Salix): Does This Result from a Trans-Speciﬁc Selective Sweep?

Home , Chosenia, Lunania, Salix alaxensis, Salix amygdaloides, Salix arbusculoides, Salix arizonica

Molecular Ecology (2014) doi: 10.1111/mec.12837

Understanding the spectacular failure of DNA barcoding in willows (Salix): Does this result from a trans-speciﬁc selective sweep?

DIANA M. PERCY,*† GEORGE W. ARGUS,‡ QUENTIN C. CRONK,*† ARON J. FAZEKAS,§ PRASAD R. KESANAKURTI,§ KEVIN S. BURGESS,¶ BRIAN C. HUSBAND,§ STEVEN G. NEWMASTER,§ SPENCER C.H. BARRETT** and SEAN W. GRAHAM*† *Department of Botany, University of British Columbia, Vancouver, BC, Canada V6T 1Z4, †Biodiversity Research Centre, University of British Columbia, Vancouver, BC, Canada V6T 1Z4, ‡Canadian Museum of Nature, PO Box 3443 Stn “D”, Ottawa, ON, Canada K1P 6P4, §Department of Integrative Biology, University of Guelph, Guelph, ON, Canada N1G 2W1, ¶Department of Biology, Columbus State University, Columbus, GA 31907-5645, USA, **Department of Ecology & Evolutionary Biology, University of Toronto, 25 Willcocks Street, Toronto, ON, Canada M5S 3B2

Abstract Willows (Salix: Salicaceae) form a major ecological component of Holarctic floras and consequently are an obvious target for a DNA-based identification system. We surveyed two to seven plastid genome regions (~3.8 kb; ~3% of the genome) from 71 Salix species across all five subgenera, to assess their performance as DNA barcode markers. Although Salix has a relatively high level of interspecific hybridization, this may not sufficiently explain the near complete failure of barcoding that we observed: only one species had a unique barcode. We recovered 39 unique haplotypes, from more than 500 specimens, that could be partitioned into six major haplotype groups. A unique variant of group I (haplotype 1*) was shared by 53 species in three of five Salix subgenera. This unusual pattern of haplotype sharing across infrageneric taxa is suggestive of either a massive nonrandom coalescence failure (incomplete lineage sorting), or of repeated plastid capture events, possibly including a historical selective sweep of haplotype 1* across taxonomic sections. The former is unlikely as molecular dating indicates that haplotype 1* originated recently and is nested in the oldest major haplotype group in the genus. Further, we detected significant non-neutrality in the frequency spectrum of mutations in group I, but not outside group I, and demonstrated a striking absence of geographical (isolation by distance) effects in the haplotype distributions of this group. The most likely explanation for the patterns we observed involves recent repeated plastid capture events, aided by widespread hybridization and long-range seed dispersal, but primarily propelled by one or more trans-species selective sweeps.

Keywords: chloroplast capture, DNA barcoding, Malpighiales, molecular dating, phylogeography, selective sweep Received 19 December 2012; revision received 29 May 2014; accepted 4 June 2014

This is often inferred by observations of strong incon- Introduction gruence between plastid and nuclear gene trees, or dis- A partial failure of plastid data to track species bound- agreements between gene trees and classically defined aries is fairly common in phylogenetic plant studies species (Xu et al. 2012; Yu et al. 2013). The processes (Percy et al. 2008; Starr et al. 2009; Hassel et al. 2013). underlying this incongruence likely contribute to the somewhat lower success of DNA barcoding markers as Correspondence: Diana M. Percy, Department of Life Sciences, an identification tool in plants vs. animals (Fazekas Natural History Museum, Cromwell Road, London SW7 5BD, et al. 2009), possibly reflecting more slowly evolving UK, Fax: +44 (0)2079425229; E-mail: [email protected] markers, or more problematic levels of hybridization,

© 2014 John Wiley & Sons Ltd 2 D. M. PERCY ET AL. introgression or incomplete lineage sorting (Hollings- confusion from incomplete lineage sorting and facilitate worth et al. 2011). Here, we report on patterns of varia- species fingerprinting. However, comparative studies tion in DNA barcoding markers in the genus Salix. The have shown that while many plant groups may be ame- spectacular failure of DNA barcoding that we observe nable to reasonably precise species identification using in willows may require an explanation involving trans- DNA barcoding, others are less so (reviewed in Hol- specific selection. This in turn may have important con- lingsworth et al. 2011). Indeed, it is now acknowledged sequences for the interpretation of incongruence in that plant species are generally harder to barcode than other taxonomically complex plant groups. most animal species. This may reflect various phenom- Willows (Salix; Salicaceae), a genus of shrub and tree ena, including large effective population sizes, periods species, are a significant component of Holarctic ecosys- of rapid speciation, larger disparity in dispersal rates of tems (Ager & Phillips 2008; Argus 2010; Myers-Smith paternal and maternal haploid genomes and higher lev- et al. 2011). They are important indicators of riparian els of hybrid speciation or introgression (Fazekas et al. habitats, and many ecological studies include estimates 2009; Hollingsworth et al. 2011). of the diversity and abundance of willows because of One or more of these phenomena may have an their contribution to ecosystem function, community impact on the success of DNA barcoding in willows. dynamics and assemblage (Myers-Smith et al. 2011). Our overall goal in this study was to document the They are also extensively planted for habitat restoration, extent to which plastid DNA barcodes (CBOL Plant erosion control, and windbreaks, and the physiological Working Group 2009) can be implemented in Salix. The adaptations and ecological resilience of willows make more specific aims of this study were to: (i) establish them valuable species for use in conservation and envi- the extent of species identification that is possible ronmental projects (Kuzovkina & Quigley 2005; among western North American Salix using DNA bar- Kuzovkina & Volk 2009). code markers; (ii) to document haplotype patterns by The genus contains ~450 species worldwide, includ- sampling widely and deeply (within and among spe- ing localized and widespread species with extensive cir- cies); (iii) to establish a probable diversification time- cumpolar distributions. However, Salix species are scale among plastid haplotypes (e.g. in the context of notoriously difficult to identify based on morphology. historic environmental and climatic shifts in North Many species are vegetatively similar and exhibit sub- America); and (iv) to explore and evaluate hypotheses stantial heteroblasty (the production of markedly differ- for the unusual patterns of molecular diversity that we ent juvenile and adult leaves; Rechinger 1992; Zotz et al. observed. 2011). Furthermore, Salix populations are dioecious, and taxonomic keys often require examination of both sta- Methods minate and pistillate individuals. In many species, flow- ering (catkin production) occurs before leaf production, Specimen sampling presenting an additional challenge when using keys that consider both vegetative and reproductive traits. Salix species are subdivided into five subgenera (four Collectively, these factors can limit the characters avail- according to Chen et al. 2010) and are mostly found in able to identify individuals sampled at a single period arctic, boreal and temperate regions (Argus 2010). Salix of development. Finally, hybridization may blur bound- is a large, diverse and widespread genus, and our sam- aries between individual species, and hybrid offspring pling covers a wide range of the geographic (from can exhibit highly variable morphologies (Mosseler North America, Asia, and Europe) and phenotypic 1990; Hardig et al. 2000). diversity and includes a fair representation of the broad The development of a molecular identification system taxonomic diversity of the genus, with representatives for willows, such as DNA barcoding (CBOL Plant from 27 of the ~40 sections (Table 1). Our species sam- Working Group 2009), would be a useful tool for pling focused on western North America, the most spe- applied and basic research in the genus. The organellar cies-rich region of the North American willow flora. We genomes (plastid or mitochondrial) are currently the sampled extensively within British Columbia, the prov- source of choice for plant and animal DNA barcodes. ince with the greatest willow diversity in Canada, with These genomes are haploid and typically uniparentally supplemental sampling in adjacent regions (e.g. Yukon, transmitted and have smaller effective population sizes Alberta) and more widely across northern temperate than those in the diploid nuclear genome (and the dioe- regions, including species from central and eastern Can- cious sexual system of Salix would be expected to ada, the United States, Europe, Mexico and Japan. We reduce effective population size further, Maynard Smith sampled a total of 546 individuals, representing 71 spe- 1978). Loci in organellar genomes therefore undergo cies, 10 identified hybrids and an additional 10 more rapid coalescence, which in turn should reduce individuals that could not be identified to species due

Table 1 Salix subgenera and sections (according to Flora of Our sampling included several voucher specimens col- North America, Argus 2010) sampled for this study are shown lected between 1946 and 2000; individual herbarium (species sampled and number of individuals sampled per samples of Salix with well preserved green leaves were taxon relative to worldwide diversity are given in Appendix II) selected, and they were all successfully amplified and with assignment to the six major haploptype groups (G) sequenced (the oldest of these were collected in 1946 and Subgenera Section G 1947). We also sampled herbarium material from five hybrid willows from a study by Mosseler (1990), derived Chamaetia Chamaetia I from experimental crosses made in 1983. We were able Diplodictyae I to sequence all five hybrids (see Appendix II) and the Glaucae I three parents for rbcL[Salix interior (maternal pistillate Herbella I parent); S. eriocephala and S. petiolaris (paternal pollen Lindleyanae I Myrtilloides I donors)], and all of the hybrids and the two paternal Myrtosalix I parents for all of the remaining gene regions. Voucher Longifoliae Longifoliae V, VI specimens for new samples are housed at the University Protitea Humboldtianae IV of British Columbia and the Canadian Museum of Nat- Salix Maccallianae I ure, and specimen and collection details are publicly Magnificae I available on the BOLD database (project: SALIX; www. Salicaster II, III, IV boldsystems.org; Ratnasingham & Hebert 2007). Salix III Vetrix Arbuscella I The identity of each individual was carefully checked Canae I (by GWA and DMP), with assignments based on diag- Candidae I, V nostic morphological features of a given species, regard- Cinerella I, V less of haplotype (although cases of highly variable Cordatae I, V hybrid morphologies are noted below). We also care- Fulvae I fully checked for sequencing error by resequencing all Geyerianae I, V individuals of species and hybrids that were placed in Hastatae I, V Lanatae I more than one haplotype group, or where hybrids with Mexicanae I the same parents in the experimental crosses did not Phylicifoliae I, V carry the same haplotype. Sitchenses I Villosae I Viminella I DNA extraction, amplification, sequencing and alignment We stored field-collected leaf tissue in silica gel and to vegetative-only voucher material (referred to here as extracted genomic DNA using a modified CTAB Salix spp. I-J). The sampling comprises 59% of the 113 method (Doyle & Doyle 1987; Rai et al. 2003). For each species in the Flora of North America (Argus 2010). individual, we surveyed up to seven plastid loci that Our data set includes 29 species collected in British have been considered as candidate DNA barcoding Columbia (BC), representing 57% of the willow flora of regions (Fazekas et al. 2008; CBOL Plant Working the province (BC has 51 native species: 53% of the Group 2009). These comprised four coding regions native North American willow flora, and 65% of the (matK, rbcL, rpoB, rpoC1) and three intergenic spacer native Canadian willow flora). The BC willow flora regions (atpF-atpH, psbK-psbI, trnH-psbA). We amplified includes five introduced species (all are included in this them with published primers (Appendix I) using the analysis); none of these appear to be extensively inva- thermocycler and reaction conditions noted in Rai et al. sive, although a few are naturalized in cultivated situa- (2003, 2008), but with the annealing temperature raised tions such as urban parks. to 53 °C for the trnH-psbA region. Bidirectional We typically sampled multiple individuals per species sequencing of amplicons was performed at the Cana- (a mean of eight individuals per species), with most dian Centre for DNA Barcoding (CCDB, University of (80%) represented by more than two individuals, and Guelph; Ivanova et al. 2005). Our seven-region analyses only 12 (eight of these non-native) represented by a sin- used 145 individuals (39 species; Appendix II). We gle individual. Seven of the native, widespread, and compiled a more extensive data set with an additional highly variable species were represented by more than 401 samples for a total of 546 individuals (56 species) 20 individuals, with Salix sitchensis, one of the most and sequenced these for the two core plant DNA widespread and phenotypically variable species in barcoding regions, matK and rbcL (CBOL Plant Working western North America, represented by 54 individuals. Group 2009) (532 of the 546 individuals were

© 2014 John Wiley & Sons Ltd 4 D. M. PERCY ET AL. completely sequenced for both genes). We also bootstrap replicates and set MaxTrees to 100; for NJ, we sequenced cytochrome oxidase I (COI) for 30 samples used 1000 bootstrap replicates. (17 species and three hybrids) with the objective of test- Maximum parsimony and NJ analyses of the plastid ing a hypothesis that unusual aspects of the evolution- data were performed for: (i) each gene region indepen- ary history of the plastid genome (e.g. a selective dently (using the seven-region data set, Appendices II); sweep) may also be detectable for the mitochondrial (ii) the proposed core plant DNA barcoding combination genome (e.g. see Olson & McCauley 2000; Sun et al. (CBOL Plant Working Group 2009) rbcL + matK (using 2014). Sequences were assembled in Sequencher 4.7 the extended sampling, Appendix II), both with and (Gene Codes Corp, Ann Arbor, MI), and Se-Al (Ram- without 13 individuals that were only sequenced for one baut 1996) and are available from GenBank (see Data of the two regions); (iii) a 145 sample data set in which all Accessibility section below for GenBank numbers). The individuals are sequenced for all seven plastid regions plastid sequences are also archived on the BOLD data- (Appendix II). ML and Bayesian analyses were per- base (www.boldsystems.org; Ratnasingham & Hebert formed on a reduced version of the rbcL + matK data set 2007). Phylogenetic tree descriptions and the aligned that excluded all identical haplotypes. The resulting 39 matrices are also available from TreeBase (www.tree- unique Salix haplotypes were aligned with sequences base.org). We had no detected sequence polymorphisms from 15 additional taxa in Salicaceae and Lacistemata- suggestive of multiple plastid types (e.g. heteroplasmy) ceae obtained from GenBank, including representatives or instances of DNA inversions. The length variations of the genera Populus, Idesia, Poliothyrsis, Flacourtia, Xylo- and indels were few, and we did not treat these as sma, Casearia, Lunania, Scyphostegia and Lacistema (see independent characters. Alignment was unproblematic, Appendix III for species and GenBank numbers), and and we did not need to exclude regions. henceforth, inclusion of all of these taxa (e.g. for the dating analyses described below) is referred to as a ‘full’ set of outgroup taxa (we also performed several dating Analyses of molecular data analyses with a subset of outgroup taxa, see below). A We concatenated the plastid regions for analyses, as haplotype network diagram of the seven-region data set they belong to the same linkage group, and character- for Salix was produced using Haploviewer (Salzburger ized major haplotype groups using heuristic maximum et al. 2011) with the best ML tree topology parsimony (MP), distance neighbour-joining (NJ), and (lnL = 6295.796) with uninformative/missing/ambig- maximum likelihood (ML) analyses in PAUP* (Swofford uous characters removed (see Fig. 1). 2003) and a Bayesian analysis using BEAST (Drummond To aid in interpreting alternative processes (i.e. geo- & Rambaut 2007), described further below. The major graphical isolation-by-distance effects vs. geographically haplogroups as deﬁned here represent nested sets of widespread horizontal plastid capture) that may explain alleles whose phylogenetic relationships to each other patterns observed in our data, we performed two types are well supported, and whose relative times of diver- of statistical analyses. Although these methods, Mantel gence can be determined in a phylogenetic context. We tests and the Tajima’s D test statistic, are typically restrict usage of the term ‘haplotype’ to refer to unique employed for within-species analyses, the extensive variants and use haplogroup or ‘Group’ when referring hybridization among willow species may support their to sets of closely related haplotypes. The MP analysis applicability to the plastid data. Furthermore, we use employed 100 random addition replicates and NNI these analyses to look speciﬁcally at differences branch swapping, with MaxTrees set at 500; the NJ between group I and the other major haplotype groups. analysis used the Kimura 2-parameter (K2P) and the We used Mantel tests (1000 iterations) performed with BioNJ option (Gascuel 1997), which is an improved NJ the ‘Isolation-by-Distance Web Service’ (IBDWS v 3.23; method for large DNA sequences data sets. The ML Jensen et al. 2005) to assess the strength of correlation analysis considered a subset of taxa representing major between geographic distances (GPS coordinate point haplotype groups (i.e. unique haplotypes only; see data transformed into pairwise distances using the Geo- below) and used DNA substitution models and user- graphic Distance Matrix Generator; Ersts 2012) and input model parameters indicated by the Akaike Infor- plastid genetic distances (uncorrected and K2P dis- mation Criterion (AIC), as implemented in the program tances obtained from PAUP*) among the North American MODELTEST (Posada & Crandall 1998). The ML search individuals sampled on the seven plastid region data used 10 random addition replicates and NNI branch set, either with all taxa or with group I only. Non-North swapping. Branch support for major haplotype groups American samples were excluded to improve the likeli- (Table 2) was assessed using 200 bootstrap replicates hood of detecting any within-continent correlation. To (Felsenstein 1985) in RAXML (Stamatakis 2014). For MP, take into consideration the much larger geographical we used 10 random addition replicates for each of 200 distances vs. relatively small genetic distances, we also

Table 2 Bootstrap support for six major haplotype groups (G) using MP, NJ, and ML analyses for (a) all seven plastid regions, (b) three plastid regions (rbcL + matK + trnH-psbA) and (c) two plastid regions (rbcL + matK)

Analysis/No. genes G I G II I + II G III G IV G V G VI IV + V + VI

MP 7 100 95 99 99 88 58 100 100 NJ 7 98 100 100 100 97 98 100 100 ML 7 98 99 98 100 98 80 100 100 MP 3 — 88 79 93 — 60 97 97 NJ3 5396849974719489 ML 3 — 89 89 97 — 87 100 98 MP 2 — 89 — 64 —— 86 99 NJ 2 — 95 — 53 62 — 78 90 ML 2 — 75 — 75 74 — 88 97 performed the Mantel tests with and without log-trans- above). We ran the r8s analyses with two different out- formation of the geographical distances. We used the groups, one with Poliothyrsis used to root a taxon set Tajima’s D test statistic to assess the frequency spec- comprising Saliceae + Idesia + Poliothyrsis, and another trum of selectively neutral mutations in the plastid data with Lacistema used to root a taxon set that included the using DNASP v 5 (Librado & Rozas 2009) with all sites/ full set of outgroup taxa (in each case the outgroup mutations using the seven-region and two-gene data taxon used to root the tree was pruned before diver- sets, with either a) all taxa, b) group II-VI, or c) group I gence times were estimated; Sanderson 2006). We used only (Table 3). We selected a test of the overall fre- the Langley–Fitch algorithm (LF) (for the taxon set com- quency spectrum of polymorphisms rather than a gene- prising Saliceae + Idesia + Poliothyrsis) as these data alogy based approach (e.g. HHT or HCT; Innan et al. were found to satisfy a molecular clock hypothesis. We 2005) due to the potentially confounding effects of lat- used nonparametric rate smoothing (NPRS) and penal- eral plastid transfer on estimating species boundaries. ized likelihood (PL) methods (Sanderson 1997, 2002), To characterize the timescale of diversification of with either Powell or TN (truncated Newton) algo- plastid markers in Salix, we estimated the ages of the rithms for the full outgroup set, as these data violated a major haplotype groups based on the matK + rbcL data molecular clock. We established the optimum smooth- set (after reduction to nonidentical sequences). We first ing value for the PL analysis using the cross validation conducted a likelihood ratio test in PAUP*, comparing option in r8s. For all r8s analyses, we also used the the model with and without the molecular clock CheckGradient option as a further confirmation of the enforced to assess whether there was significant rate correctness of the selected methods and algorithms. heterogeneity in the Salix data, or in Saliceae (Sa- We calibrated these analyses using several fossils. lix + Populus) with two sets of additional outgroups Fossil evidence and biogeographic studies suggest a (see below). We then performed molecular dating possible warm temperate origin for Salix in North or analyses using a Bayesian approach in BEAST and a max- Central America followed by early occupation of ripar- imum likelihood approach using r8s (version 1.71, San- ian habitats (Collinson 1992; Boucher et al. 2003; Abdol- derson 2006). We confirmed that rate heterogeneity lahzadeh et al. 2011). Subsequent range expansion into tests in PAUP* (described above) were consistent with cooler northern hemisphere habitats was likely accom- the likelihood ratio test performed in r8s. Our BEAST panied by repeated advances and retreats to refugia analyses estimated mean rates of evolution, and trees during glacial and interglacial periods (Ager et al. 2010). and branch lengths from the data set with the full selec- Because the leaf characters of salicoid (gland-tipped) tion of outgroup taxa using the following parameters: teeth, camptodromous secondary venation, and elliptic, substitution model GTR + Γ; clock model relaxed un- lanceolate or deltoid shape are not unique to Salix and correlated lognormal; tree prior Yule process with uni- Populus (Boucher et al. 2003; Cronk 2005), there are form distribution model; MCMC chain length of 20 often problems associated with interpreting fossil mate- million with 25% burn-in (multiple parallel analyses rial. However, the recent identification of the North were run to check for stationarity, chain convergence American Eocene fossil Pseudosalix (bearing and effective sample sizes). We visualized the results in reproductive structures) as the immediate sister group the BEAST associated programs, TRACER, TREEANNOTATOR to the tribe Saliceae (Salix + Populus; Boucher et al. and FIGTREE. The ESS (effective sample size) values for 2003) has provided a useful additional calibration point all parameters estimated were >300. The r8s analyses for dating key events in the evolution of the family used the ML tree recovered using PAUP* (described Salicaceae, the order Malpighiales, and the origins of

7-region 2-region Unique haplotype # (# individuals) Salix arctica 2 (2 individuals) G I 16 spp. 3 (40 individuals) Chamaetia 3 spp. 4 (3 individuals) Salix Salix bebbiana 5 (3 individuals) Vetrix 1* Salix arbutifolia 6 (1 individual) Salix sitchensis 7 (1 individual) G II 4 spp. 8 (4 individuals) Salix Salix sitchensis 9 (1 individual) Salix calcicola 10 (1 individual) Individuals Salix sitchensis 11 (1 individual) Salix alaxensis 12 (1 individual) G I Salix lasiolepis 13 (2 individuals) 2 spp. 14 (10 individuals) 2 spp. 15 (2 individuals) G I 2 spp. 16 (3 individuals) G III G I Salix000000 cordata 17 (1 individual) Salix G II 53 spp. 1* (337 individuals) G III 2 spp. 18 (2 individuals) G IV 2spp. G IV I+II 19 (2 individuals) Protitea G V Salix geyeriana 20 (1 individual) G VI Salix 3spp. 21 (3 individuals) Salix drummondiana 22 (1 individual) 2 spp. 23 (2 individuals) 2 spp. 24 (3 individuals) G V Salix lasiandra 25 (39 individuals) G II Longifoliae Salix Salix exigua 26 (1 individual) Vetrix Salix petiolaris 27 (1 individual) Salix exigua 28 (1 individual) G V 8 spp. 29 (21 individuals) Salix discolor 30 (1 individual) G VI IV+V+ Longifoliae 2 spp. 3130(9 individuals) G VI VI Salix interior 32 (4 individuals) 3 spp. 33 (6 individuals) G IV Saliceae 3spp. 34 (6 individuals) Salix x meyeriana 35 (1 individual) Salix x sepulcralis 36 (3 individuals) G III Salix x sepulcralis 37 (1 individual) G III 2 spp. 38 (2 individuals) Salix serissima 39 (2 individuals) Populus tremuloides Populus tomentosa Populus nigra Populus tremula Populus trichocarpa Populus deltoides Populus balsamifera Idesia polycarpa Poliothyrsis sinensis Xylosma congesta Flacourtia jangomas Scyphostegia borneensis Lunania parviflora Casearia spp. Lacistema aggregatum – 0.001 substitutions/site

Fig. 1 Maximum clade credibility tree from the BEAST analysis including 39 unique matK + rbcL Salix haplotypes plus sequences obtained from GenBank for other genera (see Appendix III for details of outgroup taxon sampling). Major haplotype group positions (Groups I–VI) are shown and bootstrap support is given in Table 2. Inset: haplotype network diagram of the seven-region data set with major haplotype groups and Salix subgenera (see Table 1 and Appendix II for Salix classiﬁcation). modern tropical forests (Davis et al. 2005). The earliest have become well established in North America and unequivocal fossils of Populus and the fossil Pseudosalix Asia (Sun et al. 2004). It still remains unclear whether are from the early Middle Eocene Green River Forma- the extant genus Salix was also established in the tion of Utah and Colorado, 46–50 Mya (Manchester Eocene period, despite some reports of Salix fossils et al. 1986; Boucher et al. 2003). These fossils consist of from the Green River Formation (Brown 1934; MacGini- leafy shoots with unisexual inﬂorescences, and capsular tie 1969; Boucher et al. 2003). We therefore used two infructescences. Earlier leaf records from the Cretaceous fossil age constraints: the Middle Eocene (Green River and Palaeocene are thought to combine features of Pop- Formation) Pseudosalix handleyi fossil age of 48 Mya ulus, Idesia and Poliothyrsis (Iljinskaya & Chelebaeva (Boucher et al. 2003) as a mean node age (in BEAST, stan- 2002; Boucher et al. 2003), and there are plausible dard deviation 0.5) and minimum age (in r8s) constraint records for Populus from the late Palaeocene (Collinson for the crown clade of Saliceae [Saliceae (Populus + Sa- 1992). There are, however, numerous Eocene records lix) vs. Idesia split], and the Casearia-type Late-Middle for Salicaceae s.l., and by this period, Populus seems to Eocene (Panama) pollen age of 37 Mya (Graham 1985)

Table 3 Results of the Tajima’s D test statistic (Tajima 1989) found only a single nucleotide polymorphism (SNP) in which tests the hypothesis that the frequency spectrum of the COI region, a synapomorphy for two individuals mutations is selectively neutral that are in the same plastid haplotype group (I); otherwise, the mitochondrial sequences are identical. We Data set S Pi Theta Tajima’s D observed six major haplotype groups in various indi- All taxa, 7 genes 103 0.494 0.625 0.67 NS vidual and combined plastid gene analyses that were in All taxa, 2 genes 31 0.128 0.406 1.8* general moderately to strongly supported by bootstrap G I, 7 genes 38 0.043 0.229 2.51*** analysis (groups I-VI in Table 2, Fig. 1, Appendix II). ** G I, 2 genes 15 0.016 0.192 2.16 As expected, the seven regions belonging to the same G II-VI, 7 genes 79 0.72 0.577 0.9 NS plastid linkage group yield congruent gene trees, albeit G II-VI, 2 genes 20 0.383 0.296 0.85 NS with greater or lesser degrees of branch support S = number of polymorphic sites; Pi = nucleotide diversity per (Table 2). To illustrate the information present in each 100 sites; Theta = estimate of mutation rate (2Nel) per 100 sites; data set, Appendix V shows a single maximum parsi- Tajima’s D = significance of rejection of neutrality: NS, P > 0.10; *, mony tree for each of the seven plastid regions analy- P < 0.05; **, P < 0.01; ***, P < 0.001. sed separately, the number of parsimony informative characters (PIC) for each gene region (see also Appen- as a mean node age (in BEAST, standard deviation 0.5) dix IV), and pairwise matrices that show the predicted and a fixed-age (in r8s) constraint for the Casearia–Luna- number of nucleotide substitutions along internal nia split. Uncertainty in the age of the calibrated node branches separating the six major haplotype groups. can be partly accommodated in BEAST by applying a Not surprisingly, the combined seven-region analysis prior distribution, considering the fossil age as a mini- (145 individuals; 3798 plastid nucleotides; 109 informa- mum bound. An underlying assumption in applying tive sites) provides the best support for relationships fossil constraints at all is that splits in the gene tree cor- among the six haplotype groups, although four to five respond to splits in the species tree. This assumption of these groups have at least 50% bootstrap support in may only hold approximately within Salix and relatives. analysis of two- and three-region multilocus Using relatively small standard deviations on the distri- barcoding combinations (i.e. matK + rbcL, and bution priors in BEAST, and minimum/fixed ages in r8s matK + rbcL + trnH-psbA) (Table 2). For all of these may be sufficient for our purposes, as we are primarily combinations, it is clear that the plastid phylogenies do interested in understanding the scale and order of gene not delimit taxonomic species (here based on Argus tree splits, not the precise dates of these splits. 2010). Four species in subgenus Vetrix (S. candida, S. cordata, S. eriocephala and S. planifolia) belonging to different sections, have different individuals that come out in Results more than one major haplotype group (in all four cases from groups I and V; Appendix II), and even within Characteristics of individual and combined plastid major haplotype groups, the individuals of a particular regions species may not have unique or identical haplotypes The overall sequencing success among the seven plastid (e.g. group I and haplotype 1*, Appendix II). In the regions was lowest for matK at 90%, similar to other 145-sample, seven-region data set (which comprises 40 comparative studies (Fazekas et al. 2008; Kress et al. Salix species), there are 43 unique haplotypes, and no 2009). The sequencing success for all other regions was less than 52 individuals in 20 species carry the same >95%, with the highest success for rbcL at 98%, and variant of haplotype (type 1* in Appendix II; identical trnH-psbA at 99%. Sequence characteristics for each of across 3798 bp and seven plastid regions) for some or the seven plastid gene regions (matK, rbcL, rpoC1, rpoB, all of the individuals sampled for those species. trnH-psbA, atpF-atpH, psbK-psbI) and the single mitochondrial gene region (COI), including the number of Expanded sampling of the matK + rbcL data set individuals sequenced, aligned sequence length, mean sequence length and parsimony informative characters The two-gene analysis used a much greater number (PIC) for each region are provided in Appendices IV of samples (an additional 401 individuals), and and V. The matK gene provided the largest number of although less well resolved (Table 2), this broader phylogenetically informative characters, followed by the sampling confirms the overall patterns found in the noncoding regions psbK-psbI, atpF-atpH and trnH-psbA seven-region analysis and suggests that the haplotype (the latter region is relatively short in Salix; mean groupings based on only two genes are highly repre- 238 bp) and then rbcL. The remaining two coding sentative of plastid distributions in willows (Appen- regions (rpoB and rpoC1) were the most conserved. We dix II). With this expanded sampling, the number of

© 2014 John Wiley & Sons Ltd 8 D. M. PERCY ET AL. individuals (337) and species (57 spp.) found with an distance (the results using either uncorrected or K2P identical haplotype (type 1*) surpasses those found distances were similar, and we report only the latter elsewhere in group I (although the lower number of here) using the seven plastid regions when all taxa are informative characters in the two-region vs. seven- included (P < 0.001, R2 = 0.343), but within group I region analysis likely also contributes to a higher alone, there is no such correlation (P = 0.49, number of individuals with identical sequence). R2 = 0.0002). When the geographical distance axis was Henceforth, when we refer to haplotype 1*, we mean log transformed, the R2 differed (all taxa: R2 = 0.133; in regard to the expanded sampling used for the group I: R2 = 0.002), but the significance (or lack) of the two-region analysis, unless otherwise stated, which correlation did not change (all taxa: P < 0.001; group I: incorporates the taxa in the seven-region analysis P = 0.2). These results add support to the hypothesis (Appendix II). With less sequence data per taxon in that there is taxonomically indiscriminate and wide- the two-gene analysis, haplotype groups IV, V and VI spread lateral gene transfer and spread of haplotypes, are less clearly distinguishable (Table 2, Fig. 1). especially haplotype 1* in group I. Here, we use the The expanded sampling of individuals in the term lateral (or horizontal) transfer to include processes matK + rbcL analysis provides additional evidence that involving hybridization and introgression. divergent haplotypes are present in the four species The Tajima’s D test statistic (Tajima 1989) tests the already identified as carrying haplotype groups I and hypothesis that the frequency spectrum of mutations is V in the less densely sampled seven-region analysis selectively neutral. A significantly negative Tajima’s D (i.e. S. candida, S. cordata, S. eriocephala, and S. planifo- is expected when the data depart from neutral expecta- lia) (Table 1, Appendix II). A subtle difference tions. Our results using this test support the presence of occurred for two individuals that had only rbcL strong positive selection located in group I as indicated sequence data, when incorporating those individuals by the highly significant negative Tajima’s D results for in a combined gene analysis; rbcL by itself lacks suffi- this haplotype group (P < 0.001 and P < 0.01 in the cient information to differentiate haplotype group I seven-region and two-gene analyses, respectively) and from II, and group V from VI (Appendix V). Two the contrastingly positive Tajima’s D results when other single gene analyses failed to differentiate all group I is excluded (Table 3). These results demonstrate six haplotype groups: rpoC1 with only four informa- an excess of low-frequency polymorphisms in group I, tive characters failed to differentiate group II from III, which is indicative of a non-random process, such as a and group IV from V; and matK, despite having 28 selective sweep of the plastid genome. An alternative informative characters, failed to differentiate groups explanation of an ancestral population expansion as the IV from V (Appendix V). The Asian species, Salix arb- source of these polymorphisms (Muir & Filatov 2007) utifolia, has haplotype group I in our analysis based seems improbable, as group I consists of individuals on the placement of GenBank sequences for matK from many different species distributed across the (EU790701) and rbcL (AB012776). This supports other Palaearctic. studies that place this species, previously placed in the genus Chosenia, within Salix (Ohashi 2001; Chen Molecular dating analyses et al. 2010; Hardig et al. 2010). Remarkably, of 71 willow species, only one species, S. Our comparative dating analyses based on the lasiandra, could be barcoded consistently and with confi- matK + rbcL reduced data set (i.e. eliminating identical dence using either the seven- or two-region barcode (it sequences), contained 54 unique haplotypes (39 Salix has a distinct and unique haplotype, designated group and 15 samples from other genera obtained from Gen- II, that has strong bootstrap support, ≥ 95% with seven- Bank) and comprised 1550 aligned nucleotides. The age regions; Fig. 1, Table 2, Appendix II). Another species, estimates and order of chronological events for the S. interior, is the only species in haplotype group VI, and divergence of the major haplotype groups are mostly it groups with most of the hybrid crosses using this spe- consistent between the two dating methods that we cies as the maternal parent; there is some intra-specific employed (Appendix VI shows the age estimates from sequence variability within this haplotype group and the BEAST and r8s analyses with the expanded outgroup strong support for group VI (bootstrap support 100% sampling, and the r8s analyses that were run with a with seven-regions; Fig 1, Table 2, Appendix II). reduced outgroup configuration, see Methods). Although r8s-based dates are younger than those obtained from BEAST (the latter shown on Fig. 2), the rel- Evidence from statistical tests ative order of chronological events of clade origins is The results from the Mantel tests indicate that there is a the same between methods, and the 95% HPD (highest significant correlation between geographic and genetic posterior density interval) range obtained from the BEAST

© 2014 John Wiley & Sons Ltd HAS A SWEEP FOILED DNA BARCODING IN WILLOWS? 9 analysis typically includes the r8s age estimates (13–28 Mya crown age). The younger than expected age (Appendix VI). We were able to obtain older dates in estimate for Populus (ca. 17 Mya crown age; 10–26 Mya) r8s, similar to those obtained in BEAST, by lowering the may be due to the limited sampling for this genus in smoothing factor in the PL analyses, which allows our data set. Of the major haplotype groups within Sa- increased relaxation of the clock assumptions (relaxa- lix, group I was the oldest (crown age: 9.6 Mya), fol- tion of the clock by lowering the gradient factor below lowed by group III (crown age: 5.6 Mya) and group V 20 caused the GradientCheck to fail). BEAST nearly (crown age: 4.6 Mya), with haplotype group IV (crown always gave older age estimates for nodes, a pattern age: 3.7 Mya) and group VI (crown age: 1.2 Mya) the also found in a comprehensive review of comparative youngest. Group II is represented by only a single hap- dating methods (Goodall-Copestake et al. 2009). We lotype, but the group I-group II split is estimated by report on the BEAST ages here (Fig. 2; see Appendix VI BEAST as 12.9 Mya (Fig. 2). for comparison to the r8s-based analyses). The mean rates of evolution (substitutions per site per year) as 10 Investigation of artificial hybrids and the influence of estimated separately in BEAST for matK (3.5 9 10 ) and hybridization on the data rbcL (2.3 9 10 10) accord with mean plastid rates for other angiosperms (e.g. legumes, Lavin et al. 2005). Our A complication to interpreting the expected distribution dating analyses places the diversification of tribe Sali- of haplotypes using plastid-based identification markers ceae (Populus and Salix) at around 35 Mya (26–42 Mya is the prospect of rare paternal transmission of plastids, crown age for the clade comprising these two genera), which occurs in some gymnosperms and angiosperms which is consistent with the date established for the (Muschner et al. 2006; Bouille et al. 2011) and may occur Populus-Salix split at the end of the Eocene (ca. 34 Mya) in willows. Our data, derived from herbarium voucher by Davis et al. (2005) using a much broader range of samples of the artificial hybrid crosses of Mosseler taxa and fossil constraints across the Malpighiales. We (1990) (see Appendix II), suggest that ‘leaky’ paternal estimate diversification within extant Salix at ca. 20 Mya plastid inheritance may take place in willows, but any

Constraint: 37 Mya

Poliothyrsis/Idesia/Saliceae+ other Salicaceae/Lacistemateceae Constraint: 48 Mya Poliothyrsis+Idesia/Saliceae

10 Myr Saliceae (Populus+Salix) G1* haplotype 1.97 Mya

Salix G1+2 G1 G4+5+6 G3

G6 1.2 [0-3] G4 3.7 [0.1-8.4] G5 4.6 [1.6-7.9] G3 5.6 [1.6-10.4] Saliceae (Populus+Salix) 34.5 [26.3-42]

G4+5+6 6.6 [2.9-10.8] Poliothyrsis+Idesia/Saliceae 52.2 [47.9-58] G1 9.6 [5.2-14.6] Poliothyrsis/Idesia/Saliceae+ G1+2 12.9 [7-19.8] other Salicaceae/Lacistemateceae 62.1 [53.3-73.2] Populus 17.6 [9.9-26.1] Salix 19.8 [12.5-27.6]

Myr 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75

Fig. 2 Bayesian molecular dating analysis using the rbcL + matK data set with 39 unique haplotypes sampled for Salix, plus sequences obtained from GenBank for Populus (seven species), Idesia, Poliothyrsis, Flacourtia, Xylosma, Scyphostegia, Casearia, Lunania and Lacistema (see Appendix III for details of outgroup taxon sampling). Haplotype groups are shown with the mean node age and the 95% highest posterior density (HPD) interval.

© 2014 John Wiley & Sons Ltd 10 D. M. PERCY ET AL. inferences about the degree and mode of inheritance to assign species in some groups of organisms (Fazekas are limited here because we could only sequence the et al. 2009; von Crautlein€ et al. 2011; Arca et al. 2012). Wil- individual maternal parent (S. interior) for rbcL, and this lows have wind and insect-dispersed pollen (Argus 1974; was distinguishable only as an undifferentiated group Vroege & Stelleman 1990), and their seeds may travel V + VI haplotype (providing insufficient information to large distances compared to species with more locally place it conclusively in either of these groups). How- restricted dispersal (Steyn et al. 2004). In principle, there- ever, the five hybrid progeny derived from the same fore, the presence of wind pollination in tribe Saliceae maternal individual and two different paternal individ- (Populus and Salix; Boucher et al. 2003), combined with uals are clearly assigned to two different haplotype their efficiently wind and water-dispersed seeds should groups: either group V or VI; two are in group V [one make them good candidates for barcoding identification interior 9 eriocephala and one interior 9 petiolaris], and methods. This is because high dispersability of genes three are in group VI [two interior 9 eriocephala and one among populations within species should help purge int- interior 9 petiolaris] see Appendix II). The paternal rogressed neutral genes from other species (Currat et al. S. eriocephala individual is one of the samples of this 2008; Petit & Excoffier 2009; Hollingsworth et al. 2011). species that carries haplotype group I, and the paternal However, our study shows very low species-specific S. petiolaris individual is in group V. So, although we identity for plastid markers, and so these features of wil- cannot place the maternal parent definitively in haplo- low biology do not appear to be sufficient to purge for- type group V vs. VI, we can at least say that hybrid eign genes and ensure the success of DNA barcoding in progeny derived from the same parental crosses are not the genus. Here, we compare expectations and evidence always found in the same haplotype group, supporting for phenomena that may contribute to the particularly at least occasional biparental inheritance of the plastid poor success of DNA barcoding markers in willows. genome. Repeating this experiment on a larger scale would be needed to clearly demonstrate leaky paternal Retention of ancestral polymorphisms inheritance of plastids in willows. We did not encounter any evidence of heteroplasmy when examining the Massive coalescence failure (incomplete lineage sorting) DNA sequence chromatograms. and subsequent haplotype extinction events may explain There are 18 taxonomic sections for which multiple widespread sharing of particular haplotypes in willows, species were sampled (Appendix II), and although the especially haplotype 1* (Fig. 1), via expansions and con- majority, 11, were found to consistently carry the same tractions during a succession of interglacial periods up to haplotype group among the species sampled in that and including after the last glacial maximum. Further- section, various sections have at least one species in a more, coalescence failure could result from rapid radia- highly divergent major haplotype group (Table 1). Sec- tion during the early diversification of the genus, and/or tion Salicaster within subgenus Salix was the most heter- extremely large effective plastid population sizes in indi- ogeneous section with individuals from three different vidual species (however, it is worth noting that both the haplotype groups, including S. lasiandra (group II), S. x haploid nature of the plastid organellar genome and the meyeriana (S. pentandra x euxina) and S. serissima (group dioecious sexual system of Salix decrease the effective III), and S. lucida (group IV). Salix lasiandra and S. luci- population size and increase the speed and rate of da, once considered to be the same species and still expected coalescence times compared to nuclear genes or thought to be closely related based on morphology, are hermaphroditic species). For this explanation to be tena- found in different, highly divergent haplotype groups ble, it would require a large number of extinction events (also found in Hardig et al. 2010). In addition to section within major taxonomic groups to leave the current dis- Salicaster, six other sections, five within subgenus Vetrix, persed but uneven distribution of group I and 1* haplo- were found to have species carrying multiple major types across the genus. Coalescence failure during the haplotype groups, and in all cases they carried haplo- early diversification of Salix would be expected to exhibit type groups I and V. The prevalence for mixed sections random sharing or extinction of genotypes among and and species to carry these two particular haplotype across taxon groups. It is difficult to see how subsequent groups (groups I and V) appears non-random, and lineage sorting could have led to the observed pattern of group I is always more commonly carried by more spe- variation among taxa, as this would require repeated sort- cies within a taxonomic section than group V. ing of one variant into terminal taxa. It also seems highly unlikely that variant 1* would not have diversified and accumulated variation since the origin of the genus, con- Discussion sidering the deep diversification evident in the dated gene Several recent studies have attempted to understand tree for Salix. The observed pattern of some haplotypes why DNA barcode identification systems may be unable being limited to within taxonomic groups (Table 1), and

© 2014 John Wiley & Sons Ltd HAS A SWEEP FOILED DNA BARCODING IN WILLOWS? 11 of other haplotypes being found in many different taxo- haplotype groups (group I; ca. 9 Myr). Given the large nomic groups, is not consistent with retention of ancestral number of different morphospecies (53 species) sharing polymorphisms across numerous successive speciation this identical haplotype, and the apparent rapidity and events from the early diversification of Salix, unless sort- recency of its spread, it seems doubtful that introgression ing and extinction of ancestral polymorphisms occurred (or hybrid speciation) alone can explain the observed pat- consistently in a non-random fashion. Such non-random- tern of haplotype diversity here. ness seems highly unlikely. In addition, the argument for Several recent studies have suggested that organellar coalescence failure or incomplete lineage sorting is uncon- genomes can undergo selective sweeps in plants and ani- vincing, given the dated phylogeny, because the origin of mals (Muir & Filatov 2007; Lack et al. 2011). We propose haplotype 1* occurred recently. We estimated diversifica- that haplotype 1* may be the result of a trans-specific tion of the crown clade of Salix at ca. 20 Mya (13–28 Mya). selective sweep (see Muir & Filatov 2007 for an example in The age estimates for the six major haplotype groups in Silene, Caryophyllaceae). The spread of an adaptive plas- Salix range from ca. 9 Mya (group I) to 1 Mya (group VI). tid may be facilitated by initial plastid capture (Tsitrone Haplotype 1* is the most widespread haplotype and et al. 2003; Kapralov & Filatov 2007); but how well can appears to have originated around 2 Mya, but may be selection propel one or more plastid types across multiple considerably younger given that the sequences are identi- species boundaries? A number of studies have looked at cal across many divergent species. It is not possible, given the spread of advantageous alleles across populations our data, to determine the relative ages of the haplotype within species (Gross et al. 2007; Presgraves et al. 2009; groups vs. the ages of the species within those groups, but Blackman et al. 2010), and within-species selective sweeps we can make some assumptions that, where a morpholog- may contribute to the cohesiveness of species (Morjan & ically determined taxonomic section is uniquely repre- Rieseberg 2004). But few studies have found evidence for sented by a major haplotype group (e.g. Humboldtianae trans-specific selective sweeps (e.g. Muir & Filatov 2007; represented by group IV; Table 1), that this haplotype Lack et al. 2011; Brand et al. 2013; Twyford et al. 2013). group may be at least as old as the species within it. In con- Nonetheless, this particular process should carry a detect- trast, haplotype 1*, within group I, may be considerably able and testable signature (Muir & Filatov 2007). The Taj- younger than any of the species sharing this haplotype, ima’s D test results (Table 3) support this hypothesis for which would not support the coalescence-failure Salix. These imply that, for group I at least, introgression hypothesis. of haplotype 1* is unlikely to have occurred via neutral processes. Horizontal gene transfer, whether by hybridization or other means, may result in a faster accumulation Horizontal gene transfer and a selective sweep of genetic novelties than through mutation alone, and if hypothesis selected on also contribute to evolutionary processes If coalescence failure can be ruled out as an explanation (Muir & Filatov 2007; Lucek et al. 2010; Hudson et al. 2011; for the large-scale sharing of haplotypes in Salix, the most Richards et al. 2011). However, whether hybridization is obvious remaining explanation for this pattern is that it actually adaptive remains controversial (Schemske & reflects repeated capture and spread of plastids across Morgan 1990; Mallet 2005; Twyford & Ennos 2012). species and continental barriers. In principle, this is con- Geographically widespread and promiscuous willows, sistent with extensive literature reports of hybridization in such as present-day S. candida, S. eriocephala, S. glauca, S. willows, which are primarily within subgenera, but can pedicellaris, S. planifolia, may have aided the transmission also be between subgenera (Argus 2010). However, if this of a plastid type over a wide geographic (and taxo- spread across species boundaries involved neutral genes, nomic) range. An example of a modern-day willow we might expect a more random distribution of shared whose ancestor may have facilitated the initial stages of haplotypes, although this depends on whether hybridiza- plastid transmission is S. pedicellaris (group I). This spe- tion patterns are truly random. Instead we observed an cies currently has a wide native geographic range within overwhelming dominance of certain haplotypes, espe- North America, forms natural hybrids with at least six cially variant 1* (Fig. 1). This hypothesis is difficult to rec- other species in group I, and is known to hybridize with oncile with the breadth of both taxonomic and geographic two of the species that have multiple haplotype groups, samples with identical or near-identical haplotypes. For S. candida and S. eriocephala (see Argus 2010; both carry example, willows with haplotype 1* are mixed phenotypi- groups I + V). In addition, S. eriocephala (groups I + V) cally, taxonomically (from many different subgenera and forms natural hybrids with at least seven species from sections) and geographically (from North America and groups I, II, IV, VI (see Argus 2010) and S. glauca has a Europe; Table 1 and Appendix II). The most widely Holarctic distribution and forms natural hybrids with at shared haplotype (type 1*) appears to have a very recent least eight species in group I. Finally, S. candida and S. origin (<2 Myr), and it is nested within one of the oldest planifolia, both widespread in North America, and both

© 2014 John Wiley & Sons Ltd 12 D. M. PERCY ET AL. carrying groups I + V, hybridize naturally with eight or extensive sampling of taxa and nuclear regions. Addi- more species (Argus 2010). The ancestors of these or tional data from the nuclear genome is needed to fully other modern-day species may have been similarly pro- test our hypothesis that the pattern observed here is a miscuous, and the long-distance seed dispersal typical result of a trans-specific selective sweep affecting (at of Salix species may further promote plastid spread on a least) the plastid genome. large geographic scale (Palme et al. 2003). In tandem with a selective sweep, this may explain the lack of geo- Significance of the mode of inheritance graphical (isolation by distance) effects observed here in haplotype group I using the Mantel test. Our analysis of archived material used in experimental In theory, a putative selective sweep of the plastid gen- crosses suggests that there is primarily maternal inheri- ome should also affect the mitochondrial genome when tance in willows, but likely accompanied by limited pater- both are maternally inherited (Olson & McCauley 2000; nal transmission. The material we had access to was not McCauley et al. 2007), but the very different modes and suitable for definitively answering the mode of plastid tempos of evolution in plant organelles make detection of inheritance in Salix, but resolving this issue would be use- the same selective forces across both organellar genomes ful for tracking which parent contributed captured orga- difficult (Palmer 1990; Soria-Hernanz et al. 2008). Our nellar genomes, and for better understanding the mitochondrial data were too invariable to provide evi- dynamics of gene flow during hybridization. The latter dence for or against a plastid selective sweep. Although may differ if the ‘invading’ genome came maternally selection on the plastid is feasible due to the number of (through seeds) or paternally (through pollen). However, functionally important genes encoded by this organelle while a selective sweep could be affected by the fine (e.g. Kapralov & Filatov 2007), the observed pattern could details of the inheritance mode (e.g. whether seeds or pol- also be caused by selection on linkage groups co-inherited len travel further), the overall pattern that we observed with the plastid. In Salix, these not only comprise the other could reasonably be expected to occur with either mode of cytoplasmically inherited genome, the mitochondrion, inheritance. We do not know if introgression is expected but also recorded cases of cyto-nuclear linkage disequilib- to be more frequent given a predominant mode of orga- rium (Latta et al. 2001; Fields et al. 2014). Such patterns of nellar inheritance via pollen or seed. disequilibrium may result from numerous processes, including migration, hybridization, drift, but also selec- Conclusions tion (Burke et al. 1998; Edmands & Burton 1999). There- fore, selection on the mitochondrion or a part of the This study highlights the serious challenges to the use of nucleus that is maternally inherited could be responsible plastid data for the barcoding of willows. The only for the pattern we observe and may have swept the plastid willow species in our sample that was consistently distin- by coinheritance. guishable using plastid barcoding regions was S. lasian- To date, there are no existing, well sampled and dra. The lack of interspecific variation, the occurrence of robustly resolved nuclear phylogenies for the genus Sa- multiple species sharing identical haplotypes, combined, lix. Two recent studies that include plastid and nuclear in some cases, with considerable intraspecific variation data for a limited number of taxa and gene regions (Har- and species with multiple divergent haplotypes, all serve dig et al. 2010; Abdollahzadeh et al. 2011) have both to confound the use of plastid data to identify willow spe- found nonmonophyly of taxa, and in the case of Hardig cies. The willows provide an extreme example of how et al., incongruence between plastid and nuclear data DNA barcoding can fail. At the same time, this study and better agreement between the taxonomic classifica- illustrates how the drive to barcode the world’s organ- tion of Salix and nuclear data. Our current understanding isms can lead to insights into, not only the extent of fail- of Salix taxonomy comes from extensive morphological ure or success expected when barcoding a particular studies (e.g. Argus 2010) and current molecular data group, but also the possible evolutionary mechanisms of remains too limited to assist in improving species classifi- this taxon-specific variability (or lack thereof). It is clear cations (an exception being the synonomization of the that a reliable barcode for every willow species will never genus Chosenia with Salix). Therefore, addressing the be achieved using the plastid as the sole source for DNA genetic/phylogenetic extent of species boundaries of Sa- markers. Species assignment in the willows using plastid lix taxa should be a high priority of future research as it data is simply not possible for nearly all species, and so affects our interpretation of when gene transfers are truly plant DNA barcoding with plastid loci will not be useful lateral. This is an important caveat of any study, like for applications like ecological surveys, identification of ours, that relies on classical species definitions to under- riparian indicator and/or rare species. At most, these stand trans-specific sharing of alleles. To further test the data provide haplotype group assignments that are hypothesis of a selective sweep in Salix will require nonrandom and have some consistency at the subgeneric

© 2014 John Wiley & Sons Ltd HAS A SWEEP FOILED DNA BARCODING IN WILLOWS? 13 and sectional levels. The unusual patterns of haplotype Boucher LD, Manchester SR, Judd WS (2003) An extinct genus group assignment in willows can likely be explained by a of Salicaceae based on twigs with attached flowers, fruits combination of factors that include interglacial demo- and foliage from the Eocene Green River Formation of Utah and Colorado. American Journal of Botany, 90, 1389–1399. graphic history of populations, patterns and frequency of Bouille M, Senneville S, Bousquet J (2011) Discordant mtDNA hybridization, and theories of haplotype spread such as and cpDNA phylogenies indicate geographic speciation and selective sweeps. We have described here the potential reticulation as driving factors for the diversification of the patterns and signature of a trans-specific selective sweep, genus Picea. Tree Genetics and Genomes, 7, 469–484. in particular the presence of a recently evolved trans- Brand CL, Kingan SB, Wu L et al. (2013) A selective sweep species haplotype. Past studies that have attributed the across species boundaries in Drosophila. Molecular Biology and – failure of plastid data to track species boundaries to pro- Evolution, 30, 2177 2186. Brown RW (1934) The recognizable species of the Green River cesses such as lack of variation, hybridization, introgres- flora. United States Geological Survey Professional Paper, 185-C, sion, and incomplete lineage sorting, might also usefully 45–77. look at the relative ages of the haplotypes involved to Burke JM, Voss TJ, Arnold ML (1998) Genetic interactions and assess how widespread this phenomenon may be in taxo- natural selection in Louisiana Iris hybrids. Evolution, 52, nomically complex plant groups. 1304–1310. CBOL Plant Working Group (2009) A DNA barcode for land plants. Proceedings of the National Academy of Sciences, USA, Acknowledgements 106, 12794–12797. Chen J-H, Sun H, Wen J et al. (2010) Molecular phylogeny of We are grateful to Genome Canada for financial support Salix L. (Salicaceae) inferred from three chloroplast datasets through the Ontario Genomics Institute to the Canadian Bar- and its systematic implications. Taxon, 59,29–37. code of Life Network. We thank those who assisted with Collinson ME (1992) The early fossil history of Salicaceae: a sequencing: Maria Kuzmina (University of Guelph) and Doro- brief review. Proceedings of the Royal Society of Edinburgh, 98B, thy Cheung (University of British Columbia). We thank four 155–167. anonymous reviewers for help improving the manuscript, and von Crautlein€ M, Korpelainen H, Pietilainen€ M et al. (2011) for useful discussions on population genetics and molecular DNA barcoding: a tool for improved taxon identification and dating, we are grateful to Armando Geraldes and William Illes. detection of species diversity. Biodiversity and Conservation, For assistance in the field we thank Cecilia Alstrom-Rapaport, 20, 373–389. Bruce Bennett, Ying Chang, Dominique Collett, Robert Foottit, Cronk QCB (2005) Plant eco-devo: the potential of poplar as a Carl-Eric Granfelt, Jason Grant, Eric Maw, Nancy Moore, Jef- model organism. New Phytologist, 166,39–48. frey Saarela, John Wardell, and David White. Currat M, Ruedi M, Petit RJ et al. (2008) The hidden side of invasions: massive introgression by local genes. Evolution, 62, – References 1908 1920. Davis CC, Webb CO, Wurdack KJ et al. (2005) Explosive radia- Abdollahzadeh A, Kazempour Osaloo S, Maassoumi AA (2011) tion of Malpighiales supports a mid-cretaceous origin of Molecular phylogeny of the genus Salix (Salicaceae) with an modern tropical rain forests. The American Naturalist, 165, emphasize to its species in Iran. Iranian Journal of Botany, 17, E36–E65. 244–253. Doyle JJ, Doyle JL (1987) A rapid isolation procedure for small Ager TA, Phillips RL (2008) Pollen evidence for Late Pleisto- quantities of fresh leaf tissue. Phytochemical Bulletin, 19,11–15. cene Bering land and bridge environments from Norton Drummond AJ, Rambaut A (2007) BEAST: Bayesian evolutionary Sound, northeastern Bering Sea, Alaska. Arctic, Antarctic, and analysis by sampling trees. BMC Evolutionary Biology, 7, 214. Alpine Research, 40, 451–461. Edmands S, Burton RS (1999) Cytochrome C oxydase activity Ager TA, Carrara PE, McGeehin JP (2010) Ecosystem develop- in interpopulation hybrids of a marine copepod: a test of ment in the Girdwood area, south-central Alaska, following nuclear-nuclear or nuclear-cytoplasmic coadaptation. Evolu- late Wisconsin glaciation. Canadian Journal of Earth Sciences, tion, 53, 1972–1978. 47, 971–985. Ersts PJ (2012) Geographic Distance Matrix Generator (version Arca M, Hinsinger DD, Cruaud C et al. (2012) Deciduous trees 1.2.3). American Museum of Natural History, Center for Bio- and the application of universal DNA barcodes: a case study diversity and Conservation. Available from http://biodiver- on the circumpolar Fraxinus. PLoS ONE, 7, e34089. sityinformatics.amnh.org/open_source/gdmg. Accessed on Argus GW (1974) An experimental study of hybridization and 29 July 2012. pollination in Salix (willows). Canadian Journal of Botany, 52, Fazekas AJ, Burgess KS, Kesanakurti PR et al. (2008) Multiple 1613–1619. multilocus DNA barcodes from the plastid genome discrimi- Argus GW (2010) Salix. In: Flora of North America Editorial nate plant species equally well. PLoS ONE, 3, e2802. Committee, eds. 1993 + . Flora of North America North of Fazekas AJ, Kesanakurti PR, Burgess KS et al. (2009) Are plant Mexico. 16 + vols. Flora of North America Association, New species harder to discriminate than animal species using York and Oxford. Vol. 7, 23–162. DNA barcoding markers? Molecular Ecological Resources, 9, Blackman BK, Strasburg JL, Michaels SD et al. (2010) The role 130–139. of recently derived FT paralogs in sunflower domestication. Felsenstein J (1985) Confidence limits on phylogenies: an Current Biology, 20, 629–635. approach using the bootstrap. Evolution, 39, 783–791.

Fields PD, McCauley DE, McAssey EV et al. (2014) Patterns of the bat fly, Trichobius major. Journal of Heredity, 102, 705– cyto-nuclear linkage disequilibrium in Silene latifolia: genomic 718. heterogeneity and temporal stability. Heredity, 112,99–104. Latta RG, Linhart YB, Mitton JB (2001) Cytonuclear disequilib- Gascuel O (1997) BIONJ: an improved version of the NJ algo- rium and genetic drift in a natural population of ponderosa rithm based on a simple model of sequence data. Molecular pine. Genetics, 158, 843–850. Biology and Evolution, 14, 685–695. Lavin M, Herendeen P, Wojciechowski MF (2005) Evolutionary Goodall-Copestake WP, Harris DJ, Hollingsworth PM (2009) rates analysis of Leguminosae implicates a rapid diversifica- The origin of a mega-diverse genus Begonia (Begoniaceae) tion of lineages during the Tertiary. Systematic Biology, 54, using alternative datasets, calibrations and relaxed clock 530–549. methods. Botanical Journal of the Linnean Society, 159, 363–380. Librado P, Rozas J (2009) DNASP v5: A software for comprehen- Graham A (1985) Studies in neotropical paleobotany. IV. The sive analysis of DNA polymorphism data. Bioinformatics, 25, Eocene communities of Panama. Annals of the Missouri Botan- 1451–1452. ical Garden, 72, 504–534. Lucek K, Roy D, Bezault E et al. (2010) Hybridization between Gross BL, Turner KG, Rieseberg LH (2007) Selective sweeps in distant lineages increases adaptive variation during a biolog- the homoploid hybrid species Helianthus deserticola: evolution ical invasion: stickleback in Switzerland. Molecular Ecology, in concert across populations and across origins. Molecular 19, 3995–4011. Ecology, 16, 5246–5258. MacGinitie HD (1969) The Eocene Green River flora of north- Hardig TM, Brunsfeld SJ, Fritz RS et al. (2000) Morphological western Colorado and northeastern Utah. University of Cali- and molecular evidence for hybridization and introgression fornia Publications in Geological Sciences, 83,1–203. in a willow (Salix) hybrid zone. Molecular Ecology, 9,9–24. Mallet J (2005) Hybridization as an invasion of the genome. Hardig TM, Anttila CK, Brunsfeld SJ (2010) A phylogenetic Trends in Ecology and Evolution, 20, 229–237. analysis of Salix (Salicaceae) based on matK and ribosomal Manchester SR, Dilcher DL, Tidwell WD (1986) Interconnected DNA sequence data. Journal of Botany, ID 197696, 12. reproductive and vegetative remains of Populus (Salicaceae) Hassel K, Segreto R, Ekrem T (2013) Restricted variation in plant from the Middle Eocene Green River Formation, northeast- barcoding markers limits identification in closely related bryo- ern Utah. American Journal of Botany, 73, 156–160. phyte species. Molecular Ecology Resources, 13, 1047–1057. Maynard Smith J (1978) The Evolution of Sex, p. 236. Cambridge Hollingsworth PM, Graham SW, Little DP (2011) Choosing and University Press, Cambridge, UK. using a plant DNA barcode. PLoS ONE, 6, e19254. McCauley DE, Sundby AK, Bailey MF et al. (2007) Inheritance of chlo- Hudson AG, Vonlanthen P, Seehausen O (2011) Rapid parallel roplast DNA is not strictly maternal in Silene vulgaris (Caryophylla- adaptive radiations from a single hybridogenic ancestral ceae): evidence from experimental crosses and natural populations. population. Proceedings of the Royal Society B-Biological Sci- American Journal of Botany, 94,1333–1337. ences, 278,58–66. Morjan CL, Rieseberg LH (2004) How species evolve collec- Iljinskaya IA, Chelebaeva AI (2002) A new fossil genus Utkholo- tively: implications of gene flow and selection for the spread kia combining leaf characters of Populus (Salicaceae) with of advantageous alleles. Molecular Ecology, 13, 1341–1356. those of Idesia and Poliothyrsis (Flacourtiaceae). Botanicheskii Mosseler A (1990) Hybrid performance and species crossability Zhurnal, 87, 101–110. relationships in willows (Salix). Canadian Journal of Botany, Innan H, Zhang K, Marjoram P et al. (2005) Statistical tests of the 68, 2329–2338. coalescent model based on the haplotype frequency distribution Muir G, Filatov D (2007) A selective sweep in the chloroplast andthenumberofsegregatingsites.Genetics,169,1763–1777. DNA of dioecious Silene (Section Elisanthe). Genetics, 177, Ivanova NV, DeWaard JR, Hajibabaei M et al. (2005) Protocols for 1239–1247. high volume DNA barcoding. http://www.dnabarcoding.ca/ Muschner VC, Lorenz-Lemke AP, Vecchia M et al. (2006) Dif- (accessed 20 March 2014). ferential organellar inheritance in Passiflora’s (Passifloraceae) Jensen JL, Bohonak AJ, Kelley ST (2005) Isolation by distance, subgenera. Genetica, 128, 449–453. web service. BMC Genetics 6, 13. http://ibdws.sdsu.edu/ Myers-Smith IH, Forbes BC, Wilmking M et al. (2011) Shrub (accessed 20 March 2014). expansion in tundra ecosystems: dynamics, impacts and Kapralov MV, Filatov DA (2007) Widespread positive selection research priorities. Environmental Research Letters, 6, 045509. in the photosynthetic Rubisco enzyme. BMC Evolutionary Ohashi H (2001) Salicaceae of Japan. Scientific Report, Tohoku Biology, 7, 73. University, 4th Series Biology, 40, 269–396. Kress WJ, Erickson DL, Jones FA et al. (2009) Plant DNA bar- Olson MS, McCauley DE (2000) Linkage disequilibrium and codes and a community phylogeny of a tropical forest phylogenetic congruence between chloroplast and mitochon- dynamics plot in Panama. Proceedings of the National Academy drial haplotypes in Silene vulgaris. Proceedings of the Royal of Sciences, USA, 106, 18621–18626. Society, Biological Sciences, 267, 1801–1808. Kuzovkina YA, Quigley MF (2005) Willows beyond wetlands: Palme AE, Semerikov V, Lascoux M (2003) Absence of geo- uses of Salix L. species for environmental projects. Water, Air graphical structure of chloroplast DNA variation in sallow, and Soil Pollution, 162, 183–204. Salix caprea L. Heredity, 91, 465–474. Kuzovkina YA, Volk TA (2009) The characterization of willow Palmer JD (1990) Contrasting modes and tempos of genome evo- (Salix L.) varieties for use in ecological engineering applica- lution in land plant organelles. Trends in Genetics, 6, 115–120. tions: co-ordination of structure, function and autecology. Percy DM, Garver AM, Wagner WL et al. (2008) Progressive Ecological Engineering, 35, 1178–1189. island colonization and ancient origin of Hawaiian Metrosid- Lack JB, Nichols RD, Wilson GM et al. (2011) Genetic signa- eros (Myrtaceae). Proceedings of the Royal Society, B-Biological ture of reproductive manipulation in the phylogeography of Sciences, 275, 1479–1490.

Petit RJ, Excoffier L (2009) Gene flow and species delimitation. homoploid hybrid origin and Pleistocene expansion. Molecu- Trends in Ecology & Evolution, 24, 386–393. lar Ecology, 23, 343–359. Posada D, Crandall KA (1998) MODELTEST: testing the model of Swofford DL (2003) PAUP*: Phylogenetic Analysis Using Parsi- DNA substitution. Bioinformatics, 14, 817–818. mony (*and Other Methods), Version 4. Sinauer, Sunderland, Presgraves DC, Gerard PR, Cherukuri A, Lyttle TW (2009) Massachusetts. Large-scale selective sweep among segregation distorter Tajima F (1989) Statistical method for testing the neutral mutation chromosomes in African populations of Drosophila melanogas- hypothesis by DNA polymorphism. Genetics, 123, 585–595. ter. PLoS Genetics, 5, e1000463. Tsitrone A, Kirkpatrick M, Levin DA (2003) A model for chlo- Rai HS, O’Brien HE, Reeves PA et al. (2003) Inference of higher- roplast capture. Evolution, 57, 1776–1782. order relationships in the cycads from a large chloroplast data Twyford AD, Ennos RA (2012) Next-generation hybridization set. Molecular Phylogenetics and Evolution, 29, 350–359. and introgression. Heredity, 108, 179–189. Rai HS, Reeves PA, Peakall R et al. (2008) Inference of higher- Twyford AD, Kidner CA, Harrison N et al. (2013) Population order conifer relationships from a multilocus plastid data history and seed dispersal in widespread Central American set. Botany, 86, 658–669. Begonia species (Begoniaceae) inferred from plastome-derived Rambaut A (1996) Se-Al: Sequence Alignment Editor, Version 2. microsatellite markers. Botanical Journal of the Linnean Society, Oxford University, Oxford. 171, 260–276. Ratnasingham S, Hebert PDN (2007) BOLD: The Barcode of Life Vroege PW, Stelleman P (1990) Insect and wind pollination in Salix Data System. Molecular Ecology Notes, 7, 355–364. repens L. and Salix caprea L. Israel Journal of Botany, 39, 125–132. Rechinger KH (1992) Salix taxonomy in Europe – problems, Xu B, Wu N, Gao XF et al. (2012) Analysis of DNA sequences interpretations, observations. Proceedings of the Royal Society of six chloroplast and nuclear genes suggests incongruence, of Edinburgh, 98B,1–12. introgression, and incomplete lineage sorting in the evolu- Richards TA, Soanes DM, Jones MDM et al. (2011) Horizontal tion of Lespedeza (Fabaceae). Molecular Phylogenetics and Evo- gene transfer facilitated the evolution of plant parasitic lution, 62, 346–358. mechanisms in the oomycetes. Proceedings of the National Yu WB, Huang PH, Li DZ et al. (2013) Incongruence between Academy of Sciences, USA, 108, 15258–15263. nuclear and chloroplast DNA phylogenies in Pedicularis sec- Salzburger W, Ewing G, Haeseler A (2011) The performance tion Cyathophora (Orobanchaceae). PLoS ONE, 8, e74828. of phylogenetic algorithms in estimating haplotype gene- Zinovjev AG (2011) Salix x meyeriana (= Salix pentandra x S. eux- alogies with migration. Molecular Ecology, 20, 1952–1963. ina) – a forgotten willow in Eastern North America. Phytotax- Sanderson MJ (1997) A nonparametric approach to estimating a, 22,57–60. divergence times in the absence of rate constancy. Molecular Zotz G, Wilhelm K, Becker A (2011) Heteroblasty – a review. Biology and Evolution, 14, 1218–1231. The Botanical Review, 77, 109–151. Sanderson MJ (2002) Estimating absolute rates of molecular evolution and divergence times: a penalized likelihood approach. Molecular Biology and Evolution, 19, 101–109. Sanderson MJ (2006) r8s version 1.71. Analysis of rates (‘r8s’) D.P., Q.C., S.G. and S.B. planned and wrote the first draft of evolution. Section of Evolution and Ecology. Univeristy of the manuscript. All authors contributed to subsequent of California, Davis, http://loco.biosci.arizona.edu/r8s/ revisions and editing of the manuscript. The following (accessed 15 January 2012). authors contributed to specimen sampling and identifica- Sang T, Crawford DJ, Stuessy TF (1997) Chloroplast DNA phy- tion (D.P., G.A., Q.C., A.F., P.K., K.B., B.H., S.N.); lab logeny, reticulate evolution and biogeography of Paeonia work and sequencing (D.P., A.F., P.K., K.B.); combining (Paeoniaceae). American Journal of Botany, 84, 1120–1136. molecular genetics and ecological theory (Q.C., B.H.). Schemske DW, Morgan MT (1990) The evolutionary significance of hybridization in Eucalyptus. Evolution, 44, 2150–2151. Soria-Hernanz DF, Braverman JM, Hamilton MB (2008) Parallel rate heterogeneity in chloroplast and mitochondrial genomes of Brazil nut trees (Lecythidaceae) is consistent with lineage Data accessibility – effects. Molecular Biology and Evolution, 25, 1282 1296. DNA sequences: Genbank accessions KM001945- Stamatakis A (2014) RAXML Version 8: A Tool for Phylogenetic KM002483 (matK), KM002817-KM003354 (rbcL), Analysis and Post-Analysis of Large Phylogenies. In Bioinformat- ics, 2014, open access. KM002484-KM002650 (rpoB), KM002651-KM002816 Starr JR, Naczi RF, Chouinard BN (2009) Plant DNA barcodes (rpoC1), KM003552-KM003706 (atpF-atpH), KM003707- and species resolution in sedges (Carex, Cyperaceae). Molecu- KM003869 (psbK-psbI), KM003355-KM003551 (trnH- lar Ecology Resources, Suppl. s1, 151–163. psbA), KM001915-KM001944 (COI). Steyn EMA, Smith GF, Van Wyk AE (2004) Functional and tax- Final DNA sequence assembly: aligned sequences onomic significance of seed structure in Salix mucronata (Sal- available from BOLD database and GenBank. icaceae). Bothalia, 34,53–59. Phylogenetic data: TreeBASE Study accession no. Sun B, Yan D, Xie S, Cong P, Xin C, Yun F (2004) Palaeogene fossil Populus leaves from Lanzhou Basin and their palaeocli- TB2:S15979. matic significance. Chinese Science Bulletin, 49, 1494–1501. Specimen information, sampling locations, and DNA Sun Y, Abbott RJ, Li L et al. (2014) Evolutionary history of pur- sequences and alignments uploaded to Dryad (doi:10. ple cone spruce Picea purpurea in the Qinghai-Tibet Plateau: 5061/dryad.qf6t5).

Appendix I Primers used in the ampliﬁcation and sequencing of seven plastid regions and one mitochondrial region. The trnH-psbA primers are published in Sang et al. (1997), all other plastid and COI primers in Fazekas et al. (2008), except matK reverse primer ‘EquiR’ which is published online at http://www.kew.org/barcoding/update.html as matK primer: R (Equisetum)

Mean sequence Gene region name length bp Primer name and sequence 50 – 30 trnH-psbA 238 trnH – GGCGCATGGTGGATTCACAAATC psbA – GTTATGCATGAACGTAATGCTC rpoB 358 2F – ATGCAACGTCAAGCAGTTCC 3R – CCGTATGTGAAAAGAAGTATA rpoC1 471 1F – GTGGATACACTTCTTGATAATGG 4R – CCATAAGCATATCTTGAGTTGG matK 888 Xf – TAATTTACGATCAATTCATTC EquiR – GTACTTTTATGTTTACGAGC rbcL 628 80F – ATGTCACCACAAACAGAAACTAAAGCAAGT ajf634R1 – GAAACGGTCTCTCCAACGCAT atpF-atpH 567 atpF – ACTCGCACACACTCCCTTTCC atpH – GCTTTTATGGAAGCTTTAACAAT psbK-psbI 470 psbK – TTAGCCTTTGTTTGGCAAG psbI – AGAGTTTGAGAGTAAGCAT COI 649 cox42F – GGATCTTCTCCACTAACCACAA cox1ajf699R – CCGAAAGAGATGCTGGTATA

Appendix II Salix species and hybrids sampled for this study with subgeneric and section assignment (approximate number of species worldwide given in {}) according to Flora of North America (Argus 2010). A superscript E indicates the experimental hybrids of Mosseler (1990). The number in brackets beside species names is the number of individuals sampled for this study. The assignment of individuals to the six major haplotype groups (G) is given (seven-region data set/two-region data set), and species or hybrids carrying more than one haplotype group are in bold. Native or introduced [N/I (native range given)] status follows Argus (2010), unless provenance of material is Europe (Eu), or of garden origin [GO (native range given)]. Salix x meyeriana (= Salix pentandra 9 S. euxina) (Zinovjev 2011)

Taxa N/I GI 1* GI others GII GIII GIV GV GVI subg. Chamaetia {142} sec. Chamaetia {4} S. nivalis (5) N 3/5 1/– S. reticulata (38) N –/30 –/8 S. vestita (2) N –/2 sec. Diplodictyae {5} S. arctica (19) N 3/12 8/7 sec. Diplodictyae x Glaucae S. arctica x glauca (1) N –/1 sec. Diplodictyae x Herbella S. arctica x polaris (2) N –/1 –/1 S. petrophila (1) N –/1 sec. Glaucae {8} S. brachycarpa (2) N –/2 S. glauca (23) N –/16 5/6 S. glauca x brachycarpa (2) N –/1 –/1 S. nakamurana (1) GO (Japan) –/1 1/– S. niphoclada (3) N –/2 –/1 S. x glauca (1) N –/1 sec. Herbella {7} S. polaris (1) N –/1 – – S.\ rotundifolia (2) N /1 /1

Appendix II Continued

Taxa N/I GI 1* GI others GII GIII GIV GV GVI sec. Lindleyanae {21} S. lindleyana (1) GO (Asia) –/1 sec. Myrtilloides {5} S. athabascensis (2) N –/1 –/1 S. pedicellaris (2) N –/2 sec. Myrtosalix {20} S. uva-ursi (1) N 1/1 subg. Longifoliae {7} sec. Longifoliae {7} S. exigua (6) N –/6 S. interior (11) N 7/11 subg. Longifoliae x Vetrix sec. Longifoliae x Cordatae S. interior x eriocephalaE (3) N 2/3 subg. Longifoliae x Vetrix sec. Longifoliae x Geyerianae S. interior x petiolarisE (2) N 1/1 –/1 subg. Protitea {32} sec. Humboldtianae {15} S. amygdaloides (2) N 1/2 S. amygdaloides x gooddingii (2) N –/2 S. bonplandiana (2) N –/2 S. gooddingii (2) N –/2 S. laevigata (2) N –/2 S. nigra (1) N 1/1 subg. Salix {84} sec. Maccallianae {1} S. maccalliana (6) N –/6 sec. Magniﬁcae {8} S. magniﬁca (1) GO (Japan) –/1 1/– sec. Salicaster {9} S. lasiandra (37) N 9/37 S. lucida (2) N 2/2 S. x meyeriana (1) I (Eu) –/1 S. serissima (2) N 2/2 sec. Salix {8} S. alba (1) I (Eu/Asia) 1/1 S. x fragilis (3) I (Eu) –/3 S. x sepulcralis (5) I (Eu/Asia) 2/5 subg. Vetrix {211} sec. Arbuscella {13} S. arbusculoides (4) N 1/4 1/– sec. Canae {1} S. elaeagnos (1) I (Eu) 1/1 sec. Candidae {2} S. candida (11) N 3/9 1/1 1/1 sec. Cinerella {36} S. discolor (6) N 3/6 S. hookeriana (13) N 2/12 1/1 S. humilis (2) N 2/2 S. pedicellata (1) Eu –/1 S. scouleriana (35) N 3/26 9/9 sec. Cordatae {1} S. eriocephala (4) N 1/2 1/– 2/2 S. famelica (2) N 1/2 1/– – S.\ ligulifolia (4) N /4

Appendix II Continued

Taxa N/I GI 1* GI others GII GIII GIV GV GVI

S. lutea (2) N –/2 S. prolixa (13) N 1/11 –/2 sec. Fulvae {7} S. bebbiana (34) N 7/24 4/8 sec. Geyerianae {4} S. geyeriana (2) N –/1 –/1 S. lemmonii (2) N –/2 S. petiolaris (4) N 4/4 sec. Hastatae {25} S. arizonica (3) N –/2 –/1 S. barclayi (32) N 7/24 4/5 S. boothii (8) N –/5 1/3 S. commutata (3) N 1/3 1/– S. cordata (5) N –/2 1/1 –/2 S. eastwoodiae (2) N –/1 –/1 S. farriae (2) N –/2 S. monticola (3) N –/2 –/1 S. myricoides (2) N –/1 –/1 S. myrtillifolia (4) N 2/2 –/2 S. pseudomonticola (7) N –/7 2/– S. pseudomyrsinites (6) N 2/6 1/– S. pyrifolia (2) N 1/2 sec. Lanatae {5} S. calcicola (2) N –/2 S. richardsonii (5) N –/3 –/2 sec. Mexicanae {5} S. irrorata (2) N –/2 S. lasiolepis (4) N –/2 –/2 sec. Phylicifoliae {11} S. drummondiana (18) N –/14 1/3 S. planifolia (8) N –/6 –/1 –/1 S. pulchra (2) N –/2 sec. Sitchenses {4} S. jepsonii (3) N –/3 S. sitchensis (54) N 7/45 8/9 sec. Villosae {6} S. alaxensis (8) N 1/7 –/1 S. barrattiana (7) N 1/5 3/8 sec. Villosae x Phylicifoliae S. alaxensis x drummondiana (1) N –/1 sec. Viminella {13} S. viminalis (1) Eu –/1 1/–

Appendix III Taxon sampling from GenBank (GB) for rbcL and matK from Salicaceae (Sal) and Lacistemataceae (Lac)

Taxon (Family) GB rbcLGBmatK

Salix arbutifolia (Sal) AB012776 EU790701 Populus balsamifera (Sal) EU676955 EU749348 Populus deltoids (Sal) AJ418829 EU790702 Populus nigra (Sal) AJ418828 AB038186 Populus tomentosa (Sal) AF527489 AY177666 Populus tremula (Sal) AJ418827 AJ506082 Populus tremuloides (Sal) AF206812 JF429913 Populus trichocarpa (Sal) NC009143 NC009143 Idesia polycarpa (Sal) AB021924 AB233831 Poliothyrsis sinensis (Sal) AJ402991 EF135586 Flacourtia jangomas (Sal) AF206768 EF135541 Xylosma congesta (Sal) AB233938 AB233834 Scyphostegia borneensis (Sal) AJ403000 EF135594 Casearia (Sal) AF206746 C. sylvestris EF135516 C. nitida Lunania parviﬂora (Sal) AB233936 EF135561 Lacistema aggregatum (Lac) AY935746 FJ670025

Appendix IV Sequence characteristics of each of the seven plastid regions (matK, rbcL, rpoC1, rpoB, trnH-psbA, atpF-atpH, psbK-psbI), and the single mitochondrial gene (COI), including parsimony informative characters (PIC) for each region

Plastid region No. individuals sequenced aligned sequence length mean sequence length PIC matK 539 898 888 28 rbcL 538 634 628 10 rpoC1 166 474 471 4 rpoB 167 358 358 6 trnH-psbA 197 291 238 16 atpF-atpH 155 609 567 20 psbK-psbI 163 534 470 25 COI 30 656 649 1

Appendix V Maximum parsimony analysis for individual gene regions are illustrated with a single parsimony tree for each of the seven plastid regions, the number of parsimony informative characters (PIC) for each region or gene are given, and the placement of the six major haplotype groups are indicated. The matrices show the number of nucleotide changes along branches separating each of the six major groups.

rpoC1 4 PIC rpoB6PIC atpF-atpH 20 PIC psbK-psbI25 PIC

SALIX118-08 07-EM-0583 Salix bebbiana SALIX380-08 61-UBC-119656 Salix arctica SALIX140-08 07-DPQC-0020 Salix arctica SALIX348-08 07-GWA-14380 Salix bebbiana SALIX310-08 07-GWA-14335 Salix famelica SALIX003-08 07-JMS-1050 Salix scouleriana SALIX142-08 07-DPQC-0025 Salix arctica SALIX384-08 75-UBC-155629 Salix alaxensis SALIX384-08 75-UBC-155629 Salix alaxensis SALIX014-08 07-JMS-1141 Salix scouleriana SALIX388-08 46-UBC-61323 Salix glauca SALIX385-08 78-UBC-162474 Salix alaxensis SALIX385-08 78-UBC-162474 Salix alaxensis SALIX113-08 07-EM-0315 Salix bebbiana SALIX390-08 73-UBC-149089 Salix arbusculoides SALIX390-08 73-UBC-149089 Salix arbusculoides SALIX015-08 07-JMS-1142 Salix scouleriana SALIX219-08 07-CAN-532085 Salix eriocephala SALIX392-08 69-UBC-149365 Salix arbusculoides SALIX392-08 69-UBC-149365 Salix arbusculoides G IIIIIIIVVVI SALIX025-08 07-JMS-1298 Salix scouleriana G I II III IV V VI SALIX138-08 07-DPQC-0018 Salix nivalis G I II III IV V VI SALIX137-08 07-DPQC-0017 Salix arctica SALIX026-08 07-JMS-1299 Salix scouleriana SALIX172-08 07-DPQC-0060 Salix sitchensis SALIX137-08 07-DPQC-0017 Salix arctica SALIX140-08 07-DPQC-0020 Salix arctica SALIX145-08 07-DPQC-0029 Salix scouleriana SALIX140-08 07-DPQC-0020 Salix arctica SALIX384-08 75-UBC-155629 Salix alaxensis G IIIIIIIVVVI SALIX141-08 07-DPQC-0024 Salix arctica SALIX141-08 07-DPQC-0024 Salix arctica SALIX146-08 07-DPQC-0030 Salix scouleriana SALIX385-08 78-UBC-162474 Salix alaxensis SALIX142-08 07-DPQC-0025 Salix arctica SALIX142-08 07-DPQC-0025 Salix arctica SALIX136-08 07-DPQC-0016 Salix sitchensis SALIX390-08 73-UBC-149089 Salix arbusculoides SALIX144-08 07-DPQC-0028 Salix arctica SALIX144-08 07-DPQC-0028 Salix arctica SALIX174-08 07-DPQC-0062 Salix glauca SALIX392-08 69-UBC-149365 Salix arbusculoides SALIX150-08 07-DPQC-0034 Salix arctica SALIX150-08 07-DPQC-0034 Salix arctica SALIX202-08 07-DPQC-VanIs1 Salix sitchensis SALIX137-08 07-DPQC-0017 Salix arctica SALIX155-08 07-DPQC-0039 Salix arctica SALIX155-08 07-DPQC-0039 Salix arctica SALIX141-08 07-DPQC-0024 Salix arctica SALIX167-08 07-DPQC-0055 Salix arctica SALIX203-08 07-DPQC-VanIs2 Salix sitchensis SALIX167-08 07-DPQC-0055 Salix arctica SALIX383-08 73-UBC-152112 Salix arctica SALIX144-08 07-DPQC-0028 Salix arctica SALIX170-08 07-DPQC-0058 Salix arctica SALIX170-08 07-DPQC-0058 Salix arctica SALIX179-08 07-DPQC-MI3 Salix scouleriana SALIX150-08 07-DPQC-0034 Salix arctica SALIX380-08 61-UBC-119656 Salix arctica SALIX383-08 73-UBC-152112 Salix arctica SALIX151-08 07-DPQC-0035 Salix barclayi SALIX180-08 07-DPQC-MI4 Salix scouleriana SALIX155-08 07-DPQC-0039 Salix arctica SALIX383-08 73-UBC-152112 Salix arctica I -01345 I -251089 SALIX167-08 07-DPQC-0055 Salix arctica SALIX153-08 07-DPQC-0037 Salix barclayi SALIX197-08 07-UBCBG-037007-1003-2003 Salix boothii SALIX151-08 07-DPQC-0035 Salix barclayi I -11223 SALIX170-08 07-DPQC-0058 Salix arctica SALIX153-08 07-DPQC-0037 Salix barclayi SALIX160-08 07-DPQC-0048 Salix barclayi SALIX316-08 07-GWA-14342 Salix pseudomonticola SALIX162-08 07-DPQC-0050 Salix barclayi SALIX219-08 07-CAN-532085 Salix eriocephala SALIX380-08 61-UBC-119656 Salix arctica I - 4 8 9 16 20 SALIX160-08 07-DPQC-0048 Salix barclayi SALIX163-08 07-DPQC-0051 Salix barclayi SALIX383-08 73-UBC-152112 Salix arctica SALIX162-08 07-DPQC-0050 Salix barclayi SALIX378-08 07-WAGNER-PS1 Salix pseudomyrsinites SALIX151-08 07-DPQC-0035 Salix barclayi SALIX163-08 07-DPQC-0051 Salix barclayi SALIX164-08 07-DPQC-0052 Salix barclayi SALIX385-08 78-UBC-162474 Salix alaxensis SALIX165-08 07-DPQC-0053 Salix barclayi SALIX153-08 07-DPQC-0037 Salix barclayi SALIX164-08 07-DPQC-0052 Salix barclayi SALIX390-08 73-UBC-149089 Salix arbusculoides SALIX171-08 07-DPQC-0059 Salix barclayi SALIX160-08 07-DPQC-0048 Salix barclayi SALIX165-08 07-DPQC-0053 Salix barclayi SALIX392-08 69-UBC-149365 Salix arbusculoides SALIX194-08 07-UBCBG-037155-1003-2004 Salix barclayi SALIX162-08 07-DPQC-0050 Salix barclayi SALIX171-08 07-DPQC-0059 Salix barclayi SALIX137-08 07-DPQC-0017 Salix arctica SALIX199-08 07-UBCBG-native3 Salix barclayi SALIX194-08 07-UBCBG-037155-1003-2004 Salix barclayi SALIX140-08 07-DPQC-0020 Salix arctica SALIX163-08 07-DPQC-0051 Salix barclayi SALIX139-08 07-DPQC-0019 Salix barrattiana SALIX199-08 07-UBCBG-native3 Salix barclayi SALIX141-08 07-DPQC-0024 Salix arctica SALIX164-08 07-DPQC-0052 Salix barclayi SALIX139-08 07-DPQC-0019 Salix barrattiana SALIX156-08 07-DPQC-0040 Salix barrattiana SALIX165-08 07-DPQC-0053 Salix barclayi SALIX173-08 07-DPQC-0061 Salix barrattiana II -1345 SALIX142-08 07-DPQC-0025 Salix arctica II -51089 SALIX156-08 07-DPQC-0040 Salix barrattiana II -0112 SALIX144-08 07-DPQC-0028 Salix arctica SALIX171-08 07-DPQC-0059 Salix barclayi SALIX381-08 43-UBC-65549 Salix barrattiana SALIX173-08 07-DPQC-0061 Salix barrattiana SALIX150-08 07-DPQC-0034 Salix arctica SALIX194-08 07-UBCBG-037155-1003-2004 Salix barclayi SALIX381-08 43-UBC-65549 Salix barrattiana SALIX382-08 73-UBC-149084 Salix barrattiana SALIX199-08 07-UBCBG-native3 Salix barclayi II -451216 SALIX005-08 07-JMS-1059 Salix bebbiana SALIX155-08 07-DPQC-0039 Salix arctica SALIX382-08 73-UBC-149084 Salix barrattiana SALIX167-08 07-DPQC-0055 Salix arctica SALIX139-08 07-DPQC-0019 Salix barrattiana SALIX005-08 07-JMS-1059 Salix bebbiana SALIX008-08 07-JMS-1094 Salix bebbiana SALIX156-08 07-DPQC-0040 Salix barrattiana SALIX113-08 07-EM-0315 Salix bebbiana SALIX170-08 07-DPQC-0058 Salix arctica SALIX008-08 07-JMS-1094 Salix bebbiana SALIX173-08 07-DPQC-0061 Salix barrattiana SALIX115-08 07-EM-0472 Salix bebbiana SALIX113-08 07-EM-0315 Salix bebbiana SALIX380-08 61-UBC-119656 Salix arctica SALIX381-08 43-UBC-65549 Salix barrattiana SALIX118-08 07-EM-0583 Salix bebbiana SALIX151-08 07-DPQC-0035 Salix barclayi SALIX115-08 07-EM-0472 Salix bebbiana SALIX382-08 73-UBC-149084 Salix barrattiana SALIX119-08 07-EM-0596 Salix bebbiana SALIX119-08 07-EM-0596 Salix bebbiana SALIX153-08 07-DPQC-0037 Salix barclayi SALIX005-08 07-JMS-1059 Salix bebbiana SALIX121-08 07-EM-0628 Salix bebbiana SALIX121-08 07-EM-0628 Salix bebbiana SALIX162-08 07-DPQC-0050 Salix barclayi SALIX008-08 07-JMS-1094 Salix bebbiana SALIX122-08 06-DPQC-S1 Salix bebbiana SALIX122-08 06-DPQC-S1 Salix bebbiana SALIX163-08 07-DPQC-0051 Salix barclayi SALIX115-08 07-EM-0472 Salix bebbiana SALIX129-08 07-DPQC-0009 Salix bebbiana III -234 III -756 SALIX129-08 07-DPQC-0009 Salix bebbiana SALIX164-08 07-DPQC-0052 Salix barclayi SALIX118-08 07-EM-0583 Salix bebbiana III -112 SALIX134-08 07-DPQC-0014 Salix bebbiana SALIX134-08 07-DPQC-0014 Salix bebbiana SALIX165-08 07-DPQC-0053 Salix barclayi SALIX198-08 07-UBCBG-037023-1003-2003 Salix bebbiana SALIX119-08 07-EM-0596 Salix bebbiana SALIX198-08 07-UBCBG-037023-1003-2003 Salix bebbiana SALIX171-08 07-DPQC-0059 Salix barclayi SALIX121-08 07-EM-0628 Salix bebbiana III -1812 SALIX200-08 07-UBCBG-34916-5555-99 Salix bebbiana SALIX200-08 07-UBCBG-34916-5555-99 Salix bebbiana SALIX323-08 07-GWA-14349 Salix bebbiana SALIX194-08 07-UBCBG-037155-1003-2004 Salix barclayi SALIX122-08 06-DPQC-S1 Salix bebbiana SALIX323-08 07-GWA-14349 Salix bebbiana SALIX348-08 07-GWA-14380 Salix bebbiana SALIX199-08 07-UBCBG-native3 Salix barclayi SALIX129-08 07-DPQC-0009 Salix bebbiana SALIX197-08 07-UBCBG-037007-1003-2003 Salix boothii SALIX197-08 07-UBCBG-037007-1003-2003 Salix boothii SALIX139-08 07-DPQC-0019 Salix barrattiana SALIX134-08 07-DPQC-0014 Salix bebbiana SALIX120-08 07-EM-0618 Salix candida SALIX120-08 07-EM-0618 Salix candida SALIX156-08 07-DPQC-0040 Salix barrattiana SALIX198-08 07-UBCBG-037023-1003-2003 Salix bebbiana SALIX312-08 07-GWA-14337 Salix candida SALIX312-08 07-GWA-14337 Salix candida SALIX173-08 07-DPQC-0061 Salix barrattiana SALIX200-08 07-UBCBG-34916-5555-99 Salix bebbiana SALIX313-08 07-GWA-14338 Salix candida SALIX313-08 07-GWA-14338 Salix candida SALIX381-08 43-UBC-65549 Salix barrattiana SALIX323-08 07-GWA-14349 Salix bebbiana SALIX315-08 07-GWA-14340 Salix candida SALIX315-08 07-GWA-14340 Salix candida SALIX382-08 73-UBC-149084 Salix barrattiana SALIX348-08 07-GWA-14380 Salix bebbiana SALIX143-08 07-DPQC-0027 Salix commutata SALIX143-08 07-DPQC-0027 Salix commutata SALIX197-08 07-UBCBG-037007-1003-2003 Salix boothii SALIX161-08 07-DPQC-0049 Salix commutata IV -12 SALIX005-08 07-JMS-1059 Salix bebbiana IV -23 IV -01 SALIX161-08 07-DPQC-0049 Salix commutata SALIX008-08 07-JMS-1094 Salix bebbiana SALIX120-08 07-EM-0618 Salix candida SALIX342-08 07-GWA-14371 Salix cordata SALIX342-08 07-GWA-14371 Salix cordata SALIX343-08 07-GWA-14372 Salix cordata SALIX115-08 07-EM-0472 Salix bebbiana SALIX312-08 07-GWA-14337 Salix candida SALIX135-08 07-DPQC-0015 Salix drummondiana SALIX313-08 07-GWA-14338 Salix candida IV -913 SALIX135-08 07-DPQC-0015 Salix drummondiana SALIX118-08 07-EM-0583 Salix bebbiana SALIX191-08 07-UBCBG-013854-0013-1976 Salix elaeagnos SALIX191-08 07-UBCBG-013854-0013-1976 Salix elaeagnos SALIX121-08 07-EM-0628 Salix bebbiana SALIX315-08 07-GWA-14340 Salix candida SALIX219-08 07-CAN-532085 Salix eriocephala SALIX219-08 07-CAN-532085 Salix eriocephala SALIX122-08 06-DPQC-S1 Salix bebbiana SALIX143-08 07-DPQC-0027 Salix commutata SALIX334-08 07-GWA-14363 Salix eriocephala SALIX334-08 07-GWA-14363 Salix eriocephala SALIX134-08 07-DPQC-0014 Salix bebbiana SALIX161-08 07-DPQC-0049 Salix commutata SALIX309-08 07-GWA-14334 Salix famelica SALIX309-08 07-GWA-14334 Salix famelica SALIX342-08 07-GWA-14371 Salix cordata SALIX007-08 07-JMS-1084 Salix glauca SALIX198-08 07-UBCBG-037023-1003-2003 Salix bebbiana SALIX310-08 07-GWA-14335 Salix famelica SALIX135-08 07-DPQC-0015 Salix drummondiana SALIX168-08 07-DPQC-0056 Salix glauca SALIX200-08 07-UBCBG-34916-5555-99 Salix bebbiana SALIX007-08 07-JMS-1084 Salix glauca SALIX191-08 07-UBCBG-013854-0013-1976 Salix elaeagnos SALIX174-08 07-DPQC-0062 Salix glauca SALIX323-08 07-GWA-14349 Salix bebbiana SALIX168-08 07-DPQC-0056 Salix glauca SALIX334-08 07-GWA-14363 Salix eriocephala SALIX388-08 46-UBC-61323 Salix glauca SALIX348-08 07-GWA-14380 Salix bebbiana SALIX174-08 07-DPQC-0062 Salix glauca V -1 V -1 SALIX309-08 07-GWA-14334 Salix famelica SALIX389-08 47-UBC-60831 Salix glauca SALIX120-08 07-EM-0618 Salix candida I SALIX388-08 46-UBC-61323 Salix glauca V -1 I+II SALIX310-08 07-GWA-14335 Salix famelica SALIX386-08 56-UBC-58897 Salix glauca x brachycarpa SALIX312-08 07-GWA-14337 Salix candida SALIX389-08 47-UBC-60831 Salix glauca I SALIX007-08 07-JMS-1084 Salix glauca I SALIX387-08 56-UBC-58933 Salix glauca x brachycarpa SALIX313-08 07-GWA-14338 Salix candida V -4 SALIX386-08 56-UBC-58897 Salix glauca x brachycarpa SALIX024-08 07-JMS-1297 Salix hookeriana SALIX168-08 07-DPQC-0056 Salix glauca SALIX387-08 56-UBC-58933 Salix glauca x brachycarpa SALIX315-08 07-GWA-14340 Salix candida SALIX189-08 07-DPQC-UBCFarm5 Salix hookeriana SALIX174-08 07-DPQC-0062 Salix glauca SALIX024-08 07-JMS-1297 Salix hookeriana SALIX143-08 07-DPQC-0027 Salix commutata SALIX192-08 07-UBCBG-037096-1003-2004 Salix hookeriana SALIX389-08 47-UBC-60831 Salix glauca SALIX189-08 07-DPQC-UBCFarm5 Salix hookeriana SALIX161-08 07-DPQC-0049 Salix commutata SALIX341-08 07-GWA-14370 Salix hookeriana SALIX386-08 56-UBC-58897 Salix glauca x brachycarpa SALIX192-08 07-UBCBG-037096-1003-2004 Salix hookeriana SALIX342-08 07-GWA-14371 Salix cordata SALIX011-08 07-JMS-1124 Salix lasiandra SALIX135-08 07-DPQC-0015 Salix drummondiana SALIX387-08 56-UBC-58933 Salix glauca x brachycarpa SALIX341-08 07-GWA-14370 Salix hookeriana SALIX013-08 07-JMS-1133 Salix lasiandra SALIX024-08 07-JMS-1297 Salix hookeriana SALIX195-08 07-UBCBG-023877-0368-1984 Salix magnifica SALIX191-08 07-UBCBG-013854-0013-1976 Salix elaeagnos SALIX131-08 07-DPQC-0011 Salix lasiandra SALIX192-08 07-UBCBG-037096-1003-2004 Salix hookeriana SALIX377-08 07-WAGNER-MYR1 Salix myrtillifolia SALIX169-08 07-DPQC-0057 Salix lasiandra SALIX334-08 07-GWA-14363 Salix eriocephala SALIX341-08 07-GWA-14370 Salix hookeriana SALIX196-08 07-UBCBG-26352-117-87 Salix nakamurana SALIX175-08 07-DPQC-natJerBeach Salix lasiandra VI - SALIX309-08 07-GWA-14334 Salix famelica VI - SALIX195-08 07-UBCBG-023877-0368-1984 Salix magnifica SALIX138-08 07-DPQC-0018 Salix nivalis VI - SALIX310-08 07-GWA-14335 Salix famelica SALIX178-08 07-JW-lasiand2 Salix lasiandra SALIX377-08 07-WAGNER-MYR1 Salix myrtillifolia SALIX149-08 07-DPQC-0033 Salix nivalis SALIX181-08 07-DPQC-MIBenBay Salix lasiandra SALIX007-08 07-JMS-1084 Salix glauca SALIX196-08 07-UBCBG-26352-117-87 Salix nakamurana SALIX157-08 07-DPQC-0041 Salix nivalis VI - SALIX185-08 07-DPQC-UBCFarm1 Salix lasiandra SALIX168-08 07-DPQC-0056 Salix glauca SALIX149-08 07-DPQC-0033 Salix nivalis SALIX158-08 07-DPQC-0042 Salix nivalis SALIX193-08 07-UBCBG-015012-0268-1974 Salix lasiandra SALIX388-08 46-UBC-61323 Salix glauca SALIX157-08 07-DPQC-0041 Salix nivalis SALIX148-08 07-DPQC-0032 Salix prolixa SALIX195-08 07-UBCBG-023877-0368-1984 Salix magnifica SALIX389-08 47-UBC-60831 Salix glauca SALIX158-08 07-DPQC-0042 Salix nivalis SALIX117-08 07-EM-0579 Salix pseudomonticola SALIX377-08 07-WAGNER-MYR1 Salix myrtillifolia SALIX386-08 56-UBC-58897 Salix glauca x brachycarpa SALIX314-08 07-GWA-14339 Salix pseudomonticola SALIX148-08 07-DPQC-0032 Salix prolixa SALIX196-08 07-UBCBG-26352-117-87 Salix nakamurana SALIX316-08 07-GWA-14342 Salix pseudomonticola SALIX387-08 56-UBC-58933 Salix glauca x brachycarpa SALIX117-08 07-EM-0579 Salix pseudomonticola SALIX138-08 07-DPQC-0018 Salix nivalis SALIX024-08 07-JMS-1297 Salix hookeriana SALIX314-08 07-GWA-14339 Salix pseudomonticola SALIX116-08 07-EM-0475 Salix pseudomyrsinites SALIX149-08 07-DPQC-0033 Salix nivalis SALIX378-08 07-WAGNER-PS1 Salix pseudomyrsinites SALIX189-08 07-DPQC-UBCFarm5 Salix hookeriana SALIX316-08 07-GWA-14342 Salix pseudomonticola SALIX157-08 07-DPQC-0041 Salix nivalis SALIX192-08 07-UBCBG-037096-1003-2004 Salix hookeriana SALIX116-08 07-EM-0475 Salix pseudomyrsinites SALIX379-08 07-WAGNER-PS2 Salix pseudomyrsinites SALIX158-08 07-DPQC-0042 Salix nivalis SALIX341-08 07-GWA-14370 Salix hookeriana SALIX378-08 07-WAGNER-PS1 Salix pseudomyrsinites SALIX347-08 07-GWA-14379 Salix pyrifolia SALIX148-08 07-DPQC-0032 Salix prolixa SALIX195-08 07-UBCBG-023877-0368-1984 Salix magnifica SALIX379-08 07-WAGNER-PS2 Salix pseudomyrsinites SALIX003-08 07-JMS-1050 Salix scouleriana SALIX117-08 07-EM-0579 Salix pseudomonticola SALIX347-08 07-GWA-14379 Salix pyrifolia SALIX006-08 07-JMS-1081 Salix scouleriana SALIX314-08 07-GWA-14339 Salix pseudomonticola SALIX377-08 07-WAGNER-MYR1 Salix myrtillifolia SALIX014-08 07-JMS-1141 Salix scouleriana SALIX316-08 07-GWA-14342 Salix pseudomonticola SALIX196-08 07-UBCBG-26352-117-87 Salix nakamurana SALIX003-08 07-JMS-1050 Salix scouleriana SALIX015-08 07-JMS-1142 Salix scouleriana SALIX116-08 07-EM-0475 Salix pseudomyrsinites SALIX138-08 07-DPQC-0018 Salix nivalis SALIX006-08 07-JMS-1081 Salix scouleriana SALIX017-08 07-JMS-1211 Salix scouleriana SALIX378-08 07-WAGNER-PS1 Salix pseudomyrsinites SALIX149-08 07-DPQC-0033 Salix nivalis SALIX014-08 07-JMS-1141 Salix scouleriana SALIX025-08 07-JMS-1298 Salix scouleriana SALIX379-08 07-WAGNER-PS2 Salix pseudomyrsinites SALIX157-08 07-DPQC-0041 Salix nivalis SALIX015-08 07-JMS-1142 Salix scouleriana SALIX026-08 07-JMS-1299 Salix scouleriana SALIX347-08 07-GWA-14379 Salix pyrifolia SALIX158-08 07-DPQC-0042 Salix nivalis SALIX017-08 07-JMS-1211 Salix scouleriana SALIX128-08 07-DPQC-0008 Salix scouleriana SALIX003-08 07-JMS-1050 Salix scouleriana SALIX148-08 07-DPQC-0032 Salix prolixa SALIX025-08 07-JMS-1298 Salix scouleriana SALIX133-08 07-DPQC-0013 Salix scouleriana SALIX006-08 07-JMS-1081 Salix scouleriana SALIX314-08 07-GWA-14339 Salix pseudomonticola SALIX026-08 07-JMS-1299 Salix scouleriana SALIX145-08 07-DPQC-0029 Salix scouleriana SALIX014-08 07-JMS-1141 Salix scouleriana SALIX116-08 07-EM-0475 Salix pseudomyrsinites SALIX128-08 07-DPQC-0008 Salix scouleriana SALIX146-08 07-DPQC-0030 Salix scouleriana SALIX015-08 07-JMS-1142 Salix scouleriana SALIX379-08 07-WAGNER-PS2 Salix pseudomyrsinites SALIX133-08 07-DPQC-0013 Salix scouleriana SALIX179-08 07-DPQC-MI3 Salix scouleriana SALIX017-08 07-JMS-1211 Salix scouleriana SALIX347-08 07-GWA-14379 Salix pyrifolia SALIX145-08 07-DPQC-0029 Salix scouleriana SALIX180-08 07-DPQC-MI4 Salix scouleriana SALIX025-08 07-JMS-1298 Salix scouleriana SALIX146-08 07-DPQC-0030 Salix scouleriana SALIX010-08 07-JMS-1123 Salix sitchensis SALIX006-08 07-JMS-1081 Salix scouleriana 0 SALIX026-08 07-JMS-1299 Salix scouleriana SALIX179-08 07-DPQC-MI3 Salix scouleriana SALIX012-08 07-JMS-1132 Salix sitchensis SALIX128-08 07-DPQC-0008 Salix scouleriana SALIX128-08 07-DPQC-0008 Salix scouleriana SALIX133-08 07-DPQC-0013 Salix scouleriana SALIX180-08 07-DPQC-MI4 Salix scouleriana SALIX018-08 07-JMS-1212 Salix sitchensis SALIX133-08 07-DPQC-0013 Salix scouleriana SALIX010-08 07-JMS-1123 Salix sitchensis SALIX023-08 07-JMS-1281 Salix sitchensis SALIX010-08 07-JMS-1123 Salix sitchensis SALIX145-08 07-DPQC-0029 Salix scouleriana SALIX012-08 07-JMS-1132 Salix sitchensis SALIX123-08 06-DPQC-S2 Salix sitchensis SALIX012-08 07-JMS-1132 Salix sitchensis SALIX146-08 07-DPQC-0030 Salix scouleriana SALIX018-08 07-JMS-1212 Salix sitchensis SALIX124-08 07-DPQC-0001A Salix sitchensis SALIX018-08 07-JMS-1212 Salix sitchensis SALIX179-08 07-DPQC-MI3 Salix scouleriana SALIX023-08 07-JMS-1281 Salix sitchensis SALIX126-08 07-DPQC-0002 Salix sitchensis SALIX180-08 07-DPQC-MI4 Salix scouleriana SALIX023-08 07-JMS-1281 Salix sitchensis SALIX136-08 07-DPQC-0016 Salix sitchensis SALIX123-08 06-DPQC-S2 Salix sitchensis SALIX010-08 07-JMS-1123 Salix sitchensis SALIX124-08 07-DPQC-0001A Salix sitchensis SALIX124-08 07-DPQC-0001A Salix sitchensis SALIX166-08 07-DPQC-0054 Salix sitchensis SALIX012-08 07-JMS-1132 Salix sitchensis SALIX126-08 07-DPQC-0002 Salix sitchensis SALIX172-08 07-DPQC-0060 Salix sitchensis SALIX126-08 07-DPQC-0002 Salix sitchensis SALIX018-08 07-JMS-1212 Salix sitchensis SALIX166-08 07-DPQC-0054 Salix sitchensis SALIX136-08 07-DPQC-0016 Salix sitchensis SALIX182-08 07-DPQC-MINavChan Salix sitchensis SALIX023-08 07-JMS-1281 Salix sitchensis SALIX182-08 07-DPQC-MINavChan Salix sitchensis SALIX166-08 07-DPQC-0054 Salix sitchensis SALIX186-08 07-DPQC-UBCFarm2 Salix sitchensis SALIX123-08 06-DPQC-S2 Salix sitchensis SALIX186-08 07-DPQC-UBCFarm2 Salix sitchensis SALIX202-08 07-DPQC-VanIs1 Salix sitchensis SALIX124-08 07-DPQC-0001A Salix sitchensis SALIX182-08 07-DPQC-MINavChan Salix sitchensis SALIX206-08 07-DPQC-WhistRd2 Salix sitchensis SALIX186-08 07-DPQC-UBCFarm2 Salix sitchensis SALIX203-08 07-DPQC-VanIs2 Salix sitchensis SALIX126-08 07-DPQC-0002 Salix sitchensis SALIX209-08 07-DPQC-WhistRd5 Salix sitchensis SALIX206-08 07-DPQC-WhistRd2 Salix sitchensis SALIX136-08 07-DPQC-0016 Salix sitchensis SALIX210-08 07-DPQC-WhistRd6 Salix sitchensis SALIX202-08 07-DPQC-VanIs1 Salix sitchensis SALIX209-08 07-DPQC-WhistRd5 Salix sitchensis SALIX166-08 07-DPQC-0054 Salix sitchensis SALIX205-08 07-DPQC-WhistRd1 Salix sp. SALIX203-08 07-DPQC-VanIs2 Salix sitchensis SALIX210-08 07-DPQC-WhistRd6 Salix sitchensis SALIX172-08 07-DPQC-0060 Salix sitchensis SALIX206-08 07-DPQC-WhistRd2 Salix sitchensis SALIX205-08 07-DPQC-WhistRd1 Salix sp. SALIX182-08 07-DPQC-MINavChan Salix sitchensis SALIX207-08 07-DPQC-WhistRd3 Salix sp. SALIX209-08 07-DPQC-WhistRd5 Salix sitchensis SALIX207-08 07-DPQC-WhistRd3 Salix sp. SALIX186-08 07-DPQC-UBCFarm2 Salix sitchensis SALIX208-08 07-DPQC-WhistRd4 Salix sp. SALIX210-08 07-DPQC-WhistRd6 Salix sitchensis SALIX208-08 07-DPQC-WhistRd4 Salix sp. SALIX202-08 07-DPQC-VanIs1 Salix sitchensis SALIX184-08 07-PMP-20885 Salix uvaursi SALIX205-08 07-DPQC-WhistRd1 Salix sp. SALIX184-08 07-PMP-20885 Salix uvaursi SALIX203-08 07-DPQC-VanIs2 Salix sitchensis SALIX204-08 07-DPQC-vimEurope Salix viminalis SALIX207-08 07-DPQC-WhistRd3 Salix sp. SALIX204-08 07-DPQC-vimEur ope Salix viminalis SALIX206-08 07-DPQC-WhistRd2 Salix sitchensis SALIX391-08 73-UBC-146342 Salix glauca SALIX208-08 07-DPQC-WhistRd4 Salix sp. SALIX391-08 73-UBC-146342 Salix glauca SALIX209-08 07-DPQC-WhistRd5 Salix sitchensis SALIX011-08 07-JMS-1124 Salix lasiandra SALIX184-08 07-PMP-20885 Salix uvaursi SALIX201-08 07-DMP-UniGuelph Salix alba SALIX210-08 07-DPQC-WhistRd6 Salix sitchensis SALIX013-08 07-JMS-1133 Salix lasiandra SALIX204-08 07-DPQC-vimEur ope Salix viminalis SALIX011-08 07-JMS-1124 Salix lasiandra SALIX205-08 07-DPQC-WhistRd1 Salix sp. SALIX131-08 07-DPQC-0011 Salix lasiandra SALIX391-08 73-UBC-146342 Salix glauca SALIX013-08 07-JMS-1133 Salix lasiandra SALIX207-08 07-DPQC-WhistRd3 Salix sp. SALIX169-08 07-DPQC-0057 Salix lasiandra SALIX011-08 07-JMS-1124 Salix lasiandra SALIX131-08 07-DPQC-0011 Salix lasiandra SALIX208-08 07-DPQC-WhistRd4 Salix sp. SALIX013-08 07-JMS-1133 Salix lasiandra SALIX169-08 07-DPQC-0057 Salix lasiandra SALIX175-08 07-DPQC-natJerBeach Salix lasiandra SALIX184-08 07-PMP-20885 Salix uvaursi SALIX178-08 07-JW-lasiand2 Salix lasiandra SALIX131-08 07-DPQC-0011 Salix lasiandra SALIX175-08 07-DPQC-natJerBeach Salix lasiandra SALIX204-08 07-DPQC-vimEur ope Salix viminalis II SALIX169-08 07-DPQC-0057 Salix lasiandra SALIX178-08 07-JW-lasiand2 Salix lasiandra SALIX181-08 07-DPQC-MIBenBay Salix lasiandra SALIX391-08 73-UBC-146342 Salix glauca SALIX175-08 07-DPQC-natJerBeach Salix lasiandra SALIX181-08 07-DPQC-MIBenBay Salix lasiandra SALIX185-08 07-DPQC-UBCFarm1 Salix lasiandra SALIX201-08 07-DMP-UniGuelph Salix alba SALIX178-08 07-JW-lasiand2 Salix lasiandra SALIX185-08 07-DPQC-UBCFarm1 Salix lasiandra SALIX193-08 07-UBCBG-015012-0268-1974 Salix lasiandra SALIX327-08 07-GWA-14353 Salix serissima SALIX201-08 07-DMP-UniGuelph Salix alba SALIX181-08 07-DPQC-MIBenBay Salix lasiandra SALIX193-08 07-UBCBG-015012-0268-1974 Salix lasiandra II+III SALIX328-08 07-GWA-14354 Salix serissima SALIX185-08 07-DPQC-UBCFarm1 Salix lasiandra SALIX327-08 07-GWA-14353 Salix serissima SALIX176-08 07-DPQC-weepJerBeac h Salix x sepulcralis III SALIX327-08 07-GWA-14353 Salix serissima II SALIX193-08 07-UBCBG-015012-0268-1974 Salix lasiandra SALIX328-08 07-GWA-14354 Salix serissima SALIX183-08 07-PMP-20866 Salix exigua SALIX328-08 07-GWA-14354 Salix serissima SALIX332-08 07-GWA-14361 Salix amygdaloides SALIX176-08 07-DPQC-weepJerBeac h Salix x sepulcralis SALIX112-08 07-JMS-0981 Salix interior SALIX176-08 07-DPQC-weepJerBeach Salix x sepulcralis SALIX324-08 07-GWA-14350 Salix lucida SALIX183-08 07-PMP-20866 Salix exigua SALIX317-08 07-GWA-14343 Salix interior SALIX183-08 07-PMP-20866 Salix exigua III SALIX112-08 07-JMS-0981 Salix interior SALIX331-08 07-GWA-14360 Salix interior SALIX112-08 07-JMS-0981 Salix interior SALIX326-08 07-GWA-14352 Salix lucida SALIX317-08 07-GWA-14343 Salix interior SALIX336-08 07-GWA-14365 Salix interior SALIX317-08 07-GWA-14343 Salix interior SALIX333-08 07-GWA-14362 Salix nigra SALIX331-08 07-GWA-14360 Salix interior SALIX337-08 07-GWA-14366 Salix interior SALIX201-08 07-DMP-UniGuelph Salix alba IV SALIX331-08 07-GWA-14360 Salix interior SALIX336-08 07-GWA-14365 Salix interior SALIX338-08 07-GWA-14367 Salix interior SALIX336-08 07-GWA-14365 Salix interior SALIX320-08 07-GWA-14346 Salix amygdaloides SALIX337-08 07-GWA-14366 Salix interior SALIX212-08 07-CAN-483931 Salix interior x eriocephala SALIX337-08 07-GWA-14366 Salix interior SALIX327-08 07-GWA-14353 Salix serissima SALIX338-08 07-GWA-14367 Salix interior SALIX217-08 07-CAN-532065 Salix interior x eriocephala VI SALIX338-08 07-GWA-14367 Salix interior SALIX328-08 07-GWA-14354 Salix serissima SALIX212-08 07-CAN-483931 Salix interior x eriocephala VI SALIX216-08 07-CAN-532063 Salix interior x petiolaris SALIX212-08 07-CAN-483931 Salix interior x eriocephala SALIX176-08 07-DPQC-weepJerBeac h Salix x sepulcralis SALIX217-08 07-CAN-532065 Salix interior x eriocephala VI SALIX183-08 07-PMP-20866 Salix exigua SALIX215-08 07-CAN-532056 Salix interior x eriocephala SALIX217-08 07-CAN-532065 Salix interior x eriocephala III SALIX215-08 07-CAN-532056 Salix interior x eriocephala SALIX340-08 07-GWA-14369 Salix candida SALIX112-08 07-JMS-0981 Salix interior SALIX320-08 07-GWA-14346 Salix amygdaloides SALIX343-08 07-GWA-14372 Salix cordata SALIX216-08 07-CAN-532063 Salix interior x petiolaris SALIX331-08 07-GWA-14360 Salix interior SALIX332-08 07-GWA-14361 Salix amygdaloides SALIX344-08 07-GWA-14375 Salix cordata SALIX215-08 07-CAN-532056 Salix interior x eriocephala SALIX336-08 07-GWA-14365 Salix interior SALIX340-08 07-GWA-14369 Salix candida SALIX114-08 07-EM-0359 Salix discolor SALIX324-08 07-GWA-14350 Salix lucida SALIX337-08 07-GWA-14366 Salix interior SALIX344-08 07-GWA-14375 Salix cordata SALIX319-08 07-GWA-14345 Salix discolor SALIX326-08 07-GWA-14352 Salix lucida SALIX338-08 07-GWA-14367 Salix interior SALIX114-08 07-EM-0359 Salix discolor SALIX321-08 07-GWA-14347 Salix discolor SALIX320-08 07-GWA-14346 Salix amygdaloides SALIX212-08 07-CAN-483931 Salix interior x eriocephala SALIX319-08 07-GWA-14345 Salix discolor SALIX329-08 07-GWA-14355 Salix discolor SALIX332-08 07-GWA-14361 Salix amygdaloides SALIX217-08 07-CAN-532065 Salix interior x eriocephala SALIX321-08 07-GWA-14347 Salix discolor SALIX339-08 07-GWA-14368 Salix discolor SALIX333-08 07-GWA-14362 Salix nigra SALIX215-08 07-CAN-532056 Salix interior x eriocephala VI SALIX329-08 07-GWA-14355 Salix discolor SALIX345-08 07-GWA-14376 Salix eriocephala SALIX340-08 07-GWA-14369 Salix candida IV SALIX317-08 07-GWA-14343 Salix interior SALIX339-08 07-GWA-14368 Salix discolor SALIX346-08 07-GWA-14377 Salix eriocephala SALIX345-08 07-GWA-14376 Salix eriocephala SALIX340-08 07-GWA-14369 Salix candida SALIX345-08 07-GWA-14376 Salix eriocephala SALIX127-08 07-DPQC-0003 Salix exigua SALIX346-08 07-GWA-14377 Salix eriocephala SALIX343-08 07-GWA-14372 Salix cordata SALIX346-08 07-GWA-14377 Salix eriocephala SALIX330-08 07-GWA-14356 Salix humilis SALIX335-08 07-GWA-14364 Salix humilis SALIX114-08 07-EM-0359 Salix discolor SALIX127-08 07-DPQC-0003 Salix exigua V SALIX335-08 07-GWA-14364 Salix humilis SALIX213-08 07-CAN-483942 Salix petiolaris SALIX319-08 07-GWA-14345 Salix discolor SALIX330-08 07-GWA-14356 Salix humilis SALIX214-08 07-CAN-483950 Salix interior x petiolaris SALIX325-08 07-GWA-14351 Salix petiolaris SALIX321-08 07-GWA-14347 Salix discolor SALIX335-08 07-GWA-14364 Salix humilis SALIX213-08 07-CAN-483942 Salix petiolaris IV+V SALIX319-08 07-GWA-14345 Salix discolor SALIX329-08 07-GWA-14355 Salix discolor SALIX214-08 07-CAN-483950 Salix interior x petiolaris SALIX318-08 07-GWA-14344 Salix petiolaris SALIX339-08 07-GWA-14368 Salix discolor SALIX324-08 07-GWA-14350 Salix lucida SALIX322-08 07-GWA-14348 Salix petiolaris SALIX339-08 07-GWA-14368 Salix discolor SALIX326-08 07-GWA-14352 Salix lucida SALIX325-08 07-GWA-14351 Salix petiolaris SALIX330-08 07-GWA-14356 Salix humilis SALIX345-08 07-GWA-14376 Salix eriocephala SALIX344-08 07-GWA-14375 Salix cordata SALIX346-08 07-GWA-14377 Salix eriocephala SALIX333-08 07-GWA-14362 Salix nigra SALIX320-08 07-GWA-14346 Salix amygdaloides SALIX321-08 07-GWA-14347 Salix discolor V SALIX213-08 07-CAN-483942 Salix petiolaris SALIX332-08 07-GWA-14361 Salix amygdaloides SALIX330-08 07-GWA-14356 Salix humilis SALIX318-08 07-GWA-14344 Salix petiolaris SALIX324-08 07-GWA-14350 Salix lucida SALIX329-08 07-GWA-14355 Salix discolor SALIX335-08 07-GWA-14364 Salix humilis V SALIX322-08 07-GWA-14348 Salix petiolaris SALIX326-08 07-GWA-14352 Salix lucida SALIX214-08 07-CAN-483950 Salix interior x petiolaris SALIX214-08 07-CAN-483950 Salix interior x petiolaris SALIX325-08 07-GWA-14351 Salix petiolaris SALIX333-08 07-GWA-14362 Salix nigra SALIX318-08 07-GWA-14344 Salix petiolaris SALIX213-08 07-CAN-483942 Salix petiolaris 0.05 changes 0.05 changes IV SALIX322-08 07-GWA-14348 Salix petiolaris SALIX318-08 07-GWA-14344 Salix petiolaris SALIX322-08 07-GWA-14348 Salix petiolaris 0.1 changes SALIX325-08 07-GWA-14351 Salix petiolaris 0.1 changes

SALIX011-08 07-JMS-1124 Salix lasiandra SALIX197-08 07-UBCBG-037007-1003-2003 Salix boothii SALIX376-08 07-GWA-14436A Salix eastwoodiae SALIX013-08 07-JMS-1133 Salix lasiandra SALIX197-08 07-UBCBG-037007-1003-2003 Salix boothii SALIX090-08 07-JMS-0942 Salix hookeriana SALIX376-08 07-GWA-14436A Salix eastwoodiae SALIX226-08 07-BAB-023 Salix alaxensis SALIX090-08 07-JMS-0942 Salix hookeriana SALIX239-08 07-BAB-088 Salix alaxensis SALIX131-08 07-DPQC-0011 Salix lasiandra SALIX234-08 07-BAB-047A Salix arctica SALIX250-08 07-BAB-197 Salix alaxensis SALIX240-08 07-BAB-096A Salix arctica x polaris SALIX261-08 07-BAB-230 Salix alaxensis SALIX169-08 07-DPQC-0057 Salix lasiandra SALIX137-08 07-DPQC-0017 Salix arctica SALIX263-08 07-BAB-232 Salix alaxensis rbcL10 PIC SALIX170-08SALIX141-08 07-DPQC-005807-DPQC-0024 Salix arctica SALIX264-08 07-BAB-237 Salix alaxensis SALIX232-08 07-BAB-033 Salix arctica x glauca SALIX384-08 75-UBC-155629 Salix alaxensis SALIX175-08 07-DPQC-natJerBeach Salix lasiandra SALIX057-08 07-JMS-1351 Salix athabascensis SALIX385-08 78-UBC-162474 Salix alaxensis SALIX160-08 07-DPQC-0048 Salix barclayi matK 28 PIC SALIX060-08SALIX534-08 08-GWA-1445107-JMS-1354 Salix Salix arbusculoides alaxensis x drummondiana SALIX178-08 07-JW-lasiand2 Salix lasiandra SALIX165-08 07-DPQC-0053 Salix barclayi SALIX229-08 07-BAB-030 Salix arbusculoides trnH-psbA 16 PIC SALIX270-08 07-BAB-267 Salix barclayi II SALIX272-08 07-BAB-269 Salix barclayi SALIX390-08 73-UBC-149089 Salix arbusculoides SALIX181-08 07-DPQC-MIBenBay Salix lasiandra SALIX063-08 07-JMS-1362 Salix bebbiana SALIX392-08 69-UBC-149365 Salix arbusculoides SALIX119-08 07-EM-0596 Salix bebbiana SALIX038-08SALIX037-08 07-JMS-133307-JMS-1330 Salix arctica SALIX185-08 07-DPQC-UBCFarm1 Salix lasiandra SALIX122-08 06-DPQC-S1 Salix bebbiana SALIX039-08 07-JMS-1334 Salix arctica SALIX323-08 07-GWA-14349 Salix bebbiana SALIX049-08 07-JMS-1343 Salix arctica SALIX424-08 08-DPQC-0076 Salix bebbiana SALIX137-08 07-DPQC-0017 Salix arctica SALIX193-08 07-UBCBG-015012-0268-1974 Salix lasiandra SALIX440-08 08-DPQC-0092 Salix bebbiana SALIX140-08 07-DPQC-0020 Salix arctica SALIX532-08SALIX356-08 07-GWA-1438808-GWA-14449 Salix boothiicalicola SALIX141-08 07-DPQC-0024 Salix arctica SALIX168-08 07-DPQC-0056 Salix glauca SALIX481-08 08-DPQC-0136 Salix candida SALIX142-08 07-DPQC-0025 Salix arctica SALIX007-08 07-JMS-1084 Salix glauca SALIX144-08 07-DPQC-0028 Salix arctica SALIX361-08 07-GWA-14396 Salix glauca SALIX150-08 07-DPQC-0034 Salix arctica SALIX536-09 08-CAR-001 Salix reticulata SALIX368-08 07-GWA-14424 Salix glauca SALIX154-08 07-DPQC-0038 Salix arctica SALIX387-08 56-UBC-58933 Salix glauca x brachycarpa SALIX155-08 07-DPQC-0039 Salix arctica SALIX538-09 08-CAR-003 Salix reticulata SALIX401-08 07-DW-6001 Salix myricoides SALIX170-08SALIX167-08 07-DPQC-005807-DPQC-0055 Salix arctica SALIX269-08 07-BAB-251 Salix niphoclada SALIX234-08 07-BAB-047A Salix arctica SALIX363-08 07-GWA-14409 Salix petrophila SALIX235-08 07-BAB-047B Salix arctica SALIX553-09 08-CAR-018 Salix reticulata SALIX061-08 07-JMS-1360 Salix prolixa I SALIX383-08 73-UBC-152112 Salix arctica SALIX436-08 08-DPQC-0088 Salix prolixa SALIX232-08 07-BAB-033 Salix arctica x glauca SALIX556-09 08-CAR-021 Salix reticulata SALIX282-08 07-BAB-292 Salix reticulata SALIX240-08 07-BAB-096A Salix arctica x polaris SALIX548-09 08-CAR-013 Salix reticulata SALIX247-08 07-BAB-186 Salix arctica x polaris SALIX554-09 08-CAR-019 Salix reticulata SALIX297-08 07-CEG-27 Salix arizonica SALIX559-09 08-CAR-024 Salix reticulata SALIX557-09 08-CAR-022 Salix reticulata SALIX298-08 07-CEG-26 Salix arizonica SALIX562-09SALIX558-09 08-CAR-02708-CAR-023 Salix reticulata SALIX510-08 08-CEG-12 Salix arizonica SALIX563-09 08-CAR-028 Salix reticulata SALIX057-08 07-JMS-1351 Salix athabascensis SALIX566-09 08-CAR-031 Salix reticulata SALIX231-08 07-BAB-032 Salix richardsonii SALIX517-08 08-GWA-14434 Salix athabascensis SALIX237-08 07-BAB-072 Salix rotundifolia SALIX040-08 07-JMS-1335 Salix barclayi SALIX174-08 07-DPQC-0062 Salix glauca SALIX126-08 07-DPQC-0002 Salix sitchensis SALIX041-08 07-JMS-1336 Salix barclayi SALIX415-08 08-DPQC-0067 Salix sitchensis SALIX047-08 07-JMS-1341 Salix barclayi SALIX446-08 08-DPQC-0097 Salix sitchensis SALIX048-08 07-JMS-1342 Salix barclayi SALIX202-08 07-DPQC-VanIs1 Salix sitchensis SALIX453-08 08-DPQC-0106 Salix sitchensis SALIX053-08SALIX050-08 07-JMS-134707-JMS-1344B Salix Salix barclayi barclayi SALIX043-08 07-JMS-1337B Salix x glauca SALIX151-08 07-DPQC-0035 Salix barclayi SALIX203-08 07-DPQC-VanIs2 Salix sitchensis SALIX011-08 07-JMS-1124 Salix lasiandra SALIX152-08 07-DPQC-0036 Salix barclayi SALIX028-08SALIX013-08 07-JMS-130907-JMS-1133 Salix lasiandra SALIX153-08 07-DPQC-0037 Salix barclayi SALIX031-08 07-JMS-1314 Salix lasiandra SALIX160-08 07-DPQC-0048 Salix barclayi SALIX540-09 08-CAR-005 Salix reticulata SALIX055-08 07-JMS-1349 Salix lasiandra SALIX162-08 07-DPQC-0050 Salix barclayi SALIX056-08 07-JMS-1350 Salix lasiandra SALIX164-08SALIX163-08 07-DPQC-005207-DPQC-0051 Salix barclayi SALIX543-09 08-CAR-008 Salix reticulata SALIX067-08 07-JMS-0863 Salix lasiandra SALIX165-08 07-DPQC-0053 Salix barclayi G IIIIIIIVVVI SALIX077-08 07-JMS-0899 Salix lasiandra SALIX123-08 06-DPQC-S2 Salix sitchensis SALIX080-08 07-JMS-0905 Salix lasiandra SALIX194-08SALIX171-08 07-UBCBG-037155-1003-200407-DPQC-0059 Salix barclayi Salix barclayi G I II III IV V VI SALIX082-08 07-JMS-0923 Salix lasiandra SALIX199-08 07-UBCBG-native3 Salix barclayi SALIX088-08 07-JMS-0937 Salix lasiandra G I II III IV V VI SALIX227-08 07-BAB-025 Salix barclayi SALIX129-08 07-DPQC-0009 Salix bebbiana SALIX091-08 07-JMS-0943 Salix lasiandra SALIX238-08 07-BAB-082 Salix barclayi SALIX106-08 07-JMS-0966 Salix lasiandra SALIX260-08 07-BAB-227 Salix barclayi SALIX131-08 07-DPQC-0011 Salix lasiandra SALIX266-08 07-BAB-246 Salix barclayi SALIX542-09 08-CAR-007 Salix reticulata SALIX169-08 07-DPQC-0057 Salix lasiandra SALIX270-08 07-BAB-267 Salix barclayi SALIX175-08 07-DPQC-natJerBeach Salix lasiandra SALIX272-08 07-BAB-269 Salix barclayi SALIX206-08 07-DPQC-WhistRd2 Salix sitchensis SALIX178-08 07-JW-lasiand2 Salix lasiandra SALIX274-08 07-BAB-272 Salix barclayi SALIX181-08 07-DPQC-MIBenBay Salix lasiandra SALIX279-08 07-BAB-287 Salix barclayi SALIX185-08 07-DPQC-UBCFarm1 Salix lasiandra SALIX287-08 07-BAB-313 Salix barclayi SALIX210-08 07-DPQC-WhistRd6 Salix sitchensis SALIX251-08SALIX193-08 07-BAB-19807-UBCBG-015012-0268-1974 Salix lasiandra Salix lasiandra SALIX404-08 07-BAB-024 Salix barclayi SALIX262-08 07-BAB-231 Salix lasiandra SALIX443-08 08-DPQC-0095A Salix barclayi SALIX296-08 07-CEG-25 Salix lasiandra SALIX444-08 08-DPQC-0095B Salix barclayi SALIX384-08 75-UBC-155629 Salix alaxensis SALIX351-08 07-GWA-14383 Salix lasiandra SALIX454-08 08-DPQC-0107 Salix barclayi SALIX393-08 08-DPYC-02 Salix lasiandra SALIX455-08 08-DPQC-0108 Salix barclayi SALIX385-08 78-UBC-162474 Salix alaxensis SALIX406-08 07-CEG-17 Salix lasiandra SALIX458-08 08-DPQC-0112 Salix barclayi SALIX423-08 08-DPQC-0075 Salix lasiandra II SALIX139-08 07-DPQC-0019 Salix barrattiana SALIX156-08 07-DPQC-0040 Salix barrattiana SALIX390-08 73-UBC-149089 Salix arbusculoides SALIX425-08 08-DPQC-0077 Salix lasiandra SALIX173-08 07-DPQC-0061 Salix barrattiana SALIX426-08 08-DPQC-0078 Salix lasiandra SALIX246-08 07-BAB-168 Salix barrattiana SALIX434-08 08-DPQC-0086 Salix lasiandra SALIX382-08 73-UBC-149084 Salix barrattiana SALIX392-08 69-UBC-149365 Salix arbusculoides SALIX438-08 08-DPQC-0090 Salix lasiandra SALIX522-08 08-GWA-14437A Salix barrattiana SALIX445-08 08-DPQC-0096 Salix lasiandra SALIX004-08 07-JMS-1056 Salix bebbiana SALIX447-08 08-DPQC-0100 Salix lasiandra SALIX005-08 07-JMS-1059 Salix bebbiana SALIX137-08 07-DPQC-0017 Salix arctica SALIX449-08 08-DPQC-0102 Salix lasiandra SALIX008-08 07-JMS-1094 Salix bebbiana I -03677 SALIX476-08 08-DPQC-0131 Salix lasiandra SALIX477-08 08-DPQC-0132 Salix lasiandra SALIX063-08 07-JMS-1362 Salix bebbiana SALIX140-08 07-DPQC-0020 Salix arctica I -15445 SALIX108-08 07-JMS-0968 Salix sp. SALIX066-08 07-JMS-1365 Salix bebbiana SALIX113-08 07-EM-0315 Salix bebbiana SALIX407-08 07-JMS-0887 Salix sp. I -38779 SALIX070-08 07-JMS-0869 Salix scouleriana SALIX115-08 07-EM-0472 Salix bebbiana SALIX141-08 07-DPQC-0024 Salix arctica SALIX071-08 07-JMS-0871 Salix scouleriana SALIX119-08SALIX118-08 07-EM-059607-EM-0583 Salix bebbiana SALIX076-08 07-JMS-0897 Salix scouleriana SALIX121-08 07-EM-0628 Salix bebbiana SALIX142-08 07-DPQC-0025 Salix arctica SALIX087-08 07-JMS-0929 Salix scouleriana SALIX129-08 07-DPQC-0009 Salix bebbiana SALIX107-08 07-JMS-0967 Salix scouleriana SALIX134-08 07-DPQC-0014 Salix bebbiana SALIX179-08 07-DPQC-MI3 Salix scouleriana SALIX198-08 07-UBCBG-037023-1003-2003 Salix bebbiana SALIX144-08 07-DPQC-0028 Salix arctica SALIX180-08 07-DPQC-MI4 Salix scouleriana SALIX200-08 07-UBCBG-34916-5555-99 Salix bebbiana SALIX409-08 07-JMS-0898B Salix scouleriana SALIX221-08 07-BAB-014 Salix bebbiana SALIX394-08 08-DPYC-03 Salix sitchensis SALIX248-08 07-BAB-193 Salix bebbiana SALIX150-08 07-DPQC-0034 Salix arctica SALIX096-08 07-JMS-0954 Salix sp. SALIX253-08 07-BAB-200 Salix bebbiana SALIX039-08 07-JMS-1334 Salix arctica SALIX275-08 07-BAB-273 Salix bebbiana SALIX155-08 07-DPQC-0039 Salix arctica SALIX258-08SALIX156-08 07-BAB-22407-DPQC-0040 Salix Salix myrtillifolia barrattiana SALIX323-08 07-GWA-14349 Salix bebbiana SALIX271-08 07-BAB-268 Salix pedicellaris SALIX414-08SALIX348-08 08-DPQC-006607-GWA-14380 Salix bebbiana SALIX167-08 07-DPQC-0055 Salix arctica SALIX283-08 07-BAB-293 Salix arctica SALIX417-08 08-DPQC-0069 Salix bebbiana SALIX464-08 08-DPQC-0119 Salix glauca villosa SALIX419-08 08-DPQC-0071 Salix bebbiana SALIX480-08 08-DPQC-0135 Salix glauca villosa SALIX424-08 08-DPQC-0076 Salix bebbiana SALIX170-08 07-DPQC-0058 Salix arctica SALIX567-09 08-CAR-032 Salix reticulata SALIX428-08 08-DPQC-0080 Salix bebbiana SALIX298-08 07-CEG-26SALIX511-08 Salix 08-CEG-13 arizonica Salix geyeriana SALIX432-08 08-DPQC-0084 Salix bebbiana SALIX380-08 61-UBC-119656 Salix arctica SALIX299-08 07-CEG-28 Salix monticola SALIX440-08 08-DPQC-0092 Salix bebbiana SALIX123-08 06-DPQC-S2 Salix sitchensis SALIX442-08 08-DPQC-0094 Salix bebbiana SALIX129-08 07-DPQC-0009 Salix bebbiana SALIX463-08 08-DPQC-0118 Salix bebbiana SALIX383-08 73-UBC-152112 Salix arctica SALIX414-08 08-DPQC-0066 Salix bebbiana SALIX472-08 08-DPQC-0127 Salix bebbiana II -3677 SALIX442-08 08-DPQC-0094 Salix bebbiana SALIX513-08 08-CEG-15 Salix bebbiana SALIX151-08 07-DPQC-0035 Salix barclayi II -6556 SALIX355-08 07-GWA-14387 Salix boothii SALIX065-08SALIX514-08 08-CEG-1607-JMS-1364 Salix Salix bebbiana boothii SALIX357-08 07-GWA-14390 Salix drummondiana II -11101012 SALIX359-08 07-GWA-14393 Salix drummondiana SALIX355-08SALIX293-08 07-CEG-1907-GWA-14387 Salix Salix boothii boothii SALIX153-08 07-DPQC-0037 Salix barclayi SALIX144-08 07-DPQC-0028 Salix arctica SALIX356-08 07-GWA-14388 Salix boothii SALIX273-08 07-BAB-270 Salix pedicellaris SALIX360-08 07-GWA-14395 Salix boothii SALIX160-08 07-DPQC-0048 Salix barclayi SALIX230-08SALIX266-08 07-BAB-24607-BAB-031 Salix barclayirichardsonii SALIX515-08 08-CEG-17 Salix boothii SALIX371-08 07-GWA-14427 Salix lasiolepis SALIX516-08 08-GWA-14433 Salix boothii SALIX372-08 07-GWA-14428 Salix lasiolepis SALIX526-08 08-GWA-14443 Salix brachycarpa SALIX162-08 07-DPQC-0050 Salix barclayi SALIX220-08 07-BAB-013 Salix planifolia SALIX527-08 08-GWA-14444 Salix brachycarpa SALIX222-08 07-BAB-015 Salix scouleriana SALIX532-08 08-GWA-14449 Salix calicola SALIX226-08 07-BAB-023 Salix alaxensis SALIX533-08 08-GWA-14450 Salix calicola SALIX163-08 07-DPQC-0051 Salix barclayi SALIX239-08 07-BAB-088 Salix alaxensis SALIX120-08SALIX395-08 07-EM-061808-ISQC-CanIs Salix Salix candida canariensis SALIX250-08 07-BAB-197 Salix alaxensis SALIX243-08 07-BAB-130 Salix candida SALIX164-08 07-DPQC-0052 Salix barclayi SALIX261-08 07-BAB-230 Salix alaxensis SALIX259-08 07-BAB-226 Salix candida SALIX263-08 07-BAB-232SALIX264-08 Salix 07-BAB-237 alaxensis Salix alaxensis SALIX312-08 07-GWA-14337 Salix candida SALIX165-08 07-DPQC-0053 Salix barclayi SALIX384-08 75-UBC-155629 Salix alaxensis SALIX315-08SALIX313-08 07-GWA-1434007-GWA-14338 Salix candida SALIX385-08 78-UBC-162474 Salix alaxensis SALIX481-08 08-DPQC-0136 Salix candida SALIX171-08 07-DPQC-0059 Salix barclayi SALIX534-08 08-GWA-14451 Salix alaxensis x drummondiana SALIX485-08 08-DPQC-0141 Salix candida SALIX060-08 07-JMS-1354 Salix arbusculoides SALIX569-09 09-DPQC-11 Salix candida SALIX229-08 07-BAB-030 Salix arbusculoides SALIX573-09 09-DPQC-26 Salix candida SALIX194-08 07-UBCBG-037155-1003-2004 Salix barclayi SALIX392-08SALIX390-08 69-UBC-14936573-UBC-149089 Salix arbusculoides SALIX143-08 07-DPQC-0027 Salix commutata SALIX037-08 07-JMS-1330 Salix arctica SALIX161-08 07-DPQC-0049 Salix commutata SALIX199-08 07-UBCBG-native3 Salix barclayi SALIX038-08 07-JMS-1333 Salix arctica SALIX529-08 08-GWA-14446 Salix commutata III -344 SALIX049-08 07-JMS-1343 Salix arctica SALIX342-08 07-GWA-14371 Salix cordata SALIX156-08 07-DPQC-0040 Salix barrattiana III -334 SALIX140-08 07-DPQC-0020 Salix arctica SALIX400-08 07-DW-6000 Salix cordata SALIX142-08 07-DPQC-0025 Salix arctica SALIX402-08 07-DW-6002 Salix cordata SALIX150-08 07-DPQC-0034 Salix arctica III -113 SALIX059-08SALIX054-08 07-JMS-135307-JMS-1348 Salix drummondiana SALIX173-08 07-DPQC-0061 Salix barrattiana SALIX154-08 07-DPQC-0038 Salix arctica SALIX064-08 07-JMS-1363 Salix drummondiana SALIX155-08 07-DPQC-0039 Salix arctica SALIX135-08 07-DPQC-0015 Salix drummondiana SALIX235-08SALIX167-08 07-BAB-047B07-DPQC-0055 Salix Salix arctica arctica SALIX357-08 07-GWA-14390 Salix drummondiana SALIX381-08 43-UBC-65549 Salix barrattiana SALIX380-08 61-UBC-119656 Salix arctica SALIX359-08 07-GWA-14393 Salix drummondiana SALIX383-08 73-UBC-152112 Salix arctica SALIX430-08 08-DPQC-0082 Salix drummondiana SALIX005-08 07-JMS-1059 Salix bebbiana SALIX247-08 07-BAB-186 Salix arctica x polaris SALIX435-08 08-DPQC-0087 Salix drummondiana SALIX297-08 07-CEG-27 Salix arizonica SALIX457-08 08-DPQC-0111 Salix drummondiana SALIX510-08 08-CEG-12 Salix arizonica SALIX466-08 08-DPQC-0121 Salix drummondiana SALIX008-08 07-JMS-1094 Salix bebbiana SALIX517-08 08-GWA-14434 Salix athabascensis SALIX470-08 08-DPQC-0125 Salix drummondiana SALIX040-08 07-JMS-1335 Salix barclayi SALIX478-08 08-DPQC-0133 Salix drummondiana SALIX113-08 07-EM-0315 Salix bebbiana SALIX041-08 07-JMS-1336 Salix barclayi SALIX521-08SALIX520-08 08-GWA-14437 21 Salix drummondiana SALIX047-08 07-JMS-1341 Salix barclayi SALIX528-08 08-GWA-14445 Salix drummondiana SALIX048-08 07-JMS-1342 Salix barclayi SALIX530-08 08-GWA-14447 Salix drummondiana SALIX115-08 07-EM-0472 Salix bebbiana SALIX050-08 07-JMS-1344B Salix barclayi SALIX574-09 07-GWA-14436B Salix drummondiana SALIX151-08SALIX053-08 07-DPQC-003507-JMS-1347 Salix Salix barclayi barclayi SALIX191-08SALIX375-08 07-UBCBG-013854-0013-197607-GWA-14431 Salix eastwoodiae Salix elaeagnos SALIX118-08 07-EM-0583 Salix bebbiana SALIX152-08 07-DPQC-0036 Salix barclayi SALIX219-08 07-CAN-532085 Salix eriocephala SALIX153-08 07-DPQC-0037 Salix barclayi SALIX334-08 07-GWA-14363 Salix eriocephala SALIX119-08 07-EM-0596 Salix bebbiana SALIX162-08 07-DPQC-0050 Salix barclayi SALIX309-08 07-GWA-14334 Salix famelica SALIX163-08 07-DPQC-0051 Salix barclayi SALIX310-08 07-GWA-14335 Salix famelica SALIX164-08 07-DPQC-0052 Salix barclayi SALIX524-08 08-GWA-14439 Salix farriae IV -11 SALIX121-08 07-EM-0628 Salix bebbiana SALIX194-08SALIX171-08 07-DPQC-005907-UBCBG-037155-1003-2004 Salix barclayi Salix barclayi SALIX570-09 09-DPQC-13 Salix farriae IV -23 SALIX199-08 07-UBCBG-native3 Salix barclayi SALIX109-08 07-JMS-0974 Salix geyeriana SALIX227-08 07-BAB-025 Salix barclayi SALIX511-08 08-CEG-13 Salix geyeriana SALIX122-08 06-DPQC-S1 Salix bebbiana SALIX238-08 07-BAB-082 Salix barclayi IV -02 SALIX007-08 07-JMS-1084 Salix glauca SALIX168-08 07-DPQC-0056 Salix glauca SALIX134-08 07-DPQC-0014 Salix bebbiana SALIX260-08 07-BAB-227 Salix barclayi SALIX174-08 07-DPQC-0062 Salix glauca SALIX274-08 07-BAB-272 Salix barclayi SALIX224-08 07-BAB-017 Salix glauca SALIX287-08SALIX279-08 07-BAB-31307-BAB-287 Salix barclayi SALIX286-08 07-BAB-299 Salix glauca SALIX198-08 07-UBCBG-037023-1003-2003 Salix bebbiana SALIX404-08 07-BAB-024 Salix barclayi SALIX361-08 07-GWA-14396 Salix glauca SALIX443-08 08-DPQC-0095A Salix barclayi SALIX362-08 07-GWA-14397 Salix glauca SALIX444-08 08-DPQC-0095B Salix barclayi SALIX368-08 07-GWA-14424 Salix glauca SALIX200-08 07-UBCBG-34916-5555-99 Salix bebbiana SALIX454-08 08-DPQC-0107 Salix barclayi SALIX374-08 07-GWA-14430 Salix glauca SALIX455-08 08-DPQC-0108 Salix barclayi SALIX388-08 46-UBC-61323 Salix glauca SALIX458-08 08-DPQC-0112 Salix barclayi SALIX389-08 47-UBC-60831 Salix glauca SALIX323-08 07-GWA-14349 Salix bebbiana SALIX139-08 07-DPQC-0019 Salix barrattiana SALIX441-08 08-DPQC-0093 Salix glauca SALIX173-08 07-DPQC-0061 Salix barrattiana SALIX471-08 08-DPQC-0126 Salix glauca SALIX348-08 07-GWA-14380 Salix bebbiana SALIX246-08 07-BAB-168 Salix barrattiana SALIX486-08 08-DPQC-0142 Salix glauca SALIX381-08 43-UBC-65549 Salix barrattiana SALIX459-08SALIX487-08 08-DPQC-014308-DPQC-0113 Salix glauca villosa SALIX197-08 07-UBCBG-037007-1003-2003 Salix boothii SALIX382-08 73-UBC-149084 Salix barrattiana SALIX460-08 08-DPQC-0114 Salix glauca villosa SALIX004-08SALIX522-08 08-GWA-14437A07-JMS-1056 Salix Salix bebbiana barrattiana SALIX464-08 08-DPQC-0119 Salix glauca villosa SALIX005-08 07-JMS-1059 Salix bebbiana SALIX465-08 08-DPQC-0120 Salix glauca villosa SALIX120-08 07-EM-0618 Salix candida SALIX008-08 07-JMS-1094 Salix bebbiana SALIX480-08 08-DPQC-0135 Salix glauca villosa SALIX066-08 07-JMS-1365 Salix bebbiana SALIX531-08 08-GWA-14448 Salix glauca villosa SALIX312-08 07-GWA-14337 Salix candida SALIX113-08 07-EM-0315 Salix bebbiana SALIX386-08 56-UBC-58897 Salix glauca x brachycarpa SALIX115-08 07-EM-0472 Salix bebbiana SALIX387-08 56-UBC-58933 Salix glauca x brachycarpa SALIX118-08 07-EM-0583 Salix bebbiana SALIX024-08 07-JMS-1297 Salix hookeriana V -0 SALIX313-08 07-GWA-14338 Salix candida SALIX121-08 07-EM-0628 Salix bebbiana SALIX069-08 07-JMS-0865 Salix hookeriana V -3 SALIX134-08 07-DPQC-0014 Salix bebbiana SALIX074-08 07-JMS-0885 Salix hookeriana SALIX198-08 07-UBCBG-037023-1003-2003 Salix bebbiana SALIX078-08 07-JMS-0900 Salix hookeriana SALIX315-08 07-GWA-14340 Salix candida SALIX200-08 07-UBCBG-34916-5555-99 Salix bebbiana V -2 SALIX098-08 07-JMS-0956 Salix hookeriana SALIX100-08 07-JMS-0958 Salix hookeriana SALIX221-08 07-BAB-014 Salix bebbiana SALIX102-08 07-JMS-0960 Salix hookeriana SALIX143-08 07-DPQC-0027 Salix commutata SALIX248-08 07-BAB-193 Salix bebbiana SALIX103-08 07-JMS-0961 Salix hookeriana SALIX253-08 07-BAB-200 Salix bebbiana SALIX189-08 07-DPQC-UBCFarm5 Salix hookeriana SALIX275-08 07-BAB-273 Salix bebbiana SALIX192-08 07-UBCBG-037096-1003-2004 Salix hookeriana SALIX161-08 07-DPQC-0049 Salix commutata SALIX417-08SALIX348-08 07-GWA-1438008-DPQC-0069 Salix bebbiana SALIX341-08 07-GWA-14370 Salix hookeriana SALIX419-08 08-DPQC-0071 Salix bebbiana SALIX399-08 08-DPsitchSB Salix hookeriana SALIX342-08 07-GWA-14371 Salix cordata SALIX428-08 08-DPQC-0080 Salix bebbiana SALIX290-08 07-CEG-15 Salix irrorata SALIX432-08 08-DPQC-0084 Salix bebbiana SALIX364-08SALIX291-08 07-CEG-1607-GWA-14411 Salix Salix irrorata jepsonii SALIX135-08 07-DPQC-0015 Salix drummondiana SALIX463-08 08-DPQC-0118 Salix bebbiana SALIX365-08 07-GWA-14413 Salix jepsonii SALIX472-08 08-DPQC-0127 Salix bebbiana SALIX370-08 07-GWA-14426 Salix jepsonii SALIX513-08 08-CEG-15 Salix bebbiana SALIX011-08 07-JMS-1124 Salix lasiandra SALIX191-08 07-UBCBG-013854-0013-1976 Salix elaeagnos SALIX514-08 08-CEG-16 Salix bebbiana SALIX013-08 07-JMS-1133 Salix lasiandra SALIX065-08 07-JMS-1364 Salix boothii SALIX028-08 07-JMS-1309 Salix lasiandra SALIX293-08 07-CEG-19 Salix boothii SALIX031-08 07-JMS-1314 Salix lasiandra SALIX219-08 07-CAN-532085 Salix eriocephala SALIX515-08SALIX360-08 07-GWA-1439508-CEG-17 Salix Salix boothii boothii SALIX055-08 07-JMS-1349 Salix lasiandra SALIX516-08 08-GWA-14433 Salix boothii SALIX056-08 07-JMS-1350 Salix lasiandra SALIX334-08 07-GWA-14363 Salix eriocephala SALIX526-08 08-GWA-14443 Salix brachycarpa SALIX067-08 07-JMS-0863 Salix lasiandra SALIX527-08 08-GWA-14444 Salix brachycarpa SALIX077-08 07-JMS-0899 Salix lasiandra SALIX533-08 08-GWA-14450 Salix calicola SALIX080-08 07-JMS-0905 Salix lasiandra SALIX309-08 07-GWA-14334 Salix famelica SALIX395-08 08-ISQC-CanIs Salix canariensis SALIX082-08 07-JMS-0923 Salix lasiandra SALIX120-08 07-EM-0618 Salix candida SALIX088-08 07-JMS-0937 Salix lasiandra VI - SALIX243-08 07-BAB-130 Salix candida SALIX310-08 07-GWA-14335 Salix famelica SALIX091-08 07-JMS-0943 Salix lasiandra VI - SALIX259-08 07-BAB-226 Salix candida SALIX106-08 07-JMS-0966 Salix lasiandra SALIX131-08 07-DPQC-0011 Salix lasiandra SALIX007-08 07-JMS-1084 Salix glauca SALIX312-08 07-GWA-14337 Salix candida VI - SALIX169-08 07-DPQC-0057 Salix lasiandra SALIX315-08SALIX313-08 07-GWA-1434007-GWA-14338 Salix candida SALIX175-08 07-DPQC-natJerBeach Salix lasiandra SALIX485-08 08-DPQC-0141 Salix candida SALIX178-08 07-JW-lasiand2 Salix lasiandra SALIX388-08 46-UBC-61323 Salix glauca SALIX569-09 09-DPQC-11 Salix candida SALIX181-08 07-DPQC-MIBenBay Salix lasiandra SALIX573-09 09-DPQC-26 Salix candida SALIX185-08 07-DPQC-UBCFarm1 Salix lasiandra SALIX143-08 07-DPQC-0027 Salix commutata SALIX193-08 07-UBCBG-015012-0268-1974 Salix lasiandra SALIX389-08 47-UBC-60831 Salix glauca SALIX161-08 07-DPQC-0049 Salix commutata SALIX262-08SALIX251-08 07-BAB-23107-BAB-198 Salix lasiandra SALIX386-08 56-UBC-58897 Salix glauca x brachycarpa SALIX529-08 08-GWA-14446SALIX342-08 07-GWA-14371 Salix commutata Salix cordata SALIX351-08SALIX296-08 07-CEG-2507-GWA-14383 Salix Salix lasiandra lasiandra SALIX400-08 07-DW-6000 Salix cordata SALIX393-08 08-DPYC-02 Salix lasiandra SALIX402-08 07-DW-6002 Salix cordata SALIX406-08 07-CEG-17 Salix lasiandra SALIX387-08 56-UBC-58933 Salix glauca x brachycarpa SALIX054-08 07-JMS-1348 Salix drummondiana SALIX423-08 08-DPQC-0075 Salix lasiandra SALIX059-08 07-JMS-1353 Salix drummondiana SALIX425-08 08-DPQC-0077 Salix lasiandra SALIX024-08 07-JMS-1297 Salix hookeriana SALIX064-08 07-JMS-1363 Salix drummondiana SALIX426-08 08-DPQC-0078 Salix lasiandra SALIX135-08 07-DPQC-0015 Salix drummondiana SALIX434-08 08-DPQC-0086 Salix lasiandra SALIX276-08 07-BAB-274 Salix drummondiana SALIX438-08 08-DPQC-0090 Salix lasiandra SALIX189-08 07-DPQC-UBCFarm5 Salix hookeriana SALIX435-08SALIX430-08 08-DPQC-008708-DPQC-0082 Salix drummondiana SALIX445-08 08-DPQC-0096 Salix lasiandra SALIX457-08 08-DPQC-0111 Salix drummondiana SALIX447-08 08-DPQC-0100 Salix lasiandra SALIX466-08 08-DPQC-0121 Salix drummondiana SALIX449-08 08-DPQC-0102 Salix lasiandra SALIX192-08 07-UBCBG-037096-1003-2004 Salix hookeriana SALIX470-08 08-DPQC-0125 Salix drummondiana SALIX476-08 08-DPQC-0131 Salix lasiandra I SALIX478-08 08-DPQC-0133 Salix drummondiana SALIX477-08 08-DPQC-0132 Salix lasiandra SALIX341-08 07-GWA-14370 Salix hookeriana SALIX520-08 08-GWA-14437 1 Salix drummondiana SALIX292-08 07-CEG-18 Salix lasiolepis SALIX521-08 08-GWA-14437 2 Salix drummondiana SALIX372-08SALIX371-08 07-GWA-1442807-GWA-14427 Salix lasiolepis SALIX195-08 07-UBCBG-023877-0368-1984 Salix magnifica SALIX528-08 08-GWA-14445 Salix drummondiana SALIX353-08 07-GWA-14385 Salix lemmonii SALIX530-08 08-GWA-14447 Salix drummondiana SALIX354-08 07-GWA-14386 Salix lemmonii SALIX574-09 07-GWA-14436B Salix drummondiana SALIX288-08 07-CEG-13 Salix ligulifolia SALIX377-08 07-WAGNER-MYR1 Salix myrtillifolia SALIX375-08 07-GWA-14431 Salix eastwoodiae SALIX289-08 07-CEG-14 Salix ligulifolia SALIX191-08 07-UBCBG-013854-0013-1976 Salix elaeagnos SALIX500-08 08-CEG-03A Salix ligulifolia I+II SALIX196-08 07-UBCBG-26352-117-87 Salix nakamurana SALIX334-08SALIX219-08 07-CAN-53208507-GWA-14363 SalixSalix eriocephalaeriocephala SALIX501-08 08-CEG-03B Salix ligulifolia SALIX309-08 07-GWA-14334 Salix famelica SALIX396-08 08-DPSlind Salix lindleyana SALIX310-08 07-GWA-14335 Salix famelica SALIX350-08 07-GWA-14382 Salix lutea SALIX138-08 07-DPQC-0018 Salix nivalis SALIX524-08 08-GWA-14439 Salix farriae SALIX352-08 07-GWA-14384 Salix lutea SALIX570-09 09-DPQC-13 Salix farriae SALIX479-08 08-DPQC-0134 Salix maccalliana SALIX109-08 07-JMS-0974 Salix geyeriana SALIX483-08 08-DPQC-0139 Salix maccalliana SALIX149-08 07-DPQC-0033 Salix nivalis SALIX168-08 07-DPQC-0056 Salix glauca SALIX484-08 08-DPQC-0140 Salix maccalliana SALIX174-08 07-DPQC-0062 Salix glauca SALIX489-08SALIX488-08 08-DPQC-014508-DPQC-0144 Salix maccalliana SALIX157-08 07-DPQC-0041 Salix nivalis SALIX224-08 07-BAB-017 Salix glauca SALIX535-08 08-GWA-14452 Salix maccalliana SALIX252-08 07-BAB-199 Salix glauca SALIX195-08 07-UBCBG-023877-0368-1984 Salix magnifica SALIX286-08 07-BAB-299 Salix glauca SALIX299-08 07-CEG-28 Salix monticola SALIX158-08 07-DPQC-0042 Salix nivalis SALIX362-08 07-GWA-14397 Salix glauca SALIX300-08 07-CEG-29 Salix monticola SALIX374-08 07-GWA-14430 Salix glauca SALIX512-08 08-CEG-14 Salix monticola SALIX148-08 07-DPQC-0032 Salix prolixa SALIX388-08 46-UBC-61323 Salix glauca SALIX401-08 07-DW-6001 Salix myricoides SALIX441-08SALIX389-08 08-DPQC-009347-UBC-60831 SalixSalix glaucaglauca SALIX403-08 07-DW-6003 Salix myricoides SALIX471-08 08-DPQC-0126 Salix glauca SALIX223-08 07-BAB-016 Salix myrtillifolia SALIX117-08 07-EM-0579 Salix pseudomonticola SALIX486-08 08-DPQC-0142 Salix glauca SALIX258-08 07-BAB-224 Salix myrtillifolia SALIX487-08 08-DPQC-0143 Salix glauca SALIX277-08 07-BAB-276 Salix myrtillifolia SALIX459-08 08-DPQC-0113 Salix glauca villosa SALIX377-08 07-WAGNER-MYR1 Salix myrtillifolia SALIX314-08 07-GWA-14339 Salix pseudomonticola SALIX460-08 08-DPQC-0114 Salix glauca villosa SALIX196-08 07-UBCBG-26352-117-87 Salix nakamurana SALIX465-08 08-DPQC-0120 Salix glauca villosa SALIX236-08 07-BAB-051 Salix niphoclada SALIX316-08 07-GWA-14342 Salix pseudomonticola SALIX531-08 08-GWA-14448 Salix glauca villosa SALIX269-08SALIX268-08 07-BAB-25107-BAB-250 Salix niphoclada SALIX386-08 56-UBC-58897 Salix glauca x brachycarpa SALIX138-08 07-DPQC-0018 Salix nivalis SALIX116-08 07-EM-0475 Salix pseudomyrsinites SALIX024-08 07-JMS-1297 Salix hookeriana SALIX149-08 07-DPQC-0033 Salix nivalis SALIX069-08 07-JMS-0865 Salix hookeriana SALIX157-08 07-DPQC-0041 Salix nivalis SALIX078-08SALIX074-08 07-JMS-090007-JMS-0885 Salix hookeriana SALIX158-08 07-DPQC-0042 Salix nivalis SALIX378-08 07-WAGNER-PS1 Salix pseudomyrsinites SALIX098-08 07-JMS-0956 Salix hookeriana SALIX523-08 08-GWA-14438 Salix nivalis SALIX100-08 07-JMS-0958 Salix hookeriana SALIX271-08 07-BAB-268 Salix pedicellaris SALIX102-08 07-JMS-0960 Salix hookeriana SALIX273-08 07-BAB-270 Salix pedicellaris SALIX379-08 07-WAGNER-PS2 Salix pseudomyrsinites SALIX103-08 07-JMS-0961 Salix hookeriana SALIX363-08 07-GWA-14409 Salix petrophila SALIX189-08 07-DPQC-UBCFarm5 Salix hookeriana SALIX058-08 07-JMS-1352 Salix planifolia SALIX347-08 07-GWA-14379 Salix pyrifolia SALIX192-08 07-UBCBG-037096-1003-2004 Salix hookeriana SALIX220-08 07-BAB-013 Salix planifolia SALIX341-08 07-GWA-14370 Salix hookeriana SALIX366-08SALIX249-08 07-BAB-19407-GWA-14416 Salix Salix planifolia planifolia SALIX537-09 08-CAR-002 Salix reticulata SALIX399-08 08-DPsitchSB Salix hookeriana SALIX291-08SALIX290-08 07-CEG-1607-CEG-15 Salix irrorata SALIX422-08SALIX367-08 08-DPQC-007407-GWA-14417 Salix planifolia SALIX461-08 08-DPQC-0115 Salix planifolia SALIX539-09 08-CAR-004 Salix reticulata SALIX364-08 07-GWA-14411 Salix jepsonii SALIX285-08 07-BAB-298 Salix polaris SALIX365-08 07-GWA-14413 Salix jepsonii SALIX061-08 07-JMS-1360 Salix prolixa SALIX370-08 07-GWA-14426 Salix jepsonii SALIX148-08 07-DPQC-0032 Salix prolixa SALIX541-09 08-CAR-006 Salix reticulata SALIX292-08 07-CEG-18 Salix lasiolepis SALIX421-08 08-DPQC-0073 Salix prolixa SALIX353-08 07-GWA-14385 Salix lemmonii SALIX427-08 08-DPQC-0079 Salix prolixa SALIX544-09 08-CAR-009 Salix reticulata SALIX288-08SALIX354-08 07-CEG-1307-GWA-14386 Salix Salix ligulifolia lemmonii I SALIX289-08 07-CEG-14 Salix ligulifolia SALIX429-08 08-DPQC-0081 Salix prolixa SALIX500-08 08-CEG-03A Salix ligulifolia SALIX436-08 08-DPQC-0088 Salix prolixa SALIX545-09 08-CAR-010 Salix reticulata SALIX501-08 08-CEG-03B Salix ligulifolia SALIX450-08SALIX439-08 08-DPQC-010308-DPQC-0091 Salix prolixa SALIX396-08 08-DPSlind Salix lindleyana SALIX452-08 08-DPQC-0105 Salix prolixa SALIX350-08 07-GWA-14382 Salix lutea SALIX469-08 08-DPQC-0124 Salix prolixa SALIX546-09 08-CAR-011 Salix reticulata SALIX352-08 07-GWA-14384 Salix lutea SALIX475-08 08-DPQC-0130 Salix prolixa SALIX479-08 08-DPQC-0134 Salix maccalliana SALIX492-08SALIX491-08 08-DPQC-014908-DPQC-0148 Salix prolixa SALIX547-09 08-CAR-012 Salix reticulata SALIX483-08 08-DPQC-0139 Salix maccalliana SALIX117-08 07-EM-0579 Salix pseudomonticola SALIX488-08SALIX484-08 08-DPQC-014408-DPQC-0140 Salix maccalliana SALIX267-08 07-BAB-247 Salix pseudomonticola SALIX548-09 08-CAR-013 Salix reticulata SALIX489-08 08-DPQC-0145 Salix maccalliana SALIX314-08 07-GWA-14339 Salix pseudomonticola SALIX535-08 08-GWA-14452 Salix maccalliana SALIX316-08 07-GWA-14342 Salix pseudomonticola SALIX195-08 07-UBCBG-023877-0368-1984 Salix magnifica SALIX468-08 08-DPQC-0123 Salix pseudomonticola SALIX550-09 08-CAR-015 Salix reticulata SALIX300-08 07-CEG-29 Salix monticola SALIX474-08 08-DPQC-0129 Salix pseudomonticola SALIX512-08 08-CEG-14 Salix monticola SALIX482-08 08-DPQC-0137 Salix pseudomonticola SALIX403-08 07-DW-6003 Salix myricoides SALIX116-08 07-EM-0475 Salix pseudomyrsinites SALIX551-09 08-CAR-016 Salix reticulata SALIX223-08 07-BAB-016 Salix myrtillifolia SALIX245-08 07-BAB-167 Salix pseudomyrsinites SALIX277-08 07-BAB-276 Salix myrtillifolia SALIX278-08 07-BAB-286 Salix pseudomyrsinites SALIX552-09 08-CAR-017 Salix reticulata SALIX377-08 07-WAGNER-MYR1 Salix myrtillifolia SALIX378-08 07-WAGNER-PS1 Salix pseudomyrsinites SALIX196-08 07-UBCBG-26352-117-87 Salix nakamurana SALIX379-08 07-WAGNER-PS2 Salix pseudomyrsinites SALIX554-09 08-CAR-019 Salix reticulata SALIX236-08 07-BAB-051 Salix niphoclada SALIX225-08SALIX405-08 07-BAB-34407-BAB-018 Salix pseudomyrsinitespulchra SALIX138-08SALIX268-08 07-BAB-25007-DPQC-0018 Salix Salix niphoclada nivalis SALIX281-08 07-BAB-291 Salix pulchra SALIX149-08 07-DPQC-0033 Salix nivalis SALIX347-08 07-GWA-14379 Salix pyrifolia SALIX555-09 08-CAR-020 Salix reticulata SALIX157-08 07-DPQC-0041 Salix nivalis SALIX418-08 08-DPQC-0070 Salix pyrifolia SALIX158-08 07-DPQC-0042 Salix nivalis SALIX536-09 08-CAR-001 Salix reticulata SALIX523-08 08-GWA-14438 Salix nivalis SALIX537-09 08-CAR-002 Salix reticulata SALIX557-09 08-CAR-022 Salix reticulata SALIX036-08 07-JMS-1320 Salix pentandra SALIX538-09 08-CAR-003 Salix reticulata SALIX249-08SALIX058-08 07-BAB-19407-JMS-1352 Salix Salix planifolia planifolia SALIX539-09 08-CAR-004 Salix reticulata SALIX558-09 08-CAR-023 Salix reticulata SALIX366-08 07-GWA-14416 Salix planifolia SALIX540-09 08-CAR-005 Salix reticulata SALIX367-08 07-GWA-14417 Salix planifolia SALIX542-09SALIX541-09 08-CAR-00708-CAR-006 Salix reticulata SALIX560-09 08-CAR-025 Salix reticulata SALIX422-08 08-DPQC-0074 Salix planifolia SALIX045-08SALIX044-08 07-JMS-133907-JMS-1338 Salix reticulata SALIX461-08 08-DPQC-0115 Salix planifolia SALIX046-08 07-JMS-1340 Salix reticulata SALIX561-09 08-CAR-026 Salix reticulata SALIX285-08 07-BAB-298 Salix polaris SALIX233-08 07-BAB-039 Salix reticulata SALIX421-08SALIX148-08 08-DPQC-007307-DPQC-0032 Salix prolixa SALIX244-08 07-BAB-165 Salix reticulata SALIX427-08 08-DPQC-0079 Salix prolixa SALIX282-08 07-BAB-292 Salix reticulata SALIX562-09 08-CAR-027 Salix reticulata SALIX429-08 08-DPQC-0081 Salix prolixa SALIX543-09 08-CAR-008 Salix reticulata SALIX439-08 08-DPQC-0091 Salix prolixa SALIX544-09 08-CAR-009 Salix reticulata SALIX563-09 08-CAR-028 Salix reticulata SALIX450-08 08-DPQC-0103 Salix prolixa SALIX545-09 08-CAR-010 Salix reticulata SALIX452-08 08-DPQC-0105 Salix prolixa SALIX546-09 08-CAR-011 Salix reticulata SALIX469-08 08-DPQC-0124 Salix prolixa SALIX547-09 08-CAR-012 Salix reticulata SALIX564-09 08-CAR-029 Salix reticulata SALIX475-08 08-DPQC-0130 Salix prolixa SALIX548-09 08-CAR-013 Salix reticulata SALIX491-08 08-DPQC-0148 Salix prolixa SALIX550-09 08-CAR-015 Salix reticulata SALIX492-08 08-DPQC-0149 Salix prolixa SALIX551-09 08-CAR-016 Salix reticulata SALIX565-09 08-CAR-030 Salix reticulata SALIX117-08 07-EM-0579 Salix pseudomonticola SALIX552-09 08-CAR-017 Salix reticulata SALIX267-08 07-BAB-247 Salix pseudomonticola SALIX554-09SALIX553-09 08-CAR-01908-CAR-018 Salix reticulata SALIX567-09 08-CAR-032 Salix reticulata SALIX316-08SALIX314-08 07-GWA-1434207-GWA-14339 Salix pseudomonticola SALIX468-08 08-DPQC-0123 Salix pseudomonticola SALIX556-09SALIX555-09 08-CAR-02108-CAR-020 Salix reticulata SALIX568-09 08-CAR-033 Salix reticulata SALIX474-08 08-DPQC-0129 Salix pseudomonticola SALIX557-09 08-CAR-022 Salix reticulata SALIX482-08 08-DPQC-0137 Salix pseudomonticola SALIX558-09 08-CAR-023 Salix reticulata SALIX116-08 07-EM-0475 Salix pseudomyrsinites SALIX559-09 08-CAR-024 Salix reticulata SALIX003-08 07-JMS-1050 Salix scouleriana SALIX245-08 07-BAB-167 Salix pseudomyrsinites SALIX560-09 08-CAR-025 Salix reticulata SALIX278-08 07-BAB-286 Salix pseudomyrsinites SALIX561-09 08-CAR-026 Salix reticulata SALIX006-08 07-JMS-1081 Salix scouleriana SALIX378-08 07-WAGNER-PS1 Salix pseudomyrsinites SALIX562-09 08-CAR-027 Salix reticulata SALIX405-08SALIX379-08 07-BAB-34407-WAGNER-PS2 Salix pseudomyrsinites Salix pseudomyrsinites SALIX563-09 08-CAR-028 Salix reticulata SALIX225-08 07-BAB-018 Salix pulchra SALIX564-09 08-CAR-029 Salix reticulata SALIX014-08 07-JMS-1141 Salix scouleriana SALIX281-08 07-BAB-291 Salix pulchra SALIX566-09SALIX565-09 08-CAR-03108-CAR-030 Salix reticulata SALIX347-08 07-GWA-14379 Salix pyrifolia SALIX015-08 07-JMS-1142 Salix scouleriana SALIX418-08 08-DPQC-0070 Salix pyrifolia SALIX568-09SALIX567-09 08-CAR-03308-CAR-032 Salix reticulata SALIX536-09 08-CAR-001 Salix reticulata SALIX228-08 07-BAB-029 Salix richardsonii SALIX017-08 07-JMS-1211 Salix scouleriana SALIX538-09SALIX537-09 08-CAR-00308-CAR-002 Salix reticulata SALIX230-08 07-BAB-031 Salix richardsonii SALIX539-09 08-CAR-004 Salix reticulata SALIX231-08 07-BAB-032 Salix richardsonii SALIX540-09 08-CAR-005 Salix reticulata SALIX255-08 07-BAB-209 Salix richardsonii SALIX025-08 07-JMS-1298 Salix scouleriana SALIX541-09 08-CAR-006 Salix reticulata SALIX284-08 07-BAB-294 Salix richardsonii SALIX542-09 08-CAR-007 Salix reticulata SALIX237-08 07-BAB-072 Salix rotundifolia SALIX044-08 07-JMS-1338 Salix reticulata SALIX242-08 07-BAB-108 Salix rotundifolia SALIX026-08 07-JMS-1299 Salix scouleriana SALIX045-08 07-JMS-1339 Salix reticulata SALIX001-08 07-JMS-1037 Salix scouleriana SALIX046-08 07-JMS-1340 Salix reticulata SALIX003-08SALIX002-08 07-JMS-105007-JMS-1038 Salix scouleriana SALIX128-08 07-DPQC-0008 Salix scouleriana SALIX233-08 07-BAB-039 Salix reticulata SALIX006-08 07-JMS-1081 Salix scouleriana SALIX244-08 07-BAB-165 Salix reticulata SALIX014-08 07-JMS-1141 Salix scouleriana SALIX133-08 07-DPQC-0013 Salix scouleriana SALIX544-09SALIX543-09 08-CAR-00908-CAR-008 Salix reticulata SALIX015-08 07-JMS-1142 Salix scouleriana SALIX545-09 08-CAR-010 Salix reticulata SALIX017-08 07-JMS-1211 Salix scouleriana SALIX546-09 08-CAR-011 Salix reticulata SALIX025-08 07-JMS-1298 Salix scouleriana SALIX145-08 07-DPQC-0029 Salix scouleriana SALIX547-09 08-CAR-012 Salix reticulata SALIX033-08SALIX026-08 07-JMS-131607-JMS-1299 Salix scouleriana SALIX550-09 08-CAR-015 Salix reticulata SALIX034-08 07-JMS-1317 Salix scouleriana SALIX551-09 08-CAR-016 Salix reticulata SALIX052-08 07-JMS-1346 Salix scouleriana SALIX146-08 07-DPQC-0030 Salix scouleriana SALIX552-09 08-CAR-017 Salix reticulata SALIX062-08 07-JMS-1361 Salix scouleriana SALIX553-09 08-CAR-018 Salix reticulata SALIX070-08 07-JMS-0869 Salix scouleriana SALIX179-08 07-DPQC-MI3 Salix scouleriana SALIX555-09 08-CAR-020 Salix reticulata SALIX071-08 07-JMS-0871 Salix scouleriana SALIX556-09 08-CAR-021 Salix reticulata SALIX076-08 07-JMS-0897 Salix scouleriana SALIX180-08 07-DPQC-MI4 Salix scouleriana SALIX559-09 08-CAR-024 Salix reticulata SALIX085-08 07-JMS-0926 Salix scouleriana SALIX561-09SALIX560-09 08-CAR-02608-CAR-025 Salix reticulata SALIX086-08 07-JMS-0927 Salix scouleriana SALIX564-09 08-CAR-029 Salix reticulata SALIX107-08SALIX087-08 07-JMS-096707-JMS-0929 Salix scouleriana SALIX010-08 07-JMS-1123 Salix sitchensis SALIX565-09 08-CAR-030 Salix reticulata SALIX566-09 08-CAR-031 Salix reticulata SALIX130-08SALIX128-08 07-DPQC-001007-DPQC-0008 Salix scouleriana SALIX568-09 08-CAR-033 Salix reticulata SALIX133-08 07-DPQC-0013 Salix scouleriana SALIX012-08 07-JMS-1132 Salix sitchensis SALIX228-08 07-BAB-029 Salix richardsonii SALIX145-08 07-DPQC-0029 Salix scouleriana SALIX255-08 07-BAB-209 Salix richardsonii SALIX146-08 07-DPQC-0030 Salix scouleriana SALIX018-08 07-JMS-1212 Salix sitchensis SALIX284-08 07-BAB-294 Salix richardsonii SALIX147-08 07-DPQC-0031 Salix scouleriana SALIX242-08 07-BAB-108 Salix rotundifolia SALIX179-08 07-DPQC-MI3 Salix scouleriana SALIX001-08 07-JMS-1037 Salix scouleriana SALIX180-08 07-DPQC-MI4 Salix scouleriana SALIX023-08 07-JMS-1281 Salix sitchensis SALIX002-08 07-JMS-1038 Salix scouleriana SALIX222-08 07-BAB-015 Salix scouleriana SALIX003-08 07-JMS-1050 Salix scouleriana SALIX257-08 07-BAB-211 Salix scouleriana SALIX006-08 07-JMS-1081 Salix scouleriana SALIX280-08 07-BAB-288 Salix scouleriana SALIX124-08 07-DPQC-0001A Salix sitchensis SALIX014-08 07-JMS-1141 Salix scouleriana SALIX358-08 07-GWA-14392 Salix scouleriana SALIX017-08SALIX015-08 07-JMS-121107-JMS-1142 Salix scouleriana SALIX409-08 07-JMS-0898B Salix scouleriana SALIX126-08 07-DPQC-0002 Salix sitchensis SALIX025-08 07-JMS-1298 Salix scouleriana SALIX502-08 08-CEG-04 Salix scouleriana SALIX026-08 07-JMS-1299 Salix scouleriana SALIX503-08 08-CEG-05 Salix scouleriana SALIX136-08 07-DPQC-0016 Salix sitchensis SALIX033-08 07-JMS-1316 Salix scouleriana SALIX010-08SALIX009-08 07-JMS-112307-JMS-1119 Salix sitchensis SALIX034-08 07-JMS-1317 Salix scouleriana SALIX012-08 07-JMS-1132 Salix sitchensis SALIX052-08 07-JMS-1346 Salix scouleriana SALIX018-08 07-JMS-1212 Salix sitchensis SALIX166-08 07-DPQC-0054 Salix sitchensis SALIX062-08 07-JMS-1361 Salix scouleriana SALIX021-08 07-JMS-1259 Salix sitchensis SALIX085-08 07-JMS-0926 Salix scouleriana SALIX022-08 07-JMS-1260 Salix sitchensis SALIX086-08 07-JMS-0927 Salix scouleriana SALIX023-08 07-JMS-1281 Salix sitchensis SALIX172-08 07-DPQC-0060 Salix sitchensis SALIX128-08 07-DPQC-0008 Salix scouleriana SALIX029-08 07-JMS-1310 Salix sitchensis SALIX130-08 07-DPQC-0010 Salix scouleriana SALIX030-08 07-JMS-1313 Salix sitchensis SALIX182-08 07-DPQC-MINavChan Salix sitchensis SALIX133-08 07-DPQC-0013 Salix scouleriana SALIX032-08 07-JMS-1315 Salix sitchensis SALIX145-08 07-DPQC-0029 Salix scouleriana SALIX035-08 07-JMS-1319 Salix sitchensis SALIX186-08 07-DPQC-UBCFarm2 Salix sitchensis SALIX147-08SALIX146-08 07-DPQC-003107-DPQC-0030 Salix scouleriana SALIX051-08 07-JMS-1345 Salix sitchensis SALIX257-08 07-BAB-211 Salix scouleriana SALIX072-08SALIX068-08 07-JMS-087807-JMS-0864 Salix sitchensis SALIX280-08 07-BAB-288 Salix scouleriana SALIX209-08 07-DPQC-WhistRd5 Salix sitchensis SALIX358-08 07-GWA-14392 Salix scouleriana SALIX075-08 07-JMS-0891SALIX073-08 Salix 07-JMS-0884 sitchensis Salix sitchensis SALIX502-08 08-CEG-04 Salix scouleriana SALIX079-08 07-JMS-0901 Salix sitchensis SALIX503-08 08-CEG-05 Salix scouleriana SALIX083-08 07-JMS-0924 Salix sitchensis SALIX205-08 07-DPQC-WhistRd1 Salix sp. SALIX009-08 07-JMS-1119 Salix sitchensis SALIX084-08 07-JMS-0925 Salix sitchensis SALIX010-08 07-JMS-1123 Salix sitchensis SALIX089-08 07-JMS-0941 Salix sitchensis SALIX207-08 07-DPQC-WhistRd3 Salix sp. SALIX012-08 07-JMS-1132 Salix sitchensis SALIX092-08 07-JMS-0948 Salix sitchensis SALIX018-08 07-JMS-1212 Salix sitchensis SALIX093-08 07-JMS-0949 Salix sitchensis SALIX021-08 07-JMS-1259 Salix sitchensis SALIX094-08 07-JMS-0952 Salix sitchensis SALIX208-08 07-DPQC-WhistRd4 Salix sp. SALIX022-08 07-JMS-1260 Salix sitchensis SALIX095-08 07-JMS-0953 Salix sitchensis SALIX023-08 07-JMS-1281 Salix sitchensis SALIX097-08 07-JMS-0955 Salix sitchensis SALIX184-08 07-PMP-20885 Salix uvaursi SALIX030-08SALIX029-08 07-JMS-131307-JMS-1310 Salix sitchensis SALIX099-08 07-JMS-0957 Salix sitchensis SALIX032-08 07-JMS-1315 Salix sitchensis SALIX104-08SALIX101-08 07-JMS-096207-JMS-0959 Salix sitchensis SALIX035-08 07-JMS-1319 Salix sitchensis SALIX105-08 07-JMS-0965 Salix sitchensis SALIX204-08 07-DPQC-vimEurope Salix viminalis SALIX051-08 07-JMS-1345 Salix sitchensis SALIX110-08 07-JMS-0977 Salix sitchensis SALIX068-08 07-JMS-0864 Salix sitchensis SALIX123-08 06-DPQC-S2 Salix sitchensis SALIX391-08 73-UBC-146342 Salix glauca SALIX072-08 07-JMS-0878 Salix sitchensis SALIX124-08 07-DPQC-0001A Salix sitchensis SALIX073-08 07-JMS-0884 Salix sitchensis SALIX126-08 07-DPQC-0002 Salix sitchensis SALIX075-08 07-JMS-0891 Salix sitchensis SALIX132-08 07-DPQC-0012 Salix sitchensis SALIX549-09 08-CAR-014 Salix reticulata SALIX079-08 07-JMS-0901 Salix sitchensis SALIX136-08 07-DPQC-0016 Salix sitchensis SALIX083-08 07-JMS-0924 Salix sitchensis SALIX166-08 07-DPQC-0054 Salix sitchensis SALIX139-08 07-DPQC-0019 Salix barrattiana SALIX084-08 07-JMS-0925 Salix sitchensis SALIX172-08 07-DPQC-0060 Salix sitchensis SALIX089-08 07-JMS-0941 Salix sitchensis SALIX182-08 07-DPQC-MINavChan Salix sitchensis SALIX093-08SALIX092-08 07-JMS-094907-JMS-0948 Salix sitchensis SALIX186-08 07-DPQC-UBCFarm2 Salix sitchensis SALIX382-08 73-UBC-149084 Salix barrattiana SALIX094-08 07-JMS-0952 Salix sitchensis SALIX202-08 07-DPQC-VanIs1 Salix sitchensis SALIX095-08 07-JMS-0953 Salix sitchensis SALIX203-08 07-DPQC-VanIs2 Salix sitchensis SALIX340-08 07-GWA-14369 Salix candida SALIX097-08 07-JMS-0955 Salix sitchensis SALIX206-08 07-DPQC-WhistRd2 Salix sitchensis SALIX099-08 07-JMS-0957 Salix sitchensis SALIX209-08 07-DPQC-WhistRd5 Salix sitchensis SALIX101-08 07-JMS-0959 Salix sitchensis SALIX394-08SALIX210-08 07-DPQC-WhistRd608-DPYC-03 Salix sitchensis Salix sitchensis SALIX343-08 07-GWA-14372 Salix cordata SALIX104-08 07-JMS-0962 Salix sitchensis SALIX408-08 07-JMS-0895 Salix sitchensis SALIX105-08 07-JMS-0965 Salix sitchensis SALIX415-08 08-DPQC-0067 Salix sitchensis SALIX344-08 07-GWA-14375 Salix cordata SALIX110-08 07-JMS-0977 Salix sitchensis SALIX437-08 08-DPQC-0089 Salix sitchensis SALIX124-08 07-DPQC-0001A Salix sitchensis SALIX446-08 08-DPQC-0097 Salix sitchensis SALIX132-08 07-DPQC-0012 Salix sitchensis SALIX448-08 08-DPQC-0101 Salix sitchensis SALIX114-08 07-EM-0359 Salix discolor SALIX136-08 07-DPQC-0016 Salix sitchensis SALIX451-08 08-DPQC-0104 Salix sitchensis SALIX166-08 07-DPQC-0054 Salix sitchensis SALIX453-08 08-DPQC-0106 Salix sitchensis SALIX172-08 07-DPQC-0060 Salix sitchensis SALIX456-08 08-DPQC-0110 Salix sitchensis SALIX319-08 07-GWA-14345 Salix discolor SALIX182-08 07-DPQC-MINavChan Salix sitchensis SALIX473-08 08-DPQC-0128 Salix sitchensis SALIX202-08SALIX186-08 07-DPQC-UBCFarm207-DPQC-VanIs1 Salix Salixsitchensis sitchensis SALIX096-08 07-JMS-0954 Salix sp. SALIX329-08 07-GWA-14355 Salix discolor SALIX203-08 07-DPQC-VanIs2 Salix sitchensis SALIX205-08SALIX108-08 07-DPQC-WhistRd107-JMS-0968 Salix sp. Salix sp. SALIX206-08 07-DPQC-WhistRd2 Salix sitchensis SALIX207-08 07-DPQC-WhistRd3 Salix sp. SALIX339-08 07-GWA-14368 Salix discolor SALIX209-08 07-DPQC-WhistRd5 Salix sitchensis SALIX208-08 07-DPQC-WhistRd4 Salix sp. SALIX210-08 07-DPQC-WhistRd6 Salix sitchensis SALIX407-08 07-JMS-0887 Salix sp. SALIX408-08 07-JMS-0895 Salix sitchensis SALIX410-08 07-PMP-21007 Salix sp. SALIX345-08 07-GWA-14376 Salix eriocephala SALIX437-08 08-DPQC-0089 Salix sitchensis SALIX413-08 08-DPQC-0065 Salix sp. SALIX448-08 08-DPQC-0101 Salix sitchensis SALIX420-08 08-DPQC-0072 Salix sp. SALIX451-08 08-DPQC-0104 Salix sitchensis SALIX571-09 09-DPQC-17 Salix sp. SALIX346-08 07-GWA-14377 Salix eriocephala SALIX456-08 08-DPQC-0110 Salix sitchensis SALIX572-09 09-DPQC-25 Salix sp. SALIX205-08SALIX473-08 07-DPQC-WhistRd108-DPQC-0128 Salix Salixsitchensis sp. SALIX184-08 07-PMP-20885 Salix uvaursi SALIX330-08 07-GWA-14356 Salix humilis SALIX207-08 07-DPQC-WhistRd3 Salix sp. SALIX518-08 08-GWA-14435 Salix vestita SALIX208-08 07-DPQC-WhistRd4 Salix sp. SALIX204-08SALIX519-08 07-DPQC-vimEur08-GWA-14436 Salix ope vestita Salix viminalis SALIX335-08 07-GWA-14364 Salix humilis SALIX413-08 08-DPQC-0065 Salix sp. SALIX043-08 07-JMS-1337B Salix x glauca V SALIX420-08 08-DPQC-0072 Salix sp. SALIX571-09 09-DPQC-17 Salix sp. SALIX467-08 08-DPQC-0122 Salix bebbiana SALIX214-08 07-CAN-483950 Salix interior x petiolaris SALIX572-09 09-DPQC-25 Salix sp. SALIX391-08 73-UBC-146342 Salix glauca SALIX184-08 07-PMP-20885 Salix uvaursi SALIX416-08 08-DPQC-0068 Salix lasiandra SALIX518-08 08-GWA-14435 Salix vestita SALIX462-08 08-DPQC-0117 Salix prolixa SALIX213-08 07-CAN-483942 Salix petiolaris SALIX519-08 08-GWA-14436 Salix vestita SALIX036-08SALIX201-08 07-JMS-132007-DMP-UniGuelph Salix pentandra Salix alba SALIX204-08 07-DPQC-vimEur ope Salix viminalis SALIX397-08 08-DPsmallSB Salix sepulcralis SALIX020-08 07-JMS-1254 Salix x rubens SALIX398-08 08-DPweepSB Salix sepulcralis SALIX318-08 07-GWA-14344 Salix petiolaris SALIX183-08 07-PMP-20866 Salix exigua SALIX327-08 07-GWA-14353 Salix serissima SALIX112-08 07-JMS-0981 Salix interior SALIX328-08 07-GWA-14354 Salix serissima SALIX254-08 07-BAB-201 Salix interior SALIX016-08 07-JMS-1206 Salix x rubens SALIX322-08 07-GWA-14348 Salix petiolaris SALIX265-08 07-BAB-242 Salix interior SALIX020-08 07-JMS-1254 Salix x rubens SALIX317-08 07-GWA-14343 Salix interior SALIX027-08 07-JMS-1303 Salix x rubens SALIX325-08 07-GWA-14351 Salix petiolaris SALIX331-08 07-GWA-14360 Salix interior SALIX019-08 07-JMS-1213 Salix x sepulcralis SALIX337-08SALIX336-08 07-GWA-1436607-GWA-14365 Salix interior SALIX081-08 07-JMS-0912 Salix x sepulcralis III SALIX127-08 07-DPQC-0003 Salix exigua SALIX338-08 07-GWA-14367 Salix interior SALIX176-08 07-DPQC-weepJerBeac h Salix x sepulcralis SALIX254-08 07-BAB-201 Salix interior SALIX525-08 08-GWA-14440 Salix interior SALIX265-08 07-BAB-242 Salix interior SALIX183-08 07-PMP-20866 Salix exigua SALIX212-08 07-CAN-483931 Salix interior x eriocephala VI SALIX317-08 07-GWA-14343 Salix interior SALIX217-08 07-CAN-532065 Salix interior x eriocephala SALIX525-08 08-GWA-14440 Salix interior SALIX216-08 07-CAN-532063 Salix interior x petiolaris SALIX340-08 07-GWA-14369 Salix candida SALIX112-08 07-JMS-0981 Salix interior SALIX081-08SALIX398-08 07-JMS-091208-DPweepSB Salix Salix x sepulcralissepulcralis SALIX343-08 07-GWA-14372 Salix cordata SALIX176-08 07-DPQC-weepJerBeac h Salix x sepulcralis SALIX344-08 07-GWA-14375 Salix cordata SALIX201-08 07-DMP-UniGuelph Salix alba SALIX114-08 07-EM-0359 Salix discolor SALIX317-08 07-GWA-14343 Salix interior SALIX016-08 07-JMS-1206 Salix x rubens SALIX319-08 07-GWA-14345 Salix discolor SALIX327-08 07-GWA-14353 Salix serissima SALIX321-08 07-GWA-14347 Salix discolor SALIX331-08 07-GWA-14360 Salix interior SALIX328-08 07-GWA-14354 Salix serissima SALIX329-08 07-GWA-14355 Salix discolor SALIX397-08 08-DPsmallSB Salix sepulcralis SALIX339-08 07-GWA-14368 Salix discolor SALIX027-08 07-JMS-1303 Salix x rubens SALIX431-08 08-DPQC-0083 Salix discolor SALIX336-08 07-GWA-14365 Salix interior SALIX019-08 07-JMS-1213 Salix x sepulcralis SALIX346-08SALIX345-08 07-GWA-1437707-GWA-14376 Salix eriocephala SALIX320-08 07-GWA-14346 Salix amygdaloides SALIX127-08 07-DPQC-0003 Salix exigua SALIX337-08 07-GWA-14366 Salix interior SALIX332-08 07-GWA-14361 Salix amygdaloides III SALIX183-08 07-PMP-20866 Salix exigua SALIX506-08 08-CEG-08 Salix amygdaloides x goodingii SALIX349-08 07-GWA-14381 Salix exigua SALIX507-08 08-CEG-09 Salix amygdaloides x goodingii SALIX373-08 07-GWA-14429 Salix exigua SALIX338-08 07-GWA-14367 Salix interior VI SALIX340-08 07-GWA-14369 Salix candida SALIX343-08 07-GWA-14372 Salix cordata SALIX490-08 08-DPQC-0147 Salix exigua SALIX344-08 07-GWA-14375 Salix cordata SALIX499-08 08-CEG-02 Salix exigua SALIX212-08 07-CAN-483931 Salix interior x eriocephala SALIX114-08 07-EM-0359 Salix discolor SALIX504-08 08-CEG-06 Salix exigua SALIX319-08 07-GWA-14345 Salix discolor SALIX330-08 07-GWA-14356 Salix humilis SALIX321-08 07-GWA-14347 Salix discolor SALIX335-08 07-GWA-14364 Salix humilis SALIX217-08 07-CAN-532065 Salix interior x eriocephala SALIX329-08 07-GWA-14355 Salix discolor SALIX112-08 07-JMS-0981 Salix interior SALIX339-08 07-GWA-14368 Salix discolor SALIX336-08SALIX331-08 07-GWA-1436507-GWA-14360 Salix interior SALIX216-08 07-CAN-532063 Salix interior x petiolaris SALIX431-08 08-DPQC-0083 Salix discolor SALIX337-08 07-GWA-14366 Salix interior V+VI SALIX345-08 07-GWA-14376 Salix eriocephala SALIX338-08 07-GWA-14367 Salix interior SALIX346-08 07-GWA-14377 Salix eriocephala SALIX212-08 07-CAN-483931 Salix interior x eriocephala SALIX201-08 07-DMP-UniGuelph Salix alba SALIX127-08 07-DPQC-0003 Salix exigua SALIX217-08 07-CAN-532065 Salix interior x eriocephala SALIX349-08 07-GWA-14381 Salix exigua SALIX214-08 07-CAN-483950 Salix interior x petiolaris SALIX373-08 07-GWA-14429 Salix exigua SALIX216-08 07-CAN-532063 Salix interior x petiolaris SALIX327-08 07-GWA-14353 Salix serissima SALIX490-08 08-DPQC-0147 Salix exigua SALIX213-08 07-CAN-483942 Salix petiolaris SALIX499-08 08-CEG-02 Salix exigua SALIX318-08 07-GWA-14344 Salix petiolaris SALIX328-08 07-GWA-14354 Salix serissima III SALIX504-08 08-CEG-06 Salix exigua SALIX508-08 08-CEG-10 Salix gooddingii SALIX322-08 07-GWA-14348 Salix petiolaris SALIX509-08 08-CEG-11 Salix gooddingii SALIX325-08 07-GWA-14351 Salix petiolaris SALIX330-08 07-GWA-14356 Salix humilis SALIX433-08 08-DPQC-0085 Salix planifolia SALIX176-08 07-DPQC-weepJerBeach Salix x sepulcralis SALIX335-08 07-GWA-14364 Salix humilis SALIX218-08 07-CAN-532084 Salix interior SALIX214-08 07-CAN-483950 Salix interior x petiolaris SALIX215-08 07-CAN-532056 Salix interior x eriocephala SALIX332-08 07-GWA-14361 Salix amygdaloides SALIX294-08 07-CEG-23 Salix laevigata SALIX320-08 07-GWA-14346 Salix amygdaloides SALIX295-08 07-CEG-24 Salix laevigata SALIX506-08 08-CEG-08 Salix amygdaloides x goodingii SALIX324-08 07-GWA-14350 Salix lucida IV+V SALIX508-08SALIX507-08 08-CEG-1008-CEG-09 Salix gooddingiiamygdaloides x goodingii SALIX324-08 07-GWA-14350 Salix lucida SALIX326-08 07-GWA-14352 Salix lucida SALIX509-08 08-CEG-11 Salix gooddingii SALIX333-08 07-GWA-14362 Salix nigra SALIX295-08 07-CEG-24 Salix laevigata SALIX326-08 07-GWA-14352 Salix lucida SALIX318-08SALIX213-08 07-GWA-1434407-CAN-483942 SalixSalix petiolarispetiolaris SALIX294-08 07-CEG-23 Salix laevigata SALIX322-08 07-GWA-14348 Salix petiolaris SALIX324-08 07-GWA-14350 Salix lucida SALIX325-08 07-GWA-14351 Salix petiolaris SALIX326-08 07-GWA-14352 Salix lucida SALIX333-08 07-GWA-14362 Salix nigra SALIX433-08 08-DPQC-0085 Salix planifolia SALIX333-08 07-GWA-14362 Salix nigra SALIX410-08 07-PMP-21007 Salix sp. SALIX411-08 07-PMP-21162 Salix sp. SALIX320-08 07-GWA-14346 Salix amygdaloides SALIX411-08 07-PMP-21162 Salix sp. SALIX412-08 07-PMP-21311 Salix sp. IV IV SALIX412-08 07-PMP-21311 Salix sp. 0.01 changes 0.1 changes 0.05 changes

Appendix VI Comparative estimates of node ages in BEAST and r8s for the matK + rbcL data set, using additional taxa sampled from GenBank (Appendix III). The BEAST mean node ages [median and the 95% highest posterior density (HPD) interval] are given. The BEAST analysis and the last two r8s analyses given were run with the expanded outgroup taxon set (i.e. Salix plus all taxa in Appendix III), the ﬁrst three r8s analyses given were run with Salix plus two Populus taxa, Idesia and Poliothyrsis. The smoothing factor used in the penalized likelihood (PL) analyses is given in parentheses

r8s – LF r8s – PL r8s – PL r8s – PL BEAST – Bayesian (Powell) (smooth 320) (smooth 32) (smooth 20) r8s – NPRS

G6 1.2 [1; 0–3] 0.49 0.44 0.39 0.31 1.38 G3 5.6 [5.3; 1.6–10.4] 1.86 1.73 1.83 1.45 8.66 G4 + 5 + 6 6.6 [6.3; 2.9–10.8] 2.40 2.21 2.11 1.66 7.9 G1 9.6 [9.2; 5.2–14.6] 2.54 2.48 8.16 3.32 10.88 G1 + G2 12.9 [12.5; 7–19.8] 4.07 3.98 11.65 5.28 18.02 G3 + 4 + 5 + 6 11 [10.6; 5.5–17.1] 5.33 5.03 5.47 4.22 13.91 Salix 19.8 [19.5; 12.5–27.6] 14.75 14.36 17.88 12.23 22.76 Saliceae 34.5 [34.6; 26.3–42] fixed 34 fixed 34 fixed 34 32.02 36.16