from our analysis. Cancers 2021, 13, 716 3 of 15 Table 1. Patient characteristics (n = 1442). Demographic Factors n (%) Non-white, unknown, or undisclosed 56 (3.9%) Race White 1386 (96.1%) Mean (SD) 53.4 (11.5) Age at diagnosis in years Median (Q1, Q3) 51.5 (45.6, 62.4) Range 22.7–90.0 Mean (SD) 61.6 (12.8) Age at time of QOL assessment in years Median (Q1, Q3) 61.0 (52.5, 71.4) Range 26.2–95.5 Mean (SD) 8.2 (3.8) Years between cancer diagnosis and QOL Median (Q1, Q3) 8.3 (5.0, 10.9) assessment Range 0.9–16.7 Male 3 (0.2%) Gender Female 1439 (99.8%) Mean (SD) 2.1 (2.7) Financial concerns rating Median (Q1, Q3) 1.0 (0.0, 3.0) (patient-reported) Range 0.0–10.0 Cancers 2021, 13, x 4 of 15 Mastectomy 782 (54.2%)/660 (45.8%) Treatment received any time before QOL Axillary lymph node dissection (ALND) 530 (36.8%)/912 (63.2%) assessment Chemotherapy 608 (42.2%)/834 (57.8%) (Yes/No) of 0 (where 0 = no financial concern). Chemotherapy treatment was associated only with Radiation 689 (47.8%)/753 (52.2%) worse global mental health (p = 0.01), not global physical health.
Recommended publications
  • 1 Evidence for Gliadin Antibodies As Causative Agents in Schizophrenia

    1 Evidence for Gliadin Antibodies As Causative Agents in Schizophrenia

    1 Evidence for gliadin antibodies as causative agents in schizophrenia. C.J.Carter PolygenicPathways, 20 Upper Maze Hill, Saint-Leonard’s on Sea, East Sussex, TN37 0LG [email protected] Tel: 0044 (0)1424 422201 I have no fax Abstract Antibodies to gliadin, a component of gluten, have frequently been reported in schizophrenia patients, and in some cases remission has been noted following the instigation of a gluten free diet. Gliadin is a highly immunogenic protein, and B cell epitopes along its entire immunogenic length are homologous to the products of numerous proteins relevant to schizophrenia (p = 0.012 to 3e-25). These include members of the DISC1 interactome, of glutamate, dopamine and neuregulin signalling networks, and of pathways involved in plasticity, dendritic growth or myelination. Antibodies to gliadin are likely to cross react with these key proteins, as has already been observed with synapsin 1 and calreticulin. Gliadin may thus be a causative agent in schizophrenia, under certain genetic and immunological conditions, producing its effects via antibody mediated knockdown of multiple proteins relevant to the disease process. Because of such homology, an autoimmune response may be sustained by the human antigens that resemble gliadin itself, a scenario supported by many reports of immune activation both in the brain and in lymphocytes in schizophrenia. Gluten free diets and removal of such antibodies may be of therapeutic benefit in certain cases of schizophrenia. 2 Introduction A number of studies from China, Norway, and the USA have reported the presence of gliadin antibodies in schizophrenia 1-5. Gliadin is a component of gluten, intolerance to which is implicated in coeliac disease 6.
  • EFA6A, an Exchange Factor for Arf6, Regulates Early Steps in Ciliogenesis

    EFA6A, an Exchange Factor for Arf6, Regulates Early Steps in Ciliogenesis

    EFA6A, an exchange factor for Arf6, regulates early steps in ciliogenesis Mariagrazia Partisani, Carole Baron, Rania Ghossoub, Racha Fayad, Sophie Pagnotta, Sophie Abélanet, Eric Macia, Frédéric Brau, Sandra Lacas-Gervais, Alexandre Benmerah, et al. To cite this version: Mariagrazia Partisani, Carole Baron, Rania Ghossoub, Racha Fayad, Sophie Pagnotta, et al.. EFA6A, an exchange factor for Arf6, regulates early steps in ciliogenesis. Journal of Cell Science, Company of Biologists, 2021, 134 (2), pp.jcs249565. 10.1242/jcs.249565. hal-03120586 HAL Id: hal-03120586 https://hal.archives-ouvertes.fr/hal-03120586 Submitted on 19 Apr 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. © 2021. Published by The Company of Biologists Ltd | Journal of Cell Science (2021) 134, jcs249565. doi:10.1242/jcs.249565 RESEARCH ARTICLE EFA6A, an exchange factor for Arf6, regulates early steps in ciliogenesis Mariagrazia Partisani1, Carole L. Baron1, Rania Ghossoub2, Racha Fayad1, Sophie Pagnotta3, Sophie Abélanet1, Eric Macia1,Frédéric Brau1, Sandra Lacas-Gervais3, Alexandre Benmerah4,Frédéric Luton1 and Michel Franco1,* ABSTRACT localized to the PC and which play an important role in its assembly Ciliogenesis is a coordinated process initiated by the recruitment and and/or function.
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K

    Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K

    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
  • LMX1B Gene LIM Homeobox Transcription Factor 1 Beta

    LMX1B Gene LIM Homeobox Transcription Factor 1 Beta

    LMX1B gene LIM homeobox transcription factor 1 beta Normal Function The LMX1B gene provides instructions for producing a protein that attaches (binds) to specific regions of DNA and regulates the activity of other genes. On the basis of this role, the LMX1B protein is called a transcription factor. The LMX1B protein appears to be particularly important during early embryonic development of the limbs, kidneys, and eyes. Health Conditions Related to Genetic Changes Nail-patella syndrome At least 145 mutations in the LMX1B gene have been found to cause nail-patella syndrome. Most mutations result in the production of an abnormally short, nonfunctional version of the LMX1B protein or change a single protein building block (amino acid). Mutations that substitute one amino acid for another amino acid reduce or eliminate the protein's ability to bind to DNA, disrupting the regulation of other genes during early development. Deletions of the entire LMX1B gene or large portions of the gene have also been shown to cause nail patella syndrome. It is unclear exactly how mutations in the LMX1B gene lead to the signs and symptoms of nail-patella syndrome. Other Names for This Gene • LIM homeo box transcription factor 1, beta • LIM homeobox transcription factor 1, beta • LMX1.2 • LMX1B_HUMAN • MGC138325 • MGC142051 • NPS1 Reprinted from MedlinePlus Genetics (https://medlineplus.gov/genetics/) 1 Additional Information & Resources Tests Listed in the Genetic Testing Registry • Tests of LMX1B (https://www.ncbi.nlm.nih.gov/gtr/all/tests/?term=4010[geneid])
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
  • Phox2a Defines a Developmental Origin of the Anterolateral System in Mice And

    Phox2a Defines a Developmental Origin of the Anterolateral System in Mice And

    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.10.144659; this version posted June 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Title: Phox2a defines a developmental origin of the anterolateral system in mice and 2 humans 3 4 Authors: R. Brian Roome1,2, Farin B. Bourojeni1,2, Bishakha Mona3, Shima Rastegar- 5 Pouyani1,2, Raphael Blain4, Annie Dumouchel1, Charleen Salesse1, W. Scott Thompson1, 6 Megan Brookbank1, Yorick Gitton4, Lino Tessarollo5, Martyn Goulding6, Jane E. 7 Johnson3,7, Marie Kmita1,9, Alain Chédotal4 and Artur Kania1,2,8,9,#,* 8 9 Affiliations : 10 1Institut de Recherches Cliniques de Montréal (IRCM), Montréal, QC, H2W 1R7, 11 Canada 12 2Integrated Program in Neuroscience, McGill University, Montréal, QC, H3A 2B4, 13 Canada 14 3Department of Neuroscience, UT Southwestern Medical Center, Dallas, TX, 75390, 15 United States 16 4Sorbonne Université, INSERM, CNRS, Institut de la Vision, 17 Rue Moreau, Paris, 17 75012, France 18 5Neural Development Section, Mouse Cancer Genetics Program, National Cancer 19 Institute, Frederick, MD, 21702, United States 20 6Molecular Neurobiology Laboratory, The Salk Institute for Biological Studies, La Jolla, 21 CA, 92037, United States 22 7Department of Pharmacology, UT Southwestern Medical Center, Dallas, TX, 75390, 23 United States 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.10.144659; this version posted June 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
  • Rbpj-Dependent and -Independent Notch2 Signaling Regulates

    Rbpj-Dependent and -Independent Notch2 Signaling Regulates

    RBPJ-DEPENDENT AND -INDEPENDENT NOTCH2 SIGNALING REGULATES CILIARY BODY DEVELOPMENT IN THE MOUSE EYE By Yi Zhou B.S., Tsinghua University, 2010 Submitted to the graduate degree program in Anatomy and Cell Biology and the Graduate Faculty of the University of Kansas in partial fulfillment of the requirements for the degree of Doctor of Philosophy. ________________________________ Ting Xie, Ph.D., Co-Chair ________________________________ William Kinsey, Ph.D., Co-Chair ________________________________ Dale Abrahamson, Ph.D. ________________________________ Peter Smith, Ph.D. ________________________________ Jerry Workman, Ph.D. Date Defended: Jan 6th, 2016 The Dissertation Committee for Yi Zhou certifies that this is the approved version of the following dissertation: RBPJ-DEPENDENT AND -INDEPENDENT NOTCH2 SIGNALING REGULATES CILIARY BODY DEVELOPMENT IN THE MOUSE EYE ________________________________ Ting Xie, Ph.D., Co-Chair ________________________________ William Kinsey, Ph.D., Co-Chair Date Approved: Jan 15th, 2016 ii ABSTRACT The ciliary body (CB) is a two-layered structure in the anterior eye, which is composed of the pigmented outer ciliary epithelium (OCE) and the non-pigmented inner ciliary epithelium (ICE). It is responsible for aqueous humor secretion and lens accommodation. Despite the important roles in maintaining normal eye functions, its development still remains poorly understood. The Notch signaling pathway is an evolutionarily conserved pathway that has diverse functions during tissue development and homeostasis. Canonical Notch signaling is mediated through the recombination signal binding protein for immunoglobulin kappa J region (RBPJ)-dependent transcription activation and repression. In this study, I have demonstrated that Notch2 and RBPJ are important regulators of CB development by conditionally deleting them in the developing CB.
  • A Transcription Factor Code Defines Nine Sensory Interneuron Subtypes in the Mechanosensory Area of the Spinal Cord

    A Transcription Factor Code Defines Nine Sensory Interneuron Subtypes in the Mechanosensory Area of the Spinal Cord

    A Transcription Factor Code Defines Nine Sensory Interneuron Subtypes in the Mechanosensory Area of the Spinal Cord Marta Garcia Del Barrio1, Steeve Bourane1, Katja Grossmann1, Roland Schu¨ le2, Stefan Britsch3,4, Dennis D.M. O’Leary1, Martyn Goulding1* 1 Molecular Neurobiology Laboratory, The Salk Institute for Biological Studies, La Jolla, California, United States of America, 2 Urologische Klinik/Frauenklinik und Zentrale Klinische Forschung, Klinikum der Universita¨t Freiburg, Freiburg, Germany, 3 Department of Medical Genetics, Max-Delbru¨ck-Center for Molecular Medicine, Berlin-Buch, Germany, 4 Institute for Molecular and Cellular Anatomy Ulm University, Ulm, Germany Abstract Interneurons in the dorsal spinal cord process and relay innocuous and nociceptive somatosensory information from cutaneous receptors that sense touch, temperature and pain. These neurons display a well-defined organization with respect to their afferent innervation. Nociceptive afferents innervate lamina I and II, while cutaneous mechanosensory afferents primarily innervate sensory interneurons that are located in lamina III–IV. In this study, we outline a combinatorial transcription factor code that defines nine different inhibitory and excitatory interneuron populations in laminae III–IV of the postnatal cord. This transcription factor code reveals a high degree of molecular diversity in the neurons that make up laminae III–IV, and it lays the foundation for systematically analyzing and manipulating these different neuronal populations to assess their function. In addition, we find that many of the transcription factors that are expressed in the dorsal spinal cord at early postnatal times continue to be expressed in the adult, raising questions about their function in mature neurons and opening the door to their genetic manipulation in adult animals.
  • Hereditary Hearing Impairment with Cutaneous Abnormalities

    Hereditary Hearing Impairment with Cutaneous Abnormalities

    G C A T T A C G G C A T genes Review Hereditary Hearing Impairment with Cutaneous Abnormalities Tung-Lin Lee 1 , Pei-Hsuan Lin 2,3, Pei-Lung Chen 3,4,5,6 , Jin-Bon Hong 4,7,* and Chen-Chi Wu 2,3,5,8,* 1 Department of Medical Education, National Taiwan University Hospital, Taipei City 100, Taiwan; [email protected] 2 Department of Otolaryngology, National Taiwan University Hospital, Taipei 11556, Taiwan; [email protected] 3 Graduate Institute of Clinical Medicine, National Taiwan University College of Medicine, Taipei City 100, Taiwan; [email protected] 4 Graduate Institute of Medical Genomics and Proteomics, National Taiwan University College of Medicine, Taipei City 100, Taiwan 5 Department of Medical Genetics, National Taiwan University Hospital, Taipei 10041, Taiwan 6 Department of Internal Medicine, National Taiwan University Hospital, Taipei 10041, Taiwan 7 Department of Dermatology, National Taiwan University Hospital, Taipei City 100, Taiwan 8 Department of Medical Research, National Taiwan University Biomedical Park Hospital, Hsinchu City 300, Taiwan * Correspondence: [email protected] (J.-B.H.); [email protected] (C.-C.W.) Abstract: Syndromic hereditary hearing impairment (HHI) is a clinically and etiologically diverse condition that has a profound influence on affected individuals and their families. As cutaneous findings are more apparent than hearing-related symptoms to clinicians and, more importantly, to caregivers of affected infants and young individuals, establishing a correlation map of skin manifestations and their underlying genetic causes is key to early identification and diagnosis of syndromic HHI. In this article, we performed a comprehensive PubMed database search on syndromic HHI with cutaneous abnormalities, and reviewed a total of 260 relevant publications.
  • A Spectrum of LMX1B Mutations in Nail-Patella Syndrome

    A Spectrum of LMX1B Mutations in Nail-Patella Syndrome

    ARTICLE A spectrum of LMX1B mutations in Nail-Patella syndrome: New point mutations, deletion, and evidence of mosaicism in unaffected parents Monica Marini, PhD1, Renata Bocciardi, PhD1, Stefania Gimelli, MS2, Marco Di Duca3, Maria T. Divizia, MD1, Anwar Baban, MD1, Harald Gaspar, MD4, Isabella Mammi, MD5, Livia Garavelli, MD6, Roberto Cerone, MD7, Francesco Emma, MD8, Maria F. Bedeschi, MD9, Romano Tenconi, MD10, Alberto Sensi, MD11, Andrea Salmaggi, MD12, Mario Bengala, MD13, Francesca Mari, MD14, Gianluca Colussi, MD15, Krzysztof Szczaluba, MD16, Stylianos E. Antonarakis, MD2, Marco Seri, MD17, Margherita Lerone, MD1, and Roberto Ravazzolo, MD1,18 Purpose: Nail-Patella syndrome (MIM 161200) is a rare autosomal mosaicism in unaffected parents in two cases, which, to our knowledge, dominant disorder characterized by hypoplastic or absent patellae, dys- are the first reported cases of inheritance of a mutated LMX1B allele in trophic nails, dysplasia of the elbows, and iliac horn. In 40% of cases, Nail-Patella syndrome patients from a mosaic parent. Conclusion: The a glomerular defect is present and, less frequently, ocular damage is study of the described case series provides some original observations observed. Inter- and intrafamilial variable expressivity of the clinical in an “old” genetic disorder. Genet Med 2010:12(7):431–439. phenotype is a common finding. Mutations in the human LMX1B gene Key Words: Nail-Patella syndrome, LMX1B gene, mutation, deletion, have been demonstrated to be responsible for Nail-Patella syndrome in mosaicism around 80% of cases. Methods: Standard polymerase chain reaction and sequencing methods were used for mutation and single nucleotide polymorphism identification and control of cloned sequences.
  • Isolation and Growth Factor Inducibility of the Xenopus Laevis Lmx1b Gene

    Isolation and Growth Factor Inducibility of the Xenopus Laevis Lmx1b Gene

    Int. J. Dev. Biol. 47: 253-262 (2003) Original Article Isolation and growth factor inducibility of the Xenopus laevis Lmx1b gene CAROLINE E. HALDIN, SARJIT NIJJAR1, KARINE MASSÉ, MARK W. BARNETT2 and ELIZABETH A. JONES* Cell and Molecular Development Group, Department of Biological Sciences, Warwick University, Coventry, U.K., 1School of Biosciences, University of Birmingham, U.K. 2Department of Anatomy, University of Edinburgh Medical School, University of Edinburgh, U.K. ABSTRACT This paper reports the cloning of the full length Xenopus laevis Lmx1b gene, Xlmx1b. Xlmx1b is a LIM homeodomain protein with high conservation to homologues identified in human, mouse, hamster and chick. In situ hybridisation and RT-PCR analysis showed that Xlmx1b has a specific temporal expression pattern which can be separated into three main spatial domains. An Xlmx1b probe hybridized to regions of the nervous system from stage 13 onwards; these regions included the placodes and otic vesicles, the eye and specific sets of neurons. Sectioning of in situ hybridised embryos confirmed the location of transcripts as discreet regions of staining in ventro- lateral regions of the neural tube. From stage 27, transcripts could be detected in the capsule of pronephric glomus. Finally, transcripts were detected by Northern blot analysis in the developing fore and hind limbs. Xlmx1b transcripts were also detected by Northern blot analysis in eye, brain, muscle and mesonephros tissue in metamorphosing tadpoles. RT-PCR analysis showed that zygotic expression of Xlmx1b is initiated at stage 10.5 and the temporal sequence of Xlmx1b expression is identical in both neural and presumptive pronephros regions. The effects of the growth factors activin A, retinoic acid (RA) and basic fibroblast growth factor (bFGF) on the regulation of Xlmx1b were also studied.
  • E-Cadherin Accumulation Within the Lymphovascular Embolus of Inflammatory Breast Cancer Is Due to Altered Trafficking

    E-Cadherin Accumulation Within the Lymphovascular Embolus of Inflammatory Breast Cancer Is Due to Altered Trafficking

    ANTICANCER RESEARCH 30: 3903-3910 (2010) E-Cadherin Accumulation within the Lymphovascular Embolus of Inflammatory Breast Cancer Is Due to Altered Trafficking YIN YE1, JOSEPH D. TELLEZ1, MARIA DURAZO1, MEAGAN BELCHER1, KURTIS YEARSLEY2 and SANFORD H. BARSKY1,3,4 1Department of Pathology, University of Nevada School of Medicine, Reno, NV 89557, U.S.A.; 2Department of Pathology, Ohio State University, Columbus, OH 43210, U.S.A.; 3Department of Pathology, The Whittemore-Peterson Institute, Reno, NV 89557, U.S.A.; 4Department of Pathology, Nevada Cancer Institute, Las Vegas, NV 89135, U.S.A. Abstract. E-Cadherin functions as a tumor suppressor in of the 95 KD band were observed. These findings suggest some invasive breast carcinomas and metastasis is promoted that it is the altered E-cadherin trafficking that contributes when its expression is lost. It has been observed, however, to its oncogenic rather than suppressive role in IBC. that in one of the most aggressive human breast cancers, inflammatory breast cancer (IBC), E-cadherin is E-Cadherin, an adhesion protein present in normal overexpressed and this accounts for the formation of the epithelial cells within lateral junctions (zona adherens), is lymphovascular embolus, a structure efficient at metastasis thought to function as a tumor suppressor in certain types and resistant to chemotherapy through unknown of invasive breast carcinomas and metastasis is promoted cytoprotective mechanisms. Studies using a human xenograft when its expression is lost by gene mutation, promoter model of IBC, MARY-X, indicate that the mechanism of E- methylation or promoter repression by snail/slug and other cadherin overexpression is not transcriptional but related to mediators of epithelial-mesenchymal transition (EMT) (1- altered protein trafficking.